Compositions and methods for treating retinitis pigmentosa

Abstract

Among other things, the present disclosure provides compositions, e.g., isolated nucleic acids, vectors, and recombinant adeno-associated viruses (rAAVs), comprising a nucleic acid sequence encoding a PRPF31 polypeptide. In some embodiments, the present disclosure provides methods for increasing PRPF31 expression, e.g., in a subject. In some embodiments, the present disclosure provides methods for treating retinal degeneration in a subject. In some embodiments, the present disclosure provides methods for treating retinitis pigmentosa (RP) in a subject.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to U.S. Provisional Patent Application No. 63 / 418,263, filed October 21, 2022, the entire contents of which are incorporated herein by reference. [Background technology]

[0002] Retinitis pigmentosa (RP) is a degenerative genetic disease affecting retinal cells. It is characterized by a decrease or loss of vision. Early symptoms of RP include impaired vision in low-light environments, such as impaired night vision. Progression can include loss of peripheral vision, followed by central vision, and then complete blindness. Mutations in PRPF31 have been reported to play a causative role in some cases of retinal degeneration, such as retinitis pigmentosa. Currently, there is no approved treatment for retinitis pigmentosa associated with mutant PRPF31, and therefore, there is a need for a therapy to treat PRPF31-associated retinal degeneration. Summary of the Invention [Means for solving the problem]

[0003] Among other things, the present disclosure provides techniques (e.g., any one or more of isolated nucleic acids, vectors, recombinant adeno-associated viruses (rAAVs), compositions thereof, or methods thereof) for the treatment or prevention of various diseases, disorders, or conditions, among others. In some embodiments, the disease, disorder, or condition is associated with PRPF31. In some embodiments, the disease, disorder, or condition is associated with mutant PRPF31. In some embodiments, the present disclosure provides an isolated nucleic acid, vector, or rAAV comprising a nucleic acid sequence encoding a PRPF31 polypeptide. In some embodiments, the PRPF31 polypeptide is a wild-type PRPF31 polypeptide. In some embodiments, the provided techniques can increase the level of PRPF31 transcripts and / or polypeptides in a system or a subject. In some embodiments, the present disclosure provides methods of increasing expression of PRPF31 in a system or a subject. In some embodiments, the present disclosure provides methods of treating a subject susceptible to or suffering from a disease, disorder, or condition.

[0004] In some aspects, the disclosure provides isolated nucleic acids. In some embodiments, the isolated nucleic acids comprise: (i) an adeno-associated virus (AAV) 5' inverted terminal repeat (ITR); (ii) a promoter, (iii) a nucleic acid sequence encoding a PRPF31 polypeptide, and (iv) an adeno-associated virus (AAV) 3' inverted terminal repeat (ITR). In some embodiments, the isolated nucleic acid comprises (i) an adeno-associated virus (AAV) 5' inverted terminal repeat (ITR), (ii) a promoter, (iii) a nucleic acid sequence encoding a PRPF31 polypeptide, (iv) a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), and (v) containing the adeno-associated virus (AAV) 3' inverted terminal repeat (ITR).

[0005] In some embodiments, the PRPF31 polypeptide is a wild-type (WT) polypeptide. In some embodiments, the nucleic acid sequence described herein encodes a WTPRPF31 polypeptide. In some embodiments, the nucleic acid sequence encoding the PRPF31 polypeptide is the nucleic acid sequence of SEQ ID NO: 1, or comprises a portion thereof.

[0006] In some embodiments, the promoter comprises a human cytomegalovirus (CMV) enhancer or a portion thereof, a chicken beta-actin (CBA) promoter or a portion thereof, a human ubiquitin C (UbC) enhancer or a portion thereof, a splice donor, a splice acceptor, or a combination thereof. In some embodiments, the promoter comprises a human CMV enhancer or a portion thereof. In some embodiments, the promoter comprises a CBA promoter or a portion thereof. In some embodiments, the promoter comprises a human UbC enhancer or a portion thereof. In some embodiments, the promoter comprises a splice donor. In some embodiments, the promoter comprises a splice acceptor. In some embodiments, the promoter comprises a splice donor and a splice acceptor. In some embodiments, the promoter comprises the nucleic acid sequence of SEQ ID NO:4.

[0007] In some embodiments, the 5' ITR is or comprises the AAV2 5' ITR and / or the 3' ITR is or comprises the AAV2 3' ITR. In some embodiments, the 5' ITR is or comprises the AAV2 5' ITR. In some embodiments, the 3' ITR is or comprises the AAV2 3' ITR. In some embodiments, the 5' ITR is or comprises the nucleic acid sequence of SEQ ID NO:2. In some embodiments, the 3' ITR is or comprises the nucleic acid sequence of SEQ ID NO:3.

[0008] In some embodiments, the WPRE is or comprises the nucleic acid sequence of SEQ ID NO:5.

[0009] In some embodiments, the isolated nucleic acid comprises a 3' untranslated region (UTR) element. In some embodiments, the 3' UTR element comprises a polyadenylation signal. In some embodiments, the polyadenylation signal comprises a human growth hormone (hGH) polyadenylation signal. In some embodiments, the polyadenylation signal comprises a beta globin polyadenylation signal. In some embodiments, the polyadenylation signal comprises a human beta globin polyadenylation signal. In some embodiments, the polyadenylation signal is or comprises the nucleic acid sequence of SEQ ID NO:6.

[0010] In some embodiments, the isolated nucleic acid is or comprises the nucleic acid sequence of SEQ ID NO:7.

[0011] In some aspects, the present disclosure provides a vector. In some embodiments, the vector comprises an isolated nucleic acid described herein. In some embodiments, the vector is a viral vector. In some embodiments, the vector is a recombinant adeno-associated virus (rAAV).

