Signal-mediated amplification of RNA technology and nucleic acid detection method using RNA aptamers

Abstract

The present invention relates to a method for detecting a target nucleic acid in a sample using an optimized SMART method that involves the use of at least one fluorescence-generating aptamer for the direct detection of RNA transcripts. Preferably, the method is used after an amplification step, for example, after a NASBA assay.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology. In particular, the present invention relates to the field of nucleic acid amplification and detection of target nucleic acids in a sample.

Background Art

[0002] RNA Technology Signal Mediated Amplification (SMART) is an isothermal nucleic acid amplification assay that relies on signal amplification and can be performed quickly and easily without the need for a thermal cycling step. This assay has the further advantage that it can be used for either DNA targets or RNA targets. Furthermore, the generated signal is highly target-dependent (i.e., a signal is generated only when a specific target is present), and it is possible to discriminate base changes within the target sequence.

[0003] The SMART assay consists of only two single-stranded oligonucleotide probes (extension and template), and each probe contains one region (referred to herein as the foot region) that can hybridize to the target and another region (referred to herein as the arm region) that can hybridize to the other probe. The two probes can anneal to each other only in the presence of a specific target and are designed to form a structure called a triple junction.

[0004] Following the formation of the triple junction, DNA polymerase extends the short (extension) arm of the probe, converting a single-stranded promoter sequence into a functional double-stranded RNA polymerase promoter. This assay relies on the fact that RNA polymerase can generate multiple copies of RNA, a molecule that is subsequently detected, only if the double-stranded RNA polymerase promoter is functional.

[0005] Several detection means for sensing and quantifying amplified RNA have been reported. Among these, the Enzyme-Linked Oligo Sorption Assay (ELOSA) is based on detection by measuring a color change in a standard plate reader where amplified RNA molecules bind and hybridize to additional probes including a detection means such as an alkaline phosphatase (AP)-conjugated probe. Other detection means rely on the use of molecular beacons, which are oligonucleotide molecules that can signal the presence of amplified RNA and have a hairpin-shaped structure with an internally quenched fluorophore, the fluorescence of which is restored when the molecular beacon binds to its target.

[0006] It is important to note that the SMART process differs from other amplification and detection methods in that it is based on amplification of the detection signal rather than amplification of the target nucleic acid. That is, the molecule detected is the amplified RNA that is only generated when the target nucleic acid binds to two probes that form a triple junction.

[0007] The SMART assay is currently under development and is used for the detection of specific nucleic acid sequences from clinical samples. However, it also has several drawbacks that leave room for improvement. One of these relates to the fact that when the RNA molecules are generated, the method requires the addition of probes that provide a means for detecting the above RNA molecules. In the case of ELOSA, the above probes are alkaline phosphatase (AP)-linked probes. When beacon molecules are used, they need to be added to the reaction so that they can hybridize to the RNA molecules for them to be detected. Since this usually occurs in the amplification method, the addition of further steps typically sacrifices specificity and efficiency. Furthermore, the SMART assay, which includes several steps, hinders the implementation of the above method in a point-of-care (POC) setting, which is critical when analyzing clinical samples in a time- and cost-effective and efficient manner.

[0008] The present invention aims to solve the above problems, provides a detection means without the need to add additional probes for detecting amplified RNA, simplifies the SMART method, and enhances its sensitivity, and describes an optimized SMART method called the Fluorescent-SMART method herein.

Summary of the Invention

[0009] The present invention is a method for detecting the presence of a target nucleic acid in a sample, comprising: a) adding a first nucleic acid probe and a second nucleic acid probe to a sample containing the target nucleic acid so as to form a triple junction structure by hybridization between the target nucleic acid molecule, the first nucleic acid probe, and the second nucleic acid probe, i) the first probe includes a foot region located in the 5' region of the probe that is complementary to and hybridizes with the first portion of the target nucleic acid, and an arm region located in the 3' region of the probe, ii) the second probe includes (1) a foot region located in the 3' region of the probe that is complementary to and hybridizes with the second portion of the target nucleic acid, (2) an arm region located in the 5' region of the probe, in the 5' to 3' direction, - the full-length reverse complementary sequence of at least one fluorescence-generating aptamer, - the full-length reverse complementary sequence of a DNA-dependent RNA polymerase promoter, wherein the reverse complementary sequence of at least one fluorescence-generating aptamer is operably linked to the DNA-dependent RNA polymerase promoter, - a region that is complementary to and hybridizes with the arm region of the first probe, preferably consisting of only 5 to 9 nucleotides, and optionally, the region is completely or partially included in the full-length reverse complementary sequence of the DNA-dependent RNA polymerase promoter, including an arm region, iii) The target nucleic acid includes a first portion located in the 3'-region of the target nucleic acid that is complementary to the foot region of the first probe, and a second portion located in the 5'-region of the target nucleic acid that is complementary to the foot region of the second probe, and the first portion and the second portion are adjacent or substantially adjacent. When the target nucleic acid is present in the sample, a triple junction structure is formed between the first probe, the second probe, and the target nucleic acid, and the step of b) adding a DNA-dependent DNA polymerase that extends the arm of the first probe to the end of the arm of the second probe to generate a double-stranded structure containing a functional RNA polymerase promoter and at least one fluorescence-generating aptamer, wherein one strand of the double-stranded structure is provided by the extended arm of the first probe and the other strand of the double-stranded structure is provided by the arm of the second probe, and the step of c) adding a DNA-dependent RNA polymerase that recognizes the double-stranded promoter formed in step b) to cause de novo synthesis of a single-stranded nucleic acid containing at least one fluorescence-generating aptamer, and the step of d) adding at least one fluorophore ligand of the at least one fluorescence-generating aptamer, thereby directly detecting the de novo synthesized nucleic acid containing at least one fluorescence-generating aptamer, and the step of detecting the nucleic acid containing at least one fluorescence-generating aptamer indicates the presence of the target nucleic acid in the sample, and the method includes the steps of Optionally, the method further includes an amplification step before step a) in which the target nucleic acid is amplified, and optionally, the first portion and the second portion are separated by 0 to 6 nucleotides. Regarding the method.

[0010] Preferably, the double-stranded RNA promoter formed in step b) is a T7 RNA polymerase promoter, and the DNA-dependent RNA polymerase added in step c) is T7 RNA polymerase. Preferably, the double-stranded RNA promoter formed in step b) is an SP6 RNA polymerase promoter, and the DNA-dependent RNA polymerase added in step c) is SP6 RNA polymerase.

[0011] Preferably, the double-stranded RNA promoter formed in step b) is a T3 RNA polymerase promoter, and the DNA-dependent RNA polymerase added in step c) is T3 RNA polymerase.

[0012] Preferably, the DNA-dependent DNA polymerase added in step b) is Bacillus stearothermophilus DNA polymerase I.

[0013] Preferably, the foot region of the first probe and / or the second probe is at least 15 nucleotides in length.

[0014] Preferably, at least one fluorescence-generating aptamer is a mango aptamer or a broccoli aptamer.

[0015] Preferably, when at least one fluorescence-generating aptamer contained in the arm of the second probe is a mango aptamer, the fluorophore ligand added in step d) is TO1 biotin fluorogen, or when at least one fluorescence-generating aptamer contained in the arm of the second probe is a broccoli aptamer, the fluorophore ligand added in step d) is DFHBI or DFHBI-1T fluorogen.

[0016] Preferably, the method further includes an amplification step before step a), which includes amplifying the target nucleic acid to generate a plurality of molecules identical to the target nucleic acid or its reverse complement, and the plurality of molecules are the target nucleic acid in subsequent steps a) to d). After the amplification step, the step of decomposing the remaining amplification primers and dephosphorylating the excess dNTPs after amplification may optionally follow.

[0017] Preferably, the method includes an amplification step, and the amplification step is carried out by nucleic acid sequence-based amplification (NASBA). Preferably, after the amplification step, a step of decomposing the remaining amplification primers and dephosphorylating the excess dNTPs after amplification follows. Preferably, the step of decomposing the remaining amplification primers and dephosphorylating the excess dNTPs after the amplification step is carried out by exonuclease digestion followed by a phosphatase reaction.

[0018] Preferably, the target nucleic acid is an RNA molecule preferably derived from an infectious agent, preferably a human infectious agent, such as a bacterial or viral genome. More preferably, the target nucleic acid is bacterial 16S or 23S rRNA. Even more preferably, the target nucleic acid is viral genomic RNA preferably selected from the SARS-CoV-2 virus or the influenza virus genome.

[0019] Preferably, the method is carried out as a one-pot reaction. Preferably, the method a) Amplifying the target nucleotide preferably using an amplification method, preferably the NASBA method, followed by, or overlapping with, or simultaneously with, preferably followed by, adding a first nucleic acid probe and a second nucleic acid probe to the sample to form the triple junction structure of the present invention by hybridization between the target nucleic acid molecule, the first nucleic acid probe and the second nucleic acid probe, wherein i) The first probe includes a foot region located in the 5' region of the probe that is complementary to and hybridizes to the first portion of the target nucleic acid, and an arm region located in the 3' region of the probe. ii) The second probe (1) A foot region located in the 3' region of the probe that is complementary to and hybridizes to the second portion of the target nucleic acid, and (2) An arm region located in the 5' region of the probe, preferably in the 5' to 3' direction, - The full-length reverse complementary sequence of at least one fluorescence-generating aptamer. -A full-length reverse complementary sequence of a DNA-dependent RNA polymerase promoter, wherein the reverse complementary sequence of at least one fluorescence-generating aptamer is operably linked to the DNA-dependent RNA polymerase promoter, the full-length reverse complementary sequence, -A region containing 5 to 9 nucleotides that is complementary to and hybridizes to the arm region of the first probe, and optionally, the region containing the 5 to 9 nucleotides is completely or partially contained in the full-length reverse complementary sequence of the DNA-dependent RNA polymerase promoter, the region containing the region, Including the arm region, iii) The target nucleic acid includes a first portion located in the 3' region of the target nucleic acid that is complementary to the foot region of the first probe and a second portion located in the 5' region of the target nucleic acid that is complementary to the foot region of the second probe, and the first portion and the second portion are adjacent or substantially adjacent, and when the target nucleic acid is present in the sample, a triple junction structure is formed between the first probe, the second probe, and the target nucleic acid, the step, b) Adding a DNA-dependent DNA polymerase that extends the arm of the first probe to the end of the arm of the second probe to generate a double-stranded structure containing a functional RNA polymerase promoter and at least one fluorescence-generating aptamer, wherein one strand of the double-stranded structure is provided by the extended arm of the first probe, and the other strand of the double-stranded structure is provided by the arm of the second probe, the step, c) Adding a DNA-dependent RNA polymerase that recognizes the double-stranded promoter formed in step b) to cause de novo synthesis of a single-stranded nucleic acid containing at least one fluorescence-generating aptamer, the step, d) Adding at least one fluorophore ligand of the at least one fluorescence-generating aptamer, thereby directly detecting and optionally quantifying the de novo synthesized nucleic acid containing the at least one fluorescence-generating aptamer, and optionally, the detection and quantification of the nucleic acid containing the at least one fluorescence-generating aptamer indicates the presence of the target nucleic acid in the sample, the step.

[0020] Preferably, the promoter used for the amplification carried out in step a) is different from the DNA-dependent RNA polymerase promoter contained in the arm region of the second probe. Preferably, one promoter is the T7 promoter and the other promoter is the SP6 promoter.

[0021] Another aspect of the present invention is a computer-implemented method for designing at least a pair of probes suitable for carrying out the method defined in the foregoing aspect, i) reading the target nucleic acid; ii) obtaining or generating the sequences of at least a pair of probes, each probe comprising a foot region and an arm region, the foot region of the first probe is located in the 5' region of the probe, is complementary to the first part of the target nucleic acid, hybridizes thereto, and the arm region of the first probe is located in the 3' region of the probe and is non-complementary to the target nucleic acid, the foot region of the second probe is located in the 3' region of the probe, is complementary to the second part of the target nucleic acid, hybridizes thereto, and the arm region of the second probe is located in the 5' region of the probe, in the 5' to 3' direction, - the full-length reverse complementary sequence of at least one fluorescence-generating aptamer, - the full-length reverse complementary sequence of a DNA-dependent RNA polymerase promoter, wherein the reverse complementary sequence of at least one fluorescence-generating aptamer is operably linked to the DNA-dependent RNA polymerase promoter, - a region consisting of only 5 to 9 nucleotides that is complementary to and hybridizes to the arm region of the first probe, optionally, the region consisting of only 5 to 9 nucleotides is completely or partially contained in the full-length reverse complementary sequence of the DNA-dependent RNA polymerase promoter, The first and second parts of the target nucleic acid are preferably separated by 0 to 6 nucleotides, a step in which a first probe and a second probe can form a triple junction structure by hybridization with a target nucleic acid molecule, iii) optionally, providing, as an output, the sequence obtained or generated in step ii). The present invention relates to a method comprising these steps.

[0022] Preferably, step ii) comprises a) obtaining the foot region of the first probe by selecting a first portion of the nucleotides contained in the target nucleic acid and providing its complementary sequence; b) obtaining the foot region of the second probe by selecting a second portion of the nucleotides contained in the target nucleic acid and providing its complementary sequence, wherein the first portion and the second portion are preferably separated by 0 to 6 nucleotides; c) obtaining the arm region of the second probe by selecting a nucleotide sequence comprising the full-length sequence of a DNA-dependent RNA polymerase promoter and the full-length reverse complementary sequence of at least one fluorescence-generating aptamer, wherein the reverse complementary sequence of the at least one fluorescence-generating aptamer is operably linked to the DNA-dependent RNA polymerase promoter; d) obtaining the arm region of the first probe by selecting 5 to 9 nucleotides complementary to a region located in the 3' region of the arm region of the second probe obtained in step c); e) optionally, synthesizing the designed first and second probes.

[0023] Another aspect of the present invention is a kit of parts for detecting the presence of a target nucleic acid in a sample, comprising the following elements: a) at least one DNA-dependent DNA polymerase, preferably Bst polymerase; b) at least one DNA-dependent RNA polymerase, preferably T7 RNA polymerase; c) a suitable fluorophore ligand for at least one fluorescence-generating aptamer; d) spermidine, and e) a nucleoside triphosphate containing deoxynucleoside triphosphate and / or ribonucleoside triphosphate, and f) a suitable buffer for carrying out a method for detecting the presence of the target nucleic acid defined above, and g) optionally, containing reverse transcriptase, RNAse, at least exonuclease and phosphatase, relates to a kit of parts, wherein elements a) to g) are contained in different containers or grouped in one or more containers.

[0024] Another aspect relates to a method for detecting the presence of a target nucleic acid in a sample defined in the previous aspect, using the kit of parts defined in the previous aspect.

[0025] Another aspect is a system for detecting the presence of a target nucleic acid in a sample comprising a first probe and a second probe, wherein the first probe comprises a foot region located in the 5' region of the probe that is complementary to and hybridizes to a first portion of the target nucleic acid, and an arm region located in the 3' region of the probe, and the second probe (1) a foot region located in the 3' region of the probe that is complementary to and hybridizes to a second portion of the target nucleic acid, and (2) in the 5' to 3' direction, i. the full-length reverse complementary sequence of at least one fluorogenic aptamer, ii. the full-length reverse complementary sequence of a DNA-dependent RNA polymerase promoter, wherein the reverse complementary sequence of at least one fluorogenic aptamer is operably linked to the RNA polymerase promoter, iii. a region comprising 5 to 9 nucleotides that is complementary to and hybridizes to the arm region of the first probe, wherein the region of 5 to 9 nucleotides may be a region contained in the full-length reverse complementary sequence of the DNA-dependent RNA polymerase promoter, and an arm region comprising the same. BRIEF DESCRIPTION OF THE DRAWINGS

[0026]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

Figure 15

Figure 16

Figure 17

Figure 18

Figure 19

Figure 20

Figure 21

Figure 22

Figure 23

Figure 24

Figure 25

Figure 26

Figure 27

[0027] General Definitions As used herein, it should be noted that the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. Further, unless otherwise indicated, the term "at least" preceding a series of elements is to be understood as referring to all elements in the series. One of ordinary skill in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the present invention.

[0028] The term "about" with respect to a given amount or quantity means a deviation of ±10 percent, preferably ±5 percent.

[0029] As used herein, the conjunctive term "and / or" between a plurality of recited elements is understood to encompass both alternative and combined alternatives. For example, when two elements are joined by "and / or", the first alternative refers to the applicability of the first element without the second element. The second alternative refers to the applicability of the second element without the first element. The third alternative refers to the applicability of the first and second elements together. Any one of these alternatives is within the scope of its meaning and is thus understood to meet the requirements of the term "and / or" as used herein. The simultaneous applicability of two or more alternatives is also included within the scope of its meaning and is thus understood to meet the requirements of the term "and / or".

[0030] Throughout this specification and the following claims, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", are to be understood to mean including the recited integer or step or group of integers or steps but not excluding any other integer or step or group of integers or steps. As used herein, the term "comprising" can be replaced by the term "containing" or "including", or sometimes, as used herein, can be replaced by the term "having". Any of the foregoing terms (comprising, containing, including, having) can, whenever used in the context of an aspect or embodiment of the present invention herein, be replaced by the term "consisting of", although this is less preferred.

[0031] As used herein, "consisting of" excludes elements, steps, or components not specified in the claims. As used herein, "consisting essentially of" does not exclude materials or steps that do not substantially affect the basic and novel characteristics of the claims.

[0032] In the context of the present invention, reference is made to "portions", "regions", "fragments", or "segments" of nucleotide sequences. As used herein, "portion", "region", "fragment", or "segment" means a specific nucleotide sequence optionally contained within a longer nucleotide sequence. Thus, "portion", "region", "fragment", or "segment" should be considered synonyms and can be used interchangeably to refer to a specific nucleotide sequence.

[0033] The terms "complementary" and "complementarity" are interchangeable and refer to the ability of polynucleotides to form base pairs with each other. Base pairs are typically formed by hydrogen bonds between nucleotide units in antiparallel polynucleotide strands or regions. Complementary polynucleotide strands or regions can base pair in a Watson-Crick-like manner (e.g., A with T, A with U, C with G). 100% (or completely) complementary refers to a situation where each nucleotide unit of one polynucleotide strand or region can hydrogen bond with each nucleotide unit of a second polynucleotide strand or region. Incomplete (or partial) complementarity refers to a situation where some, but not all, of the nucleotide units of the two strands or two regions can hydrogen bond with each other and can be expressed as a percentage. It should be noted that when used in the present invention, the term "complementary" also encompasses the term "substantially complementary". A region is "substantially complementary" to a target region if the percentage of complementarity between the two regions is at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or at least 100%. A region is "substantially complementary" to another region if it hybridizes under low stringency conditions, preferably under medium stringency conditions, and most preferably under high stringency conditions. Similarly, when the term "non-complementary" is used herein, it should be understood that the term also encompasses the term "substantially non-complementary". A region is "substantially non-complementary" to another region if the complementarity between the two regions is less than 40%, less than 30%, less than 20%, preferably less than 10%, most preferably less than 5%, or even most preferably 0% complementarity. A region is "substantially non-complementary" to another region if it does not hybridize under high stringency conditions, preferably under medium stringency conditions, and most preferably under low stringency conditions.

[0034] The "percentage of sequence identity" of polynucleotides and polypeptides is determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide or polypeptide sequence in the comparison window may include additions or deletions (i.e., gaps) as compared to the reference sequence (not including additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the same nucleic acid base or amino acid residue occurs in both sequences to obtain the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. The optimal alignment of sequences for comparison can be performed by computerized implementations of known algorithms (Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 575 Science Dr., Madison, Wis., BLAST in the resources of the National Center for Biotechnology Information, CLUSTAL, GAP, BESTFIT, FASTA and TFASTA in the resources of the European Bioinformatics Institute), or by inspection. The "percentage of identity" can be calculated based on a global alignment aimed at aligning two or more sequences over their entire spans. However, preferably, the "percentage of identity" is calculated based on a local alignment, i.e., based on the alignment of regions of local similarity between nucleic acid base sequences. Preferably, the "percentage of identity" is calculated using a local alignment comparison algorithm such as the BLAST tool.

[0035] The term "hybridization" is used to refer to a structure formed by two independent strands of RNA that form a double-stranded structure through base pairing from one strand to the other. These base pairs are thought to be G-C, A-U / T, and G-U. (A - adenine, C - cytosine, G - guanine, U - uracil, T - thymine). As in the case of complementarity, hybridization can be either total or partial. In the context of the present invention, each uracil base and thymine base can optionally be replaced by a thymine salt or uracil base, respectively.

[0036] Due to the complementary nature of base pairing between nucleic acid polymers, a double-stranded DNA molecule is composed of two strands having sequences that are reverse complements of each other. To assist molecular biologists in clearly identifying each strand individually, the two strands are usually distinguished as the "sense" strand and the "antisense" strand. An individual strand of DNA is called positive sense (also called positive (+) or simply sense) when its nucleotide sequence directly corresponds to the sequence of an RNA transcript that has been translated or is translatable into an amino acid sequence (provided that any thymine bases in the DNA sequence are replaced by uracil bases in the RNA sequence). The other strand of the double-stranded DNA molecule is called negative sense (also called negative (-) or antisense) and is reverse complementary to both the positive sense strand and the RNA transcript. In practice, although the antisense strand is the template used by RNA polymerase to construct the RNA transcript, the complementary base pairing where nucleic acid polymerization occurs means that the sequence of the RNA transcript appears identical to the sense strand, except that uracil is used instead of thymine in the RNA transcript. Thus, the "reverse complementary sequence" of a DNA / RNA element or region (i.e., a promoter) means, herein, the reverse, complementary, or reverse complementary corresponding sequence of the positive sense. For example, the positive sense sequence of the T7 promoter is "TAATACGACTCACTATA", and thus its reverse complementary sequence is "TATAGTGAGTCGTATTA".

[0037] As used herein, the term "functional RNA promoter" or "functional double-stranded RNA polymerase promoter" means a sequence that is recognized by an RNA polymerase and causes RNA synthesis in the presence of an appropriate polymerase and reagents. The term "functional RNA promoter" or "functional double-stranded RNA polymerase promoter" includes the term "substantially functional", which for the purposes herein can be defined as a nucleic acid complex having at least 20% (preferably at least 50%, more preferably at least 75%, most preferably at least 90%) of the promoter activity of a complete double-stranded wild-type promoter sequence, and the relative amount of promoter activity is measured by quantifying the amount of a given RNA transcript produced by the promoter over a given amount of time under equivalent conditions (e.g., temperature and ribonucleotide triphosphate concentration).

[0038] As used herein, the term "probe" means a DNA or RNA nucleotide sequence, preferably single-stranded, used to search for and detect a target nucleic acid. The probe is contacted with a sample under conditions that allow the probe sequence to hybridize to the target nucleic acid.

[0039] As used herein, the term "functional RNA aptamer transcript" refers to an aptamer RNA sequence that can fluoresce after the addition of its corresponding fluorophore ligand.

[0040] As used herein, the "three-way junction structure" or "3WJ structure" refers to a branched nucleic acid formed by hybridization of at least three nucleotides that are partially complementary to each other and form three double-helical arms linked at a junction, regardless of the presence or absence of some unpaired bases in one or more of the three different strands. The 3WJ structure is the simplest and most commonly occurring branched nucleic acid. For further definitions and examples of the 3WJ structure, see, for example, Wu, B., Girard, F., van Buuren, B., Schleucher, J., Tessari, M., & Wijmenga, S. (2004). Global structure of a DNA three-way junction by solution NMR: towards prediction of 3H fold. Nucleic acids research, 32(10), 3228-3239. https: / / doi.org / 10.1093 / nar / gkh645. The 3WJ structure can also be named 3H or HHH structure according to the IUPAC nomenclature (see Lilley DM, Clegg RM, Diekmann S, Seeman NC, von Kitzing E, Hagerman P. Nomenclature Committee of the International Union of Biochemistry and Molecular Biology (NC-IUBMB). A nomenclature of junctions and branchpoints in nucleic acids. Recommendations 1994. Eur J Biochem. 1995 May 15;230(1):1-2. doi:10.1111 / j.1432-1033.1995.tb20526.x. PMID:7601087).

[0041] The "3WJ structure of the present invention" means, in this specification, a 3WJ structure formed by hybridization of the first and second nucleic acid probes with a target nucleic acid or a nucleic acid of interest defined below in any of the first and second aspects of the present invention or their embodiments. The 3WJ structure of the present invention comprises or consists only of the first and second probes, each of the probes comprising a foot region and an arm region. The foot region of the first probe is located in the 5' region of the first probe, is complementary to the first part of the target nucleic acid, hybridizes thereto, and the arm region of the first probe is located in the 3' region of the first probe, is non-complementary to the target nucleic acid but is complementary to the arm of the second probe. The foot region of the second probe is located in the 3' region of the second probe, is complementary to the second part of the target nucleic acid, hybridizes thereto, and the arm region of the second probe is located in the 5' region of the second probe and is complementary to the arm region of the first probe, preferably in the 5' to 3' direction, - The full-length reverse complementary sequence of at least one fluorescence-generating aptamer, - The full-length reverse complementary sequence of a DNA-dependent RNA polymerase promoter, wherein the reverse complementary sequence of at least one fluorescence-generating aptamer is operably linked to the DNA-dependent RNA polymerase promoter, - A region consisting of only 5 to 9, preferably 6 to 8 nucleotides that is complementary to and hybridizes to the arm region of the first probe, optionally wherein the region consisting of only the 5 to 9 nucleotides is completely or partially included in the full-length reverse complementary sequence of the DNA-dependent RNA polymerase promoter, The first and second parts are adjacent or substantially adjacent, preferably the first and second parts are separated by 0 to 10, more preferably 0 to 6 nucleotides, such that when the first and second probes hybridize with their foot regions to the target nucleic acid and their arm regions to each other, the 3WJ structure of the present invention is formed. The representation of the 3WJ structure of the present invention having exemplary sequences and target nucleic acids is reproduced in FIG. 4.

Mode for Carrying Out the Invention

[0042] Description of Embodiments The SMART (Signal-Mediated Amplified RNA Technology) assay is an isothermal method that has advantages over PCR-based methods that offer simplification of technology and protocols, enabling the transfer of molecular diagnostics from centralized laboratories with dedicated equipment and experts to point-of-care use.

[0043] Typically, the SMART assay involves the use of first and second probes that can form a so-called three-way junction (3WJ) structure in the presence of a target nucleic acid, as shown in FIG. 4. Further, the SMART method includes a detection step, which usually means adding at least another probe (such as a molecular beacon) to detect the RNA transcript generated after the 3WJ structure is formed. However, the addition of further probes usually sacrifices specificity and efficiency as they need to be detected after they have hybridized efficiently to the target transcript. The inventors of the present invention have found a way to improve the detection step of the SMART assay by directly measuring the RNA transcripts generated in the method without the need to add more molecules that hybridize to them. This is achieved by including at least an RNA aptamer sequence in the arm of the second probe that generates a functional RNA aptamer transcript that is directly detected after the addition of their corresponding fluorophore ligand during transcription. Thus, the detection is direct detection rather than detection based on an intermediate molecule such as a molecular beacon.

[0044] The method disclosed herein is named the Apta-SMART method and, as shown in Example 5, FIGS. 9 and 10, can detect low concentrations of target nucleic acids more efficiently compared to the use of molecular beacon probes. Further, it is also shown herein that this method can be carried out after an isothermal amplification method such as the NASBA method. As shown in FIG. 16 and Example 11, mango-SMART detection after the NASBA assay is up to 10 2The bacterial genome at CFU / mL could be detected. Finally, another advantage of this method is that, as shown in Examples 17 to 20, it enables a one-pot implementation and further improves the efficiency of the method that can be carried out in a single tube.

