Modified promoter sequences

Abstract

The present invention provides a method for modifying a promoter to obtain a promoter variant, comprising the steps of: a. providing a promoter; b. The promoter: -GATAX1X2X3X4X5X6(X7) m , ATCCTTTTAG (SEQ ID NO: 1), and AAA, by inserting into the promoter at least one nucleic acid sequence selected from the group consisting of - Substitute nucleotides in the promoter sequence to GATAX1X2X3X4X5X6(X7) m modifying the promoter by inserting at least one nucleic acid sequence selected from the group consisting of ATCCTTTTAG (SEQ ID NO: 1), ATCCTTTTAG (SEQ ID NO: 1), and AAA; wherein X1, X2, X3, X4, X5, X6, and X7 are independently nucleotides selected from the group consisting of A, C, G, and T, and m is an integer from 0 to 10.

Description

[Technical Field]

[0001] The present invention relates to the technical field of promoters, in particular promoter variants that exhibit enhanced gene expression levels. [Background technology]

[0002] At the most basic level, protein expression is limited by the amount of transcripts available in the cell for translation. The overall transcript level depends on the gene copy number and the number of transcripts produced, which in turn is strongly influenced by the promoter. Due to this direct influence on expression, the promoter sequence is one of the most well-studied regulatory elements in eukaryotes, and promoter manipulation is used as a method to fine-tune gene expression.

[0003] Promoter sequence engineering is a broad field, and particularly for eukaryotic promoters, it mainly focuses on modifying existing sequences. Deletion and base exchange of short DNA stretches, as well as truncation, provide opportunities to improve promoter performance through genetic engineering. In most cases, promoter modification aims to create a particularly strong promoter sequence to maximize transcription.

[0004] Manipulation approaches can be random, rational, or a combination of both. Random methods are more likely to generate a large number of variants with reduced potency, but they require much less knowledge and understanding of the modified sequences. To date, saturation mutagenesis of spacer regions, random mutagenesis by error-prone PCR, hybrid promoter engineering, and direct modification of transcription factor binding sites (TFBSs) have been used in promoter engineering. The fundamental goal of all these strategies is to affect transcription by altering the TFBSs of the promoter sequence, specifically, either a single promoter sequence, a combination of promoter sequences in the sequence, or the context of promoter sequence appearance. However, based on expression analysis, alternative effects, such as differences in mRNA stability or translation initiation, also need to be kept in mind as potential reasons for changes in target protein yield.

[0005] It is therefore an object of the present invention to provide a method for obtaining promoters that exhibit superior properties compared to the respective wild-type promoters from which they are derived. Another object of the present invention is to provide promoters that have superior properties compared to the respective wild-type promoters from which they are derived. Summary of the Invention

[0006] The present invention provides a method for modifying a promoter to obtain a promoter variant, comprising the steps of: a. providing a promoter; b. The promoter: -GATAX1X2X3X4X5X6(X7) m , ATCCTTTTAG (SEQ ID NO: 1), and AAA, by inserting into the promoter at least one nucleic acid sequence selected from the group consisting of - Substitute nucleotides in the promoter sequence to GATAX1X2X3X4X5X6(X7) mmodifying the promoter by inserting at least one nucleic acid sequence selected from the group consisting of ATCCTTTTAG (SEQ ID NO: 1), ATCCTTTTAG (SEQ ID NO: 1), and AAA; wherein X1, X2, X3, X4, X5, X6, and X7 are independently nucleotides selected from the group consisting of A, C, G, and T, and m is an integer from 0 to 10.

[0007] Surprisingly, GATAX1X2X3X4X5X6(X7) m It has been found that the insertion of "neutral" nucleic acid sequences, such as ATCCTTTTAG (SEQ ID NO: 1) and / or AAA, into promoters is useful for obtaining promoter variants that exhibit increased transcription rates compared to the respective wild-type promoters. These neutral nucleic acid sequences may have the advantage of not affecting the binding of transcription factors to promoters in cells. Furthermore, the use of neutral nucleic acid sequences may prevent the formation of new transcription factor binding sites that have unpredictable effects on transcription in cells. The nucleic acid sequence GATAX1X2X3X4X5X6(X7) mIt was found that ATCCTTTTAG (SEQ ID NO: 1) and AAA are considered to be neutral nucleic acid sequences. These sequences were identified as not containing any possible binding sites for eukaryotic transcription factors. These nucleic acid sequences have been found to be very useful in identifying and producing promoter variants with superior efficacy compared to unmodified promoters. These nucleic acid sequences may be longer or shorter, but preferably contain 10 bases, which may support a neutral effect on the three-dimensional structure of the promoter DNA containing the bound transcription factor if the insertion does not replace a sequence of the same length. These nucleic acid sequences can be used to obtain promoters with higher promoter activity compared to unmodified promoters. Therefore, the method of the present invention is suitable for identifying and / or obtaining promoters / promoter variants that exhibit enhanced promoter activity, for example, with respect to protein expression, compared to unmodified promoters. Therefore, the present invention also relates to a method for identifying promoter variants that exhibit enhanced promoter activity compared to unmodified promoters, and / or GATAX1X2X3X4X5X6(X7) m , ATCCTTTTAG (SEQ ID NO: 1), and AAA into the promoter and / or by substituting nucleotides in the promoter sequence, m The present invention relates to a method for screening a library of promoter variants that have been modified by introducing into the promoter at least one nucleic acid sequence selected from the group consisting of ATCCTTTTAG (SEQ ID NO: 1), ATCCTTTTAG (SEQ ID NO: 1), and AAA. In both cases, the promoter variant can be operably linked to a target sequence to be transcribed, and the amount of transcript (i.e., RNA or protein / polypeptide) compared to the unmodified promoter indicates whether the promoter activity is increased or decreased compared to the unmodified promoter.

[0008] The promoters modified by the method of the invention can be of any origin. Thus, the promoters can be human or animal, bacterial, fungal, viral or artificial promoters. The method of the invention can also be used to introduce modifications into already modified or optimized promoters, respectively. The claimed method is a further tool for improving such promoters in terms of transcription rate or other properties.

[0009] Another aspect of the present invention relates to promoter variants obtainable by the method according to the present invention.

[0010] The promoters obtainable by the methods of the present invention may exhibit much higher transcription rates than the respective unmodified promoters from which they are derived. The promoters obtained using the methods of the present invention may result in much higher protein yields or specific productivity than the respective unmodified promoters from which they are derived. The promoters obtained by the methods of the present invention may be considered promoter variants.

[0011] A further aspect of the present invention relates to a nucleic acid molecule or vector comprising a promoter variant of the present invention or a promoter variant obtainable by the method of the present invention.

[0012] The nucleic acid molecule according to the present invention may comprise a promoter according to the present invention and a nucleic acid sequence encoding a protein or polypeptide operably linked thereto. Thus, transcription of the coding region of such a nucleic acid molecule is controlled by the promoter. Such a nucleic acid molecule or promoter variant of the present invention may be included in a vector. The vector containing the nucleic acid molecule of the present invention or the promoter of the present invention may be a linear expression construct for genome integration, a plasmid, a cosmid, or a viral vector.

[0013] Another aspect of the present invention relates to a host cell comprising a promoter variant, nucleic acid molecule or vector according to the present invention. The host cell containing the promoter variant according to the present invention may be a human, animal, plant or fungal cell. The promoter introduced into these cells directly or via the nucleic acid molecule and / or vector according to the present invention is functionally active in these cells and therefore comprises the respective functional elements.

[0014] A further aspect of the present invention relates to a method for producing a polypeptide or protein, comprising culturing a host cell comprising a promoter variant obtainable by the method of the present invention, a nucleic acid molecule or a vector according to the present invention, wherein a nucleic acid sequence encoding said polypeptide or protein is operably linked to a promoter of the present invention to allow its expression in the host cell and, optionally, its secretion from said host cell. [Brief explanation of the drawings]

[0015] [Figure 1-1] Figures 1-1 and 1-2 show the lipase activity (A) and fold change in the target gene (CalB) (B) for PCAT variant #19, the original PCAT promoter, and the reference promoter PDF. [Figure 1-2] Figures 1-1 and 1-2 show the lipase activity (A) and fold change in the target gene (CalB) (B) for PCAT variant #19, the original PCAT promoter, and the reference promoter PDF. [Figure 2] Screening of several PPDC variants to determine ABTS activity of HspUPO expression from 24-well plate cultures is shown. A 10-bp promoter sequence was replaced with 5'-GATAACCGTG-3' (SEQ ID NO: 2) at various positions within the promoter. The original sequence was used as a control and designated PDC (SEQ ID NO: 33). Values ​​given represent the average of approximately 23 culture transformants per variant, with standard deviations indicated. DETAILED DESCRIPTION OF THE INVENTION

[0016] The method according to the present invention is designed to modify promoters using "neutral" nucleic acid sequences. A "neutral" nucleic acid sequence refers to a nucleic acid molecule that does not contain any properties that may affect the activity of the promoter. This means that these neutral nucleic acid sequences do not contain transcription factor binding sites (TFBSs) and / or repressor or activator protein binding sites, and are not capable of forming TFBSs and repressor and activator protein binding sites together with any other nucleic acid sequences present in the promoter to be modified. Thus, neutral nucleic acid sequences are advantageous because they are unable to form new TFBSs in the promoter sequence that may have undesirable effects on promoter activity.

[0017] Neutral nucleic acid sequences can be introduced into a promoter by insertion or substitution. These nucleic acid sequences can be introduced into a promoter at one or more sites, preferably at 1 to 10 sites, preferably 1 to 8 sites, more preferably 1 to 6 sites, more preferably 1 to 4 sites, more preferably 1 to 3 sites, and more preferably at 1 or 2 sites. To identify modified promoters that exhibit altered properties compared to unmodified promoters, one or more neutral nucleic acid sequences can be introduced randomly into the promoter sequence. Alternatively, they can be introduced systematically in a stepwise manner from the 5' to 3' end of the promoter. Introduction can be by additional insertion into the promoter sequence, or by replacing part of the original promoter sequence by substitution. The modified promoters obtained by both approaches can be operably linked to a nucleic acid molecule encoding a polypeptide or protein and introduced into host cells to measure the expression rate of the polypeptide or protein. Alternatively, the amount of RNA, specifically mRNA, transcribed under the control of the promoter variants and unmodified promoters obtained by the methods of the present invention can be determined. An increase or decrease in the expression and / or transcription rate of a protein and / or polypeptide indicates whether a particular modification results in a modified promoter that exhibits an increased or decreased expression / transcription rate, and thus promoter activity. Thus, the method of the present invention can also be defined as, for example, a method for identifying promoter variants that exhibit increased or decreased expression rates when operably linked to a nucleic acid sequence encoding a polypeptide or protein.

[0018] As used herein, the term "operably linked" refers to the linkage of polynucleotide elements in a functional relationship. A nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. A promoter is operably linked to a coding sequence if it affects the transcription of the coding sequence. Operably linked can mean that the linked nucleic acid sequences are contiguous.

[0019] As used herein, a "promoter" refers to a nucleic acid fragment that functions to control transcription of one or more nucleic acid molecules. A promoter is typically located upstream (5') of a gene's transcription start site in the direction of transcription, is structurally identified by the presence of a DNA-dependent RNA polymerase binding site, a transcription start site, and may further contain any other nucleic acid sequences, including, but not limited to, transcription factor binding sites, repressor and activator protein binding sites, and any other nucleotide sequences known to those of skill in the art that act directly or indirectly to regulate the amount of transcription from the promoter. A "promoter variant" is a promoter that is modified by the methods of the present invention.

[0020] The insertion of at least one nucleic acid sequence is understood to mean the insertion of the nucleic acid sequence into an existing promoter sequence. The sequence can be inserted at any position in the promoter sequence. The insertion of the nucleic acid sequence only adds nucleotides to the original promoter sequence, and does not remove any nucleotides from the original promoter sequence. This modification changes the length of the promoter sequence depending on the number of nucleotides inserted by the insertion. The position of the nucleotide located before the insertion site remains unchanged. The position of the nucleotide located after the insertion site changes by the number of inserted nucleotides. When multiple insertions are performed, the position of each nucleotide is determined by adding the number of nucleotides inserted before it to the original position.