[0012] In another aspect, the present disclosure provides a recombinant adeno-associated virus (rAAV). In some embodiments, the rAAV comprises (i) a capsid and (ii) an isolated nucleic acid described herein or a vector described herein. In some embodiments, the rAAV comprises (i) a capsid and (ii) an isolated nucleic acid described herein. In some embodiments, the rAAV comprises (i) a capsid and (ii) a vector described herein. In some embodiments, the capsid is AAV2.

[0013] In another aspect, the present disclosure provides pharmaceutical compositions. In some embodiments, the pharmaceutical composition comprises an isolated nucleic acid described herein, a vector described herein, or an rAAV described herein. In some embodiments, the pharmaceutical composition comprises an isolated nucleic acid described herein. In some embodiments, the pharmaceutical composition comprises a vector described herein. In some embodiments, the pharmaceutical composition comprises an rAAV described herein. In some embodiments, the pharmaceutical composition comprises (i) an isolated nucleic acid described herein, a vector described herein, or an rAAV described herein, and (ii) a pharmaceutically acceptable carrier or excipient. In some embodiments, the pharmaceutical composition comprises (i) an isolated nucleic acid described herein, and (ii) a pharmaceutically acceptable carrier or excipient. In some embodiments, the pharmaceutical composition comprises (i) a vector described herein, and (ii) a pharmaceutically acceptable carrier or excipient. In some embodiments, the pharmaceutical composition comprises (i) a vector described herein, and (ii) a pharmaceutically acceptable carrier or excipient. In some embodiments, the pharmaceutical composition comprises (i) an rAAV described herein, and (ii) a pharmaceutically acceptable carrier or excipient.

[0014] In another aspect, the present disclosure provides a cell. In some embodiments, the cell comprises an isolated nucleic acid described herein, a vector described herein, or an rAAV described herein. In some embodiments, the cell comprises an isolated nucleic acid described herein. In some embodiments, the cell comprises a vector described herein. In some embodiments, the cell comprises an rAAV described herein. In some embodiments, the cell is a host cell. In some embodiments, the cell is an isolated cell.

[0015] In another aspect, the present disclosure provides methods for increasing PRPF31 expression in a subject. In some embodiments, the method for increasing PRPF31 expression in a subject comprises administering to the subject an isolated nucleic acid described herein, a vector described herein, an rAAV described herein, or a pharmaceutical composition described herein. In some embodiments, the method for increasing PRPF31 expression in a subject comprises administering to the subject an isolated nucleic acid described herein. In some embodiments, the method for increasing PRPF31 expression in a subject comprises administering to the subject a vector described herein. In some embodiments, the method for increasing PRPF31 expression in a subject comprises administering to the subject an rAAV described herein. In some embodiments, the method for increasing PRPF31 expression in a subject comprises administering to the subject a pharmaceutical composition described herein. In some embodiments, the method for increasing PRPF31 expression in a subject comprises administering to the subject a therapeutically effective amount of any of the isolated nucleic acids described herein, the vectors described herein, the rAAV described herein, or the pharmaceutical compositions described herein. In some embodiments, the method for increasing PRPF31 expression in a subject comprises administering to the subject a therapeutically effective amount of the isolated nucleic acid described herein. In some embodiments, a method for increasing PRPF31 expression in a subject comprises administering to the subject a therapeutically effective amount of a vector described herein. In some embodiments, a method for increasing PRPF31 expression in a subject comprises administering to the subject a therapeutically effective amount of an rAAV described herein. In some embodiments, a method for increasing PRPF31 expression in a subject comprises administering to the subject a therapeutically effective amount of a pharmaceutical composition described herein.

[0016] In some embodiments, the subject is susceptible to or suffers from a disease, disorder, or condition. In some embodiments, the disease, disorder, or condition is retinal degeneration. In some embodiments, the disease, disorder, or condition is retinitis pigmentosa. In some embodiments, the disease, disorder, or condition is retinitis pigmentosa-11 (RP11). In some embodiments, the subject has a mutation in one or both of the PRPF31 genes.

[0017] In some embodiments, the subject is an animal. In some embodiments, the subject is a mammal. In some embodiments, the subject is a mouse. In some embodiments, the subject is a rat. In some embodiments, the subject is a non-human mammal. In some embodiments, the subject is a monkey. In some embodiments, the subject is a human.

[0018] In some embodiments, the isolated nucleic acid, vector, rAAV, or pharmaceutical composition is administered by injection. In some embodiments, the isolated nucleic acid is administered by injection. In some embodiments, the vector is administered by injection. In some embodiments, the rAAV is administered by injection. In some embodiments, the pharmaceutical composition is administered by injection. In some embodiments, the isolated nucleic acid, vector, rAAV, or pharmaceutical composition is administered by subretinal injection. In some embodiments, the isolated nucleic acid is administered by subretinal injection. In some embodiments, the vector is administered by subretinal injection. In some embodiments, the rAAV is administered by subretinal injection. In some embodiments, the pharmaceutical composition is administered by subretinal injection.