[0045] In view of this, a first aspect of the present invention provides a structure hereinafter referred to as a "three-way junction structure" or "3WJ structure" formed by a hybridization reaction involving three nucleic acid molecules. The "3WJ structure" is defined herein as a branched nucleic acid structure comprising a target nucleic acid molecule and first and second nucleic acid probe molecules, wherein the first probe comprises a foot region that is complementary to and hybridizes to a first portion of the target, and an arm region that is non-complementary to the target nucleic acid, and the second probe comprises a foot region that is complementary to a second portion of the target such that the foot region of the second probe is adjacent or substantially adjacent to the foot region of the first probe, and the second probe also comprises an arm region that is non-complementary to the target nucleic acid but is complementary to and hybridizes to the arm region of the first probe. By forming the 3WJ structure, a functional double-stranded RNA polymerase promoter and at least one fluorescence-generating aptamer are generated in the presence of a DNA-dependent DNA polymerase, with one strand of the promoter provided by the elongated arm of the first probe and the other strand provided by the arm of the second probe. This structure is also referred to herein as the "3WJ structure of the present invention".

[0046] As used herein, the "foot region" refers to the regions present in the first and second probes that are complementary to the first and second portions of the target nucleic acid, respectively. The "arm region" refers to the regions present in the first and second probes that are non-complementary to the target nucleic acid. For clarity, it is noted that the first probe and the second probe may also be referred to as the "extension" probe and the "template" probe, respectively.

[0047] In a second aspect, the present invention is a method for detecting the presence of a target nucleic acid molecule in a sample, the method comprising the step of contacting a sample containing the target nucleic acid with first and second probes, each probe comprising a foot region complementary to respective first and second portions of the target, the portions being adjacent or substantially adjacent, the first and second probes each further comprising an arm region non-complementary to the target, the foot regions of the first and second probes each hybridizing to the target, at least a portion of the arm region of the first probe being complementary to at least a portion of the arm region of the second probe so as to enable hybridization of complementary portions of the arm regions of the first and second probes, whereby, after extension of the arm of the first probe by a DNA-dependent DNA polymerase, a 3WJ structure of the present invention comprising a functional double-stranded RNA polymerase promoter and at least one fluorescence-generating aptamer is generated, one strand of the promoter and at least one fluorescence-generating aptamer being provided by the first probe and the other strand being provided by the second probe, whereby RNA synthesis of at least one fluorescence-generating aptamer from the RNA promoter is induced, and detecting at least one fluorescence-generating aptamer synthesized in this way. From the following, the method of the second aspect is also named herein "the method of the present invention" or "the SMART method of the present invention".

[0048] Accordingly, the method of the second aspect is a method for detecting the presence of a target nucleic acid sequence in a sample, the method comprising contacting a sample with a first and a second probe as defined herein to form a 3WJ structure of the first aspect of the invention (the 3WJ structure of the invention), a hybridization step wherein the target nucleic acid is the target sequence or is formed as a result of the presence of the target sequence in the sample, an extension step comprising adding a DNA-dependent DNA polymerase under conditions suitable for the DNA-dependent DNA polymerase to be enzymatically active, a transcription step comprising a DNA-dependent RNA polymerase under conditions suitable for the DNA-dependent RNA polymerase to be enzymatically active, and a detection step comprising directly detecting an RNA transcript comprising at least one fluorogenic aptamer of the template portion of the first probe by adding a suitable fluorophore ligand.

[0049] In a preferred embodiment, the method of the second aspect of the invention comprises a) adding a first nucleic acid probe and a second nucleic acid probe to a sample containing a target nucleic acid so as to form a three-way junction (3WJ) structure of the invention by hybridization between the target nucleic acid molecule, the first nucleic acid probe and the second nucleic acid probe (hybridization step); b) adding a DNA-dependent DNA polymerase that extends the arm of the first probe to the end of the arm of the second probe to generate a double-stranded structure comprising a functional RNA polymerase promoter and at least one fluorogenic aptamer, wherein one strand of the double-stranded structure is provided by the extended arm of the first probe and the other strand of the double-stranded structure is provided by the arm of the second probe (extension step); c) adding a DNA-dependent RNA polymerase that recognizes the double-stranded promoter formed in step b) to initiate de novo synthesis of a single-stranded nucleic acid comprising at least one fluorogenic aptamer (transcription step); d) adding at least one fluorophore ligand of the at least one fluorescence-generating aptamer, thereby directly detecting a de novo synthesized single-stranded nucleic acid comprising the at least one fluorescence-generating aptamer, wherein the detection of the nucleic acid comprising the at least one fluorescence-generating aptamer indicates the presence of a target nucleic acid in the sample (detection step), Optionally, the method further comprises, prior to step a), an amplification step in which the target nucleic acid is amplified.

[0050] Accordingly, the method of the second aspect of the present invention results in the formation of the complex or 3WJ structure of the first aspect. Accordingly, all embodiments disclosed herein, particularly the embodiments of the first and second probes and the structures describing the 3WJ structure, apply to both the first and second aspects of the present invention.

[0051] It is essential that the first and second probes hybridize only in the presence of the target nucleic acid. Those skilled in the art will know how to select appropriate conditions, materials and sequences for the probes to ensure that the 3WJ structure occurs in a target-dependent manner. Nevertheless, the inventors describe some preferred embodiments of the 3WJ structure and method of the present invention below.

[0052] As described above, the first probe includes a foot region that is complementary (including substantially complementary) to a first portion of the target nucleic acid and an arm region that is non-complementary (including substantially non-complementary) to the target nucleic acid. In one embodiment, the foot region is located in the 5' region of the first probe, and the arm region is located in the 3' region of the first probe. As used herein, "in the 5' region" and "in the 3' region" mean that the foot region and the arm region of the first probe are located toward or in the vicinity of the 5' or 3' end of the first probe, respectively. In one embodiment, the foot region of the first probe is located 50, 40, 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, or less than 1 nucleotide from the 5' end of the first probe. More preferably, the foot region of the first probe is located exactly at the 5' end of the first probe. In one embodiment, the arm region of the first probe is located 50, 40, 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, or less than 1 nucleotide from the 3' end of the first probe. More preferably, the arm region of the first probe is located exactly at the 3' end of the first probe. In one embodiment, the first probe includes elements as shown in FIG. 4, and the nucleotide sequence of the first probe is adapted / modified to hybridize to the target nucleic acid and the second probe, respectively, in each case.

[0053] The second probe includes a foot region that is complementary (including substantially complementary) to a second portion of the target nucleic acid, and an arm region that is non-complementary (including substantially non-complementary) to the target nucleic acid but is complementary (including substantially complementary) to the arm region of the first probe. In one embodiment, the foot region is located in the 3' region of the second probe, and the arm region is located in the 5' region of the second probe. As used herein, "in the 5' region" and "in the 3' region" refer to the foot region and the arm region of the second probe being located towards or in the vicinity of the 5' or 3' end of the second probe, respectively. In one embodiment, the foot region of the second probe is located 50, 40, 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, or less than 1 nucleotide from the 3' end of the second probe. More preferably, the foot region of the second probe is located precisely at the 3' end of the second probe. In one embodiment, the arm region of the second probe is located 50, 40, 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, or less than 1 nucleotide from the 5' end of the second probe. More preferably, the arm region of the second probe is located precisely at the 5' end of the probe. In one embodiment, the foot region of the second probe hybridizes to the target in a region adjacent or substantially adjacent to the hybridization location of the foot region of the first probe, as described in detail below. In one embodiment, the second probe includes the elements shown in Figure 4, and the nucleotide sequence of the second probe is adapted / modified to hybridize to the target nucleic acid and the first probe, respectively, in each case.

[0054] The total number of nucleotides forming the arm regions of the first and second probes is not limited as long as the arm regions do not hybridize to each other in the absence of the target. In essence, the degree of complementarity between the arm regions of the first and second probes must be such that they do not hybridize to each other under the conditions used, unless stabilized by hybridization of the respective foot regions of the first and second probes to the target, ensuring that the 3WJ structure of the first aspect and the method of the invention is completed only in the presence of the target nucleic acid. Thus, the arm regions of the first and second probes hybridize to each other only when the foot regions of the first and second probes hybridize to the first and second portions of the target nucleic acid, respectively. Thus, the 3WJ structure of the present invention is formed between the first probe, the second probe, and the target nucleic acid only when the target nucleic acid is present in the sample. In one embodiment, the 3WJ structure is as shown in FIG. 4, and the specific nucleotide sequences of the first and second probes are adapted / modified to hybridize to the target nucleic acid to be detected, depending on the case.

[0055] Thus, the number of complementary bases between the arm regions of the first and second probes before the DNA-dependent DNA polymerase extends the arm of the first probe is typically 25 or less, typically less than 15, optimally 5-13 bases, preferably 5-10 bases, so that the arm regions do not hybridize to each other in the absence of the target (under the assay conditions used). In a preferred embodiment, the total length of the arm of the first probe before extension is less than 15, 14, 13, 12, 11, 10, 9, 8 or 7 nucleotides. Preferably, the length of the arm of the first probe before extension is at least 5 or 6 nucleotides, preferably 5-10 nucleotides, more preferably 5-9 nucleotides, most preferably 6-8 nucleotides (see FIGS. 4 and 5).

[0056] In one embodiment, the region of the arm of the second probe that is complementary to the arm region of the first probe before the extension step is at least 5 or 6 nucleotides, preferably 5 to 9 nucleotides, more preferably 6 to 8 nucleotides. Preferably, the region of the second probe that is complementary to the arm region of the first probe before the extension step is 5 to 10 nucleotides in length, preferably 6 to 8 nucleotides in length. In a preferred embodiment, the total length of the arm of the second probe is 150 to 50, 100 to 50, preferably 75 to 50, 100 to 60, 100 to 70 nucleotides.

[0057] In one embodiment, since the arm of the second probe contains the elements essential to the present invention (promoter and at least a fluorescence-generating aptamer), the arm region of the first probe is shorter than the arm of the second probe, and its length can be limited to the size of the above elements to at least a certain extent. In one embodiment, the first and second probes are DNA molecules.

[0058] In one embodiment, the arm of the second probe preferably has the following sequence in the 5' to 3' direction, that is, - The full-length reverse complementary sequence of at least one fluorescence-generating aptamer, - The full-length reverse complementary sequence of a DNA-dependent RNA polymerase promoter, wherein the reverse complementary sequence of at least one fluorescence-generating aptamer is operably linked to the DNA-dependent RNA polymerase promoter, and - A region that is complementary to the arm region of the first probe and that is optionally fully or partially included in the full-length reverse complementary sequence of the DNA-dependent RNA polymerase promoter is included.

[0059] Preferably, the arm of the second probe contains, in its 5' region, preferably at the 5' end, at least one, preferably one full-length reverse complementary sequence of a fluorescence-generating aptamer. As used herein, an "aptamer" means a short single-stranded DNA or RNA (ssDNA or ssRNA) molecule that can selectively bind to a specific target such as a protein, peptide, carbohydrate, small molecule, toxin, or even a living cell. DNA aptamers or RNA aptamers themselves are not fluorescent, but they can be designed to bind to a fluorophore (a low-fluorescent molecule) and enhance its fluorescence. In this case, the above DNA aptamer or RNA aptamer is called a fluorescence-generating aptamer or a fluorescent aptamer, and emits light when a fluorophore is added. Therefore, as used herein, a "fluorescence-generating or fluorescent aptamer" refers to an aptamer that can bind to a fluorophore and form a complex with it to enhance its fluorescence. In some embodiments, two or more fluorescence-generating aptamers are included. Preferably, the full-length reverse complementary sequences of one, two, three, four, five, or more than five fluorescence-generating aptamers are included in the arm of the second probe.

[0060] Fluorescent generating aptamers are generally known in the art and include, for example, spinach aptamer (DB entry 4kzd), corn aptamer (PDB entry 5bjp), mango I, mango II, mango III, mango IV aptamers (see Autour, A., et al. Fluorogenic RNA Mango aptamers for imaging small non-coding RNAs in mammalian cells. Nat Commun 9, 656 (2018)), red DIR2s aptamer (PDB entry 6db8), or broccoli aptamer (see Filonov, G.S., et al. Broccoli: rapid selection of an RNA mimic of green fluorescent protein by fluorescence-based selection and directed evolution. J. Am. Chem. Soc. 136, 16299-16308), etc. In a preferred embodiment, at least one fluorescent generating aptamer is at least one RNA fluorescent generating aptamer. Preferably, the RNA fluorescent generating aptamer is a mango aptamer or a broccoli aptamer.

[0061] In a preferred embodiment, the RNA fluorescence-generating aptamer is a mango aptamer, and its sequence comprises or consists only of a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 3. More preferably, the RNA fluorescence-generating aptamer is a mango aptamer, and its sequence comprises, consists only of, or consists essentially of SEQ ID NO: 3. In a preferred embodiment, the RNA fluorescence-generating aptamer is a mango aptamer, and its reverse complementary sequence comprises or consists only of a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 60. More preferably, the RNA fluorescence-generating aptamer is a mango aptamer, and its reverse complementary sequence comprises, consists only of, or consists essentially of SEQ ID NO: 60.

[0062] In a preferred embodiment, the RNA fluorescence-generating aptamer is a broccoli aptamer, and its sequence comprises or consists only of a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 57. More preferably, the RNA fluorescence-generating aptamer is a broccoli aptamer, and its sequence comprises, consists only of, or consists essentially of SEQ ID NO: 57. In a preferred embodiment, the RNA fluorescence-generating aptamer is a broccoli aptamer, and its reverse complementary sequence comprises or consists only of a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the full length of SEQ ID NO: 61. More preferably, the RNA fluorescence-generating aptamer is a broccoli aptamer, and its reverse complementary sequence comprises, consists only of, or consists essentially of SEQ ID NO: 61.

[0063] Preferably, the regions of the arms of the second probe that are complementary and thus hybridize to the arm regions of the first probe are completely or partially contained in the reverse complementary sequence of the DNA-dependent RNA polymerase promoter such that the two regions overlap. Thus, in one embodiment, the arm of the second probe preferably contains or consists only of the full-length reverse complementary sequence of at least one fluorogenic aptamer, in the 5' to 3' direction, followed by the full-length reverse complementary sequence of the DNA-dependent RNA polymerase promoter, operably linked thereto, and the nucleotides in the arm of the second probe that are complementary to the arm of the first probe are partially or completely contained in the full-length reverse complementary sequence of the DNA-dependent RNA polymerase promoter. That is, in one embodiment, the arm of the first probe is complementary or substantially complementary to the region of the reverse complementary sequence of the DNA-dependent RNA polymerase promoter contained in the arm of the second probe.

[0064] In one embodiment, the first and second probes are DNA, and the 3' end of the first probe is extended by a DNA-dependent DNA polymerase to generate a double-stranded structure containing a functional double-stranded RNA polymerase promoter and at least one fluorescence-generating aptamer (also referred to herein as the extension step). One strand of the double-stranded structure is provided by the extended arm of the first probe, and the other strand of the double-stranded structure is provided by the arm of the second probe. In this case, when the extension step is performed, the arm of the first probe is thus completely complementary (or substantially complementary) to the arm of the second probe. As described above, the extension by the DNA-dependent DNA polymerase occurs only when the 3WT structure is formed in the presence of the target nucleic acid. Therefore, the design of the first and second probes is such that in the absence of the target nucleic acid, a substantially functional double-stranded RNA promoter is not formed, so that de novo RNA is not substantially synthesized. In one embodiment, the situation where there is no target nucleic acid in the sample is such that the first and second probes cannot result in at least 20%, 15%, more preferably 10%, or even more preferably 5% of the activity of the fully double-stranded wild-type RNA promoter in the absence of the target nucleic acid.

[0065] Thus, one of the strands of the promoter is provided by the arm of the second probe in the form of a reverse complementary sequence, which becomes the "antisense" (-) strand. The other strand of the promoter, which becomes the "sense" (+) strand, is generated in the method of the present invention when DNA-dependent DNA polymerase extends the arm of the first probe to the end of the arm of the second probe, thereby generating a functional double-stranded RNA polymerase promoter. Thus, typically, the second probe is longer than the first probe and can act as a template for the extension of the first probe only in the presence of the target nucleic acid (and the formation of the 3WJ structure) and upon addition of DNA-dependent DNA polymerase. When a functional double-stranded RNA polymerase promoter is generated after the extension step, at least one fluorogenic aptamer sequence, which is in the form of a double-stranded sequence here, is transcribed upon addition of DNA-dependent RNA polymerase (also referred to herein as the transcription step). Thus, the extended first probe contains the template portion of at least one fluorogenic aptamer that is transcribed into multiple RNA copies upon formation of the functional double-stranded RNA polymerase promoter.

[0066] Thus, the extended first probe usually contains a nucleic acid to be transcribed, and the nucleic acid contains the sequence of at least one fluorogenic aptamer sequence. Thus, at least one fluorogenic aptamer sequence is generated after the enzymatic activity of DNA-dependent DNA polymerase. Thus, the DNA-dependent RNA polymerase promoter and the sequence of at least one fluorogenic aptamer contained in the arm of the second probe are not the plus strand but the reverse complement of the plus strand. As a result, when the extension of the arm of the first probe is completed, a functional double-stranded DNA-dependent RNA polymerase promoter and a double-stranded fluorogenic aptamer are formed. Here, one of the strands (the extended first probe arm) contains the positive sequence of at least one fluorogenic aptamer such that the transcript of at least one fluorogenic aptamer is in the correct 5'-3' orientation during transcription and, thus, emits light in the presence of the corresponding fluorophore ligand. Thus, preferably, the extended arm of the first probe is designed to be the sense strand.

[0067] Therefore, it is also essential that the sequence of at least one fluorescence-generating aptamer sequence be operably linked to and under the control of a DNA-dependent RNA polymerase promoter. The sequence and the promoter are said to be operably linked when they are linked in such a way that the promoter affects or places the transcription of the sequence under its control. In this case, the at least one fluorescence-generating aptamer sequence is operably linked to the promoter nucleotide sequence such that the transcription level of the at least one fluorescence-generating aptamer sequence is regulated by the promoter.

[0068] In one embodiment, the DNA-dependent RNA polymerase promoter is preferably a promoter recognized by a bacteriophage polymerase, preferably a promoter recognized by one of T3, T7 or SP6 polymerases. These promoters usually contain at least 15 or 16 bases. Preferably, the DNA-dependent RNA polymerase promoter is the T7 promoter. Then, an efficient RNA polymerase such as T7 polymerase can produce a large amount of RNA (including the sequence of at least one fluorescence-generating aptamer) from one of the strands of the double-stranded nucleic acid formed by the extended first probe and the second probe. Thus, in one embodiment, both probes are DNA, and the extension of the arm of the first probe results in the production of newly synthesized double-stranded DNA (dsDNA), which contains a DNA-dependent RNA polymerase promoter and a transcription start site for transcription by the RNA polymerase, and the dsDNA also contains the double-stranded sequence of at least one fluorescence-generating aptamer that is operably linked and regulated by the promoter.

[0069] In a preferred embodiment, the DNA-dependent RNA polymerase promoter is the T7 promoter, and its reverse complementary sequence comprises or consists of a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the entire length of SEQ ID NO: 62. More preferably, the DNA-dependent RNA polymerase promoter is the T7 promoter, and its reverse complementary sequence comprises, consists of, or consists essentially of SEQ ID NO: 62.

[0070] In another embodiment, the DNA-dependent RNA polymerase promoter is the SP6 promoter. Thus, in a preferred embodiment, the DNA-dependent RNA polymerase promoter is the SP6 promoter, and its reverse complementary sequence comprises or consists of a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99%, or 100% identical over the entire length of SEQ ID NO: 75. More preferably, the DNA-dependent RNA polymerase promoter is the SP6 promoter, and its reverse complementary sequence comprises, consists of, or consists essentially of SEQ ID NO: 75.

[0071] Regarding the foot region, there is no upper limit to the size of the foot regions of the first and second probes. Preferably, the foot region comprises at least 7 or at least 10 bases, preferably at least 15 or 20 bases, more preferably at least 25 or at least 30 bases. Preferably, the hood region comprises 8 - 20, 10 - 40, 15 - 35, preferably 15 - 30 or 15 - 25 bases. In practice, it is also preferred that the foot region comprises about 75 bases or less or less than 7 bases.

[0072] In one embodiment, the target nucleic acid includes a first portion and a second portion, and the first portion is located 3' to the second portion. In one embodiment, the first portion of the target nucleic acid is complementary (including substantially complementary) to the foot region of the first probe, and the second portion of the target nucleic acid is complementary (including substantially complementary) to the foot region of the second probe.

[0073] The essential feature of the present invention is that when the first and second probes hybridize to the first and second portions of the target nucleic acid sequence, respectively, they are adjacent to or substantially adjacent to each other. The use of the term "adjacent" is intended herein to mean that there are no nucleotides of the target sequence remaining unpaired (i.e., zero nucleotides are present) between the first and second portions of the target nucleic acid sequence that are base-paired with the complementary sequences of the probes. This proximity between the probes allows the complementary arm portions of the probes to anneal. As will be readily apparent to those skilled in the art, by designing the probes to be spaced further apart from the target sequence to allow them to anneal to each other, a gap between the first and second portions of the target sequence can be introduced between the nucleotides to which the foot portions of the probes hybridize. In this situation, the probes are said to be "substantially adjacent" because some nucleotides of the target sequence may remain unpaired between the portions of the target sequence that are forming base pairs with the probes. Preferably, the term "substantially adjacent" is intended herein to mean that there are at most 15 nucleotides of the target sequence remaining unpaired between the first and second portions of the target sequence that are base-paired with the complementary sequences of the probes, preferably at most 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotide. Clearly, the number of intervening unpaired nucleotides of the target sequence can vary according to the design of the probes. Thus, it is preferred that the first and second probes hybridize so as to be adjacent, i.e., leaving zero nucleotides between the first and second portions of the target sequence, but the foot portions of each probe may be separated by at most 10, 9, 8, 7, 6 nucleotides of the target sequence, and in the present invention, the term "substantially adjacent" is intended to refer to such a latter situation.

[0074] In one embodiment, the first probe preferably has, in the 5' to 3' direction, the following sequence, namely, - a foot region that is complementary (including substantially complementary) to the first portion of the target nucleic acid and hybridizes thereto, - An arm region that is non-complementary (including substantially non-complementary) to the target nucleic acid and is complementary (including substantially complementary) to a part of the arm of the second probe is included.

[0075] In the presence of the target nucleic acid, a 3WJ structure is formed. However, before the addition of DNA-dependent DNA polymerase (i.e., before the extension step), the arm region of the first probe preferably has no more than 9, 8, 7, 6, or 5 nucleotides that are complementary to the arm of the second probe. Preferably, as described above, before the arm of the first probe is extended, no more than 6 to 8 nucleotides of the arm of the first probe are complementary to the arm of the second probe.

[0076] However, in the presence of the target nucleic acid, the 3WJ structure of the present invention is formed. After the activation of DNA-dependent DNA polymerase (i.e., after the extension step), the arm region of the first probe is extended. Subsequently, the extended first probe preferably has, in the 5' to 3' direction, - A foot region that is complementary (including substantially complementary) to the first part of the target nucleic acid and hybridizes thereto - An arm region that is non-complementary (including substantially non-complementary) to the target nucleic acid and is complementary (including substantially complementary) to the arm of the second probe over its entire length. Preferably, in the 5' to 3' direction, it includes the sense strand of a functional double-stranded RNA promoter and the sense strand of at least one fluorescence-generating aptamer, and at least one fluorescence-generating aptamer sequence is operably linked to and under the control of the above RNA promoter is included.

[0077] In a preferred embodiment, the first probe comprises, or consists of only, a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical over the entire length of SEQ ID NO: 1, 7, 10, 11, 12, 14, 15, 16, 17, 18, 19, 20, 21, 22, 26, 35, 40, 45, 46, 83, or of SEQ ID NO: 1, 7, 10, 11, 12, 14, 15, 16, 17, 18, 19, 20, 21, 22, 26, 35, 40, 45, 46 or 83. More preferably, the first probe comprises, consists of only, or consists essentially of only SEQ ID NO: 1, 7, 10, 11, 12, 14, 15, 16, 17, 18, 19, 20, 21, 22, 26, 35, 40, 45, 46 or 83.

[0078] In one embodiment, the second probe preferably has, in the 5' to 3' direction, the following sequences, namely, - the full-length reverse complementary sequence of at least one fluorescence-generating aptamer, preferably a mango aptamer or a broccoli aptamer, - the full-length reverse complementary sequence of a DNA-dependent RNA polymerase promoter, preferably a T7 or SP6 promoter, in which the reverse complementary sequence of at least one fluorescence-generating aptamer is operably linked to the DNA-dependent RNA polymerase promoter, - a region that is complementary (including substantially complementary) to the arm region of the first probe and hybridizes thereto, optionally being completely or partially included in the full-length reverse complementary sequence of the DNA-dependent RNA polymerase promoter, and - a foot region that is complementary (including substantially complementary) to the second portion of the target nucleic acid and hybridizes thereto and includes.

[0079] In a preferred embodiment, the second probe comprises, or consists of only, a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical over the entire length of SEQ ID NO: 2, 8, 23, 24, 25, 27, 36, 41, 47, 48, 58, 59, 63 - 74, 76, 77, 78, 79, 81, 82, 84 or 85, or consists of only thereof. More preferably, the second probe comprises, consists of only, or consists essentially of only SEQ ID NO: 8, 23, 24, 25, 27, 36, 41, 47, 48, 58, 59, 63 - 74, 76, 77, 78, 79, 81, 82, 84 or 85.

[0080] In a preferred embodiment, the first probe comprises or consists of only SEQ ID NO: 1 (E. coli 23S rRNA), the second probe comprises or consists of SEQ ID NO: 2 or 63 (E. coli 23S rRNA), and the target sequence comprises, or consists of only, a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical over the entire length of SEQ ID NO: 38, or SEQ ID NO: 1, 2, 63 or 38, respectively.

[0081] In a preferred embodiment, the first probe comprises or consists of only SEQ ID NO: 7, 16, 17, 18, 19, 20, 21 or 12, the second probe comprises or consists of only SEQ ID NO: 8, 23, 24, 58, 64, 65, 66 or 73, and the target sequence comprises, or consists of only, a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical over the entire length of SEQ ID NO: 9 or 13 (E. coli 16S rRNA), or SEQ ID NO: 7, 16, 17, 18, 19, 20, 21, 12, 8, 23, 24, 58, 64, 65, 66, 73, 9 or 13, respectively.

[0082] In a preferred embodiment, the first probe comprises or consists only of SEQ ID NO: 26, the second probe comprises or consists only of SEQ ID NO: 27, 59, 68, 74, 78 or 79, and the target sequence comprises or consists only of SEQ ID NO: 28 or 29 (SARS-CoV-2), or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical over the entire length of SEQ ID NO: 26, 27, 59, 68, 74, 78, 79, 28 or 29, respectively.

[0083] In a preferred embodiment, the first probe comprises or consists only of SEQ ID NO: 35, the second probe comprises or consists only of SEQ ID NO: 36, 69, 76 or 77, and the target sequence comprises or consists only of SEQ ID NO: 37 or 39 (E. coli 23S rRNA), or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical over the entire length of SEQ ID NO: 35, 36, 69, 76, 77, 37 or 39, respectively.