[0021] The substitution of nucleotides in a promoter sequence to insert at least one nucleic acid sequence is the exchange of a portion of the existing promoter sequence with a nucleic acid sequence. During the substitution, the same number of nucleotides of the original promoter sequence are removed as new ones are added. This does not change the position of individual nucleotides, both upstream and downstream. Since the length of a promoter can affect its activity and overall behavior, promoter modifications can be made to GATAX1X2X3X4X5X6(X7). mPreferably, this is done via substitution, such that the promoter is modified by substituting nucleotides in the promoter sequence to introduce into the promoter at least one nucleic acid sequence selected from the group consisting of: ATCCTTTTAG (SEQ ID NO: 1), ATCCTTTTAG (SEQ ID NO: 2), and AAA.

[0022] In the first step of this method for modifying promoter, a promoter must be provided.This promoter can be of any origin.Promoter can be a naturally occurring promoter, but can also be a variant of such a naturally occurring sequence.Hybrid versions of several naturally occurring promoters are also suitable.Synthetically produced promoter sequences can also be used.Those skilled in the art know how to generate such sequences.

[0023] One of the neutral nucleic acid sequences that can be used in the methods of the present invention is the nucleic acid sequence GATAX1X2X3X4X5X6(X7) m This nucleic acid sequence can be used to modify the original promoter by insertion or substitution. X1 to X7 represent nucleotides. The nucleotides are preferably selected from the group consisting of A, C, G, and T.

[0024] According to a particularly preferred embodiment of the present invention, X1 is A or T, X2 is C or G, X3 is C or G, X4 is C or G, X5 is A or G, and X6 is C or G, wherein X1 is even more preferably A, X2 is even more preferably C, X3 is even more preferably C, X4 is even more preferably G, X5 is even more preferably T, and X6 is even more preferably G.

[0025] Nucleic acid sequence GATAX1X2X3X4X5X6(X7) mcan consist of 10 to 20 nucleotides, where the variable m defines the length of the nucleic acid sequence. m is defined as an integer between 0 and 10, and in preferred embodiments of the present invention, m is an integer between 0 and 8, more preferably between 0 and 6, more preferably between 0 and 4, and more preferably between 0 and 2. In particularly preferred embodiments, m is 0, such that the nucleic acid sequence incorporated into the promoter has a length of 10 nucleotides. Changing the length of the nucleic acid sequence also changes the number of substituted nucleotides in the promoter.

[0026] In a particularly preferred embodiment of the present invention, the nucleic acid sequence incorporated into the promoter consists of GATAACCGTG (SEQ ID NO: 2). This nucleic acid sequence can be inserted into the promoter or can be substituted by the nucleotides of the promoter.

[0027] Alternatively, the nucleic acid sequence incorporated into the promoter by insertion and / or substitution may consist of ATCCTTTTAG (SEQ ID NO: 1) and / or AAA. These nucleic acid sequences should also be considered neutral nucleic acid sequences and may result in modified promoters that exhibit an altered, preferably increased, rate of transcription of nucleic acid molecules encoding polypeptides or proteins.

[0028] In a particularly preferred embodiment of the invention, the promoter is the nucleic acid sequence GATAX1X2X3X4X5X6(X7) m , ATCCTTTTAG (SEQ ID NO: 1), and AAA. m and ATCCTTTTAG (SEQ ID NO: 1), GATAX1X2X3X4X5X6 (X7) m and AAA, ATCCTTTTAG (SEQ ID NO: 1) and AAA, or even all three of these nucleic acid sequences (i.e., GATAX1X2X3X4X5X6(X7) m , ATCCTTTTAG (SEQ ID NO: 1) and AAA) are particularly preferred.

[0029] According to a particularly preferred embodiment of the present invention, a promoter is modified in its regulatory region. Modifications in the regulatory region of a promoter allow for the identification of potential regulatory hotspots and the production of modified promoters with altered regulatory profiles and increased promoter strength. The "regulatory region" of a promoter comprises or consists of TFBS and / or suppressor binding sites. Transcription factor binding sites are regions within a promoter that affect transcription. Regulatory regions can be identified using a semi-rational approach. Suppressor binding sites bind polypeptides or proteins that repress and thus reduce the transcription rate of the promoter. Modifications of the promoter sequence either upstream or downstream of the TFBS or suppressor binding site are particularly preferred.

[0030] According to another preferred embodiment of the present invention, the promoter is a eukaryotic promoter, i.e., a promoter that is directly derived from or functionally active in eukaryotic cells. In an even more preferred embodiment of the present invention, the promoter to be modified is a fungal promoter. A fungal promoter is a promoter that is naturally present in or functionally active in cells of the fungal kingdom. Particularly preferred fungal promoters are yeast promoters, more preferably promoters of methylotrophic yeast cells.

[0031] According to an even more preferred embodiment of the present invention, the fungal promoter is a promoter of fungal cells from the phylum Ascomycota. Ascomycota are of great importance to humans as they are the cause of many diseases and are also involved in medicine, the food industry, and the ecosystem. Several representative Ascomycota are used to produce recombinant proteins and polypeptides.

[0032] Promoters for fungal cells from the Ascomycota are preferably from the genus Komagataella, more preferably from Komagataella phaffii. Other preferred promoters are DNA sequences that are active as promoters in the filamentous fungi Trichoderma species, Myceliophthora species, Myceliophthora thermophila (e.g., Myceliophthora thermophila C1), and Aspergillus species.

[0033] The Komagataella phaffii alcohol oxidase 1 promoter (Pichia pastoris) is a prime example of promoter engineering due to its great popularity, strength, and tight regulation. Using a random engineering approach, variants with increased, repressed, and higher expression can be produced.

[0034] Komagataella phaffii is one of the most important eukaryotic hosts for recombinant protein production, possessing high-level protein production and secretion capabilities, glycosylation patterns, and low levels of endogenously secreted proteins. Classical promoter sequences for Komagataella phaffii expression systems are still frequently used. New alternatives include promoters of genes involved in the methanol utilization pathway. The Komagataella phaffii catalase promoter has been described, which is not only inducible by methanol but also activated upon carbon source depletion, a process known as derepression, increasing the feasibility of methanol-free protein production.

[0035] The modified promoters of the present invention can be used to increase protein or polypeptide expression in fungi, preferably Komagataella phaffi. Specifically, the modified promoters of the present invention can increase protein expression of antibodies and other binding proteins or fragments thereof, enzymes, food and feed proteins, biopharmaceutical proteins, structural proteins, and proteins for materials and cosmetics.

[0036] Even more preferably, the promoter according to the present invention is a yeast promoter, preferably associated with a gene encoding a catalase, preferably a catalase from Komagataella phaffii, or a heat shock protein, preferably heat shock protein 12, more preferably heat shock protein 12 from Komagataella phaffii.

[0037] K. phaffii is one of the most important eukaryotic hosts for recombinant protein production, possessing the ability to produce and secrete proteins at high levels, favorable glycosylation patterns, and low amounts of endogenously secreted proteins, to name just a few. Although fine-tuning gene expression by using promoter sequences with appropriate regulatory elements and strength has been shown to be a viable approach for increasing the yield of proteins of interest, the K. phaffii (PAOX1 and PGAP) expression system is still frequently used. Alternatives include promoters of genes related to the MUT pathway. For the first time, the K. phaffii catalase promoter, e.g., PCTA1 (also known as PCAT), was described as a strongly regulated promoter with intriguing responses to various carbon sources. These promoters are not only inducible by methanol but can also be activated upon carbon source starvation (a mechanism known from regulatory sequences related to carbon metabolism, called derepression). Due to the favorable qualities of PCTA1, potential regulatory regions were identified and selected as targets for promoter engineering to create novel sequence-diversified promoter variants. Another very strong regulatory sequence is the promoter of the heat shock protein designated PDH (HSP12), which may also serve as a promoter to be modified in the methods of the present invention.

[0038] Filamentous fungi are often used as industrial protein production hosts for heterologous and homologous protein production, and they have enormous potential for efficient large-scale production of recombinant gene products. Thus, the promoters of the present invention can also be used in such cells.

[0039] For example, fungi of the genus Myceliophthora, such as Myceliophthora thermophila (also known as Chrysosporium thermophilum, Sporotrichum thermophile, Thielavia heterothallica, and Corynascus heterothallicus), specifically Myceliophthora thermophila C1, are filamentous fungi that can be used, for example, for the production of thermostable enzymes, food and feed proteins, therapeutic proteins, and protein-based biomaterials. The high product titers of proteins make them interesting expression hosts for biotechnological applications.

[0040] Efficient protein expression depends on several factors, including regulatory sequences such as promoters, which have a significant effect on expression levels. Therefore, promoter manipulation is an effective tool for generating positive effects on gene expression levels and increasing protein titers. Various constitutive promoters have been published for M. thermophila, including the pyruvate decarboxylase-like gene P. PDC The promoter of (MYCTH_112121, gene ID: 11511210) is one target for promoter engineering to create optimized promoter variants.

[0041] Thus, the promoter used in the present invention preferably comprises or consists of a nucleic acid sequence having at least 80% identity, preferably at least 90% identity, more preferably at least 95% identity to SEQ ID NO:3, SEQ ID NO:4 or SEQ ID NO:33, and it is particularly preferred that the promoter used in the present invention comprises or consists of the nucleic acid sequence of SEQ ID NO:3, SEQ ID NO:4 or SEQ ID NO:33.

[0042] PCTA1 (SEQ ID NO: 3): TAATCGAACTCCGAATGCGGTTCTCCTGTAACCTTAATTGTAGCATAGATCACTTAAATAAACTCATGGCCTGACATCTGTACACGTTCTTATTGGTCTTTTAGCAATCTTGAAGTCTTTCTATTGTTCCGGTCGGCATTACCTAATAAATTCGAATCGAGATTGCTAGTACCTGATATCATATGAAGTAATCATCACATGCAAGTTCCATGATACCCTCTACTAATGGAATTGAACAAAGTTTAAGCTTCTCGCACGAGACCGAATCCATACTATGCACCCCTCAAAGTTGGGATTAGTCAGGAAAGCTGAGCAATTAACTTCCCTCGATTGGCCTGGACTTTTCGCTTAGCCTGCCGCAATCGGTAAGTTTCATTATCCCAGCGGGGTGATAGCCTCTGTTGCTCATCAGGCCAAAATCATATATAAGCTGTAGACCCAGCACTTCAATTACTTGAAATTCACCATAACACTTGCTCTAGTCAAGACTTACAATTAAA

[0043] PDH (SEQ ID NO: 4): CTTCAGTAAGAGAAGGAAGCTTGGTGACGATCACAGCTATGATGTAATAGAAATTGCTAAGCAATTGTGAGGTGTGATGTATTTTGCAGAGCAATTGTGCGGTACAACGGGGTGTTATTGTCTTCACAAGGCATTTATTGCGAATTTCGTAGTTGAAAGAATATTTTAGCACAGGGTGCTTGACCCCTATTGTTGCTCGCTAAACCATGATTGCTAAATGATGACATAGCAATCACTTTACTAAGATTGCTATAAGGACACCTTTCTTAGTATAAATGGACACTCTTTTCCCCTGCTAAACTTCTTTTATTTTTCACACTTAAACAGTTACAAAACACAAACACAACTAGAA

[0044] PDC (SEQ ID NO: 33): CCGAGTGTACTCCGTAAGGAGGGTTGGTCTCATGCCTCTTGGCGGGAGCCGCCCGATAACTAGTATAACTAGTTGTAACTCCGTATCCGGTTACGGAAACGGAAAGGCCCGCTCGGCTGTTCTCCGGCGGCTCCCCGATCGCTGATCAGAGCATGGAACAGATGTCAATTACATCACTCCCGCGTAAACGAACCATAGTTATCGAACCACAGTTATCGAACCACAGAGCCAGCCCATGGGAACGTCTGAACAGCTCGGAGGATGCAACCGATATTGCAATGCAAAACGTCACCCATGCTACAATTAATTCCCTGCACAACTACTTGTAAGCCGCGAGGCCTAGAACACAGTTGCAGAACCTGGGTATCGTGCCTGTGGTCTGATGCAGATATGTGTCACCACTCAAGACCCCGCCAACACGCCGCTTCGAGGCCCTGAACAGTACAAAGGGCGCTTCAAATTCGTACAAGCCCCCCCGAGGCCGTTTTCAAGTCTTTGTATGACCATCTATTTTCCGATTGACGTCCCTCACGGATTCTCTTTCGTTGCTGACCTCCTTGTGACCACAAACATCGCCAACAACAGAC

[0045] The "identity" of two or more nucleic acid sequences can be determined by aligning these nucleic acid sequences. Alignment can be performed using BLAST (National Center for Biological Information (NCBI) Basic Local Alignment Search Tool) version 2.13.0 software with default parameters. The nucleic acid sequence identity percentage between nucleic acid sequences can be determined using standard nucleotide BLAST with the following default parameters: maximum target sequence: 100; short query: automatically adjust parameters for short input sequences; expectation threshold: 10; word size: 28; maximum match in query range: 0; match / mismatch score: 1, -2; gap cost: linear; filter: low complexity region; mask: mask for lookup table only. A sequence that has an identity score of XX% (e.g., 80%) to a reference sequence using the NCBI BLAST version 2.13.0 algorithm with default parameters is considered to be at least XX% identical to the reference sequence, or equivalently, to have XX% sequence identity.