[0019] In some embodiments, the vector, rAAV, or pharmaceutical composition is administered in an amount of about 10 per eye. 8 ~about 10 14 In some embodiments, the vector, rAAV, or pharmaceutical composition is administered at a dose in the range of about 10 vector genome copies (vg) per eye. 8 , about 109 , about 10 10 , about 10 11 , about 10 12 , about 10 13 , or about 10 14 In some embodiments, the vector, rAAV, or pharmaceutical composition is administered at a dose of about 10 vector genome copies (vg) per eye. 8 In some embodiments, the vector, rAAV, or pharmaceutical composition is administered at a dose of about 5x10 vg per eye. 8 In some embodiments, the vector, rAAV, or pharmaceutical composition is administered at a dose of about 10 vg per eye. 9 In some embodiments, the vector, rAAV, or pharmaceutical composition is administered at a dose of about 5x10 vg per eye. 9 In some embodiments, the vector, rAAV, or pharmaceutical composition is administered at a dose of about 10 vg per eye. 10 In some embodiments, the vector, rAAV, or pharmaceutical composition is administered at a dose of about 5x10 vg per eye. 10 In some embodiments, the vector, rAAV, or pharmaceutical composition is administered at a dose of about 10 vg per eye. 11 In some embodiments, the vector, rAAV, or pharmaceutical composition is administered at a dose of about 5x10 vg per eye. 11 In some embodiments, the vector, rAAV, or pharmaceutical composition is administered at a dose of about 10 vg per eye. 12 In some embodiments, the vector, rAAV, or pharmaceutical composition is administered at a dose of about 5x10 vg per eye. 12 It is administered at a dose of vg.

[0020] In some embodiments, the method for increasing PRPF31 expression in a subject further comprises administering one or more immunosuppressants to the subject. In some embodiments, the one or more immunosuppressants are administered before, simultaneously with, and / or after administration of the isolated nucleic acid, vector, rAAV, or pharmaceutical composition. In some embodiments, the one or more immunosuppressants are administered before administration of the isolated nucleic acid, vector, rAAV, or pharmaceutical composition. In some embodiments, the one or more immunosuppressants are administered simultaneously with administration of the isolated nucleic acid, vector, rAAV, or pharmaceutical composition. In some embodiments, the one or more immunosuppressants are administered after administration of the isolated nucleic acid, vector, rAAV, or pharmaceutical composition. In some embodiments, the one or more immunosuppressants comprise a steroid. In some embodiments, the one or more immunosuppressants comprise methylprednisolone.

[0021] In some aspects, the present disclosure provides methods of treating a subject susceptible to or suffering from a disease, disorder, or condition. In some embodiments, the method of treating a subject susceptible to or suffering from a disease, disorder, or condition comprises administering to the subject an isolated nucleic acid described herein, a vector described herein, an rAAV described herein, or a pharmaceutical composition described herein. In some embodiments, the method of treating a subject susceptible to or suffering from a disease, disorder, or condition comprises administering to the subject an isolated nucleic acid described herein. In some embodiments, the method of treating a subject susceptible to or suffering from a disease, disorder, or condition comprises administering to the subject a vector described herein. In some embodiments, the method of treating a subject susceptible to or suffering from a disease, disorder, or condition comprises administering to the subject an rAAV described herein. In some embodiments, the method of treating a subject susceptible to or suffering from a disease, disorder, or condition comprises administering to the subject a pharmaceutical composition described herein. In some embodiments, a method of treating a subject susceptible to or suffering from a disease, disorder, or condition comprises administering to the subject a therapeutically effective amount of an isolated nucleic acid described herein, a vector described herein, an rAAV described herein, or a pharmaceutical composition described herein. In some embodiments, a method of treating a subject susceptible to or suffering from a disease, disorder, or condition comprises administering to the subject a therapeutically effective amount of an isolated nucleic acid described herein. In some embodiments, a method of treating a subject susceptible to or suffering from a disease, disorder, or condition comprises administering to the subject a therapeutically effective amount of a vector described herein. In some embodiments, a method of treating a subject susceptible to or suffering from a disease, disorder, or condition comprises administering to the subject a therapeutically effective amount of an rAAV described herein. In some embodiments, a method of treating a subject susceptible to or suffering from a disease, disorder, or condition comprises administering to the subject a therapeutically effective amount of a pharmaceutical composition described herein.

[0022] In some embodiments, the subject is susceptible to or suffers from a disease, disorder, or condition. In some embodiments, the disease, disorder, or condition is retinal degeneration. In some embodiments, the disease, disorder, or condition is retinitis pigmentosa. In some embodiments, the disease, disorder, or condition is retinitis pigmentosa-11 (RP11). In some embodiments, the subject has a mutation in one or both of the PRPF31 genes.

[0023] In some embodiments, the subject is an animal. In some embodiments, the subject is a mammal. In some embodiments, the subject is a non-human primate. In some embodiments, the subject is a human.

[0024] In some embodiments, the isolated nucleic acid, vector, rAAV, or pharmaceutical composition is administered by injection. In some embodiments, the isolated nucleic acid is administered by injection. In some embodiments, the vector is administered by injection. In some embodiments, the rAAV is administered by injection. In some embodiments, the pharmaceutical composition is administered by injection. In some embodiments, the isolated nucleic acid, vector, rAAV, or pharmaceutical composition is administered by subretinal injection. In some embodiments, the isolated nucleic acid is administered by subretinal injection. In some embodiments, the vector is administered by subretinal injection. In some embodiments, the rAAV is administered by subretinal injection. In some embodiments, the pharmaceutical composition is administered by subretinal injection.