[0084] In a preferred embodiment, the first probe comprises or consists only of SEQ ID NO: 83, the second probe comprises or consists only of SEQ ID NO: 84 or 85, and the target sequence comprises or consists only of SEQ ID NO: 37 (E. coli 23S rRNA), or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical over the entire length of SEQ ID NO: 83, 84, 85 or 37, respectively.

[0085] In a preferred embodiment, the first probe comprises or consists only of SEQ ID NO: 40, the second probe comprises or consists only of SEQ ID NO: 41, 70, 81 or 82, and the target sequence is SEQ ID NO: 42 or 44 (Staphylococcus aureus mecA), or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical over the entire length of SEQ ID NO: 40, 41, 70, 81, 82, 42 or 44, respectively, and comprises or consists only of such a sequence.

[0086] In a preferred embodiment, the first probe comprises or consists only of SEQ ID NO: 45, the second probe comprises or consists only of SEQ ID NO: 47 or 71, and the target sequence is SEQ ID NO: 49 (Influenza A), or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical over the entire length of SEQ ID NO: 45, 47, 71 or 49, respectively, and comprises or consists only of such a sequence.

[0087] In a preferred embodiment, the first probe comprises or consists only of SEQ ID NO: 46, the second probe comprises or consists only of SEQ ID NO: 48 or 72, and the target sequence is SEQ ID NO: 50 (Influenza B), or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical over the entire length of SEQ ID NO: 46, 48, 72 or 50, respectively, and comprises or consists only of such a sequence.

[0088] Either the first or the second probe may comprise DNA, peptide nucleic acid (PNA), locked nucleic acid (LNA), RNA, or any combination thereof. However, generally, the portion of the probe that constitutes the promoter would desirably contain conventional DNA in order to ensure recognition by the relevant polymerase. Accordingly, the terms "nucleic acid complex", "nucleic acid molecule" and "nucleic acid probe" should not be construed as being limited to complexes, molecules or probes (respectively) consisting only of conventional nucleic acids, but also include complexes, molecules or probes containing non-conventional nucleic acids (such as PNA or LNA) or non-nucleic acid moieties.

[0089] PNA is a synthetic nucleic acid analogue in which the sugar / phosphate backbone is replaced by a peptide bond chain (typically repeating N-(2-aminoethyl)-glycine units) to which bases are linked by methylene carbonyl bonds. PNA / DNA hybrids have a higher Tm value compared to double-stranded DNA molecules, which is because in DNA, the highly negatively charged phosphate backbone causes electrostatic repulsion between the respective strands, while the backbone of PNA is uncharged. Another characteristic of PNA is that, relatively speaking, a single-base mismatch is more unstable than a single-base mismatch in heteroduplex DNA. Thus, PNA is useful for inclusion in probes for use in the present invention because the resulting probes have higher specificity than probes consisting entirely of DNA only. The synthesis and use of PNA are known in the technical field of the present invention.

[0090] LNA is a synthetic nucleic acid analogue incorporating "internally bridged" nucleoside analogues. The synthesis and properties of LNA have been widely reported in the art.

[0091] Furthermore, a spacer molecule can be added between the foot region and the arm region of the first and / or second probe. As used herein, the "spacer molecule" refers to any one or more molecules (including nucleotide sequences, organic and inorganic compounds, etc.) that connect the foot region of the probe on one hand and the arm region of the probe on the other hand. Preferably, the spacer is a non-nucleoside-based spacer. Preferably, the spacer molecule is an organic compound containing 20 to 15 atoms, preferably 18 atoms. Preferably, the spacer molecule is an organic compound containing 18, 17, 16, 15, 14, 13, 12, 11, 10, or less than 10 carbon atoms. Preferably, the spacer molecule is an 18-atom hexaethylene glycol spacer (referred to herein as the iSp18 spacer, see Figure 4).

[0092] Furthermore, the first and / or second probe may be bound to another compound or element at their 3' or 5' ends. In one embodiment, the 3' end of the second probe is blocked, such that its RNA polymerase-mediated extension is not possible from that end. In one embodiment, the blocking compound or element is bound at the 3' end. Blocking of the 3' end is readily achieved by providing a phosphate group or a propyl group on the 3' terminal nucleotide instead of an -OH group. Other methods of blocking the 3' end are well known to those skilled in the art. In a preferred embodiment, the compound or element bound to the molecule, preferably bound to the second probe, is a 3'-amino group, preferably NH3 (see Figure 4). In one embodiment, the compound or element bound to the molecule, preferably bound to the second probe, is a 3' amino modification factor (also referred to herein as / 3AmMO / ).

[0093] The target nucleic acid is the sequence of the object to be detected or is formed as a result of the presence in a sample of the sequence of interest. Thus, depending on the application to which the present invention is applied, the "sequence of interest" or "target nucleic acid" may be very long (e.g., the entire gene) or quite short. Thus, the first and second probes defined above may hybridize to the target sequence so as to bind to just a short range of the sequence of interest or may bind such that a part of the target sequence extends strictly beyond the sequence of interest.

[0094] The above target can be DNA, RNA, and / or hybrid DNA / RNA. The target sequence can be formed as a result of the presence in a sample of the sequence of interest (e.g., by PCR or by any other amplification method). Preferably, the target nucleic acid is an infectious disease agent or is derived from an infectious disease agent. Preferably, the target nucleic acid is an RNA molecule derived from the genome of an infectious agent such as a bacterium or a virus. Preferably, the infectious agent is a microorganism that causes disease in humans. In one embodiment, the target nucleic acid is a bacterial genome, preferably bacterial 16S or 23S rRNA, or is derived therefrom.

[0095] In one embodiment, the target nucleic acid is a viral genome, preferably a viral RNA genome, or is derived therefrom. Preferably, the target nucleic acid is the genome of a plus-strand RNA virus, preferably a coronavirus or an influenza virus genome, or is derived therefrom. Preferably, the coronavirus is the SARS-CoV-2 virus. Preferably, the influenza virus is an influenza A or B virus.

[0096] With respect to the sample, in one embodiment, the sample is an isolated biological sample. Exemplary biological samples include tissue samples (e.g., tissue sections and tissue needle biopsies), cell samples (e.g., cytological smears (e.g., Pap or blood smears) or samples of cells obtained by microdissection), samples of whole organisms (e.g., samples of yeast or bacteria), or cell fractions, fragments or organelles (e.g., obtained by lysing cells and separating their components by centrifugation or other methods). Other examples of biological samples include blood, serum, urine, semen, feces, cerebrospinal fluid, interstitial fluid, mucus, tears, sweat, pus, biopsy tissue (e.g., obtained by surgical or needle biopsy), nipple aspirate, milk, vaginal fluid, saliva, swabs (such as buccal swabs), or any material containing biomolecules derived from the above biological samples. In some embodiments, the biological sample can be a body fluid, which can be a fluid isolated from an individual's body. For example, "body fluid" can include blood, plasma, serum, mucus, bile, saliva, nasopharyngeal swab, urine, tears, sweat, or effluent from body cavities.

[0097] The biological sample can be obtained from a subject in need of analysis. The "subject" can be a human (i.e., a male or female of any age group, e.g., a pediatric subject (e.g., an infant, child, or adolescent) or an adult subject (e.g., a young adult, middle-aged adult, or elderly person)). Alternatively, the subject can be a non-human animal. In certain embodiments, the non-human animal is a mammal (e.g., a primate, e.g., a cynomolgus monkey or rhesus monkey), a commercially important mammal (e.g., a cow, pig, horse, sheep, goat, cat or dog), or a bird (e.g., a commercially important bird, e.g., a chicken, duck, goose, or turkey). In other examples, the non-human animal is a fish, reptile, or amphibian. The non-human animal can be a transgenic or genetically engineered animal. In some examples, the subject can be a plant.

[0098] Step a) of the method of the second aspect involves adding the first and second probes to a sample containing the target nucleic acid so as to form a 3WJ structure. It will be apparent to those skilled in the art that the order of addition of the probes in step a) of the method is not important. For example, the first probe can be mixed with the second first probe before the sample (which may contain the target nucleic acid to be detected) is added. Alternatively, all the probes may be mixed simultaneously with the sample containing the target molecule.

[0099] Thus, this step is a hybridization step that results in the formation of the 3WJ of the first aspect when the target nucleic acid is present in the sample. Hybridization refers to the ability of complementary single-stranded DNA or RNA to form a complex. The hybridization step can be carried out under appropriate hybridization conditions that are within the knowledge of those skilled in the art. The hybridization conditions that result in a particular degree of stringency vary depending on the nature of the hybridization method and the composition and length of the nucleic acid sequences being hybridized. Generally, the temperature of hybridization and the ionic strength of the hybridization buffer determine the stringency of hybridization. Calculations regarding the hybridization conditions for achieving a particular degree of stringency are routine and are known in the art. The hybridization temperature can be determined based on various factors within the knowledge of those skilled in the art, such as the length of the complementary region between the probe and the target nucleic acid, the composition of the complementary region (e.g., G / C content), and the required stringency.

[0100] In one embodiment, the first and second probes are designed such that proper hybridization of both probes to the target nucleic acid occurs at substantially the same temperature. In such cases, this step may be performed in a single step. As used herein, "proper temperature" means a temperature at which the first and second probes form a 3WJ structure with the target nucleic acid with high specificity and form little or no complex with other nucleic acids, or even nucleic acids sharing sequence homology with the target nucleic acid of interest. Such a proper hybridization temperature can be determined based on various factors known to those skilled in the art, such as the melting temperature of the capture and detection probes, ionic strength, the length of the target nucleic acid, or the presence of homologous non-target nucleic acids in the same sample.

[0101] Step b) of the method of the second aspect, also referred to as the extension step, comprises adding or providing a DNA-dependent DNA polymerase that extends the arm of the first probe to the end of the arm of the second probe to generate a double-stranded structure comprising a functional RNA polymerase promoter and at least one fluorescence-generating aptamer, wherein one strand of the double-stranded structure is provided by the extended arm of the first probe and the other strand of the double-stranded structure is provided by the arm of the second probe.

[0102] DNA-dependent DNA polymerase catalyzes DNA synthesis by adding deoxyribonucleotide units to a DNA strand using DNA as a template. In this case, the template is the arm of the second probe, and the addition of deoxyribonucleotide units occurs at the arm of the first probe, causing the extension of the above arm, and thus increasing the number of complementary bases between the arms of the first and second probes. As described above, the extension of the arm of the first probe generates the plus strand of a functional double-stranded RNA promoter and at least one fluorescence-generating aptamer.

[0103] In one embodiment, the DNA-dependent DNA polymerase is preferably a type I prokaryotic polymerase enzyme. Preferably, the DNA-dependent DNA polymerase is Bacillus stearothermophilus DNA polymerase I (Bst).

[0104] The elongation step is within the knowledge of those skilled in the art and is carried out under appropriate enzyme conditions that depend on the selected DNA-dependent DNA polymerase.

[0105] Step c) of the method, also referred to as the transcription step, involves adding or providing an appropriate DNA-dependent RNA polymerase that recognizes the double-stranded promoter formed in step b) to cause de novo synthesis of a plurality of single-stranded nucleic acid copies containing at least one fluorogenic aptamer. In one embodiment, the DNA-dependent RNA polymerase can be T7, T3, or SP6 polymerase. Thereby, the addition of the appropriate DNA-dependent RNA polymerase generates an RNA copy of the sense strand, which in this case is an arm of the first probe, and the RNA copy is a functional fluorogenic aptamer.

[0106] The selection of the RNA polymerase depends on which reverse complementary sequence is placed in the arm of the second probe. Thus, if the arm of the second probe contains the reverse complementary sequence of the T7 promoter, the DNA-dependent RNA polymerase added in step c) of the method must be T7 polymerase. Alternatively, if the arm of the second probe contains the reverse complementary sequence of the SP6 promoter, the DNA-dependent RNA polymerase added in step c) of the method must be SP6 polymerase.

[0107] The transcription step is within the knowledge of those skilled in the art and can be carried out under appropriate enzyme conditions that depend on the selected RNA polymerase.

[0108] Step d) of the method, also referred to as the detection step, involves adding or providing at least one fluorophore ligand for at least one of the at least one fluorogenic aptamers, thereby directly detecting the de novo synthesized nucleic acid containing at least one fluorogenic aptamer, and the detection of the nucleic acid containing at least one fluorogenic aptamer indicates the presence of the target nucleic acid in the sample.

[0109] Therefore, step d) of the present method means the direct detection of the synthesized nucleic acid, obviating the need to further amplify the de novo synthesized nucleic acid or add any other oligonucleotides for sequence detection. One skilled in the art will understand that both the second probe and the target sequence need to at least partially hybridize to the first probe in order to form the 3WJ structure and the functional double-stranded RNA promoter. Thus, the RNA transcript of the template portion of the first probe containing at least one fluorogenic aptamer indicates the presence in the sample of the target sequence. Accordingly, the 3WJ structure of the present invention provides the basis for an assay involving the direct detection of the nucleic acid sequence of interest in a sample.

[0110] Similarly, the conditions for performing the detection step are within the knowledge of one skilled in the art.

[0111] Therefore, the method of the present invention provides a one-step method for detecting a target nucleic acid. In a preferred embodiment, the present invention generates a signal target-dependently (i.e., the generation of the 3WJ structure and thus the formation of the functional promoter), and causes amplification of this signal (the generation of multiple RNA transcripts containing at least one fluorogenic aptamer under the control of the promoter), in a system that requires only the use of two probes, two enzymes (DNA and RNA polymerases), and a fluorophore ligand, without the need for additional steps or reactive or enzymatic agents to effect detection.

[0112] The fluorophore ligand added in the detection step depends on one or more fluorescence-generating aptamers included in the arm of the second probe, as it needs to be suitable for the above aptamer. For example, when a mango aptamer is included, the fluorophore ligand must be a thiazole orange (TO1) derivative such as TO1 biotin fluorogen. When a broccoli aptamer is included in the sequence of the second probe, the ligand added in step d) is (5Z)-5-[(3,5-difluoro-4-hydroxyphenyl)methylene]-3,5-dihydro-2,3-dimethyl-4H-imidazol-4-one (DFHBI) or (5Z)-5-[(3,5-difluoro-4-hydroxyphenyl)methylene]-3,5-dihydro-2-methyl-3-(2,2,2-trifluoroethyl)-4H-imidazol-4-one (DFHBI-1T).

[0113] When an interaction occurs between an RNA transcript containing at least one fluorescence-generating aptamer and at least one fluorophore ligand, the fluorescence of the fluorophore increases significantly compared to the fluorescence of the fluorophore that does not form a complex with at least one fluorescence-generating aptamer. Thus, in any step e) of this method, also called the quantification step, the fluorescence emitted by at least one fluorophore-aptamer complex is measured and quantified by fluorescence reading. In one embodiment, step e) of the method includes measuring the level or concentration of the target nucleic acid present in the sample. Methods for measuring fluorescence are known in the art and may include the use of a fluorescence plate reader.

[0114] To measure the level (concentration) of a target nucleic acid in a sample, a calibration curve may be generated using a sample containing a target nucleic acid molecule of known concentration. The concentration of the target nucleic acid in the sample can be determined by comparison of the measured parameter with a calibration standard. In some cases, a calibration curve can be prepared, where the total measurement signal is measured for a plurality of samples containing a target nucleic acid of known concentration using a substantially similar assay format. For example, the total intensity of an array can be compared to the calibration curve to obtain a measure of the concentration of the target nucleic acid in the sample. The calibration curve can be generated by completing the method using a plurality of standardized samples of known concentration under the same conditions used to analyze a test sample of unknown concentration. The calibration curve can be used to correlate the detected signal of the target nucleic acid (i.e., the fluorophore-aptamer complex formed when the target nucleic acid is present) with the known concentration of the target nucleic acid. An assay can then be completed on a sample containing a target nucleic acid or fragment of unknown concentration, and the detected signal can be compared to the calibration curve (or a mathematical equation that fits it) to obtain a measure of the concentration of the target nucleic acid in the sample.

[0115] Considering the high sensitivity of the method of the present invention, it is not necessary to pre-amplify the target nucleic acid. However, in a preferred embodiment, the target nucleic acid is amplified prior to step a) of the method of the present invention. Thus, in one embodiment, the method of the present invention further comprises an amplification step prior to, simultaneously with, or overlapping with step a), which comprises amplifying the target nucleic acid to generate a plurality of molecules identical to the target nucleic acid or its reverse complement, and the plurality of molecules are the target nucleic acids detected in steps a) to d), preferably a) to e) of the method, as defined above. Methods for amplifying a target nucleic acid to generate a plurality of molecules identical to the target nucleic acid are known in the art. Preferably, the amplification method used is an isothermal amplification method, more preferably an isothermal amplification method selected from the group consisting of loop-mediated isothermal amplification (LAMP), helicase-dependent amplification (HDA), rolling circle amplification (RCA), multiple displacement amplification (MDA), recombinase polymerase amplification (RPA), and nucleic acid sequence-based amplification (NASBA). Preferably, the method of the present invention comprises an amplification step prior to step a), and the amplification step is carried out by nucleic acid sequence-based amplification (NASBA).

[0116] In one embodiment, after the amplification step, optionally, a step of degrading the amplification primers remaining after amplification and dephosphorylating excess dNTPs follows. In one embodiment, the step of degrading the remaining amplification primers and dephosphorylating excess dNTPs is carried out by exonuclease digestion followed by a phosphatase reaction.

[0117] Thus, in a preferred embodiment, the method of the present invention is a) amplifying the target nucleotide, preferably using an isothermal amplification method, preferably the NASBA method, and subsequently, overlapping with, or simultaneously with, preferably subsequently, adding a first nucleic acid probe and a second nucleic acid probe to the sample to form the triple junction structure of the present invention by hybridization between the target nucleic acid molecule, the first nucleic acid probe, and the second nucleic acid probe, (iv) The first probe includes a foot region located in the 5' region of the probe that is complementary to and hybridizes with the first portion of the target nucleic acid, and an arm region located in the 3' region of the probe. (v) The second probe (1) includes a foot region located in the 3' region of the probe that is complementary to and hybridizes with the second portion of the target nucleic acid, and (2) an arm region located in the 5' region of the probe, preferably in the 5' to 3' direction, - the full-length reverse complementary sequence of at least one fluorescence-generating aptamer, - the full-length reverse complementary sequence of a DNA-dependent RNA polymerase promoter, wherein the reverse complementary sequence of at least one fluorescence-generating aptamer is operably linked to the DNA-dependent RNA polymerase promoter, - a region containing 5 to 9, preferably 6 to 8 nucleotides that is complementary to and hybridizes with the arm region of the first probe, and optionally, the region containing 5 to 9, preferably 6 to 9 nucleotides is completely or partially included in the full-length reverse complementary sequence of the DNA-dependent RNA polymerase promoter. (The second probe) includes an arm region. (vi) The target nucleic acid includes a first portion located in the 3' region of the target nucleic acid that is complementary to the foot region of the first probe, and a second portion located in the 5' region of the target nucleic acid that is complementary to the foot region of the second probe. The first portion and the second portion are adjacent or substantially adjacent. When the target nucleic acid is present in the sample, a triple junction structure is formed between the first probe, the second probe, and the target nucleic acid. Preferably, the first portion and the second portion are separated by 0 to 10, more preferably 0 to 6 nucleotides. b) Adding a DNA-dependent DNA polymerase that extends the arm of the first probe to the end of the arm of the second probe to generate a double-stranded structure containing a functional RNA polymerase promoter and at least one fluorescence-generating aptamer, wherein one strand of the double-stranded structure is provided by the extended arm of the first probe and the other strand of the double-stranded structure is provided by the arm of the second probe; c) Adding a DNA-dependent RNA polymerase that recognizes the double-stranded promoter formed in step b) to initiate de novo synthesis of a single-stranded nucleic acid containing at least one fluorescence-generating aptamer; d) Adding at least one fluorophore ligand of the at least one fluorescence-generating aptamer to directly detect and optionally quantify the de novo synthesized nucleic acid containing the at least one fluorescence-generating aptamer, wherein detection and optionally quantification of the nucleic acid containing the at least one fluorescence-generating aptamer indicates the presence of a target nucleic acid in the sample. The method includes this step.

[0118] Optionally, additional steps may be included during, before, or after the above-described steps. Such additional steps may be, for example, one or more washing steps. Further, preferably, some of the reagents and buffers used in the amplification step, such as deoxynucleotide triphosphates or ribonucleoside triphosphates, are also used in the hybridization step of the method, thereby simplifying the method without sacrificing efficiency while saving reagents and time.

[0119] It will be apparent to those skilled in the art that the steps of the method of any of the second aspect or its embodiments may be performed in order, i.e., steps a) to d), optionally in the order of a) to e), or all steps may be performed simultaneously by adding the reagents defined in each of these steps to the sample containing the target molecule at the same time. Thus, in one embodiment, the method is performed in the above order following steps a) to d), optionally step e). In another embodiment, the method is performed by simultaneously executing all steps a) to d), optionally step e).

[0120] Preferably, as shown in Examples 17 to 20, the method is carried out as a one-pot reaction. As used herein, the "one-pot reaction" refers to a method in which all steps of the method are carried out in a single container, vessel, tube or reactor. Preferably, the method is carried out as a one-pot reaction that performs an amplification step, preferably NASBA amplification, before or simultaneously with the SMART method of the present invention. Preferably, the method is carried out as a one-pot reaction, and the method is a) amplifying the target nucleotide, preferably using an isothermal amplification method, preferably the NASBA method, and subsequently, overlapping with or simultaneously with it, preferably subsequently, adding a first nucleic acid probe and a second nucleic acid probe to the sample to form the three-way junction structure of the present invention by hybridization between the target nucleic acid molecule, the first nucleic acid probe and the second nucleic acid probe, wherein i) the first probe comprises a foot region located in the 5' region of the probe that is complementary to and hybridizes to the first portion of the target nucleic acid, and an arm region located in the 3' region of the probe, ii) the second probe is (1) a foot region located in the 3' region of the probe that is complementary to and hybridizes to the second portion of the target nucleic acid, and (2) an arm region located in the 5' region of the probe, preferably in the 5' to 3' direction, - the full-length reverse complementary sequence of at least one fluorescence-generating aptamer, - the full-length reverse complementary sequence of a DNA-dependent RNA polymerase promoter, wherein the reverse complementary sequence of at least one fluorescence-generating aptamer is operably linked to the DNA-dependent RNA polymerase promoter, the full-length reverse complementary sequence, - a region comprising 5 to 9, preferably 6 to 8 nucleotides that is complementary to and hybridizes to the arm region of the first probe, and optionally, the region comprising 5 to 9, preferably 6 to 9 nucleotides is completely or partially included in the full-length reverse complementary sequence of the DNA-dependent RNA polymerase promoter, the region comprising, including an arm region, iii) the target nucleic acid includes a first portion located in the 3' region of the target nucleic acid that is complementary to the foot region of the first probe and a second portion located in the 5' region of the target nucleic acid that is complementary to the foot region of the second probe, the first portion and the second portion being adjacent or substantially adjacent, and when the target nucleic acid is present in the sample, a triple junction structure is formed between the first probe, the second probe, and the target nucleic acid; e) adding a DNA-dependent DNA polymerase to extend the arm of the first probe to the end of the arm of the second probe, resulting in a double-stranded structure comprising a functional RNA polymerase promoter and at least one fluorescence-generating aptamer, wherein one strand of the double-stranded structure is provided by the extended arm of the first probe and the other strand of the double-stranded structure is provided by the arm of the second probe; f) adding a DNA-dependent RNA polymerase that recognizes the double-stranded promoter formed in step b) to initiate de novo synthesis of a single-stranded nucleic acid comprising at least one fluorescence-generating aptamer; g) adding at least one fluorophore ligand for the at least one fluorescence-generating aptamer, thereby directly detecting and optionally quantifying the de novo synthesized nucleic acid comprising at least one fluorescence-generating aptamer, wherein detection and optionally quantification of the nucleic acid comprising at least one fluorescence-generating aptamer indicates the presence of the target nucleic acid in the sample. Preferably, the promoter used for amplification carried out in step a) is different from the DNA-dependent RNA polymerase promoter contained in the arm region of the second probe. Preferably, one promoter is the T7 promoter and the other promoter is the SP6 promoter. Preferably, the first and second portions of the target nucleic acid are separated by 0 to 10 nucleotides, more preferably 0 to 6 nucleotides. Preferably, the reagents (probes, DNA-dependent DNA polymerase, DNA-dependent RNA polymerase, and fluorophore ligand) for carrying out the method of the present invention are added to the reaction vessel only after amplification, preferably NASBA amplification, has been carried out for an appropriate time, preferably 10 to 50 minutes, preferably 20 to 40 minutes, and most preferably 30 minutes. Thus, in a preferred embodiment, the method is carried out as a one-pot reaction, - A first step comprising amplifying a target nucleotide, preferably by using an isothermal amplification method, preferably the NASBA method, wherein the amplification is carried out by adding appropriate primers, buffer, and enzymes (e.g., reverse transcriptase, RNAseH, and polymerase) for said amplification to a reaction vessel, - A second step comprising adding a first and a second nucleic acid probe, a DNA-dependent DNA polymerase, and a DNA-dependent RNA polymerase to the reaction vessel to perform a SMART reaction, - A third step comprising adding at least a fluorophore ligand to the reaction vessel to detect at least one fluorescently generated aptamer produced during the second step, Preferably, the second step is initiated after the first step has been carried out for at least 10 to 50 minutes, preferably 20 to 40 minutes, and most preferably 30 minutes.

[0121] In one embodiment, since the method of the present invention is an isothermal method, all reactions described herein can potentially be achieved at a single temperature, preferably from about 30°C to 45°C, more preferably from 35°C to 43°C, and most preferably from 37°C to 41°C. In a preferred embodiment where an amplification step is included prior to the method of the present invention, the amplification step is carried out at a single temperature, preferably from about 35°C to 40°C, more preferably at 37°C, and the subsequent method of the present invention is carried out at a different temperature, preferably from 40°C to 43°C, more preferably at 41°C. Those skilled in the art will know which enzymes are suitable for the method of the present invention implemented isothermally and which temperature should be selected accordingly to obtain the optimal efficiency of the method.

[0122] The application of the method of the present invention includes detecting the presence of and / or measuring the level of a target nucleic acid of interest in a suitable sample. In some embodiments, the sample can be a biological sample obtained from a subject, and the results obtained from the assay methods described herein can be used for diagnostic and / or prognostic purposes. In other embodiments, the assay methods described herein can be used in a research environment to detect the presence of or measure the level of a target nucleic acid in a sample. The method can be applied to detect the presence of or measure the level of a nucleic acid biomarker associated with a target disease in a diagnostic / prognostic setting. For example, the method can be used to detect / measure the presence of an infectious agent that may be associated with a particular disease, such as COVID or influenza. The method can be used to detect such a nucleic acid biomarker in a subject without symptoms of the disease for early diagnosis. This assay method can also be used to detect the nucleic acid of a microorganism to determine whether a subject is infected with such a microorganism, such as a virus (e.g., HBV, HCV, HPV, HIV, influenza, coronavirus).

