Gene editing of targeted genes to enhance natural killer cell function

Abstract

Some embodiments of the methods and compositions disclosed herein relate to immune cells that have been gene-edited, e.g., using Crispr / Cas, to modulate, reduce, or otherwise eliminate expression of one or more endogenous genes. In some embodiments, the edited cells are engineered to express a chimeric antigen receptor that targets a tumor antigen, such as CD19, a ligand for the NKG2D receptor, CD70, and / or BCMA. In some embodiments, the editing enhances one or more aspects of the effectiveness of the immune cells in cellular immunotherapy, including cytotoxicity (e.g., ADCC) and / or persistence.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 63 / 370357, filed August 3, 2022, U.S. Provisional Patent Application No. 63 / 489965, filed March 13, 2023, and U.S. Provisional Patent Application No. 63 / 498166, filed April 25, 2023, the entire contents of each of which are incorporated herein by reference.

[0002] Field Some embodiments disclosed herein relate to methods and compositions comprising genetically engineered and edited immune cells for cancer immunotherapy. In some embodiments, the present disclosure relates to cells engineered to express a chimeric antigen receptor (CAR). In some embodiments, the CAR-expressing cells are also genetically edited to enhance their expansion, cytotoxicity against target cells, persistence (e.g., lifespan) after administration, and / or to reduce potential side effects when the cells are used in cancer immunotherapy. [Background technology]

[0003] As more is learned about various cancers and what characteristics cancerous cells possess that can be used to specifically distinguish them from healthy cells, therapeutics are underway that exploit notable features of cancerous cells. Immunotherapy using engineered and / or edited immune cells is one approach to treating cancer.

[0004] INCORPORATION-BY-REFERENCE OF MATERIAL IN THE SEQUENCE LISTING This application incorporates by reference the material contained in the Sequence Listing XML file submitted herewith: Filename: NKT089WO_ST26.xml; created on August 2, 2023, size 1,364,361 bytes. Summary of the Invention

[0005] Immunotherapy represents a new technological advance in disease treatment, where immune cells are engineered to express specific targeting and / or effector molecules that specifically identify and react with diseased or damaged cells. This represents a promising advancement, at least in part due to its potential to specifically target diseased or damaged cells, in contrast to more traditional approaches such as chemotherapy, in which all cells are affected, with the desired outcome being the survival of sufficient healthy cells to allow the patient to survive. One immunotherapy approach is the recombinant expression of cytotoxic receptors (e.g., chimeric receptors) in immune cells to achieve targeted recognition and destruction of the desired abnormal cells.

[0006] In some embodiments, provided herein is a population of genetically engineered and gene-edited immune cells, comprising genetically engineered immune cells that express a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand-binding domain targets an antigen expressed by cells of a target tumor or cancer, and the immune cells are gene-edited within a target sequence in the MED12 gene and a target sequence in the CISH gene; and wherein the editing results in reduced expression and / or function of the MED12 protein encoded by the MED12 gene and the CIS protein encoded by the CISH gene, respectively, compared to immune cells that have not been edited within the target sequence in the MED12 gene and the target sequence in the CISH gene.

[0007] In some embodiments, the target sequence within the MED12 gene comprises any one of SEQ ID NOs: 997, 938-944, 996, or 998. In some embodiments, the target sequence within the MED12 gene comprises multiple target sites selected from SEQ ID NOs: 997, 938-944, 996, and 998.

[0008] In some embodiments, the target sequence in the CISH gene comprises any one of SEQ ID NOs: 1013, 153-157, or 463-466, or 1012. In some embodiments, the target sequence in the CISH gene comprises multiple target sites selected from SEQ ID NOs: 1013, 153-157, or 463-466 and 1012.

[0009] In some embodiments, the extracellular ligand-binding domain targets an antigen selected from BCMA, an NKG2D ligand, CD19, and CD70. In some embodiments, the extracellular ligand-binding domain targets a BCMA antigen. In some embodiments, the extracellular ligand-binding domain targets an NKG2D ligand. In some embodiments, the extracellular ligand-binding domain targets a CD19 antigen. In some embodiments, the extracellular ligand-binding domain targets a CD70 antigen.

[0010] In some embodiments, the transmembrane domain comprises CD8, CD28, or a portion thereof, and optionally the transmembrane domain comprises CD8a or a portion thereof. In some embodiments, the transmembrane domain comprises CD8 or a portion thereof. In some embodiments, the transmembrane domain comprises CD28 or a portion thereof. Depending on the embodiment, the transmembrane domain may comprise CD8a or a portion thereof in combination with CD8 or CD28.

[0011] In some embodiments, the cytotoxic signaling complex comprises a CD3 zeta domain, and / or the cytotoxic signaling complex comprises the intracellular signaling domain of OX40, 4-1BB, CD28, or a signaling portion thereof, and optionally the intracellular signaling domain of OX40, or a signaling portion thereof.

[0012] In some embodiments, at least a portion of the genetically engineered immune cells are engineered to express membrane-bound IL-15 (mbIL15). In some such embodiments, the cytotoxic receptor and mbIL15 may be encoded by the same nucleic acid molecule, and optionally, the nucleic acid sequences encoding the cytotoxic receptor and mbIL15 are separated by a nucleic acid sequence encoding a 2A peptide. In some such embodiments, the cytotoxic receptor and mbIL15 are encoded by the same nucleic acid molecule, and optionally, the nucleic acid sequences encoding the cytotoxic receptor and mbIL15 are separated by a nucleic acid sequence encoding a 2A peptide. In some such embodiments, the cytotoxic receptor and mbIL15 are encoded by the same nucleic acid molecule, and optionally, the nucleic acid sequences encoding the cytotoxic receptor and mbIL15 are separated by a nucleic acid sequence encoding a 2A peptide.

[0013] In some embodiments, the cells are further gene edited within a target sequence in the CBLB gene, wherein the target sequence in the CBLB gene comprises any one of SEQ ID NOs: 164, 165-166, or 453-456, or 1005-1008.

[0014] In some embodiments, the cells are further gene edited within a target sequence in a disintegrin and metalloproteinase domain-containing protein 17 (ADAM17) gene comprising any one of SEQ ID NOs: 682-687.

[0015] In some embodiments, the cells are further gene edited within a target sequence in the hypoxia inducible factor 1-alpha (HIF1-a) gene comprising any one of SEQ ID NOs: 750-760.

[0016] In some embodiments, the cells are further gene edited within a target sequence in the DGKz gene, wherein the target sequence comprises any one of SEQ ID NOs: 688-723.

[0017] In some embodiments, the cells are further gene edited within a target sequence in the GSK-3B gene, wherein the target sequence comprises any one of SEQ ID NOs: 724-749.

[0018] In some embodiments, the cells are further gene edited within a target sequence in the LAG3 gene, wherein the target sequence comprises any one of SEQ ID NOs: 761-789.

[0019] In some embodiments, the cells are further gene edited within a target sequence in the TIM3 gene, wherein the target sequence comprises any one of SEQ ID NOs: 790-825.

[0020] In some embodiments, the cells are further gene edited within a target sequence in the TRIM29 gene, wherein the target sequence comprises any one of SEQ ID NOs: 826-835 or 1009-1011.

[0021] In some embodiments, the cells are further gene edited within a target sequence in the IL-1R8 gene, wherein the target sequence comprises any one of SEQ ID NOs: 836-865.

[0022] In some embodiments, the cells are further gene edited within a target sequence in the CD38 gene, wherein the target sequence comprises any one of SEQ ID NOs: 866-874.

[0023] In some embodiments, the cells are further gene edited within a target sequence in the FBP-1 gene, wherein the target sequence comprises any one of SEQ ID NOs: 875-889.

[0024] In some embodiments, the cells are further gene edited within a target sequence in the INSIG1 gene, wherein the target sequence comprises any one of SEQ ID NOs: 890-934.

[0025] In some embodiments, the cells are further gene edited within a target sequence in the CDK8 gene, wherein the target sequence comprises any one of SEQ ID NOs: 949-955.

[0026] In some embodiments, the cells are further gene edited within a target sequence in the CCNC gene, wherein the target sequence comprises any one of SEQ ID NOs: 956-961 or 999-1001.

[0027] In some embodiments, the cells are further gene edited within a target sequence in the ID3 gene, wherein the target sequence comprises any one of SEQ ID NOs: 963-969.

[0028] In some embodiments, the cells are further gene edited within a target sequence in the SOX4 gene, wherein the target sequence comprises any one of SEQ ID NOs: 970-976.

[0029] In some embodiments, the editing of one or more target sequences is performed using an RNA-guided endonuclease. In some embodiments, the editing of one or more target sequences is performed using the Crispr / Cas9 system.

[0030] In some embodiments, the immune cells comprise natural killer (NK) cells, T cells, induced pluripotent stem cells (iPSCs), iPSC-derived NK cells, iPSC-derived T cells, NK-92 cells, or any combination thereof.

[0031] In some embodiments, a population of gene-edited immune cells is provided, wherein the immune cells are gene-edited within a target sequence in the MED12 gene and within a target sequence in the CISH gene, and the editing results in reduced expression and / or function of the MED12 protein encoded by the MED12 gene and the CIS protein encoded by the CISH gene, respectively, compared to immune cells that have not been edited within the target sequence in the MED12 gene and the target sequence in the CISH gene. In some embodiments, the gene-edited immune cells are genetically engineered immune cells that express a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand-binding domain targets an antigen expressed by cells of a target tumor or cancer.

[0032] In some embodiments, provided is a population of genetically engineered and gene-edited immune cells that express a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand-binding domain targets an antigen expressed by cells of a target tumor or cancer; and the immune cells are gene-edited within a target sequence in the MED12 gene, wherein the target sequence in the MED12 gene comprises any one of SEQ ID NOs: 997, 938-944, 996, or 998, and wherein the editing results in reduced expression and / or function of the MED12 protein encoded by the MED12 gene compared to immune cells that have not been edited within the target sequence in the MED12 gene.

[0033] In some embodiments, a composition comprising a population of genetically engineered and / or gene-edited immune cells disclosed herein is provided.

[0034] In some embodiments, methods are provided for treating a subject having a disease or condition, the methods comprising administering to the subject a population of genetically engineered and gene-edited immune cells disclosed herein.

[0035] In some embodiments, there is provided a use of the genetically engineered and edited population of immune cells disclosed herein for the treatment of a subject having a disease or condition, in some embodiments, the disease or condition is an infectious disease, an autoimmune disease, cancer, or a tumor.

[0036] In some embodiments, the immune cells are NK cells.

[0037] Also provided herein are populations of gene edited and engineered immune cells comprising immune cells that are (i) gene edited to express a cytotoxic receptor, and (ii) gene edited within a target sequence in a gene selected from the group consisting of ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, and SOX4.

[0038] In some embodiments, immune cells are gene edited using RNA-guided endonucleases.

[0039] In some embodiments, a population of gene-edited immune cells is provided, comprising immune cells that have been gene-edited within a target sequence in the MED12 gene. In some embodiments, the immune cells are engineered to express a cytotoxic receptor. In some embodiments, a population of gene-edited and engineered immune cells is provided, comprising immune cells that have been (i) engineered to express a cytotoxic receptor, and (ii) gene-edited within a target sequence in the MED12 gene.

[0040] In some embodiments, the cytotoxic receptor comprises an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex. In some embodiments, the extracellular ligand-binding domain binds to an antigen expressed by a target tumor or cancer cell. In some embodiments, the gene editing is within a target sequence in the MED12 gene comprising any one of SEQ ID NOs: 938-994 or 996-998. In some embodiments, the gene editing for MED12 reduces the expression and / or function of the MED12 protein encoded by the MED12 gene compared to immune cells not edited within the target sequence. In some embodiments, the gene editing for MED12 reduces the expression and function of the MED12 protein encoded by the MED12 gene compared to immune cells not edited within the target sequence. In some embodiments, the gene editing for MED12 reduces the expression and function of the MED12 protein encoded by the MED12 gene compared to immune cells not edited within the target sequence. In some embodiments, the gene editing for MED12 reduces the expression and function of the MED12 protein encoded by the MED12 gene compared to immune cells not edited within the target sequence. In some embodiments, the edits to the MED12 gene are made using an RNA-guided endonuclease. In some embodiments, the immune cell is a natural killer cell.

[0041] In some embodiments, a population of gene-edited immune cells is provided, including immune cells that have been gene-edited within a target sequence in the ADAM17 gene. In some embodiments, the immune cells are genetically engineered to express a cytotoxic receptor. In some embodiments, the cytotoxic receptor comprises an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex. In some embodiments, the extracellular ligand-binding domain binds to an antigen expressed by a target tumor or cancer cell. In some embodiments, gene editing within the target sequence in the ADAM17 gene reduces the expression and / or function of the ADAM17 protein encoded by the ADAM17 gene compared to immune cells that have not been edited within the target sequence. In some embodiments, gene editing within the target sequence in the ADAM17 gene reduces the expression of the ADAM17 protein encoded by the ADAM17 gene compared to immune cells that have not been edited within the target sequence. In some embodiments, gene editing within the target sequence in the ADAM17 gene reduces the function of the ADAM17 protein encoded by the ADAM17 gene compared to immune cells that have not been edited within the target sequence. In some embodiments, gene editing within the target sequence in the ADAM17 gene reduces the expression and function of the ADAM17 protein encoded by the ADAM17 gene compared to immune cells that have not been edited within the target sequence.In some embodiments, a population of genetically engineered and gene-edited immune cells is provided, comprising genetically engineered immune cells that express a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand-binding domain targets an antigen expressed by cells of a target tumor or cancer, and the immune cells are gene-edited within a target sequence in a disintegrin and metalloproteinase domain-containing protein 17 (ADAM17) gene, wherein the editing results in reduced expression and / or function of the ADAM17 protein encoded by the ADAM17 gene compared to immune cells that have not been edited within the target sequence in the ADAM17 gene, and wherein the editing of the ADAM17 gene is performed using an RNA-guided endonuclease.

[0042] In some embodiments, a population of gene-edited immune cells is provided, including immune cells that have been gene-edited within a target sequence in the MED12 gene. In some embodiments, the immune cells are also gene-edited within a target sequence in the CISH gene. In some embodiments, a population of gene-edited immune cells is provided, including immune cells that have been (i) gene-edited within a target sequence in the MED12 gene; and (ii) gene-edited within a target sequence in the CISH gene. In some embodiments, a population of gene-edited immune cells is provided, including immune cells that have been gene-edited within a target sequence in the MED12 gene and within a target sequence in the CISH gene. In some embodiments, the immune cells are genetically engineered to express a cytotoxic receptor. In some embodiments, the cytotoxic receptor comprises an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex. In some embodiments, the extracellular ligand-binding domain binds to an antigen expressed by target tumor or cancer cells. In some embodiments, gene editing within the target sequence in the MED12 gene reduces the expression and / or function of the MED12 protein encoded by the MED12 gene compared to immune cells that have not been edited within the target sequence. In some embodiments, gene editing within the target sequence in the CISH gene reduces the expression and / or function of the CIS protein encoded by the CIS gene compared to immune cells that have not been edited within the target sequence. In some embodiments, gene editing within the target sequence in the CISH gene reduces the expression of the CIS protein encoded by the CIS gene compared to immune cells that have not been edited within the target sequence. In some embodiments, gene editing within the target sequence in the CISH gene reduces the function of the CIS protein encoded by the CIS gene compared to immune cells that have not been edited within the target sequence. In some embodiments, gene editing within the target sequence in the CISH gene reduces the expression and function of the CIS protein encoded by the CIS gene compared to immune cells that have not been edited within the target sequence.In some embodiments, a population of genetically engineered and gene-edited immune cells is provided, comprising genetically engineered immune cells that express a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand-binding domain targets an antigen expressed by cells of a target tumor or cancer, and the immune cells are gene-edited within a target sequence in the MED12 gene, wherein the editing results in reduced expression and / or function of Mediator complex subunit 12 (MED12) protein encoded by the MED12 gene compared to immune cells that have not been edited within the target sequence in the MED12 gene, and wherein the editing of the MED12 gene is made using an RNA-guided endonuclease. In some embodiments, a population of genetically engineered and gene-edited immune cells is provided, comprising genetically engineered immune cells that express a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand-binding domain targets an antigen expressed by target tumor or cancer cells, and the immune cells are gene-edited within a target sequence in the MED12 gene and a target sequence in the CISH gene, wherein the editing results in reduced expression and / or function of Mediator complex subunit 12 (MED12) protein and CIS protein compared to immune cells that have not been edited within the target sequences in the MED12 and CISH genes, and wherein the editing is performed using an RNA-guided endonuclease. In some embodiments, the immune cells are natural killer cells.

[0043] Also provided herein is a population of genetically engineered and gene-edited immune cells, comprising genetically engineered immune cells that express a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand-binding domain targets an antigen expressed by cells of a target tumor or cancer, and the immune cells are genetically edited within a target sequence in the hypoxia-inducible factor 1-alpha (HIF1-a) gene, wherein the editing results in reduced expression and / or function of the HIF1-a protein encoded by the HIF1-a gene compared to immune cells that have not been edited within the target sequence in the HIF1-a gene, and wherein the editing of the HIF1-a gene is made using an RNA-guided endonuclease.

[0044] In some such embodiments, the immune cells may be edited within the additional target sequence in the target gene to result in a reduced level of expression of the protein encoded by the target gene compared to immune cells that have not been edited within the additional target sequence.

[0045] In an additional embodiment, a population of genetically engineered and gene-edited immune cells is provided, comprising genetically engineered immune cells that express a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand-binding domain targets an antigen expressed by cells of the target tumor or cancer, and the immune cells express one of the following: ADAM17, HIF-1α, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, and any combination thereof. and wherein the target gene is gene edited within a target sequence in a target gene selected from the group consisting of: ...

[0046] In some embodiments, editing of the target gene is performed using the Crispr / Cas9 system.

[0047] In some embodiments, the extracellular ligand-binding domain targets an antigen selected from a ligand of NKG2D, CD19, CD70, and BCMA. In some embodiments, the extracellular ligand-binding domain targets a ligand of NKG2D. In some embodiments, the extracellular ligand-binding domain targets CD19. In some embodiments, the extracellular ligand-binding domain targets CD70. In some embodiments, the extracellular ligand-binding domain targets BCMA.

[0048] In some embodiments, a population of genetically engineered and gene-edited immune cells comprises genetically engineered immune cells that express a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand-binding domain targets an antigen expressed by cells of a target tumor or cancer selected from a ligand of the NKG2D receptor, CD19, CD70, and BCMA, and the immune cells are selected from the group consisting of ADAM17, HIF-1α, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8. , ID3, SOX4, and any combination thereof, wherein the editing results in reduced expression and / or function of the protein encoded by the target gene compared to immune cells that have not been edited within the target sequence in the target gene, and the immune cells are edited within additional target sequences in the target gene such that the editing results in reduced levels of expression of the protein encoded by the target gene compared to immune cells that have not been edited within the additional target sequence, wherein the editing of the target gene is performed using a Crispr / Cas system.

[0049] In some embodiments, the genetically engineered and gene-edited immune cells provided herein exhibit enhanced expansion capacity, enhanced cytotoxicity against target tumor cells, enhanced persistence, or any combination thereof, compared to immune cells that do not include the edits.

[0050] In some embodiments, methods are provided for producing a population of gene-edited immune cells, the method comprising contacting the population of immune cells with a targeting endonuclease that effects an edit within a target sequence in a target gene selected from ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, CISH, CBLB, and any combination thereof, wherein the gene-edited immune cells exhibit enhanced expansion capacity, enhanced cytotoxicity against target tumor cells, enhanced persistence, or any combination thereof, compared to immune cells that were not edited within the target sequence in the target gene.

[0051] In some embodiments, methods of producing a population of gene-edited immune cells are provided, comprising contacting the population of immune cells with an RNA-guided endonuclease that effects an edit within a target sequence in a target gene selected from ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, and any combination thereof, wherein the gene-edited immune cells exhibit enhanced expansion capacity, enhanced cytotoxicity against target tumor cells, enhanced persistence, or any combination thereof, compared to immune cells that were not edited within the target sequence in the target gene.

[0052]

[0010] In some embodiments, a method of producing a population of gene-edited immune cells is provided, comprising contacting the population of immune cells with a Cas-gRNA ribonucleoprotein complex (RNP), wherein the RNP effects editing within a target sequence in a target gene selected from ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, and any combination thereof, and wherein the Cas of the RNP comprises Cas9, CasX, CasY, or a combination thereof, and wherein the gene-edited immune cells exhibit enhanced expansion, enhanced cytotoxicity against target tumor cells, enhanced persistence, or any combination thereof, compared to immune cells that were not edited within the target sequence in the target gene.

[0053] In some embodiments, the gene is ADAM17. In some embodiments, the gene is HIF-1α. In some embodiments, the gene is DGKz. In some embodiments, the gene is GSK-3B. In some embodiments, the gene is LAG3. In some embodiments, the gene is TIM3. In some embodiments, the gene is TRIM29. In some embodiments, the gene is IL-1R8. In some embodiments, the gene is CD38. In some embodiments, the gene is FBP-1. In some embodiments, the gene is INSIG1. In some embodiments, the gene is MED12. In some embodiments, the gene is MED13. In some embodiments, the gene is CCNC. In some embodiments, the gene is CDK8. In some embodiments, the gene is ID3. In some embodiments, the gene is SOX4.

[0054] In some embodiments, a method of producing a gene-edited population of immune cells comprises: (a) contacting the population of immune cells with a first RNA-guided endonuclease, where the RNA-guided endonuclease effects an edit within a target sequence in a target gene selected from ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, and any combination thereof; and (b) contacting the population of immune cells with a second RNA-guided endonuclease. and contacting a gene-edited immune cell with a second RNA-guided endonuclease, wherein the second RNA-guided endonuclease effects an edit within the target sequence in the CISH gene such that the edited immune cell exhibits a reduced level of expression of the CIS protein encoded by the CISH gene, compared to immune cells that have not been edited within the target gene and the target sequence in the CISH gene, wherein the gene-edited immune cells exhibit enhanced expansion potential, enhanced cytotoxicity against target tumor cells, enhanced persistence, or any combination thereof, compared to immune cells that have not been edited within the target gene and the target sequence in the CISH gene.

[0055] In some embodiments, a method of making a gene-edited population of immune cells comprises: (a) contacting the population of immune cells with a first Cas-gRNA ribonucleoprotein (RNP) complex, where the RNP complex effects editing within a target sequence in a target gene selected from ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof, and the Cas of the first RNP complex comprises Cas9, CasX, CasY, or a combination thereof; and (b) contacting the population of immune cells with a second Cas-gRNA. and contacting a first RNP complex with a second RNP complex, wherein the second RNP complex effects editing within the target sequence in the CISH gene such that the level of expression of the CIS protein encoded by the CISH gene is reduced compared to immune cells that have not been edited within the target sequence in the CISH gene, and the Cas of the second RNP complex comprises Cas9, CasX, CasY, or a combination thereof, wherein the gene-edited immune cells exhibit enhanced expansion potential, enhanced cytotoxicity against target tumor cells, enhanced persistence, or any combination thereof, compared to immune cells that have not been edited within the target gene and the target sequence in the CISH gene.

[0056] In some embodiments, a method of making a gene-edited population of immune cells comprises: (a) contacting the population of immune cells with a first Cas-gRNA ribonucleoprotein (RNPP) complex, where the RNP effects editing within a target sequence in a target gene selected from ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof, and the Cas of the first RNP complex comprises Cas9, CasX, CasY, or a combination thereof; and (b) contacting the population of immune cells with a second Cas-gRNA ribonucleoprotein (RNPP) complex, where the RNP effects editing within a target sequence in a target gene selected from ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof, and the Cas of the first RNP complex comprises Cas9, CasX, CasY, or a combination thereof; a second RNP complex that effects an edit within the target sequence in the CBLB gene such that the level of expression of the CBLB protein encoded by the CBLB gene is reduced compared to immune cells that have not been edited within the location in the CBLB gene, and the Cas of the second RNP complex comprises Cas9, CasX, CasY, or a combination thereof; wherein the gene-edited immune cells exhibit enhanced expansion potential, enhanced cytotoxicity against target tumor cells, enhanced persistence, or any combination thereof, compared to immune cells that have not been edited within the target gene and the target sequence in the CBLB gene.

[0057] In some embodiments, a method of making a population of gene-edited immune cells comprises: (a) contacting the population of immune cells with a first RNA-guided endonuclease, where the first endonuclease effects an edit within a target sequence in a target gene selected from ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof; (b) contacting the population of immune cells with a second RNA-guided endonuclease, where the second RNA-guided endonuclease effects an edit within a target sequence in a target gene selected from ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof; and (c) contacting the population of immune cells with a second RNA-guided endonuclease, where the second RNA-guided endonuclease effects an edit within a target sequence in a CISH gene compared to unedited immune cells. and (c) contacting the population of immune cells with a second RNA-guided endonuclease, wherein the third RNA-guided endonuclease introduces an edit within the target sequence in the CBLB gene, such that the edit results in a reduced level of expression of the CBLB protein encoded by the CBLB gene, compared to immune cells that have not been edited within the target sequence in the CBLB gene, wherein the gene-edited immune cells exhibit enhanced expansion potential, enhanced cytotoxicity against target tumor cells, enhanced persistence, or any combination thereof, compared to immune cells that have not been edited within the target, CISH, and target sequences in the CBLB gene.

[0058] In some embodiments, a method of making a population of gene-edited immune cells comprises: (a) contacting the population of immune cells with a first Cas-gRNA ribonucleoprotein (RNP) complex, where the first RNP complex effects an edit within a target sequence in a target gene selected from ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof; and (b) contacting the population of immune cells with a second RNP complex, where the second RNP complex effects a reduced level of expression of a CIS protein encoded by the CISH gene, compared to immune cells that have not been edited within the target sequence in the CISH gene. and (c) contacting the population of immune cells with a third RNP complex, wherein the third RNP complex effects an edit in the target sequence in the CBLB gene so as to result in a reduced level of expression of the CBLB protein encoded by the CBLB gene compared to immune cells that have not been edited in the target sequence in the CBLB gene, wherein the Cas of each of the first, second, and third RNP complexes comprises Cas9, CasX, CasY, or a combination thereof, and wherein the gene-edited immune cells exhibit enhanced expansion potential, enhanced cytotoxicity against target tumor cells, enhanced persistence, or any combination thereof, compared to immune cells that have not been edited in the target sequences in the target, CISH, and CBLB genes.

[0059] In some embodiments, a method of producing a gene-edited population of immune cells is provided, comprising: (a) contacting the population of immune cells with a first Cas-gRNA ribonucleoprotein (RNP) complex, where the RNP complex effects an edit within a target sequence in the MED12 gene; and (b) contacting the population of immune cells with a second Cas-gRNA RNP complex, where the second RNP complex effects an edit within a target sequence in the CISH gene.

[0060] In some embodiments, a method of producing a population of gene-edited immune cells comprises contacting a population of immune cells with a plurality of Cas-gRNA ribonucleoprotein (RNP) complexes, wherein the plurality of RNPs effect edits within the target sequence in the CISH gene such that the level of expression of a CIS protein encoded by the CISH gene is reduced compared to immune cells that have not been edited within the target sequence in the CISH gene, and wherein the plurality of RNP complexes effect edits within the target sequence in the CBLB gene such that the level of expression of a CBLB protein encoded by the CBLB gene is reduced compared to immune cells that have not been edited within the target sequence in the CBLB gene. wherein the plurality of RNP complexes induce editing within a target sequence in a target gene selected from ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof; wherein each Cas of the plurality of RNP complexes comprises Cas9, CasX, CasY, or a combination thereof; and wherein the gene-edited immune cells exhibit enhanced expansion capacity, enhanced cytotoxicity against target tumor cells, enhanced persistence, or any combination thereof, compared to CISH, CBLB, and immune cells that were not edited within the target sequence in the target gene.

[0061] In some embodiments, the gene is ADAM17. In some embodiments, the gene is HIF-1α. In some embodiments, the gene is DGKz. In some embodiments, the gene is GSK-3B. In some embodiments, the gene is LAG3. In some embodiments, the gene is TIM3. In some embodiments, the gene is TRIM29. In some embodiments, the gene is IL-1R8. In some embodiments, the gene is CD38. In some embodiments, the gene is FBP-1. In some embodiments, the gene is INSIG1. In some embodiments, the gene is MED12. In some embodiments, the gene is MED13. In some embodiments, the gene is CCNC. In some embodiments, the gene is CDK8. In some embodiments, the gene is ID3. In some embodiments, the gene is SOX4.

[0062] In some embodiments, the method of manufacturing further comprises contacting the population of immune cells with a vector comprising a polynucleotide encoding a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex.

[0063] In some embodiments, immune cells are gene edited within a target sequence in the ADAM17 gene, wherein the target sequence comprises any of SEQ ID NOs: 682-687. In some embodiments, immune cells are gene edited within a target sequence in the HIF-1a gene, wherein the target sequence comprises any of SEQ ID NOs: 750-760. In some embodiments, immune cells are gene edited within a target sequence in the DGKz gene, wherein the target sequence comprises any of SEQ ID NOs: 688-723. In some embodiments, immune cells are gene edited within a target sequence in the GSK-3B gene, wherein the target sequence comprises any of SEQ ID NOs: 724-749. In some embodiments, immune cells are gene edited within a target sequence in the LAG3 gene, wherein the target sequence comprises any of SEQ ID NOs: 761-789. In some embodiments, immune cells are gene edited within a target sequence in the TIM3 gene, wherein the target sequence comprises any of SEQ ID NOs: 790-825. In some embodiments, immune cells are gene edited within a target sequence in the TRIM29 gene, wherein the target sequence comprises any of SEQ ID NOs: 826-835. In some embodiments, immune cells are gene edited within a target sequence in the IL-1R8 gene, wherein the target sequence comprises any of SEQ ID NOs: 836-865. In some embodiments, immune cells are gene edited within a target sequence in the CD38 gene, wherein the target sequence comprises any of SEQ ID NOs: 866-874. In some embodiments, immune cells are gene edited within a target sequence in the FBP-1 gene, wherein the target sequence comprises any of SEQ ID NOs: 875-889. In some embodiments, immune cells are gene edited within a target sequence in the INSIG1 gene, wherein the target sequence comprises any of SEQ ID NOs: 890-934. In some embodiments, immune cells are gene edited within a target sequence in the MED12 gene, wherein the target sequence comprises any of SEQ ID NOs: 938-944.In some embodiments, immune cells are gene edited within a target sequence in the MED12 gene, wherein a target sequence comprising any of SEQ ID NOs: 938-944 is used to target the MED12 gene; optionally, immune cells are gene edited within a target sequence in the MED13 gene, wherein the target sequence comprises any of SEQ ID NOs: 945-948. In some embodiments, immune cells are gene edited within a target sequence in the MED13 gene, wherein the target sequence comprises any of SEQ ID NOs: 945-948. In some embodiments, immune cells are gene edited within a target sequence in the CDK8 gene, wherein the target sequence comprises any of SEQ ID NOs: 949-955. In some embodiments, immune cells are gene edited within a target sequence in the CCNC gene, wherein the target sequence comprises any of SEQ ID NOs: 956-962. In some embodiments, immune cells are gene edited within a target sequence in the ID3 gene, wherein the target sequence comprises any of SEQ ID NOs: 963-969. In some embodiments, immune cells are gene edited within a target sequence in the SOX4 gene, wherein the target sequence comprises any of SEQ ID NOs: 970-976. In some embodiments, immune cells are gene edited within a target sequence in the CISH gene, wherein the target sequence comprises any of SEQ ID NOs: 153-157 or 463-466. In some embodiments, immune cells are gene edited within a target sequence in the CBLB gene, wherein the target sequence comprises any of SEQ ID NOs: 164-166 or 453-456. In some embodiments, cells are gene edited within a target sequence in the MED12 gene. In some embodiments, the target sequence in the MED12 gene comprises any of SEQ ID NOs: 996-998. In some embodiments, cells are gene edited within a target sequence in the CCNC gene. In some embodiments, the target sequence in the CCNC gene comprises any of SEQ ID NOs: 999-1001. In some embodiments, cells are gene edited within a target sequence in the SOCS2 gene. In some embodiments, the target sequence in the SOCS2 gene comprises any of SEQ ID NOs: 1002-1004.In some embodiments, cells are gene edited within a target sequence in the CISH gene. In some embodiments, the target sequence in the CISH gene comprises any of SEQ ID NOs: 1012-1013. In some embodiments, cells are gene edited within a target sequence in the CBLB gene. In some embodiments, the target sequence in the CBLB gene comprises any of SEQ ID NOs: 1005-1008. In some embodiments, cells are gene edited within a target sequence in the TRIM29 gene. In some embodiments, the target sequence in the TRIM29 gene comprises any of SEQ ID NOs: 1009-1011. In some embodiments, cells are gene edited within a target sequence in the CD70 gene. In some embodiments, cells are gene edited within a target sequence in the TGFBR2 gene, TIGIT gene, adenosine A2a receptor (ADORA2A) gene, SMAD3 gene, MAPKAPK3 gene, CEACAM1 gene, DDIT4 gene, NKG2A gene, SOCS2 gene, B2M gene, PDCD1 gene, and / or TRAC gene.