[0025] In some embodiments, the vector, rAAV, or pharmaceutical composition is administered in an amount of about 10 per eye. 8 ~about 10 14 In some embodiments, the vector, rAAV, or pharmaceutical composition is administered at a dose in the range of about 10 vector genome copies (vg) per eye. 8 , about 10 9 , about 10 10 , about 1011 , about 10 12 , about 10 13 , or about 10 14 In some embodiments, the vector, rAAV, or pharmaceutical composition is administered at a dose of about 10 vector genome copies (vg) per eye. 8 In some embodiments, the vector, rAAV, or pharmaceutical composition is administered at a dose of about 5x10 vg per eye. 8 In some embodiments, the vector, rAAV, or pharmaceutical composition is administered at a dose of about 10 vg per eye. 9 In some embodiments, the vector, rAAV, or pharmaceutical composition is administered at a dose of about 5x10 vg per eye. 9 In some embodiments, the vector, rAAV, or pharmaceutical composition is administered at a dose of about 10 vg per eye. 10 In some embodiments, the vector, rAAV, or pharmaceutical composition is administered at a dose of about 5x10 vg per eye. 10 In some embodiments, the vector, rAAV, or pharmaceutical composition is administered at a dose of about 10 vg per eye. 11 In some embodiments, the vector, rAAV, or pharmaceutical composition is administered at a dose of about 5x10 vg per eye. 11 In some embodiments, the vector, rAAV, or pharmaceutical composition is administered at a dose of about 10 vg per eye. 12 In some embodiments, the vector, rAAV, or pharmaceutical composition is administered at a dose of about 5x10 vg per eye. 12 It is administered at a dose of vg.

[0026] In some embodiments, the method for increasing PRPF31 expression in a subject further comprises administering one or more immunosuppressants to the subject. In some embodiments, the one or more immunosuppressants are administered before, simultaneously with, and / or after administration of the isolated nucleic acid, vector, rAAV, or pharmaceutical composition. In some embodiments, the one or more immunosuppressants are administered before administration of the isolated nucleic acid, vector, rAAV, or pharmaceutical composition. In some embodiments, the one or more immunosuppressants are administered simultaneously with administration of the isolated nucleic acid, vector, rAAV, or pharmaceutical composition. In some embodiments, the one or more immunosuppressants are administered after administration of the isolated nucleic acid, vector, rAAV, or pharmaceutical composition. In some embodiments, the one or more immunosuppressants comprise a steroid. [Brief explanation of the drawings]

[0027] [Figure 1] 1 is an exemplary schematic diagram of an isolated nucleic acid described herein, showing, from left to right, the 5′ inverted terminal repeat (ITR), human cytomegalovirus enhancer (CMVenh.), chicken beta-actin promoter (CβAprom.), human ubiquitin C enhancer (UbCenh.), human native PRPF31 complementary DNA, woodchuck hepatitis virus posttranscriptional regulatory element (WPRE), polyadenylation signal (polyA), and 3′ inverted terminal repeat (ITR).

[0028] [Figure 2] 1 is an exemplary schematic diagram of subretinal administration. As shown, the compositions described herein can be administered to a subject's eye by subretinal injection. A subretinal bleb can be formed by subretinal injection of the composition.

[0029] [Figure 3A]Exemplary results from an in vivo assay of the rAAV described herein. Cynomolgus monkeys were subretinal injected with rAAV containing the construct depicted in FIG. 1, as depicted in FIG. 2. The PRPF31 polypeptide expressed from the rAAV contained a V5 epitope tag fused to its N-terminus. Twenty-eight days after administration, the animals were euthanized, and the eyes were harvested, fixed, and processed into retinal cross sections for histological analysis, as known in the art. Retinal cross sections were immunolabeled with an antibody against the V5 epitope tag (to identify vector-derived PRPF31) and DAPI. A representative image of one such retinal cross section is shown. RPE = retinal pigment epithelium, IS / OS = inner segment / outer segment, ONL = outer nuclear layer, INL = inner nuclear layer, GCL = ganglion cell layer.

[0030] [Figure 3B] Exemplary results from an in vivo assay of rAAV described herein. Cynomolgus monkeys were subretinal injected with rAAV containing the construct depicted in FIG. 1, as depicted in FIG. 2. The PRPF31 polypeptide expressed from the rAAV contained a V5 epitope tag fused to the N-terminus. Animals were treated with methylprednisolone the day before rAAV administration and weekly thereafter. Inflammation was assessed on day 12 of administration, and on days 3, 7, 14, 21, and 28 after administration. The figure shows representative results from one animal. The x-axis indicates days after injection, and the y-axis indicates the vitreous cell score (0 = none, 1 = minimal, 2 = mild, 3 = moderate, 4 = marked, 5 = severe).

[0031] [Figure 4]Exemplary results from the in vivo rAAV assay described herein. Mutant (Prpf31+ / −) mice were subretinal injected with rAAV containing the construct (AAV-PRPF31) shown in Figure 1 or vehicle control. The PRPF31 polypeptide expressed from the rAAV contained a V5 epitope tag fused to the N-terminus. Wild-type (Prpf31+ / +) mice that did not receive the injection were also examined. Thirteen weeks after injection, the animals were sacrificed, and retinal tissue was harvested to examine vector-mediated PRPF31 expression. In mutant (Prpf31+ / −) mice administered AAV-PRPF31, retinal tissue was examined from within and outside the subretinal bleb area (formed by subretinal injection as shown in Figure 2). Retinal cross sections were immunolabeled with antibodies to PRPF31 (top row of micrographs) and V5 (second row of micrographs), as well as DAPI (shown in the third row with a merged image of the top and second rows).

[0032] [Figure 5A] Exemplary results from the in vivo rAAV assay described herein. Mutant (Prpf31+ / -) mice were subretinally injected with rAAV containing the constructs shown in Figure 1 at 2 x 109 vg per eye (N = 5) or vehicle control (N = 4). Thirteen weeks after injection, animals were sacrificed and eyes were harvested. The posterior eye cup (PEC), including the RPE layer, was isolated from the neural retina and protein extraction was performed. Protein content was analyzed by Western blot. A band of approximately 54 kDa associated with PRPF31 was observed (top). PRPF31 expression was quantified and normalized to the corresponding GAPDH expression level (middle). As shown in the graph below, a significant increase in PRPF31 expression (more than 2-fold difference) was observed in samples collected from mice injected with rAAV containing PRPF31 complementary DNA compared to mice injected with the vehicle control. Error bars indicate the standard error of the mean (SEM). Unpaired Student's t-test; P=0.0006.