[0123] Using the methods described herein, nucleic acids in a sample can be directly detected in a very sensitive and efficient manner. Further, using the methods described herein, it is also possible to detect several targets present in a sample or to measure the levels of two or more targets in a sample (multiplex assay). In this case, two or more target nucleic acids can then be detected using different second probes containing different fluorescence-generating aptamers, such that different signals are associated with each target nucleic acid (i.e., each, i.e., fluorophore-aptamer complex). For example, in a sample suspected of containing three different target nucleic acids, the detection step may include (i) measuring a first signal emitted from a first fluorophore-aptamer complex and examining the presence or level of the first target nucleic acid in the sample based on the intensity of the first signal, (ii) measuring a second signal emitted from a second fluorophore-aptamer complex and examining the presence or level of the second target nucleic acid in the sample based on the intensity of the second signal, and (iii) measuring a third signal emitted from a third fluorophore-aptamer complex and examining the presence or level of the third target nucleic acid in the sample based on the intensity of the third signal. It should be noted that the multiplex assay also includes the possibility of detecting a given target nucleic acid by performing the method of the invention several times over the length of the target nucleic acid. For example, in a sample suspected of containing a target nucleic acid, two or more first and second probes that hybridize at different regions of the target nucleic acid can be designed, such that two or more triple junction structures are formed on the target nucleic acid, and the detection step includes (i) measuring the first, second or subsequent signals emitted from the first, second or subsequent fluorophore-aptamer complexes, and (ii) examining the presence or level of the target nucleic acid in the sample based on the intensity of all the detected signals. This multiplexing method is shown in Example 21.

[0124] In a third aspect, the invention relates to a computer-implemented method for designing pairs of probes, preferably the first and second probes defined above, for use in the method of the invention. In one embodiment, the method of the third aspect i) Reading the target nucleic acid; ii) Obtaining or generating the sequences of at least a pair of probes, wherein one of them contains or consists only of the sequence of the first probe defined above, and the other contains or consists only of the sequence of the second probe defined above, and further characterized in that they can form the three-way junction structure of the present invention by hybridization with the target nucleic acid molecule, and iii) Optionally, providing the sequence obtained or generated in step ii) as an output.

[0125] In a preferred embodiment of the third aspect, the computer-implemented method comprises i) Reading the target nucleic acid; ii) Obtaining or generating the sequences of at least a pair of probes, each probe comprising a foot region and an arm region, The foot region of the first probe is located in the 5' region of the probe, is complementary to and hybridizes with the first part of the target nucleic acid, and the arm region of the first probe is located in the 3' region of the probe and is non-complementary to the target nucleic acid, The foot region of the second probe is located in the 3' region of the probe, is complementary to and hybridizes with the second part of the target nucleic acid, and the arm region of the second probe is located in the 5' region of the probe, preferably in the 5' to 3' direction, - The full-length reverse complementary sequence of at least one fluorescence-generating aptamer, - The full-length reverse complementary sequence of a DNA-dependent RNA polymerase promoter, wherein the reverse complementary sequence of at least one fluorescence-generating aptamer is operably linked to the DNA-dependent RNA polymerase promoter, - A region consisting of only 5 to 9 nucleotides that is complementary to and hybridizes with the arm region of the first probe, and optionally, the region consisting of only the 5 to 9 nucleotides is completely or partially included in the full-length reverse complementary sequence of the DNA-dependent RNA polymerase promoter. The first probe and the second probe can form the triple junction structure of the present invention by hybridization with the target nucleic acid molecule, and the first part and the second part are adjacent or substantially adjacent. Preferably, the first part and the second part are separated by 0 to 10 nucleotides, more preferably 0 to 6 nucleotides. A step, iii) Optionally, providing the sequence obtained or generated in step ii) as an output.

[0126] In one embodiment, the target nucleic acid read in step i) is retrieved from a database. In another embodiment, the target nucleic acid read in step i) can be provided by the user. In one embodiment, step ii) of the method of the third aspect is a) Selecting a first part of the nucleotides contained in the target nucleic acid and generating its complementary sequence to obtain the foot region of the first probe; b) Selecting a second part of the nucleotides contained in the target nucleic acid and providing its complementary sequence to obtain the foot region of the second probe, wherein the first part and the second part are adjacent or substantially adjacent, preferably separated by 0 to 10 nucleotides, more preferably 0 to 6 nucleotides. A step, c) Selecting a nucleotide sequence containing the full-length sequence of a DNA-dependent RNA polymerase promoter and the full-length reverse complementary sequence of at least one fluorescence-generating aptamer to obtain the arm region of the second probe, wherein the reverse complementary sequence of at least one fluorescence-generating aptamer is operably linked to the DNA-dependent RNA polymerase promoter. A step, d) Selecting 5 to 9 nucleotides, preferably 6 to 8 nucleotides, complementary to the region located in the 3' region of the arm region of the second probe obtained in step c) to obtain the arm region of the first probe.

[0127] In one embodiment, the output of step iii) is provided in a readable format such as a txt or html file.

[0128] Note that the steps of the computer-implemented method may be performed in any order.

[0129] In a fourth aspect, the present invention further provides a kit of parts for detecting the presence of a target nucleic acid in a sample or for carrying out the method of any of the second aspect or its embodiments. Preferably, the kit includes the first and / or second nucleic acid probes defined in the first and / or second aspects of the present invention, and optionally, instructions for using them to carry out the method of any of the second aspect or its embodiments. In one embodiment, the kit may further include one or more containers for containing the components for performing the methods described herein, and optionally, instructions for use. Specifically, such a kit may include one or more agents described herein (e.g., the first and second probes described herein), optionally, instructions describing the intended use and the proper use of these agents, e.g., instructions for designing the first or second probe if they are not provided as reagents in the kit. Preferably, the kit includes one or more containers or vials containing the first or second probe, preferably together with the reagents necessary to carry out the method of the second aspect, and optionally also includes reagents for carrying out a previous amplification step.

[0130] Thus, in one embodiment, the kit may include (i) a DNA-dependent DNA polymerase, preferably Bst polymerase, (ii) at least one DNA-dependent RNA polymerase, preferably T7 RNA polymerase, and / or (iii) at least one appropriate fluorophore ligand of at least one fluorescence-generating aptamer for detecting the presence of a target nucleotide. Preferably, the kit includes all of (i)-(iii). Preferably, the kit includes, together with reagents (i)-(iii), the first and second probes defined in the first and / or second aspects of the present invention, which are suitable for carrying out the method of the second aspect and forming the structure of the first aspect. Other elements that may be included in the kit are spermidine, dNTPs, and / or an appropriate buffer for the correct functioning of the enzymes and reagents used in the method. An "appropriate" buffer means a buffer that provides appropriate conditions for the DNA-dependent RNA polymerase and / or any other enzyme present during the reaction (such as a DNA-dependent DNA polymerase) to function when in contact with the reaction mixture. Appropriate buffers include, for example, buffers containing Tris-HCl, such as: - 40 mM Tris-HCl, 6 mM MgCl2 and 10 mM NaCl, or - 40 mM Tris-HCl, pH 8.0, 13.2 mM MgCl2, 75 mM KCl, 10 mM DTT and 15% μL DMSO, or any appropriate buffer that allows the DNA-dependent RNA polymerase and / or DNA-dependent DNA polymerase to function correctly.

[0131] In one embodiment, a kit for detecting the presence of a target nucleic acid in a sample comprises, hereinafter, a) at least one DNA-dependent DNA polymerase, preferably Bst polymerase, b) at least one DNA-dependent RNA polymerase, preferably T7 RNA polymerase, c) at least one appropriate fluorophore ligand of at least one fluorescence-generating aptamer, d) spermidine, e) Ribonucleoside triphosphates (NTPs such as ATP, GTP, UTP, and CTP) or deoxynucleotide triphosphates (dNTPs such as dATP, dGTP, dTTP, and dCTP), or nucleoside triphosphates such as any combination thereof, f) A buffer suitable for carrying out the method of either the second embodiment or its implementation form, g) Optionally, reverse transcriptase, RNAse, and at least one exonuclease and phosphatase (for performing the previous amplification step, preferably the NASBA assay) may include at least one, preferably all, of Elements a) to g) are contained in different containers or grouped in one or more containers.

[0132] Such a kit can be designed to be suitable for diagnostic use or other purposes, such as research use. For example, the kit may include a device for collecting samples from a patient and / or reagents for detecting diseases related to nucleic acid molecules. Kits for research purposes may contain components in appropriate concentrations or amounts for performing various experiments.

[0133] In one embodiment, a computer-readable storage medium is provided. The computer-readable storage medium includes instructions stored therein. When the instructions are executed by a computer, the computer's processor is configured to enable the execution of the method of the third embodiment for providing and / or designing the first and second probes. In one embodiment, a device for providing and / or designing the first and second probe nucleic acid sequence datasets is provided. The device includes a computer processor and a computer-readable storage medium coupled to the computer processor. In one embodiment, a computer program is provided. The computer program is stored in a computer-readable storage medium. When the program is executed by a computer, the program is configured to enable the computer's processor to execute the method of the third embodiment.

[0134] In a fifth aspect, the present invention further provides a method for detecting the presence of a target nucleic acid in a sample as defined in the second aspect of the present invention, which uses the kit of parts as defined in the fourth aspect of the present invention.

[0135] In a sixth aspect, the present invention further provides a system for detecting the presence of a target nucleic acid in a sample, which comprises a first probe and a second probe as defined in the first and / or second aspect of the present invention.

[0136] Sequence Listing SEQ ID NO:1: >Escherichia coli 23S rRNA SMART - First probe (DNA form from Wharam et al. Nucl Acids Res, 2001) Underline the target - specific region, italicize the complementary sequence to the second probe TIFF2025523984000001.tif6170SEQ ID NO:2: >Escherichia coli 23S rRNA SMART - Mango second probe (design based on Wharam et al. Nucl Acids Res, 2001) Italicize the sequence complementary to the first probe, underline the target - specific region, make the mango reverse complement in lowercase, and make the T7 promoter in bold TIFF2025523984000002.tif12170SEQ ID NO:3: >Mango III (A10U) RNA aptamer (45 nt, Trachman et al. Nat Chem Biol, 2019) Italicize the nucleotides forming the stem structure, make the aptamer core in lowercase, and underline the target - specific region GGCACGUACGAA ggaagguuuguaugugguaua UUCGUACGUGCC SEQ ID NO:4: >5' primer for Escherichia coli 16S rRNA NASBA amplification reaction (OV2, Kao et al. Anal Letters, 2010) GGAGGCAGCAGTGGGGAATA SEQ ID NO:5: >3' primer for E. coli 16S rRNA NASBA amplification reaction (OV3, Kao et al. Anal Letters, 2010) T7 promoter in bold TIFF2025523984000003.tif Sequence number 6: >NR 024570.1 Escherichia coli strain U 5 / 41 16S ribosomal RNA, partial sequence Accession number 7: >E. coli 16S rRNA SMART - First probe (29 nt hybridization) TIFF2025523984000004.tif7170Accession number 8: >E. coli 16S rRNA SMART - Mango Second probe (29 nt hybridization) Mango reverse complement in lowercase, T7 promoter in bold, sequence complementary to the first probe in italic, target - specific region underlined TIFF2025523984000005.tif13170Accession number 9: >Reverse - complementary RNA sequence of E. coli 16S, NASBA product (191 nt) The 3’ NASBA - primer used in italic, the target region recognized by the second probe in lowercase, the target region recognized by the first probe in bold, the RC of the 5’ NASBA - primer used underlined TIFF2025523984000006.tif27170Accession number 10: >E. coli 16S rRNA SMART - First probe, 2 complementary (3WJ) nucleotides Target - specific region underlined, sequence complementary to the second probe in italic TIFF2025523984000007.tif5170Accession number 11: >E. coli 16S rRNA SMART - First probe, 4 complementary (3WJ) nucleotides Target - specific region underlined, sequence complementary to the second probe in italic TIFF2025523984000008.tif6170Accession number 12: >E. coli 16S rRNA SMART - First probe, 6 complementary (3WJ) nucleotides Target - specific region underlined, sequence complementary to the second probe in italic TIFF2025523984000009.tif6170Accession number 13: >Synthetic RNA target for Escherichia coli 16S ribosomal RNA (75 nt, pos. 357 - 432, reverse complement) The target region recognized by the second probe is in lowercase, and the target region recognized by the first probe is in bold TIFF2025523984000010.tif12170 Sequence number 14: >Escherichia coli 16S rRNA SMART - First probe, 10 complementary (3WJ) nucleotides The target - specific region is underlined, and the complementary sequence to the second probe is in italic TIFF2025523984000011.tif6170 Sequence number 15: >Escherichia coli 16S rRNA SMART - First probe, 15 complementary (3WJ) nucleotides The target - specific region is underlined, and the complementary sequence to the second probe is in italic TIFF2025523984000012.tif6170 Sequence number 16: >Escherichia coli 16S rRNA SMART - First probe, 1 nt gap from the second - probe hybridization region The target - specific region is underlined, and the complementary sequence to the second probe is in italic TIFF2025523984000013.tif5170 Sequence number 17: >Escherichia coli 16S rRNA SMART - First probe, 2 nt gap from the second - probe hybridization region The target - specific region is underlined, and the complementary sequence to the second probe is in italic TIFF2025523984000014.tif5170 Sequence number 18: >Escherichia coli 16S rRNA SMART - First probe, 4 nt gap from the second - probe hybridization region The target - specific region is underlined, and the complementary sequence to the second probe is in italic TIFF2025523984000015.tif5170 Sequence number 19: >E. coli 16S rRNA SMART - 6 - nt Spacer from the First Probe and Second Probe Hybridization Region Underline the target - specific region and italicize the complementary sequence to the second probe TIFF2025523984000016.tif5170 Sequence number 20: >E. coli 16S rRNA SMART - First Probe (22 - nt Hybridization) Underline the target - specific region and italicize the complementary sequence to the second probe TIFF2025523984000017.tif6170 Sequence number 21: >E. coli 16S rRNA SMART - First Probe (15 - nt Hybridization) Underline the target - specific region and italicize the complementary sequence to the second probe TIFF2025523984000018.tif6170 Sequence number 22: >E. coli 16S rRNA SMART - First Probe (7 - nt Hybridization) Underline the target - specific region and italicize the complementary sequence to the second probe TIFF2025523984000019.tif6170 Sequence number 23: >E. coli 16S rRNA SMART - Mango Second Probe (22 - nt Hybridization) Make the mango reverse complement in lowercase, the T7 promoter in bold, the sequence complementary to the first probe in italic, and underline the target - specific region TIFF2025523984000020.tif13170 Sequence number 24: >E. coli 16S rRNA SMART - Mango Second Probe (15 - nt Hybridization) Make the mango reverse complement in lowercase, the T7 promoter in bold, the sequence complementary to the first probe in italic, and underline the target - specific region TIFF2025523984000021.tif12170 Sequence number 25: >E. coli 16S rRNA SMART-Mango Second Probe (7nt Hybridization) Mango reverse complement in lowercase, T7 promoter in bold, sequence complementary to the first probe in italic, target-specific region underlined TIFF2025523984000022.tif12170 Sequence number 26: >SARS-CoV-2 T3 SMART-First Probe Target-specific region underlined, complementary sequence to the second probe in italic TIFF2025523984000023.tif6170 Sequence number 27: >SARS-CoV-2 T3 SMART-Mango Second Probe Mango reverse complement in lowercase, T7 promoter in bold, sequence complementary to the first probe in italic, target-specific region underlined TIFF2025523984000024.tif12170 Sequence number 28: >Synthetic RNA Target of SARS-CoV-2 S "Spike" RNA (30nt, pos.21766 - 21795, reverse complement) Target region recognized by the second probe in lowercase, target region recognized by the first probe in bold TIFF2025523984000025.tif6170 Sequence number 29: >Reverse Complementary RNA Sequence of NASBA's SARS-CoV-2 Product (189nt, S "Spike" RNA) 3’ NASBA-primers used in italic, target region recognized by the second probe in lowercase, target region recognized by the first probe in bold, RC of 5’ NASBA-primers used underlined TIFF2025523984000026.tif27170 Sequence number 30: >SARS-CoV-2 T3 SMART-Second Probe for Molecular Beacon Detection Molecular beacon reverse complement in lowercase, T7 promoter in bold, sequence complementary to the first probe in italic, target-specific region underlined TIFF2025523984000027.tif13170 Sequence number 31: >Molecular beacon oligonucleotide probe (Grm neg 16S MB, Zhao et al. J Clin Microbiol, 2009) Underlined at complementary 5' and 3' ends, 56-FAM = 5'-6-FAM, 3DAb = 3'-Dabcyl. / 56-FAM / CGAGCT TGAAGAAGGCCTTCGGGTTGTAAAG AGCTCG / 3DAb / Sequence number 32: >S "Spike" surface glycoprotein RNA (CDS), NC_045512.2:21563-25384 Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1 (SARS-CoV-2), complete genome Accession number 33: >5’ primer for SARS-CoV-2 NASBA amplification reaction CACGTGGTGTTTATTACCCTGACA Accession number 34: >3’ primer for SARS-CoV-2 NASBA amplification reaction T7 promoter in bold TIFF2025523984000028.tif7170 Accession number 35: >E. coli 23S rRNA SMART - first probe Target-specific region underlined, complementary sequence to the second probe in italics TIFF2025523984000029.tif7170 Accession number 36: >E. coli 23S rRNA SMART - mango second probe Mango reverse complement in lowercase, T7 promoter in bold, sequence complementary to the first probe in italics, target-specific region underlined TIFF2025523984000030.tif13170 Accession number 37: >Reverse complementary RNA sequence of E. coli 23S rRNA, NASBA product (256nt) 3’ NASBA - primer used in italics, target region recognized by the second probe in lowercase, target region recognized by the first probe in bold, RC of the 5’ NASBA - primer used underlined TIFF2025523984000031.tif33170 Accession number 38: >NR_103073.1 Escherichia coli K - 12 strain 23S ribosomal RNA gene, complete sequence Accession number 39: >Synthetic RNA target for 23S ribosomal RNA (79 nt, pos. 2393 - 2468, reverse complement) Target region recognized by the second probe in lowercase, target region recognized by the first probe in bold TIFF2025523984000032.tif13170 Accession number 40: >Staphylococcus aureus mecA SMART - First probe Target - specific region underlined, complementary sequence to the second probe in italics TIFF2025523984000033.tif6170 Accession number 41: >Staphylococcus aureus mecA SMART - Mango second probe Mango reverse complement in lowercase, T7 promoter in bold, sequence complementary to the first probe in italics, target - specific region underlined TIFF2025523984000034.tif12170 Accession number 42: >Reverse - complementary RNA sequence of Staphylococcus aureus mecA gene, NASBA product (98 nt) 3’NASBA - primer used in italics, target region recognized by the second probe in lowercase, target region recognized by the first probe in bold, RC of the 5’NASBA - primer used underlined TIFF2025523984000035.tif13170 Accession number 43: >KX639010.1 Staphylococcus aureus strain SQ5 methicillin - resistant protein subunit A (mecA) gene, partial cds TGTAAAGGTTGGCAAAAAGATAAATCTTGGGGTGGTTACAACGTTACAAGATATGAAGTGGTAAATGGTAATATCGACTTAAAACAAGGGATAGAATCATCAGATAACATTTTCTTTGCTAGAGTAGCACTCGAATTAGGCAGTAAGAAATTTGAAAAAGGCATGAAAAAACTAGGTGTTGGTGAAGATATACCAAGCCATTATCCATTTTATAGGGCTCAAATTTCAAACAAAAATTTAGATAATGAAATATTATTAGCTGATTCAGGTTACGGACAAGGTGAAATACTGATTAACCCAGTACAGATCCTTTCAATCTATAGCGCATTAGAAGGTAATGGCAATATTAACGCACCTCACTTATTAAAAGACACGAAAAACAAAGTTTGGAAGAAAAATATTATTTCCAAAGAAAATATCAATCTATTAACTGATGGTATGCAACAAGTCGTAAATAAAACACATAAAGAAGATA Accession number 44: >Synthetic RNA target for Staphylococcus aureus mecA RNA (98 nt, pos. 268 - 362, reverse complement) Target region recognized by the second probe in lowercase, target region recognized by the first probe in bold, RC of the 5’ NASBA - primer used underlined TIFF2025523984000036.tif12170 Accession number 45: >Influenza A PB1 gene SMART - first probe (15 nt target hybridization region) Target - specific region underlined, complementary sequence to the second probe in italics TIFF2025523984000037.tif6170 Sequence ID 46: >Influenza B PA gene SMART - first probe (15 nt target hybridization region) Target - specific region underlined, complementary sequence to the second probe in italics TIFF2025523984000038.tif6170 Accession number 47: >Influenza A PB1 gene SMART - Second probe (15nt target hybridization region) Mango reverse complement in lowercase, T7 promoter in bold, sequence complementary to the first probe in italic, target - specific region underlined TIFF2025523984000039.tif13170 Accession number 48: >Influenza B PA gene SMART - Second probe (15nt target hybridization region) Mango reverse complement in lowercase, T7 promoter in bold, sequence complementary to the first probe in italic, target - specific region underlined TIFF2025523984000040.tif12170 Accession number 49: >Synthetic RNA target (30nt) of Influenza A PB1 gene Target region recognized by the second probe in lowercase, target region recognized by the first probe in bold TIFF2025523984000041.tif7170 Accession number 50: >Synthetic RNA target (30nt) of Influenza B PA gene Target region recognized by the second probe in lowercase, target region recognized by the first probe in bold TIFF2025523984000042.tif6170 Accession number 51: >MK185298.1 Influenza A virus (A / swine / South Dakota / A02016893 / 2018(H1N1)) segment 2 polymerase PB1 (PB1) and PB1 - F2 protein (PB1 - F2) gene, complete cds Accession number 52: >MT637912.1 Influenza B virus (B / Texas / 9813 / 2019) segment 3 polymerase PA (PA) gene, complete cds Accession number 53: >5' primer for E. coli 23S rRNA NASBA amplification reaction GGCATAAGCCAGCTTGACTG Accession number 54: >3' primer for E. coli 23S rRNA NASBA amplification reaction T7 promoter in bold TIFF2025523984000043.tif6170 Accession number 55: >5' primer for S. aureus mecA+NASBA amplification reaction GGTTACGGACAAGGTGAAAT Accession number 56: >3' primer for S. aureus mecA+NASBA amplification reaction T7 promoter in bold TIFF2025523984000044.tif6170 Accession number 57: >Broccoli RNA aptamer (49nt, Filonov et al. JACS, 2014) Variable region in lowercase, conserved bases involved in base pairing in bold, conserved bases of the protrusion underlined TIFF2025523984000045.tif6170 Accession number 58: >Second probe of E. coli 16S rRNA SMART-broccoli Complementary strand of broccoli in lowercase, T7 promoter in bold, sequence complementary to the first probe in italic, target-specific region underlined TIFF2025523984000046.tif12170 Accession number 59: >Second probe of SARS-CoV-2 T3 SMART-broccoli Complementary strand of broccoli in lowercase, T7 promoter in bold, sequence complementary to the first probe in italic, target-specific region underlined TIFF2025523984000047.tif12170 Accession number 60: >Mango aptamer (complementary strand) GGCACGTACGAATATACCACATACCAAACCTTCCTTCGTACGTGCC SEQ ID NO: 61: >Broccoli aptamer (reverse complement) GAGCCCACACTCTACTCGACAGATACGAATATCTGGACCCGACCGTCTC SEQ ID NO: 62: >T7 promoter (reverse complement) TATAGTGAGTCGTATTA SEQ ID NO: 63 (similar to SEQ ID NO: 2, but with iSp18 replaced by any spacer and optionally containing any blocker molecule at the 3'-end): >E. coli 23S rRNA SMART-Mango second probe (designed based on Wharam et al. Nucl Acids Res, 2001) Italicize the sequence complementary to the first probe, underline the target-specific region, make the Mango reverse complement in lowercase, and make the T7 promoter in bold TIFF2025523984000048.tif12170 Here, preferably, the 3'-end of the molecule is blocked from elongation by DNA-dependent DNA polymerase, and preferably, the 3'-end of the molecule is blocked by conjugating or coupling the above 3'-end to a 3'-amino modifier (also referred to herein as / 3AmMO / ). SEQ ID NO: 64 (similar to SEQ ID NO: 8, but with iSp18 replaced by any spacer and optionally containing any blocker molecule at the 3'-end): >E. coli 16S rRNA SMART-Mango second probe (29 nt hybridization) Italicize the sequence complementary to the first probe, underline the target-specific region, make the Mango reverse complement in lowercase, and make the T7 promoter in bold TIFF2025523984000049.tif12170 Here, preferably, the 3'-end of the molecule is blocked from elongation by DNA-dependent DNA polymerase, and preferably, the 3'-end of the molecule is blocked by conjugating or coupling the 3'-end to a 3'-amino modifier (also referred to herein as / 3AmMO / ). SEQ ID NO: 65 (similar to SEQ ID NO: 23, but with iSp18 replaced by any spacer and optionally including any blocker molecule at the 3'-end): > E. coli 16S rRNA SMART-Mango second probe (22 nt hybridization) Mango reverse complement in lowercase, T7 promoter in bold, sequence complementary to the first probe in italic, target-specific region underlined TIFF2025523984000050.tif12170 Here, preferably, the 3'-end of the molecule is blocked from elongation by DNA-dependent DNA polymerase, and preferably, the 3'-end of the molecule is blocked by conjugating or coupling the 3'-end to a 3'-amino modifier (also referred to herein as / 3AmMO / ). SEQ ID NO: 66 (similar to SEQ ID NO: 24, but with iSp18 replaced by any spacer and optionally including any blocker molecule at the 3'-end): > E. coli 16S rRNA SMART-Mango second probe (15 nt hybridization) Mango reverse complement in lowercase, T7 promoter in bold, sequence complementary to the first probe in italic, target-specific region underlined TIFF2025523984000051.tif12170 Here, preferably, the 3'-end of the molecule is blocked from elongation by DNA-dependent DNA polymerase, and preferably, the 3'-end of the molecule is blocked by conjugating or coupling the 3'-end to a 3'-amino modifier (also referred to herein as / 3AmMO / ). SEQ ID NO: 67 (similar to SEQ ID NO: 25, but iSp18 is replaced with any spacer and optionally includes any blocker molecule at the 3' end): >E. coli 16S rRNA SMART-Mango second probe (7nt hybridization) Mango reverse complement in lowercase, T7 promoter in bold, sequence complementary to the first probe in italic, target-specific region underlined TIFF2025523984000052.tif12170 Here, preferably, the 3' end of the molecule is blocked from elongation by DNA-dependent DNA polymerase, and preferably, the 3' end of the molecule is blocked by conjugating or coupling the above 3' end to a 3'-amino modifier (also referred to herein as / 3AmMO / ). SEQ ID NO: 68 (similar to SEQ ID NO: 27, but iSp18 is replaced with any spacer and optionally includes any blocker molecule at the 3' end): >SARS-CoV-2 T3 SMART-Mango second probe Mango reverse complement in lowercase, T7 promoter in bold, sequence complementary to the first probe in italic, target-specific region underlined TIFF2025523984000053.tif12170 Here, preferably, the 3' end of the molecule is blocked from elongation by DNA-dependent DNA polymerase, and preferably, the 3' end of the molecule is blocked by conjugating or coupling the above 3' end to a 3'-amino modifier (also referred to herein as / 3AmMO / ). SEQ ID NO: 69 (similar to SEQ ID NO: 36, but iSp18 is replaced with any spacer and optionally includes any blocker molecule at the 3' end): >E. coli 23S rRNA SMART-Mango second probe Mango reverse complement in lowercase, T7 promoter in bold, sequence complementary to the first probe in italic, target-specific region underlined TIFF2025523984000054.tif13170 Here, preferably, the 3'-end of the molecule is blocked from elongation by DNA-dependent DNA polymerase, and preferably, the 3'-end of the molecule is blocked by conjugating or coupling the 3'-end to a 3'-amino modifier (also referred to herein as / 3AmMO / ). SEQ ID NO: 70 (similar to SEQ ID NO: 41, but with iSp18 replaced by any spacer and optionally containing any blocker molecule at the 3'-end): >Staphylococcus aureus mecA SMART-Mango Second Probe Mango reverse complement in lowercase, T7 promoter in bold, sequence complementary to the first probe in italic, target-specific region underlined TIFF2025523984000055.tif13170 Here, preferably, the 3'-end of the molecule is blocked from elongation by DNA-dependent DNA polymerase, and preferably, the 3'-end of the molecule is blocked by conjugating or coupling the 3'-end to a 3'-amino modifier (also referred to herein as / 3AmMO / ). SEQ ID NO: 71 (similar to SEQ ID NO: 47, but with iSp18 replaced by any spacer and optionally containing any blocker molecule at the 3'-end): >Influenza A PB1 gene SMART-Second Probe (15nt target hybridization region) Mango reverse complement in lowercase, T7 promoter in bold, sequence complementary to the first probe in italic, target-specific region underlined TIFF2025523984000056.tif13170 Here, preferably, the 3'-end of the molecule is blocked from elongation by DNA-dependent DNA polymerase, and preferably, the 3'-end of the molecule is blocked by conjugating or coupling the 3'-end to a 3'-amino modifier (also referred to herein as / 3AmMO / ). SEQ ID NO: 72 (similar to SEQ ID NO: 48, but with iSp18 replaced by any spacer and optionally containing any blocker molecule at the 3'-end): >Influenza B PA gene SMART - Second probe (15 nt target hybridization region) Mango reverse complement in lowercase, T7 promoter in bold, sequence complementary to the first probe in italic, target - specific region underlined TIFF2025523984000057.tif14170 Here, preferably, the 3' end of the molecule is blocked from elongation by DNA - dependent DNA polymerase, and preferably, the 3' end of the molecule is blocked by conjugating or coupling the said 3' end to a 3' amino modifier (also referred to herein as / 3AmMO / ). SEQ ID NO: 73 (similar to SEQ ID NO: 58, but with iSp18 replaced by any spacer and optionally containing any blocker molecule at the 3' end): >E. coli 16S rRNA SMART - Broccoli second probe Broccoli reverse complement in lowercase, T7 promoter in bold, sequence complementary to the first probe in italic, target - specific region underlined TIFF2025523984000058.tif15170 Here, preferably, the 3' end of the molecule is blocked from elongation by DNA - dependent DNA polymerase, and preferably, the 3' end of the molecule is blocked by conjugating or coupling the said 3' end to a 3' amino modifier (also referred to herein as / 3AmMO / ). SEQ ID NO: 74 (similar to SEQ ID NO: 59, but with iSp18 replaced by any spacer and optionally containing any blocker molecule at the 3' end): >SARS - CoV - 2 T3 SMART - Broccoli second probe Broccoli reverse complement in lowercase, T7 promoter in bold, sequence complementary to the first probe in italic, target - specific region underlined TIFF2025523984000059.tif13170Here, preferably, the 3'-end of the molecule is blocked from elongation by DNA-dependent DNA polymerase, and preferably, the 3'-end of the molecule is blocked by conjugating or coupling the 3'-end to a 3'-amino modifier (also referred to herein as / 3AmMO / ). SEQ ID NO: 75 >Sp6 promoter (reverse complement) TATAGTGTCACCTAAAT SEQ ID NO: 76 >E. coli 23S rRNA SMART-mango second probe for one-pot NASBA-Apta-SMART detection Mango reverse complement in lowercase, Sp6 promoter in bold, sequence complementary to the first probe in italic, target-specific region underlined TIFF2025523984000060.tif14170SEQ ID NO: 77 (similar to SEQ ID NO: 76 but with iSp18 replaced by any spacer and optionally including any blocker molecule at the 3'-end): >E. coli 23S rRNA SMART-mango second probe for one-pot NASBA-Apta-SMART detection Mango reverse complement in lowercase, Sp6 promoter in bold, sequence complementary to the first probe in italic, target-specific region underlined JPEG2025523984000061.jpg13170Here, preferably, the 3'-end of the molecule is blocked from elongation by DNA-dependent DNA polymerase, and preferably, the 3'-end of the molecule is blocked by conjugating or coupling the 3'-end to a 3'-amino modifier (also referred to herein as / 3AmMO / ). SEQ ID NO: 78 >SARS-CoV-2 T3 SMART-mango second probe for one-pot NASBA-Apta-SMART detection Mango reverse complement in lowercase, Sp6 promoter in bold, sequence complementary to the first probe in italic, target-specific region underlined TIFF2025523984000062.tif Sequence number 79 (similar to sequence number 78, but iSp18 is replaced with an arbitrary spacer and optionally includes an arbitrary blocker molecule at the 3' end): > Second probe for SARS-CoV-2 T3 SMART-mango for one-pot NASBA-Apta-SMART detection Mango reverse complement in lowercase, Sp6 promoter in bold, sequence complementary to the first probe in italics, target-specific region underlined TIFF2025523984000063.tif Here, preferably, the 3' end of the molecule is blocked from elongation by DNA-dependent DNA polymerase, and preferably, the 3' end of the molecule is blocked by conjugating or coupling the above 3' end to a 3'-amino modifier (also referred to herein as / 3AmMO / ). Sequence number 80: > Modified 3' primer for E. coli 23S rRNA NASBA amplification reaction, Sp6 promoter Sp6 promoter in bold TIFF2025523984000064.tif Sequence number 81: > Second probe for Staphylococcus aureus mecA SMART-mango for one-pot NASBA-Apta-SMART detection Mango reverse complement in lowercase, Sp6 promoter in bold, sequence complementary to the first probe in italics, target-specific region underlined TIFF2025523984000065.tif Sequence number 82 (similar to sequence number 81, but iSp18 is replaced with an arbitrary spacer and optionally includes an arbitrary blocker molecule at the 3' end): > Second probe for Staphylococcus aureus mecA SMART-mango for one-pot NASBA-Apta-SMART detection Mango reverse complement in lowercase, Sp6 promoter in bold, sequence complementary to the first probe in italics, target-specific region underlined TIFF2025523984000066.tif14170Here, preferably, the 3'-end of the molecule is blocked from elongation by DNA-dependent DNA polymerase, and preferably, the 3'-end of the molecule is blocked by conjugating or coupling the 3'-end to a 3'-amino modifier (also referred to herein as / 3AmMO / ). SEQ ID NO: 83 > E. coli 23S rRNA SMART - First probe for detection of Region 2 (R2) used in the Dual Apta - SMART assay. Target - specific region underlined, complementary sequence to the second probe in italics GAGTTCATATCGACGGCGGTGTTTGGCACTTCGAAAT SEQ ID NO: 84 > E. coli 23S rRNA SMART - Mango probe for detection of Region 2 (R2) used in the Dual Apta - SMART assay. Mango reverse complement in lowercase, T7 promoter in bold, complementary sequence to the first probe in italics, target - specific region underlined ggcacgtacgaatataccacataccaaaccttccttcgtacgtgccCCCTATAGTGAGTCGTATTAATTTCGAA / iSp18 / CTCGATGTCGGCTCATCACATCCTGGGGC / 3AmMO / SEQ ID NO: 85 (similar to SEQ ID NO: 84, but with iSp18 replaced by any spacer and optionally containing any blocker molecule at the 3'-end): > E. coli 23S rRNA SMART - Mango probe for detection of Region 2 (R2) used in the Dual Apta - SMART assay. Mango reverse complement in lowercase, T7 promoter in bold, complementary sequence to the first probe in italics, target - specific region underlined TIFF2025523984000067.tif13170 Here, preferably, the 3'-end of the molecule is blocked from elongation by a DNA-dependent DNA polymerase, and preferably, the 3'-end of the molecule is blocked by conjugating or coupling the 3'-end to a 3'-amino modifier (also referred to herein as / 3AmMO / ).