[0064] In some embodiments, at least a portion of the genetically engineered immune cells are engineered to express interleukin-15 (IL15). In some embodiments, the IL15 is membrane-bound IL15 (mbIL15). In some embodiments, at least a portion of the genetically engineered immune cells are engineered to express membrane-bound IL-15 (mbIL15). The cytotoxic receptor and mbIL15 are encoded by the same nucleic acid molecule. In some embodiments, the nucleic acid sequences encoding the cytotoxic receptor and mbIL15 are separated by a nucleic acid sequence encoding the 2A peptide.

[0065] In some embodiments, cells are edited within target sequences in the CISH, CBLB, and ADAM17 genes.

[0066] In some embodiments, cells are edited within target sequences in the CISH, CBLB, and HIF1a genes.

[0067] In some embodiments, cells are edited within target sequences in the CISH, CBLB, and FBP-1 genes.

[0068] In some embodiments, cells are edited within target sequences in the CISH, CBLB, and / or MED12 genes. In some embodiments, cells are edited within target sequences in the CISH and MED12 genes. In some embodiments, cells are edited within target sequences in the CBLB and MED12 genes. In some embodiments, cells are edited within target sequences in the CISH, CBLB, and MED12 genes.

[0069] In some embodiments, the cells are also edited within a target sequence in the CD70 gene, and the method further comprises contacting the population of immune cells with a vector comprising a polynucleotide encoding a cytotoxic receptor comprising an extracellular ligand binding domain that targets CD70, a transmembrane domain, and a cytotoxic signaling complex.

[0070] In some embodiments, the method does not include editing the CD70 gene. In some embodiments, the method does not include editing the CD70 gene and the immune cells express their normal endogenous amounts of CD70. In some embodiments, the cells are not edited within the target sequence in the CD70 gene.

[0071] In some embodiments, the cytotoxic receptor binds to BCMA, CD19, CD70, an NKG2D ligand, CD38, GPRC5D, CD138, DLL3, EGFR, PSMA, FLT3, KREMEN2, or a combination thereof. In some embodiments, the cytotoxic receptor binds to BCMA. In some embodiments, the cytotoxic receptor binds to CD19. In some embodiments, the cytotoxic receptor binds to CD70. In some embodiments, the cytotoxic receptor binds to an NKG2D ligand. In some embodiments, the cytotoxic receptor binds to CD38. In some embodiments, the cytotoxic receptor binds to GPRC5D. In some embodiments, the cytotoxic receptor binds to CD138. In some embodiments, the cytotoxic receptor binds to GPRC5D. In some embodiments, the cytotoxic receptor binds to DLL3. In some embodiments, the cytotoxic receptor binds to EGFR. In some embodiments, the cytotoxic receptor binds to PSMA. In some embodiments, the cytotoxic receptor binds to FLT3. In some embodiments, the cytotoxic receptor binds to KREMEN2.

[0072] In some embodiments, the cytotoxic receptor does not target CD19.

[0073] In some embodiments, the cytotoxicity receptor does not target an NKG2D ligand.

[0074] In some embodiments, the immune cells comprise natural killer (NK) cells, T cells, induced pluripotent stem cells (iPSCs), iPSC-derived NK cells, iPSC-derived T cells, NK-92 cells, or a combination thereof. In some embodiments, the immune cells comprise natural killer (NK) cells. In some embodiments, the immune cells comprise T cells. In some embodiments, the immune cells comprise natural killer (NK) cells and T cells.

[0075] In some embodiments, the immune cells comprise a mixture of NK cells and T cells, or a mixture of iPSC-derived NK cells and T cells, hi some embodiments, the immune cells comprise a mixture of iPSC-derived NK cells and / or iPSC-derived T cells.

[0076] Also provided herein are methods for treating cancer in a subject, comprising administering to the subject a population of genetically engineered immune cells provided herein, in some embodiments, the cells of the cancer express an antigen bound to a cytotoxic receptor.

[0077] In some embodiments, the immune cells are allogeneic with respect to the subject, hi some embodiments, the immune cells are obtained from a donor who does not have cancer.

[0078] In some embodiments, the methods of treatment or uses provided herein further comprise administering IL2.

[0079] In some embodiments, the transmembrane domain of the expressed cytotoxic receptor comprises CD8, CD28, or a portion thereof, optionally wherein the transmembrane domain comprises CD8alpha or a portion thereof. In some embodiments, the transmembrane domain of the expressed cytotoxic receptor comprises CD8. In some embodiments, the transmembrane domain of the expressed cytotoxic receptor comprises CD8alpha. In some embodiments, the cytotoxic signaling complex of the expressed cytotoxic receptor comprises a CD3zeta domain and an intracellular signaling domain. In some embodiments, the cytotoxic signaling complex of the expressed cytotoxic receptor comprises a CD3zeta domain and the intracellular signaling domain of OX40, 4-1BB, CD28, or a signaling portion thereof, and optionally the intracellular signaling domain of OX40 or a signaling portion thereof. In some embodiments, the cytotoxic signaling complex of the expressed cytotoxic receptor comprises a CD3zeta domain and the intracellular signaling domain of OX40. In some embodiments, at least a portion of the engineered immune cells are engineered to express interleukin-15 (IL15). In some embodiments, the IL15 is membrane-bound IL15 (mbIL15). In some embodiments, at least a portion of the engineered immune cells are engineered to express membrane-bound IL-15 (mbIL15).

[0080] In some embodiments, provided herein are compositions comprising the genetically engineered and gene-edited populations of immune cells provided herein. In some embodiments, provided herein are compositions comprising the genetically engineered and gene-edited populations of immune cells provided herein. In some embodiments, provided herein are compositions comprising the genetically engineered and gene-edited populations of immune cells provided herein and a pharmaceutically acceptable excipient. In some embodiments, provided herein are compositions comprising the genetically edited populations of immune cells provided herein and a pharmaceutically acceptable excipient.

[0081] Also provided herein is a method for treating a subject having a disease or condition, the method comprising administering to the subject a genetically engineered and gene-edited immune cell population or composition disclosed herein. Also provided is a use of a genetically engineered and gene-edited immune cell population or composition disclosed herein for treating a subject having a disease or condition. Also provided is a use of a genetically engineered and gene-edited immune cell population or composition disclosed herein for the preparation of a medicament for treating a subject having a disease or condition. Also provided herein is a method for treating a subject having a disease or condition, the method comprising administering to a subject a gene-edited immune cell population or composition disclosed herein. Also provided is a use of a gene-edited immune cell population or composition disclosed herein for the treatment of a subject having a disease or condition. Also provided is a use of a gene-edited immune cell population or composition disclosed herein for the preparation of a medicament for treating a subject having a disease or condition.

[0082] In some embodiments, the disease or condition is an infectious disease, an autoimmune disease, cancer, or a tumor. In some embodiments, the disease or condition is cancer. In some embodiments, the disease or condition is a cancer that expresses an NKG2D ligand. In some embodiments, the disease or condition is a cancer that expresses CD19. In some embodiments, the disease or condition is a cancer that expresses CD70. In some embodiments, the disease or condition is a cancer that expresses BCMA. In some embodiments, the immune cells comprise natural killer (NK) cells. In some embodiments, the immune cells are allogeneic to the subject.

[0083] Provided herein is a population of gene-edited immune cells that have been gene-edited within a target sequence in a gene encoding a disintegrin and metalloproteinase domain-containing protein 17 (ADAM17) protein, wherein the editing results in reduced expression and / or function of the ADAM17 protein compared to immune cells that have not been edited within the target sequence in the ADAM17 gene. In some embodiments, the gene-edited immune cells are engineered to express a cytotoxic receptor that includes an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex. In some embodiments, the extracellular ligand-binding domain binds to an antigen expressed by cancer or tumor cells.

[0084] Also provided herein is a population of genetically engineered and gene-edited immune cells, including genetically engineered immune cells expressing a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand-binding domain targets a tumor marker expressed by a target tumor cell, and the immune cells are gene-edited within a target sequence in the ADAM17 gene, the editing resulting in reduced expression and / or function of the ADAM17 protein compared to immune cells that have not been edited within the target sequence in the ADAM17 gene. In some embodiments, the immune cells are edited within an additional target sequence in the genome of the immune cells to result in a reduced level of expression of a protein encoded by the gene comprising the edit within the additional target sequence compared to immune cells that have not been edited. In some embodiments, the protein encoded by the gene comprising the edit within the additional target sequence is ADAM17. In some embodiments, the protein encoded by the gene comprising the edit within the additional target sequence is not ADAM17. In some embodiments, the editing of the ADAM17 gene is performed using an RNA-guided endonuclease. In some embodiments, editing of the additional locations is performed using an RNA-guided endonuclease. In some embodiments, the engineered and edited immune cells exhibit one or more of enhanced expansion capacity, enhanced cytotoxicity against target tumor cells, and enhanced persistence compared to immune cells that do not contain the gene-edited locations.

[0085] In some embodiments, a population of genetically engineered and gene-edited immune cells is provided, comprising genetically engineered immune cells that express a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand-binding domain targets a tumor marker expressed by target tumor cells; the immune cells are gene-edited at one or more locations in an ADAM17 target gene that encodes a corresponding protein, wherein the editing results in reduced expression and / or function of the corresponding ADAM17 protein compared to immune cells that have not been edited at the one or more locations in the ADAM17 gene; and the immune cells may be edited at one or more additional target sites in the genome of the immune cells such that the editing results in reduced levels of expression of the protein encoded by the gene comprising the edited target site(s) compared to immune cells that have not been edited; the editing of the one or more target genes is performed using an RNA-guided endonuclease; and the genetically engineered and edited immune cells exhibit one or more of the following: enhanced expansion capacity, enhanced cytotoxicity against target tumor cells, and enhanced persistence compared to immune cells that do not comprise the gene-edited one or more target sites.

[0086] Provided herein is a population of gene-edited immune cells that have been gene-edited within a target sequence in a gene encoding the mediator of RNA polymerase II transcription subunit 12 (MED12) protein, wherein the editing results in reduced expression and / or function of the MED12 protein compared to immune cells that have not been edited within the target sequence in the MED12 gene. In some embodiments, the gene-edited immune cells are engineered to express a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex. In some embodiments, the extracellular ligand-binding domain binds to an antigen expressed by cancer or tumor cells.

[0087]

[0010] Also provided herein is a population of genetically engineered and gene-edited immune cells, comprising genetically engineered immune cells expressing a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand-binding domain targets a tumor marker expressed by target tumor cells, and the immune cells have been gene-edited within a target sequence in the MED12 gene.

[0011] Also provided herein is a population of genetically engineered and gene-edited immune cells, comprising genetically engineered immune cells expressing a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand-binding domain targets a tumor marker expressed by target tumor cells, and the immune cells have been gene-edited within a target sequence in the MED12 gene, and the editing results in reduced expression and / or function of the MED12 protein compared to immune cells that have not been edited within the target sequence in the MED12 gene. In some embodiments, immune cells are edited within an additional target sequence in the genome of the immune cells to result in a reduced level of expression of a protein encoded by the gene comprising the edit within the additional target sequence compared to unedited immune cells. In some embodiments, the protein encoded by the gene comprising the edit within the additional target sequence is MED12. In some embodiments, the protein encoded by the gene comprising the edit within the additional target sequence is not MED12. In some embodiments, the editing of the MED12 gene is performed using an RNA-guided endonuclease. In some embodiments, the editing of the additional location is performed using an RNA-guided endonuclease. In some embodiments, the genetically engineered and edited immune cells exhibit one or more of enhanced expansion potential, enhanced cytotoxicity against target tumor cells, and enhanced persistence compared to immune cells not comprising the gene-edited location.

[0088] In some embodiments, a population of genetically engineered and gene-edited immune cells is provided, comprising genetically engineered immune cells that express a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand-binding domain targets a tumor marker expressed by target tumor cells; the immune cells are gene-edited at one or more locations in a MED12 target gene that encodes a corresponding protein, wherein the editing results in reduced expression and / or function of the corresponding MED12 protein compared to immune cells that have not been edited at the one or more locations in the MED12 gene; and the immune cells may be edited at one or more additional target sites in the genome of the immune cells such that the editing results in reduced levels of expression of the protein encoded by the gene comprising the edited target site(s) compared to immune cells that have not been edited; the editing of the one or more target genes is performed using an RNA-guided endonuclease; and the genetically engineered and edited immune cells exhibit one or more of the following: enhanced expansion capacity, enhanced cytotoxicity against target tumor cells, and enhanced persistence compared to immune cells that do not comprise the gene-edited one or more target sites.

[0089] Provided herein is a population of gene-edited immune cells that have been gene-edited within a target sequence in a gene encoding hypoxia-inducible factor 1-alpha (HIF1-a) protein, wherein the editing results in reduced expression and / or function of HIF1-a protein compared to immune cells that have not been edited within the target sequence in the HIF1A gene. In some embodiments, the gene-edited immune cells are engineered to express a cytotoxic receptor that includes an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex. In some embodiments, the extracellular ligand-binding domain binds to an antigen expressed by cancer or tumor cells.

[0090] In some embodiments, a population of genetically engineered and gene-edited immune cells includes genetically engineered immune cells that express a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand-binding domain targets a tumor marker expressed by a target tumor cell, and the immune cells are gene-edited at one or more locations in a HIF1-a target gene that encodes a corresponding HIF1-a protein, wherein the editing results in reduced expression and / or function of the corresponding HIF1-a protein compared to immune cells that have not been edited at one or more locations in the HIF1-a gene. and optionally the immune cells have been edited at one or more additional target sites in the genome of the immune cells to result in a reduced level of expression of a protein encoded by a gene comprising the edited target site(s) compared to unedited immune cells, wherein the editing of the one or more target genes is performed using an RNA-guided endonuclease, and wherein the engineered and edited immune cells exhibit one or more of enhanced expansion capacity, enhanced cytotoxicity against target tumor cells, and enhanced persistence compared to immune cells that do not comprise said gene-edited one or more target sites.

[0091] In some embodiments, immune cells are genetically edited within a target sequence in a target gene selected from ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof. In some embodiments, the editing results in reduced expression and / or function of the corresponding protein compared to immune cells that have not been edited within the target sequence in the target gene. In some embodiments, the editing is performed using an RNA-guided endonuclease. In some embodiments, the editing is performed using a CRISPR / Cas system. In some embodiments, the Cas is Cas9. In some embodiments, the editing is performed using a CRISPR / Cas9 system. In some embodiments, the genetically engineered and edited immune cells exhibit enhanced expansion, enhanced cytotoxicity against target tumor cells, enhanced persistence, or any combination thereof, compared to immune cells that have not been edited within the target sequence.

[0092] In some embodiments, a population of genetically engineered and gene-edited immune cells comprises genetically engineered immune cells that express a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand-binding domain targets a tumor marker expressed by a target tumor cell, and the immune cells are gene-edited at one or more positions in a target gene selected from ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof, each of said genes encoding a corresponding protein, and wherein the editing Provided is a population of genetically engineered and gene-edited immune cells, wherein the immune cells are edited at one or more additional target sites in the genome of the immune cells to result in reduced expression and / or function of the corresponding protein compared to immune cells that have not been edited at the one or more locations, and the immune cells have reduced levels of expression of the protein encoded by the gene comprising the edited target site compared to immune cells that have not been edited, wherein the editing of the one or more target genes is performed using an RNA-guided endonuclease, and the genetically engineered and edited immune cells exhibit one or more of enhanced expansion capacity, enhanced cytotoxicity against target tumor cells, and enhanced persistence compared to immune cells that do not comprise said genetically edited one or more target sites.

[0093] In some embodiments, a population of genetically engineered and gene-edited immune cells comprises genetically engineered immune cells that express a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand-binding domain targets a tumor marker expressed by a target tumor cell, and the immune cells are gene-edited at one or more locations in a target gene selected from ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof, each of said genes encoding a corresponding protein, and wherein the edits are and wherein the immune cells are edited at one or more additional target sites in the genome of the immune cells to result in reduced expression and / or function of the corresponding protein compared to immune cells that have not been edited at the one or more locations, and the immune cells are edited at one or more additional target sites in the genome of the immune cells to result in reduced levels of expression of the protein encoded by the gene comprising the edited target site compared to immune cells that have not been edited, wherein the edits to the one or more target genes are made using the Crispr / Cas9 system, and wherein the engineered and edited immune cells exhibit one or more of enhanced expansion capacity, enhanced cytotoxicity to target tumor cells, and enhanced persistence compared to immune cells that do not comprise said gene-edited one or more target sites.

[0094] In some embodiments, a population of genetically engineered and gene-edited immune cells comprises genetically engineered immune cells that express a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand-binding domain targets a tumor marker expressed by a target tumor cell, and the tumor marker expressed by the target tumor cell is selected from a ligand for the NKG2D receptor, CD19, or CD70, and the immune cells are gene-edited at one or more locations in a target gene selected from ADAM17, HIF-1α, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof, and each of said genes expresses a corresponding protein. and wherein the editing results in reduced expression and / or function of the corresponding protein compared to immune cells that have not been edited at one or more locations in the individual genes, and the immune cells are edited at one or more additional target sites in the genome of the immune cells such that the editing results in reduced levels of expression of the protein encoded by the gene comprising the edited target site compared to immune cells that have not been edited, and the edits to the one or more target genes are made using a Crispr / Cas system or other guide endonuclease, and the engineered and edited immune cells exhibit one or more of enhanced expansion capacity, enhanced cytotoxicity against target tumor cells, and enhanced persistence compared to immune cells that do not comprise said gene-edited one or more target sites.

[0095]

[0014] In some embodiments, methods are provided for producing a population of gene-edited immune cells for cancer immunotherapy, comprising contacting the population of immune cells with a targeting endonuclease, wherein the targeting endonuclease cleaves nucleic acid at two or more target sites in a target gene selected from ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, CISH, CBLB, or any combination thereof, and wherein the gene-edited immune cells exhibit one or more of enhanced expansion capacity, enhanced cytotoxicity against target tumor cells, and enhanced persistence compared to immune cells that do not comprise the one or more gene-edited target sites.

[0096] In some embodiments, a method of producing a population of gene-edited immune cells for cancer immunotherapy is provided, comprising contacting the population of immune cells with an RNA-guided endonuclease, wherein the RNA-guided endonuclease effects editing at one or more target sites in a target gene selected from ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof, and wherein the gene-edited immune cells exhibit one or more of enhanced expansion capacity, enhanced cytotoxicity against target tumor cells, and enhanced persistence compared to immune cells that do not comprise the one or more gene-edited target sites.

[0097]

[0010] In some embodiments, a method of producing a population of gene-edited immune cells for cancer immunotherapy is provided, comprising contacting the population of immune cells with a Cas-gRNA ribonucleoprotein complex (RNP), wherein the RNP effects editing at one or more target sites in a target gene selected from ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof, and wherein the Cas of the RNP comprises Cas9, CasX, CasY, or a combination thereof, wherein the gene-edited immune cells exhibit one or more of enhanced expansion capacity, enhanced cytotoxicity against target tumor cells, and enhanced persistence compared to immune cells that do not comprise the gene-edited one or more target sites.

[0098] In some embodiments, the gene is ADAM17. In some embodiments, the gene is HIF-1α. In some embodiments, the gene is DGKz. In some embodiments, the gene is GSK-3B. In some embodiments, the gene is LAG3. In some embodiments, the gene is TIM3. In some embodiments, the gene is TRIM29. In some embodiments, the gene is IL-1R8. In some embodiments, the gene is CD38. In some embodiments, the gene is FBP-1. In some embodiments, the gene is INSIG1. In some embodiments, the gene is MED12. In some embodiments, the gene is MED13. In some embodiments, the gene is CCNC. In some embodiments, the gene is CDK8. In some embodiments, the gene is ID3. In some embodiments, the gene is SOX4.

[0099]

[0013] In some embodiments, a method of producing a gene-edited population of immune cells for cancer immunotherapy comprises contacting the population of immune cells with a first RNA-guided endonuclease, where the endonuclease effects editing at one or more target sites in a target gene selected from ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof; and contacting the population of immune cells with a second RNA-guided endonuclease. and contacting the immune cell with a second NA-guided endonuclease, wherein the second endonuclease effects editing at one or more target sites in the CISH gene of the immune cell such that the level of expression of the CIS protein encoded by the CISH gene is reduced compared to immune cells that have not been edited in the CISH gene, wherein the gene-edited immune cells exhibit one or more of enhanced expansion potential, enhanced cytotoxicity against target tumor cells, and enhanced persistence compared to immune cells that do not contain the gene-edited one or more target sites.

[0100]

[0013] In some embodiments, a method of producing a gene-edited population of immune cells for cancer immunotherapy comprises contacting the population of immune cells with a first Cas-gRNA ribonucleoprotein complex (RNP), wherein the RNP effects editing at one or more target sites, wherein the RNP effects editing at one or more target sites in a target gene selected from ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof, and wherein the Cas of the RNP is Cas9, CasX, CasY, or any combination thereof. and contacting a population of immune cells with a second RNP complex, wherein the second RNP effects editing at one or more target sites in the CISH gene of the immune cells so as to result in a reduced level of expression of the CIS protein encoded by the CISH gene compared to immune cells that have not been edited in the CISH gene, and wherein the Cas of the RNP comprises Cas9, CasX, CasY, or a combination thereof; wherein the gene-edited immune cells exhibit one or more of enhanced expansion potential, enhanced cytotoxicity against target tumor cells, and enhanced persistence compared to immune cells that do not comprise the one or more gene-edited target sites.

[0101]

[0013] In some embodiments, a method of producing a gene-edited population of immune cells for cancer immunotherapy comprises contacting the population of immune cells with a first Cas-gRNA ribonucleoprotein complex (RNP), wherein the RNP effects editing at one or more target sites, wherein the RNP effects editing at one or more target sites in a target gene selected from ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof, and wherein the Cas of the RNP is Cas9, CasX, CasY, or any combination thereof. and contacting a population of immune cells with a second RNP complex, wherein the second RNP effects editing at one or more target sites in the CBLB gene of the immune cells, such that the level of expression of the CBLB protein encoded by the CBLB gene is reduced compared to immune cells that have not been edited in the CBLB gene, and the Cas of the RNP comprises Cas9, CasX, CasY, or a combination thereof; wherein the gene-edited immune cells exhibit one or more of enhanced expansion potential, enhanced cytotoxicity against target tumor cells, and enhanced persistence compared to immune cells that do not comprise the one or more gene-edited target sites.

[0102]

[0013] In some embodiments, a method of producing a gene-edited population of immune cells for cancer immunotherapy comprises contacting the population of immune cells with a first RNA-guided endonuclease, where the first endonuclease effects editing at one or more target sites and RNP effects editing at one or more target sites in a target gene selected from ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof; and contacting the population of immune cells with second and third RNA-guided endonucleases, where the second RNA-guided endonuclease effects editing at one or more target sites in a target gene selected from ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof. and a third RNA-guided endonuclease causes editing at one or more target sites in the CBLB gene of the immune cell, such that the level of expression of the CIS protein encoded by the CISH gene is reduced compared to immune cells that have not been genetically edited; and wherein the gene-edited immune cells exhibit one or more of the following: enhanced expansion potential, enhanced cytotoxicity against target tumor cells, and enhanced persistence compared to immune cells that do not comprise the one or more gene-edited target sites.

[0103]

[0013] In some embodiments, a method of making a population of gene-edited immune cells for cancer immunotherapy comprises contacting the population of immune cells with a first Cas-gRNA ribonucleoprotein complex (RNP), where the RNP effects editing at one or more target sites, where the RNP effects editing at one or more target sites in a target gene selected from ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof, and contacting the population of immune cells with second and third RNP complexes, where the second RNP effects editing at one or more target sites in a target gene selected from ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof, compared to immune cells that have not been edited. a third RNP that effects editing at one or more target sites in the CISH gene of the immune cell to result in a reduced level of expression of the CIS protein encoded by the CISH gene, compared to an immune cell that has not been edited in the CBLB gene, wherein each Cas of the RNP comprises Cas9, CasX, CasY, or a combination thereof; wherein the gene-edited immune cells exhibit one or more of enhanced expansion potential, enhanced cytotoxicity against target tumor cells, and enhanced persistence compared to immune cells that do not comprise the one or more gene-edited target sites.

[0104] In some embodiments, a method of producing a population of gene-edited immune cells for cancer immunotherapy comprises contacting a population of immune cells with a plurality of Cas-gRNA ribonucleoprotein complexes (RNPs), wherein the plurality of RNPs induce editing at one or more target sites in a CISH gene of the immune cells, such that the level of expression of a CIS protein encoded by the CISH gene is reduced compared to immune cells that have not been edited in the CISH gene; and wherein the plurality of RNPs induce editing at one or more target sites in a CBLB gene of the immune cells, such that the level of expression of a CBLB protein encoded by the CBLB gene is reduced compared to immune cells that have not been edited in the CBLB gene. wherein the plurality of RNPs induce editing at one or more target sites in a target gene selected from ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof, and wherein the Cas of each of the plurality of RNPs comprises Cas9, CasX, CasY, or a combination thereof, and wherein the gene-edited immune cells exhibit one or more of enhanced expansion capacity, enhanced cytotoxicity against target tumor cells, and enhanced persistence compared to immune cells that do not comprise the gene-edited one or more target sites.

[0105] In some embodiments, the gene is ADAM17. In some embodiments, the gene is HIF-1α. In some embodiments, the gene is DGKz. In some embodiments, the gene is GSK-3B. In some embodiments, the gene is LAG3. In some embodiments, the gene is TIM3. In some embodiments, the gene is TRIM29. In some embodiments, the gene is IL-1R8. In some embodiments, the gene is CD38. In some embodiments, the gene is FBP-1. In some embodiments, the gene is INSIG1. In some embodiments, the gene is MED12. In some embodiments, the gene is MED13. In some embodiments, the gene is CCNC. In some embodiments, the gene is CDK8. In some embodiments, the gene is ID3. In some embodiments, the gene is SOX4.

[0106] In some embodiments, the method of production further comprises contacting the population of immune cells with a vector comprising a polynucleotide encoding a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex.

[0107] Also provided herein are methods for treating a subject with a disease or condition, comprising administering to the subject a population of gene-edited natural killer (NK) cells that have been gene-edited within a target sequence in the MED12 gene. In some embodiments, the immune cells are genetically engineered to express a cytotoxic receptor. In some embodiments, the cytotoxic receptor comprises an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex. In some embodiments, the extracellular ligand-binding domain binds to an antigen expressed by a target tumor or cancer cell. In some embodiments, the gene edit within the target sequence in the MED12 gene comprises any one of SEQ ID NOs: 938-994 or 996-998. In some embodiments, the gene edit for MED12 reduces the expression and / or function of the MED12 protein encoded by the MED12 gene compared to immune cells that have not been edited within the target sequence. In some embodiments, the edit for the MED12 gene is performed using an RNA-guided endonuclease.

[0108] In some embodiments, provided herein are methods for treating a subject with a disease or condition, comprising administering to the subject a population of natural killer (NK) cells that have been gene-edited within a target sequence in the MED12 gene. In some embodiments, provided herein are methods for treating a subject with a disease or condition, comprising administering to the subject a population of natural killer (NK) cells that have been gene-edited within a target sequence in the MED12 gene and a target sequence in the CISH gene. In some embodiments, provided are populations of gene-edited immune cells, including immune cells that have been gene-edited within a target sequence in the MED12 gene and a target sequence in the CISH gene. In some embodiments, the immune cells are genetically engineered to express a cytotoxic receptor. In some embodiments, the cytotoxic receptor comprises an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex. In some embodiments, the extracellular ligand-binding domain binds to an antigen expressed by target tumor or cancer cells. In some embodiments, gene editing within the target sequence in the MED12 gene reduces the expression and / or function of the MED12 protein encoded by the MED12 gene compared to immune cells that have not been edited within the target sequence. In some embodiments, gene editing within the target sequence in the CISH gene reduces the expression and / or function of the CIS protein encoded by the CIS gene compared to immune cells that have not been edited within the target sequence.In some embodiments, a population of genetically engineered and gene-edited immune cells is provided, comprising genetically engineered immune cells that express a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand-binding domain targets an antigen expressed by cells of a target tumor or cancer, and the immune cells are gene-edited within a target sequence in the MED12 gene, wherein the editing results in reduced expression and / or function of Mediator complex subunit 12 (MED12) protein encoded by the MED12 gene compared to immune cells that have not been edited within the target sequence in the MED12 gene, and wherein the editing of the MED12 gene is made using an RNA-guided endonuclease. In some embodiments, a population of genetically engineered and gene-edited immune cells is provided, the population comprising genetically engineered immune cells expressing a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex, wherein the extracellular ligand-binding domain targets an antigen expressed by target tumor or cancer cells, and the immune cells are gene-edited within a target sequence in the MED12 gene and a target sequence in the CISH gene, the editing resulting in reduced expression and / or function of the Mediator complex subunit 12 (MED12) protein and the CIS protein compared to immune cells that have not been edited within the target sequences in the MED12 and CISH genes, and the editing is performed using an RNA-guided endonuclease. In some embodiments, the disease or condition is cancer. In some embodiments, the immune cells are allogeneic to the subject.

[0109] Also provided herein is a method for treating a disease or condition in a subject, comprising administering to the subject a population of genetically engineered immune cells, wherein the immune cells express a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex; the immune cells are gene-edited within a target sequence in a CISH gene; and the immune cells are edited within a target sequence in a target gene selected from ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof. In some embodiments, the disease or condition is an autoimmune disease, an infectious disease, or cancer. In some embodiments, the disease or condition is cancer. In some embodiments, the disease or condition is an autoimmune disease. In some embodiments, the disease or condition is an infectious disease.In some embodiments, a method for treating cancer in a subject comprises administering to the subject a population of genetically engineered immune cells, wherein the immune cells express a cytotoxic receptor comprising an extracellular ligand binding domain, a transmembrane domain, and a cytotoxic signaling complex; the immune cells are gene edited at one or more target locations in the CISH gene, which encodes a CIS protein, wherein the editing results in reduced expression and / or function of CIS compared to immune cells that have not been edited at one or more locations in the CISH gene; and the immune cells express one or more of the following: ADAM17, HIF-1a, DGKz, GSK-3B, L Provided herein are methods in which immune cells are edited at one or more target locations in more than one target gene selected from AG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof, wherein the editing is performed using an RNA-guided endonuclease, and the engineered and edited immune cells exhibit one or more of enhanced expansion capacity, enhanced cytotoxicity against target tumor cells, and enhanced persistence, particularly in a hypoxic tumor microenvironment, compared to immune cells that do not comprise the one or more gene-edited target sites.

[0110] Also provided herein is a method for treating a disease or condition in a subject, comprising administering to the subject a population of genetically engineered immune cells, wherein the immune cells express a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex; the immune cells have been gene-edited within a target sequence in a CISH gene; the immune cells have been gene-edited within a target sequence in a CBLB gene; or the immune cells have been edited within a target sequence in a target gene selected from ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof. In some embodiments, the disease or condition is an autoimmune disease, an infectious disease, or cancer. In some embodiments, the disease or condition is cancer. In some embodiments, the disease or condition is an autoimmune disease. In some embodiments, the disease or condition is an infectious disease.1. A method for treating cancer in a subject, comprising administering to the subject a population of genetically engineered immune cells, wherein the immune cells express a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex; the immune cells are gene edited at one or more target locations in a CISH gene encoding a CIS protein, wherein the editing results in reduced expression and / or function of CIS compared to immune cells that have not been edited at the one or more locations in the CISH gene; and the immune cells are gene edited at one or more target locations in a CBLB gene encoding a CBLB protein, wherein the editing results in reduced expression and / or function of CIS compared to immune cells that have not been edited at the one or more locations in the CBLB gene. Also provided herein are methods that result in reduced expression and / or function of CIS, wherein immune cells are edited at one or more target sites in more than one target gene selected from ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof, wherein the editing is performed using an RNA-guided endonuclease, and the genetically engineered and edited immune cells exhibit one or more of the following: enhanced expansion capacity, enhanced cytotoxicity against target tumor cells, and enhanced persistence, particularly in a hypoxic tumor microenvironment, compared to immune cells that do not contain the gene-edited one or more target sites. In some embodiments, the administered immune cells are allogeneic to the subject. In some embodiments, the treatment method further comprises administering IL2.