[0033] [Figure 5B]Exemplary results from the in vivo rAAV assay described herein. Mutant (Prpf31+ / -) mice were subretinally injected with rAAV containing the constructs shown in Figure 1 at a dose of 2 x 1010 vg per eye (N = 5) or vehicle control (N = 4). Thirteen weeks after injection, animals were sacrificed and eyes were harvested. The posterior eye cup (PEC), including the RPE layer, was isolated from the neural retina and protein extraction was performed. Protein content was analyzed by Western blot. A band of approximately 54 kDa associated with PRPF31 was observed (top). PRPF31 expression was quantified and normalized to the corresponding β-actin expression (middle). As shown in the graph below, a significant increase in PRPF31 expression (approximately 4-fold difference) was observed in samples collected from mice injected with rAAV containing PRPF31 complementary DNA compared to mice injected with the vehicle control. Error bars indicate standard error of the mean (SEM). Unpaired Student's t-test; P<0.0001.

[0034] [Figure 6A] Exemplary results from the in vivo rAAV assay described herein. Mutant (Prpf31+ / -) mice received subretinal injections (N=6) or vehicle control (N=6). Wild-type (Prpf31+ / +) mice that did not receive any injections were also examined (N=4). Thirteen weeks after injection, animals were sacrificed, retinal tissue was harvested, and RPE phagocytosis was examined. Retinal cross sections were immunolabeled with antibodies against PRPF31 (top row of micrographs), F-actin (second row of micrographs), rhodopsin (RHO) (third row of macrographs), and DAPI (shown in the fourth row as a merger of the top three rows).

[0035] [Figure 6B]Exemplary results from the in vivo rAAV assay described herein. Mutant (Prpf31+ / -) mice received subretinal injections of 2 x 109 (low dose, N = 5) or 2 x 1010 vg (high dose, N = 4) per eye. Thirteen weeks after injection, animals were sacrificed, retinal tissue was harvested, and RPE phagocytosis was examined. Retinal cross sections were immunolabeled with antibodies against PRPF31 (top row of micrographs), F-actin (second row of micrographs), rhodopsin (RHO) (third row of macrographs), and DAPI (shown in the fourth row as a merger of the top three rows).

[0036] [Figure 6C] Exemplary results from the in vivo rAAV assay described herein. Mutant (Prpf31+ / -) mice were subretinally injected with rAAV containing the constructs shown in Figure 1 at 2x109 vg (low dose, N=5) or 2x1010 vg (high dose, N=4) per eye, or vehicle control (N=6). Wild-type (Prpf31+ / +) mice that did not receive the injection were also examined (N=4). Thirteen weeks after injection, animals were sacrificed, retinal tissue was harvested, and RPE phagocytosis was examined. Retinal cross sections were immunolabeled with antibodies against rhodopsin (RHO) and PRPF31. RHO phagosomes in the RPE layer were quantified in every 100 μm section. Unpaired Student's t-test; wild-type vs. vehicle, P = 0.02; wild-type vs. high dose, not significant (ns); vehicle vs. low dose, P = 0.01; vehicle vs. high dose, P = 0.0042. Error bars indicate the standard error of the mean (SEM).

[0037] [Figure 7]Exemplary results from the in vivo rAAV assay described herein. Wild-type (Prpf31+ / +) and mutant (Prpf31+ / -) induced pluripotent stem cell (iPSC)-derived RPE cells were cultured and matured for 3 weeks. rAAV containing the constructs depicted in Figure 1 was administered to the cultures at an MOI of 5 x 10. After culturing the cells for 3 weeks post-administration, phagocytosis was assayed by treatment with FITC-conjugated photoreceptor outer segments (POS). Cells were then evaluated by microscopy. Mutant (Prpf31+ / -) cells exhibited reduced ability to bind and internalize POS compared to wild-type (Prpf31+ / +) cells, as indicated by a decrease in FITC signal in the untreated column of the micrograph. Treatment of cells with rAAV containing PRPF31 complementary DNA restored phagocytic activity, as demonstrated by an increase in FITC signal after POS binding and internalization (the far right column of the micrograph). DETAILED DESCRIPTION OF THE INVENTION

[0038] definition As used herein in this disclosure, unless otherwise clear from the context, (i) the term "a" or "an" may be understood to mean "at least one," (ii) the term "or" may be understood to mean "and / or," (iii) "comprising," "comprise," "including" (whether used as "limited to"), and "include" (whether used as "without limitation") may be understood to encompass the itemized component or step, whether presented with the step by itself or with one or more additional components or steps, (iv) the term "another" may be understood to mean at least an additional / second one or more, and (v) when ranges are provided, the endpoints are included.

[0039] About: The term "about," when used herein with respect to a value, refers to a similar value in the context of a reference value. Generally, a person of ordinary skill in the art will be familiar with the context and will understand the appropriate degree of variation encompassed by "about" in that context. For example, in some embodiments, the term "about" can encompass a range of 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less of the reference value.