[0046] Also encompassed are promoter variants that have truncations at the 5' and / or 3' ends of the promoter from which they are derived. Thus, truncated versions of promoter variants of the invention may be used where the truncation is a GATAX1X2X3X4X5X6(X7) m , ATCCTTTTAG (SEQ ID NO: 1), and AAA, and may contain a 5' deletion and / or a 3' deletion of 1 to 200, preferably 1 to 150, more preferably 1 to 100, and more preferably 1 to 50 nucleotides, provided that the nucleic acid sequence does not contain a site for insertion and / or substitution of at least one nucleic acid sequence selected from the group consisting of:

[0047] The modifications described below for promoters comprising or consisting of a nucleic acid sequence having at least 80% identity to SEQ ID NO: 3 or SEQ ID NO: 4 are preferably GATAX1X2X3X4X5X6(X7) m, ATCCTTTTAG (SEQ ID NO: 1), and AAA.

[0048] A promoter comprising or consisting of a nucleic acid sequence having at least 80% identity to SEQ ID NO: 3 can be modified according to the present invention. Modification of a promoter according to the present invention results in a promoter that exhibits improved properties compared to the wild-type / unmodified promoter, specifically, it results in increased transcription efficiency and therefore increased protein expression. A promoter can be further improved by making multiple modifications according to the present invention.

[0049] According to a particularly preferred embodiment of the present invention, a promoter comprising or consisting of a nucleic acid sequence having at least 80% identity to SEQ ID NO: 3 is modified in at least one promoter region selected from the group consisting of positions 1 to 20, 131 to 150, 251 to 270, 371 to 390, 401 to 410, and 461 to 480 of SEQ ID NO: 3. Even more preferably, a promoter comprising or consisting of a nucleic acid sequence having at least 80% identity to SEQ ID NO: 3 is modified in at least one promoter region selected from the group consisting of positions 1 to 10, 131 to 140, 251 to 260, 371 to 380, 401 to 410, and 471 to 480 of SEQ ID NO: 3. In an even more preferred embodiment, positions 1 to 10 are thereby modified, preferably with ATCCTTTTAG (SEQ ID NO: 1), and positions 131 to 140, 251 to 260, 371 to 380, 401 to 410 and 471 to 480 are preferably modified with GATAX1X2X3X4X5X6(X7) m is modified with

[0050] GATAX1X2X3X4X5X6(X7) of a promoter comprising or consisting of a nucleic acid sequence having at least 80% identity to SEQ ID NO: 3 m, ATCCTTTTAG (SEQ ID NO: 1), and AAA, or by replacing the nucleotides in the promoter, GATAX1X2X3X4X5X6(X7) m , ATCCTTTTAG (SEQ ID NO: 1), and AAA, resulting in a promoter variant that exhibits a significantly increased transcription rate compared to the wild-type promoter, and thus the nucleic acid sequence GATAX1X2X3X4X5X6(X7) m is preferably used for promoter modification.

[0051] According to another particularly preferred embodiment of the present invention, the promoter comprising or consisting of a nucleic acid sequence having at least 80% identity to SEQ ID NO: 3 is simultaneously modified at positions 1 to 10, 131 to 140 and 251 to 260, or at positions 131 to 140, 251 to 260 and 401 to 410, or at positions 131 to 140, 251 to 260 and 471 to 480, or at positions 1 to 10, 131 to 140, 251 to 260 and 371 to 380, or at positions 1 to 10, 131 to 140, 251 to 260 and 471 to 480, or at positions 1 to 10, 131 to 140, 251 to 260, 371 to 380, 401 to 410 and 471 to 480.

[0052] According to the present invention, promoters can also be additionally modified by deletion. Modifying a promoter sequence by deletion means that specific nucleotides in the original promoter sequence are removed. No new nucleotides are added to the promoter sequence. Deletion of a single nucleotide or a nucleic acid stretch within a modified promoter can also affect the transcription rate of a nucleic acid sequence operably linked to such a promoter. Therefore, it is particularly preferred to delete one or more, preferably 1, 2, 3, 4, 5, 6, or even all, nucleotides within positions 89-101, 137, 138, 162, 176, and / or 448-468 of a promoter comprising or consisting of a nucleic acid sequence having at least 80% identity to SEQ ID NO: 3. Deletions within putative transcription factor binding sites are particularly preferred.

[0053] According to a particularly preferred embodiment of the present invention, the promoter comprising or consisting of a nucleic acid sequence having at least 80% identity to SEQ ID NO: 3 is modified at positions 371 to 380 by a substitution and at positions 89 to 101, 137, 138, 162 and 176 by deletion, or modified at positions 251 to 260 by a substitution and at positions 89 to 101, 137, 138, 162 and 176 by deletion, or modified at positions 131 to 140 and 251 to 260 by substitution and at positions 448 to 468 by deletion, or modified at positions 1 to 10 and 251 to 260 by substitution and at positions 448 to 468 by deletion.

[0054] These promoter modifications result in improved product expression characteristics, specifically increased expression rates. In particular, multiple modifications according to the present invention are particularly advantageous. When these multiple modifications are made at defined positions, the promoter properties can be further improved.

[0055] According to a particularly preferred embodiment of the present invention, a promoter comprising or consisting of a nucleic acid sequence having at least 80% identity to SEQ ID NO: 4 is modified in at least one region selected from the group consisting of positions 1 to 20, 151 to 170, and 171 to 190, preferably positions 1 to 20, 161 to 170, and 171 to 180. In this regard, it is even more preferred that a promoter comprising or consisting of a nucleic acid sequence having at least 80% identity to SEQ ID NO: 4 is simultaneously modified at positions 161 to 170 and 171 to 180, or at positions 11 to 20, 161 to 170, and 171 to 180.

[0056] Modification of the aforementioned regions of the defined PDH promoter has been found to result in a modified promoter that exhibits an increased rate of transcription of a nucleic acid sequence operably linked thereto, as compared to the wild-type promoter.

[0057] To further increase the transcription rate, a promoter comprising or consisting of a nucleic acid sequence having at least 80% identity to SEQ ID NO: 4 is modified in a specific region with the nucleic acid sequence AAA. Thus, the properties of the promoter can be further improved by multiple modifications at specific positions with the nucleic acid sequence AAA.

[0058] According to a particularly preferred embodiment of the present invention, the promoter comprising or consisting of a nucleic acid sequence having at least 80% identity to SEQ ID NO: 4 is modified with a nucleic acid AAA within at least one promoter region selected from the group consisting of positions 235-237 and 349-351.

[0059] According to a particularly preferred embodiment of the present invention, a promoter comprising or consisting of a nucleic acid sequence having at least 80% identity to SEQ ID NO: 4 is modified, preferably substituted, with a nucleic acid AAA within at least one promoter region selected from the group consisting of positions 37-39, 103-105, 109-111, 178-180, 235-237 and 349-351.

[0060] According to a particularly preferred embodiment of the present invention, the promoter comprising or consisting of a nucleic acid sequence having at least 80% identity to SEQ ID NO: 4 is modified in at least one promoter region selected from the group consisting of positions 161-170, 171-180, 37-39, 103-105, 109-111, 121-130, 178-180, 235-237 and 349-351, whereby positions 121-130, 161-170 and 171-180 are preferably modified by the nucleic acid sequence GATAX1X2X3X4X5X6(X7) m and positions 37 to 39, 103 to 105, 109 to 111, 178 to 180, 235 to 237, and 349 to 351 are preferably modified with the nucleic acid AAA.

[0061] According to a preferred embodiment of the present invention, a promoter comprising or consisting of a nucleic acid sequence having at least 80% identity to SEQ ID NO: 33 is modified within at least one promoter region selected from the group consisting of positions 1 to 10, 21 to 30, 141 to 150, 461 to 470, 61 to 70, 281 to 290, 361 to 370, 301 to 310, and 561 to 570 of SEQ ID NO: 33, preferably within positions 1 to 10 and / or 461 to 470 of SEQ ID NO: 33.

[0062] According to another preferred embodiment of the present invention, the promoter comprises or consists of a nucleic acid sequence having at least 80% identity to SEQ ID NO: 33, GATAX1X2X3X4X5X6(X7) m , preferably modified with SEQ ID NO: 2. These aforementioned regions are preferably GATAX1X2X3X4X5X6(X7) m , preferably replaced with SEQ ID NO:2.

[0063] The present invention also relates to promoter variants obtainable by the methods described herein. The promoters produced in this manner have improved properties compared to the original promoters from which they are derived. The promoter variants according to the present invention preferably exhibit a higher transcription rate of the nucleic acid sequence operably linked thereto compared to the original promoters. The promoter variants according to the present invention can be used in all regions where high-level protein production is desired.

[0064] The promoters produced by using the process and / or identified using the method of the present invention have improved properties compared to their respective original promoters. Preferably, these promoters have increased transcription rates, in particular, they exhibit higher transcription rates under methanol induction and / or derepression conditions.

[0065] According to particularly preferred embodiments of the invention, these promoter variants comprise or consist of a nucleic acid sequence selected from the group of SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24. These promoters are preferably used in yeast cells to control the expression of homologous and / or heterologous proteins and / or peptides.

[0066] SEQ ID NO:5: ATCCTTTTTAGCCGAATGCGGTTCTCCTGTAACCTTAATTGTAGCATAGATCACTTAAATAAACTCATGGCCTGACATCTGTACACGTTCTTATTGGTCTTTTTAGCAATCTTGAAGTCTTCTATTGTTCCGGTCGGCATTAACTAATAAATTCGAATCGAGATTGCTAGTACCTGATATCATATGAAGTAATCATCACATGCAAGTTCCATGATACCCTCTACTAATGGAATTGAACAAAGTTTAAGCTT CTCGCACGAGACCGAATCCATACTATGCACCCCTCAAAGTTGGGATTAGTCAGGAAAGCTGAGCAATTAACTTCCCTCGATTGGCCTGGACTTTTCGCTTAGCCTGCCGCAATCGGTAAGTTTCATTATCCCAGCGGGGTGATAGCCTCTGTTGCTCATCAGGCCAAAATCATATATAAGCTGTAGACCCAGCACTTCATTACTTGAAATTCACCATAACACTTGCTCTAGTCAAGACTTACAATTAAA

[0067] sequence number 6: TAATCGAACTCCGAATGCGGTTCTCCTGTAACCTTAATTGTAGCATAGTCACTTAAATAAAACTCATGGCCTGACATCTGTACACGTTCTTATTGGTCTTTTTAGCAATCTTGAAGTCTTTCTATTGTTCCGATAACCGTGACCTAATAAATTCGAATCGAGATTGCTAGTACCTGATATCATATGAAGTAATCATCACATGCAAGTTCCATGATACCCTCTACTAATGGAATTGAACAAAGTTTAAGCTT CTCGCACGAGACCGAATCCATACTATGCACCCCTCAAAGTTGGGATTAGTCAGGAAAGCTGAGCAATTAACTTCCCTCGATTGGCCTGGACTTTTCGCTTAGCCTGCCGCAATCGGTAAGTTTCATTATCCCAGCGGGGTGATAGCCTCTGTTGCTCATCAGGCCAAAATCATATATAAGCTGTAGACCCAGCACTTCATTACTTGAAATTCACCATAACACTTGCTCTAGTCAAGACTTACAATTAAA

[0068] sequence number 7: TAATCGAACTCCGAATGCGGTTCTCCTGTAACCTTAATTGTAGCATAGTCACTTAAATAAACTCATGGCCTGACATCTGTACACGTTCTTATTGGTCTTTTTAGCAATCTTGAAGTCTTCTATTGTTCCGGTCGGCATTAACTAATAAATTCGAATCGAGATTGCTAGTACCTGATATCATATGAAGTAATCATCACATGCAAGTTCCATGATACCCTCTACTAATGGAATTGAACAAAGTTTAAGCTT GATAACCGTGACCGAATCCATACTATGCACCCCTCAAAGTTGGGATTAGTCAGGAAAGCTGAGCAATTAACTTCCCTCGATTGGCCTGGACTTTTCGCTTAGCCTGCCGCAATCGGTAAGTTTCATTATCCCAGCGGGGTGATAGCCTCTGTTGCTCATCAGGCCAAAATCATATATAAGCTGTAGACCCAGCACTTCATTACTTGAAATTCACCATAACACTTGCTCTAGTCAAGACTTACAATTAAA