[0111] In some embodiments, immune cells are gene edited within a target sequence in the ADAM17 gene. In some embodiments, immune cells are gene edited within a target sequence in the HIF1A gene. In some embodiments, immune cells are gene edited within a target sequence in the DGKz gene. In some embodiments, immune cells are gene edited within a target sequence in the GSK3B gene. In some embodiments, immune cells are gene edited within a target sequence in the LAG3 gene. In some embodiments, immune cells are gene edited within a target sequence in the TIM3 gene. In some embodiments, immune cells are gene edited within a target sequence in the TRIM29 gene. In some embodiments, immune cells are gene edited within a target sequence in the IL1R8 gene. In some embodiments, immune cells are gene edited within a target sequence in the CD38 gene. In some embodiments, immune cells are gene edited within a target sequence in the FBP1 gene. In some embodiments, immune cells are gene edited within a target sequence in the INSIG1 gene. In some embodiments, immune cells are gene edited within a target sequence in the MED12 gene. In some embodiments, immune cells are gene edited within a target sequence in the MED13 gene. In some embodiments, immune cells are gene edited within a target sequence in the CCNC gene. In some embodiments, immune cells are gene edited within a target sequence in the CDK8 gene. In some embodiments, immune cells are gene edited within a target sequence in the ID3 gene. In some embodiments, immune cells are gene edited within a target sequence in the SOX4 gene.

[0112] In some embodiments, ADAM17 is edited, and a guide sequence of any of SEQ ID NOs: 682-687 is used to target the ADAM17 gene. In some embodiments, ADAM17 is edited at a target sequence comprising SEQ ID NO: 682. In some embodiments, ADAM17 is edited at a target sequence comprising SEQ ID NO: 683. In some embodiments, ADAM17 is edited at a target sequence comprising SEQ ID NO: 684. In some embodiments, ADAM17 is edited at a target sequence comprising SEQ ID NO: 685. In some embodiments, ADAM17 is edited at a target sequence comprising SEQ ID NO: 686. In some embodiments, ADAM17 is edited at a target sequence comprising SEQ ID NO: 687.

[0113] In some embodiments, ADAM17 is edited and the target sequence comprises any of SEQ ID NOs: 682-687. In some embodiments, ADAM17 is edited and the target sequence comprises SEQ ID NO: 682. In some embodiments, ADAM17 is edited and the target sequence comprises SEQ ID NO: 683. In some embodiments, ADAM17 is edited and the target sequence comprises SEQ ID NO: 684. In some embodiments, ADAM17 is edited and the target sequence comprises SEQ ID NO: 685. In some embodiments, ADAM17 is edited and the target sequence comprises SEQ ID NO: 686. In some embodiments, ADAM17 is edited and the target sequence comprises SEQ ID NO: 687.

[0114] In some embodiments, MED12 is edited, and a guide sequence of any of SEQ ID NOs: 938-944 is used to target the MED12 gene. In some embodiments, MED12 is edited at a target sequence comprising SEQ ID NO: 938. In some embodiments, MED12 is edited at a target sequence comprising SEQ ID NO: 939. In some embodiments, MED12 is edited at a target sequence comprising SEQ ID NO: 940. In some embodiments, MED12 is edited at a target sequence comprising SEQ ID NO: 941. In some embodiments, MED12 is edited at a target sequence comprising SEQ ID NO: 942. In some embodiments, MED12 is edited at a target sequence comprising SEQ ID NO: 943. In some embodiments, MED12 is edited at a target sequence comprising SEQ ID NO: 944. In some embodiments, MED12 is edited at a target sequence comprising SEQ ID NO: 996. In some embodiments, MED12 is edited at a target sequence comprising SEQ ID NO: 997. In some embodiments, MED12 is edited at a target sequence comprising SEQ ID NO: 998.

[0115] In some embodiments, MED12 is edited and the target sequence comprises any of SEQ ID NOs: 938-944. In some embodiments, MED12 is edited and the target sequence comprises SEQ ID NO: 938. In some embodiments, MED12 is edited and the target sequence comprises SEQ ID NO: 939. In some embodiments, MED12 is edited and the target sequence comprises SEQ ID NO: 940. In some embodiments, MED12 is edited and the target sequence comprises SEQ ID NO: 941. In some embodiments, MED12 is edited and the target sequence comprises SEQ ID NO: 942. In some embodiments, MED12 is edited and the target sequence comprises SEQ ID NO: 943. In some embodiments, MED12 is edited and the target sequence comprises SEQ ID NO: 944. In some embodiments, MED12 is edited and the target sequence comprises SEQ ID NO: 996. In some embodiments, MED12 is edited and the target sequence comprises SEQ ID NO: 997. In some embodiments, MED12 is edited and the target sequence comprises SEQ ID NO:998.

[0116] In some embodiments, CISH is edited and the target sequence comprises any of SEQ ID NOs: 153-157, 463-466, or 1012-1013. In some embodiments, the target sequence comprises SEQ ID NO: 153. In some embodiments, the target sequence comprises SEQ ID NO: 154. In some embodiments, the target sequence comprises SEQ ID NO: 155. In some embodiments, the target sequence comprises SEQ ID NO: 156. In some embodiments, the target sequence comprises SEQ ID NO: 157. In some embodiments, the target sequence comprises SEQ ID NO: 463. In some embodiments, the target sequence comprises SEQ ID NO: 464. In some embodiments, the target sequence comprises SEQ ID NO: 465. In some embodiments, the target sequence comprises SEQ ID NO: 466. In some embodiments, the target sequence comprises SEQ ID NO: 1012. In some embodiments, the target sequence comprises SEQ ID NO: 1013.

[0117] In some embodiments, HIF-1a is edited and a guide sequence of any of SEQ ID NOs: 750-760 is used to target the HIF-1a gene. In some embodiments, HIF-1a is edited and the target sequence comprises any of SEQ ID NOs: 750-760. In some embodiments, DGKz is edited and a guide sequence of any of SEQ ID NOs: 688-723 is used to target the DGKz gene. In some embodiments, DGKz is edited and the target sequence comprises any of SEQ ID NOs: 688-723. In some embodiments, GSK-3B is edited and a guide sequence of any of SEQ ID NOs: 724-749 is used to target the GSK-3B gene. In some embodiments, GSK-3B is edited and the target sequence comprises any of SEQ ID NOs: 724-749. In some embodiments, LAG3 is edited and a guide sequence of any of SEQ ID NOs: 761-789 is used to target the LAG3 gene. In some embodiments, LAG3 is edited and the target sequence comprises any of SEQ ID NOs: 761-789. In some embodiments, TIM3 is edited and a guide sequence of any of SEQ ID NOs: 790-825 is used to target the TIM3 gene. In some embodiments, TIM3 is edited and the target sequence comprises any of SEQ ID NOs: 790-825. In some embodiments, TRIM29 is edited and a guide sequence of any of SEQ ID NOs: 826-835 is used to target the TRIM29 gene. In some embodiments, TRIM29 is edited and the target sequence comprises any of SEQ ID NOs: 826-835. In some embodiments, TRIM29 is edited and a guide sequence of any of SEQ ID NOs: 167-169, 826-835, or 1009-1011 is used to target the TRIM29 gene. In some embodiments, TRIM29 is edited and the target sequence comprises any of SEQ ID NOs: 167-169, 826-835, or 1009-1011. In some embodiments, IL-1R8 is edited and a guide sequence of any of SEQ ID NOs: 836-865 is used to target the IL-1R8 gene.In some embodiments, IL-1R8 is edited and the target sequence comprises any of SEQ ID NOs: 836-865. In some embodiments, CD38 is edited and a guide sequence of any of SEQ ID NOs: 866-874 is used to target the CD38 gene. In some embodiments, CD38 is edited and the target sequence comprises any of SEQ ID NOs: 866-874. In some embodiments, FBP-1 is edited and a guide sequence of any of SEQ ID NOs: 875-889 is used to target the FBP-1 gene. In some embodiments, FBP-1 is edited and the target sequence comprises any of SEQ ID NOs: 875-889. In some embodiments, INSIG1 is edited and a guide sequence of any of SEQ ID NOs: 890-934 is used to target the INSIG1 gene. In some embodiments, INSIG1 is edited and the target sequence comprises any of SEQ ID NOs: 890-934. In some embodiments, MED12 is edited and a guide sequence of any of SEQ ID NOs: 938-944 is used to target the MED12 gene. In some embodiments, MED12 is edited and a guide sequence of any of SEQ ID NOs: 938-944 or 996-998 is used to target the MED12 gene. In some embodiments, MED12 is edited and the target sequence comprises any of SEQ ID NOs: 938-944. In some embodiments, MED12 is edited and the target sequence comprises any of SEQ ID NOs: 938-944 or 996-998. In some embodiments, MED13 is edited and a guide sequence of any of SEQ ID NOs: 945-948 is used to target the MED13 gene. In some embodiments, MED13 is edited and the target sequence comprises any of SEQ ID NOs: 945-948. In some embodiments, CDK8 is edited and a guide sequence of any of SEQ ID NOs: 949-955 is used to target the CDK8 gene. In some embodiments, CDK8 is edited and the target sequence comprises any of SEQ ID NOs: 949-955.In some embodiments, CCNC is edited and a guide sequence of any of SEQ ID NOs: 956-961 is used to target the CCNC gene. In some embodiments, CCNC is edited and a guide sequence of any of SEQ ID NOs: 956-961 or 999-1001 is used to target the CCNC gene. In some embodiments, CCNC is edited and the target sequence comprises any of SEQ ID NOs: 956-961. In some embodiments, CCNC is edited and the target sequence comprises any of SEQ ID NOs: 956-961 or 999-1001. In some embodiments, ID3 is edited and a guide sequence of any of SEQ ID NOs: 963-969 is used to target the ID3 gene. In some embodiments, ID3 is edited and the target sequence comprises any of SEQ ID NOs: 963-969. In some embodiments, SOX4 is edited and a guide sequence of any of SEQ ID NOs: 970-976 is used to target the SOX4 gene. In some embodiments, SOX4 is edited and the target sequence comprises any of SEQ ID NOs: 970-976. In some embodiments, immune cells are further edited in the CISH gene, which encodes the CIS protein. In some embodiments, a guide sequence of any of SEQ ID NOs: 153-157 or 463-466 is used to target the CISH gene. In some embodiments, a guide sequence of any of SEQ ID NOs: 153-157, 463-466, or 1012-1013 is used to target the CISH gene. In some embodiments, CISH is edited and the target sequence comprises any of SEQ ID NOs: 153-157 or 463-466. In some embodiments, CISH is edited and the target sequence comprises any of SEQ ID NOs: 153-157, 463-466, or 1012-1013. In some embodiments, cells are edited at an additional target site in the CBLB gene. In some embodiments, a guide sequence of any of SEQ ID NOs: 164-166 or 453-456 is used to target the CBLB gene.In some embodiments, a guide sequence of any of SEQ ID NOs: 164-166, 453-456, or 1005-1008 is used to target the CBLB gene. In some embodiments, CBLB is edited and the target sequence comprises any of SEQ ID NOs: 164-166, or 453-456. In some embodiments, CBLB is edited and the target sequence comprises any of SEQ ID NOs: 164-166, 453-456, or 1005-1008.

[0118] According to some embodiments, the cells may be further edited in a gene encoding CD70. In some embodiments, the cells may be edited in the TGFBR2 gene, the TIGIT gene, the adenosine A2 receptor gene, the SMAD3 gene, the MAPKAPK3 gene, the CEACAM1 gene, the DDIT4 gene, the NKG2A gene, the SOCS2 gene, the B2M gene, the PD-1 gene, and / or the TCR alpha gene.

[0119] In some embodiments, at least a portion of the engineered immune cells are engineered to express membrane-bound IL-15. In some embodiments, the engineered immune cells are engineered to express membrane-bound IL-15. In some embodiments, IL15 is expressed from a separate cassette in a construct comprising any one of the CARs disclosed herein. In some embodiments, IL15 is expressed from a separate cassette in a construct comprising any one of the cytotoxic receptors disclosed herein. In some embodiments, IL15 is expressed from the same cassette as any one of the CARs disclosed herein. In some embodiments, IL15 is expressed from the same cassette as any one of the cytotoxic receptors disclosed herein. In some embodiments, IL15 and the cytotoxic receptor are expressed bicistronically. In some embodiments, the chimeric receptor and IL15 are separated by a nucleic acid sequence encoding a cleavage site, e.g., a proteolytic cleavage site, or a T2A, P2A, E2A, or F2A autocleavage peptide cleavage site. In some embodiments, the chimeric receptor and IL15 are separated by a T2A sequence. In some embodiments, the IL15 is membrane-bound IL15 (mbIL15).

[0120] In some embodiments, the immune cells comprise natural killer (NK) cells, T cells, induced pluripotent stem cells (iPSCs), iPSC-derived NK cells, NK-92 cells, or a combination thereof. In some embodiments, the immune cells comprise natural killer (NK) cells. In some embodiments, the engineered and edited immune cells are suitable for use in allogeneic cancer cell therapy, where the cells maintain enhanced cytotoxicity and / or persistence in a hypoxic tumor microenvironment. In some embodiments, the engineered and edited immune cells exhibit increased persistence in vivo compared to engineered cells that are not edited in the target sequence.

[0121] In some embodiments, the genetically engineered and edited immune cells provided herein are used for the treatment of a disease or condition. In some embodiments, the disease or condition is an autoimmune disease. In some embodiments, the disease or condition is cancer. In some embodiments, the genetically engineered and edited immune cells provided herein are used for the treatment of cancer. In some embodiments, the genetically engineered and edited immune cells provided herein are used for the preparation of a medicament for the treatment of a disease or condition. In some embodiments, the disease or condition is an autoimmune disease. In some embodiments, the disease or condition is cancer. In some embodiments, the genetically engineered and edited immune cells provided herein are used for the preparation of a medicament for the treatment of cancer. [Brief explanation of the drawings]

[0122] [Figure 1] 1A-1D depict non-limiting examples of tumor-tropic chimeric antigen receptors. [Figure 2] FIG. 2 depicts a schematic workflow for assessing gene editing as disclosed herein. [Figure 3] Figures 3A-3B show data on the expression of non-limiting examples of CD19-directed CARs when cells are edited to disrupt expression of the indicated target genes. Figure 3A shows data after editing of DGKz, GSK-3B, HIF-1a, TRIM29, IL-1R8, CD38, FBP-1, or an electroporation (EP) control. Figure 3B shows data after editing of ADAM17, LAG3, TIM3, INSIG1, CISH-15, or an EP untransduced control. Similar results were achieved in cells from other donors (data not shown). [Figure 4]Figures 4A-4C show data on the knockout efficiency of ADAM17, LAG3, and TIM3 in the non-limiting example of NK cells expressing a CD19-directed CAR when the cells were edited to disrupt expression of the indicated target genes. Figure 4A shows the ADAM17 knockout efficiency in cells at day 11 using an APC isotype control and an EP untransduced control. Figure 4B shows the TIM3 and CD38 knockout efficiency in cells at day 11. Figure 4C shows the LAG3 knockout efficiency in cells at day 11. Similar results were achieved in cells from other donors (data not shown). [Figure 5] Figures 5A-C represent summaries of expression data for the indicated genes after editing in the non-limiting example of a CD19-directed CAR. Figure 5A summarizes data from the first donor (512), Figure 5C summarizes data from the second donor (558), and Figure 5B summarizes data from the third donor (548). [Figure 6] Figure 6 depicts the results of CRISPR-mediated on-target INDEL analysis for the indicated genes of donors 558, 548, and 512 in the non-limiting example of a CD19-directed CAR. [Figure 7] Figures 7A-B represent a summary of fold expansion results for cells expressing CD19-directed CARs when the cells were edited to disrupt expression of the indicated target genes. Fold expansion was determined on days 0-7, 7-14, and 0-14 for cells from donors 512 (Figure 7A) and 558 (Figure 7B). [Figure 8] Figures 8A-8B represent in vitro cytotoxicity data against tumor cells. Figure 8 shows data for NK cells expressing non-limiting examples of CD19-directed CARs and tested as indicated (single-edited) starting at day 14 (Figure 8A) and day 21 (Figure 8B). Similar results were seen in cells from other donors (data not shown). [Figure 9]Figures 9A-9B relate to glycolysis stress test and hypoxia data. Figure 9A shows the corresponding extracellular acidification rate (ECAR) data for NK cells expressing CD19-directed CARs, compiled as indicated. Figure 9B shows additional data from an assessment of the oxygen consumption rate (OCR) for the cells and a determination of mitochondrial versus non-mitochondrial respiration in NK cells expressing CD19-CARs, compiled as indicated. [Figure 10] Figure 10 depicts the results of cytokine production assessment following co-culture of NK cells from donor 512 expressing CD19-CAR, edited as indicated, incubated with Raji cells for 3 days, where results for the gene-edited group expressing CD19-CAR are compared to cytokine levels in EP controls, Raji cells, and CD19-CAR-expressing cells without additional gene editing. [Figure 11] FIG. 11 depicts a schematic workflow for assessing gene editing as disclosed herein. [Figure 12] Figure 12 depicts a summary of expression data for cells expressing non-limiting examples of CD70-directed CARs that have been edited to disrupt expression of the indicated target genes. % viability, % CD70-positive cells, and % CAR-positive cells are shown for each group compared to unedited, untransduced controls. [Figure 13] Figure 13 depicts a summary of fold expansion results for cells expressing non-limiting examples of CD70-directed CARs when the cells were edited to disrupt expression of the indicated target genes. Fold expansion was determined on days 0-6, 6-7, 7-14, and 0-14. [Figure 14]Figure 14 depicts in vitro cytotoxicity data against tumor cells. Figure 14 shows data for NK cells expressing non-limiting examples of CD70-directed CARs edited as indicated from donor 512 against HL60 and Molm13 cells at day 14. Each assay was performed at a 1:2 ratio of effector cells to target cells (E:T), with controls being target (tumor) cells alone and incubation of target (tumor) cells with unedited, untransduced NK cells (EP). [Figure 15] Figure 15 depicts the results of a cellular mitochondrial stress study, in which NK cells expressing non-limiting examples of CD70-directed CARs edited as shown were treated with lactate for 3 days prior to assessment of OCR. [Figure 16] FIG. 16 depicts a schematic workflow for assessing gene editing as disclosed herein. [Figure 17] Figure 17 depicts a summary of expression data for cells expressing non-limiting examples of CD70-directed CARs that have been edited to disrupt expression of the indicated target genes. The % ADAM17 positive, % CD70 positive cells, and % CAR positive cells are shown for each group compared to the unedited, untransduced control (EP). [Figure 18] Figure 18 depicts a summary of fold expansion results for cells expressing non-limiting examples of CD70-directed CARs when the cells were edited to disrupt expression of the indicated target genes. Fold expansion was determined on days 0-7, 7-15, and 1-15. [Figure 19]

[00130] Figures 19A-19D show in vitro cytotoxicity data against tumor cells. Figures 19A-19B show data for NK cells expressing non-limiting examples of CD70-directed CARs tested as indicated starting on day 14 against 786-O cells using an effector-to-target ratio (E:T) of 1:2 for Figure 19A and 1:4 for Figure 19B. Figures 19C-19D show cytotoxicity data for NK cells expressing non-limiting examples of CD70-directed CARs tested as indicated starting on day 14 against HL60 cells using an E:T of 1:1 for Figure 19C and 1:2 for Figure 19D. [Figure 20] Figure 20 depicts the results of a cellular mitochondrial stress study under hypoxic conditions for NK cells expressing non-limiting examples of CD70-directed CARs edited as indicated. [Figure 21] Figure 21 depicts a schematic workflow for assessing gene editing as disclosed herein. [Figure 22] Figures 22A-22B show data regarding the expression of non-limiting examples of CD19-directed CARs when cells are edited to disrupt ADAM17 expression. Figure 22A depicts expression of CD19 CARs in NK cells 4 days after transduction. Figure 22B depicts validation of ADAM17 knockout from NK cells of donors 512 and 558. [Figure 23]Figures 23A-23B show assessment of CD16 and CD62L expression in cells expressing a non-limiting example of a CD19-directed CAR edited in ADAM17 (ADAM17 KO) and treated with DMSO (control) or 1 ug / mL phorbol myristate acetate (PMA) stimulation for 1 hour. Similar results were seen in cells from other donors (data not shown). Figure 23B summarizes the data in Figure 23A and reports the CD16 and CD62L positivity % and MFI for cells from two donors, control, and PMA treatment conditions for EP control, as well as ADAM17-edited cells with and without NKX19. Figure 23C shows assessment of the expression of various ADAM17 substrates in cells expressing a non-limiting example of a CD70-directed CAR edited in ADAM17 (ADAM17 KO) and treated with DMSO (control) or 1 ug / mL PMA stimulation for 1 hour. [Figure 24] Figures 24A-24G show in vitro cytotoxicity data of NK cells edited as indicated against tumor cells. Figure 24A represents a study in which Raji and Nalm6 cells were evaluated for CD20 expression. Figure 24B shows cytotoxicity assay results for ADAM17-edited cells from donors 512 and 558 tested against Raji cells at an E:T of 2:1. In Figures 24C-24G, Raji cells were pre-coated with cetuximab (anti-EGFR) or rituximab (anti-CD20) for 30 minutes to determine whether antibody-dependent cellular cytotoxicity (ADCC) was enhanced when antibody-coated Raji cells were incubated with CAR NK cells with ADAM17 editing. Figure 24C shows results for NK cells expressing a CD70-directed CAR edited as indicated, with or without the presence of cetuximab, at an E:T of 1:2 (Figure 24C) or 1:4 (Figure 24D). Additional ADCC assays were performed after incubation of target cells with rituximab, with assays performed at 1:2 (Figure 24E) and 1:4 (Figure 24F) with expression of a CD19-directed CAR, and at 1:1 (Figure 24G) without expression of a CD19-directed CAR. [Figure 25] Figure 25 depicts a schematic workflow for assessing gene editing as disclosed herein. [Figure 26] Figure 26 summarizes % viability and fold expansion data from days 1 and 3 for NK cells expressing non-limiting examples of CD70-directed CARs, compiled as indicated. [Figure 27] Figures 27A-27F depict flow cytometry results for NK cells expressing non-limiting examples of CD70-directed CARs edited as indicated. Figures 27A-27B depict CD56 and CD70 staining of NK cells expressing CD70-directed CARs edited as indicated. Figures 27C-27E depict % CD70-positive cells edited for CD38 (Figure 27C), LAG3 (Figure 27D), and ADAM17 (Figure 27E). Figure 27F summarizes the data from Figures 27C-27E. [Figure 28] Figure 28 depicts the results of a cellular mitochondrial stress study under hypoxic conditions for NK cells expressing non-limiting examples of CD70-directed CARs edited as indicated. [Figure 29] Figures 29A-29B show in vitro cytotoxicity data against tumor cells for NK cells expressing non-limiting examples of CD70-directed CARs edited as shown. Figure 29A shows cytotoxicity data for a CD70-directed CAR edited to create a triple knockout. Figure 29B shows cytotoxicity data for a CD70-directed CAR edited to create a quadruple knockout. [Figure 30]Figure 30A depicts the results of an in vivo anti-tumor activity assay, where mice were injected with 786-O cells on day -7, followed by an injection of NK cells expressing non-limiting examples of CD70-directed CARs edited as indicated to be double (CISH / CBLB) or triple (CISH / CBLB / HIF1a, CISH / CBLB / ADAM17, or CISH / CBLB / FBP1) knockout on day 0, with assessment of tumor volume (TV) over a 25-day period. Figure 30B depicts the results of an in vivo anti-tumor activity assay, where mice were injected with HL60 cells on day -2, followed by an injection of NK cells expressing non-limiting examples of CD70-directed CARs edited as indicated to be double (CISH / CBLB) or triple (CISH / CBLB / ADAM17) knockout on day 0, with assessment of tumor volume (TV) over a 30-day period. [Figure 31] Figure 31 depicts a schematic workflow for assessing gene editing as disclosed herein. [Figure 32] Figures 32A-32B represent in vitro cytotoxicity data against tumor cells for NK cells expressing non-limiting examples of CD70-directed CARs compiled as shown for the following genes: MED12, CCNC, CDK8, ID3, SOX4. [Figure 33] Figure 33 depicts expression of CD70-targeted CARs by NK cells from three different donors edited as indicated for the following genes: CD70, MED12, CDK8, CCNC, CISH, ID3, SOX4. [Figure 34] Figures 34A-34B relate to glycolytic stress tests and glycolytic capacity, respectively. Figures 34A and 34B show the corresponding extracellular acidification rate (ECAR) and oxygen consumption rate (OCR) data for NK cells expressing CD70-directed CARs, compiled as indicated. [Figure 35] Figure 35 depicts expression of CD19-targeted CARs by NK cells from donors edited in the indicated target genes. [Figure 36]Figures 36A-36B depict in vitro cytotoxicity data against Nalm6 tumor cells. Figures 36A-36B show data for NK cells expressing non-limiting examples of CD19-directed CARs, edited as indicated, on day 6 against Nalm6 cells using an effector-to-target ratio (E:T) of 1:1 in the absence of TGF-β for Figure 36A and in the presence of TGF-β for Figure 36B. [Figure 37] Figure 37 relates to extracellular acidification rate (ECAR) data for NK cells expressing CD19-directed CARs compiled as indicated. [Figure 38] Figures 38A-38B relate to the proliferative capacity of NK cells expressing CD19-directed CARs edited as indicated. Figure 38A depicts the proliferative capacity of edited CD19-CAR NK cells from three different healthy donors, and Figure 38B depicts a quantification of the data presented in Figure 38A. [Figure 39] Figure 39 depicts a schematic workflow for assessing gene editing as disclosed herein. [Figure 40] Figures 40A-40B represent in vitro cytotoxicity data against Nalm6 tumor cells. Figures 40A-40B show data for NK cells expressing non-limiting examples of CD19-directed CARs tested as indicated starting at day 14 against Nalm6 target cells and Nalm6 cells in the absence (Figure 40A) or presence (Figure 40B) of TGF-β at an E:T ratio of 1:2 or 1:1, respectively. Figure 40C represents assessment of cytokine production by Luminex® multiplex assay of donor-derived CD19-CAR NK cells edited as indicated at day 6 in the absence or presence of Nalm6 cells and TGF-β at an E:T ratio of 1:1. [Figure 41] Figure 41A depicts a diagram of in vivo treatment with CD19 CAR NK cells edited as indicated. Figures 41B-41C depict tumor burden (Figure 41B) and CD19 CAR NK cell persistence (Figure 41C), respectively, in a mouse model of acute lymphoblastic leukemia (ALL). [Figure 42] Figures 42A-42B represent the cytotoxicity of edited BCMA1 CAR-expressing NK cells at the indicated targets against BCMA-expressing Daudi cells at effector to target ratios (E:T) of 1:2 and 1:4, respectively. [Figure 43] Figures 43A-43B represent the cytotoxicity of edited BCMA2 CAR-expressing NK cells at the indicated targets against BCMA-expressing MM.1S cells at effector to target ratios (E:T) of 1:1 and 1:2, respectively. DETAILED DESCRIPTION OF THE INVENTION

[0123] Detailed Description Some embodiments of the methods and compositions provided herein relate to engineered immune cells and combinations thereof for use in immunotherapy. In some embodiments, the engineered cells are engineered in multiple ways, for example, to express a receptor complex that induces cytotoxicity. As used herein, the term "cytotoxic receptor complex" shall be given its ordinary meaning and shall refer to chimeric antigen receptors (CARs) and chimeric receptors (in the case of NKG2D chimeric receptors, also referred to as activating chimeric receptors) (unless otherwise indicated). In some embodiments, the cells are further engineered to achieve modified cellular reactivity toward non-tumor tissue. Some embodiments relate to the modification of T cells by various genetic engineering methodologies such that the resulting T cells have reduced and / or eliminated alloreactivity. Such non-alloreactive T cells can also be engineered to express a chimeric antigen receptor (CAR), which enables the non-alloreactive T cells to exert a cytotoxic effect against tumor cells. In some embodiments, natural killer (NK) cells are also engineered to express a receptor complex that induces cytotoxicity (e.g., a chimeric antigen receptor or a chimeric receptor). In some embodiments, combinations of these engineered immune cell types are used in immunotherapy, which results in both rapid (NK cell-based) and long-lasting (T cell-based) anti-tumor effects, all while advantageously having little to no graft-versus-host disease (GvHD). Some embodiments include methods of use of the compositions or cells in immunotherapy.

[0124] Although autologous CAR T cell therapy has been developed and shown to exhibit considerable in vivo persistence and efficacy, the majority of patients treated with autologous CAR T cell therapy experience cytokine release syndrome (CRS) and / or neurotoxicity. Furthermore, autologous CAR T cell therapy faces numerous challenges, including the need for leukapheresis and then producing a matched CAR T cell product from patients who are often highly ill, have undergone severe conditioning, or both. Producing a sufficient number of CAR T cells from such patients can be difficult, or in some cases, impossible. In addition, potential patients may not survive the time it takes to produce the final CAR T cell product from T cells obtained from the patient.

[0125] In contrast, NK cell therapy, including allogeneic NK cell therapy produced from healthy donors, can obviate many of these challenges. For example, the manufacturing success rate for allogeneic CAR NK cells can be higher due to the better quality of the derived donor cells. Allogeneic CAR NK cell therapy can also be provided to patients when needed, without the need to wait for the patient's own cells to be manufactured. As such, allogeneic NK cell therapy is being considered for use as a commercial product. Despite the potential advantages offered by NK cells, they have not been shown to persist in vivo to the same extent as T cells. Therefore, a solution is needed to overcome this challenge. Gene editing that can increase the persistence, efficacy (e.g., cytotoxicity), or both of NK cells is described herein. Embodiments of such gene-edited NK cells include compositions and methods of using them to treat a disease or condition (e.g., cancer) in a subject. For example, the experiments described herein have surprisingly found that disruption of specific genes, including ADAM17, MED12, CISH, CBLB, or a combination thereof, conferred beneficial effects on NK cells, including enhanced cytotoxicity both in vitro and in vivo. These results were observed in NK cells expressing CARs targeting different antigens (e.g., BCMA, CD19, or CD70). Without wishing to be bound by theory, these findings are consistent with the observation that such gene editing can confer advantages to CAR-expressing NK cells, regardless of the specific antigen targeted by the CAR.

[0126] The term "anti-cancer effect" refers to a biological effect that may be exerted by various means, including, but not limited to, a reduction in tumor volume, a reduction in the number of cancer cells, a reduction in the number of metastases, an increase in life expectancy, a reduction in cancer cell proliferation, a reduction in cancer cell survival, and / or an improvement in various physiological symptoms associated with a cancerous condition.

[0127] cell type Some embodiments of the methods and compositions provided herein relate to cells, such as immune cells. In some embodiments, the immune cells are engineered to express a chimeric receptor that binds to an antigen (e.g., an antigen expressed by a cancer cell). For example, immune cells, such as T cells, may be engineered to contain a chimeric receptor, such as a CD19-directed chimeric receptor, or may be engineered to contain a nucleic acid encoding said chimeric receptor described herein. In some embodiments, NK cells are engineered to express a chimeric receptor that binds to an antigen (e.g., an antigen expressed by a cancer cell). Additional embodiments relate to engineering a second set of cells to express another cytotoxic receptor complex, such as the NKG2D-chimeric receptor complex disclosed herein. Thus, in some embodiments, combinations or compositions comprising two different types of immune cells (e.g., T cells and NK cells) are contemplated. In some embodiments, the engineered T cells and the engineered NK cells express the same chimeric receptor. In some embodiments, the engineered T cells and the engineered NK cells express different chimeric receptors. In some embodiments, the engineered T cells and the engineered NK cells express chimeric receptors that bind to the same antigen (e.g., different epitopes of the same antigen). In some embodiments, the engineered T cells and the engineered NK cells express chimeric receptors that bind to different antigens.