[0040] Adeno-associated virus (AAV): As used herein, the terms "adeno-associated virus" and "AAV" refer to all or part of a viral particle of the Parvoviridae and Dependoparvovirus genus. AAVs are small, replication-defective, non-enveloped viruses. AAV may include, but is not limited to, AAV serotype 1, AAV serotype 2, AAV serotype 3 (such as serotypes 3A and 3B), AAV serotype 4, AAV serotype 5, AAV serotype 6, AAV serotype 7, AAV serotype 8, AAV serotype 9, AAV serotype 10, AAV serotype 11, AAV serotype 12, AAV serotype 13, AAV serotype rh10, AAV serotype rh74, AAV of the HSC1-17 series, AAV of the CBr, CLv or CLg series, snake AAV, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, caprine AAV, shrimp AAV, and any variants of any of the foregoing. AAV can also include engineered or chimeric forms of wild-type AAV that contain one or more insertions, deletions, and / or substitutions in the Cap polypeptide(s) that affect one or more properties of the wild-type AAV serotype, such as, but not limited to, tropism and evasion of neutralizing antibodies (e.g., AAV-DJ, AAV-PHP.B, AAV-PHP.N, AAV.CAP-B1 through AAAV.CAP-B25, and variants thereof). Wild-type AAV is replication-deficient and requires co-infection of cells with a helper virus (e.g., adenovirus, herpes, or vaccinia virus) or supplementation with helper virus genes in order to replicate.

[0041] Administration: As used herein, the term "administration" refers to administering a composition to a subject. Administration can be by any suitable route. For example, in some embodiments, administration can be bronchial (including by bronchial instillation), buccal, enteral, intradermal, intraarterial, intradermal, intragastric, intramedullary, intramuscular, intranasal, intraperitoneal, intrathecal, intravenous, intraventricular, mucosal, nasal, oral, rectal, subcutaneous, sublingual, subretinal, topical, tracheal (including intratracheal instillation), intradermal, vaginal, vitreous, or any combination thereof. In some embodiments, the administration method can be subretinal. In some embodiments, a preferred administration method reduces or prevents an immune response from the subject being treated.

[0042] Agent: As used herein, the term "agent" may refer to any chemical class of compound or entity, including, for example, polypeptides, nucleic acids, saccharides, lipids, small molecules, metals, or combinations thereof. As is clear from the context, in some embodiments, an agent may be or include a cell or organism, or a fraction, extract, or component thereof. In some embodiments, an agent is or includes a natural product, in that it is found in nature and / or obtained from nature. In some embodiments, an agent is or includes one or more entities that are man-made, in that they have been designed, engineered, and / or produced by the action of man and / or are not found in nature. In some embodiments, an agent may be utilized in isolated or pure form. In some embodiments, an agent may be utilized in crude form. In some embodiments, potential agents may be provided as a collection or library and screened, for example, to identify or characterize active agents therein. Some specific embodiments of agents that may be utilized in accordance with the present disclosure include small molecules, antibodies, antibody fragments, aptamers, siRNA, shRNA, miRNA, DNA / RNA hybrids, antisense oligonucleotides, ribozymes, peptides, peptidomimetics, and small molecules. In some embodiments, the agent is or comprises a polymer. In some embodiments, the agent is not a polymer and / or is substantially free of polymers. In some embodiments, the agent comprises at least one polymer moiety. In some embodiments, the agent is free of or substantially free of any polymer moieties.

[0043] Complementary: As used herein, the term "complementary" in the context of nucleic acid base pairing refers to oligonucleotide hybridization related by the base pairing rules. For example, the sequence "CAGT" is complementary to the sequence "GTCA." Complementarity can be partial or complete. Thus, any degree of partial complementarity is intended to be included within the scope of the term "complementary," as long as the partial complementarity allows for oligonucleotide hybridization. Partial complementarity is when one or more nucleic acid bases do not match according to the base pairing rules. Full complementarity or complete complementarity between nucleic acids is when each and every nucleic acid base matches another base according to the base pairing rules.

[0044] Therapeutically effective amount: As used herein, the term "therapeutically effective amount" refers to an amount that is sufficient when administered to a population suffering from or susceptible to a disease, disorder, and / or condition in accordance with a therapeutic dosing regimen to treat the disease, disorder, and / or condition. In some embodiments, a therapeutically effective amount is an amount that reduces the incidence and / or severity of one or more symptoms of a disease, disorder, and / or condition and / or delays their onset. Those skilled in the art will appreciate that the term "therapeutically effective amount" does not actually require that a therapeutic response be achieved in a particular individual. Rather, a therapeutically effective amount may be an amount that, when administered to patients in need of such treatment, provides a specific, desired pharmacological response in a significant number of subjects. It is particularly understood that certain subjects may actually be "refractory" to a "therapeutically effective amount." By way of example only, refractory subjects may have low bioavailability and therefore lack clinical efficacy. In some embodiments, reference to a therapeutically effective amount may be a reference to the amount measured in one or more particular tissues (e.g., tissues affected by a disease, disorder, or condition) or bodily fluids (e.g., blood, saliva, serum, sweat, tears, urine, etc.). One of skill in the art will understand that in some embodiments, a therapeutically effective amount may be formulated and / or administered in a single dose. In some embodiments, a therapeutically effective amount may be formulated and / or administered in multiple doses, for example, as part of a dosing regimen.

[0045] Expression: As used herein, "expression" of a nucleic acid sequence refers to one or more of the following events: (1) production of an RNA template from a DNA sequence (e.g., by transcription); (2) processing of the RNA transcript (e.g., by splicing, editing, 5' cap formation, and / or 3' end formation); (3) translation of the RNA into a polypeptide or protein, and / or (4) post-translational modification of the polypeptide or protein.