[0069] sequence number 8: TAATCGAACTCCGAATGCGGTTCTCCTGTAACCTTAATTGTAGCATAGTCACTTAAATAAACTCATGGCCTGACATCTGTACACGTTCTTATTGGTCTTTTTAGCAATCTTGAAGTCTTCTATTGTTCCGGTCGGCATTAACTAATAAATTCGAATCGAGATTGCTAGTACCTGATATCATATGAAGTAATCATCACATGCAAGTTCCATGATACCCTCTACTAATGGAATTGAACAAAGTTTAAGCTT CTCGCACGAGACCGAATCCATACTATGCACCCCTCAAAGTTGGGATTAGTCAGGAAAGCTGAGCAATTAACTTCCCTCGATTGGCCTGGACTTTTCGCTTAGCCTGCCGCAATCGGTAAGGATAACCGTGCCAGCGGGGTGATAGCCTCTGTTGCTCATCAGGCCAAAATCATATATAAGCTGTAGACCCAGCACTTCATTACTTGAAATTCACCATAACACTTGCTCTAGTCAAGACTTACAATTAAA

[0070] sequence number 9: TAATCGAACTCCGAATGCGGTTCTCCTGTAACCTTAATTGTAGCATAGTCACTTAAATAAACTCATGGCCTGACATCTGTACACGTTCTTATTGGTCTTTTTAGCAATCTTGAAGTCTTCTATTGTTCCGGTCGGCATTAACTAATAAATTCGAATCGAGATTGCTAGTACCTGATATCATATGAAGTAATCATCACATGCAAGTTCCATGATACCCTCTACTAATGGAATTGAACAAAGTTTAAGCTT CTCGCACGAGACCGAATCCATACTATGCACCCCTCAAAGTTGGGATTAGTCAGGAAAGCTGAGCAATTAACTTCCCTCGATTGGCCTGGACTTTTCGCTTAGCCTGCCGCAATCGGTAAGTTTCATTATCCCAGCGGGGTGATAGCCTCTGTTGCTCATCAGGCCAAAATCATATATAAGCTGTAGACCCAGCACTTCATTACTTGAAATTCACCATAAGATAACCGTGATCAAGACTTAAAAA

[0071] sequence number 10: TAATCGAACTCCGAATGCGGTTCTCCTGTAACCTTAATTGTAGCATAGTCACTTAAATAAAACTCATGGCCTGACATCTGTACACGTTCTTATTGGTCTTTTTAGCAATCTTGAAGTCTTTCTATTGTTCCGATAACCGTGACCTAATAAATTCGAATCGAGATTGCTAGTACCTGATATCATATGAAGTAATCATCACATGCAAGTTCCATGATACCCTCTACTAATGGAATTGAACAAAGTTTAAGCTT GATAACCGTGACCGAATCCATACTATGCACCCCTCAAAGTTGGGATTAGTCAGGAAAGCTGAGCAATTAACTTCCCTCGATTGGCCTGGACTTTTCGCTTAGCCTGCCGCAATCGGTAAGTTTCATTACCCAGCGGGGTGATAGCCTCTGATAACCGTGAGGCCAAAATCATATAAGCTGTAGACCCAGCACTTCATTACTTGAAATTCACCATAACACTTGCTCTAGTCAAGACTTACAATTAAA

[0072] sequence number 11: TAATCGAACTCCGAATGCGGTTCTCCTGTAACCTTAATTGTAGCATAGTCACTTAAATAAAACTCATGGCCTGACATCTGTACACGTTCTTATTGGTCTTTTTAGCAATCTTGAAGTCTTTCTATTGTTCCGATAACCGTGACCTAATAAATTCGAATCGAGATTGCTAGTACCTGATATCATATGAAGTAATCATCACATGCAAGTTCCATGATACCCTCTACTAATGGAATTGAACAAAGTTTAAGCTT GATAACCGTGACCGAATCCATACTATGCACCCCTCAAAGTTGGGATTAGTCAGGAAAGCTGAGCAATTAACTTCCCTCGATTGGCCTGGACTTTTCGCTTAGCCTGCCGCAATCGGTAAGTTTCATTATCCCAGCGGGGTGATAGCCTCTGTTGCTCATCAGGCCAAAATCATATATAAGCTGTAGACCCAGCACTTCATTACTTGAAATTCACCATAAGATAACCGTGATCAAGACTTAAAAA

[0073] sequence number 12: ATCCTTTTTAGCCGAATGCGGTTCTCCTGTAACCTTAATTGTAGCATAGATCACTTAAATAAACTCATGGCCTGACATCTGTACACGTTCTTATTGGTCTTTTTAGCAATCTTGAAGTCTTTCTATTGTTCCGATAACCGTGACCTAATAAATTCGAATCGAGATTGCTAGTACCTGATATCATATGAAGTAATCATCACATGCAAGTTCCATGATACCCTCTACTAATGGAATTGAACAAAGTTTAAGCTT GATAACCGTGACCGAATCCATACTATGCACCCCTCAAAGTTGGGATTAGTCAGGAAAGCTGAGCAATTAACTTCCCTCGATTGGCCTGGACTTTTCGCTTAGCCTGCCGCAATCGGTAAGTTTCATTATCCCAGCGGGGTGATAGCCTCTGTTGCTCATCAGGCCAAAATCATATATAAGCTGTAGACCCAGCACTTCATTACTTGAAATTCACCATAACACTTGCTCTAGTCAAGACTTACAATTAAA

[0074] sequence number 13: ATCCTTTTTAGCCGAATGCGGTTCTCCTGTAACCTTAATTGTAGCATAGATCACTTAAATAAACTCATGGCCTGACATCTGTACACGTTCTTATTGGTCTTTTTAGCAATCTTGAAGTCTTTCTATTGTTCCGATAACCGTGACCTAATAAATTCGAATCGAGATTGCTAGTACCTGATATCATATGAAGTAATCATCACATGCAAGTTCCATGATACCCTCTACTAATGGAATTGAACAAAGTTTAAGCTT GATAACCGTGACCGAATCCATACTATGCACCCCTCAAAGTTGGGATTAGTCAGGAAAGCTGAGCAATTAACTTCCCTCGATTGGCCTGGACTTTTCGCTTAGCCTGCCGCAATCGGTAAGGATAACCGTGCCAGCGGGGTGATAGCCTCTGTTGCTCATCAGGCCAAAATCATATATAAGCTGTAGACCCAGCACTTCATTACTTGAAATTCACCATAACACTTGCTCTAGTCAAGACTTACAATTAAA

[0075] sequence number 14: ATCCTTTTTAGCCGAATGCGGTTCTCCTGTAACCTTAATTGTAGCATAGATCACTTAAATAAACTCATGGCCTGACATCTGTACACGTTCTTATTGGTCTTTTTAGCAATCTTGAAGTCTTTCTATTGTTCCGATAACCGTGACCTAATAAATTCGAATCGAGATTGCTAGTACCTGATATCATATGAAGTAATCATCACATGCAAGTTCCATGATACCCTCTACTAATGGAATTGAACAAAGTTTAAGCTT GATAACCGTGACCGAATCCATACTATGCACCCCTCAAAGTTGGGATTAGTCAGGAAAGCTGAGCAATTAACTTCCCTCGATTGGCCTGGACTTTTCGCTTAGCCTGCCGCAATCGGTAAGTTTCATTATCCCAGCGGGGTGATAGCCTCTGTTGCTCATCAGGCCAAAATCATATATAAGCTGTAGACCCAGCACTTCATTACTTGAAATTCACCATAAGATAACCGTGATCAAGACTTAAAAA

[0076] sequence number 15: ATCCTTTTTAGCCGAATGCGGTTCTCCTGTAACCTTAATTGTAGCATAGATCACTTAAATAAACTCATGGCCTGACATCTGTACACGTTCTTATTGGTCTTTTTAGCAATCTTGAAGTCTTTCTATTGTTCCGATAACCGTGACCTAATAAATTCGAATCGAGATTGCTAGTACCTGATATCATATGAAGTAATCATCACATGCAAGTTCCATGATACCCTCTACTAATGGAATTGAACAAAGTTTAAGCTT GATAACCGTGACCGAATCCATACTATGCACCCCTCAAAGTTGGGATTAGTCAGGAAAGCTGAGCAATTAACTTCCCTCGATTGGCCTGGACTTTTCGCTTAGCCTGCCGCAATCGGTAAGGATAACCGTGCCAGCGGGGTGATAGCCTCTGATAACCGTGAGGCCAAAATCATATAAGCTGTAGACCCAGCACTTCATTACTTGAAATTCACCATAAGATAACCGTGATCAAGACTTAAAAA

[0077] sequence number 16: CTTCAGTAAGGATAACCGTGTTGGTGACGATCACAGCTATGATGTAATAGAAATTGCTAAGCAATTGTGAGGTGATGTATTTTGCAGAGCAATTGTGCGGTACAACGGGGTGTTATTGTCTTCACAAGGCATTTATTGCGAATTTCGTAGTTGAAAGAATATTTTAGCACAGGG TGCTTGACCCCTATTGTTGCTCGCTAAACCATGATTGCTAAATGATCATAGCAATCACTTTACTAAGATTGCTATAAGGACACCTTTCTTAGTATAAATGGACACTCTTTCCCCTGCTAAACTTCTTTTATTTTTCACACTTAAACAGTTACAAAACACAAACACAACTAGAA

[0078] sequence number 17: CTTCAGTAAGAGAAGGAAGCTTGGTGACGATCACAGCTATGATGTAATAGAAATTGCTAAGCAATTGTGAGGTGTGATGTATTTTGCAGAGCAATTGTGCGGTACAACGGGGTGTTATTGGATAACCGTGGCATTTTATTGCGAATTTCGTAGTTGAAAGAATATTTTAGCACAGGG TGCTTGACCCCTATTGTTGCTCGCTAAACCATGATTGCTAAATGATCATAGCAATCACTTTACTAAGATTGCTATAAGGACACCTTTCTTAGTATAAATGGACACTCTTTCCCCTGCTAAACTTCTTTTATTTTTCACACTTAAACAGTTACAAAACACAAACACAACTAGAA

[0079] sequence number 18: CTTCAGTAAGAGAAGGAAGCTTGGTGACGATCACAGCTATGATGTAATAGAAATTGCTAAGCAATTGTGAGGTGTGATGTATTTTGCAGAGCAATTGTGCGGTACAACGGGGTGTTATTGTCTTCACAAGGCATTTATTGCGAATTTCGTAGTTGAAAGAGATAACCGTGACAGGG TGCTTGACCCCTATTGTTGCTCGCTAAACCATGATTGCTAAATGATCATAGCAATCACTTTACTAAGATTGCTATAAGGACACCTTTCTTAGTATAAATGGACACTCTTTCCCCTGCTAAACTTCTTTTATTTTTCACACTTAAACAGTTACAAAACACAAACACAACTAGAA

[0080] sequence number 19: CTTCAGTAAGAGAAGGAAGCTTGGTGACGATCACAGCTATGATGTAATAGAAATTGCTAAGCAATTGTGAGGTGTGATGTATTTTGCAGAGCAATTGTGCGGTACAACGGGGTGTTATTGTCTTCACAAGGCATTTATTGCGAATTTCGTAGTTGAAAGAATATTTTAGCGATAAC CGTTGACCCCTATTGTTGCTCGCTAAACCATGATTGCTAAATGATCATAGCAATCACTTTACTAAGATTGCTATAAGGACACCTTTTCTTAGTATAAATGGACACTCTTTCCCCTGCTAAACTTCTTTTATTTTTCACACTTAAACAGTTACAAAACACAAACACAACTAGAA

[0081] sequence number 20: CTTCAGTAAGAGAAGGAAGCTTGGTGACGATCACAGCTATGATGTAATAGAAATTGCTAAGCAATTGTGAGGTGTGATGTATTTTGCAGAGCAATTGTGCGGTACAACGGGGTGTTATTGTCTTCACAAGGCATTTATTGCGAATTTCGTAGTTGAAAGAGATAACCGTGGATAAC CGTTGACCCCTATTGTTGCTCGCTAAACCATGATTGCTAAATGATCATAGCAATCACTTTACTAAGATTGCTATAAGGACACCTTTTCTTAGTATAAATGGACACTCTTTCCCCTGCTAAACTTCTTTTATTTTTCACACTTAAACAGTTACAAAACACAAACACAACTAGAA