[0128] Additional embodiments relate to the further genetic manipulation of NK cells (e.g., donor NK cells) to increase the persistence and / or potency of the engineered NK cells. Yet additional embodiments relate to the further genetic manipulation of T cells (e.g., donor T cells) to reduce, disrupt, minimize, and / or eliminate the ability of donor T cells to be alloreactive to recipient cells (graft-versus-host disease). For example, in some embodiments, T cells are engineered to reduce alloreactivity to recipient cells.

[0129] Traditional anti-cancer therapies have relied on surgical approaches, radiation therapy, chemotherapy, or a combination of these methods. As research has led to a deeper understanding of some of the mechanisms of certain cancers, this knowledge has been utilized to develop targeted cancer therapies. Targeted therapy is a cancer treatment that uses certain drugs to target specific genes or proteins found in cancer cells or cells that support cancer growth (such as vascular cells) to reduce or stop the growth of cancer cells. More recently, genetic engineering has made it possible to exploit and develop certain aspects of the immune system to fight cancer. In some cases, a patient's own immune cells are modified to specifically eradicate the patient's type of cancer. Various types of immune cells, such as T cells, natural killer (NK cells), or a combination thereof, can be used, as described in more detail below.

[0130] To facilitate cancer immunotherapy, provided herein are polynucleotides (e.g., encoding chimeric receptors), polypeptides (e.g., chimeric receptors), and vectors encoding chimeric antigen receptors (CARs) comprising a target-binding moiety (e.g., an extracellular binding agent of a ligand expressed by cancer cells, or a tumor marker-directed chimeric receptor) and a cytotoxic signaling complex. For example, some embodiments include polynucleotides, polypeptides, or vectors encoding, e.g., chimeric antigen receptors directed against tumor markers, e.g., CD19, CD123, CD70, Her2, mesothelin, claudin 6, BCMA, EGFR, etc., to facilitate targeting of immune cells to cancer and conferring a cytotoxic effect on cancer cells. Engineered immune cells (e.g., T cells or NK cells) expressing such CARs are also provided. In some embodiments, the chimeric antigen receptor binds to a ligand for NKG2D. In some embodiments, the chimeric antigen receptor binds to CD19. In some embodiments, the chimeric antigen receptor binds to CD70. In some embodiments, the chimeric antigen receptor binds to BCMA. In some embodiments, polynucleotides, polypeptides, and vectors encoding constructs comprising an extracellular domain comprising two or more subdomains, for example, a first CD19 targeting subdomain comprising a CD19-binding moiety disclosed herein, and a second subdomain comprising a C-type lectin-like receptor and a cytotoxic signaling complex, are also provided herein. Engineered immune cells (e.g., T cells or NK cells) expressing such bispecific constructs are also provided herein. Methods for treating cancer and other uses of such cells for cancer immunotherapy are also provided herein.

[0131] Also provided are chimeric receptors comprising antigen binding domains and cytotoxic signal transduction complexes.For example, some embodiments comprise chimeric receptors directed against tumor antigens (e.g., CD19, BCMA, or CD70).Also provided are immune cells (e.g., NK cells) engineered to express such CARs.In some embodiments, immune cells are gene-edited (e.g., in MED12 and / or CISH).

[0132] Also provided herein are polynucleotides (e.g., encoding chimeric receptors), polypeptides (e.g., chimeric receptors), and vectors encoding chimeric receptors that comprise a target-binding moiety (e.g., an extracellular binding agent of a ligand expressed by cancer cells) and a cytotoxic signaling complex to facilitate cancer immunotherapy. For example, some embodiments include polynucleotides, polypeptides, or vectors encoding activating chimeric receptors that comprise an NKG2D extracellular domain directed against, for example, tumor markers such as MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6, to facilitate targeting of immune cells to cancer and conferring a cytotoxic effect on cancer cells. In some embodiments, the chimeric receptor comprises the extracellular domain of NKG2D.

[0133] Also provided herein are engineered immune cells (e.g., T cells or NK cells) that express such chimeric receptors. In some embodiments, polynucleotides, polypeptides, and vectors encoding constructs comprising two or more subdomains, e.g., an extracellular domain comprising a first and second ligand-binding receptor and a cytotoxic signaling complex, are also provided herein. Also provided herein are engineered immune cells (e.g., T cells or NK cells) that express such bispecific constructs (in some embodiments, the first and second ligand-binding domains target the same ligand). Also provided herein are methods for treating cancer and other uses of such cells for cancer immunotherapy.

[0134] Engineered cells for immunotherapy In some embodiments, immune system cells are engineered to enhance their cytotoxic effect on target cells, such as tumor cells. For example, immune system cells may be engineered to contain the tumor-targeting chimeric receptors and / or tumor-targeting CARs described herein. In some embodiments, white blood cells or leukocytes are used because their native function is to defend the body against abnormal cell growth and infectious diseases. Various types of white blood cells play specific roles in the human immune system and are therefore preferred starting points for the cell engineering disclosed herein. White blood cells include granulocytes and agranulocytes (the presence or absence of granules in the cytoplasm, respectively). Granulocytes include basophils, eosinophils, neutrophils, and mast cells. Agranulocytes include lymphocytes and monocytes. Cells, such as those described below or otherwise herein, may be engineered to contain a chimeric receptor, e.g., an NKG2D-chimeric receptor, and / or a CAR, e.g., a CD19-directed CAR, or a nucleic acid encoding a chimeric receptor or CAR. In some embodiments, the cells may be engineered to co-express a membrane-bound interleukin-15 (mbIL15) domain. In some embodiments, immune cells engineered to express a chimeric receptor are engineered to bicistronically express the mbIL15 domain. As discussed in more detail below, in some embodiments, the cells, particularly T cells, are further genetically modified to reduce and / or eliminate alloreactivity of the cells.

[0135] Monocytes for immunotherapy In some embodiments, the immune cells include monocytes. Monocytes are a subtype of white blood cells. Monocytes can differentiate into macrophages and myeloid-lineage dendritic cells. Monocytes are associated with the adaptive immune system and perform the primary functions of phagocytosis, antigen presentation, and cytokine production. Phagocytosis is the process of engulfment or cellular invasion of cellular material, followed by digestion and destruction of the engulfed cellular material.

[0136] In some embodiments, the monocytes are positive for cell surface expression of a marker selected from the group consisting of CCR2, CCR5, CD11c, CD14, CD16, CD62L, CD68+, CX3CR1, HLA-DR, or any combination thereof. In some embodiments, the monocytes are positive for cell surface expression of CD14. In some embodiments, the monocytes are positive for cell surface expression of CCR2. In some embodiments, the monocytes are positive for cell surface expression of CCR5. In some embodiments, the monocytes are positive for cell surface expression of CD62L.

[0137] In some embodiments, monocytes are used in conjunction with one or more additional engineered cells disclosed herein. Some embodiments of the methods and compositions described herein relate to monocytes comprising tumor-targeting CARs or nucleic acids encoding tumor-targeting CARs. In some embodiments, the monocytes express CARs that bind to tumor antigens, such as CD19, CD123, CD70, Her2, mesothelin, claudin 6, BCMA, or EGFR.

[0138] In some embodiments, monocytes are engineered to express a membrane-bound interleukin-15 (mbIL15) domain. In some embodiments, monocytes engineered to express a chimeric receptor are also engineered to express (e.g., bicistronic) a membrane-bound interleukin-15 (mbIL15) domain. Thus, in some embodiments, monocytes are engineered to bicistronicly express a chimeric receptor and mbIL15. Some embodiments of the methods and compositions disclosed herein relate to monocytes engineered to express a CAR that targets a tumor marker, e.g., CD19, CD123, CD70, Her2, mesothelin, claudin 6, BCMA, EGFR, and a membrane-bound interleukin-15 (mbIL15) domain, among others disclosed herein. Some embodiments of the methods and compositions disclosed herein relate to monocytes engineered to express activating chimeric receptors that target ligands on tumor cells, such as MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6 (among others), and optionally, the membrane-bound interleukin-15 (mbIL15) domain.

[0139] In some embodiments, the monocytes are allogeneic cells. In some embodiments, the monocytes are obtained from a donor who does not have cancer.

[0140] Lymphocytes for immunotherapy In some embodiments, immune cells comprise lymphocytes. Lymphocytes, the other major subtype of white blood cells, include T cells (cell-mediated, cytotoxic adaptive immunity), natural killer cells (cell-mediated, cytotoxic innate immunity), and B cells (humoral, antibody-driven adaptive immunity). While B cells are engineered according to some embodiments disclosed herein, some embodiments also relate to engineered T cells or engineered NK cells (mixtures of T cells and NK cells are used in some embodiments, either from the same donor or different donors). Thus, in some embodiments, immune cells comprise T cells. In some embodiments, immune cells comprise NK cells. In some embodiments, immune cells comprise T cells and NK cells. In some embodiments, immune cells comprise B cells.

[0141] In some embodiments, lymphocytes are used in conjunction with one or more additional engineered cells disclosed herein. Some embodiments of the methods and compositions described herein relate to lymphocytes comprising tumor-targeting CARs or nucleic acids encoding tumor-targeting CARs. In some embodiments, lymphocytes express CARs that bind to tumor antigens, such as CD19, CD123, CD70, Her2, mesothelin, claudin 6, BCMA, or EGFR.

[0142] In some embodiments, lymphocytes are engineered to express a membrane-bound interleukin-15 (mbIL15) domain. In some embodiments, lymphocytes engineered to express a chimeric receptor are also engineered to express (e.g., bicistronic) a membrane-bound interleukin-15 (mbIL15) domain. Thus, in some embodiments, lymphocytes are engineered to bicistronicly express a chimeric receptor and mbIL15. Some embodiments of the methods and compositions disclosed herein relate to lymphocytes engineered to express a CAR that targets a tumor marker, e.g., CD19, CD123, CD70, Her2, mesothelin, claudin 6, BCMA, EGFR, and a membrane-bound interleukin-15 (mbIL15) domain, among others disclosed herein. Some embodiments of the methods and compositions disclosed herein relate to lymphocytes engineered to express activating chimeric receptors that target ligands on tumor cells, such as MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6 (among others), and optionally, the membrane-bound interleukin-15 (mbIL15) domain.

[0143] In some embodiments, the lymphocytes are allogeneic cells. In some embodiments, the lymphocytes are obtained from a donor who does not have cancer. T Cells for Immunotherapy

[0144] In some embodiments, the immune cells comprise T cells, which are distinguishable from other lymphocyte subtypes (e.g., B cells or NK cells) based on the presence of T cell receptors on the cell surface.

[0145] T cells can be divided into a variety of different subtypes, including effector T cells, helper T cells, cytotoxic T cells, memory T cells, regulatory T cells, natural killer T cells, mucosal-associated invariant T cells, and gamma delta T cells. In some embodiments, a specific subtype of T cells is engineered. In some embodiments, the T cells are positive for cell surface expression of a marker selected from the group consisting of CD3, CD4, and / or CD8. In some embodiments, the T cells are positive for cell surface expression of CD3. In some embodiments, the T cells are positive for cell surface expression of CD4. In some embodiments, the T cells are positive for cell surface expression of CD8.

[0146] In some embodiments, CD3+ T cells are engineered. In some embodiments, CD4+ T cells are engineered. In some embodiments, CD8+ T cells are engineered. In some embodiments, regulatory T cells are engineered. In some embodiments, gamma delta T cells are engineered. In some embodiments, a mixed pool of T cell subtypes is engineered. For example, in some embodiments, CD4+ and CD8+ T cells are engineered. In some embodiments, there is no specific selection of the type of T cell engineered to express a cytotoxicity receptor complex disclosed herein. In some embodiments, certain techniques, such as the use of cytokine stimulation, are used to enhance the expansion / harvesting of T cells with specific marker profiles. For example, in some embodiments, activation of certain human T cells, e.g., CD4+ T cells, CD8+ T cells, is achieved by the use of CD3 and / or CD28 as stimulatory molecules.

[0147] In some embodiments, methods of treating or preventing cancer or infectious disease are provided, comprising administering a therapeutically effective amount of T cells expressing a cytotoxic receptor complex and / or a homing moiety described herein. In some embodiments, methods of treating or preventing cancer or infectious disease are provided, comprising administering T cells expressing a cytotoxic receptor complex described herein. In some embodiments, the engineered T cells are autologous, while in some embodiments, the T cells are allogeneic. In some embodiments, the T cells are allogeneic. In some embodiments, the T cells are obtained from a cancer-free donor.

[0148] Some embodiments of the methods and compositions disclosed herein relate to T cells engineered to express a CAR that targets tumor markers, such as CD19, CD123, CD70, Her2, mesothelin, claudin 6, BCMA, EGFR, and membrane-bound interleukin-15 (mbIL15) domains, among others disclosed herein. In some embodiments, the T cells express a CAR that binds to CD19. In some embodiments, the T cells express a CAR that binds to CD70. In some embodiments, the T cells express a CAR that binds to BCMA. Some embodiments of the methods and compositions disclosed herein relate to T cells engineered to express an activating chimeric receptor that targets a ligand on tumor cells, such as MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6 (among others), and, optionally, membrane-bound interleukin-15 (mbIL15) domains. In some embodiments, the T cells express a chimeric receptor that binds to an NKG2D ligand. In some embodiments, the T cell expresses a chimeric receptor comprising the extracellular domain of NKG2D.

[0149] In some embodiments, T cells are engineered to express a membrane-bound interleukin-15 (mbIL15) domain. In some embodiments, T cells engineered to express a chimeric receptor are also engineered to express (e.g., bicistronic) a membrane-bound interleukin-15 (mbIL15) domain. Thus, in some embodiments, T cells are engineered to bicistronicly express a chimeric receptor and mbIL15.

[0150] In some embodiments, the immune cells include T cells and NK cells (either from the same donor or from different donors).

[0151] NK cells for immunotherapy In some embodiments, the immune cells comprise natural killer (NK) cells. In some embodiments, methods of treating or preventing cancer or infectious diseases are provided, comprising administering a therapeutically effective amount of natural killer (NK) cells expressing a cytotoxic receptor complex and / or a homing moiety described herein. In some embodiments, methods of treating or preventing cancer are provided, comprising administering natural killer (NK) cells expressing a cytotoxic receptor complex described herein. In some embodiments, methods of treating or preventing infectious diseases are provided, comprising administering natural killer (NK) cells expressing a cytotoxic receptor complex described herein. In some embodiments, the engineered NK cells are autologous cells, while in some embodiments, the NK cells are allogeneic cells.

[0152] In some embodiments, NK cells are preferred due to the relatively high natural cytotoxicity of NK cells. In some embodiments, it is unexpectedly beneficial that the engineered cells disclosed herein can further upregulate the cytotoxic activity of NK cells, resulting in even more effective activity against target cells (e.g., tumor or other diseased cells).

[0153] In some embodiments, the NK cells are positive for cell surface expression of a marker selected from the group consisting of CCR7, CD16, CD56, CD57, CD11, CX3CR1, killer Ig-like receptor (KIR), NKp30, NKp44, NKp46, or any combination thereof. In some embodiments, the NK cells are positive for cell surface expression of CD16. In some embodiments, the NK cells are positive for cell surface expression of CD56. In some embodiments, the NK cells are positive for cell surface expression of killer Ig-like receptor.

[0154] Some embodiments of the methods and compositions described herein relate to NK cells engineered to express a CAR that targets a tumor marker, e.g., CD19, CD123, CD70, Her2, mesothelin, claudin 6, BCMA, EGFR, and, optionally, a membrane-bound interleukin-15 (mbIL15) domain, among others disclosed herein. In some embodiments, the NK cells express a CAR that binds to CD19. In some embodiments, the NK cells express a CAR that binds to CD70. In some embodiments, the NK cells express a CAR that binds to BCMA. Some embodiments of the methods and compositions disclosed herein relate to NK cells engineered to express an activating chimeric receptor that targets a ligand on tumor cells, e.g., MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6 (among others), and, optionally, a membrane-bound interleukin-15 (mbIL15) domain. In some embodiments, the NK cells express a chimeric receptor that binds to an NKG2D ligand. In some embodiments, the NK cells express a chimeric receptor comprising the extracellular domain of NKG2D.

[0155] In some embodiments, NK cells are engineered to express a membrane-bound interleukin-15 (mbIL15) domain. In some embodiments, NK cells engineered to express a chimeric receptor are also engineered to express (e.g., bicistronic) a membrane-bound interleukin-15 (mbIL15) domain. Thus, in some embodiments, NK cells are engineered to bicistronicly express a chimeric receptor and mbIL15.

[0156] In some embodiments, the NK cells are derived from the cell line NK-92. NK-92 cells are derived from NK cells but lack the major inhibitory receptors exhibited by normal NK cells, while retaining major activating receptors. Some embodiments of the NK-92 cells described herein relate to NK-92 cells engineered to silence certain additional inhibitory receptors, such as SMAD3, which allow for upregulation of interferon-γ (IFNγ), granzyme B, and / or perforin production. Additional information regarding the NK-92 cell line is disclosed in WO 1998 / 49268 and U.S. Patent Application Publication No. 2002-0068044, both of which are incorporated herein by reference in their entireties.

[0157] In some embodiments, NK cells are used in combination with T cells. Thus, in some embodiments, the immune cells comprise T cells and NK cells (either from the same donor or from different donors). NK-92 cells are used in some embodiments in combination with one or more of the other cell types disclosed herein. For example, in one embodiment, NK-92 cells are used in combination with the NK cells disclosed herein. In additional embodiments, NK-92 cells are used in combination with the T cells disclosed herein.

[0158] Hematopoietic stem cells for cancer immunotherapy In some embodiments, hematopoietic stem cells (HSCs) are used in the immunotherapy methods disclosed herein. In some embodiments, the cells are engineered to express a homing moiety and / or a cytotoxic receptor complex. In some embodiments, the cells are engineered to express a cytotoxic receptor complex. HSCs are used in some embodiments to exploit their ability to engraft long-term blood cell production, which can provide a sustained source of targeted anti-cancer effector cells, e.g., to effect cancer remission. In some embodiments, this ongoing production serves to counteract anergy or depletion of other cell types, e.g., due to the tumor microenvironment.

[0159] In some embodiments, the HSCs are positive for cell surface expression of a marker selected from the group consisting of CD34, CD59, and CD90. In some embodiments, the HSCs are positive for cell surface expression of CD34. In some embodiments, the HSCs are positive for cell surface expression of CD59. In some embodiments, the HSCs are positive for cell surface expression of CD90.

[0160] In some embodiments, allogeneic HSCs are used, while in some embodiments, autologous HSCs are used. In some embodiments, HSCs are used in combination with one or more additional engineered cell types disclosed herein. Some embodiments of the methods and compositions described herein relate to stem cells, e.g., hematopoietic stem cells, engineered to express CARs that target tumor markers, such as CD19, CD123, CD70, Her2, mesothelin, claudin 6, BCMA, EGFR, and optionally, membrane-bound interleukin-15 (mbIL15) domains, among others disclosed herein. Some embodiments of the methods and compositions disclosed herein relate to hematopoietic stem cells engineered to express activating chimeric receptors that target ligands on tumor cells, such as MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6 (among others), and optionally, membrane-bound interleukin-15 (mbIL15) domains.

[0161] induced pluripotent stem cells In some embodiments, immune cells are derived (differentiated) from pluripotent stem cells (PSCs). In some embodiments, immune cells (e.g., NK and / or T cells) derived from induced pluripotent stem cells (iPSCs) are used in the immunotherapy methods disclosed herein. For example, in some embodiments, NK cells are derived from iPSCs. In some embodiments, induced pluripotent stem cells (iPSCs) are used in the immunotherapy methods disclosed herein. In some embodiments, iPSCs are used to exploit their ability to differentiate or divide into non-pluripotent cells, including, but not limited to, CD34 cells, hemogenic endothelial cells, HSCs (hematopoietic stem and progenitor cells), hematopoietic multipotent progenitor cells, T cell precursors, NK cell precursors, T cells, NKT cells, NK cells, and B cells containing one or several genetic modifications at selected sites, or less differentiated cells containing the same genetic modifications at the same selected sites. In some embodiments, iPSCs are used to generate iPSC-derived NK or T cells. In some embodiments, the iPSCs are used to generate iPSC-derived NK cells. In some embodiments, the iPSCs are used to generate iPSC-derived T cells.

[0162] In some embodiments, the cells are engineered to express a homing moiety and / or a cytotoxic receptor complex. In some embodiments, the cells are engineered to express a cytotoxic receptor complex. In some embodiments, iPSCs are used in combination with one or more additional engineered cell types disclosed herein.

[0163] Some embodiments of the methods and compositions disclosed herein relate to induced pluripotent stem cells engineered to express an activating chimeric receptor that targets a ligand on tumor cells, such as CD19, CD123, CD70, Her2, mesothelin, claudin 6, BCMA, or EGFR. In some embodiments, iPSCs engineered to express a chimeric receptor are also engineered to express (e.g., bicistronic) a membrane-bound interleukin-15 (mbIL15) domain. Some embodiments of the methods and compositions described herein relate to stem cells, e.g., induced pluripotent stem cells, engineered to express a CAR that targets a tumor marker, such as CD19, CD123, CD70, Her2, mesothelin, claudin 6, BCMA, EGFR, and, optionally, a membrane-bound interleukin-15 (mbIL15) domain, among others disclosed herein.

[0164] Some embodiments of the methods and compositions disclosed herein relate to induced pluripotent stem cells engineered to express activating chimeric receptors that target ligands on tumor cells, such as MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6 (among others). In some embodiments, iPSCs engineered to express chimeric receptors are also engineered to express (e.g., bicistronic) a membrane-bound interleukin-15 (mbIL15) domain. Some embodiments of the methods and compositions disclosed herein relate to induced pluripotent stem cells engineered to express activating chimeric receptors that target ligands on tumor cells, such as MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6 (among others), and, optionally, a membrane-bound interleukin-15 (mbIL15) domain.

[0165] In some embodiments, the engineered iPSCs are differentiated into NK, T, or other immune cells, e.g., for use in the compositions or methods provided herein. In some embodiments, the engineered iPSCs are differentiated into NK cells. In some embodiments, the engineered iPSCs are differentiated into T cells. In some embodiments, the engineered iPSCs are differentiated into NK and T cells.

[0166] Gene editing of immune cells As discussed above, various cell types can be utilized in cellular immunotherapy. Furthermore, as detailed in more detail below and shown in the Examples, genetic modifications can be made to these cells to enhance one or more aspects of their efficacy (e.g., cytotoxicity) and / or durability (e.g., active lifespan). As discussed herein, in some embodiments, NK cells are used for immunotherapy. In some embodiments provided herein, gene editing of NK cells can advantageously confer the edited NK cells the ability to resist and / or overcome various inhibitory signals generated in the tumor microenvironment. Tumors are known to produce various signaling molecules intended to reduce the anti-tumor effect of immune cells. As discussed in more detail below, in some embodiments, gene editing of NK cells limits the tumor microenvironment's suppressive effect on NK cells, T cells, a combination of NK cells and T cells, or any edited / engineered immune cells provided herein.

[0167] As discussed below, in some embodiments, gene editing is used to reduce or knock out expression of a target protein, for example, by disrupting the underlying gene that encodes the protein.

[0168] In some embodiments, gene editing can reduce transcription of the target gene by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, gene editing reduces transcription of the target gene by at least about 30%. In some embodiments, gene editing reduces transcription of the target gene by at least about 40%. In some embodiments, gene editing reduces transcription of the target gene by at least about 50%. In some embodiments, gene editing reduces transcription of the target gene by at least about 60%. In some embodiments, gene editing reduces transcription of the target gene by at least about 70%. In some embodiments, gene editing reduces transcription of the target gene by at least about 80%. In some embodiments, gene editing reduces transcription of the target gene by at least about 90%. In some embodiments, the gene is completely knocked out, such that transcription of the target gene is undetectable.

[0169] In some embodiments, gene editing can reduce target protein expression by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, gene editing reduces target protein expression by at least about 30%. In some embodiments, gene editing reduces target protein expression by at least about 40%. In some embodiments, gene editing reduces target protein expression by at least about 50%. In some embodiments, gene editing reduces target protein expression by at least about 60%. In some embodiments, gene editing reduces target protein expression by at least about 70%. In some embodiments, gene editing reduces target protein expression by at least about 80%. In some embodiments, gene editing reduces target protein expression by at least about 90%. In some embodiments, the gene is completely knocked out, such that target protein expression is undetectable.

[0170] In some embodiments, gene editing is used to "knock in" or otherwise increase transcription of a target gene. In some embodiments, transcription of the target gene is increased by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, transcription of the target gene is increased by at least about 30%. In some embodiments, transcription of the target gene is increased by at least about 40%. In some embodiments, transcription of the target gene is increased by at least about 50%. In some embodiments, transcription of the target gene is increased by at least about 60%. In some embodiments, transcription of the target gene is increased by at least about 70%. In some embodiments, transcription of the target gene is increased by at least about 80%. In some embodiments, transcription of the target gene is increased by at least about 90%. In some embodiments, transcription of the target gene is increased by at least about 100%.

[0171] In some embodiments, gene editing is used to "knock in" or otherwise enhance expression of a target protein. In some embodiments, target protein expression can be enhanced by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, target protein expression is increased by at least about 30%. In some embodiments, target protein expression is increased by at least about 40%. In some embodiments, target protein expression is increased by at least about 50%. In some embodiments, target protein expression is increased by at least about 60%. In some embodiments, target protein expression is increased by at least about 70%. In some embodiments, target protein expression is increased by at least about 80%. In some embodiments, target protein expression is increased by at least about 90%. In some embodiments, target protein expression is increased by at least about 100%.

[0172] Unless otherwise indicated to the contrary, sequences provided for guide RNAs (gRNAs) that are recited using deoxyribonucleotides refer to target DNA sequences (complementary to the corresponding non-target DNA sequence to which the gRNA binds) and should be considered as referring to those guides actually used (e.g., ribonucleotides are used when the ribonucleotide uracil is used in place of the deoxyribonucleotide thymine, or conversely, when thymine is used in place of uracil, where both are complementary base pairs to adenine when reciting either an RNA or DNA sequence). In other words, the sequences provided for particular gRNAs provided herein are identical to the gRNA sequences actually used, except that the gRNA sequence contains uracil in place of thymine. For example, a gRNA having the sequence ATGCTCAATGCGTC (SEQ ID NO: 977) shall also refer to the following sequence AUGCUCAAUGCGUC (SEQ ID NO: 978), or a gRNA having the sequence AUGCUCAAUGCGUC (SEQ ID NO: 978) shall also refer to the following sequence ATGCTCAATGCGTC (SEQ ID NO: 977). Furthermore, the non-target DNA sequence to which a particular gRNA sequence binds is complementary to the sequence of the particular gRNA. For example, a gRNA having the provided sequence of ATGCTCAATGCGTC (SEQ ID NO: 977) binds to a non-target DNA sequence of TACGAGTTACGCAG (SEQ ID NO: 979). In this situation, the corresponding target DNA sequence that is complementary to the non-target DNA sequence is ATGCTCAATGCGTC (SEQ ID NO: 977).

[0173] In some embodiments, gene editing of immune cells can also provide unexpectedly enhanced expansion, persistence, and / or cytotoxicity of the edited immune cells. As disclosed herein, engineered cells (e.g., those expressing CARs) can also be edited in combination to provide robust cells for immunotherapy. In some embodiments, editing unexpectedly allows for improved expansion, persistence, and / or cytotoxicity of NK cells. In some embodiments, knocking out gene expression in NK cells removes potent negative regulators or other inhibitors of NK cell signaling and / or activity, thereby disinhibiting NK cells and allowing for one or more of enhanced NK cell homing, NK cell migration, NK cell activation, expansion, cytotoxicity, and / or persistence. Additionally, in some embodiments, editing can enhance NK and / or T cell function in an otherwise suppressive tumor microenvironment.

[0174] In some embodiments, gene editing (whether knockout or knock-in) of any of the target genes disclosed herein is achieved by targeted introduction of DNA breaks and subsequent DNA repair mechanisms. In some embodiments, DNA double-strand breaks are repaired by non-homologous end joining (NHEJ), where enzymes are used to directly bind to the DNA ends to repair the break. NHEJ is an error-prone process. Generally, in the absence of a repair template, the NHEJ process re-ligates the ends of the broken DNA strand, which frequently results in the deletion and insertion of nucleotides at the break site. In some embodiments, however, double-strand breaks (DSBs) are repaired by homology-directed repair (HDR), which is advantageously more accurate and thereby allows sequence-specific excision and repair. HDR uses a vector carrying a desired genetic element (e.g., an insertion element that disrupts the coding sequence of a gene) within a homologous sequence, for example, a sequence that is homologous to the flanking sequence of the double-strand break, as a template for regenerating the missing DNA sequence at the break point. This will result in the desired change (for example, insertion) being inserted at the site of DSB.HDR pathway can occur by classical HDR pathway or alternative HDR pathway.Unless otherwise indicated, the term "HDR" or "homologous recombination repair" as used herein encompasses both classical HDR and alternative HDR.

[0175] Classical HDR or "classical homology-directed repair" or "cHDR" are used interchangeably and refer to the process of using homologous nucleic acid (e.g., endogenous homologous sequence, e.g., sister chromatid; or exogenous nucleic acid, e.g., donor template) to repair DNA damage.Classical HDR typically works when there is significant resection in DSB, forming at least one single-stranded portion of DNA.In normal cells, classical HDR typically includes a series of steps, such as recognition of break, stabilization of break, resection, stabilization of single-stranded DNA, formation of DNA crossover intermediate, disassembly of crossover intermediate, and ligation.Classical HDR process requires RAD51 and BRCA2, and homologous nucleic acid, e.g., repair template, is typically double-stranded. In classical HDR, double-stranded polynucleotide, for example, double-stranded repair template, is introduced, which comprises the sequence that is homologous with targeting sequence, and is directly integrated into targeting sequence, or is used as the template for inserting the sequence or part of the sequence of repair template into target gene.After resection at break, repair can proceed by different pathways, for example, by double Holliday junction model (also called double-strand break repair or DSBR pathway) or by synthesis-dependent strand annealing (SDSA) pathway.

[0176] In the double Holliday junction model, strand invasion occurs through the two double-stranded overhangs of the targeting sequence to the homologous sequence in a double-stranded polynucleotide, such as a double-stranded donor template, resulting in the formation of an intermediate with two Holliday junctions.As new DNA is synthesized from the end of the invaded strand to fill the gap resulting from resection, the junction moves.The end of the newly synthesized DNA is ligated to the resectioned end, and the junction is dissolved, resulting in the insertion of the targeting sequence or a portion of the target sequence containing the gene mutation.Crossover with a polynucleotide, such as a repair template, can occur during the dissolution of the junction.

[0177] In the SDSA pathway, a unique single-stranded overhang invades a polynucleotide, e.g., a donor template, and new DNA is synthesized from the end of the invaded strand to fill the gap resulting from the resection. The newly synthesized DNA then anneals with the remaining single-stranded overhang, new DNA is synthesized to fill the gap, and the strands are ligated to generate a modified DNA duplex.

[0178] Alternative HDR, or " alternative homologous recombination repair ", or " alternative HDR ", are used interchangeably and in some embodiments refer to the process of using homologous nucleic acid (e.g., endogenous homologous sequence, e.g., sister chromatid; or exogenous nucleic acid, e.g., repair template) to repair DNA damage.Alternative HDR differs from classical HDR in that this process utilizes a different pathway from classical HDR and can be inhibited by classical HDR mediators RAD51 and BRCA2.Alternative HDR is also distinguished by the involvement of single-stranded or nicked homologous nucleic acid template, e.g., repair template, while classical HDR generally involves double-stranded homologous template.In alternative HDR pathway, a single-stranded template polynucleotide, e.g., repair template, is introduced. The nicks, single-strand breaks or DSBs at the cut site for changing the desired target site (for example, gene mutations in target gene) are mediated by nuclease molecules, and the resection occurs at the cut site, leaving single-stranded overhangs.The incorporation of the template polynucleotide for changing the target site of DNA, for example, the sequence of the repair template, typically occurs by the SDSA pathway, as described herein.In some embodiments, HDR is carried out by introducing one or more agents that can induce DSB and repair template, for example, single-stranded oligonucleotide, into cells.The introduction can be carried out by any suitable delivery method.The condition that allows HDR to occur can be any suitable condition for HDR to occur in cells.

[0179] In some embodiments, gene editing is achieved by one or more of various engineered nucleases. In some embodiments, restriction enzymes are used, especially when double-strand breaks are desired in multiple regions. In some embodiments, bioengineered nucleases are used. Depending on the embodiment, one or more of zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), meganucleases and / or clustered regularly interspaced short palindromic repeats (CRISPR / Cas9) systems are used to specifically edit the genes encoding one or more TCR subunits.