[0046] Identity: As used herein, the term "identity" refers to the overall relatedness between polymers, e.g., between nucleic acid molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. In some embodiments, polymers are considered to be "substantially identical" to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical. As will be appreciated by those of skill in the art, a variety of algorithms are available that allow for the comparison of sequences to determine the degree of homology, such as by allowing gaps of a specified length in one sequence against another, when considering which residues in different sequences "correspond" to each other. Calculation of the percent identity between two nucleic acid sequences can be performed, for example, by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced into one or both of the first and second nucleic acid sequences for optimal alignment, and non-corresponding sequences can be ignored for comparison purposes). In one embodiment, the length of the sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or substantially 100% of the length of the reference sequence. Nucleotides at corresponding nucleotide positions are then compared. If a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, the molecules are identical at that position. The percent identity between two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps and the length of each gap that needs to be introduced for optimal alignment of the two sequences. Representative algorithms and computer programs useful for determining the percent identity between two nucleotide sequences include, for example, the algorithm of Meyers and Miller (CABIOS, 1989, 4:11-17), which is incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4.Alternatively, the percent identity between two nucleotide sequences can be determined using, for example, the GAP program in the GCG software package using the NWSgapdna.CMP matrix.

[0047] Nucleic Acid: As used herein, the term "nucleic acid" in its broadest sense refers to any compound and / or substance that is or can be incorporated into an oligonucleotide chain. In some embodiments, a nucleic acid is a compound and / or substance that is or can be incorporated into an oligonucleotide chain via a phosphodiester linkage. As is clear from the context, in some embodiments, "nucleic acid" refers to individual nucleic acid residues (e.g., nucleotides and / or nucleosides). In some embodiments, "nucleic acid" refers to an oligonucleotide chain comprising individual nucleic acid residues. In some embodiments, "nucleic acid" is or comprises RNA. In some embodiments, "nucleic acid" is or comprises DNA. In some embodiments, a nucleic acid is, comprises, or consists of one or more naturally occurring nucleic acid residues. In some embodiments, a nucleic acid is, comprises, or consists of one or more nucleic acid analogs. In some embodiments, nucleic acid analogs differ from nucleic acids in that they do not utilize a phosphodiester scaffold. For example, in some embodiments, a nucleic acid is, comprises, or consists of one or more "peptide nucleic acids," which are known in the art and have peptide bonds instead of phosphodiester bonds in the scaffold and are considered within the scope of the present disclosure. Alternatively or additionally, in some embodiments, the nucleic acid has one or more phosphorothioate and / or 5'-N-phosphoramidite linkages rather than phosphodiester linkages. In some embodiments, the nucleic acid comprises or consists of one or more natural nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, deoxycytidine).In some embodiments, the nucleic acid is, comprises, or consists of one or more nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, 2-thiocytidine, methylated bases, intercalated bases, and combinations thereof). In some embodiments, the nucleic acid comprises one or more modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose) compared to those found in naturally occurring nucleic acids. In some embodiments, the nucleic acid has a nucleotide sequence encoding a functional gene product such as RNA or a protein. In some embodiments, the nucleic acid comprises one or more introns. In some embodiments, the nucleic acid is prepared by one or more of isolation from natural sources, enzymatic synthesis by polymerization from a complementary template (in vivo or in vitro), regeneration in a recombinant cell or system, and chemical synthesis. In some embodiments, the nucleic acid may comprise or consist of one or more inhibitory nucleic acids (e.g., small RNA molecules). In some embodiments, the inhibitory nucleic acid comprises or consists of RNA molecules (e.g., small RNA molecules) that inhibit gene expression (e.g., via mRNA degradation) or inhibit translation (e.g., reduce the level of gene expression or translation of a transcript compared to a relevant control). In some embodiments, the inhibitory nucleic acid comprises or consists of one or more siRNAs, miRNAs, shRNAs, gRNAs, or any combination thereof. In some embodiments, the inhibitory nucleic acid can be single-stranded or double-stranded.

[0048] Pharmaceutical composition: As used herein, the term "pharmaceutical composition" refers to an active agent formulated with one or more pharmaceutically acceptable carriers. In some embodiments, the active agent is present in a unit dose suitable for administration in a treatment regimen that exhibits a statistically significant probability of achieving a predetermined therapeutic effect when administered to a relevant population. In some embodiments, pharmaceutical compositions can include those specially prepared for administration in solid or liquid form, or those adapted for the following: oral administration, e.g., drenches (aqueous or non-aqueous solutions or suspensions), tablets (e.g., buccal, sublingual, and those targeted for systemic absorption), boluses, powders, granules, pastes for application to the tongue, etc.; parenteral administration, e.g., as sterile aqueous solutions or suspensions, or as sustained-release formulations, e.g., by subcutaneous, intramuscular, intravenous, or epidural injection; topical application, e.g., as a cream, ointment, or controlled-release patch or spray applied to the skin; pulmonary or buccal administration; vaginal or rectal administration, e.g., as a pessary, cream, or foam; sublingual administration; ophthalmic administration; transdermal administration; or intranasal, pulmonary, and other mucosal surfaces. In some embodiments, the pharmaceutical composition is prepared for subretinal administration, e.g., subretinal injection.

[0049] Recombinant adeno-associated virus (rAAV) particle: As used herein, "recombinant adeno-associated virus (rAAV) particle" or "rAAV particle" refers to an infectious, replication-defective viral particle comprising an AAV protein shell encapsulating at least one payload flanked by inverted terminal repeats (ITRs) within a vector. rAAV particles can be produced in suitable host cells (e.g., HEK293 cells, CHO-K cells, HeLa cells, or variants thereof) described herein. For example, host cells are transfected with one or more vectors encoding at least one payload flanked by ITRs, at least one Rep polypeptide, at least one Cap polypeptide, and at least one helper polypeptide, thereby enabling the host cells to produce the Rep, Cap, and helper polypeptides required for packaging of rAAV particles. Any of the rAAV particles described herein can be used for subsequent gene delivery.