[0137] The following clauses are also included in the present invention.

[0138] Clause 1. A method for detecting the presence of a target nucleic acid in a sample, comprising: a) adding a first nucleic acid probe and a second nucleic acid probe to a sample containing the target nucleic acid so as to form a triple junction structure by hybridization between the target nucleic acid molecule, the first nucleic acid probe, and the second nucleic acid probe, i) the first probe includes a foot region located in the 5'-region of the probe that is complementary to and hybridizes to a first portion of the target nucleic acid, and an arm region located in the 3'-region of the probe, ii) the second probe includes (1) a foot region located in the 3'-region of the probe that is complementary to and hybridizes to a second portion of the target nucleic acid, (2) an arm region located in the 5'-region of the probe, in the 5' to 3' direction, - the full-length reverse complementary sequence of at least one fluorescence-generating aptamer, - the full-length reverse complementary sequence of a DNA-dependent RNA polymerase promoter, wherein the reverse complementary sequence of at least one fluorescence-generating aptamer is operably linked to the DNA-dependent RNA polymerase promoter, - a region containing only 5 to 9 nucleotides that is complementary to and hybridizes to the arm region of the first probe, and optionally, the region containing only 5 to 9 nucleotides is completely or partially included in the full-length reverse complementary sequence of the DNA-dependent RNA polymerase promoter, including an arm region, iii) The target nucleic acid includes a first portion located in the 3' region of the target nucleic acid that is complementary to the foot region of the first probe and a second portion located in the 5' region of the target nucleic acid that is complementary to the foot region of the second probe, the first portion and the second portion are adjacent or substantially adjacent, preferably, the first portion and the second portion are separated by 0 to 6 nucleotides, and when the target nucleic acid is present in the sample, a triple junction structure is formed between the first probe, the second probe, and the target nucleic acid, the step, b) Adding a DNA-dependent DNA polymerase that extends the arm of the first probe to the end of the arm of the second probe to generate a double-stranded structure containing a functional RNA polymerase promoter and at least one fluorescence-generating aptamer, wherein one strand of the double-stranded structure is provided by the extended arm of the first probe, and the other strand of the double-stranded structure is provided by the arm of the second probe, the step, c) Adding a DNA-dependent RNA polymerase that recognizes the double-stranded promoter formed in step b) to cause de novo synthesis of a single-stranded nucleic acid containing at least one fluorescence-generating aptamer, the step, d) Adding at least one fluorophore ligand of the at least one fluorescence-generating aptamer, thereby directly detecting the de novo synthesized nucleic acid containing at least one fluorescence-generating aptamer, the step in which the detection of the nucleic acid containing at least one fluorescence-generating aptamer indicates the presence of the target nucleic acid in the sample, and the method includes the step, Optionally, before step a), the method further includes an amplification step in which the target nucleic acid is amplified.

[0139] Item 2. The method according to Item 1, wherein the double-stranded RNA promoter formed in step b) is a T7 RNA polymerase promoter, and the DNA-dependent RNA polymerase added in step c) is T7 RNA polymerase, or the double-stranded RNA promoter formed in step b) is an SP6 RNA polymerase promoter, and the DNA-dependent RNA polymerase added in step c) is SP6 RNA polymerase.

[0140] Item 3. The method according to any one of Items 1 or 2, wherein the DNA-dependent DNA polymerase added in step b) is Bacillus stearothermophilus DNA polymerase I.

[0141] Item 4. The method according to any one of Items 1 to 3, wherein the foot region of the first probe and / or the second probe is at least 15 nucleotides in length.

[0142] Item 5. The method according to any one of Items 1 to 4, wherein at least one fluorescent aptamer is a mango aptamer or a broccoli aptamer.

[0143] Item 6. Preferably, when at least one fluorescent aptamer contained in the arm of the second probe is a mango aptamer, at least one fluorophore ligand added in step d) is TO1 biotin fluorogen, or when at least one fluorescence-generating aptamer contained in the arm of the second probe is a broccoli aptamer, at least one fluorophore ligand added in step d) is DFHBI or DFHBI-1T fluorogen. The method according to Item 5.

[0144] Item 7. Further comprising an amplification step before step a), which comprises amplifying the target nucleic acid to generate a plurality of molecules identical to the target nucleic acid or its reverse complement, wherein the plurality of molecules are the target nucleic acid in subsequent steps a) to d). Optionally, after the amplification step, a step of decomposing the remaining amplification primers and dephosphorylating the excess dNTPs after amplification follows. The method according to any one of Items 1 to 6.

[0145] Item 8. The method according to Item 7, wherein the amplification step is carried out by nucleic acid sequence-based amplification (NASBA).

[0146] Item 9. The method according to any one of Items 1 to 8, wherein the target nucleic acid is an RNA molecule derived from the genome of an infectious agent, such as a bacterium or a virus.

[0147] A computer-implemented method for designing at least a pair of probes suitable for implementing the method defined in any one of claims 1 to 9, comprising: i) reading a target nucleic acid; ii) obtaining or generating the sequences of at least a pair of probes, each probe including a foot region and an arm region, wherein the foot region of the first probe is located in the 5' region of the probe, is complementary to and hybridizes with the first part of the target nucleic acid, and the arm region of the first probe is located in the 3' region of the probe and is non-complementary to the target nucleic acid; wherein the foot region of the second probe is located in the 3' region of the probe, is complementary to and hybridizes with the second part of the target nucleic acid, and the arm region of the second probe is located in the 5' region of the probe and, in the 5' to 3' direction, - the full-length reverse complementary sequence of at least one fluorescent aptamer; - the full-length reverse complementary sequence of a DNA-dependent RNA polymerase promoter, wherein the reverse complementary sequence of at least one fluorescent aptamer is operably linked to the DNA-dependent RNA polymerase promoter; - a region consisting of only 5 to 9 nucleotides that is complementary to and hybridizes with the arm region of the first probe, optionally, the region consisting of only 5 to 9 nucleotides is completely or partially included in the full-length reverse complementary sequence of the DNA-dependent RNA polymerase promoter; wherein the first and second parts of the target nucleic acid are separated by 0 to 6 nucleotides; wherein the first and second probes are capable of forming a triple junction structure by hybridization with the target nucleic acid molecule; iii) optionally, providing the sequence obtained or generated in step ii) as an output.

[0148] Claim 11. Step ii) is a) Selecting a first portion of nucleotides contained in the target nucleic acid and obtaining the foot region of the first probe by providing its complementary sequence; b) Selecting a second portion of nucleotides contained in the target nucleic acid and obtaining the foot region of the second probe by providing its complementary sequence, wherein the first portion and the second portion are separated by 0 to 6 nucleotides; c) Selecting a nucleotide sequence containing the full-length sequence of a DNA-dependent RNA polymerase promoter and the full-length reverse complementary sequence of at least one fluorescence-generating aptamer to obtain the arm region of the second probe, wherein the reverse complementary sequence of the at least one fluorescence-generating aptamer is operably linked to the DNA-dependent RNA polymerase promoter; d) Selecting 5 to 9 nucleotides complementary to a region located in the 3'-region of the arm region of the second probe obtained in step c) to obtain the arm region of the first probe; e) Optionally, synthesizing the designed first and second probes. The computer-implemented method according to claim 10.

[0149] Item 12. A kit of parts for detecting the presence of a target nucleic acid in a sample, comprising the following elements, namely: a) At least one DNA-dependent DNA polymerase, preferably Bst polymerase; b) At least one DNA-dependent RNA polymerase, preferably T7 RNA polymerase or SP6 RNA polymerase; c) At least an appropriate fluorophore ligand of at least one fluorescence-generating aptamer; d) Spermidine; e) Nucleoside triphosphates containing deoxynucleoside triphosphates and / or ribonucleoside triphosphates; f) An appropriate buffer; g) Optionally, containing reverse transcriptase, RNAse, at least exonuclease and phosphatase. A kit of parts in which elements a) to g) are contained in different containers or grouped in one or more containers.

[0150] Item 13. A system for detecting the presence of a target nucleic acid in a sample comprising a first probe and a second probe, wherein the first probe comprises a foot region located in the 5' region of the probe that is complementary to and hybridizes to the first portion of the target nucleic acid, and an arm region located in the 3' region of the probe, and the second probe (1) A foot region located in the 3' region of the probe that is complementary to and hybridizes to the second portion of the target nucleic acid, (2) In the 5' to 3' direction, i. The full-length reverse complementary sequence of at least one fluorescence-generating aptamer, ii. The full-length reverse complementary sequence of a DNA-dependent RNA polymerase promoter, wherein the reverse complementary sequence of at least one fluorescence-generating aptamer is operably linked to the RNA polymerase promoter, iii. A region comprising 5 to 9 nucleotides that is complementary to and hybridizes to the arm region of the first probe, and the region of 5 to 9 nucleotides may be a region contained in the full-length reverse complementary sequence of the DNA-dependent RNA polymerase promoter, and an arm region comprising the same.

[0151] Hereinafter, the present invention will be described by the following examples, which are merely illustrative and do not limit the scope of the present invention.

Example

[0152] Example 1: Apta-SMART Probe Design The aptamer-SMART (「apta-SMART」) assay is a detection method that relies on the hybridization of two DNA probes whose regions are complementary to a target nucleic acid (either DNA or RNA). These two probes (the first and second probes) can hybridize to adjacent regions of the target sequence, and only in that case, enable the annealing of complementary arm-specific sequences in both probes that form a three-way junction (3WJ) structure. After the 3WJ is formed, Bst DNA polymerase extends the first probe sequence in the 5’ to 3’ direction to create a functional double-stranded RNA polymerase promoter, which, in the presence of a specific RNA polymerase (either T7, T3, or SP6), uses the second probe as a template to enable the transcription of an aptamer sequence (i.e., for mango, broccoli, etc.), producing multiple copies of the RNA aptamer that are detected by fluorescence readout after the addition of a fluorescent substrate (e.g., TO1-biotin or TO3-biotin for mango).

[0153] Based on this concept, here, a method for designing a pair of apta-SMART probes for detecting Escherichia coli - E. coli - 23 S rRNA is shown (Figure 4). The probe design was based on previously published SMART probes (Wharam et al. Nucl Acids Res, 2001) for the detection of the Escherichia coli K 12 23 S DNA region. Each probe contains one region that can hybridize to the target and another, much shorter, region that hybridizes to the other probe. These probes are designed to anneal to each other only in the presence of the specific target and form a 3WJ structure. Probes for detecting different rRNA target sequences were all designed in the same way by changing only the target hybridization region.

[0154] The first probe (SEQ ID NO: 1) of Escherichia coli 23S rRNA consists of a target-specific region consisting of only 30 nucleotides that specifically hybridizes to the target sequence, and a non-target complementary region (adjacent to the target-specific region) consisting of only 8 fixed nucleotides (TTCGAAAT) that are complementary to the second probe forming a 3WJ.

[0155] The second probe (SEQ ID NO: 2) of Escherichia coli 23S rRNA also consists of a target-specific region consisting of only 30 nucleotides that hybridizes to the target sequence (at a position adjacent to the target region recognized by the first probe), and an 8-nucleotide fixed sequence (reverse-complemented) for annealing with the first probe. The second probe also contains a non-functional (reverse complement) single-stranded RNA polymerase promoter sequence, followed by a reverse complement RNA aptamer sequence, i.e., the Mango-III (A10U) aptamer (SEQ ID NO: 3, Trachman et al. Nat Chem Biol, 2019). The 3' end of the second probe is blocked by an amino group to avoid the initial intervention of RNA polymerase. Furthermore, to reduce non-specific background signals, a non-nucleoside linker (in this case, an 18-atom hexaethylene glycol spacer) is included immediately before the 3WJ (shown as iSp18 in Figure 4).

[0156] Example 2: Region of hybridization (non-target complementary region) between probes forming a 3WJ. Based on previously published primers (OV2 and OV3, SEQ ID NOs: 4 and 5, respectively) (Kao et al. Anal Letters, 2010) for NASBA detection of Escherichia coli 16S rRNA (SEQ ID NO: 6), the inventors designed a first probe (SEQ ID NO: 7) of Escherichia coli 16S rRNA, and a modified second probe (SEQ ID NO: 8) containing a T7 promoter and a Mango aptamer for detecting the previously reported reverse complement (RC) region (SEQ ID NO: 9) of Escherichia coli 16S rRNA (Kao et al. Anal Letters, 2010).

[0157] The preferred size of the non-target complementary region consists of only 8 nucleotides (8 nt, TTCGAAAT) complementary to the arm of the second probe. In this example, the inventors hybridized 8 nt in the first and second probes (SEQ ID NOs: 7 and 8) as their standard to form a 3WJ, and also used fewer hybridizing nucleotides (2 nt, 4 nt, 6 nt, SEQ ID NOs: 10, 11, 12 respectively) in the first probe to test whether it was sufficient for SMART detection with a high signal-to-noise ratio using a synthetic RNA target (sRNA, SEQ ID NO: 13) of Escherichia coli 16S rRNA. To test this, the inventors used the sequences TT, TTCG, and TTCGAA (as shown in SEQ ID NOs: 10, 11, 12) to form a 3WJ between the probes. The complementary sequences in the second probe were ATTTCGAA for the standard 8 nt, AA, CGAA, and TTCGAA for 2 nt, 4 nt, and 6 nt respectively, (in the 5' to 3' direction). Furthermore, the inventors used lengths greater than 8 nt (specifically, 10 nt and 15 nt, SEQ ID NOs: 14 and 15) to elucidate whether hybridization between the probes could become non-specific and as a result, a reaction could occur in the absence of sRNA. For this, the inventors used the sequences TTCGAAATTA and TTCGAAATTAATACG (shown in SEQ ID NOs: 14 and 15). The complementary sequences in the second probe were TAATTTCGAA and CGTATTAATTTCGAA for 10 nt and 15 nt respectively, (in the 5' to 3' direction).

[0158] Using the standard first probe for E. coli 16S rRNA (SEQ ID NO: 7), the first probes having 2nt, 4nt, 6nt, 10nt and 15nt (SEQ ID NOs: 10, 11, 12, 14 and 15 respectively), and the standard second probe (SEQ ID NO: 8) containing the mango aptamer for the detection of the reverse complementary RNA sequence (synthetic RNA, sRNA) (SEQ ID NO: 13) of E. coli 16S rRNA (SEQ ID NO: 6), the inventors performed the apta - SMART reaction as follows in detail. Denaturation at 65°C for 5 minutes, followed by pre - incubation of the reaction mixture containing both the first and second probes (840 and 700 fmol respectively) and 17.5 nM sRNA (SEQ ID NO: 13) in 1× transcription buffer (40 mM Tris - HCl pH 7.9, 6 mM MgCl2, 2 mM spermidine and 10 mM NaCl) (from T7 RNA pol, Promega)+1 mM spermidine (Sigma) at 41°C for 60 minutes. Then, 3 μL of dNTP / NTP and enzyme mix (containing 5 μM dNTP, 2 mM NTP, 2 U Bst DNA polymerase and 25 U T7 RNA polymerase) was added until a final volume of 10 μL and incubated for an additional 60 minutes in the same buffer. Finally, immediately after adding 1 μL of 4.8 μM TO1 - biotin fluorogen (BioCat, catalog number: G955 - ABM) to a black - bottom 384 - well plate (Nunc) (final concentration 480 nM), fluorescence was read at 510 nm (excitation) and 535 nm (emission) wavelengths using a BioTek plate reader (Synergy H1 hybrid multimode reader).

[0159] As shown in Figure 5, the apta-SMART detection of 17.5 nM sRNA (SEQ ID NO: 13) is optimal when the hybridization regions (3WJ) contain 8 nt and 6 nt (SEQ ID NO: 7 and SEQ ID NO: 12), and the fold changes in sRNA detection in the absence of sRNA are 4.6 and 3.6, respectively (Figure 5B), and is ineffective when containing nucleotides of 4 nt or less (SEQ ID NO: 10 and SEQ ID NO: 11) that form 3WJ. When 10 nt and 15 nt hybridizations were tested, high non-specific signals were found from the sRNA-free control, suggesting interactions that can occur in the absence of the RNA target. The lowest amount of sRNA tested (1.75 nM) was specifically detected, and the optimal hybridizing 8-nucleotide construct reached a fold change of 1.4 times that in the absence of sRNA. Notably, 2 or 5 residues of the 10 nt probe and 15 nt probe, respectively, can interact with the T7 promoter sequence of the second probe region to form dsDNA that can result in the "indiscriminate" activity of T7 RNA polymerase. To eliminate it, the inventors performed an assay without using Bst polymerase. As shown in Figures 5C and 5D, the apta-SMART signal is null without Bst polymerase activity. These results support that an 8 nt hybridization between the first and second probes is optimally sized for target specificity since 10 complementary nucleotides are already hybridizing non-specifically in the absence of the RNA target (in the example, sRNA).

[0160] Example 3: Spacing between Hybridization Regions (Target Probes) As detailed, both the first and second probes have a 30-nucleotide target-specific region that hybridizes to a 60-nucleotide region target sequence, respectively. These 30 nt regions are adjacent to each other on the target, and thus, after target hybridization, they are adjacent.

[0161] Here, the inventors tested whether the first probe could anneal to an RNA target region (SEQ ID NO: 13) separated from hybridization of the second probe region by 1, 2, 4, or 6 nucleotides (SEQ ID NOs: 16, 17, 18, and 19), still form a 3WJ, and give an optimal SMART reaction and signal.

[0162] Using the second probe (SEQ ID NO: 8) and the first probe of E. coli 16S rRNA separated by 0 (standard, SEQ ID NO: 7), 1, 2, 4, and 6 nucleotides (SEQ ID NOs: 16, 17, 18, and 19), the inventors performed the apta - SMART reaction as follows in detail. Denaturation for 5 minutes at 65°C, followed by pre - incubation of the reaction mixture containing both the first and second probes (840 and 700 fmol respectively) with 17.5 nM sRNA (SEQ ID NO: 13) in 1× transcription buffer (40 mM Tris - HCl pH 7.9, 6 mM MgCl2, 2 mM spermidine, and 10 mM NaCl) (from T7 RNA pol, Promega)+1 mM spermidine (Sigma) for 60 minutes at 41°C. Then, 3 μL of dNTP / NTP and enzyme mix (containing 5 μM dNTP, 2 mM NTP, 2 U Bst DNA polymerase, and 25 U T7 RNA polymerase) was added to a final volume of 10 μL and incubated for an additional 60 minutes in the same buffer. Finally, immediately after adding 1 μL of 4.8 μM TO1 - biotin fluorogen (BioCat, catalog number: G955 - ABM) (final concentration 480 nM) to a black - bottom 384 - well plate (Nunc), fluorescence was read at 510 nm (excitation) and 535 nm (emission) wavelengths using a BioTek plate reader (Synergy H1 hybrid multimode reader).

[0163] Figure 6 shows the detection of sRNA by Mango-SMART using "on-target" continuous probes and probes having a gap between the target hybridization regions of 1 to 6 nt. All conditions optimally detected 17.5 nM sRNA, and the sRNA showed a fold change of more than 4.0 relative to sRNA-free (Figure 6B).

[0164] Example 4: Minimum hybridization region length of the probe to the target.

[0165] To elucidate whether the hybridization region of the probe with a target shorter than the 29 nt (SEQ ID NOs: 7 and 8) standard is still optimal for the apta-SMART reaction, the inventors used (1) Escherichia coli 16S sRNA (SEQ ID NO: 13) as the target and (2) the NASBA product of the Escherichia coli 16S rRNA region, and conducted experiments using hybridization regions of 22 nt, 15 nt, and 7 nt in the first probe (SEQ ID NOs: 20, 21, and 22) and the second probe (SEQ ID NOs: 23, 24, and 25). All probes included a standard 8 nt 3WJ region, and their detection was by the Mango aptamer as in the previous two examples.