[0180] Meganucleases are characterized by their ability to recognize and cleave large DNA sequences (14-40 base pairs). In some embodiments, meganucleases from the LAGLIDADG family are used and subjected to mutagenesis and screening to generate meganuclease variants that recognize unique sequences, such as specific sites in a TCR subunit (e.g., TRAC), or CISH, or any other target gene disclosed herein. Target sites in TCR subunits can be readily identified. Further information on target sites within regions of TCRs can be found in U.S. Patent Publication Nos. 2018 / 0325955 and 2015 / 0017136, each of which is incorporated herein by reference in its entirety. In some embodiments, two or more meganucleases, or functional fragments thereof, are fused to create a hybrid enzyme that recognizes a desired target sequence within a target gene (e.g., CISH).

[0181] In contrast to meganucleases, ZFNs and TALENs function based on a nonspecific DNA-cleaving catalytic domain linked to a specific DNA sequence that recognizes peptides such as zinc fingers or transcription activator-like effectors (TALEs). Advantageously, ZFNs and TALENs thus enable sequence-dependent cleavage of DNA with a high degree of sequence specificity in target recognition. Zinc finger motifs naturally function in transcription factors to recognize specific DNA sequences for transcription. The C-terminal portion of each finger is responsible for specific recognition of the DNA sequence. Although the sequence recognized by ZFNs is relatively short (e.g., about 3 base pairs), in some embodiments, a combination of 2, 3, 4, 5, 6, 7, 8, 9, 10, or more zinc fingers is used to define a recognition site, thereby enabling targeting of specific sequences, such as a portion of a TCR (or immune checkpoint). The combined ZFNs are then fused to the catalytic domain of an endonuclease, such as FokI (which may be a FokI heterodimer), to induce targeted DNA cleavage. Additional information on the use of ZFNs to edit TCR subunits and / or immune checkpoints can be found in U.S. Patent No. 9,597,357, which is incorporated herein by reference.

[0182] Transcription activator-like effector nuclease (TALEN) is a specific DNA binding protein characterized by a sequence of 33 or 34 amino acid repeats.Like ZFN, TALEN is a fusion of the DNA cleavage domain of nuclease to a TALE domain, which allows for sequence-independent introduction of double-stranded DNA breaks through highly precise target site recognition.TALEN creates double-stranded breaks at target sites that can be repaired by error-prone non-homologous end joining (NHEJ), resulting in gene disruption through the introduction of small insertions or deletions.Advantageously, TALEN is used in some embodiments, at least in part, due to their high specificity in DNA binding, reduced off-target effects, and ease of constructing DNA binding domains.

[0183] CRISPR (clustered regularly interspaced short palindromic repeats) is a genetic element used by bacteria to protect against viruses. The repeats are short sequences originating from viral genomes and integrated into bacterial genomes. Cas (CRISPR-associated protein) processes these sequences and cleaves matching viral DNA sequences. By introducing a plasmid containing a Cas gene and a specifically constructed CRISPR into eukaryotic cells, the eukaryotic genome can be cleaved at any desired location. Additional information on CRISPR can be found in U.S. Patent Publication No. 2014 / 0068797, which is incorporated herein by reference. In some embodiments, CRISPR is used to manipulate genes encoding target genes to be knocked out or knocked in, such as CISH, TGFBR2, TCR, B2M, CIITA, CD47, HLA-E, etc. In some embodiments, CRISPR is used to edit genes encoding one or more TCRs and / or one or more immune checkpoints of T cells. In some embodiments, the immune checkpoint is selected from one or more of CTLA4 and PD1. In some embodiments, CRISPR is used to truncate one or more of TCRα, TCRβ, TCRγ and TCRδ. In some embodiments, TCR is truncated without affecting the function of the CD3z signaling domain of TCR.

[0184] Depending on the embodiment and which target gene is being edited, Class 1 or Class 2 Cas is used. In some embodiments, Class 1 Cas is used, and the type of Cas is selected from the following types: I, IA, IB, IC, ID, IE, IF, IU, III, IIIA, IIIB, IIIC, IIID, IV IVA, IVB, and combinations thereof. In some embodiments, the Cas is selected from the group consisting of Cas3, Cas8a, Cas5, Cas8b, Cas8c, Cas10d, Csel, Csel, Csel2, Csyl, Csy2, Csy3, GSU0054, Cas10, Csm2, Cmr5, Cas10, Csx11, Csx10, Csf1, and combinations thereof. In some embodiments, Class 2 Cas is used, and the type of Cas is selected from the following types: II, IIA, IIB, IIC, V, VI, and combinations thereof. In some embodiments, the Cas is selected from the group consisting of Cas9, Csn2, Cas4, Cas12a (formerly known as Cpf1), C2c1, C2c3, Cas13a (formerly known as C2c2), Cas13b, Cas13c, CasX, CasY, and combinations thereof. In some embodiments, the Cas is Cas9. In some embodiments, a class 2 CasX is used, where CasX can form a complex with a guide nucleic acid, and the complex can bind to target DNA, where the target DNA comprises a non-target strand and a target strand. In some embodiments, a class 2 CasY is used, where CasY can bind to and modify a target nucleic acid and / or a polypeptide associated with the target nucleic acid.

[0185] Targets for gene editing As discussed above, gene editing can be used to disrupt a target gene (or genes) to enhance the functionality (e.g., proliferation, cytotoxicity) or persistence (lifespan or ability to resist hypoxia) of immune cells, such as NK cells. In some embodiments, immune cells are gene-edited in ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof. In some embodiments, the immune cells are gene edited in ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, CBLB, CISH, ID3, SOX4, or any combination thereof.

[0186] As a non-limiting example, in some embodiments, a member of the disintegrin and metalloprotease domain (ADAM) family, in particular ADAM17, is the target of gene editing. ADAM17, located on chromosome 2, is involved in antibody-dependent cell-mediated cytotoxicity (ADCC), which is an important mechanism of action in anti-tumor responses. CD16A is a membrane-bound protein expressed by NK cells and is a receptor for the Fc portion of IgG. Ligation of CD16A (e.g., by antibody-coated target cells) triggers NK cell-mediated ADCC, but CD16A is rapidly downregulated after NK cell activation by cleavage from the NK cell surface (either in vivo or in vitro, e.g., by PMA). ADAM17 is thought to be the primary protease responsible for cleaving CD16A from the surface of NK cells, and inhibition of ADAM17 (e.g., by disrupting ADAM17 expression) reduces, ameliorates, or otherwise prevents CD16A cleavage, allowing ADCC to remain an effective antitumor pathway [Wu et al., J Leukoc Biol (2019) 105(6):1297-1303]. CD62 ligand (CD62L) is also a substrate for ADAM17, and disruption of ADAM17 expression, in some embodiments, functions to stabilize CD62L expression. CD62L, an L-selectin molecule, mediates lymphocyte homing to lymphoid organs. CD56dimCD62L+ cells represent a unique subset of mature, multifunctional NK cells that influence the magnitude of local NK cell responses, particularly by their ability to produce IDN-γ after cytokine stimulation, to proliferate in vivo during viral infection, and to kill target cells upon activating receptor ligation. Thus, stabilization of CD62L can, in some embodiments, further enhance NK cell function.

[0187] In some embodiments, gene editing reduces transcription of ADAM17 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, gene editing reduces transcription of ADAM17 by at least about 30%. In some embodiments, gene editing reduces transcription of ADAM17 by at least about 40%. In some embodiments, gene editing reduces transcription of ADAM17 by at least about 50%. In some embodiments, gene editing reduces transcription of ADAM17 by at least about 60%. In some embodiments, gene editing reduces transcription of ADAM17 by at least about 70%. In some embodiments, gene editing reduces transcription of ADAM17 by at least about 80%. In some embodiments, the gene editing reduces transcription of ADAM17 by at least about 90%.

[0188] In some embodiments, gene editing can reduce expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of ADAM17 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of ADAM17 by at least about 30%. In some embodiments, gene editing reduces expression of ADAM17 by at least about 40%. In some embodiments, gene editing reduces expression of ADAM17 by at least about 50%. In some embodiments, gene editing reduces ADAM17 expression by at least about 60%. In some embodiments, gene editing reduces ADAM17 expression by at least about 70%. In some embodiments, gene editing reduces ADAM17 expression by at least about 80%. In some embodiments, gene editing reduces ADAM17 expression by at least about 90%.

[0189] In some embodiments, a guide RNA (gRNA) comprising any of the sequences set forth in SEQ ID NOs: 682 to 687 is used to disrupt the ADAM17 gene (eg, reduce its expression).

[0190] In some embodiments, hypoxia-inducible factor 1 alpha (HIF1a) is the target of gene editing. HIF1a, located on chromosome 15, is a transcriptional activator of CD274 (also known as PDL1). In the presence of hypoxia, HIF1a interacts with the hypoxia response element in the promoter of PDL1, which then drives increased PDL1 expression. This upregulation of PDL1 expression in various cells, including tumor cells, immune cells (including MDSCs, macrophages, DCs, and bone marrow-derived macrophages (BMDMs)), and other cells in the TME, plays a role in inhibiting the ability of T cells and / or NK cells to kill tumors through PD1 binding to PDL1. A study using single-cell RNA sequencing of tumor-infiltrating NK cells revealed that inhibition of HIF1a promoted the activity of tumor-infiltrating NK cells [Ni et al., Immunity (2020) 52(6):1075-87]. In some embodiments, loss of HIF1a in NK cells inhibits tumor growth, for example, by stimulating non-productive angiogenesis (eg, resulting in tumor cells being starved of blood supply).

[0191] In some embodiments, gene editing reduces transcription of HIF1A by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, gene editing reduces transcription of HIF1A by at least about 30%. In some embodiments, gene editing reduces transcription of HIF1A by at least about 40%. In some embodiments, gene editing reduces transcription of HIF1A by at least about 50%. In some embodiments, gene editing reduces transcription of HIF1A by at least about 60%. In some embodiments, gene editing reduces transcription of HIF1A by at least about 70%. In some embodiments, gene editing reduces transcription of HIF1A by at least about 80%. In some embodiments, the gene editing reduces transcription of HIF1A by at least about 90%.

[0192] In some embodiments, gene editing can reduce expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of HIF1A by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of HIF1A by at least about 30%. In some embodiments, gene editing reduces expression of HIF1A by at least about 40%. In some embodiments, gene editing reduces expression of HIF1A by at least about 50%. In some embodiments, gene editing reduces HIF1A expression by at least about 60%. In some embodiments, gene editing reduces HIF1A expression by at least about 70%. In some embodiments, gene editing reduces HIF1A expression by at least about 80%. In some embodiments, gene editing reduces HIF1A expression by at least about 90%.

[0193] In some embodiments, a guide RNA (gRNA) comprising any of the sequences of SEQ ID NOs: 750-760 is used to disrupt the HIF1A gene (eg, reduce its expression).

[0194] As a non-limiting example, diacylglycerol kinase zeta (DGKz) has been targeted for gene editing to reduce and knock out its expression. DGKz is located on chromosome 11 and is a negative regulator of diacylglycerol kinase-mediated signaling. Studies have shown that mice lacking DGKz exhibit increased cytokine production and degranulation, in some cases in an ERK-dependent (also known as the Ras-Ref-MEK-ERK pathway) manner. In addition, CRISPR / Cas9-mediated knockout of DGKz can improve T cell function (e.g., antitumor activity). However, in NK cells, DGKz disruption is considered particularly beneficial because, according to some embodiments, DGKz disruption does not negatively affect inhibitory NK cell receptor expression or function, thereby maintaining the natural balance of NK activating and inhibitory signals that regulate NK cell activity in some contexts [Singh and Kambayashi, Front Cell Dev Bio (2016) 4:96]. Thus, enhancing NK cell function is achieved in some embodiments by enhancing NK cell activity and signaling by disinhibiting negative regulatory aspects of activation pathways, rather than by disrupting the expression or function of inhibitory NK cell receptors, which are "brakes" on NK cell function and can lead to unchecked NK cell activity and potential off-target cytotoxicity.

[0195] In some embodiments, gene editing reduces transcription of DGKZ by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, gene editing reduces transcription of DGKZ by at least about 30%. In some embodiments, gene editing reduces transcription of DGKZ by at least about 40%. In some embodiments, gene editing reduces transcription of DGKZ by at least about 50%. In some embodiments, gene editing reduces transcription of DGKZ by at least about 60%. In some embodiments, gene editing reduces transcription of DGKZ by at least about 70%. In some embodiments, gene editing reduces transcription of DGKZ by at least about 80%. In some embodiments, the gene editing reduces transcription of DGKZ by at least about 90%.

[0196] In some embodiments, gene editing can reduce expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of DGKZ by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of DGKZ by at least about 30%. In some embodiments, gene editing reduces expression of DGKZ by at least about 40%. In some embodiments, gene editing reduces expression of DGKZ by at least about 50%. In some embodiments, gene editing reduces expression of DGKZ by at least about 60%. In some embodiments, gene editing reduces expression of DGKZ by at least about 70%. In some embodiments, gene editing reduces expression of DGKZ by at least about 80%. In some embodiments, gene editing reduces expression of DGKZ by at least about 90%.

[0197] In some embodiments, a guide RNA (gRNA) comprising the sequence of any of SEQ ID NOs: 688 to 723 is used to disrupt the DGKZ gene (eg, reduce its expression).

[0198] In some embodiments, glycogen synthase kinase 3β (GSK3B) is the target of gene editing. GSK3B, located on chromosome 11, is a ubiquitously expressed serine / threonine kinase involved in various cellular functions, including differentiation, survival, glycogen metabolism, protein synthesis, immune response, and cell death. In AML patients, suppression of GSK3B is thought to restore NK cell cytotoxicity. Furthermore, GSK3B inhibition (e.g., with a small molecule inhibitor) can promote NK cell maturation and, in some embodiments, enhance antitumor activity [Cichocki et al., Cancer Res (2017) 77(20):5664-75]. Normal levels of GSK3B are thought to negatively regulate several aspects of NK cell function, including functions induced by one or more (e.g., a combination) of activating NK cell receptors. Reversing the effects of small molecules, small molecule inhibitors of GSK3B can specifically inhibit transcription of the inhibitory co-receptor LAG-3 [Rudd et al., Cell Rep (2020) 30(7):2075-82; discussed in more detail below].

[0199] In some embodiments, gene editing reduces transcription of GSK3B by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, gene editing reduces transcription of GSK3B by at least about 30%. In some embodiments, gene editing reduces transcription of GSK3B by at least about 40%. In some embodiments, gene editing reduces transcription of GSK3B by at least about 50%. In some embodiments, gene editing reduces transcription of GSK3B by at least about 60%. In some embodiments, gene editing reduces transcription of GSK3B by at least about 70%. In some embodiments, gene editing reduces transcription of GSK3B by at least about 80%. In some embodiments, the gene editing reduces transcription of GSK3B by at least about 90%.

[0200] In some embodiments, gene editing can reduce expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of GSK3B by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of GSK3B by at least about 30%. In some embodiments, gene editing reduces expression of GSK3B by at least about 40%. In some embodiments, gene editing reduces expression of GSK3B by at least about 50%. In some embodiments, the gene editing reduces GSK3B expression by at least about 60%. In some embodiments, the gene editing reduces GSK3B expression by at least about 70%. In some embodiments, the gene editing reduces GSK3B expression by at least about 80%. In some embodiments, the gene editing reduces GSK3B expression by at least about 90%.

[0201] In some embodiments, a guide RNA (gRNA) comprising the sequence of any of SEQ ID NOs: 724 to 749 is used to disrupt the GSK3B gene (eg, reduce its expression).

[0202] In some embodiments, lymphocyte activation gene 3 (LAG3) is the target of gene editing. LAG3, located on chromosome 12, acts as an immune checkpoint, inhibiting the activation of its host cells (e.g., NK and / or T cells), generally promoting a more suppressive immune response. For example, in T cells, LAG3 reduces cytokine and granzyme production and proliferation, all while promoting differentiation into regulatory T cells rather than cytotoxic cells. In NK cells, LAG3 functions as a checkpoint, reducing cytokine production by CD56+Dim cytotoxic cells.

[0203] In some embodiments, gene editing reduces transcription of LAG3 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, gene editing reduces transcription of LAG3 by at least about 30%. In some embodiments, gene editing reduces transcription of LAG3 by at least about 40%. In some embodiments, gene editing reduces transcription of LAG3 by at least about 50%. In some embodiments, gene editing reduces transcription of LAG3 by at least about 60%. In some embodiments, gene editing reduces transcription of LAG3 by at least about 70%. In some embodiments, gene editing reduces transcription of LAG3 by at least about 80%. In some embodiments, gene editing reduces transcription of LAG3 by at least about 90%.

[0204] In some embodiments, gene editing can reduce expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of LAG3 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of LAG3 by at least about 30%. In some embodiments, gene editing reduces expression of LAG3 by at least about 40%. In some embodiments, gene editing reduces expression of LAG3 by at least about 50%. In some embodiments, the gene editing reduces expression of LAG3 by at least about 60%. In some embodiments, the gene editing reduces expression of LAG3 by at least about 70%. In some embodiments, the gene editing reduces expression of LAG3 by at least about 80%. In some embodiments, the gene editing reduces expression of LAG3 by at least about 90%.

[0205] In some embodiments, a guide RNA (gRNA) comprising any of the sequences set forth in SEQ ID NOs: 761-789 is used to disrupt the LAG3 gene (e.g., reduce its expression).

[0206] In some embodiments, T cell immunoglobulin and mucin domain 3 (TIM3) is the target of gene editing. TIM3 is a receptor expressed on NK cells and is implicated as a marker of dysfunctional NK cells. TIM3 is an immune checkpoint and a member of the TIM family of proteins. TIM3 has multiple ligands, including CEACAM1, high-mobility group box 1 (HMGB1), phosphatidylserine (PtdSer), and galectin-9 (Gal-9), which can reduce cell signaling upon interaction with TIM3. Like LAG3, TIM3 is induced by hypoxia and is present, for example, in some areas of the tumor microenvironment (including, among other genes, CTLA4, PD1, PDL1, CD47, and other immune checkpoints). In some embodiments, genetic disruption of TIM3 reduces the negative effects of the hypoxic TME and allows for enhanced anti-tumor activity of NK cells.

[0207] In some embodiments, gene editing reduces transcription of TIM3 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, gene editing reduces transcription of TIM3 by at least about 30%. In some embodiments, gene editing reduces transcription of TIM3 by at least about 40%. In some embodiments, gene editing reduces transcription of TIM3 by at least about 50%. In some embodiments, gene editing reduces transcription of TIM3 by at least about 60%. In some embodiments, gene editing reduces transcription of TIM3 by at least about 70%. In some embodiments, gene editing reduces transcription of TIM3 by at least about 80%. In some embodiments, gene editing reduces transcription of TIM3 by at least about 90%.

[0208] In some embodiments, gene editing can reduce expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of TIM3 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of TIM3 by at least about 30%. In some embodiments, gene editing reduces expression of TIM3 by at least about 40%. In some embodiments, gene editing reduces expression of TIM3 by at least about 50%. In some embodiments, gene editing reduces TIM3 expression by at least about 60%. In some embodiments, gene editing reduces TIM3 expression by at least about 70%. In some embodiments, gene editing reduces TIM3 expression by at least about 80%. In some embodiments, gene editing reduces TIM3 expression by at least about 90%.

[0209] In some embodiments, a guide RNA (gRNA) comprising the sequence of any of SEQ ID NOs: 790 to 825 is used to disrupt the TIM3 gene (eg, reduce its expression).

[0210] In some embodiments, tripartite motif-containing 29 (TRIM29) is a target for gene editing. TRIM29, located on chromosome 11, is a member of a family of proteins involved in many biological processes, including cell development, differentiation, apoptosis, and tumorigenesis. TRIM29 is induced in NK cells by IL-12 and IL-18, and due to its E3 ubiquitin ligase function, promotes the proteasome-mediated degradation of various target genes, such as TAB2 (TGF-beta-activated kinase-binding protein 2), which results in the inhibition of IFN-γ production by activated NK cells, thereby limiting their cytotoxicity [Dou et al., J Immunol (2019) 203(4):873-80]. In some embodiments, depletion of TRIM29 in NK cells, for example, by gene editing, can result in a significant enhancement of NK cell function, even after IL-12 and IL-18 stimulation.

[0211] In some embodiments, gene editing reduces transcription of TRIM29 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, gene editing reduces transcription of TRIM29 by at least about 30%. In some embodiments, gene editing reduces transcription of TRIM29 by at least about 40%. In some embodiments, gene editing reduces transcription of TRIM29 by at least about 50%. In some embodiments, gene editing reduces transcription of TRIM29 by at least about 60%. In some embodiments, gene editing reduces transcription of TRIM29 by at least about 70%. In some embodiments, gene editing reduces transcription of TRIM29 by at least about 80%. In some embodiments, the gene editing reduces transcription of TRIM29 by at least about 90%.

[0212] In some embodiments, gene editing can reduce expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of TRIM29 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of TRIM29 by at least about 30%. In some embodiments, gene editing reduces expression of TRIM29 by at least about 40%. In some embodiments, gene editing reduces expression of TRIM29 by at least about 50%. In some embodiments, the gene editing reduces TRIM29 expression by at least about 60%. In some embodiments, the gene editing reduces TRIM29 expression by at least about 70%. In some embodiments, the gene editing reduces TRIM29 expression by at least about 80%. In some embodiments, the gene editing reduces TRIM29 expression by at least about 90%.

[0213] In some embodiments, a guide RNA (gRNA) comprising the sequence of any of SEQ ID NOs: 826 to 835 is used to disrupt the TRIM29 gene (eg, reduce its expression).

[0214] In some embodiments, interleukin-1 receptor 8 (IL-1R8) is the target of gene editing. IL-1R8, located on chromosome 11, is a member of the IL-1 receptor (ILR) family that acts as a negative regulator of ILR and Toll-like receptor (TLR) downstream signaling pathways and inflammation. IL-1R8 is a co-receptor of IL-1R5 / IL-18Rα for IL-37. IL-1R8 is a checkpoint in NK cells that negatively regulates anti-tumor and anti-viral activity.

[0215] In some embodiments, gene editing reduces transcription of IL-1R8 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, gene editing reduces transcription of IL-1R8 by at least about 30%. In some embodiments, gene editing reduces transcription of IL-1R8 by at least about 40%. In some embodiments, gene editing reduces transcription of IL-1R8 by at least about 50%. In some embodiments, gene editing reduces transcription of IL-1R8 by at least about 60%. In some embodiments, gene editing reduces transcription of IL-1R8 by at least about 70%. In some embodiments, gene editing reduces transcription of IL-1R8 by at least about 80%. In some embodiments, the gene editing reduces transcription of IL-1R8 by at least about 90%.

[0216] In some embodiments, gene editing can reduce expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of IL-1R8 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of IL-1R8 by at least about 30%. In some embodiments, gene editing reduces expression of IL-1R8 by at least about 40%. In some embodiments, the gene editing reduces IL-1R8 expression by at least about 50%. In some embodiments, the gene editing reduces IL-1R8 expression by at least about 60%. In some embodiments, the gene editing reduces IL-1R8 expression by at least about 70%. In some embodiments, the gene editing reduces IL-1R8 expression by at least about 80%. In some embodiments, the gene editing reduces IL-1R8 expression by at least about 90%.

[0217] In some embodiments, a guide RNA (gRNA) comprising the sequence of any of SEQ ID NOs: 836 to 865 is used to disrupt the IL-1R8 gene (eg, reduce its expression).

[0218] In some embodiments, CD38 is the target of gene editing. CD38, located on chromosome 4, is an ectoenzyme with nicotinamide-adenine dinucleotide positive (NAD+) glycohydrolase and ADP-ribosyl cyclase activity. CD38 is also expressed on some tumor cells, such as multiple myeloma and acute myeloid leukemia cells. The function of CD38 and its glycohydrolase activity, as well as its cyclase activity, results in the production of the immunosuppressive molecule adenosine, which in some cases: i) inhibits tumor cell lysis of T and NK cells; ii) induces M2 macrophages and tolerogenic dendritic cells (DCs); and / or iii) induces Treg expansion and proliferation. In addition, the endogenous expression of CD38 can be problematic for the persistence of therapeutic cells when CD38-targeted CAR is used, for example, due to fratricidality.

[0219] In some embodiments, the gene editing reduces CD38 transcription by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, the gene editing reduces CD38 transcription by at least about 30%. In some embodiments, the gene editing reduces CD38 transcription by at least about 40%. In some embodiments, the gene editing reduces CD38 transcription by at least about 50%. In some embodiments, the gene editing reduces CD38 transcription by at least about 60%. In some embodiments, the gene editing reduces CD38 transcription by at least about 70%. In some embodiments, the gene editing reduces CD38 transcription by at least about 80%. In some embodiments, the gene editing reduces CD38 transcription by at least about 90%.

[0220] In some embodiments, gene editing can reduce expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of CD38 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of CD38 by at least about 30%. In some embodiments, gene editing reduces expression of CD38 by at least about 40%. In some embodiments, gene editing reduces expression of CD38 by at least about 50%. In some embodiments, the gene editing reduces CD38 expression by at least about 60%. In some embodiments, the gene editing reduces CD38 expression by at least about 70%. In some embodiments, the gene editing reduces CD38 expression by at least about 80%. In some embodiments, the gene editing reduces CD38 expression by at least about 90%.

[0221] In some embodiments, a guide RNA (gRNA) comprising the sequence of any of SEQ ID NOs: 866-874 is used to disrupt the CD38 gene (e.g., reduce its expression).

[0222] In some embodiments, fructose-1,6-bisphosphatase (FBP1) is the target of gene editing. FBP1, located on chromosome 9, is a rate-limiting enzyme involved in gluconeogenesis. Its function is primarily to promote gluconeogenesis while inhibiting glycolysis. FBP1-related impairment of NK cell glycolysis induces NK cell dysfunction [Cong et al., Cell Metab (2018) 28(2):243-55]. However, according to some embodiments, disruption of FBP1 expression restores NK cell function.

[0223] In some embodiments, gene editing reduces transcription of FBP1 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, gene editing reduces transcription of FBP1 by at least about 30%. In some embodiments, gene editing reduces transcription of FBP1 by at least about 40%. In some embodiments, gene editing reduces transcription of FBP1 by at least about 50%. In some embodiments, gene editing reduces transcription of FBP1 by at least about 60%. In some embodiments, gene editing reduces transcription of FBP1 by at least about 70%. In some embodiments, gene editing reduces transcription of FBP1 by at least about 80%. In some embodiments, gene editing reduces transcription of FBP1 by at least about 90%.

[0224] In some embodiments, gene editing can reduce expression of a target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of FBP1 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of FBP1 by at least about 30%. In some embodiments, gene editing reduces expression of FBP1 by at least about 40%. In some embodiments, gene editing reduces expression of FBP1 by at least about 50%. In some embodiments, gene editing reduces expression of FBP1 by at least about 60%. In some embodiments, gene editing reduces expression of FBP1 by at least about 70%. In some embodiments, gene editing reduces expression of FBP1 by at least about 80%. In some embodiments, gene editing reduces expression of FBP1 by at least about 90%.

[0225] In some embodiments, a guide RNA (gRNA) comprising the sequence of any of SEQ ID NOs: 875 to 889 is used to disrupt the FBP1 gene (eg, reduce its expression).

[0226] In some embodiments, insulin-induced gene 1 (INSIG1) is the target of gene editing. INSIG1, located on chromosome 7, is a negative regulator of sterol regulatory element-binding protein (SRBP) transcription. SRBPs are proteins that, when transcribed and expressed, are involved in essential aspects of glucose metabolism by NK cells, particularly with regard to the functional response (e.g., cytotoxicity) of NK cells [Assmann et al., Nat Immunol (2017) 18(11):1197-1206]. According to some embodiments, disruption of INSIG1 expression disinhibits and thus restores NK cell function.

[0227] In some embodiments, gene editing reduces transcription of INSIG1 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, gene editing reduces transcription of INSIG1 by at least about 30%. In some embodiments, gene editing reduces transcription of INSIG1 by at least about 40%. In some embodiments, gene editing reduces transcription of INSIG1 by at least about 50%. In some embodiments, gene editing reduces transcription of INSIG1 by at least about 60%. In some embodiments, gene editing reduces transcription of INSIG1 by at least about 70%. In some embodiments, gene editing reduces transcription of INSIG1 by at least about 80%. In some embodiments, the gene editing reduces transcription of INSIG1 by at least about 90%.

[0228] In some embodiments, gene editing can reduce expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of INSIG1 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of INSIG1 by at least about 30%. In some embodiments, gene editing reduces expression of INSIG1 by at least about 40%. In some embodiments, gene editing reduces expression of INSIG1 by at least about 50%. In some embodiments, the gene editing reduces expression of INSIG1 by at least about 60%. In some embodiments, the gene editing reduces expression of INSIG1 by at least about 70%. In some embodiments, the gene editing reduces expression of INSIG1 by at least about 80%. In some embodiments, the gene editing reduces expression of INSIG1 by at least about 90%.

[0229] In some embodiments, a guide RNA (gRNA) comprising the sequence of any of SEQ ID NOs: 890 to 934 is used to disrupt the INSIG1 gene (eg, reduce its expression).

[0230] Cells require many different types of molecular complexes to accomplish the cellular processes of transcription and translation. These complexes, made up of multiple, sometimes distinct, subunits, have the ability to confer cell-specific functions depending on their assembly and activity. One such molecular complex is the Mediator complex, which is expressed and required in cells where genes are actively expressed, such as immune cells such as NK cells. It primarily functions as a "molecular bridge" that secures two otherwise unconnected regions of DNA within a cell. For example, it can link promoters and enhancers to physically localize various elements and associated transcription factors required for the expression of genes transcribed by RNA polymerase. Mediator complex subunit 12 (MED12) is one part of the four-part cyclin-dependent kinase (CDK) module of Mediator, along with MED13, cyclin-dependent kinase 8 (CDK8), and cyclin C (CCNC). Mutations in MED12 are associated with lymphoproliferative disorders [Kampjarvi et al., Oncotarget (2015) 6(3):1884-88]. More recently, targeted deletion of MED12, CCNC, or CDK8 in human CAR T cells was observed to increase proliferation, cytokine production, and antitumor activity. In particular, MED12-deficient T cells showed alterations in genes regulating effector T cell differentiation. See Freitas et al., Cancer Res (2022) 82(12_suppl):2822; and Freitas et al., Science (2022) 378(6620):eabn5647. It is contemplated that reduction of MED12, MED13, CDK8, and / or CCNC provides edited cells, e.g., NK cells, with sustained enhancement, enabling enhanced cytotoxicity against target tumor cells (when engineered according to the embodiments provided herein).

[0231] In some embodiments, the gene editing reduces transcription of MED12 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, the gene editing reduces transcription of MED12 by at least about 30%. In some embodiments, the gene editing reduces transcription of MED12 by at least about 40%. In some embodiments, the gene editing reduces transcription of MED12 by at least about 50%. In some embodiments, the gene editing reduces transcription of MED12 by at least about 60%. In some embodiments, the gene editing reduces transcription of MED12 by at least about 70%. In some embodiments, the gene editing reduces transcription of MED12 by at least about 80%. In some embodiments, the gene editing reduces transcription of MED12 by at least about 90%.

[0232] In some embodiments, gene editing can reduce expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of MED12 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of MED12 by at least about 30%. In some embodiments, gene editing reduces expression of MED12 by at least about 40%. In some embodiments, gene editing reduces expression of MED12 by at least about 50%. In some embodiments, the gene editing reduces MED12 expression by at least about 60%. In some embodiments, the gene editing reduces MED12 expression by at least about 70%. In some embodiments, the gene editing reduces MED12 expression by at least about 80%. In some embodiments, the gene editing reduces MED12 expression by at least about 90%.

[0233] In some embodiments, MED12 expression is disrupted and / or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) or other guide nucleases disclosed elsewhere herein by use of one or more of the following MED12-specific guide RNAs: SEQ ID NOs: 938-948 (see, e.g., Table E2). In some embodiments, a guide RNA (gRNA) comprising the sequence of any of SEQ ID NOs: 938-948 is used to disrupt (e.g., reduce expression of) the MED12 gene. Non-limiting examples of guide RNAs for reducing and / or eliminating MED12 expression are provided in Table 1 below.