[0082] sequence number 21: CTTCAGTAAGGATAACCGTGTTGGTGACGATCACAGCTATGATGTAATAGAAATTGCTAAGCAATTGTGAGGTGATGTATTTTGCAGAGCAATTGTGCGGTACAACGGGGTGTTATTGTCTTCACAAGGCATTTATTGCGAATTTCGTAGTTGAAAGAGATAACCGTGGATAAC CGTTGACCCCTATTGTTGCTCGCTAAACCATGATTGCTAAATGATCATAGCAATCACTTTACTAAGATTGCTATAAGGACACCTTTTCTTAGTATAAATGGACACTCTTTCCCCTGCTAAACTTCTTTTATTTTTCACACTTAAACAGTTACAAAACACAAACACAACTAGAA

[0083] sequence number 22: CTTCAGTAAGAGAAGGAAGCTTGGTGACGATCACAGCTATGATGTAATAGAAATTGCTAAGCAATTGTGAGGTGTGATGTATTTTGCAGAGCAATTGTGCGGTACAACGGGGTGTTATTGTCTTCACAAGGCATTTATTGCGAATTTCGTAGTTGAAAGAATATTTTAGCACAGGG TAAATGACCCCTATTGTTGCTCGCTAAACCATGATTGCTAAATGATGACATAGCAATCAAATTACTAAGATTGCTATAAGGACACCTTTCTTAGTATAAATGGACACTCTTTCCCCTGCTAAACTTCTTTTATTTTTCACACTTAAACAGTTACAAAACACAAACACAACTAAAA

[0084] sequence number 23: CTTCAGTAAGAGAAGGAAGCTTGGTGACGATCACAGAAATGATGTAATAGAAATTGCTAAGCAATTGTGAGGTGATGTATTTTGCAGAGCAATTGTGCGGAAAAACAAAGTGTTATTGTCTTCACAAGGCATTTATTGCGAATTTCGTAGTTGAAAGAATATTTTAGCACAGGG TAAATGACCCCTATTGTTGCTCGCTAAACCATGATTGCTAAATGATGACATAGCAATCAAATTACTAAGATTGCTATAAGGACACCTTTCTTAGTATAAATGGACACTCTTTCCCCTGCTAAACTTCTTTTATTTTTCACACTTAAACAGTTACAAAACACAAACACAACTAAAA

[0085] sequence number 24: CTTCAGTAAGAGAAGGAAGCTTGGTGACGATCACAGCTATGATGTAATAGAAATTGCTAAGCAATTGTGAGGTGTGATGTATTTTGCAGAGCAATTGTGCGGTACAACGGGGTGTTATTGTCTTCACAAGGCATTTATTGCGAATTTCGTAGTTGAAAGAGATAACCGTGGATAAC CGTGTGACCCCTATTGTTGCTCGCTAAACCATGATTGCTAAATGATGACATAGCAATCAAATTACTAAGATTGCTATAAGGACACCTTTCTTAGTATAAATGGACACTCTTTCCCCTGCTAAACTTCTTTTATTTTTCACACTTAAACAGTTACAAAACACAAACACAACTAAAA

[0086] According to another preferred embodiment of the present invention, these promoter variants comprise or consist of a nucleic acid sequence selected from the group of SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41 and SEQ ID NO: 42, with SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36 and SEQ ID NO: 37 being most preferred. These promoters are preferably used in fungal cells (other than yeast cells) to control the expression of homologous and / or heterologous proteins and / or peptides. In particular, it has been found that promoter variants comprising or consisting of the nucleic acid sequences of SEQ ID NO: 34 and SEQ ID NO: 35 are capable of increasing the expression of proteins / peptides operably linked thereto by several fold.

[0087] SEQ ID NO:34: CCGAGTGTACTCCGTAAGGAGGGTTGGTCTCATGCCTCTTGGCGGGAGCCGCCCGATAACTAGTATAACTAGTTGTAACTCCGTATCCGGTTACGGAAACGGAAAGGCCCGCTCGGCTGTTCTCCGGCGGCTCCCCGATCGCTGAT CAGAGCATGGAACAGATGTCAATTACATCACTCCCGCGTAAACGAACCATAGTTATCGAACCACAGTTATCGAACCACAGAGCCAGCCCATGGGAACGTCTGAACAGCTCGGAGGATGCAACCGATATTGCAATGCAAAACGTCACC CATGCTACAATTAATTCCCTGCACAACTACTTGTAAGCCGCGAGGCCTAGAACACAGTTGCAGAACCTGGGTATCGTGCCTGTGGTCTGATGCAGATATGTGTCACCACTCAAGACCCCGCCAACACGCCGCTTCGAGGCCCTGAAC AGTACAAAGGGCGCTTCAAAGATAACCGTGCCCCCCCGAGGCCGTTTTCAAGTCTTTTGTATGACCATCTATTTTCCGATTGACGTCCCTCACGGATTCTCTTTCGTTGCTGACCTCCTTGTGACCACAAACATCGCCAACAAACAGAC

[0088] sequence number 35: GATAACCGTGTCCGTAAGGAGGGTTGGTCTCATGCCTCTTGGCGGGAGCCGCCCGATAACTAGTATAACTAGTTGTAACTCCGTATCCGGTTACGGAAACGGAAAGGCCCGCTCGGCTGTTCCGGCGGCTCCCCGATCGCTGATCAGAGCATGGAACAGATGTCCAATTACATCACTCCCGCGTAAACGAACCATAGTTATCGAACCACAGTTATCGAACCACAGAGCCAGCCCATGGGAACGTCTGAACAGCTCGGAGGATGCAACCGATATTGCAAATGCAAAACGTCACC CATGCTACAATTAATTCCCTGCACAACTACTTGTAAGCCGCGAGGCCTAGAACACAGTTGCAGAACCTGGGTATCGTGCCTGTGGTCTGATGCAGATATGTGTCACCACTCAAGACCCCGCCAACACGCCGCTTCGAGGCCCTGAACAGTACAAAGGGCGCTTCCAAATTCGTACAAGCCCCCCCGAGGCCGTTTTCAAGTCTTTGTATGACCATCTATTTTCCGATTGACGTCCCTCACGGATTCTCTTTCGTTGCTGACCTCCTTGTGACCACAAACATCGCCAACAAGAAC

[0089] sequence number 36: CCGAGTGTACTCCGTAAGGAGATAACCGTGCATGCCTCTTGGCGGGAGCCGCCCGATAACTAGTATAACTAGTTGTAACTCCGTATCCGGTTACGGAAACGGAAAGGCCCGCTCGGCTGTTCTCGGCGCTCCCCGATCGCTGATCAGAGCATGGAACAGATGTCCAATTACATCACTCCCGCGTAAACGAACCATAGTTATCGAACCACAGTTATCGAACCACAGAGCCAGCCCATGGGAACGTCTGAACAGCTCGGAGGATGCAACCGATATTGCAAATGCAAAACGTCACC CATGCTACAATTAATTCCCTGCACAACTACTTGTAAGCCGCGAGGCCTAGAACACAGTTGCAGAACCTGGGTATCGTGCCTGTGGTCTGATGCAGATATGTGTCACCACTCAAGACCCCGCCAACACGCCGCTTCGAGGCCCTGAACAGTACAAAGGGCGCTTCCAAATTCGTACAAGCCCCCCCGAGGCCGTTTTCAAGTCTTTGTATGACCATCTATTTTCCGATTGACGTCCCTCACGGATTCTCTTTCGTTGCTGACCTCCTTGTGACCACAAACATCGCCAACAAGAAC

[0090] sequence number 37: CCGAGTGTACTCCGTAAGGAGGGTTGGTCTCATGCCTCTTGGCGGGAGCCGCCCGATAACTAGTATAACTAGTTGTAACTCCGTATCCGGTACGGAACGGAAAGGCCCGTCGGCTGTTCTCGGCGCTCCCCGATCGATAACCGTGCATGGAACAGATGTCCAATTACATCACTCCCGCGTAAACGAACCATAGTTATCGAACCACAGTTATCGAACCACAGAGCCAGCCCATGGGAACGTCTGAACAGCTCGGAGGATGCAACCGATATTGCAATGCAAAACGTCACC CATGCTACAATTAATTCCCTGCACAACTACTTGTAAGCCGCGAGGCCTAGAACACAGTTGCAGAACCTGGGTATCGTGCCTGTGGTCTGATGCAGATATGTGTCACCACTCAAGACCCCGCCAACACGCCGCTTCGAGGCCCTGAACAGTACAAAGGGCGCTTCCAAATTCGTACAAGCCCCCCCGAGGCCGTTTTCAAGTCTTTGTATGACCATCTATTTTCCGATTGACGTCCCTCACGGATTCTCTTTCGTTGCTGACCTCCTTGTGACCACAAACATCGCCAACAAGAAC

[0091] sequence number 38: CCGAGTGTACTCCGTAAGGAGGGTTGGTCTCATGCCTCTTGGCGGGAGCCGCCCGATAACTAGTATAACTAGTTGTAACTCCGTATCCGGTTACGGAACGGAAAGGCCCGTCGGCTGTTCCGGCGGCTCCCCGATCGATCAGAGCATGGAACAGATGTCCAATTACATCACTCCCGCGTAAACGAACCATAGTTATCGAACCACAGTTATCGAACCACAGAGCCAGCCCATGGGAACGTCTGAACAGCTCGGAGGATGCAACCGATATTGCAATGATAACCGTCGACC CATGCTACAATTAATTCCCTGCACAACTACTTGTAAGCCGCGAGGCCTAGAACACAGTTGCAGAACCTGGGTATCGTGCCTGTGGTCTGATGCAGATATGTGTCACCACTCAAGACCCCGCCAACACGCCGCTTCGAGGCCCTGAACAGTACAAAGGGCGCTTCCAAATTCGTACAAGCCCCCCCGAGGCCGTTTTCAAGTCTTTGTATGACCATCTATTTTCCGATTGACGTCCCTCACGGATTCTCTTTCGTTGCTGACCTCCTTGTGACCACAAACATCGCCAACAAGAAC

[0092] sequence number 39: CCGAGTGTACTCCGTAAGGAGGGTTGGTCTCATGCCTCTTGGCGGGAGCCGCCCGATAACTAGTATAACTAGTTGTAACTCCGTATCCGGTACGGAACGGAAAGGCCCGTCGGCTGTTCTCGGCGCTCCCCGATCGCTGATCAGAGCATGGAACAGATGTCCAATTACATCACTCCCGCGTAAACGAACCATAGTTATCGAACCACAGTTATCGAACCACAGAGCCAGCCCATGGGAACGTCTGAACAGCTCGGAGGATGCAACCGATATTGCAAATGCAAAACGTCACC CATGCTACAATTAATTCCCTGCACAACTACTTGTAAGCCGCGAGGCCTAGAACACAGTTGCAGAACCGATAACCGTGGCCTGTGGTCGATGCAGATATGTGTCACCACTCAAGACCCCGCCAACACGCCGCTTCGAGGCCCTGAACAGTACAAAGGGCGCTTCCAAATTCGTACAAGCCCCCCCGAGGCCGTTTTCAAGTCTTTGTATGACCATCTATTTTCCGATTGACGTCCCTCACGGATTCTCTTTCGTTGCTGACCTCCTTGTGACCACAAACATCGCCAACAAGAAC

[0093] sequence number 40: CCGAGTGTACTCCGTAAGGAGGGTTGGTCTCATGCCTCTTGGCGGGAGCCGCCCGATAACTAGTATAACTAGTTGTAACTCCGTATCCGGTACGGAACGGAAAGGCCCGTCGGCTGTTCTCGGCGCTCCCCGATCGCTGATCAGAGCATGGAACAGATGTCCAATTACATCACTCCCGCGTAAACGAACCATAGTTATCGAACCACAGTTATCGAACCACAGAGCCAGCCCATGGGAACGTCTGAACAGCTCGGAGGATGCAACCGATATTGCAAATGCAAAACGTCACC CATGCTAGATAACCGTGCCTGCACAACTACTTGTAAGCCGCGAGGCCTAGAACACAGTTGCAGAACCTGGGTATCGTGCCTGTGCTCTGATGCAGATATGTGTCACCACTCAAGACCCCGCCAACACGCCGCTTCGAGGCCCTGAACAGTACAAAGGGCGCTTCCAAATTCGTACAAGCCCCCCCGAGGCCGTTTTCAAGTCTTTGTATGACCATCTATTTTCCGATTGACGTCCCTCACGGATTCTCTTTCGTTGCTGACCTCCTTGTGACCACAAACATCGCCAACAACAGAC