[0166] 4.1. Apta-SMART detection of Escherichia coli 16S synthetic RNA target using probes of different lengths Using 22-, 15- and 7-nt first probes (SEQ ID NOs: 20, 21 and 22) and second probes (SEQ ID NOs: 23, 24 and 25) containing the Mango aptamer for the detection of the 29-nucleotide (nt) E. coli 16S rRNA standard first and second probes (SEQ ID NOs: 7 and 8) and the reverse complementary RNA sequence (synthetic target) of E. coli 16S rRNA (SEQ ID NO: 6), the inventors performed the apta-SMART reaction as follows in detail. Denaturation at 65 °C for 5 minutes, followed by pre-incubation of the reaction mixture of both the first and second probes (840 and 700 fmol respectively) and 17.5 nM sRNA (SEQ ID NO: 13) in 1× transcription buffer (40 mM Tris-HCl pH 7.9, 6 mM MgCl2, 2 mM spermidine and 10 mM NaCl) (from T7 RNA pol, Promega) + 1 mM spermidine (Sigma) at 41 °C for 60 minutes. Then, 3 μL of dNTP / NTP and enzyme mix (containing 5 μM dNTP, 2 mM NTP, 2 U Bst DNA polymerase and 25 U T7 RNA polymerase) was added until a final volume of 10 μL and incubated for a further 60 minutes in the same buffer. Finally, immediately after adding 1 μL of 4.8 μM TO1-biotin fluorogen (BioCat, catalog number: G955-ABM) (final concentration 480 nM) to a black-bottom 384-well plate (Nunc), fluorescence was read at 510 nm (excitation) and 535 nm (emission) wavelengths using a BioTek plate reader (Synergy H1 hybrid multimode reader).

[0167] 4.2. Apta-SMART detection of the E. coli 16S RNA region after NASBA reaction using probes of different lengths Based on previously published primers (OV2 and OV3, SEQ ID NOs. and 5 respectively) (Kao et al. Anal Letters, 2010) for the NASBA detection of Escherichia coli 16S rRNA (SEQ ID NO: 6), the inventors designed a first probe (SEQ ID NO: 7) of Escherichia coli 16S rRNA, and a modified second probe (SEQ ID NO: 8) containing a T7 promoter and a mango aptamer, for detecting the previously reported reverse complement (RC) region (SEQ ID NO: 9) of Escherichia coli 16S rRNA (Kao et al. Anal Letters, 2010).

[0168] Step 1: NASBA. The inventors used a previously published 5' primer (SEQ ID NO: 4) and a 3' primer (SEQ ID NO: 5) containing a T7 promoter that isothermally amplifies the region (SEQ ID NO: 9) of Escherichia coli 16S rRNA (SEQ ID NO: 6) (Kao et al. Anal Letters, 2010). NASBA consisted of a reaction containing 2 μL of an Escherichia coli culture and 500 nM of NASBA primers in a final volume of 15 μL in NASBA buffer (40 mM Tris-HCl, pH 8.0, 13.2 mM MgCl2, 75 mM KCl, 10 mM DTT, 1 mM dNTP, 2 mM ATP, 2 mM UTP, 2 mM CTP, 1.5 mM GTP, 0.5 mM ITP and 15% uL DMSO - corresponding to 3 μL of the reaction mixture) in an initial denaturation step at 95°C for 2 minutes and 37°C for 2 minutes. Then, 5 μL of an enzyme mix (6.8 U AMV-RT, 0.08 U RNAse H, 32 U T7 RNA polymerase and 120 μg / mL BSA in water) was added and incubated at 37°C for 90 minutes. The resulting amplified fragment is the reverse complement (RC) region of the 191 nt region (SEQ ID NO: 9) of Escherichia coli 16S rRNA (SEQ ID NO: 6) that is used as a template for the mango-SMART reaction (Step 2).

[0169] Step 2: Mango-SMART detection. For the detection of the reverse complementary RNA sequence of E. coli 16S RNA (SEQ ID NO: 6), using the first probes (SEQ ID NOs: 7, 20, 21 and 22) and the second probes (SEQ ID NOs: 8, 23, 24 and 25) of 29, 22, 15 and 7 nt of E. coli 16S rRNA containing the mango aptamer, the inventors performed the mango - SMART reaction as follows in detail. Denaturation at 65°C for 5 minutes, followed by pre - incubation of the reaction mixture at 41°C for 60 minutes with both the first and second probes (840 and 700 fmol respectively) in 1× transcription buffer (see the above composition, from T7 RNA pol, Promega) + 1 mM spermidine (Sigma). Then, 3 μL of dNTP / NTP and enzyme mix (containing 5 μM dNTP, 2 mM NTP, 2 U Bst DNA polymerase and 25 U T7 RNA polymerase) were added until a final volume of 10 μL was reached and incubated for an additional 60 minutes in the same buffer. Finally, immediately after adding 1 μL of 4.8 μM TO1 - biotin fluorogen (BioCat, catalog number: G955 - ABM) (final concentration 480 nM) to a black - bottom 384 - well plate (Nunc), fluorescence was read at 510 nm (excitation) and 535 nm (emission) wavelengths using a BioTek plate reader (Synergy H1 hybrid multimode reader).

[0170] As shown in Fig. 7, when using sRNA as a target, the Mango-SMART signal was optimal up to a hybridization region of 15 nt per probe, but when using a probe having only a 7 nt hybridization region, the reaction completely stopped (Fig. 7A). Thus, no signal was found for 7 nt hybridization (compared to the case without RNA), but 15 nt, 22 nt, and 29 nt probes showed an increase in fold change of 6.1 - 7.7 times more than the case without RNA (Fig. 7B). When using NASBA amplicon as a target, for sRNA, the reaction showed good results for the Mango-TO1 signal for 15 nt (per probe) from the standard 29 nt hybridization region length, but no signal was detected for the 7 nt hybridization region (Fig. 7C). When normalizing the data against the data points of NASBA without RNA, (Fig. 7D) 29 nt, 22 nt, and 15 nt probes showed a fold change of more than 1.5 indicating positive.

[0171] Example 5: Comparison between Molecular Beacon (MB) and apta-SMART detection In this example, the inventors compared the use of molecular beacons for the detection of newly synthesized RNA with the inventors' apta-SMART (using Mango aptamer) detection method. For this comparison, the first and second probes of SARS-CoV-2 (SEQ ID NOs: 26 and 27 respectively) were used for the detection of the reverse complement (RC) of the region of the SARS-CoV-2 S "spike" ssRNA (hereinafter, in the text, S "spike" RNA) sequence encoding the spike-S glycoprotein, which is identical to the result of the NASBA reaction. The inventors tested the SMART reaction using (1) synthetic RNA consisting only of the 30 nucleotide region of interaction (SEQ ID NO: 28) and (2) the RC RNA sequence result (SEQ ID NO: 29) of the NASBA reaction.

[0172] For Mango-SMART detection, the inventors used a first probe of SARS-CoV-2 (SEQ ID NO: 26) and a second probe containing the Mango aptamer (SEQ ID NO: 27).

[0173] For molecular beacon (MB) detection of the same region of SARS-CoV-2 (see the figure in Fig. 8), the inventors designed a new second probe of SARS-CoV-2 (SEQ ID NO: 30) containing a 25 nt RNA sequence identical to the internal loop of the molecular beacon oligonucleotide probe (instead of the Mango-aptamer sequence). The molecular beacon oligonucleotide probe used for detection (SEQ ID NO: 31) (Zhao et al. J Clin Microbiol, 2009) contains sequences derived from E. coli with complementary 5' and 3' ends.

[0174] 4.1. Apta-SMART Detection of Synthetic Targets For the detection of the reverse complementary RNA sequence (synthetic target) (SEQ ID NO: 28) of the SARS-CoV-2 S "spike" RNA (SEQ ID NO: 32), the inventors used the first probe of SARS-CoV-2 (SEQ ID NO: 26) and the second probe of SARS-CoV-2 containing the mango aptamer (SEQ ID NO: 27) to perform the apta-SMART reaction as follows in detail (using mango as the fluorescence-generating aptamer). Denaturation at 65°C for 5 minutes, followed by pre-incubation of the reaction mixture of the first and second probes (840 and 700 fmol respectively) and synthetic RNA at 1.75, 17.5, or 175 nM in 1× transcription buffer (40 mM Tris-HCl pH 7.9, 6 mM MgCl2, 2 mM spermidine, and 10 mM NaCl) (from T7 RNA pol, Promega) + 1 mM spermidine (Sigma) at 41°C for 60 minutes. Then, 3 μL of dNTP / NTP and enzyme mix (containing 5 μM dNTP, 2 mM NTP, 2 U Bst DNA polymerase, and 25 U T7 RNA polymerase) was added until a final volume of 10 μL was reached and incubated for an additional 60 minutes in the same buffer. Finally, immediately after adding 1 μL of 4.8 μM TO1-biotin fluorogen (BioCat, catalog number: G955-ABM) (final concentration 480 nM) to a black-bottom 384-well plate (Nunc), fluorescence was read at 510 nm (excitation) and 535 nm (emission) wavelengths using a BioTek plate reader (Synergy H1 hybrid multimode reader).

[0175] 4.2. Apta-SMART Detection of Genomic Regions after NASBA Step 1: NASBA. The inventors designed a 5' primer (SEQ ID NO: 33) that isothermally amplifies an 189-nucleotide region (SEQ ID NO: 29) of the SARS-CoV-2 S "spike" RNA (SEQ ID NO: 32) and a 3' primer (SEQ ID NO: 34) containing a T7 promoter. The NASBA reaction consisted of a reaction containing 2 μL of previously isolated SARS-CoV-2 RNA (having a known Ct value as evaluated by qPCR) and 500 nM NASBA primers in a final volume of 15 μL in NASBA buffer (40 mM Tris-HCl, pH 8.0, 13.2 mM MgCl2, 75 mM KCl, 10 mM DTT, 1 mM dNTP, 2 mM ATP, 2 mM UTP, 2 mM CTP, 1.5 mM GTP, 0.5 mM ITP, and 15% uL DMSO - corresponding to 3 μL of the reaction mixture) during an initial denaturation step at 95°C for 2 minutes and 37°C for 2 minutes. Then, 5 μL of enzyme mix (6.8 U AMV-RT, 0.08 U RNase H, 32 U T7 RNA polymerase, and 120 μg / mL BSA in water) was added and incubated at 37°C for 90 minutes. The resulting amplified fragment (SEQ ID NO: 29) is the reverse complement (RC) region of the S "spike" RNA (SEQ ID NO: 32) that is used as a template for the Mango-SMART reaction (step 2).

[0176] Step 2a: Mango-SMART detection. For the detection of the RC RNA sequence (SEQ ID NO: 29) of the SARS-CoV-2 S "spike" RNA (SEQ ID NO: 32), the inventors performed the Mango-SMART reaction as follows in detail using the first probe of SARS-CoV-2 (SEQ ID NO: 26) and the second probe of SARS-CoV-2 containing the Mango aptamer (SEQ ID NO: 27). Denaturation at 65°C for 5 minutes, followed by pre-incubation at 41°C for 60 minutes of both the first and second probes (840 and 700 fmol respectively) in 1× transcription buffer (same as above, from T7 RNA pol, Promega) + 1 mM spermidine (Sigma), and a reaction mixture of 1 μL of NASBA reaction or synthetic RNA at 1.75, 17.5, or 175 nM. Then, 3 μL of dNTP / NTP and enzyme mix (containing 5 μM dNTP, 2 mM NTP, 2 U Bst DNA polymerase, and 25 U T7 RNA polymerase) was added until a final volume of 10 μL, and incubated for an additional 60 minutes in the same buffer. Finally, immediately after adding 1 μL of 4.8 μM TO1-biotin fluorogen (BioCat, catalog number: G955-ABM) (final concentration 480 nM) to a black-bottom 384-well plate (Nunc), fluorescence was read at 510 nm (excitation) and 535 nm (emission) wavelengths using a BioTek plate reader (Synergy H1 hybrid multimode reader).

[0177] 4.3. Molecular Beacon (MB) Detection Assay 4.3.1. MB Detection of Synthetic RNA For the detection of the RC RNA sequence (synthetic target) (SEQ ID NO: 28) of the region of the SARS-CoV-2 S "spike" RNA (SEQ ID NO: 32), using the first probe of SARS-CoV-2 (SEQ ID NO: 26) and the second probe of SARS-CoV-2 (SEQ ID NO: 30) containing a 25 nt RNA sequence identical to the internal loop of the MB oligonucleotide probe (SEQ ID NO: 31, Zhao et al. J Clin Microbiol. 2009), the inventors performed the SMART reaction as follows in detail. Denaturation at 65 °C for 5 minutes, followed by pre-incubation at 41 °C for 60 minutes of a reaction mixture of both the first and second probes (840 and 700 fmol respectively) in 1× transcription buffer (Promega) + 1 mM spermidine (Sigma), and 1 μL of NASBA reaction or synthetic RNA at 1.75, 17.5, or 175 nM. Then, 3 μL of dNTP / NTP and enzyme mix (containing 5 μM dNTP, 2 mM NTP, 2 U Bst DNA polymerase and 25 U T7 RNA polymerase) was added to a final volume of 10 μL and incubated for a further 60 minutes in the same buffer. Finally, 1 μL of the MB oligonucleotide probe containing 5'-6-FAM (reporter) and 3'-Dabcyl (quencher) (SEQ ID NO: 31, Zhao et al. J Clin Microbiol. 2009) (three different final concentrations: 300 nM, 100 nM and 10 nM) was added and incubated at room temperature for 60 minutes in the dark. The fluorescence signal from the hybridized beacon / target was read at wavelengths of 495 nm (excitation) and 520 nm (emission) using a BioTek plate reader (Synergy H1 hybrid multimode reader) in a black-bottom 384-well plate (Nunc).

[0178] 4.3.2. MB Detection of Genomic Regions after NASBA For the detection of the RC RNA sequence (result of NASBA reaction) (SEQ ID NO: 29) of the region of the SARS-CoV-2 S "spike" RNA (SEQ ID NO: 32), using the first probe (SEQ ID NO: 26) and the second probe (SEQ ID NO: 30) of SARS-CoV-2 containing a 25 nt RNA sequence identical to the internal loop of the MB oligonucleotide probe (SEQ ID NO: 31, Zhao et al. J Clin Microbiol. 2009), the inventors performed the SMART reaction as follows in detail. Denaturation at 65°C for 5 minutes, followed by pre-incubation at 41°C for 60 minutes of a reaction mixture of both the first and second probes (840 and 700 fmol respectively) in 1× transcription buffer (Promega) + 1 mM spermidine (Sigma), and 1 μL of NASBA reaction or synthetic RNA at 1.75, 17.5, or 175 nM. Then, 3 μL of dNTP / NTP and enzyme mix (containing 5 μM dNTP, 2 mM NTP, 2 U Bst DNA polymerase and 25 U T7 RNA polymerase) were added to a final volume of 10 μL and incubated for a further 60 minutes in the same buffer. Finally, 1 μL of the MB oligonucleotide probe (SEQ ID NO: 31) (three different final concentrations: 300 nM, 100 nM and 10 nM) was added and incubated at room temperature for 60 minutes in the dark. The fluorescence signal from the hybridized beacon / target was read at wavelengths of 495 nm (excitation) and 520 nm (emission) using a BioTek plate reader (Synergy H1 hybrid multimode reader) in a black-bottom 384-well plate (Nunc).

[0179] 4.4. Results of the comparison of MB vs. apta-SMART using sRNA products and NASBA products As shown in Fig. 9, the detection of mango-TO1 at sRNA concentrations of 175 and 17.5 nM was optimal, with an approximately 4-fold change in magnitude relative to the RNA-free control, despite some variation between experiments. The sRNA at 1.75 nM was also detected with lower sensitivity (the magnitude change did not reach 2-fold). However, when MB was used for detection, the sensitivity was completely lost even at higher sRNA and MB concentrations (175 nM and 300 nM, respectively). None of the conditions could detect the sRNA concentrations tested. These results demonstrate the clear advantage of mango-SMART over MB detection.

[0180] Figure 10 shows a comparison of the fluorescence detection of the NASBA products of the SARS-CoV-2 "spike" S RNA region. For sRNA, the mango-SMART method had the sensitivity to detect NASBA products from three SARS-CoV-2 RNA samples tested (Ct values in the range of 13.23 - 22.66) and showed a change of more than 1.5-fold relative to RNA-free NASBA (control). In contrast, MB could not detect any of the samples, confirming a low sensitivity range for the detection of SARS-CoV-2 RNA samples.

[0181] Example 6: Apta-SMART Detection of a Synthetic RNA Target of Escherichia coli 16S rRNA Based on previously published primers (OV2 and OV3, SEQ ID NOs. and 5, respectively) (Kao et al. Anal Letters, 2010) for the NASBA detection of the E. coli 16S rRNA region (SEQ ID NO: 6), the inventors designed a modified second probe (SEQ ID NO: 8) containing a first probe (SEQ ID NO: 7) of E. coli 16S rRNA and a mango aptamer to detect the previously reported reverse complement (RC) region (SEQ ID NO: 9) of E. coli 16S rRNA (Kao et al. Anal Letters, 2010). The essence of the inventors' assay for each bacterial species tested was the SMART reaction using sRNA of a 75-nucleotide region (SEQ ID NO: 13) containing the hybridization regions of the first probe (SEQ ID NO: 7) and the second probe (SEQ ID NO: 8) of E. coli 16S rRNA. The SMART reaction started with a denaturation step at 65°C for 5 minutes, followed by a pre-incubation step at 41°C for 60 minutes of a reaction mixture containing both the first and second probes (840 and 700 fmol, respectively) and a 17.5 nM synthetic RNA target in 1× transcription buffer (Promega) + 1 mM spermidine (Sigma) until it reached 7 μL. Then, 3 μL of dNTP / NTP and enzyme mix (containing 5 μM dNTP, 2 mM NTP, 2 U Bst DNA polymerase, and 25 U T7 RNA polymerase) was added and incubated for an additional 60 minutes in the same buffer. Finally, immediately after adding 1 μL of 4.8 μM TO1-biotin fluorogen (BioCat, catalog number: G955-ABM) (final concentration 480 nM) to a black-bottom 384-well plate (Nunc), fluorescence was read at 510 nm (excitation) and 535 nm (emission) wavelengths using a BioTek plate reader (Synergy H1 hybrid multimode reader).

[0182] As shown in Figure 11, the mango-SMART detection of E. coli 16S rRNA was optimal at 17.5 nM sRNA, showing a 6.0-fold change compared to the sRNA-free control. The sRNA control showing an average of approximately 10,500 RFU was not used as background fluorescence.

[0183] Example 7: Apta - SMART Detection of a Synthetic RNA Target of Escherichia coli 23S rRNA To detect the reverse complement (RC) of the RNA region (SEQ ID NO: 37) of Escherichia coli 23S rRNA (SEQ ID NO: 38), a first probe (SEQ ID NO: 35) of Escherichia coli 23S rRNA and a second probe (SEQ ID NO: 36) containing a mango aptamer were designed. The inventors tested the SMART reaction using an sRNA containing a 58 - nucleotide region (SEQ ID NO: 39) of the interaction of the first and second probes of Escherichia coli 23S. The SMART reaction began with a denaturation step for 5 minutes at 65°C, followed by a pre - incubation step for 60 minutes at 41°C of a reaction mixture containing both the first and second probes (420 and 350 fmol, respectively) and 17.5 nM synthetic RNA target in 1× transcription buffer (Promega) + 1 mM spermidine (Sigma) until it reached 7 μL. Then, 3 μL of dNTP / NTP and enzyme mix (containing 5 μM dNTP, 2 mM NTP, 2 U Bst DNA polymerase, and 25 U T7 RNA polymerase) was added and incubated for an additional 60 minutes in the same buffer. Finally, immediately after adding 1 μL of 4.8 μM TO1 - biotin fluorogen (BioCat, catalog number: G955 - ABM) (final concentration 480 nM) to a black - bottom 384 - well plate (Nunc), fluorescence was read at 510 nm (excitation) and 535 nm (emission) wavelengths using a BioTek plate reader (Synergy H1 hybrid multimode reader).

[0184] As shown in Figure 12, the mango - SMART detection of Escherichia coli 23S rRNA using 17.5 nM sRNA was optimal, showing an 8.7 - fold (about 98,500 RFU) increase in signal compared to a control without sRNA, and the sRNA control showed an average fluorescence of about 11,750 RFU.

[0185] Example 8: Apta - SMART detection of a synthetic RNA target for the methicillin - resistant protein subunit A gene (mecA) of Staphylococcus aureus (S. aureus). To detect the reverse complement (RC) of the RNA region (SEQ ID NO: 42) of the Staphylococcus aureus mecA gene (SEQ ID NO: 43), a first probe for mecA (SEQ ID NO: 40) and a second probe for mecA containing a mango aptamer (SEQ ID NO: 41) were designed. The inventors tested the SMART reaction using a synthetic RNA consisting only of a 98 - nucleotide region (SEQ ID NO: 44) containing a 60 - nt target - probe interaction with the first and second probes of mecA. The SMART reaction started with a denaturation step at 65°C for 5 minutes, followed by a pre - incubation step at 41°C for 60 minutes of a reaction mixture containing both the first and second probes (420 and 350 fmol respectively) and 17.5 nM synthetic RNA target in 1× transcription buffer (Promega)+1 mM spermidine (Sigma) until it reached 7 μL. Then, 3 μL of dNTP / NTP and enzyme mix (containing 5 μM dNTP, 2 mM NTP, 2 U Bst DNA polymerase and 25 U T7 RNA polymerase) was added and incubated for an additional 60 minutes in the same buffer. Finally, immediately after adding 1 μL of 4.8 μM TO1 - biotin fluorogen (BioCat, catalog number: G955 - ABM) (final concentration 480 nM) to a black - bottom 384 - well plate (Nunc), fluorescence was read at 510 nm (excitation) and 535 nm (emission) wavelengths using a BioTek plate reader (Synergy H1 hybrid multimode reader).

[0186] Figure 13 shows the mango - SMART detection of the Staphylococcus aureus mecA gene using 17.5 nM sRNA. The results showed an optimal detection change of 9.1 - fold (about 79500 RFU) for sRNA compared to a control without sRNA. The sRNA control showing an average of about 8900 RFU was not used as background fluorescence.

[0187] Example 9: Apta - SMART Detection of a Synthetic RNA Target in the SARS-CoV-2 S "Spike" RNA Region The first probe (SEQ ID NO: 26) and the second probe (SEQ ID NO: 27) of SARS-CoV-2 containing a mango aptamer for detecting the reverse complement (RC) of an 189 nt RNA region (SEQ ID NO: 29) of SARS-CoV-2 S "spike" RNA (SEQ ID NO: 32) were designed. The inventors tested the SMART reaction using a synthetic RNA consisting only of a 30 nucleotide interaction region (SEQ ID NO: 28) together with the first and second probes of SARS-CoV-2. The SMART reaction started with a denaturation step at 65 °C for 5 minutes, followed by a pre-incubation step at 41 °C for 60 minutes of a reaction mixture containing both the first and second probes (840 and 700 fmol each) and 17.5 nM synthetic RNA target in 1× transcription buffer (Promega) + 1 mM spermidine (Sigma) until it reached 7 μL. Then, 3 μL of dNTP / NTP and enzyme mix (containing 5 μM dNTP, 2 mM NTP, 2 U Bst DNA polymerase, and 25 U T7 RNA polymerase) was added and incubated for an additional 60 minutes in the same buffer. Finally, immediately after adding 1 μL of 4.8 μM TO1-biotin fluorogen (BioCat, catalog number: G955-ABM) (final concentration 480 nM) to a black-bottom 384-well plate (Nunc), fluorescence was read at 510 nm (excitation) and 535 nm (emission) wavelengths using a BioTek plate reader (Synergy H1 hybrid multimode reader).

[0188] As seen in Figure 14, the mango - SMART detection of SARS-CoV-2 S "spike" RNA using 17.5 nM was optimal, although it showed a lower fold change (about 4.1) than previous examples. The sRNA control, which showed a slightly higher average RFU than previous examples (about 16400), was not used as background fluorescence.

[0189] Example 10: Mango-SMART Detection of Synthetic RNA Targets of Influenza A and B Viruses The inventors designed specific first probes (SEQ ID NOs: 45 and 46) and second probes containing mango aptamers (SEQ ID NOs: 47 and 48) for detecting highly specific RNA regions (SEQ ID NOs: 49 and 50) of influenza A and influenza B viruses, respectively. In the case of influenza A, this region corresponds to segment 2 of the polymerase PB1 (PB1) gene (SEQ ID NO: 51), and in the case of influenza B, this region corresponds to segment 3 of the polymerase PA (PA) gene (SEQ ID NO: 52). The inventors tested the SMART reaction using 30-nt synthetic RNAs (SEQ ID NOs: 49 and 50), corresponding to 15 nt of hybridization nucleotides per probe (first and second), for both influenza A and B. The SMART reaction started with a denaturation step at 65°C for 5 minutes, followed by a pre-incubation step at 41°C for 60 minutes of a reaction mixture containing both the first and second probes (840 and 700 fmol, respectively) and 17.5 nM synthetic RNA target in 1× transcription buffer (Promega) + 1 mM spermidine (Sigma) until it reached 7 μL. Then, 3 μL of dNTP / NTP and enzyme mix (containing 5 μM dNTP, 2 mM NTP, 2 U Bst DNA polymerase, and 25 U T7 RNA polymerase) was added and incubated for an additional 60 minutes in the same buffer. Finally, immediately after adding 1 μL of 4.8 μM TO1-biotin fluorogen (BioCat, catalog number: G955-ABM) (final concentration 480 nM) to a black-bottom 384-well plate (Nunc), fluorescence was read at 510 nm (excitation) and 535 nm (emission) wavelengths using a BioTek plate reader (Synergy H1 hybrid multimode reader).

[0190] As shown in Fig. 15, the Mango-SMART detection of the RNA regions of influenza A (corresponding to the PB1 gene) and influenza B (corresponding to the PA gene) using 17.5 nM was optimal, with an RFU exceeding 30,000 units and fold changes of approximately 5.0 and approximately 2.4 for influenza A and B, respectively. The reads of the sRNA-free control (background fluorescence) were approximately 6700 RFU for influenza A and approximately 13,200 RFU for influenza B.

[0191] Example 11: Apta-SMART Detection of Escherichia coli 16S rRNA after NASBA Amplification Step 1: NASBA The inventors used the 5' primer (SEQ ID NO: 4) and the 3' primer containing the T7 promoter (SEQ ID NO: 5), previously reported by Kao et al. (Anal Letters, 2010), which isothermally amplify a 191-nucleotide region (SEQ ID NO: 9) of Escherichia coli 16S rRNA (SEQ ID NO: 6). The NASBA reaction consisted of a mixture containing 2 μL of pre-isolated Escherichia coli RNA and 1 μM of NASBA primers in a final volume of 15 μL in NASBA buffer (40 mM Tris-HCl, pH 8.0, 13.2 mM MgCl2, 75 mM KCl, 10 mM DTT, 1 mM dNTP, 2 mM ATP, 2 mM UTP, 2 mM CTP, 1.5 mM GTP, 0.5 mM ITP, and 15% uL DMSO - corresponding to 3 μL of the reaction mixture) in an initial denaturation step at 95 °C for 2 minutes and 37 °C for 2 minutes. Then, 5 μL of the enzyme mix (6.8 U AMV-RT, 0.08 U RNase H, 32 U T7 RNA polymerase, and 120 μg / mL BSA in water) was added and incubated at 37 °C for 90 minutes. The amplified region obtained (SEQ ID NO: 9) is the reverse complement (RC) of the Escherichia coli 16S rRNA fragment used as a template for the Mango-SMART reaction (Step 2).