[0234] [Table 1]

[0235] In some embodiments, gene editing reduces transcription of MED13 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, gene editing reduces transcription of MED13 by at least about 30%. In some embodiments, gene editing reduces transcription of MED13 by at least about 40%. In some embodiments, gene editing reduces transcription of MED13 by at least about 50%. In some embodiments, gene editing reduces transcription of MED13 by at least about 60%. In some embodiments, gene editing reduces transcription of MED13 by at least about 70%. In some embodiments, gene editing reduces transcription of MED13 by at least about 80%. In some embodiments, the gene editing reduces transcription of MED13 by at least about 90%.

[0236] In some embodiments, gene editing can reduce expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of MED13 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of MED13 by at least about 30%. In some embodiments, gene editing reduces expression of MED13 by at least about 40%. In some embodiments, gene editing reduces expression of MED13 by at least about 50%. In some embodiments, the gene editing reduces MED13 expression by at least about 60%. In some embodiments, the gene editing reduces MED13 expression by at least about 70%. In some embodiments, the gene editing reduces MED13 expression by at least about 80%. In some embodiments, the gene editing reduces MED13 expression by at least about 90%.

[0237] In some embodiments, gene editing reduces transcription of CDK8 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, gene editing reduces transcription of CDK8 by at least about 30%. In some embodiments, gene editing reduces transcription of CDK8 by at least about 40%. In some embodiments, gene editing reduces transcription of CDK8 by at least about 50%. In some embodiments, gene editing reduces transcription of CDK8 by at least about 60%. In some embodiments, gene editing reduces transcription of CDK8 by at least about 70%. In some embodiments, gene editing reduces transcription of CDK8 by at least about 80%. In some embodiments, gene editing reduces transcription of CDK8 by at least about 90%.

[0238] In some embodiments, gene editing can reduce expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of CDK8 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of CDK8 by at least about 30%. In some embodiments, gene editing reduces expression of CDK8 by at least about 40%. In some embodiments, gene editing reduces expression of CDK8 by at least about 50%. In some embodiments, gene editing reduces CDK8 expression by at least about 60%. In some embodiments, gene editing reduces CDK8 expression by at least about 70%. In some embodiments, gene editing reduces CDK8 expression by at least about 80%. In some embodiments, gene editing reduces CDK8 expression by at least about 90%.

[0239] In some embodiments, CDK8 expression is disrupted and / or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) or other guide nucleases disclosed elsewhere herein by use of one or more of the following CDK8-specific guide RNAs: SEQ ID NOs: 949-955 (see, e.g., Table E2). In some embodiments, a guide RNA (gRNA) comprising the sequence of any of SEQ ID NOs: 949-955 is used to disrupt the CDK8 gene (e.g., reduce its expression). Non-limiting examples of guide RNAs for reducing and / or eliminating CDK8 expression are provided in Table 2 below.

[0240] [Table 2]

[0241] In some embodiments, gene editing reduces transcription of CCNC by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, gene editing reduces transcription of CCNC by at least about 30%. In some embodiments, gene editing reduces transcription of CCNC by at least about 40%. In some embodiments, gene editing reduces transcription of CCNC by at least about 50%. In some embodiments, gene editing reduces transcription of CCNC by at least about 60%. In some embodiments, gene editing reduces transcription of CCNC by at least about 70%. In some embodiments, gene editing reduces transcription of CCNC by at least about 80%. In some embodiments, gene editing reduces transcription of CCNC by at least about 90%.

[0242] In some embodiments, gene editing can reduce expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of CCNC by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of CCNC by at least about 30%. In some embodiments, gene editing reduces expression of CCNC by at least about 40%. In some embodiments, gene editing reduces expression of CCNC by at least about 50%. In some embodiments, gene editing reduces expression of CCNC by at least about 60%. In some embodiments, gene editing reduces expression of CCNC by at least about 70%. In some embodiments, gene editing reduces expression of CCNC by at least about 80%. In some embodiments, gene editing reduces expression of CCNC by at least about 90%.

[0243] In some embodiments, CCNC expression is disrupted and / or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) or other guide nucleases disclosed elsewhere herein by using one or more of the following CCNC-specific guide RNAs: SEQ ID NOs: 956-962 (see, e.g., Table E2). In some embodiments, a guide RNA (gRNA) comprising any of the sequences of SEQ ID NOs: 956-962 is used to disrupt (e.g., reduce expression of) the CCNC gene. Non-limiting examples of guide RNAs for reducing and / or eliminating CCNC expression are provided in Table 3 below.

[0244] [Table 3]

[0245] Two additional transcription factors known as key regulators of T cell exhaustion have emerged as promising targets in NK cells for disrupting or otherwise reducing NK cell exhaustion as well. Inhibitor of DNA binding 3 (ID3) is also known to be highly expressed in precursor NK cells but reduced in mature cells [Boos et al., J Exp Med (2007) 204(5):1119-30]. Deletion of ID3, therefore, confers a more mature phenotype and activity to NK cells and / or reduces exhaustion in some embodiments. Similarly, editing SOX4 to reduce SOX4 expression reduces NK cell exhaustion in some embodiments [Good et al., Cell 184(25):P6081-6100].

[0246] In some embodiments, gene editing reduces transcription of ID3 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, gene editing reduces transcription of ID3 by at least about 30%. In some embodiments, gene editing reduces transcription of ID3 by at least about 40%. In some embodiments, gene editing reduces transcription of ID3 by at least about 50%. In some embodiments, gene editing reduces transcription of ID3 by at least about 60%. In some embodiments, gene editing reduces transcription of ID3 by at least about 70%. In some embodiments, gene editing reduces transcription of ID3 by at least about 80%. In some embodiments, gene editing reduces transcription of ID3 by at least about 90%.

[0247] In some embodiments, gene editing can reduce expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of ID3 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of ID3 by at least about 30%. In some embodiments, gene editing reduces expression of ID3 by at least about 40%. In some embodiments, gene editing reduces expression of ID3 by at least about 50%. In some embodiments, gene editing reduces ID3 expression by at least about 60%. In some embodiments, gene editing reduces ID3 expression by at least about 70%. In some embodiments, gene editing reduces ID3 expression by at least about 80%. In some embodiments, gene editing reduces ID3 expression by at least about 90%.

[0248] In some embodiments, ID3 expression is disrupted and / or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) by use of one or more of the following ID3-specific guide RNAs: SEQ ID NOs: 963-969, or other guide nucleases disclosed elsewhere herein (see, e.g., Table E2). In some embodiments, a guide RNA (gRNA) comprising the sequence of any of SEQ ID NOs: 963-969 is used to disrupt the ID3 gene (e.g., reduce its expression). Non-limiting examples of guide RNAs for reducing and / or eliminating ID3 expression are provided in Table 4 below.

[0249] [Table 4]

[0250] In some embodiments, gene editing reduces transcription of SOX4 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, gene editing reduces transcription of SOX4 by at least about 30%. In some embodiments, gene editing reduces transcription of SOX4 by at least about 40%. In some embodiments, gene editing reduces transcription of SOX4 by at least about 50%. In some embodiments, gene editing reduces transcription of SOX4 by at least about 60%. In some embodiments, gene editing reduces transcription of SOX4 by at least about 70%. In some embodiments, gene editing reduces transcription of SOX4 by at least about 80%. In some embodiments, gene editing reduces transcription of SOX4 by at least about 90%.

[0251] In some embodiments, gene editing can reduce expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of SOX4 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of SOX4 by at least about 30%. In some embodiments, gene editing reduces expression of SOX4 by at least about 40%. In some embodiments, gene editing reduces expression of SOX4 by at least about 50%. In some embodiments, the gene editing reduces SOX4 expression by at least about 60%. In some embodiments, the gene editing reduces SOX4 expression by at least about 70%. In some embodiments, the gene editing reduces SOX4 expression by at least about 80%. In some embodiments, the gene editing reduces SOX4 expression by at least about 90%.

[0252] In some embodiments, SOX4 expression is disrupted and / or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) or other guide nucleases disclosed elsewhere herein by use of one or more of the following SOX4-specific guide RNAs: SEQ ID NOs: 970-976 (see, e.g., Table E2). In some embodiments, a guide RNA (gRNA) comprising the sequence of any of SEQ ID NOs: 970-976 is used to disrupt (e.g., reduce expression of) the SOX4 gene. Non-limiting examples of guide RNAs for reducing and / or eliminating ID3 expression are provided in Table 5 below.

[0253] [Table 5]

[0254] According to additional embodiments, other modulators of one or more aspects of NK cell (or T cell) function are modulated by gene editing. Various cytokines confer either negative (as with TGF-beta, as described above) or positive signals to immune cells. As a non-limiting example, IL15 is a positive regulator of NK cells, which, as disclosed herein, can enhance one or more of NK cell homing, NK cell migration, NK cell expansion / proliferation, NK cell cytotoxicity, and / or NK cell persistence. To keep NK cells in check under normal physiological conditions, cytokine-inducible SH2-containing protein (CIS, encoded by the CISH gene) acts as a key negative regulator of IL-15 signaling in NK cells. As discussed herein, IL15 biology affects multiple aspects of NK cell functionality, including, but not limited to, proliferation / proliferation, activation, cytotoxicity, persistence, homing, migration, etc. Thus, according to some embodiments, editing CIS enhances NK cell functionality across multiple functions, resulting in more effective and long-lasting NK cell therapeutics. In some embodiments, an inhibitor of CIS is used in conjunction with the administration of engineered NK cells. In some embodiments, CIS expression is knocked down or knocked out by gene editing of the CIS gene, for example, by using CRISPR-Cas editing. Small interfering RNA, antisense RNA, TALEN, or zinc fingers are used in other embodiments. In some embodiments, CIS expression in T cells is knocked down by gene editing.

[0255] In some embodiments, as discussed above, CISH editing advantageously confers enhanced expansion, cytotoxicity, and / or persistence to edited cells, particularly edited NK cells. Additionally, in some embodiments, TCR modifications include modifications to TCRα, allowing T cell proliferation without affecting signaling through the CD3 complex. In one embodiment, TCRα is inactivated by expression of pre-Tα in cells, thus restoring a functional CD3 complex in the absence of a functional alpha / beta TCR. As disclosed herein, non-alloreactive modified T cells are also engineered to express a CAR, altering the tropism of non-alloreactive T cell specificity toward tumor markers, but independently of MHC. Combinations of editing, such as, but not limited to, knockout of TCR and CISH, or knockout of CISH and knockin of CD47, are used in some embodiments. In some embodiments, a combination of CISH knockout and CDK8 knockout is used in combination. In some embodiments, a combination of a CISH knockout and a CCNC knockout is used in combination. In some embodiments, a combination of a CISH knockout and a MED12 knockout is used in combination. In some embodiments, a combination of a CISH knockout and a MED13 knockout is used in combination.

[0256] In some embodiments, CISH gene editing provides NK cells with enhanced ability to home to target sites. In some embodiments, CISH gene editing provides NK cells with enhanced ability to migrate, e.g., in response to chemotactic factors, or to move away from repellents, e.g., within tissues. In some embodiments, CISH gene editing provides NK cells with enhanced ability to activate and thus exert, e.g., anti-tumor effects. In some embodiments, CISH gene editing provides NK cells with enhanced proliferation capacity, which in some embodiments allows for the generation of robust NK cell numbers from donor blood samples. Additionally, in such embodiments, NK cells edited for CISH and engineered to express a CAR are more easily, robustly, and consistently expanded in culture. In some embodiments, CISH gene editing provides NK cells with enhanced cytotoxicity. In some embodiments, CISH editing synergistically enhances the cytotoxic effect of engineered NK cells and / or engineered T cells expressing a CAR.

[0257] In some embodiments, CISH gene editing activates or inhibits a wide variety of pathways. CIS proteins are negative regulators of IL15 signaling, for example, by inhibiting the JAK-STAT signaling pathway. These pathways typically result in the transcription of IL15-responsive genes (including CISH). In some embodiments, knockdown of CISH disinhibits JAK-STAT (e.g., JAK1-STAT5) signaling, and there is enhanced transcription of IL15-responsive genes. In some embodiments, knockout of CISH results in enhanced signaling through the mammalian target of rapamycin (mTOR), with a corresponding increase in expression of genes related to cellular metabolism and respiration. In some embodiments, knockout of CISH results in increased IL15-induced expression of IL-2Rα (CD25), but not IL-15Rα or IL-2 / 15Rβ, enhanced NK cell membrane binding of IL15 and / or IL2, increased phosphorylation of STAT-3 and / or STAT-5, and elevated expression of anti-apoptotic proteins such as Bcl-2. In some embodiments, CISH knockout results in IL15-induced upregulation of selected genes related to mitochondrial function (e.g., electron transport chain and cellular respiration) and the cell cycle. Thus, in some embodiments, knockout of CISH by gene editing enhances NK cell cytotoxicity and / or persistence, at least in part, through metabolic reprogramming. In some embodiments, negative regulators of cellular metabolism, such as TXNIP, are downregulated in response to CISH knockout. In some embodiments, promoters for cell survival and proliferation, including BIRC5 (survivin), TOP2A, CKS2, and RACGAP1, are upregulated after CISH knockout, while antiproliferative or proapoptotic proteins, such as TGFB1, ATM, and PTCH1, are downregulated.In some embodiments, the CISH knockout alters the signaling state (e.g., activates or inactivates) through or by one or more of CXCL-10, IL2, TNF, IFNg, IL13, IL4, Jnk, PRF1, STAT5, PRKCQ, IL2 receptor beta, SOCS2, MYD88, STAT3, STAT1, TBX21, LCK, JAK3, IL& receptor, ABL1, IL9, STAT5A, STAT5B, Tcf7, PRDM1, and / or EOMES.

[0258] As a non-limiting example, TGF-beta is one such cytokine released by tumor cells that leads to immunosuppression within the tumor microenvironment. This immunosuppression reduces the ability of immune cells, and in some cases, engineered CAR immune cells, to destroy tumor cells, thus enabling tumor progression. In some embodiments, immune checkpoints are disrupted by gene editing, as discussed in detail below. In some embodiments, blockers of immunosuppressive cytokines in the tumor microenvironment are used, including blockers or competitive inhibitors of their release, which reduce the ability of signaling molecules to bind to and inhibit immune cells. Such signaling molecules include, but are not limited to, TGF-beta, IL10, arginase, inducible NOS, reactive NOS, Arg1, indoleamine 2,3-dioxygenase (IDO), and PGE2. However, in additional embodiments, immune cells, such as NK cells, are provided in which the ability of NK cells (or other cells) to respond to a given immunosuppressive signaling molecule has been disrupted and / or eliminated. For example, in some embodiments, NK cells or T cells are gene-edited to reduce their sensitivity to TGF-beta. TGF-beta is an inhibitor of NK cell function, at least at the levels of proliferation and cytotoxicity. Therefore, according to some embodiments, expression of TGF-beta receptor is knocked down or knocked out by gene editing, such that the edited NK cells are resistant to the immunosuppressive effects of TGF-beta in the tumor microenvironment. In some embodiments, the TGFB2 receptor is knocked down or knocked out by gene editing, for example, by using CRISPR-Cas editing. Small interfering RNA, antisense RNA, TALEN, or zinc finger is used in other embodiments. Other isoforms of TGF-beta receptor (e.g., TGF-beta 1 and / or TGF-beta 3) are edited in some embodiments. In some embodiments, the TGF-beta receptor in T cells is knocked down by gene editing.

[0259] Provided herein are additional cell engineering strategies that serve to further enhance the persistence of allogeneic cell therapy products, e.g., allogeneic CAR-T cells and / or allogeneic CAR-NK cells. In some embodiments, provided herein are populations of genetically engineered immune cells for cancer immunotherapy, where the genetically engineered immune cells are genetically modified (e.g., gene edited) at one, two, three, or more genetic loci to enhance the cytotoxic activity, persistence, or other traits of the cells, e.g., NK cells and / or T cells.

[0260] As discussed herein, there are various strategies that can be used to reduce the tendency of an allogeneic cell therapy product to induce host cell-mediated graft rejection. For example, in some embodiments, expression of B2M is reduced and / or eliminated to reduce host cell-mediated graft rejection. In some embodiments, B2M expression is disrupted and / or knocked out using a Crispr-Cas mediated approach (e.g., Cas9), or other guide nucleases disclosed elsewhere herein, by use of one or more of the following B2M-specific guide RNAs: sequence ID199-CGCGAGCACAGCTAAGGCCA; sequence ID200-GAGTAGCGCGAGCACAGCTA; sequence ID201-GCTACTCTCTCTTTCTGGCC; sequence ID202-GGCCGAGATGTCTCGCTCCG; sequence ID203-GGCCACGGAGCGAGACATCT; sequence ID204-CACAGCCCAAGATAGTTAAG; sequence ID205-AGTCACATGGTTCACACGGC; sequence ID206-AAGTCAACTTCAATGTCGGA; sequence ID207-ACTTGTCTTTCAGCAAGGAC; and sequence ID208-TGGGCTGTGACAAAGTCACA.

[0261] In some embodiments, gene editing reduces transcription of B2M by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, gene editing reduces transcription of B2M by at least about 30%. In some embodiments, gene editing reduces transcription of B2M by at least about 40%. In some embodiments, gene editing reduces transcription of B2M by at least about 50%. In some embodiments, gene editing reduces transcription of B2M by at least about 60%. In some embodiments, gene editing reduces transcription of B2M by at least about 70%. In some embodiments, gene editing reduces transcription of B2M by at least about 80%. In some embodiments, gene editing reduces transcription of B2M by at least about 90%.

[0262] In some embodiments, gene editing can reduce expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of B2M by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of B2M by at least about 30%. In some embodiments, gene editing reduces expression of B2M by at least about 40%. In some embodiments, gene editing reduces expression of B2M by at least about 50%. In some embodiments, the gene editing reduces expression of B2M by at least about 60%. In some embodiments, the gene editing reduces expression of B2M by at least about 70%. In some embodiments, the gene editing reduces expression of B2M by at least about 80%. In some embodiments, the gene editing reduces expression of B2M by at least about 90%.

[0263] In some embodiments, expression of ADORA2A (adenosine 2a receptor) is reduced and / or eliminated to increase overall activation in the resulting T cells and / or NK cells, or other cell types provided herein. In some embodiments, ADORA2A is disrupted and / or knocked out using one or more of the gene editing methods disclosed herein. In some embodiments, ADORA2A is disrupted and / or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) using a nuclease guided by the use of one or more of the following ADORA2A-specific guide RNAs: SEQ ID NOs: 404-407, or other guided nucleases disclosed elsewhere herein. In some embodiments, gene editing can reduce target protein expression by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between the listed amounts). Loss of ADORA2A expression induces decreased sensitivity to adenosine, a well-established immunosuppressant for T cells and NK cells (Young et al., Cancer Res. (2018) 78(4):1003-16; Cekic and Linden, Cancer Res. (2014) 74(24):7239-49). In NK cells, loss of ADORA2A results in loss of maturation, proliferation, and effector function (as shown in constitutive knockout mice). In T cells, loss of ADORA2A results in downstream loss of CD8 activation and function, an increase in Tregs and TH2, and a loss of TH1. Thus, according to some embodiments, gene editing of ADORA2A increases the cytotoxicity, persistence, immune evasion, or otherwise enhances the effectiveness of engineered NK, T, or other cells disclosed herein.

[0264] In some embodiments, gene editing reduces transcription of ADORA2A by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, gene editing reduces transcription of ADORA2A by at least about 30%. In some embodiments, gene editing reduces transcription of ADORA2A by at least about 40%. In some embodiments, gene editing reduces transcription of ADORA2A by at least about 50%. In some embodiments, gene editing reduces transcription of ADORA2A by at least about 60%. In some embodiments, gene editing reduces transcription of ADORA2A by at least about 70%. In some embodiments, gene editing reduces transcription of ADORA2A by at least about 80%. In some embodiments, the gene editing reduces transcription of ADORA2A by at least about 90%.

[0265] In some embodiments, gene editing can reduce expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of ADORA2A by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of ADORA2A by at least about 30%. In some embodiments, gene editing reduces expression of ADORA2A by at least about 40%. In some embodiments, gene editing reduces expression of ADORA2A by at least about 50%. In some embodiments, gene editing reduces expression of ADORA2A by at least about 60%. In some embodiments, gene editing reduces expression of ADORA2A by at least about 70%. In some embodiments, gene editing reduces expression of ADORA2A by at least about 80%. In some embodiments, gene editing reduces expression of ADORA2A by at least about 90%.

[0266] The tumor microenvironment (TME), as suggested by the nomenclature, is the environment surrounding a tumor. It includes surrounding blood vessels and capillaries, immune cells circulating through or retained in the region, fibroblasts, various signaling molecules released by tumor cells, immune cells, or other cells in the region, and the surrounding extracellular matrix. Various mechanisms, including modification of the TME, are used by tumors to avoid detection and / or destruction by host immune cells. Tumors can alter the TME by releasing extracellular signals, promoting tumor angiogenesis, or even inducing immune tolerance, in part by limiting immune cell invasion and / or regeneration / expansion in the TME. Tumors can also modify the extracellular matrix (ECM), which may allow tumors to develop pathways for extravascularization to new sites. Transforming growth factor beta (TGFb) has beneficial effects in reducing inflammation and preventing autoimmunity. However, it can also function to inhibit anti-tumor immune responses, and thus upregulated expression of TGFb is associated with tumor progression and metastasis [Pickup et al., Nat. Rev. Cancer (2013) 13(11):788-99]. TGFb signaling can inhibit the cytotoxic function of NK cells by interacting with TGFb receptors expressed by NK cells, such as TGFb receptor isoform II (TGFBR2). According to some embodiments disclosed herein, reducing or eliminating the expression of TGFBR2 by gene editing (e.g., by CRISPr / Cas9 guided by a TGFBR2 guide RNA) prevents the inhibitory effect of TGFb in NK cells.

[0267] In some embodiments, the expression of TGFBR2 is reduced and / or eliminated to increase the overall activation of the resulting T cells and / or NK cells, or other cell types provided herein. In some embodiments, TGFBR2 is disrupted and / or knocked out using one or more of the gene editing methods disclosed herein. Non-limiting examples of guide RNAs for reducing and / or eliminating TGFBR2 expression are provided in Table 6 below.

[0268] [Table 6]

[0269] In some embodiments, TGFBR2 is disrupted and / or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) using a nuclease guided by the use of one or more of the following TGFBR2-specific guide RNAs: SEQ ID NOs: 445-448, or other guided nucleases disclosed elsewhere herein.

[0270] In some embodiments, gene editing reduces transcription of TGFBR2 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, gene editing reduces transcription of TGFBR2 by at least about 30%. In some embodiments, gene editing reduces transcription of TGFBR2 by at least about 40%. In some embodiments, gene editing reduces transcription of TGFBR2 by at least about 50%. In some embodiments, gene editing reduces transcription of TGFBR2 by at least about 60%. In some embodiments, gene editing reduces transcription of TGFBR2 by at least about 70%. In some embodiments, gene editing reduces transcription of TGFBR2 by at least about 80%. In some embodiments, the gene editing reduces transcription of TGFBR2 by at least about 90%.

[0271] In some embodiments, gene editing can reduce expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of TGFBR2 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of TGFBR2 by at least about 30%. In some embodiments, gene editing reduces expression of TGFBR2 by at least about 40%. In some embodiments, gene editing reduces expression of TGFBR2 by at least about 50%. In some embodiments, gene editing reduces TGFBR2 expression by at least about 60%. In some embodiments, gene editing reduces TGFBR2 expression by at least about 70%. In some embodiments, gene editing reduces TGFBR2 expression by at least about 80%. In some embodiments, gene editing reduces TGFBR2 expression by at least about 90%.

[0272] In NK cells, TGFBR2 is a potent checkpoint in NK cell-mediated tumor immunity, while in T cells, knockout of TGFBR2 rescues TGF-β1-induced exhaustion of CAR T cells [Tang et al., JCI Insight (2020) 5(4):e133977]. Thus, according to some embodiments, gene editing of TGFBR2 increases the cytotoxicity, persistence, and / or otherwise enhances the efficacy of engineered NK, T, or other cells disclosed herein.

[0273] According to additional embodiments, disruption or elimination of receptor, pathway, or protein expression in immune cells can result in enhanced immune cell activity (e.g., cytotoxicity, persistence, etc.) against target cancer cells. In some embodiments, this results from immune cell disinhibition. Natural killer cells express a variety of receptors, particularly those within the natural killer group 2 family of receptors. According to some embodiments disclosed herein, one such receptor, the NKG2D receptor, is used to create cytotoxic signaling constructs expressed by NK cells, resulting in enhanced anti-cancer activity of such NK cells. In addition, NK cells express the inhibitory receptor NKG2A receptor. One mechanism by which tumors develop resistance to immune cells is through the expression of peptide-loaded HLA class I molecules (HLA-E), which suppress NK cell activity through ligation of HLA-E with the NKG2A receptor. Therefore, one approach is to block the interaction between HLA-E and the NKG2A receptor expressed on NK cells; according to some embodiments disclosed herein, the expression of NKG2A is disrupted, which short-circuits the inhibitory pathway and allows for enhanced NK cell cytotoxicity.

[0274] Non-limiting examples of guide RNAs for reducing and / or eliminating NKG2A expression are provided in Table 7 below.

[0275] [Table 7]

[0276] In some embodiments, NKG2A is disrupted and / or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) using a nuclease guided by the use of one or more of the following NKG2A-specific guide RNAs: SEQ ID NOs: 450-452, or other guided nucleases disclosed elsewhere herein.

[0277] In some embodiments, gene editing reduces transcription of NKG2A by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, gene editing reduces transcription of NKG2A by at least about 30%. In some embodiments, gene editing reduces transcription of NKG2A by at least about 40%. In some embodiments, gene editing reduces transcription of NKG2A by at least about 50%. In some embodiments, gene editing reduces transcription of NKG2A by at least about 60%. In some embodiments, gene editing reduces transcription of NKG2A by at least about 70%. In some embodiments, gene editing reduces transcription of NKG2A by at least about 80%. In some embodiments, the gene editing reduces transcription of NKG2A by at least about 90%.

[0278] In some embodiments, gene editing can reduce expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of NKG2A by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of NKG2A by at least about 30%. In some embodiments, gene editing reduces expression of NKG2A by at least about 40%. In some embodiments, gene editing reduces expression of NKG2A by at least about 50%. In some embodiments, gene editing reduces NKG2A expression by at least about 60%. In some embodiments, gene editing reduces NKG2A expression by at least about 70%. In some embodiments, gene editing reduces NKG2A expression by at least about 80%. In some embodiments, gene editing reduces NKG2A expression by at least about 90%.

[0279] NKG2A binds to HLA-E and is recognized as an MHC recognition receptor. Because NKG2A is an inhibitor receptor, loss of NKG2A expression induces increased activation of constitutive cells. In NK and T cells, loss of NKG2A results in increased activation and cytotoxicity against HLA-E-expressing tumor cells [Kamiya et al., J. Clin. Invest. (2019) 129(5):2094-2106]. Therefore, according to some embodiments, gene editing of NKG2A increases the cytotoxicity, persistence, and / or otherwise enhances the efficacy of engineered NK, T, or other cells disclosed herein.

[0280] Interleukins, particularly interleukin-15, are important for the function and survival of NK cells. Suppressor of cytokine signaling (SOCS) proteins are negative regulators of cytokines released by NK cells. Protein tyrosine phosphatase CD45, through its Src-family kinase activity, is a key regulator of NK cell activity. CD45 expression is involved in ITAM-specific NK cell functions and processes, such as degranulation, cytokine production, and expansion [Hesslein et al., Blood (2011) 117(11):3087-95]. Therefore, knocking out CD45 expression should result in less effective NK cells. As discussed above, CRISPR / Cas9 was used to disrupt the expression of CD45 (encoded by PTPRC) and SOCS2, but other gene editing approaches can be used in additional embodiments. Non-limiting examples of CD45- and SOCS2-targeting guide RNAs are listed in Table 8 below.

[0281] [Table 8]

[0282] In some embodiments, gene editing reduces transcription of the PTPRC by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, gene editing reduces transcription of the PTPRC by at least about 30%. In some embodiments, gene editing reduces transcription of the PTPRC by at least about 40%. In some embodiments, gene editing reduces transcription of the PTPRC by at least about 50%. In some embodiments, gene editing reduces transcription of the PTPRC by at least about 60%. In some embodiments, gene editing reduces transcription of the PTPRC by at least about 70%. In some embodiments, gene editing reduces transcription of the PTPRC by at least about 80%. In some embodiments, gene editing reduces transcription of the PTPRC by at least about 90%.

[0283] In some embodiments, gene editing can reduce expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of CD45 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of CD45 by at least about 30%. In some embodiments, gene editing reduces expression of CD45 by at least about 40%. In some embodiments, gene editing reduces expression of CD45 by at least about 50%. In some embodiments, the gene editing reduces CD45 expression by at least about 60%. In some embodiments, the gene editing reduces CD45 expression by at least about 70%. In some embodiments, the gene editing reduces CD45 expression by at least about 80%. In some embodiments, the gene editing reduces CD45 expression by at least about 90%.

[0284] In some embodiments, SOCS2 is disrupted and / or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) using a nuclease guided by the use of one or more of the following SOCS2-specific guide RNAs: SEQ ID NOs: 457-462, or other guided nucleases disclosed elsewhere herein.

[0285] In some embodiments, gene editing reduces transcription of SOCS2 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, gene editing reduces transcription of SOCS2 by at least about 30%. In some embodiments, gene editing reduces transcription of SOCS2 by at least about 40%. In some embodiments, gene editing reduces transcription of SOCS2 by at least about 50%. In some embodiments, gene editing reduces transcription of SOCS2 by at least about 60%. In some embodiments, gene editing reduces transcription of SOCS2 by at least about 70%. In some embodiments, gene editing reduces transcription of SOCS2 by at least about 80%. In some embodiments, gene editing reduces transcription of SOCS2 by at least about 90%.

[0286] In some embodiments, gene editing can reduce expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of SOCS2 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of SOCS2 by at least about 30%. In some embodiments, gene editing reduces expression of SOCS2 by at least about 40%. In some embodiments, gene editing reduces expression of SOCS2 by at least about 50%. In some embodiments, the gene editing reduces SOCS2 expression by at least about 60%. In some embodiments, the gene editing reduces SOCS2 expression by at least about 70%. In some embodiments, the gene editing reduces SOCS2 expression by at least about 80%. In some embodiments, the gene editing reduces SOCS2 expression by at least about 90%.

[0287] SOCS proteins are negative regulators of cytokine responses, and SOCS2 specifically negatively regulates NK cell development by inhibiting JAK2 activity. Loss of SOCS2 expression in NK cells induces increased NK cell development and overall cytotoxicity [Kim et al., Scientific Reports (2017) 7:46153]. Thus, according to some embodiments, gene editing of SOCS2 increases the cytotoxicity, persistence, and / or otherwise enhances the efficacy of engineered NK, T, or other cells disclosed herein.

[0288] In some embodiments, expression of Casitas B-lineage lymphoma b (Cbl-b) is reduced and / or eliminated to increase overall activation in the resulting T cells and / or NK cells, or other cell types provided herein. In some embodiments, Cbl-b is disrupted and / or knocked out using one or more of the gene editing methods disclosed herein. In some embodiments, Cbl-b is disrupted and / or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) or other guide nucleases disclosed elsewhere herein. Non-limiting examples of CBLB-targeting guide RNAs for reducing and / or eliminating CBLB expression are shown in Table 9 below.

[0289] [Table 9]

[0290] In some embodiments, Cbl-b is disrupted and / or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) or other guide nucleases disclosed elsewhere herein by use of one or more of the following Cbl-b specific guide RNAs: SEQ ID NOs: 453-456.

[0291] In some embodiments, gene editing reduces CBLB transcription by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, gene editing reduces CBLB transcription by at least about 30%. In some embodiments, gene editing reduces CBLB transcription by at least about 40%. In some embodiments, gene editing reduces CBLB transcription by at least about 50%. In some embodiments, gene editing reduces CBLB transcription by at least about 60%. In some embodiments, gene editing reduces CBLB transcription by at least about 70%. In some embodiments, gene editing reduces CBLB transcription by at least about 80%. In some embodiments, gene editing reduces CBLB transcription by at least about 90%.