[0094] sequence number 41: CCGAGTGTACTCCGTAAGGAGGGTTGGTCTCATGCCTCTTGGCGGGAGCCGCCCGATAACGATAACCGTGAGTTGTAACTCCGTATCCGGTTACGGAAACGGAAAGGCCCGCTCGGCTGTTCTCGGCGCTCCCCGATCGCTGATCAGAGCATGGAACAGATGTCCAATTACATCACTCCCGCGTAAACGAACCATAGTTATCGAACCACAGTTATCGAACCACAGAGCCAGCCCATGGGAACGTCTGAACAGCTCGGAGGATGCAACCGATATTGCAATGCAAAACGTCACC CATGCTACAATTAATTCCCTGCACAACTACTTGTAAGCCGCGAGGCCTAGAACACAGTTGCAGAACCTGGGTATCGTGCCTGTGGTCTGATGCAGATATGTGTCACCACTCAAGACCCCGCCAACACGCCGCTTCGAGGCCCTGAACAGTACAAAGGGCGCTTCCAAATTCGTACAAGCCCCCCCGAGGCCGTTTTCAAGTCTTTGTATGACCATCTATTTTCCGATTGACGTCCCTCACGGATTCTCTTTCGTTGCTGACCTCCTTGTGACCACAAACATCGCCAACAAGAAC

[0095] sequence number 42: CCGAGTGTACTCCGTAAGGAGGGTTGGTCTCATGCCTCTTGGCGGGAGCCGCCCGATAACTAGTATAACTAGTTGTAACTCCGTATCCGGTTACGGAAACGGAAAGGCCCGCTCGGCTGTTCTCCGGCGGCTCCCCGATCGCTGAT CAGAGCATGGAACAGATGTCAATTACATCACTCCCGCGTAAACGAACCATAGTTATCGAACCACAGTTATCGAACCACAGAGCCAGCCCATGGGAACGTCTGAACAGCTCGGAGGATGCAACCGATATTGCAATGCAAAACGTCACC CATGCTACAATTAATTCCCTGCACAACTACTTGTAAGCCGCGAGGCCTAGAACACAGTTGCAGAACCTGGGTATCGTGCCTGTGGTCTGATGCAGATATGTGTCACCACTCAAGACCCCGCCAACACGCCGCTTCGAGGCCCTGAAC AGTACAAAGGGCGCTTCAAATTCGTACAAGCCCCCCCGAGGCCGTTTTCAAGTCTTTTGTATGACCATCTATTTTCCGATTGACGTCCCTCACGGATTCTCTTTCGTTGCTGACCTCCTTGGATAACCGTGCATCGCCAACAAACAGAC

[0096] The present invention further relates to a nucleic acid molecule or vector comprising a promoter variant according to the invention.

[0097] The nucleic acid molecules of the present invention can be operably linked to a nucleic acid sequence encoding a polypeptide or protein. These nucleic acid molecules or promoter variants of the present invention can be part of a vector, including a plasmid, cosmid, or yeast artificial chromosome (YAC), and modified viruses or virus particles.

[0098] These nucleic acid molecules and in particular these vectors may contain additional elements required for protein expression or replication in a host cell. Such elements are well known to those skilled in the art.

[0099] According to a particularly preferred embodiment of the present invention, the promoter variant of the present invention is operably linked to a nucleic acid sequence encoding a polypeptide or protein.

[0100] The present invention further relates to a host cell comprising a nucleic acid molecule or a promoter variant according to the invention.

[0101] The nucleic acid molecules and / or promoters of the present invention may be contained within a host cell. The host cell may be used as a carrier for the nucleic acid and / or promoter or may be functionally active therein. When the nucleic acid molecules and / or promoters of the present invention are functionally active, the host cell may be used to express a protein or polypeptide of interest under the control of a promoter of the present invention.

[0102] According to a particularly preferred embodiment of the present invention, the host cell is a fungal cell, preferably of the phylum Ascomycota, more preferably of the genus Komagataella or Myceliophthora, more preferably a Komagataella phaffii cell or a Myceliophthora thermophila cell, even more preferably a Myceliophthora thermophila C1 cell.

[0103] The present invention further relates to a method for producing a polypeptide or protein of interest, comprising culturing a host cell according to the invention. Methods for culturing cells and for activating the promoter variants of the invention to overexpress proteins and polypeptides are well known to those skilled in the art and depend on the modified promoter.

[0104] The present invention is further illustrated by the following examples, but is not limited thereto. [Example]

[0105] In Examples 1-4, two promoters, the K. phaffii catalase promoter PCTA1 (SEQ ID NO: 3) and the heat shock protein 12 promoter PDH (SEQ ID NO: 4), were modified using the methods of the present invention to identify promoter variants that exhibit higher expression rates or product titers than the wild-type promoter (the "original promoter").

[0106] The promoter sequence has been modified by insertion, substitution, or deletion. The type and position of each modification is indicated.

[0107] Example 1: Effect of a single mutation on expression under derepressing conditions Promoter PCTA1 The entire promoter sequence was systematically scanned using two different 10-bp-long "neutral" sequences, designated A (5'-ATCCTTTTAG-3', SEQ ID NO: 1) and B (5'-GATAACCGTG-3', SEQ ID NO: 2). By systematically exchanging every 10 base pairs between these two A and B sequences, a total of 100 so-called "scanning variants," designated 1A / B to 50A / B, were generated, numbered starting from the 5' end of the promoter.

[0108] To assess promoter strength of scanning variants, promoters and promoter variants were operably linked to a nucleic acid sequence encoding enhanced green fluorescent protein (eGFP) (GenBank accession number ADL66923) (Vogl et al. ACS Synth. Biol. 5(2016):172-186). Promoter activity was measured as a function of cell density (OD) at different time points during culture, either upon carbon source starvation (derepression) or after methanol induction (induction). 600The RFU was then set relative to the respective values ​​of the original (i.e., unmodified) promoter sequences. Cultivation was performed at a microscale using 96-well culture plates. For transformation, 1 μg of small linearized DNA was used to transform electrocompetent CBS7435Δku70 cells and grown on YPD Zeo Following the initial selection above, single colonies were used to inoculate microscale cultures.

[0109] Following Weis et al. (FEMS Yeast Res 5(2004):179-89), yeast cells containing the promoter PCTA1 and its (scanning) variants were cultured in buffered minimal medium with 1% glucose as carbon source at 28°C and 320 rpm for 60 hours, followed by methanol induction in 0.5% MeOH for 38 hours.

[0110] Cultivation of yeast cells containing promoter PDH and its (scanning) variants was carried out in buffered minimal medium with 1% glycerol as carbon source at 28°C and 320 rpm for 48 h, followed by a glycerol pulse to 0.25% for 96 h.

[0111] In the table below, the ODs are shown in relation to the RFUs obtained by using the original promoter sequences. 600 Derepressed and induced activities of the variants given by RFU normalized to .times. ...

[0112] [Table 1]

[0113] SEQ ID NO:25: TAATCGAACTCCGAATGCGGTTCTCCTGTAACCTTAATTGTAGCATAGATCACTTAAATAAACTCATGGCCTGACATCTGTACACGTTTCTTATTGGTCTTTTAGCAATCTTGAAGTCTTTCTATT GTTCCGGTCGGCATTACCTAATAAATTCGAATCGAGATTGCTAGTACCTGATATCATATGAAGTAATCATCACATGCAAGTTCCATGATACCCTCTACTAATGGAATTGAACAAAGTTTAAGCTT CTCGCACGAGACCGAATCCATACTATGCACCCCTCAAAGTTGGGATTAGTCAGGAAAGCTGAGCAATTAACTTCCCTCGATTGGCCTGGACTTTTCGCTTAGCCTGCCGCAATCGGTAAGTTTCATTATCCCAGCGGGGTGATAGCCTCTGATAACCGTGAGGCCAAAATCATATATAAGCTGTAGACCCAGCACTTCAATTACTTGAAATTCACCATAACACTTGCTCTAGTCAAGACTTACAATTAAA

[0114] Table 1 clearly shows that the substitution variants according to the present invention have higher promoter activity than the original Komagataella phaffii PCTA1 promoter. From the measurements, it can also be seen that modifications within the preferred regions according to the present invention result in even higher promoter activity than those outside these regions. The changes under derepression conditions are higher than under induction conditions. In addition to these substitution variants, the PCTA1 promoter has also been modified by deleting putative TFBSs. For these variants, the changes in activity were not as pronounced as for the "scanning variants," as most of them showed fluorescence levels within 20% of the parent promoter. Only three variants reached higher values, approximately 140% to 180%, compared to the parent PCTA1 under derepression and induction conditions, respectively. The following variants: #1, #4, and #53. * could be used in a combinatorial approach together with "scanning variants" (see Table 2).

[0115] [Table 2] 53 * contains an additional randomly introduced A to T exchange at position 408.

[0116] SEQ ID NO:26: TGCGGTTCTCCTGTAACCTTAATTGTAGCATAGATCACTTAAATAAACTCATGGCCTGACATCTGTACACGTTCTTATTGGTCTTTTAGCAATCTTGAAGTCTTTCTATTGTTCCGGTCGGCATTACCTAATAAATTCGAATCGAGATTGCTAGTACCTGATATCATATGAAGTAATCATCACATGCAAGTTCCATGATACCCTCTACTAATGGAATTGAACAAAGTTTAAGCTTCTCGCAC GAGACCGAATCCATACTATGCACCCCTCAAAGTTGGGATTAGTCAGGAAAGCTGAGCAATTAACTTCCCTCGATTGGCCTGGACTTTTCGCTTAGCCTGCCGCAATCGGTAAGTTTCATTATCCCAGCGGGGTGATAGCCTCTGTTGCTCATCAGGCCAAAATCATATATAAGCTGTAGACCCAGCACTTCAATTACTTGAAATTCACCATAACACTTGCTCTAGTCAAGACTTACAATTAAA

[0117] SEQ ID NO:27: TAATCGAACTCCGAATGCGGTTCTCCTTAGCATAGATCACTTAAATAAACTCATGGCCTGACATCTGTACACGTTCTTATTGGTCTTTTTAGCAATCTTGAAGTCTTTCTATTGTTCCGGTCGGCATCACCTAATAAATTCGAATCGAGATTGCTAGTACCTGATATCATATGAAGTAATCATCACATGCAAGTTCCATGATACCCTCTACTAATGGAATTGAACAAAGTTTAAGCTTCTCGCA CGAGACCGAATCCATACTATGCACCCCTCAAAGTTGGGGATTAGTCAGGAAAGCTGAGCAATTAACTTCCCTCGATTGGCCTGGACTTTTCGCTTAGCCTGCCGCAATCGGTAAGTTTCCATTATCCAGCGGGGTGATAGCCTCTGTTGCTCATCAGGCCAAAATCATATATAAGCTGTAGACCCAGCACTTCATTACTTGAAATTCACCATAACACTTGCTCTAGTCAAGACTTACAATTAAA

[0118] sequence number 28: TAATCGAACTCCGAATGCGGTTCTCCTGTAACCTTAATTGTAGCATAGTCACTTAAATAAACTCATGGCCTGACATCTGTACACGTTCTTATTGGTCTTTTTAGCAATCTTGAAGTCTTCTATTGTTCCGGTCGGCATTAACTAATAAATTCGAATCGAGATTGCTAGTACCTGATATCATATGAAGTAATCATCACATGCAAGTTCCATGATACCCTCTACTAATGGAATTGAACAA AGTTTAAGCTTCTCGCACGAGACCGAATCCATACTATGCACCCCTCAAAGTTGGGGATTAGTCAGGAAAGCTGAGCAATTAACTTCCCTCGATTGGCCTGGACTTTTCGCTTAGCCTGCCGCAATCGGTAAGTTTCATTATCCCAGCGGGGTGATAGCCTCTGTTGCTCTTCAGGCCAAAATCATATAATAAGCTGTAGACCCAGCACTTAACACTTGCTCTAGTCCAAGACTTACAATTAAA

[0119] sequence number 29: TAATCGAACTCCGAATGCGGTTCTCCTGTAACCTTAATTGTAGCATAGATCACTTAAATAAACTCATGGCCTGACATCTGTACACGTTTAGCAATCTTGAAGTCTTTCTATTGTTCCGGTCGGTTACCTAATAAATTCGAATCGAGTTGCTAGTACCTGTATCATATGAAGTAATCATCACATGCAAGTTCCATGATACCCTCTACTAATGGAATTGAACAAAGTTTAAGCTTCTCGCACG AGACCGAATCCATACTATGCACCCCTCAAAGTTGGGATTAGTCAGGAAAGCTGAGCAATTAACTTCCCTCGATTGGCCTGGACTTTTCGCTTAGCCTGCCGCAATCGGTAAGTTTCATTATCCCAGCGGGGTGATAGCCTCTGTTGCTCATCAGGCCAAAATCATATATAAGCTGTAGACCCAGCACTTCAATTACTTGAAATTCACCATAACACTTGCTCTAGTCAAGACTTACAATTAAA

[0120] The results obtained by screening substitution variants using the HSP12 promoter PDH are shown in Table 3.