[0192] Step 1.1. ExoCIP Treatment (Optional) In the assays using ExoCIP (panels B and D of FIG. 16 and the scheme of FIG. 3), immediately after NASBA amplification, 0.5 μL of ExoCIP solution A and 0.5 μL of ExoCIP solution B (New England Biolabs) are added to 2.5 μL of the NASBA product and incubated at 37° C. for 4 minutes. To inactivate the enzyme, the mixture is heated at 80° C. for 1 minute and apta-SMART is performed immediately thereafter.

[0193] Step 2: Mango-SMART. Using the first probe of E. coli 16S (SEQ ID NO: 7) and the second probe containing the mango aptamer (SEQ ID NO: 8) from the previous example for the detection of the RC RNA sequence of E. coli 16S rRNA (SEQ ID NO: 6) (the product of the NASBA reaction) (SEQ ID NO: 9), the inventors performed the mango-SMART reaction as follows in detail. Denaturation at 65°C for 5 minutes, followed by pre-incubation at 41°C for 60 minutes of a reaction mixture of both the first and second probes (840 and 700 fmol respectively) in 1× transcription buffer (Promega) + 1 mM spermidine (Sigma), and 1 μL of the NASBA reaction or 1.4 μL of the ExoCIP-treated NASBA product until a volume of 7 μL was reached. Then, 3 μL of dNTP / NTP and enzyme mix (containing 5 μM dNTP, 2 mM NTP, 2 U Bst DNA polymerase and 25 U T7 RNA polymerase) were added until a final volume of 10 μL was obtained and incubated for a further 60 minutes in the same buffer (shown as “+dNTP” in FIG. 16). Further, the same reaction was performed without dNTP (shown as “-dNTP” in FIG. 16), and then only the enzyme mix (2 mM NTP, 2 U Bst DNA polymerase and 25 U T7 RNA polymerase) was added until a final volume of 10 μL was reached. Finally, immediately after adding 1 μL of 4.8 μM TO1-biotin fluorogen (BioCat, catalog number: G955-ABM) (final concentration 480 nM) to a black-bottom 384-well plate (Nunc), fluorescence was read at 510 nm (excitation) and 535 nm (emission) wavelengths using a BioTek plate reader (Synergy H1 hybrid multimode reader).

[0194] Figure 16 shows the results of Mango-SMART detection of Escherichia coli 16S rRNA under different tested conditions. As shown in panels A (RFU) and C (fold change), all cultured E. coli samples without ExoCIP treatment after NASBA amplification were detected with a fluorescence fold change of more than 2.0 times relative to the RNA-free NASBA control. The difference in the presence or absence of dNTP addition in the SMART detection step was not significant. Despite some variation between the three (-dNTP) or five (+dNTP) experiments conducted, detection was optimal even at the lowest concentration of bacteria tested (10 2 CFU / mL). Panels B (RFU) and D (fold change) show the same samples tested in the ExoCIP cleanup step after NASBA amplification, showing a slight improvement in detection, i.e., lower variability giving a tighter fold change for both samples of 10 6 (3.9 - 4.2) and 10 2 CFU / mL (about 2.2). For samples not treated with ExoCIP, the difference between minus or plus dNTP in SMART detection did not result in a difference in detection sensitivity.

[0195] Example 12: Apta-SMART Detection of Escherichia coli 23S rRNA after NASBA Amplification Step 1: NASBA. A 5' primer (SEQ ID NO: 53) and a 3' primer (SEQ ID NO: 54) containing a T7 promoter were designed to isothermally amplify a 256-nucleotide region (SEQ ID NO: 37) of Escherichia coli 23S rRNA (SEQ ID NO: 38). The NASBA reaction consisted of a mixture containing 2 μL of pre-isolated Escherichia coli RNA and 1 μM of NASBA primers in a final volume of 15 μL in NASBA buffer (40 mM Tris-HCl, pH 8.0, 13.2 mM MgCl2, 75 mM KCl, 10 mM DTT, 1 mM dNTP, 2 mM ATP, 2 mM UTP, 2 mM CTP, 1.5 mM GTP, 0.5 mM ITP, and 15% uL DMSO - corresponding to 3 μL of the reaction mixture) in an initial denaturation step at 95°C for 2 minutes and 37°C for 2 minutes. Then, 5 μL of enzyme mix (6.8 U AMV-RT, 0.08 U RNase H, 32 U T7 RNA polymerase, and 120 μg / mL BSA in water) was added and incubated at 37°C for 90 minutes. The resulting amplified RNA region (SEQ ID NO: 37) is the reverse complement (RC) of the Escherichia coli 23S rRNA fragment used as a template in the Mango-SMART reaction (Step 2).

[0196] Step 2: Mango-SMART. Using the first probe (SEQ ID NO: 35) of Escherichia coli 23S rRNA and the second probe (SEQ ID NO: 36) containing the mango aptamer from the previous example for the detection of Escherichia coli 23S rRNA (the RC RNA sequence of SEQ ID NO: 38 (product of NASBA reaction) (SEQ ID NO: 37)), the inventors conducted the mango-SMART reaction as follows in detail. Denaturation at 65°C for 5 minutes, followed by pre-incubation at 41°C for 60 minutes in 1× transcription buffer (Promega) + 1 mM spermidine (Sigma) with both the first and second probes (840 and 700 fmol, respectively) and 1 μL of the reaction mixture of the NASBA reaction until the volume reached 7 μL. Then, 3 μL of dNTP / NTP and enzyme mix (containing 5 μM dNTP, 2 mM NTP, 2 U Bst DNA polymerase, and 25 U T7 RNA polymerase) were added until a final volume of 10 μL was obtained, and the mixture was incubated for an additional 60 minutes in the same buffer. Finally, immediately after adding 1 μL of 4.8 μM TO1-biotin fluorogen (BioCat, catalog number: G955-ABM) (final concentration 480 nM) to a black-bottom 384-well plate (Nunc), fluorescence was read at 510 nm (excitation) and 535 nm (emission) wavelengths using a BioTek plate reader (Synergy H1 hybrid multimode reader).

[0197] As seen in Figure 17, the detection of the Escherichia coli 23S rRNA region in Escherichia coli at 10 4 and 10 6 CFU / mL was optimal for both cultured samples, showing fold changes of 3.60 (31150 RFU) and 6.70 (64360 RFU), respectively, relative to the RNA-free NASBA control. The data were normalized relative to the RNA-free NASBA control with an average RFU of 9825.

[0198] Example 13: NASBA and apta-SMART detection of methicillin-resistant Staphylococcus aureus (mecA). Step 1: NASBA. The inventors designed a 5' primer (SEQ ID NO: 55) that isothermally amplifies a 98-nucleotide region (SEQ ID NO: 42) of the mecA gene of Staphylococcus aureus (SEQ ID NO: 43) and a 3' primer (SEQ ID NO: 56) containing the T7 promoter. The NASBA reaction consisted of a mixture containing 2 μL of pre-isolated mecA Staphylococcus aureus RNA and 1 μM of NASBA primers in a final volume of 15 μL in NASBA buffer (40 mM Tris-HCl, pH 8.0, 13.2 mM MgCl2, 75 mM KCl, 10 mM DTT, 1 mM dNTP, 2 mM ATP, 2 mM UTP, 2 mM CTP, 1.5 mM GTP, 0.5 mM ITP, and 15% uL DMSO - corresponding to 3 μL of the reaction mixture) during an initial denaturation step at 95°C for 2 minutes and 37°C for 2 minutes. Then, 5 μL of an enzyme mix (6.8 U AMV-RT, 0.08 U RNase H, 32 U T7 RNA polymerase, and 120 μg / mL BSA in water) was added and incubated at 37°C for 90 minutes. The resulting amplified RNA region (SEQ ID NO: 42) is the reverse complement (RC) of the mecA Staphylococcus aureus RNA fragment used as a template in the Mango-SMART reaction (step 2).

[0199] Step 2: Mango-SMART. Using the first probe of mecA (SEQ ID NO: 40) containing the mango aptamer (SEQ ID NO: 41) and the second probe of mecA for the detection of the reverse complement (RC) of the RNA region (SEQ ID NO: 42) of mecA - positive Staphylococcus aureus (SEQ ID NO: 43), the inventors performed the mango - SMART reaction as follows in detail. Denaturation at 65°C for 5 minutes, followed by pre - incubation of both the first and second probes (420 and 350 fmol respectively) in 1× transcription buffer (Promega) + 1 mM spermidine (Sigma) and 1 μL of NASBA reaction (instead of synthetic RNA) at 41°C for 60 minutes. Then, 3 μL of dNTP / NTP and enzyme mix (containing 5 μM dNTP, 2 mM NTP, 2 U Bst DNA polymerase and 25 U T7 RNA polymerase) was added until a final volume of 10 μL, and incubated for an additional 60 minutes in the same buffer. Finally, immediately after adding 1 μL of 4.8 μM TO1 - biotin fluorogen (BioCat, catalog number: G955 - ABM) to a black - bottom 384 - well plate (Nunc) (final concentration 480 nM), fluorescence was read at 510 nm (excitation) and 535 nm (emission) wavelengths using a BioTek plate reader (Synergy H1 hybrid multimode reader).

[0200] Figure 18 shows the optimal mango - SMART detection of the region of the mecA gene in a culture of Staphylococcus aureus at 10 6 CFU / mL. The fold - change of the NASBA - amplified sample relative to the NASBA control without RNA was 5.17 (64930 RFU versus 13087 RFU) after 6 replicates and independent experiments.

[0201] Example 14: NASBA and apta - SMART Detection of SARS - CoV - 2 S "Spike" RNA Step 1: NASBA. The inventors designed a 5' primer (SEQ ID NO: 33) that isothermally amplifies an 189-nucleotide region (SEQ ID NO: 29) of the SARS-CoV-2 S "spike" RNA (SEQ ID NO: 32) and a 3' primer (SEQ ID NO: 34) containing a T7 promoter. The NASBA reaction consisted of a reaction containing 2 μL of previously isolated SARS-CoV-2 RNA (having a known Ct value as evaluated by qPCR) and 500 nM NASBA primers in a final volume of 15 μL in NASBA buffer (40 mM Tris-HCl, pH 8.0, 13.2 mM MgCl2, 75 mM KCl, 10 mM DTT, 1 mM dNTP, 2 mM ATP, 2 mM UTP, 2 mM CTP, 1.5 mM GTP, 0.5 mM ITP, and 15% uL DMSO - corresponding to 3 μL of the reaction mixture) during an initial denaturation step at 95°C for 2 minutes and 37°C for 2 minutes. Then, 5 μL of enzyme mix (6.8 U AMV-RT, 0.08 U RNase H, 32 U T7 RNA polymerase, and 120 μg / mL BSA in water) was added and incubated at 37°C for 90 minutes. The resulting amplified region (SEQ ID NO: 29) is the reverse complement (RC) of the S "spike" RNA fragment used as a template in the Mango-SMART reaction (step 2).

[0202] Step 2: Mango-SMART. For the detection of the RC RNA sequence of SARS-CoV-2 S "spike" RNA (SEQ ID NO: 32) (result of NASBA reaction) (SEQ ID NO: 29), the inventors used the first probe of SARS-CoV-2 from the previous example (SEQ ID NO: 26) and the second probe of SARS-CoV-2 containing the mango aptamer (SEQ ID NO: 27) and performed the mango-SMART reaction as follows in detail. Denaturation at 65°C for 5 minutes, followed by pre-incubation of both the first and second probes (840 and 700 fmol respectively) in 1× transcription buffer (Promega) + 1 mM spermidine (Sigma) and 1 μL of NASBA reaction (instead of synthetic RNA) at 41°C for 60 minutes. Then, 3 μL of dNTP / NTP and enzyme mix (containing 5 μM dNTP, 2 mM NTP, 2 U Bst DNA polymerase and 25 U T7 RNA polymerase) was added until a final volume of 10 μL and incubated for an additional 60 minutes in the same buffer. Finally, immediately after adding 1 μL of 4.8 μM TO1-biotin fluorogen (BioCat, catalog number: G955-ABM) to a black-bottom 384-well plate (Nunc) (final concentration 480 nM), fluorescence was read at 510 nm (excitation) and 535 nm (emission) wavelengths using a BioTek plate reader (Synergy H1 hybrid multimode reader).

[0203] As shown in Figure 19, for the three samples tested, the mango-SMART detection of SARS-CoV-2 S "spike" RNA was optimal, and for NASBA samples #3 and #7, the fold change values were higher (3.44 and 3.26 compared to 2.04 for sample #1, the average of 6 independent experiments). The mango-TO1 RFU background for RNA-free samples or NASBA samples without RNA was 15375 - 18000 RFU in this example.

[0204] Example 15: Broccoli-SMART detection of a synthetic RNA target of Escherichia coli 16S rRNA. Based on the first probe for Escherichia coli 16S rRNA (SEQ ID NO: 7) and the second probe containing the mango aptamer (SEQ ID NO: 8) used in Examples 2 and 6, the inventors designed a modified second probe to detect the same reverse complement (RC) region of Escherichia coli 16S rRNA (Kao et al. Anal Letters, 2010), but used the broccoli RNA aptamer (SEQ ID NO: 57, Filonov et al. JACS, 2014) instead of mango III (A10U) (SEQ ID NO: 3, Trachman et al. Nat Chem Biol, 2019).

[0205] The essence of the inventors' test was a SMART reaction using synthetic RNA of a 75-nucleotide region (SEQ ID NO: 13) of the interaction between the first probe for Escherichia coli 16S rRNA (SEQ ID NO: 7) and the broccoli-second probe (SEQ ID NO: 58). The SMART reaction began with a denaturation step at 65°C for 5 minutes, followed by a pre-incubation step at 41°C for 60 minutes of a reaction mixture containing both the first and second probes (840 and 700 fmol each) and the synthetic RNA target (final concentration 17.5 nM) in 1× transcription buffer (Promega) + 1 mM spermidine (Sigma) until it reached 7 μL. Then, 3 μL of dNTP / NTP and enzyme mix (containing 5 μM dNTP, 2 mM NTP, 2 U Bst DNA polymerase, and 25 U T7 RNA polymerase) was added and incubated for another 60 minutes in the same buffer. Finally, immediately after adding 1 μL of 10 μM DFHBI or DFHBI-1T fluorogen (MedChemExpress, #HY-110250 and #HY-110251 respectively) to a black-bottom 384-well plate (Nunc) (final concentration 1 μM), fluorescence was read at 472 nm (excitation) and 507 nm (emission) wavelengths using a BioTek plate reader (Synergy H1 hybrid multimode reader).

[0206] Figure 20 shows a comparison of the detection of a mango aptamer versus a broccoli aptamer of a 75 nt fragment of E. coli 16S rRNA synthetic RNA using the TO1-biotin ("TO1" in the graph) fluorogen for mango and both DFHBI and DFHBI-1T fluorogen substrates for broccoli. The results show a clear advantage of mango-TO1 over broccoli (either with added DFHBI or DFHBI-1T) for the detection of this E. coli RNA fragment, while mango-TO1 shows a ~3.0-fold change in sRNA for the case without RNA, which neither broccoli-DFHBI nor broccoli-DFHBI-1T reached even 2.2-fold.

[0207] Example 16: SMART-broccoli detection of a synthetic RNA target of SARS-CoV-2 S "spike" RNA. Based on the first probe of SARS-CoV-2 (SEQ ID NO: 26) and the second probe containing the mango aptamer (SEQ ID NO: 27), the inventors designed a modified second probe (SEQ ID NO: 59) to detect the same reverse complement (RC) of the region (SEQ ID NO: 29) of SARS-CoV-2 S "spike" RNA (SEQ ID NO: 32) using the broccoli RNA aptamer (SEQ ID NO: 57) instead of mango-III(A10U) (SEQ ID NO: 3).

[0208] The inventors tested the SMART reaction using synthetic RNA consisting only of the 30-nucleotide interaction region (SEQ ID NO: 28) with the first probe of SARS-CoV-2 (SEQ ID NO: 26) and the broccoli - second probe (SEQ ID NO: 59). The SMART reaction started with a denaturation step at 65°C for 5 minutes, followed by a pre-incubation step at 41°C for 60 minutes of a reaction mixture containing both the first and second probes (840 and 700 fmol, respectively) and the synthetic RNA target (final concentration 17.5 nM) in 1× transcription buffer (Promega) + 1 mM spermidine (Sigma) until it reached 7 μL. Then, 3 μL of dNTP / NTP and enzyme mix (containing 5 μM dNTP, 2 mM NTP, 2 U Bst DNA polymerase, and 25 U T7 RNA polymerase) was added and incubated for an additional 60 minutes in the same buffer. Finally, immediately after adding 1 μL of 10 μM DFHBI or DFHBI-1T fluorogen (MedChemExpress, #HY-110250 and #HY-110251, respectively) to a black-bottom 384-well plate (Nunc) (final concentration 1 μM), fluorescence was read at 472 nm (excitation) and 507 nm (emission) wavelengths using a BioTek plate reader (Synergy H1 hybrid multimode reader).

[0209] As shown in Fig. 21, for mango, TO1-biotin was used, and for broccoli, DFHBI and DFHBI-1T were used. As shown in Example 14, a comparison of mango aptamer vs. broccoli aptamer detection was also performed for a 30-nucleotide synthetic RNA fragment of the SARS-CoV-2 S "spike" RNA. The results also show a clear advantage of mango-TO1 over broccoli (using either DFHBI or DFHBI-1T) for the detection of SARS-CoV-2 RNA in this case. Mango-TO1 shows a ~5.0-fold change in sRNA for the case without RNA, while broccoli-DFHBI and broccoli-DFHBI-1T only reach 2.5-fold and 3.3-fold, respectively. That said, these are optimal fold changes (above 2.0), supporting that broccoli and its fluorogenic substrate are alternative aptamers that should be used in place of mango, if needed, for apta-SMART detection.

[0210] Example 17: One-Pot NASBA-Apta-SMART Detection of Escherichia coli 23S rRNA As a strategy to improve the efficiency of the method described in this patent, a one-pot NASBA-Apta-SMART reaction was developed. This strategy enables the detection of Escherichia coli 23S rRNA by a sequential NASBA reaction and Apta-SMART reaction that combines the reagents and enzymes of both steps in just one tube.

[0211] In the initial step, the inventors use the 5' primer (SEQ ID NO: 53) from Example 12 and the 3' primer (SEQ ID NO: 54) containing the T7 promoter prior to isothermally amplifying the 256 nucleotide region (SEQ ID NO: 37) of Escherichia coli 23S rRNA (SEQ ID NO: 38). The resulting NASBA amplicon (RC RNA sequence, SEQ ID NO: 37) of Escherichia coli 23S rRNA (SEQ ID NO: 38) is detected in the second step by using the first probe (SEQ ID NO: 35) of Escherichia coli 23S rRNA from the previous example and a modified second probe containing the Sp6 RNA polymerase promoter reverse complementary sequence (SEQ ID NO: 75, instead of the T7 promoter sequence) and the mango aptamer (SEQ ID NO: 76). The inventors use a synthetic RNA containing a 58 nucleotide region (SEQ ID NO: 39) that interacts with the first and second probes as a positive control for the SMART reaction.

[0212] The inventors performed the NASBA-Apta-SMART reaction as follows in detail. A mixture containing 2 μL of pre-isolated Escherichia coli RNA (25 nM synthetic RNA target as a positive control) and 0.5 μM NASBA primer in a final volume of 15 μL in NASBA buffer (40 mM Tris-HCl, pH 8.0, 13.2 mM MgCl2, 75 mM KCl, 10 mM DTT, 1 mM dNTP, 2 mM ATP, 2 mM UTP, 2 mM CTP, 1.5 mM GTP, 0.5 mM ITP and corresponding to 10% uL DMSO - 2 μL of the reaction mixture) was incubated in an initial denaturation step at 65 °C for 5 minutes and at 37 °C for 2 minutes. Then, 1.5 μL of NASBA enzyme mix (6.8 U AMV-RT, 0.08 U RNase H, 32 U T7 RNA polymerase and 120 μg / mL BSA in water) was added and incubated at 37 °C for 30 minutes. Thereafter, 3.5 μL of Apta-SMART probe and enzyme mix (containing 420 nM of the first probe, 350 nM of the second probe, 1 mM spermidine, 2 U of Bst DNA polymerase and 25 U of Sp6 RNA polymerase) was added to obtain a final volume of 20 μL and incubated for an additional 30 minutes, 60 minutes and 90 minutes in the same buffer. Finally, immediately after adding 1 μL of 4.8 μM TO1-biotin fluorogen (BioCat, catalog number: G955-ABM) to 10 μL of the NASBA-Apta-SMART sample in a black-bottom 384-well plate (Nunc), fluorescence was read at 510 nm (excitation) and 535 nm (emission) wavelengths using a BioTek plate reader (Synergy H1 hybrid multimode reader).

[0213] As seen in Figure 23, the detection of the Escherichia coli 23S rRNA region of Escherichia coli at 10 6 CFU / mL was optimal for both replicate samples cultured and showed the highest fold changes (3.05 - 19207 RFU - and 2.75 - 17319 RFU -) relative to the RNA-free control 1.5 hours after the start of the reaction. The data was normalized relative to the RNA-free control with an average RFU of 6291.

[0214] Example 18: One-Pot NASBA-Apta-SMART Detection of SARS-CoV-2 S "Spike" RNA The same one-pot strategy used in the previous example was optimized for the detection of SARS-CoV-2 S "spike" RNA. In the first step, the inventors used the 5' primer (SEQ ID NO: 33) from Example 14 and the 3' primer (SEQ ID NO: 34) containing the T7 promoter to isothermally amplify the 189-nucleotide region (SEQ ID NO: 29) of the S "spike" RNA of SARS-CoV-2 (SEQ ID NO: 32). The resulting NASBA amplicon (RC RNA sequence, SEQ ID NO: 29) of SARS-CoV-2 S "spike" RNA (SEQ ID NO: 32) was detected in the second step by using the first probe of SARS-CoV-2 (SEQ ID NO: 26) from the previous example and a modified second probe containing the Sp6 RNA polymerase promoter reverse complementary sequence (SEQ ID NO: 75, instead of the T7 promoter sequence) and the mango aptamer (SEQ ID NO: 78). The inventors used synthetic RNA containing a 30-nucleotide region (SEQ ID NO: 28) that interacts with the first and second probes as a positive control for the SMART reaction.

[0215] The inventors performed the NASBA-Apta-SMART reaction as follows in detail. A mixture containing 2 μL of pre-isolated SARS-CoV-2 RNA (25 nM synthetic RNA target as a positive control) and 0.5 μM NASBA primer in a final volume of 15 μL in NASBA buffer (40 mM Tris-HCl, pH 8.0, 13.2 mM MgCl2, 75 mM KCl, 10 mM DTT, 1 mM dNTP, 2 mM ATP, 2 mM UTP, 2 mM CTP, 1.5 mM GTP, 0.5 mM ITP and corresponding to 10% uL DMSO - 2 μL of the reaction mixture) was incubated in an initial denaturation step at 65 °C for 5 minutes and 37 °C for 2 minutes. Then, 1.5 μL of NASBA enzyme mix (6.8 U AMV-RT, 0.08 U RNAse H, 32 U T7 RNA polymerase and 120 μg / mL BSA in water) was added and incubated at 37 °C for 30 minutes. Thereafter, 3.5 μL of Apta-SMART probe and enzyme mix (containing 420 nM of the first probe, 350 nM of the second probe, 1 mM spermidine, 2 U of Bst DNA polymerase and 25 U of Sp6 RNA polymerase) was added to obtain a final volume of 20 μL and incubated for an additional 30 minutes, 60 minutes and 90 minutes in the same buffer. Finally, immediately after adding 1 μL of 4.8 μM TO1-biotin fluorogen (BioCat, catalog number: G955-ABM) to 10 μL of the NASBA-Apta-SMART sample in a black-bottom 384-well plate (Nunc), fluorescence was read at 510 nm (excitation) and 535 nm (emission) wavelengths using a BioTek plate reader (Synergy H1 hybrid multimode reader).

[0216] As seen in Figure 24, the detection of SARS-CoV-2 S "spike" RNA was optimal in the two RNA samples tested and showed the highest fold change (4.02 - 27661 RFU - for RNA#1 and 3.99 - 27470 RFU - for RNA#2) relative to the RNA-free control 1 hour after the start of the reaction. Data were normalized to the RNA-free control with an average RFU of 6889.

[0217] Example 19: One-Pot NASBA-Apta-SMART Detection of Escherichia coli 23S rRNA with Exchanged RNA Polymerase To confirm that any DNA-dependent RNA polymerase can be used in both steps of the one-pot NASBA-Apta-SMART reaction, a test of exchanging the RNA polymerase was conducted. In this experiment, the inventors used Sp6 RNA polymerase in the NASBA reaction and T7 RNA polymerase for the Apta-SMART detection step.

[0218] In the first step, the same 256-nucleotide region (SEQ ID NO: 37) of Escherichia coli 23S rRNA (SEQ ID NO: 38) is isothermally amplified using the 5' primer (SEQ ID NO: 53) from the previous example and a modified 3' primer (SEQ ID NO: 80) containing an Sp6 promoter instead of the T7 promoter sequence. The resulting NASBA amplicon (RC RNA sequence, SEQ ID NO: 37) of Escherichia coli 23S rRNA (SEQ ID NO: 38) is detected in the second step by using the first (SEQ ID NO: 35) of Escherichia coli 23S rRNA and a second probe (SEQ ID NO: 36) containing the T7 RC promoter sequence and the mango aptamer from the previous Example 12. The inventors use synthetic RNA containing a 58-nucleotide region (SEQ ID NO: 39) that interacts with the first and second probes as a positive control for the SMART reaction.

[0219] Similar to the previous examples, the inventors performed the NASBA-Apta-SMART reaction as follows in detail. A mixture containing 2 μL of pre-isolated Escherichia coli RNA (250 nM synthetic RNA target as a positive control) and 0.5 μM NASBA primer in a final volume of 15 μL in NASBA buffer (40 mM Tris-HCl, pH 8.0, 13.2 mM MgCl2, 75 mM KCl, 10 mM DTT, 1 mM dNTP, 2 mM ATP, 2 mM UTP, 2 mM CTP, 1.5 mM GTP, 0.5 mM ITP and corresponding to 10% uL DMSO - 2 μL of the reaction mixture) was incubated in an initial denaturation step at 65 °C for 5 minutes and 37 °C for 2 minutes. Then, 1.5 μL of NASBA enzyme mix (6.8 U AMV-RT, 0.08 U RNAse H, 32 U Sp6 RNA polymerase and 120 μg / mL BSA in water) was added and incubated at 37 °C for 30 minutes. Thereafter, 3.5 μL of Apta-SMART probe and enzyme mix (containing 420 nM of the first probe, 350 nM of the second probe, 1 mM spermidine, 2 U of Bst DNA polymerase and 25 U of T7 RNA polymerase) was added to obtain a final volume of 20 μL and incubated for an additional 30 minutes, 60 minutes and 90 minutes in the same buffer. Finally, immediately after adding 1 μL of 4.8 μM TO1-biotin fluorogen (BioCat, catalog number: G955-ABM) to 10 μL of the NASBA-Apta-SMART sample in a black-bottom 384-well plate (Nunc) (final concentration 480 nM), fluorescence was read at 510 nm (excitation) and 535 nm (emission) wavelengths using a BioTek plate reader (Synergy H1 hybrid multimode reader).