[0292] In some embodiments, gene editing can reduce expression of a target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of Cbl-b by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of Cbl-b by at least about 30%. In some embodiments, gene editing reduces expression of Cbl-b by at least about 40%. In some embodiments, gene editing reduces expression of Cbl-b by at least about 50%. In some embodiments, gene editing reduces Cbl-b expression by at least about 60%. In some embodiments, gene editing reduces Cbl-b expression by at least about 70%. In some embodiments, gene editing reduces Cbl-b expression by at least about 80%. In some embodiments, gene editing reduces Cbl-b expression by at least about 90%.

[0293] Cbl-b is an E3 ubiquitin ligase that negatively regulates T cell activation. Loss of Cbl-b expression in NK cells and T cells is associated with increased antitumor immunity. Furthermore, Cbl-b-deficient T cells and NK cells are resistant to PD-L1 / PD-1-mediated suppression [Fujiwara et al., Front. Immunol. (2017) 8:42]. Thus, according to some embodiments, gene editing of Cbl-b increases the cytotoxicity, persistence, and / or otherwise enhances the efficacy of engineered NK, T, or other cells disclosed herein.

[0294] Another E3 ubiquitin ligase, tripartite motif-containing protein 29 (TRIM29), is a negative regulator of NK cell function [Dou et al., J. Immunol. (2019) 203(4):873-80]. TRIM29 is not generally expressed by resting NK cells, but is rapidly upregulated after activation (particularly by IL-12 / IL-18 stimulation). Non-limiting examples of TRIM29-targeting guide RNAs for reducing and / or eliminating TRIM29 expression are shown in Table 10 below.

[0295] [Table 10]

[0296] In some embodiments, gene editing reduces transcription of TRIM29 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, gene editing reduces transcription of TRIM29 by at least about 30%. In some embodiments, gene editing reduces transcription of TRIM29 by at least about 40%. In some embodiments, gene editing reduces transcription of TRIM29 by at least about 50%. In some embodiments, gene editing reduces transcription of TRIM29 by at least about 60%. In some embodiments, gene editing reduces transcription of TRIM29 by at least about 70%. In some embodiments, gene editing reduces transcription of TRIM29 by at least about 80%. In some embodiments, the gene editing reduces transcription of TRIM29 by at least about 90%.

[0297] In some embodiments, gene editing can reduce expression of a target protein (e.g., TRIM29) by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of TRIM29 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of TRIM29 by at least about 30%. In some embodiments, gene editing reduces expression of TRIM29 by at least about 40%. In some embodiments, the gene editing reduces TRIM29 expression by at least about 50%. In some embodiments, the gene editing reduces TRIM29 expression by at least about 60%. In some embodiments, the gene editing reduces TRIM29 expression by at least about 70%. In some embodiments, the gene editing reduces TRIM29 expression by at least about 80%. In some embodiments, the gene editing reduces TRIM29 expression by at least about 90%.

[0298] In some embodiments, expression of beta-2 microglobulin (B2-microglobulin) is reduced and / or eliminated to increase overall activation in the resulting T cells and / or NK cells, or other cell types provided herein. In some embodiments, B2-microglobulin is disrupted and / or knocked out using one or more of the gene editing methods disclosed herein. In some embodiments, B2-microglobulin is disrupted and / or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) using a nuclease guided by the use of one or more of the following B2-microglobulin-specific guide RNAs: SEQ ID NOs: 199-208, or other guided nucleases disclosed elsewhere herein.

[0299] In some embodiments, gene editing reduces transcription of B2M by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, gene editing reduces transcription of B2M by at least about 30%. In some embodiments, gene editing reduces transcription of B2M by at least about 40%. In some embodiments, gene editing reduces transcription of B2M by at least about 50%. In some embodiments, gene editing reduces transcription of B2M by at least about 60%. In some embodiments, gene editing reduces transcription of B2M by at least about 70%. In some embodiments, gene editing reduces transcription of B2M by at least about 80%. In some embodiments, gene editing reduces transcription of B2M by at least about 90%.

[0300] In some embodiments, gene editing can reduce expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of B2M by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of B2M by at least about 30%. In some embodiments, gene editing reduces expression of B2M by at least about 40%. In some embodiments, gene editing reduces expression of B2M by at least about 50%. In some embodiments, the gene editing reduces expression of B2M by at least about 60%. In some embodiments, the gene editing reduces expression of B2M by at least about 70%. In some embodiments, the gene editing reduces expression of B2M by at least about 80%. In some embodiments, the gene editing reduces expression of B2M by at least about 90%.

[0301] Loss of B2-microglobulin expression induces greatly reduced levels of MHC class I molecules, and in both NK and T cells, reduction of B2-microglobulin can globally modulate cellular recognition of autologous and allogeneic cells. Thus, according to some embodiments, gene editing of B2-microglobulin increases the cytotoxicity, persistence, and / or otherwise enhances the efficacy of engineered NK, T, or other cells disclosed herein.

[0302] In some embodiments, expression of T cell immunoreceptor with Ig and ITIM domains (TIGIT) is reduced and / or eliminated to increase overall activation in the resulting T cells and / or NK cells, or other cell types provided herein. In some embodiments, TIGIT is disrupted and / or knocked out using one or more of the gene editing methods disclosed herein. In some embodiments, TIGIT is disrupted and / or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) with a nuclease guided by use of one or more of the following TIGIT-specific guide RNAs: SEQ ID NOs: 408-411, or other guided nucleases disclosed elsewhere herein.

[0303] In some embodiments, gene editing reduces transcription of TIGIT by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, gene editing reduces transcription of TIGIT by at least about 30%. In some embodiments, gene editing reduces transcription of TIGIT by at least about 40%. In some embodiments, gene editing reduces transcription of TIGIT by at least about 50%. In some embodiments, gene editing reduces transcription of TIGIT by at least about 60%. In some embodiments, gene editing reduces transcription of TIGIT by at least about 70%. In some embodiments, gene editing reduces transcription of TIGIT by at least about 80%. In some embodiments, gene editing reduces transcription of TIGIT by at least about 90%.

[0304] In some embodiments, gene editing can reduce expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of TIGIT by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of TIGIT by at least about 30%. In some embodiments, gene editing reduces expression of TIGIT by at least about 40%. In some embodiments, gene editing reduces expression of TIGIT by at least about 50%. In some embodiments, gene editing reduces TIGIT expression by at least about 60%. In some embodiments, gene editing reduces TIGIT expression by at least about 70%. In some embodiments, gene editing reduces TIGIT expression by at least about 80%. In some embodiments, gene editing reduces TIGIT expression by at least about 90%.

[0305] TIGIT is a checkpoint receptor associated with the exhaustion of T cells and NK cells. Loss of TIGIT expression in NK cells prevents NK cell exhaustion and promotes NK cell-dependent tumor immunity [Zhang et al., Nat. Immunol. (2018) 19(7):723-32]. Loss of TIGIT expression in T cells can similarly result in downstream activation of the resulting T cells. Thus, according to some embodiments, gene editing of TIGIT increases the cytotoxicity, persistence, and / or otherwise enhances the efficacy of engineered NK, T, or other cells disclosed herein.

[0306] In some embodiments, expression of programmed cell death protein-1 (PD-1; encoded by PDCD1) is reduced and / or eliminated to increase overall activation in the resulting T cells and / or NK cells, or other cell types provided herein. In some embodiments, PD-1 is disrupted and / or knocked out using one or more of the gene editing methods disclosed herein. In some embodiments, PD-1 is disrupted and / or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) with a nuclease guided by use of one or more of the following PD-1 specific guide RNAs: SEQ ID NOs: 412-415, or other guided nucleases disclosed elsewhere herein.

[0307] In some embodiments, gene editing reduces transcription of PDCD1 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, gene editing reduces transcription of PDCD1 by at least about 30%. In some embodiments, gene editing reduces transcription of PDCD1 by at least about 40%. In some embodiments, gene editing reduces transcription of PDCD1 by at least about 50%. In some embodiments, gene editing reduces transcription of PDCD1 by at least about 60%. In some embodiments, gene editing reduces transcription of PDCD1 by at least about 70%. In some embodiments, gene editing reduces transcription of PDCD1 by at least about 80%. In some embodiments, gene editing reduces transcription of PDCD1 by at least about 90%.

[0308] In some embodiments, gene editing can reduce expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of PD-1 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of PD-1 by at least about 30%. In some embodiments, gene editing reduces expression of PD-1 by at least about 40%. In some embodiments, gene editing reduces expression of PD-1 by at least about 50%. In some embodiments, the gene editing reduces PD-1 expression by at least about 60%. In some embodiments, the gene editing reduces PD-1 expression by at least about 70%. In some embodiments, the gene editing reduces PD-1 expression by at least about 80%. In some embodiments, the gene editing reduces PD-1 expression by at least about 90%.

[0309] PD-1 plays an inhibitory role in immune regulation, downregulating overall function by suppressing immune cell activity. Loss of PD-1 expression in NK cells increases overall cytotoxicity due to increased secretion of interferon-gamma, granzyme B, and perforin [Niu et al., Int. J. Med. Sci. (2020) 17(13):1964-73]. Similarly, T cells with loss of PD-1 expression exhibit increased cytotoxicity and overall caspase activation [Zhao et al., Ocotarget (2018) 9(4):5208-15]. Thus, according to some embodiments, gene editing of PD-1 increases cytotoxicity, persistence, and / or otherwise enhances the efficacy of engineered NK, T, or other cells disclosed herein.

[0310] In some embodiments, T cell immunoglobulin and mucin domain-containing 3 (TIM-3; also known as HAVCR2) expression is reduced and / or eliminated to increase overall activation in the resulting T cells and / or NK cells, or other cell types provided herein. In some embodiments, TIM-3 is disrupted and / or knocked out using one or more of the gene editing methods disclosed herein. In some embodiments, TIM-3 is disrupted and / or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) with a nuclease guided by use of one or more of the following TIM-3 specific guide RNAs: SEQ ID NOs: 416-419, or other guided nucleases disclosed elsewhere herein.

[0311] In some embodiments, gene editing reduces transcription of TIM3 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, gene editing reduces transcription of TIM3 by at least about 30%. In some embodiments, gene editing reduces transcription of TIM3 by at least about 40%. In some embodiments, gene editing reduces transcription of TIM3 by at least about 50%. In some embodiments, gene editing reduces transcription of TIM3 by at least about 60%. In some embodiments, gene editing reduces transcription of TIM3 by at least about 70%. In some embodiments, gene editing reduces transcription of TIM3 by at least about 80%. In some embodiments, gene editing reduces transcription of TIM3 by at least about 90%.

[0312] In some embodiments, gene editing can reduce expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of TIM-3 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of TIM-3 by at least about 30%. In some embodiments, gene editing reduces expression of TIM-3 by at least about 40%. In some embodiments, gene editing reduces expression of TIM-3 by at least about 50%. In some embodiments, gene editing reduces TIM-3 expression by at least about 60%. In some embodiments, gene editing reduces TIM-3 expression by at least about 70%. In some embodiments, gene editing reduces TIM-3 expression by at least about 80%. In some embodiments, gene editing reduces TIM-3 expression by at least about 90%.

[0313] TIM-3 is an inhibitory receptor involved in immune checkpoint function. Loss of TIM-3 expression increases the overall cytotoxicity of engineered NK and T cells, as well as reducing NK and T cell exhaustion, resulting in increased effector function of constituent cells lacking TIM-3 expression [Pires de Silva et al., Cancer Imunol. Res. (2014) 2(5):410-22]. Thus, according to some embodiments, gene editing of TIM-3 increases the cytotoxicity, persistence, immune evasion, or otherwise enhances the efficacy of engineered NK, T, or other cells disclosed herein.

[0314] In some embodiments, CD38 expression is reduced and / or eliminated to increase overall activation in the resulting T cells and / or NK cells, or other cell types provided herein. In some embodiments, CD38 is disrupted and / or knocked out using one or more of the gene editing methods disclosed herein. In some embodiments, CD38 is disrupted and / or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) using a nuclease guided by the use of one or more of the following CD38-specific guide RNAs: SEQ ID NOs: 420-423, or other guided nucleases disclosed elsewhere herein.

[0315] In some embodiments, the gene editing reduces CD38 transcription by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, the gene editing reduces CD38 transcription by at least about 30%. In some embodiments, the gene editing reduces CD38 transcription by at least about 40%. In some embodiments, the gene editing reduces CD38 transcription by at least about 50%. In some embodiments, the gene editing reduces CD38 transcription by at least about 60%. In some embodiments, the gene editing reduces CD38 transcription by at least about 70%. In some embodiments, the gene editing reduces CD38 transcription by at least about 80%. In some embodiments, the gene editing reduces CD38 transcription by at least about 90%.

[0316] In some embodiments, gene editing can reduce expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of CD38 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of CD38 by at least about 30%. In some embodiments, gene editing reduces expression of CD38 by at least about 40%. In some embodiments, gene editing reduces expression of CD38 by at least about 50%. In some embodiments, the gene editing reduces CD38 expression by at least about 60%. In some embodiments, the gene editing reduces CD38 expression by at least about 70%. In some embodiments, the gene editing reduces CD38 expression by at least about 80%. In some embodiments, the gene editing reduces CD38 expression by at least about 90%.

[0317] CD38 plays a role in the maturation cycle of immune cells, and hematological cancers often have upregulated CD38. Loss of CD38 expression in constitutive NK cells allows for greater cytotoxicity due to reduced fratricide [Nagai et al., Blood (2019) 134 (suppl. 1):870]. Wild-type NK cells self-express CD38, resulting in downstream self-targeting effects in wild-type NK cells. For T cells, loss of CD38 expression in constitutive T cells results in increased cytotoxicity. Thus, according to some embodiments, gene editing of CD38 increases cytotoxicity, persistence, and / or otherwise enhances the efficacy of engineered NK, T, or other cells disclosed herein.

[0318] In some embodiments, expression of T cell receptor alpha (TCRα) is reduced and / or eliminated to increase overall activation in the resulting T cells and / or NK cells, or other cell types provided herein. In some embodiments, TCRα is disrupted and / or knocked out using one or more of the gene editing methods disclosed herein. In some embodiments, TCRα is disrupted and / or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) with a nuclease guided by use of one or more of the following TCRα-specific guide RNAs: SEQ ID NOs: 467-470, or other guided nucleases disclosed elsewhere herein.

[0319] In some embodiments, gene editing reduces transcription of TRAC by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, gene editing reduces transcription of TRAC by at least about 30%. In some embodiments, gene editing reduces transcription of TRAC by at least about 40%. In some embodiments, gene editing reduces transcription of TRAC by at least about 50%. In some embodiments, gene editing reduces transcription of TRAC by at least about 60%. In some embodiments, gene editing reduces transcription of TRAC by at least about 70%. In some embodiments, gene editing reduces transcription of TRAC by at least about 80%. In some embodiments, gene editing reduces transcription of TRAC by at least about 90%.

[0320] In some embodiments, gene editing can reduce expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of TRAC by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of TRAC by at least about 30%. In some embodiments, gene editing reduces expression of TRAC by at least about 40%. In some embodiments, gene editing reduces expression of TRAC by at least about 50%. In some embodiments, gene editing reduces TRAC expression by at least about 60%. In some embodiments, gene editing reduces TRAC expression by at least about 70%. In some embodiments, gene editing reduces TRAC expression by at least about 80%. In some embodiments, gene editing reduces TRAC expression by at least about 90%.

[0321] T cell receptors (TCRs) are protein complexes found in T cells that are responsible for recognizing MHC molecules. The loss of certain TCRs and the preferential expression of other TCRs can result in increased cytotoxicity in engineered cells due to increased selective targeting and recognition by the constituent cells. Thus, in some embodiments, gene editing of TCRs increases cytotoxicity, persistence, and / or otherwise enhances the effectiveness of engineered NK, T, or other cells disclosed herein.

[0322] Cytokine-inducible SH2-containing protein (CIS) is a negative regulator of IL-15 signaling in NK cells and is encoded by the CISH gene in humans. IL-15 signaling can have a positive effect on NK cell expansion, survival, cytotoxicity, and cytokine production. Therefore, disruption of CISH renders NK cells more sensitive to IL-15, thereby increasing their antitumor efficacy. In some embodiments, expression of CISH is reduced and / or eliminated to increase overall activation in the resulting T cells and / or NK cells, or other cell types provided herein. In the experiments described herein, it was observed that disruption (e.g., knockout) of MED12 increased the cytotoxicity of NK cells but also tended to reduce the proliferation of such cells. Surprisingly, however, it was found that the effect of MED12 disruption on proliferation could be rescued by disruption (e.g., knockout) of CISH. Therefore, in some embodiments, it is contemplated that immune cells (e.g., NK cells) may be knocked out for both MED12 and CISH. In some embodiments, immune cells are gene edited within a target sequence in the MED12 gene and gene edited within a target sequence in the CISH gene, where the editing results in reduced expression and / or function of the CIS and MED12 proteins encoded by the CISH and MED12 genes, respectively, compared to immune cells that have not been edited within the target sequences.

[0323] In some embodiments, CISH is disrupted and / or knocked out using one or more of the gene editing methods disclosed herein. Non-limiting examples of CISH-targeting guide RNAs for reducing and / or eliminating expression of CIS (the protein encoded by CISH) are shown in Table 11 below.

[0324] [Table 11]

[0325] In some embodiments, CISH is disrupted and / or knocked out using a Crispr-Cas mediated approach (e.g., Cas9), or other guided nucleases disclosed elsewhere herein, using nucleases guided by the use of one or more of the following CISH-specific guide RNAs: SEQ ID NOs: 463-466, or other guides disclosed herein: SEQ ID NO: 463: GCACCTACAGAAGATGCCGG; SEQ ID NO: 464: GACAGCGTGAACAGGTAGCT; SEQ ID NO: 465: GACAGCGTGAACAGGTAGCT; SEQ ID NO: 466: ACTCAATGCGTACATTGGTG.

[0326] In some embodiments, gene editing reduces transcription of CISH by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, gene editing reduces transcription of CISH by at least about 30%. In some embodiments, gene editing reduces transcription of CISH by at least about 40%. In some embodiments, gene editing reduces transcription of CISH by at least about 50%. In some embodiments, gene editing reduces transcription of CISH by at least about 60%. In some embodiments, gene editing reduces transcription of CISH by at least about 70%. In some embodiments, gene editing reduces transcription of CISH by at least about 80%. In some embodiments, gene editing reduces transcription of CISH by at least about 90%.

[0327] In some embodiments, gene editing can reduce expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of CISH by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of CISH by at least about 30%. In some embodiments, gene editing reduces expression of CISH by at least about 40%. In some embodiments, gene editing reduces expression of CISH by at least about 50%. In some embodiments, gene editing reduces expression of CISH by at least about 60%. In some embodiments, gene editing reduces expression of CISH by at least about 70%. In some embodiments, gene editing reduces expression of CISH by at least about 80%. In some embodiments, gene editing reduces expression of CISH by at least about 90%.

[0328] In CD8+ T cells, CISH actively silences TCR signaling to maintain tumor resistance, and CISH has been shown to be a downstream negative regulator of IL-15 receptor signaling [Palmer et al., J. Exp. Med. (2015) 212(12):2095-2113]. In NK and T cells, CISH plays a role in checkpoint maturation and proliferation [Delconte et al., Nature Immunol (2016) 17:816-24]. Thus, according to some embodiments, gene editing of CISH increases the cytotoxicity, persistence, and / or otherwise enhances the efficacy of engineered NK, T, or other cells disclosed herein.

[0329] In some embodiments, expression of CEACAM1 is reduced and / or eliminated to increase overall activation in the resulting T cells and / or NK cells, or other cell types provided herein. In some embodiments, CEACAM1 is disrupted and / or knocked out using one or more of the gene editing methods disclosed herein. In some embodiments, CEACAM1 is disrupted and / or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) using a nuclease guided by the use of one or more of the following CEACAM1-specific guide RNAs: SEQ ID NOs: 398-400, or other guided nucleases disclosed elsewhere herein.

[0330] In some embodiments, gene editing reduces CEACAM1 transcription by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, gene editing reduces CEACAM1 transcription by at least about 30%. In some embodiments, gene editing reduces CEACAM1 transcription by at least about 40%. In some embodiments, gene editing reduces CEACAM1 transcription by at least about 50%. In some embodiments, gene editing reduces CEACAM1 transcription by at least about 60%. In some embodiments, gene editing reduces CEACAM1 transcription by at least about 70%. In some embodiments, gene editing reduces CEACAM1 transcription by at least about 80%. In some embodiments, the gene editing reduces transcription of CEACAM1 by at least about 90%.

[0331] In some embodiments, gene editing can reduce expression of a target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of CEACAM1 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of CEACAM1 by at least about 30%. In some embodiments, gene editing reduces expression of CEACAM1 by at least about 40%. In some embodiments, gene editing reduces expression of CEACAM1 by at least about 50%. In some embodiments, the gene editing reduces CEACAM1 expression by at least about 60%. In some embodiments, the gene editing reduces CEACAM1 expression by at least about 70%. In some embodiments, the gene editing reduces CEACAM1 expression by at least about 80%. In some embodiments, the gene editing reduces CEACAM1 expression by at least about 90%.

[0332] CEACAM1 is an immune checkpoint for both NK and T cells and can inhibit the lysis of CEACAM1-bearing tumor cell lines. Loss of CEACAM1 expression can increase the overall cytotoxicity of NK and T cells [Markel et al., J. Clin. Oncol. (2016) 34(suppl. 15):3044]. Thus, according to some embodiments, gene editing of CEACAM1 increases the cytotoxicity, persistence, and / or otherwise enhances the efficacy of engineered NK, T, or other cells disclosed herein.

[0333] In some embodiments, DDIT4 expression is reduced and / or eliminated to increase overall activation in the resulting T cells and / or NK cells, or other cell types provided herein. In some embodiments, DDIT4 is disrupted and / or knocked out using one or more of the gene editing methods disclosed herein. In some embodiments, DDIT4 is disrupted and / or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) using a nuclease guided by the use of one or more of the following DDIT4-specific guide RNAs: SEQ ID NOs: 401-403, or other guided nucleases disclosed elsewhere herein.

[0334] In some embodiments, gene editing reduces transcription of DDIT4 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, gene editing reduces transcription of DDIT4 by at least about 30%. In some embodiments, gene editing reduces transcription of DDIT4 by at least about 40%. In some embodiments, gene editing reduces transcription of DDIT4 by at least about 50%. In some embodiments, gene editing reduces transcription of DDIT4 by at least about 60%. In some embodiments, gene editing reduces transcription of DDIT4 by at least about 70%. In some embodiments, gene editing reduces transcription of DDIT4 by at least about 80%. In some embodiments, gene editing reduces transcription of DDIT4 by at least about 90%.

[0335] In some embodiments, gene editing can reduce target protein expression by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces DDIT4 expression by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces DDIT4 expression by at least about 30%. In some embodiments, gene editing reduces DDIT4 expression by at least about 40%. In some embodiments, gene editing reduces DDIT4 expression by at least about 50%. In some embodiments, gene editing reduces DDIT4 expression by at least about 60%. In some embodiments, gene editing reduces DDIT4 expression by at least about 70%. In some embodiments, gene editing reduces DDIT4 expression by at least about 80%. In some embodiments, gene editing reduces DDIT4 expression by at least about 90%.

[0336] In NK and T cells, DDIT4 is a negative regulator of mTORC1, which itself enhances IL-15-mediated survival and proliferation of NK cells. DDIT4 is also upregulated by oxidative stress conditions, which are common in the tumor microenvironment. Loss of DDIT4 function in engineered cells not only results in enhanced proliferation, but can also increase overall glucose metabolism, which increases the overall cytotoxicity of NK or T cells. Thus, according to some embodiments, gene editing of DDIT4 increases the cytotoxicity, persistence, and / or otherwise enhances the efficacy of engineered NK, T, or other cells disclosed herein.

[0337] In some embodiments, expression of MAPKAP kinase 3 (MAPKAPK3) is reduced and / or eliminated to increase overall activation in the resulting T cells and / or NK cells, or other cell types provided herein. In some embodiments, MAPKAPK3 is disrupted and / or knocked out using one or more of the gene editing methods disclosed herein. In some embodiments, MAPKAPK3 is disrupted and / or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) using a nuclease guided by use of one or more of the following MAPKAPK3-specific guide RNAs: SEQ ID NOs: 395-397, or other guided nucleases disclosed elsewhere herein.

[0338] In some embodiments, gene editing reduces transcription of MAPKAPK3 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, gene editing reduces transcription of MAPKAPK3 by at least about 30%. In some embodiments, gene editing reduces transcription of MAPKAPK3 by at least about 40%. In some embodiments, gene editing reduces transcription of MAPKAPK3 by at least about 50%. In some embodiments, gene editing reduces transcription of MAPKAPK3 by at least about 60%. In some embodiments, gene editing reduces transcription of MAPKAPK3 by at least about 70%. In some embodiments, gene editing reduces transcription of MAPKAPK3 by at least about 80%. In some embodiments, the gene editing reduces transcription of MAPKAPK3 by at least about 90%.

[0339] In some embodiments, gene editing reduces expression of MAPKAPK3 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, gene editing reduces expression of MAPKAPK3 by at least about 30%. In some embodiments, gene editing reduces expression of MAPKAPK3 by at least about 40%. In some embodiments, gene editing reduces expression of MAPKAPK3 by at least about 50%. In some embodiments, gene editing reduces expression of MAPKAPK3 by at least about 60%. In some embodiments, gene editing reduces expression of MAPKAPK3 by at least about 70%. In some embodiments, gene editing reduces expression of MAPKAPK3 by at least about 80%. In some embodiments, gene editing reduces expression of DDIT4 by at least about 90%.

[0340] In some embodiments, gene editing can reduce expression of a target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount between the listed amounts). MAPKAP kinase 3 is expressed in both NK and T cells. Loss of MAPKAPK3 in engineered cells is expected to increase cytotoxicity, cytokine secretion, and overall NK signaling. Thus, according to some embodiments, gene editing of MAPKAPK3 increases cytotoxicity, persistence, and / or otherwise enhances the efficacy of engineered NK, T, or other cells disclosed herein.

[0341] In some embodiments, expression of SMAD3 is reduced and / or eliminated to increase overall activation in the resulting T cells and / or NK cells, or other cell types provided herein. In some embodiments, SMAD3 is disrupted and / or knocked out using one or more of the gene editing methods disclosed herein. In some embodiments, SMAD3 is disrupted and / or knocked out using a Crispr-Cas mediated approach (e.g., Cas9) with a nuclease guided by use of one or more of the following SMAD3-specific guide RNAs: SEQ ID NOs: 392-394, or other guided nucleases disclosed elsewhere herein.

[0342] In some embodiments, gene editing reduces transcription of SMAD3 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amount in between those listed). In some embodiments, gene editing reduces transcription of SMAD3 by at least about 30%. In some embodiments, gene editing reduces transcription of SMAD3 by at least about 40%. In some embodiments, gene editing reduces transcription of SMAD3 by at least about 50%. In some embodiments, gene editing reduces transcription of SMAD3 by at least about 60%. In some embodiments, gene editing reduces transcription of SMAD3 by at least about 70%. In some embodiments, gene editing reduces transcription of SMAD3 by at least about 80%. In some embodiments, gene editing reduces transcription of SMAD3 by at least about 90%.

[0343] In some embodiments, gene editing can reduce expression of the target protein by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of SMAD3 by about 30%, about 40%, about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about 99%, or more (including any amounts in between those listed). In some embodiments, gene editing reduces expression of SMAD3 by at least about 30%. In some embodiments, gene editing reduces expression of SMAD3 by at least about 40%. In some embodiments, gene editing reduces expression of SMAD3 by at least about 50%. In some embodiments, the gene editing reduces SMAD3 expression by at least about 60%. In some embodiments, the gene editing reduces SMAD3 expression by at least about 70%. In some embodiments, the gene editing reduces SMAD3 expression by at least about 80%. In some embodiments, the gene editing reduces SMAD3 expression by at least about 90%.

[0344] SMAD3 is a downstream mediator of TGF-beta and activin A signaling. Inhibitors of activin A provide effective downstream TGFBR knockout. NK cells in which Smad3 is silenced exhibit increased proliferation and differentiation, as well as increased cytotoxicity in engineered T and NK cells [Tang et al., Nat. Commun. (2017) 8:14677]. Thus, according to some embodiments, gene editing of SMAD3 increases cytotoxicity, persistence, and / or otherwise enhances the efficacy of engineered NK, T, or other cells disclosed herein.

[0345] As discussed above, gene-edited cells can be edited at multiple locations. For example, in some embodiments, cells (e.g., NK cells or T cells, or a mixture thereof) are edited at two locations. In some embodiments, one of the gene edits is performed at a target site in the CISH gene. In some embodiments, one of the gene edits is performed at a target site in the CBLB gene. In some embodiments, one of the gene edits is performed at a target site in the TGFBR2 gene. In some embodiments, one of the gene edits is performed at a target site in the TIGIT gene. Any combination of such edits is also within the provided embodiments, such as double TGFBR2 / CBLB, double TIGIT / TGFBR2, CISH / CBLB, CISH / TGFBR2, CISH / TIGIT, etc. Also, any combination of editing of any of the target genes for editing (e.g., by Crispr or other nucleases) can be performed according to some embodiments. In addition, multiple edits can be performed in a single target gene, or in multiple target genes, to the extent necessary to achieve the desired amount of reduction in gene expression.

[0346] In some embodiments, gene editing is performed at a target site in the CISH gene and a target site in the CBLB gene. In some embodiments, dual editing, e.g., CISH / CBLB, is performed in NK cells and / or T cells for use in therapy. In some embodiments, combined CISH / CBLB gene editing is performed in NK cells that do not include editing in the CD70 gene. In some embodiments, combined CISH / CBLB gene editing is performed in NK cells that do not include editing in any additional genes. In some embodiments, combined CISH / CBLB gene editing is performed in NK cells that do not express any one or combination of an anti-CD70 CAR, an anti-CD19 CAR, or an anti-NKG2D chimeric receptor. In some embodiments, triple editing, e.g., CD70 / CISH / CBLB, is performed in NK cells and / or T cells for use in therapy. In some embodiments, triple editing, e.g., CD70 / CISH / CBLB, is performed in NK cells and / or T cells that have been engineered to express a tumor-targeting CAR.

[0347] In some embodiments, gene editing is performed at a target site in the CISH gene and a target site in the MED12 gene. In some embodiments, dual editing, e.g., CISH / MED12, is performed in NK cells and / or T cells. In some embodiments, combined CISH / MED12 gene editing is performed in NK cells. In some embodiments, combined CISH / MED12 gene editing is performed in NK cells that do not include editing in the CD70 gene. In some embodiments, combined CISH / MED12 gene editing is performed in NK cells that do not include editing in any additional genes. In some embodiments, combined CISH / MED12 gene editing is performed in NK cells that do not express any one or combination of an anti-CD70 CAR, an anti-CD19 CAR, or an anti-NKG2D chimeric receptor. In some embodiments, combined CISH / MED12 gene editing is performed in NK cells that express a CD19-targeted CAR. In some embodiments, combined CISH / MED12 gene editing is performed in NK cells that express a CD70-targeted CAR. In some embodiments, combined CISH / MED12 gene editing is performed in NK cells expressing a BCMA-targeted CAR.

[0348] In some embodiments, gene editing is performed at a target site in the CISH gene, a target site in the CBLB gene, and a target site in the MED12 gene. In some embodiments, triple editing, e.g., CBLB / CISH / MED12, is performed in NK cells and / or T cells. In some embodiments, triple editing, e.g., CBLB / CISH / MED12, is performed in NK cells. In some embodiments, the combination of CISH / MED12 / CBLB gene editing is performed in NK cells that do not include editing in the CD70 gene. In some embodiments, the combination of CISH / MED12 / CBLB gene editing is performed in NK cells that do not include editing in any additional gene. In some embodiments, the combination of CISH / MED12 / CBLB gene editing is performed in NK cells that do not express any one or combination of an anti-CD70 CAR, an anti-CD19 CAR, or an anti-NKG2D chimeric receptor. In some embodiments, triple editing, e.g., CBLB / CISH / MED12, is performed in NK cells that express a CD19-targeted CAR. In some embodiments, triple editing, e.g., CBLB / CISH / MED12, is performed in NK cells expressing a CD70-targeted CAR. In some embodiments, triple editing, e.g., CBLB / CISH / MED12, is performed in NK cells expressing a BCMA-targeted CAR.