[0121] [Table 3]

[0122] SEQ ID NO:30: CTTCAGTAAGAGAAGGAAGCTTGGTGACGATCACAGCTATGATAACCGTGAAATTGCTAAGCAATTGTGAGGTGTGATGTATTTTGCAGAGCAATTGTGCGGTACAACGGGGTGTTATTGTCTTCACAAGGCATTTATTGCGAATTTCGTAGTTGAAAGAATATTTTAGCACAGGG TGCTTGACCCCTATTGTTGCTCGCTAAACCATGATTGCTAAATGATGACATAGCAATCACTTTACTAAGATTGCTATAAGGACACCTTTCTTAGTATAAATGGACACTCTTTTCCCCTGCTAAACTTCTTTTATTTTTCACACTTAAACAGTTACAAAACACAAACACAACTAGAA

[0123] SEQ ID NO:31: CTTCAGTAAGAGAAGGAAGCTTGGTGACGATCACAGCTATGATGTAATAGAAATTGCTAAGCAATTGTGAGGTGTGATGTATTTTGCAGAGCAATTGTGCGGTACAACGGGGTGTTATTGTCTTCACAAGGCATTTATTGCGAATTTCGTAGTTGAAAGAATATTTTAGCACAGGG TAAATGACCCCTATTGTTGCTCGCTAAACCATGATTGCTAAATGATGACATAGCAATCACTTTACTAAGATTGCTATAAGGACACCTTTCTTAGTATAAATGGACACTCTTTTCCCCTGCTAAACTTCTTTTATTTTTCACACTTAAACAGTTACAAAACACAAACACAACTAGAA

[0124] From Table 3 it can be seen that the single mutation variants according to the invention using SEQ ID NO: 4 [PDH] also result in higher promoter activity than the original promoter sequence. Again, higher activity can be achieved if the mutations are made within preferred regions.

[0125] Example 2: Effect of multiple mutations on expression under derepressing conditions Multiple mutant variants were generated as described above, using the catalase promoter SEQ ID NO:3 [PCTA1]. Cultivation was carried out at 28°C, 320 rpm for 60 hours using 1% glucose as the carbon source for the double and triple mutant variants, and at 28°C, 320 rpm for 60 hours using 0.5% glucose as the carbon source for the quadruple and sextuple mutant variants.

[0126] Cultures using the heat shock protein promoter SEQ ID NO: 4 [PDH] were grown at 28°C, 320 rpm with 1% glycerol as the carbon source for 48 hours, followed by a glycerol pulse to 0.25% for 94 hours.

[0127] OD for the original promoter sequence 600 The activity of the variants, given in RFU normalized to , is shown in the table below.

[0128] [Table 4]

[0129] SEQ ID NO:32: TAATCGAACTCCGAATGCGGTTCTCCTGTAACCTTAATTGTAGCATAGATCACTTAAATAAACTCATGGCCTGACATCTGTACACGTTTCTTATTGGTCTTTTAGCAATCTTGAAGTCTTTCTATT GTTCCGGTCGGCATTACCTAATAAATTCGAATCGAGATTGCTAGTACCTGATATCATATGAAGTAATCATCACATGCAAGTTCCATGATACCCTCTACTAATGGAATTGAACAAAGTTTAAGCTT CTCGCACGAGACCGAATCCATACTATGCACCCCTCAAAGTTGGGATTAGTCAGGAAAGCTGAGCAATTAACTTCCCTCGATTGGCCTGGACTTTTCGCTTAGCCTGCCGCAATCGGTAAGGATAACCGTGCCAGCGGGGTGATAGCCTCTGATAACCGTGAGGCCAAAATCATATATAAGCTGTAGACCCAGCACTTCAATTACTTGAAATTCACCATAAGATAACCGTGAGTCAAGACTTACAATTAAA

[0130] Table 4 shows that the multiple mutation variants have higher promoter activity than the original promoter. Generally, multiple mutations result in higher expression than single mutations. For single mutation variants, the change in eGFP expression is greater under derepression conditions.

[0131] [Table 5]

[0132] From Table 5, it can be inferred that multiple mutations according to the present invention result in even higher expression / promoter activity than the original promoter. Multiple mutations increase activity even more than single mutations. Changes in expression activity can be observed, especially under derepression conditions. Even higher expression activity can be achieved when the promoter sequence is modified multiple times, especially at preferred positions.

[0133] Further experiments were carried out to analyze the expression activity using Candida antarctica lipase (CalB), human growth hormone (HGH), or peroxygenase as secreted model proteins. The results were consistent with those of experiments carried out using eGFP, and similar expression activity was found for these proteins.

[0134] Example 3: Scale-up of promoter variants with the secreted model protein CalB The performance of two promoter variants from Example 2 was evaluated in medium-scale culture using shake flasks. The promoter variants tested had SEQ ID NO: 12 [1A, 14B, 26B] and SEQ ID NO: 11 [14B, 26B, 48B]. In the following, SEQ ID NO: 12 [1A, 14B, 26B] is designated #19, and SEQ ID NO: 11 [14B, 26B, 48B] is designated #26. As controls, the parent Komagataella phaffii catalase promoter and a negative control were included. One average-functioning strain was selected as a representative for each promoter.

[0135] Cultures were run in two ways: once with 0.5% BMD and methanol induction, and once with 0.5% BMG and a glycerol feed disc to establish a derepressed state. Cultures were run in biological replicates, and samples were taken after 4, 17, 24, 42, and 65 hours. The process was monitored online using an SFR vario system (PreSens Precision Sensing GmbH, Regensburg, Germany), allowing for methanol induction and the addition of a feed disc when the initial carbon source was depleted after 20 hours. For each time point, enzyme activity was set relative to the respective value of the parent promoter.

[0136] Only the supernatants from sampling points after 24 hours showed lipase activity, after which lipase activity could not be measured.

[0137] The activity measurements are listed in the table below. Volume units are normalized to wild type and plotted against variant.

[0138] [Table 6]

[0139] As can be seen from the table above, both variants perform better in mesoscale cultures than in microscale cultures under both culture conditions.

[0140] Example 4: Determining expression levels of multiple mutation variants using qPCR Mutant variant #19 from Example 3 was further characterized for its expression level using qPCR (Abad S et al. Biotechnol J 5(2010):413-20). To do so, cell material was harvested at different time points (16, 20, 22, 44, 46, and 68 hours) of shake flask culture, lipase activity was determined, and RNA was isolated and used for qPCR. Relative changes in gene expression were calculated for the analyzed P. pastoris reporter strains using the comparative ΔΔCT method. Results were normalized to an internal reference gene (housekeeping gene) and presented as the fold change in gene expression compared to the untreated control (calibrator). ACT1 was used as a housekeeping gene to normalize the amount of target RNA input and as the calibrator variant #19 after 16 hours.

[0141] Figure 1 shows lipase activity (A) and fold change in the target gene (CalB) (B) for variant #19, the original promoter, and the reference promoter PDF (Vogl et al. MB Expr 10(2020):38) (HpFMD promoter fragment) using two different cultivation strategies: MeOH induction and derepression with glycerol-feeding beads.

[0142] Lipase activity measurements (11A) validate the previously observed performance of variant #19. Under methanol induction conditions, variant #19 showed higher activity than the native promoter and the PDF promoter. For long-term derepression using glycerol-fed beads, variant #19 and PDF performed equally well.

[0143] Under derepression conditions, glycerol variant #19 exhibits slightly higher amounts of RNA compared to PDF. After 68 hours, the highest overall fold change can be seen for variant #19, suggesting that potentially even higher CalB activity than determined after 68 hours can be achieved in further experiments.

[0144] Example 5: Promoter engineering using Myceliophthora thermophila ATCC42464 Filamentous fungi can be used as industrial protein production hosts for heterologous and homologous protein production. Myceliophthora thermophila is a thermophilic fungus that is often used to produce thermostable enzymes. The high secretion rate of proteins makes it an interesting expression host for biotechnological applications.

[0145] Efficient protein expression depends on several factors, including regulatory sequences such as promoters, which have a significant effect on expression levels. Therefore, promoter manipulation can be an effective tool to positively influence gene expression levels and increase protein titers. For M. thermophila, various constitutive promoters have been published, including the pyruvate decarboxylase-like gene P. PDC (MYCTH_112121, gene ID: 11511210) was selected as a target for promoter engineering to identify potential regulatory regions and generate optimized promoter variants.

[0146] Materials and Methods Cloning Twenty-nine different promoter variants were synthesized and cloned into M. thermophila vectors. The HspUPO gene from Hypoxylon sp. EC38 (UPO: nonspecific peroxygenase) was used as a reporter. The plasmids consisted of a codon-optimized HspUPO gene with an N-terminal fusion signal peptide, MYCTH_66729, to facilitate secretion. All plasmids contained an ampicillin resistance gene (bla) for selection in Escherichia coli and a hygromycin resistance gene (hph) for selection in M. thermophila. Ampicillin resistance gene expression was driven by promoter P_EM72, and the hph gene was under the control of the elongation factor 1-alpha promoter derived from the M. thermophila genome. The HspUPO gene was under the control of different constitutive PDC promoter variants. The PDC terminator was used as the HspUPO gene terminator. The Cellobiohydrales II terminator was used as the terminator for the hph gene (MYCTH_51545). The plasmid was linearized and used for transformation with the wild-type strain M. thermophila ATCC42464.

[0147] Protoplast-mediated transformation protocol The protocol was adapted from Gruber et al. (Current Genetics, Springer Verlag 71-76 (1990)). 8Spores were used to inoculate 50 mL of potato dextrose medium, incubated at 50°C, and shaken overnight at 110 rpm to obtain mycelium. The next day, the approach was filtered through a layer of Miracloth, and the mycelium was washed with cold Solution A. For 1 g of mycelium, 0.5 g of lytic enzyme was added to 10 mL of Solution A, dissolved, and the lytic enzyme solution was filter-sterilized. The lytic enzyme solution was added to the mycelium in the Petri dish, mixed well, and incubated at 37°C for 1 to 5 hours. After 90 minutes to 5 hours, the efficiency of protoplast formation was checked under a microscope. Once sufficient protoplasts were present, the suspension was pipetted using a cut tip to remove large mycelial debris. The protoplasts were filtered through a layer of Miracloth into a 50 mL tube on ice and rinsed with cold Solution A. After centrifugation in a swing-out rotor at 600 g for 10 min at 4°C, the supernatant was carefully decanted and the pelleted protoplasts were resuspended in 4 mL of cold solution B. The protoplasts were centrifuged again, the supernatant was decanted, and the protoplasts were resuspended in 600 μL of solution B.

[0148] For transformation, the following components were combined in a 15 mL tube: 10 μL of purified DNA fragment (must be linearized), approximately 1-10 μg DNA used 200 μL of protoplast suspension 50 μL of PEG

[0149] The tube was gently mixed by tapping and incubated on ice for 20 minutes. 2 mL of PEG was then added, and it was again incubated at room temperature for 5 minutes. 4 mL of solution B was added. 2 mL of the solution was added to 10 mL of preheated overlay medium, briefly mixed by pipetting up and down, and poured onto a 145 mm bottom medium plate. Three plates were required per transformation (three times 2 mL of solution combined with 10 mL of overlay medium). The plates were incubated at 37°C for 4-5 days. Transformants were counted, transferred to small selective plates, and grown at 37°C for 3-5 days until sporulation.

[0150] Isolation of single spores Using a drop of spore solution, several spores from the transformants were harvested from the plate and spread onto MEX-Triton agar plates to obtain colonies from single spores. The plates were incubated at 37°C for 2 days. Single colonies were then excised, transferred to new, small selective plates, and grown again for 3–5 days until sporulation occurred. These steps were repeated three times before further analysis was initiated.

[0151] Three rounds of single spore isolation were performed on 23 transformants per variant, and the variants with the highest activity during the initial culture (1, 3, 7, 15, 29, 31, 37, 47, 55, 57, and the PDC original sequence) were cultured and their UPO activity was determined.