[0220] As seen in Figure 25, 10 6The detection of the E. coli 23S rRNA region of E. coli at CFU / mL was also optimal for both replicated samples that were cultured and showed the highest fold change (2.46 - 25169 RFU - and 2.52 - 25804 RFU -) relative to the RNA-free control 1.5 hours after the start of the reaction. The data were normalized against the RNA-free control with an average RFU of 10221. This experiment confirmed the possibility of using any DNA-dependent RNA bacteriophage polymerase (preferably one of T3, T7 or SP6 polymerases), i.e., the possibility of using different RNA polymerases in each step, in each step of the one-pot NASBA-Apta-SMART reaction.

[0221] Example 20: One-pot NASBA-Apta-SMART detection of methicillin-resistant Staphylococcus aureus mecA The same one-pot strategy used in the previous examples was optimized for the detection of the methicillin resistance protein subunit A gene (mecA) of Staphylococcus aureus rRNA. In the first step, the inventors used the 5' primer (SEQ ID NO: 55) from Example 13 and the 3' primer (SEQ ID NO: 56) containing the T7 promoter for the isothermal amplification of the 98 nucleotide region (SEQ ID NO: 42) of the mecA gene (SEQ ID NO: 43) of Staphylococcus aureus. The resulting NASBA amplicon (RC RNA sequence, SEQ ID NO: 42) of mecA Staphylococcus aureus (SEQ ID NO: 43) was detected in the second step by using the first probe of mecA (SEQ ID NO: 40) from the previous examples and a modified second probe containing the Sp6 RNA polymerase promoter reverse complementary sequence (SEQ ID NO: 75, instead of the T7 promoter sequence) and the mango aptamer (SEQ ID NO: 81). The inventors used synthetic RNA consisting only of the first and second probes and a 98 nucleotide region (SEQ ID NO: 44) that interacts with 60 nt as a positive control for the SMART reaction.

[0222] The inventors performed the NASBA-Apta-SMART reaction as follows in detail. A mixture containing 2 μL of pre-isolated mecA Staphylococcus aureus RNA (250 nM synthetic RNA target as a positive control) and 0.5 μM NASBA primers in NASBA buffer (40 mM Tris-HCl, pH 8.0, 13.2 mM MgCl2, 75 mM KCl, 10 mM DTT, 1 mM dNTP, 2 mM ATP, 2 mM UTP, 2 mM CTP, 1.5 mM GTP, 0.5 mM ITP and corresponding to 10% uL DMSO - 2 μL of the reaction mixture) in a final volume of 15 μL was incubated in an initial denaturation step at 65 °C for 5 minutes and 37 °C for 2 minutes. Then, 1.5 μL of NASBA enzyme mix (6.8 U AMV-RT, 0.08 U RNAse H, 32 U T7 RNA polymerase and 120 μg / mL BSA in water) was added and incubated at 37 °C for 30 minutes. Thereafter, 3.5 μL of Apta-SMART probe and enzyme mix (containing 420 nM of the first probe, 350 nM of the second probe, 1 mM spermidine, 2 U of Bst DNA polymerase and 25 U of Sp6 RNA polymerase) was added to obtain a final volume of 20 μL and incubated for an additional 30 minutes, 60 minutes and 90 minutes in the same buffer. Finally, immediately after adding 1 μL of 4.8 μM TO1-biotin fluorogen (BioCat, catalog number: G955-ABM) to 10 μL of the NASBA-Apta-SMART sample in a black-bottom 384-well plate (Nunc), fluorescence was read at 510 nm (excitation) and 535 nm (emission) wavelengths using a BioTek plate reader (Synergy H1 hybrid multimode reader).

[0223] As seen in Figure 26, the detection of the region of the mecA gene in a culture of Staphylococcus aureus at 10 6 CFU / mL was optimal for both replicate samples cultured, showing the highest fold changes (10.29 - 51816 RFU - and 9.76 - 49120 RFU -) relative to the RNA-free control 1 hour after the start of the reaction. The data was normalized relative to the RNA-free control with an average RFU of 5034

[0224] Example 21: Multiplex Apta - SMART Detection of Escherichia coli 23S rRNA after NASBA Amplification This example demonstrates the possibility of detecting the Escherichia coli 23S rRNA target by implementing two Mango - Apta - SMART assays over the length of the target mentioned. For this purpose, a second pair of first and second probes that hybridize in the adjacent region (SEQ ID NO: 37) of the Escherichia coli 23S rRNA target detected in the previous example was designed. This second pair of probes (SEQ ID NO: 83 and 84) is used together with the previous first and second probes (SEQ ID NO: 35 and SEQ ID NO: 36, respectively) for the detection of the Escherichia coli 23S rRNA target (SEQ ID NO: 37). Each pair of probes forms a triple - junction structure, each of which enables the production of multiple copies of the Mango RNA aptamer that is detected by fluorescence readout after the addition of a fluorescent substrate.

[0225] Step 1: NASBA. For E. coli RNA amplification, the inventors used the 5' primer (SEQ ID NO: 53) from Example 12 and the 3' primer (SEQ ID NO: 54) containing the T7 promoter before isothermally amplifying the 256 nucleotide region (SEQ ID NO: 37) of E. coli 23S rRNA (SEQ ID NO: 38). The NASBA reaction consisted of a mixture containing 2 μL of pre-isolated E. coli RNA and 500 nM of NASBA primers in a final volume of 15 μL in NASBA buffer (40 mM Tris-HCl, pH 8.0, 13.2 mM MgCl2, 75 mM KCl, 10 mM DTT, 1 mM dNTP, 2 mM ATP, 2 mM UTP, 2 mM CTP, 1.5 mM GTP, 0.5 mM ITP and 15% uL DMSO - corresponding to 3 μL of the reaction mixture) during an initial denaturation step at 65 °C for 5 minutes and 37 °C for 2 minutes. Then, 5 μL of the enzyme mix (6.8 U AMV-RT, 0.08 U RNAse H, 32 U T7 RNA polymerase and 120 μg / mL BSA in water) was added and incubated at 37 °C for 90 minutes. The resulting amplified RNA region (SEQ ID NO: 37) is the reverse complement (RC) of the E. coli 23S rRNA fragment used as a template in the Mango-SMART reaction (Step 2).

[0226] Step 2: Mango-SMART. For the detection of region 1 (R1) (SEQ ID NO: 37) of the RC RNA sequence (product of the NASBA reaction) of Escherichia coli 23S rRNA (SEQ ID NO: 38), the first probe of Escherichia coli 23S rRNA (SEQ ID NO: 35) and the second probe containing the mango aptamer from the previous example (SEQ ID NO: 36) were used together with a newly designed first probe (SEQ ID NO: 83) and a second probe also containing a mango aptamer (SEQ ID NO: 84) that hybridizes to region 2 (R2) of the same target (SEQ ID NO: 37). The inventors performed the mango-SMART reaction as follows in detail. Denaturation at 65°C for 5 minutes, followed by pre-incubation of both pairs of the first and second probes (840 fmol of each first probe and 700 fmol of each second probe) in 1× transcription buffer (Promega) + 1 mM spermidine (Sigma) for 30 minutes at 41°C of a 1 μL reaction mixture of the NASBA reaction until the volume reached 7 μL. Then, 3 μL of dNTP / NTP and enzyme mix (containing 5 μM dNTP, 2 mM NTP, 2 U Bst DNA polymerase and 25 U T7 RNA polymerase) were added until a final volume of 10 μL was obtained and incubated for an additional 60 minutes in the same buffer. Finally, immediately after adding 1 μL of 4.8 μM TO1-biotin fluorogen (BioCat, catalog number: G955-ABM) (final concentration 480 nM) to a black-bottom 384-well plate (Nunc), fluorescence was read at 510 nm (excitation) and 535 nm (emission) wavelengths using a BioTek plate reader (Synergy H1 hybrid multimode reader). Each pair of the first and second probes was also tested separately to confirm the formation of the triple junction and the production of multiple copies of the mango RNA aptamer of both probe pairs.

[0227] As seen in Figure 27, 10 using two different probe pairs that hybridize to two different regions of the NASBA amplicon target 6The detection of the 23S rRNA region of E. coli at CFU / mL was optimal, showing a fold change of 4.71 (25126 RFU) relative to the RNA-free NASBA control. The data were normalized against the RNA-free NASBA control (5335 RFU). When each pair of probes was used separately, the detection of E. coli at 10 6 CFU / mL was also optimal, showing fold changes of 2.38 (9915 RFU) and 1.92 (10390 RFU) for regions R1 and R2, respectively, relative to the RNA-free NASBA control. The data were normalized against the RNA-free NASBA control (4158 and 5424, respectively). The intensity of the detected mango-substrate complex fluorescence signal increased when both pairs of probes were used together.

[0228] References ● Filonov et al. Broccoli: Rapid Selection of an RNA Mimic of Green Fluorescent Protein by Fluorescence-Based Selection and Directed Evolution. Journal of the American Chemical Society, 136(46), 16299 - 16308 (2014) ● Kao et al. Detection of Escherichia coli Using Nucleic Acid Sequence-Based Amplification and Oligonucleotide Probes for 16S Ribosomal RNA. Analytical Letters, 43, 1756 - 1769 (2010) ● Trachman et al. Structure and functional reselection of the Mango-III fluorogenic RNA aptamer. Nature Chemical Biology, 15, 472 - 479 (2019) ●Wharam et al. Specific detection of DNA and RNA targets using a novel isothermal nucleic acid amplification assay based on the formation of a three-way junction structure. Nucleic Acids Research, 29(11), e54(2001) ●Zhao et al. Rapid Real-Time Nucleic Acid Sequence-Based Amplification-Molecular Beacon Platform to Detect Fungal and Bacterial Bloodstream Infections. Journal of Clinical Microbiology, 47(7), 2067-2078(2009)

Claims

Claim 1 A method for detecting the presence of a target nucleic acid in a sample, comprising: a) adding a first nucleic acid probe and a second nucleic acid probe to a sample containing the target nucleic acid so as to form a triple junction structure by hybridization among the target nucleic acid molecule, the first nucleic acid probe, and the second nucleic acid probe, wherein: i) the first probe comprises a foot region located in the 5' region of the probe that is complementary to and hybridizes with a first portion of the target nucleic acid, and an arm region located in the 3' region of the probe; ii) the second probe comprises: (1) a foot region located in the 3' region of the probe that is complementary to and hybridizes with a second portion of the target nucleic acid; (2) an arm region located in the 5' region of the probe, which, in the 5' to 3' direction, comprises: the full-length reverse complementary sequence of at least one fluorescence-generating aptamer; the full-length reverse complementary sequence of a DNA-dependent RNA polymerase promoter, wherein the reverse complementary sequence of the at least one fluorescence-generating aptamer is operably linked to the DNA-dependent RNA polymerase promoter; a region consisting of only 5 to 9 nucleotides that is complementary to and hybridizes with the arm region of the first probe, and optionally, a region consisting of only 5 to 9 nucleotides that is completely or partially included in the full-length reverse complementary sequence of the DNA-dependent RNA polymerase promoter; and iii) the target nucleic acid comprises a first portion located in the 3' region of the target nucleic acid that is complementary to the foot region of the first probe and a second portion located in the 5' region of the target nucleic acid that is complementary to the foot region of the second probe, the first portion and the second portion being adjacent or substantially adjacent, and when the target nucleic acid is present in the sample, the triple junction structure is formed between the first probe, the second probe, and the target nucleic acid; and b) adding a DNA-dependent DNA polymerase that extends the arm of the first probe to the end of the arm of the second probe, to generate a double-stranded structure comprising a functional RNA polymerase promoter and at least one fluorogenic aptamer, wherein one strand of the double-stranded structure is provided by the extended arm of the first probe and the other strand of the double-stranded structure is provided by the arm of the second probe; c) adding a DNA-dependent RNA polymerase that recognizes the promoter of the double-stranded structure formed in step b) to initiate de novo synthesis of a single-stranded nucleic acid comprising at least one fluorogenic aptamer; d) adding at least one fluorophore ligand for the at least one fluorogenic aptamer, thereby directly detecting the de novo synthesized nucleic acid comprising the at least one fluorogenic aptamer, wherein detection of the nucleic acid comprising the at least one fluorogenic aptamer indicates the presence of the target nucleic acid in the sample; and optionally, further comprising an amplification step of amplifying the target nucleic acid prior to step a). **Claim 2** The double-stranded RNA promoter formed in step b) is a T7 RNA polymerase promoter, and the DNA-dependent RNA polymerase added in step c) is T7 RNA polymerase, or The double-stranded RNA promoter formed in step b) is an SP6 RNA polymerase promoter, and the DNA-dependent RNA polymerase added in step c) is SP6 RNA polymerase, or The double-stranded RNA promoter formed in step b) is a T3 RNA polymerase promoter, and the DNA-dependent RNA polymerase added in step c) is T3 RNA polymerase, according to the method of claim 1. **Claim 3** The DNA-dependent DNA polymerase added in step b) is Bacillus stearothermophilus DNA polymerase I, according to the method of any one of claims 1 or 2. **Claim 4** The foot region of the first probe and / or the second probe is at least 15 nucleotides in length, according to the method of any one of claims 1 to 3. **Claim 5** The method according to any one of claims 1 to 4, wherein the at least one fluorescence-generating aptamer is a mango aptamer or a broccoli aptamer.

6. When the at least one fluorescence-generating aptamer contained in the arm of the second probe is a mango aptamer, the at least one fluorophore ligand added in step d) is TO1 biotin fluorogen, or when the at least one fluorescence-generating aptamer contained in the arm of the second probe is a broccoli aptamer, the at least one fluorophore ligand added in step d) is DFHB I or DFHB I-1T fluorogen. The method according to claim 5.

7. Further comprising an amplification step before step a) that includes amplifying the target nucleic acid to generate a plurality of molecules identical to the target nucleic acid or its reverse complement, wherein the plurality of molecules are the target nucleic acid in subsequent steps a) to d), and after the amplification step, an optional step of decomposing residual amplification primers and dephosphorylating excess dNTPs after amplification follows. The method according to any one of claims 1 to 6.

8. The method according to claim 7, wherein the amplification step is carried out by nucleic acid sequence-based amplification (NASBA).

9. The method according to any one of claims 1 to 8, wherein the target nucleic acid is an RNA molecule preferably derived from the genome of an infectious agent, such as a bacterium or a virus.

10. The method according to any one of claims 1 to 9, which is carried out as a one-pot reaction.

11. a) Amplifying the target nucleotide, preferably using an amplification method, preferably the NASBA method, and subsequently, or overlapping with it, or simultaneously with it, preferably subsequently, adding a first nucleic acid probe and a second nucleic acid probe to the sample to form the triple junction structure of the present invention by hybridization between the target nucleic acid molecule, the first nucleic acid probe, and the second nucleic acid probe, i) The first probe includes a foot region located in the 5' region of the probe that is complementary to the first part of the target nucleic acid and hybridizes to it, and an arm region located in the 3' region of the probe, ii) The second probe is (1) a foot region located in the 3'-region of the probe, which is complementary to and hybridizes with the second part of the target nucleic acid; (2) an arm region located in the 5'-region of the probe, preferably in the 5' to 3' direction, the full-length reverse complementary sequence of at least one fluorescence-generating aptamer; the full-length reverse complementary sequence of a DNA-dependent RNA polymerase promoter, wherein the reverse complementary sequence of the at least one fluorescence-generating aptamer is operably linked to the DNA-dependent RNA polymerase promoter; a region containing 5 to 9 nucleotides, which is complementary to and hybridizes with the arm region of the first probe, and optionally, the region containing 5 to 9 nucleotides is completely or partially contained in the full-length reverse complementary sequence of the DNA-dependent RNA polymerase promoter; an arm region containing such a region and iii) the target nucleic acid includes a first part located in the 3'-region of the target nucleic acid that is complementary to the foot region of the first probe and a second part located in the 5'-region of the target nucleic acid that is complementary to the foot region of the second probe, the first part and the second part are adjacent or substantially adjacent, and when the target nucleic acid is present in the sample, the triple junction structure is formed between the first probe, the second probe, and the target nucleic acid; a step; e) adding a DNA-dependent DNA polymerase to extend the arm of the first probe to the end of the arm of the second probe, resulting in a double-stranded structure containing a functional RNA polymerase promoter and at least one fluorescence-generating aptamer, wherein one strand of the double-stranded structure is provided by the extended arm of the first probe and the other strand of the double-stranded structure is provided by the arm of the second probe; f) adding a DNA-dependent RNA polymerase that recognizes the double-stranded promoter formed in step b) to initiate de novo synthesis of a single-stranded nucleic acid containing the at least one fluorescence-generating aptamer; g) adding at least one fluorophore ligand of the at least one fluorescence-generating aptamer, thereby directly detecting and optionally quantifying the de novo synthesized nucleic acid comprising the at least one fluorescence-generating aptamer, wherein the detection and optionally quantification of the nucleic acid comprising the at least one fluorescence-generating aptamer indicates the presence of the target nucleic acid in the sample, and The method according to any one of claims 1 to 10, comprising. **Claim 12** The promoter used for the amplification carried out in step a) is different from the DNA-dependent RNA polymerase promoter contained in the arm region of the second probe, and preferably, one promoter is the T7 promoter and the other promoter is the SP6 promoter. The method according to claim 11. **Claim 13** The first probe comprises or consists only of SEQ ID NO: 1 (E. coli 23S rRNA), the second probe comprises or consists only of SEQ ID NO: 2 or 63 (E. coli 23S rRNA), and the target sequence is SEQ ID NO: 38, or over the full length of SEQ ID NO: 1, 2, 63 or 38, respectively at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical sequences, or consists only of such, or The first probe comprises or consists only of SEQ ID NO: 7, 16, 17, 18, 19, 20, 21 or 12, the second probe comprises or consists only of SEQ ID NO: 8, 23, 24, 58, 64, 65, 66 or 73, and the target sequence is SEQ ID NO: 9 or 13 (E. coli 16S rRNA), or over the full length of SEQ ID NO: 7, 16, 17, 18, 19, 20, 21, 12, 8, 23, 24, 58, 64, 65, 66, 73, 9 or 13, respectively at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical sequences, or consists only of such, or The first probe contains or consists only of SEQ ID NO: 26, the second probe contains or consists only of SEQ ID NO: 27, 59, 68, 74, 78 or 79, and the target sequence is SEQ ID NO: 28 or 29 (SARS-CoV-2), or over the full length of SEQ ID NO: 26, 27, 59, 68, 74, 78, 79, 28 or 29, respectively, contains or consists only of a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical, or The first probe contains or consists only of SEQ ID NO: 35, the second probe contains or consists only of SEQ ID NO: 36, 69, 76 or 77, and the target sequence is SEQ ID NO: 37 or 39 (E. coli 23S rRNA), or over the full length of SEQ ID NO: 35, 36, 69, 76, 77, 37 or 39, respectively, contains or consists only of a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical, or The first probe contains or consists only of SEQ ID NO: 83, the second probe contains or consists only of SEQ ID NO: 84 or 85, and the target sequence is SEQ ID NO: 37 (E. coli 23S rRNA), or over the full length of SEQ ID NO: 83, 84, 85 or 37, respectively, contains or consists only of a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical, or The first probe contains or consists only of SEQ ID NO: 40, the second probe contains or consists only of SEQ ID NO: 41, 70, 81 or 82, and the target sequence is SEQ ID NO: 42 or 44 (Staphylococcus aureus mecA), or over the full length of SEQ ID NO: 40, 41, 70, 81, 82, 42 or 44, respectively, contains or consists only of a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical, or The first probe comprises or consists only of SEQ ID NO: 45, the second probe comprises or consists only of SEQ ID NO: 47 or 71, and the target sequence comprises or consists only of SEQ ID NO: 49 (Influenza A), or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical over the entire length of SEQ ID NO: 45, 47, 71 or 49, respectively, or, The first probe comprises or consists only of SEQ ID NO: 46, the second probe comprises or consists only of SEQ ID NO: 48 or 72, and the target sequence comprises or consists only of SEQ ID NO: 50 (Influenza B), or a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical over the entire length of SEQ ID NO: 46, 48, 72 or 50, respectively. The method according to any one of claims 1 to 12.

14. A computer-implemented method for designing at least a pair of probes suitable for implementing the method according to any one of claims 1 to 13, i) a step of reading a target nucleic acid; ii) a step of obtaining or generating the sequences of at least a pair of probes, each of the probes comprising a foot region and an arm region, the foot region of the first probe is located in the 5' region of the probe and is complementary to and hybridizes with a first portion of the target nucleic acid, and the arm region of the first probe is located in the 3' region of the probe and is non-complementary to the target nucleic acid, the foot region of the second probe is located in the 3' region of the probe and is complementary to and hybridizes with a second portion of the target nucleic acid, and the arm region of the second probe is located in the 5' region of the probe and, in the 5' to 3' direction, the full-length reverse complementary sequence of at least one fluorescence-generating aptamer, the full-length reverse complementary sequence of a DNA-dependent RNA polymerase promoter, wherein the reverse complementary sequence of the at least one fluorescence-generating aptamer is operably linked to the DNA-dependent RNA polymerase promoter. A region consisting of only 5 to 9 nucleotides that is complementary to and hybridizes to the arm region of the first probe, and optionally, the region consisting of only the 5 to 9 nucleotides is completely or partially included in the full-length reverse complementary sequence of the DNA-dependent RNA polymerase promoter. The step that the first probe and the second probe can form a triple junction structure by hybridization with the target nucleic acid molecule. iii) Optionally, providing the sequence obtained or generated in step ii) as an output. A computer-implemented method comprising the above steps.

15. Step ii) is a) Obtaining the foot region of the first probe by selecting a first portion of the nucleotides contained in the target nucleic acid and providing its complementary sequence. b) Obtaining the foot region of the second probe by selecting a second portion of the nucleotides contained in the target nucleic acid and providing its complementary sequence, wherein the first portion and the second portion are preferably separated by 0 to 6 nucleotides. c) Obtaining the arm region of the second probe by selecting a nucleotide sequence comprising the full-length sequence of the DNA-dependent RNA polymerase promoter and the full-length reverse complementary sequence of at least one fluorescence-generating aptamer, wherein the reverse complementary sequence of at least one fluorescence-generating aptamer is operably linked to the DNA-dependent RNA polymerase promoter. d) Obtaining the arm region of the first probe by selecting 5 to 9 nucleotides that are complementary to a region located in the 3' region of the arm region of the second probe obtained in step c). e) Optionally, synthesizing the designed first probe and the second probe. The computer-implemented method according to claim 14, comprising the above steps.

16. A system for detecting the presence of a target nucleic acid in a sample containing a first probe and a second probe, wherein the first probe comprises a foot region located in the 5' region of the probe that is complementary to and hybridizes to a first portion of the target nucleic acid, and an arm region located in the 3' region of the probe, and the second probe a foot region located in the 3′ region of the probe, which is complementary to and hybridizes with a second portion of the target nucleic acid; in the 5′ to 3′ direction; i. the full-length reverse complementary sequence of at least one fluorescence-generating aptamer; ii. the full-length reverse complementary sequence of a DNA-dependent RNA polymerase promoter, wherein the reverse complementary sequence of the at least one fluorescence-generating aptamer is operably linked to the RNA polymerase promoter; iii. a region containing 5 to 9 nucleotides, which is complementary to and hybridizes with an arm region of the first probe and may be a region contained in the full-length reverse complementary sequence of the DNA-dependent RNA polymerase promoter, and an arm region containing the region; A system comprising the same. **Claim 17** The first probe comprises or consists only of SEQ ID NO: 1 (E. coli 23S rRNA), the second probe comprises or consists only of SEQ ID NO: 2 or 63 (E. coli 23S rRNA), and the target sequence comprises or consists only of a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical over the entire length of SEQ ID NO: 38, or SEQ ID NO: 1, 2, 63 or 38, or The first probe comprises or consists only of SEQ ID NO: 7, 16, 17, 18, 19, 20, 21 or 12, the second probe comprises or consists only of SEQ ID NO: 8, 23, 24, 58, 64, 65, 66 or 73, and the target sequence comprises or consists only of a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical over the entire length of SEQ ID NO: 9 or 13 (E. coli 16S rRNA), or SEQ ID NO: 7, 16, 17, 18, 19, 20, 21, 12, 8, 23, 24, 58, 64, 65, 66, 73, 9 or 13, or The first probe contains or consists only of SEQ ID NO: 26, the second probe contains or consists only of SEQ ID NO: 27, 59, 68, 74, 78 or 79, and the target sequence is SEQ ID NO: 28 or 29 (SARS-CoV-2), or over the entire length of SEQ ID NO: 26, 27, 59, 68, 74, 78, 79, 28 or 29, respectively, contains or consists of a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical, or The first probe contains or consists only of SEQ ID NO: 35, the second probe contains or consists only of SEQ ID NO: 36, 69, 76 or 77, and the target sequence is SEQ ID NO: 37 or 39 (E. coli 23S rRNA), or over the entire length of SEQ ID NO: 35, 36, 69, 76, 77, 37 or 39, respectively, contains or consists of a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical, or The first probe contains or consists only of SEQ ID NO: 83, the second probe contains or consists only of SEQ ID NO: 84 or 85, and the target sequence is SEQ ID NO: 37 (E. coli 23S rRNA), or over the entire length of SEQ ID NO: 83, 84, 85 or 37, respectively, contains or consists of a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical, or The first probe contains or consists only of SEQ ID NO: 40, the second probe contains or consists only of SEQ ID NO: 41, 70, 81 or 82, and the target sequence is SEQ ID NO: 42 or 44 (Staphylococcus aureus mecA), or over the entire length of SEQ ID NO: 40, 41, 70, 81, 82, 42 or 44, respectively, contains or consists of a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical, or The first probe comprises or consists only of SEQ ID NO: 45, the second probe comprises or consists only of SEQ ID NO: 47 or 71, and the target sequence is SEQ ID NO: 49 (Influenza A), or comprises or consists only of a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical over the entire length of SEQ ID NO: 45, 47, 71 or 49, or, The first probe comprises or consists only of SEQ ID NO: 46, the second probe comprises or consists only of SEQ ID NO: 48 or 72, and the target sequence is SEQ ID NO: 50 (Influenza B), or comprises or consists only of a sequence that is at least 75%, 80%, 85%, 89%, 90%, 91%, 92%, 95%, 97%, 98%, 99% or 100% identical over the entire length of SEQ ID NO: 46, 48, 72 or 50. The system according to claim 16.

18. A kit of parts for detecting the presence of a target nucleic acid in a sample, comprising the first and second probes according to any one of claims 16 or 17, and the following elements, namely, a) at least one DNA-dependent DNA polymerase, preferably Bst polymerase, and b) at least one DNA-dependent RNA polymerase, preferably T7 RNA polymerase or SP6 RNA polymerase, and c) at least an appropriate fluorophore ligand of at least one fluorescence-generating aptamer, and d) spermidine, and e) nucleoside triphosphates including deoxynucleoside triphosphates and / or ribonucleoside triphosphates, and f) a buffer suitable for carrying out the method according to any one of claims 1 to 12, and g) optionally, reverse transcriptase, RNase, at least one exonuclease and phosphatase further comprising, A kit of parts, wherein the elements a) to g) are contained in different containers or grouped in one or more containers.

Images