[0349] In some embodiments, gene editing is performed at a target site in the CISH gene and a target site in the TGFBR2 gene. In some embodiments, dual editing, e.g., CISH / TGFBR2, is performed in NK cells and / or T cells for use in therapy. In some embodiments, the combined CISH / TGFBR2 gene editing is performed in NK cells that do not include editing in the CD70 gene. In some embodiments, the combined CISH / TGFBR2 gene editing is performed in NK cells that do not include editing in any additional genes. In some embodiments, the combined CISH / TGFBR2 gene editing is performed in NK cells that do not express any one or combination of an anti-CD70 CAR, an anti-CD19 CAR, or an anti-NKG2D chimeric receptor. In some embodiments, triple editing, e.g., CD70 / CISH / TGFBR2, is performed in NK cells and / or T cells for use in therapy. In some embodiments, triple editing, e.g., CD70 / CISH / TGFBR2, is performed in NK cells and / or T cells that have been engineered to express a tumor-targeting CAR.

[0350] In some embodiments, gene editing is performed at a target site in the CISH gene and a target site in the TIGIT gene. In some embodiments, dual editing, e.g., CISH / TIGIT, is performed in NK cells and / or T cells for use in therapy. In some embodiments, combined CISH / TIGIT gene editing is performed in NK cells that do not include editing in the CD70 gene. In some embodiments, combined CISH / TIGIT gene editing is performed in NK cells that do not include editing in any additional gene. In some embodiments, combined CISH / TIGIT gene editing is performed in NK cells that do not express any one or combination of an anti-CD70 CAR, an anti-CD19 CAR, or an anti-NKG2D chimeric receptor. In some embodiments, triple editing, e.g., CD70 / CISH / TIGIT, is performed in NK cells and / or T cells for use in therapy. In some embodiments, triple editing, e.g., CD70 / CISH / TIGIT, is performed in NK cells and / or T cells that have been engineered to express a tumor-targeting CAR.

[0351] Extracellular domain (tumor-binding agent) Some embodiments of the compositions and methods described herein relate to chimeric antigen receptors (chimeric antigen receptors) comprising an extracellular domain that includes a tumor-binding domain (also referred to as...

Claims

1. A population of genetically engineered and gene-edited immune cells, comprising genetically engineered immune cells that express a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex, the extracellular ligand-binding domain targets an antigen expressed by cells of the target tumor or cancer; an immune cell is gene edited within a target sequence in the MED12 gene and within a target sequence in the CISH gene; the editing results in reduced expression and / or function of the MED12 protein encoded by the MED12 gene and the CIS protein encoded by the CISH gene, respectively, compared to immune cells that have not been edited within the target sequence in the MED12 gene and the target sequence in the CISH gene; Genetically engineered and gene-edited immune cell populations.

2. The target sequence within the MED12 gene comprises any one of SEQ ID NOs: 997, 938-944, 996, or 998; 2. The genetically engineered and gene-edited population of immune cells of claim 1.

3. 2. The genetically engineered and gene-edited population of immune cells of claim 1, wherein the target sequence in the CISH gene comprises any one of SEQ ID NOs: 1013, 153-157, or 463-466, or 1012.

4. 2. The population of genetically engineered and gene-edited immune cells of claim 1, wherein the extracellular ligand-binding domain targets an antigen selected from BCMA, an NKG2D ligand, CD19, and CD70.

5. 2. The genetically engineered and gene-edited population of immune cells of claim 1, wherein the extracellular ligand-binding domain targets BCMA.

6. 2. The population of genetically engineered and gene-edited immune cells of claim 1, wherein the transmembrane domain comprises CD8, CD28, or a portion thereof, and optionally the transmembrane domain comprises CD8a or a portion thereof.

7. the cytotoxic signaling complex comprises a CD3 zeta domain; and / or the cytotoxic signaling complex comprises the intracellular signaling domain or signaling portion thereof of OX40, 4-1BB, CD28, and optionally the intracellular signaling domain or signaling portion thereof of OX40; 2. The genetically engineered and gene-edited population of immune cells of claim 1.

8. 10. The population of genetically engineered and gene-edited immune cells of claim 1, wherein at least a portion of the genetically engineered immune cells are engineered to express membrane-bound IL-15 (mbIL15).

9. 9. The genetically engineered and gene-edited population of immune cells of claim 8, wherein the cytotoxic receptor and mbIL15 are encoded by the same nucleic acid molecule, and optionally the nucleic acid sequences encoding the cytotoxic receptor and mbIL15 are separated by a nucleic acid sequence encoding a 2A peptide.

10. 2. The genetically engineered and gene-edited population of immune cells of claim 1, wherein the cells are further gene edited within a target sequence in the CBLB gene, wherein the target sequence in the CBLB gene comprises any one of SEQ ID NOs: 164, 165-166, or 453-456, or 1005-1008.

11. 2. The genetically engineered and gene-edited population of immune cells of claim 1, wherein the cells are further gene edited within a target sequence in a disintegrin and metalloproteinase domain-containing protein 17 (ADAM17) gene comprising any one of SEQ ID NOs: 682-687.

12. 10. The genetically engineered and gene-edited population of immune cells of claim 1, wherein the cells are further gene edited within a target sequence in the hypoxia inducible factor 1-alpha (HIF1-a) gene comprising any one of SEQ ID NOs: 750-760.

13. 2. The genetically engineered and gene-edited population of immune cells of claim 1, wherein the cells are further gene edited within a target sequence in the DGKz gene, wherein the target sequence comprises any one of SEQ ID NOs: 688-723.

14. 2. The genetically engineered and gene-edited population of immune cells of claim 1, wherein the cells are further gene edited within a target sequence in the GSK-3B gene, wherein the target sequence comprises any one of SEQ ID NOs: 724-749.

15. 2. The genetically engineered and gene edited population of immune cells of claim 1, wherein the cells are further gene edited within a target sequence in the LAG3 gene, wherein the target sequence comprises any one of SEQ ID NOs: 761-789.

16. 2. The genetically engineered and gene-edited population of immune cells of claim 1, wherein the cells are further gene edited within a target sequence in the TIM3 gene, wherein the target sequence comprises any one of SEQ ID NOs: 790-825.

17. 2. The genetically engineered and gene-edited population of immune cells of claim 1, wherein the cells are further gene edited within a target sequence in the TRIM29 gene, wherein the target sequence comprises any one of SEQ ID NOs: 826-835 or 1009-1011.

18. 2. The genetically engineered and gene-edited population of immune cells of claim 1, wherein the cells are further gene edited within a target sequence in the IL-1R8 gene, wherein the target sequence comprises any one of SEQ ID NOs: 836-865.

19. 2. The genetically engineered and gene-edited population of immune cells of claim 1, wherein the cells are further gene edited within a target sequence in the CD38 gene, wherein the target sequence comprises any one of SEQ ID NOs: 866-874.

20. 2. The genetically engineered and gene-edited population of immune cells of claim 1, wherein the cells are further gene edited within a target sequence in the FBP-1 gene, wherein the target sequence comprises any one of SEQ ID NOs: 875-889.

21. 2. The genetically engineered and gene-edited population of immune cells of claim 1, wherein the cells are further gene edited within a target sequence in the INSIG1 gene, wherein the target sequence comprises any one of SEQ ID NOs: 890-934.

22. 2. The genetically engineered and gene-edited population of immune cells of claim 1, wherein the cells are further gene edited within a target sequence in the CDK8 gene, wherein the target sequence comprises any one of SEQ ID NOs: 949-955.

23. 2. The genetically engineered and gene-edited population of immune cells of claim 1, wherein the cells are further gene edited within a target sequence in the CCNC gene, wherein the target sequence comprises any one of SEQ ID NOs: 956-961 or 999-1001.

24. 2. The genetically engineered and gene-edited population of immune cells of claim 1, wherein the cells are further gene edited within a target sequence in the ID3 gene, wherein the target sequence comprises any one of SEQ ID NOs: 963-969.

25. 2. The genetically engineered and gene-edited population of immune cells of claim 1, wherein the cells are further gene edited within a target sequence in the SOX4 gene, wherein the target sequence comprises any one of SEQ ID NOs: 970-976.

26. 26. The genetically engineered and gene-edited population of immune cells of any one of claims 1 to 25, wherein the edits to the one or more target sequences are made using an RNA-guided endonuclease.

27. 27. The genetically engineered and gene-edited population of immune cells of claim 26, wherein editing of one or more target sequences is performed using the Crispr / Cas9 system.

28. 28. The genetically engineered and gene-edited population of immune cells of any one of claims 1-27, wherein the immune cells comprise natural killer (NK) cells, T cells, induced pluripotent stem cells (iPSCs), iPSC-derived NK cells, iPSC-derived T cells, NK-92 cells, or any combination thereof.

29. 29. The genetically engineered and gene-edited population of immune cells of claim 28, wherein the immune cells are natural killer (NK) cells.

30. 30. A composition comprising a population of genetically engineered and gene-edited immune cells according to any one of claims 1 to 29.

31. 31. A method for the treatment of a subject having a disease or condition, the method comprising administering to the subject a population of genetically engineered and gene-edited immune cells according to any one of claims 1 to 29 or a composition according to claim 30.

32. 31. Use of the population of genetically engineered and edited immune cells of any one of claims 1 to 29 or the composition of claim 30 for the treatment of a subject having a disease or condition.

33. 33. The method of claim 31 or the use of claim 32, wherein the disease or condition is an infectious disease, an autoimmune disease, cancer, or a tumor.

34. A population of genetically engineered and gene-edited immune cells, comprising genetically engineered immune cells that express a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex, the extracellular ligand-binding domain targets an antigen expressed by cells of the target tumor or cancer; an immune cell is gene edited within a target sequence in a disintegrin and metalloproteinase domain-containing protein 17 (ADAM17) gene comprising any one of SEQ ID NOs: 682-687; the editing results in reduced expression and / or function of the ADAM17 protein encoded by the ADAM17 gene compared to an immune cell that has not been edited within the target sequence in the ADAM17 gene; Editing of the ADAM17 gene is performed using an RNA-guided endonuclease. Genetically engineered and gene-edited immune cell populations.

35. A population of genetically engineered and gene-edited immune cells, comprising genetically engineered immune cells that express a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex, the extracellular ligand-binding domain targets an antigen expressed by cells of the target tumor or cancer; an immune cell is gene edited within a target sequence in a hypoxia-inducible factor 1-alpha (HIF1-a) gene comprising any one of SEQ ID NOs: 750-760; the editing results in reduced expression and / or function of the HIF1-a protein encoded by the HIF1-a gene compared to an immune cell that has not been edited within the target sequence in the HIF1-a gene; Editing of the HIF1-a gene is performed using an RNA-guided endonuclease. Genetically engineered and gene-edited immune cell populations.

36. A population of genetically engineered and gene-edited immune cells, comprising genetically engineered immune cells that express a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex, the extracellular ligand-binding domain targets an antigen expressed by cells of the target tumor or cancer; the immune cells are gene edited within a target sequence in a target gene selected from MED12, ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED13, CCNC, CDK8, ID3, SOX4, and any combination thereof; the editing results in reduced expression and / or function of the protein encoded by the target gene compared to an immune cell that has not been edited within the target sequence in the target gene; the immune cell is edited at an additional target sequence within the target gene to result in a reduced level of expression of the protein encoded by the target gene compared to an immune cell that has not been edited at the additional target sequence; Editing of the target gene is performed using an RNA-guided endonuclease. Genetically engineered and gene-edited immune cell populations.

37. A population of genetically engineered and gene-edited immune cells, comprising genetically engineered immune cells that express a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex, the extracellular ligand-binding domain targets a tumor marker expressed by the target tumor cell; the immune cells are gene edited at one or more locations in a target gene selected from ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED12, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof; each of said genes encodes a corresponding protein; the editing results in a reduction in expression and / or function of the corresponding protein compared to an immune cell that is not edited at one or more locations in the individual gene; the immune cell is edited at one or more additional target sites in the genome of the immune cell such that the immune cell results in a reduced level of expression of a protein encoded by a gene comprising the edited target site(s) compared to a non-edited immune cell; Editing of one or more target genes is performed using the Crispr / Cas9 system; the genetically engineered and edited immune cells exhibit one or more of enhanced expansion capacity, enhanced cytotoxicity to target tumor cells, and enhanced persistence compared to immune cells that do not contain the one or more gene-edited target sites; Genetically engineered and gene-edited immune cell populations.

38. Immune cells, A DGKz gene, wherein the target sequence comprises any one of SEQ ID NOs: 688-723; a GSK-3B gene, wherein the target sequence comprises any one of SEQ ID NOs: 724 to 749; LAG3, the LAG3 gene, wherein the target sequence comprises any one of SEQ ID NOs: 761-789; TIM3, the TIM3 gene, wherein the target sequence comprises any one of SEQ ID NOs: 790-825; TRIM29, the TRIM29 gene, wherein the target sequence comprises any one of SEQ ID NOs: 826-835 or 1009-1011; IL-1R8, the IL-1R8 gene, wherein the target sequence comprises any one of SEQ ID NOs: 836 to 865; CD38, the CD38 gene, wherein the target sequence comprises any one of SEQ ID NOs: 866-874; FBP-1, wherein the FBP-1 gene is a target sequence comprising any one of SEQ ID NOs: 875 to 889; INSIG1, the INSIG1 gene, wherein the target sequence comprises any one of SEQ ID NOs: 890-934; CDK8, the CDK8 gene, wherein the target sequence comprises any one of SEQ ID NOs: 949-955; CCNC, the CCNC gene, wherein the target sequence comprises any one of SEQ ID NOs: 956-961 or 999-1001; ID3 gene, wherein the target sequence comprises any one of SEQ ID NOs: 963-969; and SOX4 gene, wherein the target sequence comprises any one of SEQ ID NOs: 970 to 976. and wherein the gene is edited within the target sequence in one or more of:

38. The genetically engineered and gene-edited population of immune cells of any one of claims 34 to 37.

39. 39. The genetically engineered and gene-edited population of immune cells of claim 38, wherein the cells are gene edited within a target sequence in the CD70 gene.

40. 40. The genetically engineered and gene-edited population of immune cells of any one of claims 34-39, wherein the cells have been gene-edited within a target sequence in the TGFBR2 gene, TIGIT gene, adenosine A2a receptor (ADORA2A) gene, SMAD3 gene, MAPKAPK3 gene, CEACAM1 gene, DDIT4 gene, NKG2A gene, SOCS2 gene, B2M gene, PDCD1 gene, and / or TRAC gene.

41. 41. The genetically engineered and gene-edited population of immune cells of any one of claims 34 to 40, wherein the immune cells comprise NK cells.

42. 42. A composition comprising a population of genetically engineered and gene-edited immune cells according to any one of claims 34 to 41.

43. 1. A method of producing a gene-edited population of immune cells, comprising contacting the population of immune cells with a targeting endonuclease that effects an edit within a target sequence in a target gene selected from MED12, CISH, ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED13, CCNC, CDK8, ID3, SOX4, CBLB, and any combination thereof; The gene-edited immune cells exhibit enhanced expansion, enhanced cytotoxicity against target tumor cells, enhanced persistence, or any combination thereof, compared to immune cells that have not been edited within the target sequence in the target gene. method.

44. 1. A method of producing a gene-edited population of immune cells, comprising contacting the population of immune cells with an RNA-guided endonuclease that effects an edit within a target sequence in a target gene selected from MED12, CISH, ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED13, CCNC, CDK8, ID3, SOX4, and any combination thereof; The gene-edited immune cells exhibit enhanced expansion, enhanced cytotoxicity against target tumor cells, enhanced persistence, or any combination thereof, compared to immune cells that have not been edited within the target sequence in the target gene. method.

45. 1. A method of producing a population of gene-edited immune cells, comprising contacting a population of immune cells with a Cas-gRNA ribonucleoprotein complex (RNP); the RNP effects editing within a target sequence in a target gene selected from MED12, CISH, ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED13, CCNC, CDK8, ID3, SOX4, and any combination thereof; The Cas of the RNP comprises Cas9, CasX, CasY, or a combination thereof; The gene-edited immune cells exhibit enhanced expansion, enhanced cytotoxicity against target tumor cells, enhanced persistence, or any combination thereof, compared to immune cells that have not been edited within the target sequence in the target gene. method.

46. 1. A method for producing a population of gene-edited immune cells, comprising: (a) contacting a population of immune cells with a first RNA-guided endonuclease; the RNA-guided endonuclease effects editing within a target sequence in a target gene selected from MED12, ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED13, CCNC, CDK8, ID3, SOX4, and any combination thereof; and (b) contacting the population of immune cells with a second RNA-guided endonuclease; The second RNA-guided endonuclease effects an edit within the target sequence in the CISH gene, resulting in a reduced level of expression of the CIS protein encoded by the CISH gene compared to immune cells that have not been edited within the target sequence in the CISH gene. Including; The gene-edited immune cells exhibit enhanced expansion, enhanced cytotoxicity against target tumor cells, enhanced persistence, or any combination thereof, compared to immune cells that have not been edited within the target sequence in the target gene and CISH gene. method.

47. 1. A method for producing a population of gene-edited immune cells, comprising: (a) contacting a population of immune cells with a first Cas-gRNA ribonucleoprotein (RNP) complex; the RNP complex effects editing within a target sequence in a target gene selected from MED12, ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof; The Cas of the first RNP complex comprises Cas9, CasX, CasY, or a combination thereof; and (b) contacting the population of immune cells with a second Cas-gRNA RNP complex; the second RNP complex effects an edit in the target sequence in the CISH gene that results in a reduced level of expression of a CIS protein encoded by the CISH gene compared to an immune cell that has not been edited in the target sequence in the CISH gene; The Cas of the second RNP complex includes Cas9, CasX, CasY, or a combination thereof. Including; The gene-edited immune cells exhibit enhanced expansion, enhanced cytotoxicity against target tumor cells, enhanced persistence, or any combination thereof, compared to immune cells that have not been edited within the target sequence in the target gene and CISH gene. method.

48. 1. A method for producing a population of gene-edited immune cells, comprising: (a) contacting a population of immune cells with a first Cas-gRNA ribonucleoprotein (RNP) complex; the RNP results in an edit within a target sequence in a target gene selected from MED12, ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof; The Cas of the first RNP complex comprises Cas9, CasX, CasY, or a combination thereof; and (b) contacting the population of immune cells with a second Cas-gRNA RNP complex; the second RNP complex effects an edit within the target sequence in the CBLB gene, resulting in a reduced level of expression of a CBLB protein encoded by the CBLB gene, compared to an immune cell that has not been edited within the target sequence in the CBLB gene; The Cas of the second RNP complex includes Cas9, CasX, CasY, or a combination thereof. Including; The gene-edited immune cells exhibit enhanced expansion, enhanced cytotoxicity against target tumor cells, enhanced persistence, or any combination thereof, compared to immune cells that have not been edited within the target gene and the target sequence in the CBLB gene. method.

49. 1. A method for producing a population of gene-edited immune cells, comprising: (a) contacting a population of immune cells with a first RNA-guided endonuclease; the first RNA-guided endonuclease effects an edit within a target sequence in a target gene selected from MED12, ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof; (b) contacting the population of immune cells with a second RNA-guided endonuclease; the second RNA-guided endonuclease effects an edit within the target sequence in the CISH gene that results in a reduced level of expression of the CIS protein encoded by the CISH gene compared to an immune cell that has not been edited within the target sequence in the CISH gene; and (c) contacting the population of immune cells with a third RNA-guided endonuclease; The third RNA-guided endonuclease effects an edit within the target sequence in the CBLB gene, resulting in a reduced level of expression of the CBLB protein encoded by the CBLB gene compared to an immune cell that has not been edited within the target sequence in the CBLB gene. Including, the gene-edited immune cells exhibit enhanced expansion capacity, enhanced cytotoxicity against target tumor cells, enhanced persistence, or any combination thereof, compared to immune cells that were not edited within the target sequences in the target, CISH, and CBLB genes; method.

50. 1. A method for producing a population of gene-edited immune cells, comprising: (a) contacting a population of immune cells with a first Cas-gRNA ribonucleoprotein (RNP) complex; the first RNP complex effects editing within a target sequence in a target gene selected from MED12, ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof; (b) contacting the population of immune cells with a second RNP complex; the second RNP complex effects an edit within the target sequence in the CISH gene that results in a reduced level of expression of the CIS protein encoded by the CISH gene compared to an immune cell that has not been edited within the target sequence in the CISH gene; and (c) contacting the population of immune cells with a third RNP complex, the third RNP complex effects an edit within the target sequence in the CBLB gene, resulting in a reduced level of expression of the CBLB protein encoded by the CBLB gene, compared to an immune cell that has not been edited within the target sequence in the CBLB gene. Including; the Cas of each of the first, second, and third RNP complexes comprises Cas9, CasX, CasY, or a combination thereof; the gene-edited immune cells exhibit enhanced expansion capacity, enhanced cytotoxicity against target tumor cells, enhanced persistence, or any combination thereof, compared to immune cells that were not edited within the target sequences in the target, CISH, and CBLB genes; method.

51. 1. A method of producing a population of gene-edited immune cells, comprising contacting the population of immune cells with a plurality of Cas-gRNA ribonucleoprotein (RNP) complexes; the plurality of RNP complexes effect editing within the target sequence in the CISH gene such that the plurality of RNP complexes effect a reduced level of expression of a CIS protein encoded by the CISH gene compared to an immune cell that has not been edited within the target sequence in the CISH gene; the plurality of RNP complexes effect editing within the target sequence in the CBLB gene, such that the plurality of RNP complexes effect a reduced level of expression of a CBLB protein encoded by the CBLB gene, compared to an immune cell that has not been edited within the target sequence in the CBLB gene; the plurality of RNP complexes effect editing within a target sequence in a target gene selected from MED12, ADAM17, HIF-1a, DGKz, GSK-3B, LAG3, TIM3, TRIM29, IL-1R8, CD38, FBP-1, INSIG1, MED13, CCNC, CDK8, ID3, SOX4, or any combination thereof; each Cas of the plurality of RNP complexes comprises Cas9, CasX, CasY, or a combination thereof; The gene-edited immune cells exhibit enhanced expansion, enhanced cytotoxicity against target tumor cells, enhanced persistence, or any combination thereof, compared to immune cells that were not edited within the target sequence in the CISH, CBLB, and target gene. method.

52. 52. The method of claim 51 , wherein the immune cell is gene edited within a target sequence in the MED12 gene, wherein the target sequence comprises any of SEQ ID NOs: 997, 938-944, 996, or 998; and wherein the immune cell is gene edited within a target sequence in the CISH gene, wherein the target sequence comprises any of SEQ ID NOs: 1013, 153-157, or 463-466, or 1012.

53. 53. The method of claim 51 or 52, wherein the immune cell is gene edited within a target sequence in the CBLB gene, and the target sequence comprises any of SEQ ID NOs: 164-166, 453-456, or 1005-1008.

54. Immune cells, ADAM17 gene, wherein the target sequence comprises any of SEQ ID NOs: 682-687; HIF-1a, which is a HIF-1a gene, wherein the target sequence comprises any of SEQ ID NOs: 750-760; DGKz gene, wherein the target sequence comprises any of SEQ ID NOs: 688-723; GSK-3B, which is a GSK-3B gene, wherein the target sequence comprises any of SEQ ID NOs: 724-749; LAG3, the LAG3 gene, wherein the target sequence comprises any of SEQ ID NOs: 761-789; TIM3, the TIM3 gene, wherein the target sequence comprises any of SEQ ID NOs: 790-825; TRIM29, the TRIM29 gene, wherein the target sequence comprises any of SEQ ID NOs: 826-835 or 1009-1011; IL-1R8, the IL-1R8 gene, wherein the target sequence comprises any of SEQ ID NOs: 836-865; CD38, the CD38 gene, wherein the target sequence comprises any of SEQ ID NOs: 866-874; FBP-1, which is an FBP-1 gene, wherein the target sequence comprises any of SEQ ID NOs: 875 to 889; INSIG1, the INSIG1 gene, wherein the target sequence comprises any of SEQ ID NOs: 890-934; MED13 gene, wherein the target sequence comprises any of SEQ ID NOs: 945-948; CDK8, the CDK8 gene, wherein the target sequence comprises any of SEQ ID NOs: 949-955; CCNC gene, wherein the target sequence comprises any of SEQ ID NOs: 956-962 or 999-1001; ID3 gene, wherein the target sequence comprises any of SEQ ID NOs: 963-969; and SOX4 gene, wherein the target sequence comprises any one of SEQ ID NOs: 970 to 976; 54. The method of claim 51, 52, or 53, wherein the target sequence in one or more of:

55. 55. The method of any one of claims 51 to 54, wherein the cell has been gene edited within a target sequence in the CD70 gene.

56. 55. The method of any one of claims 51 to 54, wherein the method does not comprise editing the CD70 gene.

57. 57. The method of any one of claims 51 to 56, wherein the cell has been gene edited within a target sequence in the TGFBR2 gene, TIGIT gene, adenosine A2a receptor (ADORA2A) gene, SMAD3 gene, MAPKAPK3 gene, CEACAM1 gene, DDIT4 gene, NKG2A gene, SOCS2 gene, B2M gene, PDCD1 gene, and / or TRAC gene.

58. 58. The method of any one of claims 51-57, further comprising contacting the population of immune cells with a vector comprising a polynucleotide encoding a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex.

59. 59. The method of claim 58, wherein the extracellular ligand-binding domain targets a BCMA, CD19, CD70, or NKG2D ligand.

60. 59. The method of claim 58, wherein the cytotoxic receptor does not target CD19 or an NKG2D ligand.

61. 61. A method for the treatment of a subject having a disease or condition, the method comprising administering to the subject a population of genetically engineered and gene-edited immune cells according to any one of claims 34-41, or a composition according to claim 42, or a population of gene-edited immune cells produced by the method of any one of claims 43-60.

62. 61. Use of a population of genetically engineered and edited immune cells according to any one of claims 34 to 41, or a composition according to claim 42, or a population of gene-edited immune cells produced by a method according to any one of claims 43 to 60, for the treatment of a subject having a disease or condition.

63. 61. Use of a population of genetically engineered and edited immune cells according to any one of claims 34 to 41, or a composition according to claim 42, or a population of gene-edited immune cells produced by a method according to any one of claims 43 to 60, for the preparation of a medicament for the treatment of a subject having a disease or condition.

64. 64. The method of claim 61, or the use of claim 62 or claim 63, wherein the disease or condition is an infectious disease, an autoimmune disease, cancer, or a tumor.

65. 1. A method for treating a subject having a disease or condition, comprising administering to the subject a population of genetically engineered and gene-edited immune cells that express a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex; the extracellular ligand-binding domain targets an antigen expressed by cells of the target tumor or cancer; an immune cell is gene edited within a target sequence in the MED12 gene; the target sequence within the MED12 gene comprises any one of SEQ ID NOs: 997, 938-944, 996, or 998; the editing results in reduced expression and / or function of the MED12 protein encoded by the MED12 gene compared to an immune cell that has not been edited within the target sequence in the MED12 gene; method.

66. The genetically engineered and gene-edited immune cells are further edited within a target sequence in the CISH gene; the target sequence in the CISH gene comprises any one of SEQ ID NOs: 1013, 153-157, or 463-466, or 1012; the editing results in reduced expression and / or function of the CIS protein encoded by the CISH gene compared to an immune cell that has not been edited within the target sequence within the CISH gene; 66. The method of claim 65.

67. 67. The method of claim 65 or 66, wherein the extracellular ligand-binding domain targets BCMA.

68. 68. The method of any one of claims 65 to 67, wherein the genetically engineered and gene-edited immune cells are NK cells.

69. A population of genetically engineered and gene-edited immune cells, comprising genetically engineered immune cells that express a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex, the extracellular ligand-binding domain targets an antigen expressed by cells of the target tumor or cancer; the antigen is B-cell maturation antigen (BCMA); an immune cell is gene edited within a target sequence in the MED12 gene; the editing results in reduced expression and / or function of the MED12 protein encoded by the MED12 gene compared to an immune cell that has not been edited within the target sequence in the MED12 gene; Genetically engineered and gene-edited immune cell populations.

70. 70. The genetically engineered and gene-edited population of immune cells of claim 69, wherein the target sequence within the MED12 gene comprises any one of SEQ ID NOs: 997, 938-944, 996, or 998.

71. The genetically engineered and gene-edited immune cells are further edited within a target sequence in the CISH gene; the target sequence in the CISH gene comprises any one of SEQ ID NOs: 1013, 153-157, or 463-466, or 1012; the editing results in reduced expression and / or function of the CIS protein encoded by the CISH gene compared to an immune cell that has not been edited within the target sequence within the CISH gene; 71. The genetically engineered and gene-edited population of immune cells of claim 69 or 70.

72. a population of genetically engineered and gene-edited immune cells comprising genetically engineered immune cells, wherein at least a portion of the genetically engineered immune cells are engineered to express membrane-bound IL-15 (mbIL15); an immune cell is gene edited within a target sequence in the MED12 gene; the editing results in reduced expression and / or function of the MED12 protein encoded by the MED12 gene compared to an immune cell that has not been edited within the target sequence in the MED12 gene; Genetically engineered and gene-edited immune cell populations.

73. 73. The genetically engineered and gene-edited population of immune cells of Claim 72, wherein the cytotoxic receptor and mbIL15 are encoded by the same nucleic acid molecule, and optionally the nucleic acid sequences encoding the cytotoxic receptor and mbIL15 are separated by a nucleic acid sequence encoding a 2A peptide.

74. A population of genetically engineered and gene-edited immune cells, comprising genetically engineered and gene-edited immune cells that express a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex, the extracellular ligand-binding domain targets an antigen expressed by cells of the target tumor or cancer; the cytotoxic signaling complex comprises a CD3 zeta domain and the intracellular signaling domain of OX40, 4-1BB, CD28, or a signaling portion thereof, and may comprise the intracellular signaling domain of OX40, or a signaling portion thereof; an immune cell is gene edited within a target sequence in the MED12 gene; the target sequence within the MED12 gene comprises any one of SEQ ID NOs: 997, 938-944, 996, or 998; the editing results in reduced expression and / or function of the MED12 protein encoded by the MED12 gene compared to an immune cell that has not been edited within the target sequence in the MED12 gene; Genetically engineered and gene-edited immune cell populations.

75. The genetically engineered and gene-edited immune cells are further edited within the target sequence in the CISH gene, and optionally: the target sequence in the CISH gene comprises any one of SEQ ID NOs: 1013, 153-157, or 463-466, or 1012; and / or the editing results in reduced expression and / or function of the CIS protein encoded by the CISH gene compared to an immune cell that has not been edited within the target sequence within the CISH gene; 75. The genetically engineered and gene-edited population of immune cells of claim 74.

76. 76. The population of genetically engineered and gene-edited immune cells of Claim 74 or 75, wherein the transmembrane domain comprises CD8, CD28, or a portion thereof, and optionally the transmembrane domain comprises CD8a or a portion thereof.

77. 77. The genetically engineered and gene-edited population of immune cells of any one of claims 74-76, wherein the extracellular ligand-binding domain targets BCMA.

78. 78. The population of genetically engineered and gene-edited immune cells of any one of claims 74-77, wherein at least a portion of the genetically engineered immune cells are engineered to express membrane-bound IL-15 (mbIL15).

79. A population of gene-edited immune cells, an immune cell is gene edited within a target sequence in the MED12 gene and within a target sequence in the CISH gene; the editing results in reduced expression and / or function of the MED12 protein encoded by the MED12 gene and the CIS protein encoded by the CISH gene, respectively, compared to immune cells that have not been edited within the target sequence in the MED12 gene and the target sequence in the CISH gene; A population of gene-edited immune cells.

80. the gene-edited immune cells are genetically engineered immune cells that express a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex; the extracellular ligand-binding domain targets an antigen expressed by cells of the target tumor or cancer; 80. The population of gene-edited immune cells of claim 79.

81. A population of genetically engineered and gene-edited immune cells that express a cytotoxic receptor comprising an extracellular ligand-binding domain, a transmembrane domain, and a cytotoxic signaling complex, the extracellular ligand-binding domain targets an antigen expressed by cells of the target tumor or cancer; an immune cell is gene edited within a target sequence in the MED12 gene; the target sequence within the MED12 gene comprises any one of SEQ ID NOs: 997, 938-944, 996, or 998; the editing results in reduced expression and / or function of the MED12 protein encoded by the MED12 gene compared to an immune cell that has not been edited within the target sequence in the MED12 gene; Genetically engineered and gene-edited immune cell populations.

82. 82. The genetically engineered and / or gene-edited population of immune cells of any one of claims 69 to 81, wherein the immune cells are NK cells.

Images