[0152] Culture in 24-well plates For culture in sterile 24-well plates, add 10 cells to 2.5 mL of medium per well. 6 Spores were inoculated. Cultivation was carried out at 40°C and 110 rpm for approximately 75 hours. At the end of the cultivation, the supernatant was collected and stored at -20°C. For each variant, approximately 23 transformants were analyzed.

[0153] Measurement of UPO activity - ABTS assay All activity assays were performed in 96-well crystal clear flat-bottom microplates with supernatant already spotted onto the plate. Assay solutions were always freshly prepared in 50 mL Falcon tubes and kept on ice. H2O2 was used to initiate the reaction using a Picus electronic 8-channel 50-1200 μL pipette. Immediately after applying the reaction mixture, the plate was measured at room temperature. All plates were orbitally shaken for 30 seconds before the first measurement. The volumetric initial rate activity, V, was calculated using the slope of the linear increase. 平均 was calculated in milliabsorbance units / mL (mAU / mL). A minimum of six data points in the linear range of the reaction was used to calculate the initial rate activity (slope, mAU / min).

[0154] The ABTS (2,2-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid) assay solution for approximately 96 reactions was freshly prepared as follows: 1 mL of 20x ABTS stock solution (16 mM) in sodium acetate buffer (50 mM, pH 4.5), 19 mL of sodium citrate buffer (0.2 M, pH 4.5), and 6 µL of HO (3% w / w). Then, 140 µL of ABTS solution was added to 15 µL of culture supernatant. The absorbance was measured at a wavelength of 405 nm for 10 min.

[0155] medium Solution A 0.1M KH2PO4 and 1.2M sorbitol Dissolve 1.261 g KH2PO4 and 21.864 g sorbitol in 100 mL dH2O. Adjust to pH 5.6 (diluted KOH). Autoclave and store at room temperature.

[0156] Solution B 50 mM CaCl2·2H2O, 1 M sorbitol, 10 mM Tris HCl pH 7.5 Dissolve 0.735 g of CaCl 2H O and 18.22 g of sorbitol in 99 mL of dH O. Add 1 mL of 1 M Tris HCl pH 7.5. Adjust to pH 7.5. (HCl), autoclave, and store at room temperature.

[0157] PEG 25% PEG, 50mM CaCl2·2H2O, 10mM Tris HCl pH7.5 Dissolve 12.5 g of PEG and 0.368 g of CaCl 2H O in 40 mL of dH O and add 500 μL of 1 M Tris HCl pH 7.5. Fill to 50 mL with dH O. Autoclave and store at room temperature.

[0158] bottom medium 3% malt extract (MEX), 2% agar, 1M sorbitol, hygromycin Dissolve 30 g of MEX, 20 g of agar, and 180 g of sorbitol in 1 L of TAP water, autoclave, and add the selective reagent after autoclaving, pouring as thinly as possible.

[0159] Overlay Media 3% malt extract (MEX), 2% agarose, 1M sorbitol, hygromycin Dissolve 30 g of MEX, 20 g of agarose, and 182.2 g of sorbitol in 1 L of TAP water, autoclave, and add the selection reagent after autoclaving, pouring as thinly as possible.

[0160] MEX agar plates 3% malt extract (MEX), 2% agar, hygromycin Dissolve 30g of MEX and 20g of agar in 1L of TAP water. Autoclave, then add the selectin reagent and pour in.

[0161] MEX-Triton agar plates 3% malt extract (MEX), 2% agar, 0.1% Triton X-100, hygromycin 30 g of MEX, 20 g of agar and 1 g of Triton X-100 are dissolved in 1 L of TAP water, autoclaved, and then the selection reagent is added and poured.

[0162] Spore solution 0.8% NaCl, 0.05% Tween 80 Dissolve 0.4 g of NaCl in 50 mL of dH2O, add 25 μL of Tween 80, filter sterilize, and store at room temperature.

[0163] Promoter manipulation approach P PDC A sequence library was established using the following 10-bp-long sequence: 5'-GATAACCGTG-3'. First, bp 1-10 were replaced with this sequence to generate variant 1 (V1), then bp 21-30 were replaced with this sequence to generate variant 3 (V3), and so on for all promoter sequences, resulting in 29 different promoter variants.

[0164] P PDC Variant screening was performed using a nonspecific peroxygenase, HspUPO from Hypoxylon species EC38, as a reporter. Promoter activity was determined by a colorimetric assay using 2,2-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) as a substrate. PDC Using the original sequence of as a benchmark and control, the above-mentioned method was applied to find improved promoter sequences.

[0165] A total of two rounds of screening were performed. In the first round, five transformants per variant were cultured, and the supernatants were collected for enzyme activity assays. These transformants were then subjected to a single spore isolation (SSI).

[0166] In the second screening, approximately 23 transformants per variant were cultured and analyzed. Three rounds of single spore isolation were performed on these transformants to minimize the possibility of using a combination of spores instead of a single spore. In the second culture, the original P PDC Promoter variants with increased enzymatic activity compared to the sequence were screened.

[0167] First Screening - SSI1 The highest enzymatic activity was determined for variants 7, 47, 37 and 1, where expression was up to two-fold higher than the original promoter PDC.

[0168] Second Screening - SSI3 In the second screening, the best 10 variants from the first screening were re-cultured and ABTS activity was determined. Approximately 23 transformants per variant were cultured after three rounds of single spore isolation. For variant 1, only five transformants were analyzed because only these transformants had the ability to regrow on selective medium after two rounds of transformation.

[0169] The results of the second culture are shown in Figure 3. The highest enzyme activity was achieved for PDC variants 1 (SEQ ID NO:35) and 47 (SEQ ID NO:34), which increased three-fold compared to the original PDC sequence (SEQ ID NO:33). Variants 3 (SEQ ID NO:36) and 15 (SEQ ID NO:37) showed a two-fold increase, and the activity of variants 31 (SEQ ID NO:40), 37 (SEQ ID NO:39), and 29 (SEQ ID NO:38) as well as variants 7 (SEQ ID NO:41) and 57 (SEQ ID NO:42) increased compared to the original sequence.

[0170] The result is a P PDC We show that some sequence variants of PDC appear to have a positive effect on promoter activity. These novel sequence variants exhibit activity that is as high as, or even 2-3 times higher than, the original PDC sequence.

Claims

1. 1. A method for modifying a promoter to obtain a promoter variant, comprising: a. providing a promoter; b. The promoter -GATAX １ X ２ X ３ X ４ X ５ X ６ (X ７ ) ｍ , ATCCTTTTAG (SEQ ID NO: 1), and AAA, by inserting into the promoter at least one nucleic acid sequence selected from the group consisting of: - GATAX by substituting nucleotides in the promoter sequence １ X ２ X ３ X ４ X ５ X ６ (X ７ ) ｍ , ATCCTTTTAG (SEQ ID NO: 1), and AAA by inserting at least one nucleic acid sequence selected from the group consisting of: X １ , X ２ , X ３ , X ４ , X ５ , X ６ , and X ７ is independently a nucleotide selected from the group consisting of A, C, G, and T, and m is an integer from 0 to 10.

2. X １ is A and X ２ is C and X ３ is C and X ４ is G and X ５ is T and X ６ The method of claim 1 , wherein

3. 3. The method of claim 1 or 2, wherein the at least one nucleic acid sequence consists of GATAACCGTG (SEQ ID NO: 2).

4. The method according to any one of claims 1 to 3, wherein the promoter is a eukaryotic promoter, preferably a fungal promoter, more preferably a yeast promoter, more preferably a methylotrophic yeast promoter.

5. 5. The method of any one of claims 1 to 4, wherein the promoter comprises or consists of a nucleic acid sequence having at least 80% identity, preferably at least 90% identity, more preferably at least 95% identity to SEQ ID NO:3, SEQ ID NO:4 or SEQ ID NO:

33.

6. 6. The method of claim 5, wherein the promoter comprising or consisting of a nucleic acid sequence having at least 80% identity to SEQ ID NO:3 is modified in at least one promoter region selected from the group consisting of positions 1 to 20, 131 to 150, 251 to 270, 371 to 390, 401 to 410 and 461 to 480 of SEQ ID NO:

3.

7. The promoter comprises or consists of a nucleic acid sequence having at least 80% identity to SEQ ID NO:3, and is modified in at least one promoter region selected from the group consisting of positions 1 to 10, 131 to 140, 251 to 260, 371 to 380, 401 to 410, and 471 to 480 of SEQ ID NO:3, wherein positions 1 to 10 of SEQ ID NO:3 are preferably modified with ATCCTTTTAG (SEQ ID NO:1), and positions 131 to 140, 251 to 260, 371 to 380, 401 to 410, and 471 to 480 of SEQ ID NO:3 are preferably modified with GATAX. １ X ２ X ３ X ４ X ５ X ６ (X ７ ) ｍ The method of claim 5 or 6, wherein the compound is modified with

8. The promoter comprises or consists of a nucleic acid sequence having at least 80% identity to SEQ ID NO: 3, and is selected from the group consisting of positions 1 to 10, 131 to 140 and 251 to 260, or positions 131 to 140, 251 to 260 and 401 to 410, or positions 131 to 140, 251 to 260 and 471 to 480, or positions 1 to 10, 131 to 140, 251 to 260 and 371 to 380, or positions 1 to 10, 131 to 140, 251 to 260 and 371 to 380. The method according to any one of claims 5 to 7, wherein the amino acid sequence is modified at positions 1 to 260 and 471 to 480, or at positions 1 to 10, 131 to 140, 251 to 260, 371 to 380, 401 to 410 and 471 to 480 of SEQ ID NO:3, preferably at positions 1 to 10, 131 to 140 and 251 to 260 or at positions 1 to 10, 131 to 140, 251 to 260, 371 to 380, 401 to 410 and 471 to 480 of SEQ ID NO:

3.

9. 9. The method of any one of claims 5 to 8, wherein the promoter comprising or consisting of a nucleic acid sequence having at least 80% identity to SEQ ID NO: 3 has one or more, preferably all, nucleotides within positions 89 to 101, 137, 138, 162, 176 and / or 448 to 468 deleted.

10. 6. The method of claim 5, wherein the promoter comprising or consisting of a nucleic acid sequence having at least 80% identity to SEQ ID NO: 4 is modified in at least one promoter region selected from the group consisting of positions 1 to 20, 151 to 170, preferably 161 to 170, and 171 to 190, preferably 171 to 180.

11. 11. The method of claim 5 or 10, wherein the promoter comprising or consisting of a nucleic acid sequence having at least 80% identity to SEQ ID NO: 4 is modified at positions 161 to 170 and 171 to 180, or at positions 11 to 20, 161 to 170 and 171 to 180.

12. 12. The method of claim 5, 10 or 11, wherein the promoter comprising or consisting of a nucleic acid sequence having at least 80% identity to SEQ ID NO:4 is modified with a nucleic acid AAA within at least one promoter region selected from the group consisting of positions 37-39, 103-105, 109-111, 178-180, 235-237 and 349-351 of SEQ ID NO:

4.

13. 6. The method of claim 5, wherein the promoter comprising or consisting of a nucleic acid sequence having at least 80% identity to SEQ ID NO: 33 is modified in at least one promoter region selected from the group consisting of positions 1 to 10, 21 to 30, 141 to 150, 461 to 470, 61 to 70, 281 to 290, 361 to 370, 301 to 310 and 561 to 570 of SEQ ID NO: 33, preferably within positions 1 to 10 and / or 461 to 470 of SEQ ID NO:

33.

14. The promoter comprises or consists of a nucleic acid sequence having at least 80% identity to SEQ ID NO: 33, １ X ２ X ３ X ４ X ５ X ６ (X ７ ) ｍ The method of claim 13, wherein the compound is modified with

15. A promoter variant obtainable by the method according to any one of claims 1 to 14.

16. 16. The promoter variant of claim 15, wherein the promoter variant comprises or consists of a nucleic acid sequence selected from the group of: SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41 and SEQ ID NO:

42.

17. A nucleic acid molecule or vector comprising the promoter variant of claim 15 or 16.

18. 18. The nucleic acid molecule or vector of claim 17, wherein the promoter variant is operably linked to a nucleic acid sequence encoding a polypeptide or protein.

19. A host cell comprising the nucleic acid molecule or promoter variant according to any one of claims 15 to 18.

20. 20. The host cell of claim 19, wherein the host cell is a fungal cell, preferably from the phylum Ascomycota, more preferably from the genus Komagataella or Myceliophthora, more preferably a Komagataella phaffii or Myceliophthora thermophila cell.

21. 21. A method for producing a polypeptide or protein, comprising culturing a host cell according to claim 19 or 20.

Images