[0050] Subject: As used herein, the term "subject" or "patient" refers to any organism to which a provided composition has been or can be administered, for example, for experimental, diagnostic, prophylactic, cosmetic, and / or therapeutic purposes. In some embodiments, the subject is or includes a cell or tissue. Typical patients include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and / or humans). In some embodiments, the patient is human. In some embodiments, the patient is suffering from or susceptible to one or more diseases, disorders, or conditions. In some embodiments, the patient exhibits one or more symptoms of the disease, disorder, or condition. In some embodiments, the patient has been diagnosed with one or more diseases, disorders, or conditions. In some embodiments, the disease, disorder, or condition is retinal degeneration. In some embodiments, the disease, disorder, or condition is retinitis pigmentosa (e.g., retinitis pigmentosa-11 (RP11)).

[0051] Substantially: As used herein, the term "substantially" refers to the qualitative condition of exhibiting the entire or nearly entire extent or degree of a desired characteristic or property. Those skilled in the art of biology will understand that biological and chemical phenomena rarely, if ever, go to and / or proceed to completion or achieve or avoid an absolute result. Thus, the term "substantially" is used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena.

[0052] Susceptible: An individual who is "susceptible" to a disease, disorder, and / or condition is an individual who is at a higher risk than the general population of developing the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition is more likely to develop the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may not have been diagnosed with the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may not exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition develops the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition does not develop the disease, disorder, and / or condition.

[0053] Therapeutically effective amount: As used herein, "therapeutically effective amount" refers to an amount of a substance (e.g., a therapeutic agent, composition, and / or formulation) that elicits a desired biological response when administered as part of a treatment regimen. In some embodiments, a therapeutically effective amount of a substance is an amount sufficient to treat, diagnose, prevent, and / or delay the onset of a disease, disorder, and / or condition when administered to a subject suffering from or susceptible to the disease, disorder, and / or condition. As will be understood by one of skill in the art, the effective amount of a substance can vary depending on factors such as the desired biological endpoint, the substance being delivered, and the target cell or tissue. For example, an effective amount of a compound in a formulation intended to treat a disease, disorder, and / or condition is an amount that alleviates, ameliorates, relieves, inhibits, prevents, delays the onset of, reduces the severity of, and / or reduces the frequency of occurrence of one or more diseases, disorders, and / or conditions. In some embodiments, a therapeutically effective amount is administered in a single dose. In some embodiments, multiple unit doses are required to deliver a therapeutically effective amount.

[0054] Vector: As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a "plasmid," which refers to a circular double-stranded DNA loop into which additional DNA segments can be ligated. Another type of vector is a viral vector, into which additional DNA segments can be ligated. Some vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) can be integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Additionally, some vectors are capable of directing the expression of genes to which they are operably linked. Such vectors are referred to herein as "expression vectors." In some embodiments, the term "vector" refers to an agent capable of transporting or containing a nucleic acid. In some embodiments, a vector comprises or is an agent capable of transporting a nucleic acid.

[0055] Wild-type: As used herein, the term "wild-type" has the meaning commonly understood in the art and refers to an entity having a structure and / or activity found in a "normal" (as opposed to mutant, diseased, modified, etc.) state or context in nature. Those of skill in the art will understand that wild-type genes and polypeptides often exist in multiple alternative forms (e.g., alleles).

[0056] (Mode for Carrying Out the Invention) Among other things, the present disclosure provides various isolated nucleic acids, vectors, rAAVs, and compositions thereof. In some embodiments, the isolated nucleic acids, vectors, or rAAVs comprise a nucleic acid sequence encoding a PRPF31 polypeptide. In some embodiments, the provided technologies (e.g., isolated nucleic acids, vectors, rAAVs, compositions thereof, or methods thereof) increase PRPF31 expression. Expression of PRPF31 from a nucleic acid sequence encoding PRPF31 may depend on or be increased by other sequence elements, such as one or more inverted terminal repeats (ITRs), promoters, enhancers, woodchuck hepatitis virus posttranscriptional regulatory elements (WPREs), 3' untranslated region (UTR) elements, or polyadenylation signals. In some embodiments, the provided isolated nucleic acids, vectors, or rAAVs contain various sequence elements, including other elements, that improve PRPF31 expression (e.g., increasing expression levels and / or improving stability). In some embodiments, the isolated nucleic acid, vector, or rAAV comprises a 5' ITR, a promoter, a nucleic acid sequence encoding PRPF31, a WPRE, a polyadenylation signal, and / or a 3' ITR as described herein.

[0057] PRPF31 In some embodiments, PRPF31 refers to a gene or its gene product (e.g., a nucleic acid (e.g., DNA or RNA), a transcript (e.g., PRPF31 mRNA), or a protein encoded by the gene (e.g., a PRPF31 polypeptide) derived from a particular species, and may be known as PRPF31, PRP31, precursor mRNA processing factor 31, U4 / U6 small nuclear ribonucleoprotein, or other names known to those of skill in the art. Various PRPF31 sequences (including variants thereof) are readily available to those of skill in the art. In addition, a variety of techniques, including assays, cells, and animal models, have been reported and can be used to characterize or evaluate the techniques (e.g., one or more isolated nucleic acids, vectors, rAAV vectors, or methods) provided in accordance with the present disclosure.

[0058] The PRPF31 gene has been reported to encode the PRPF31 protein, which is primarily localized in the cell nucleus in various tissues, including ocular tissues (e.g., retinal tissue). The PRPF31 protein has been reported as a splicing factor that functions as a component of the spliceosome as part of the U4 / U6.U5 triple-snRNP (tri-snRNP) complex (Makarova, OV et al., EMBO J. 2002 Mar 1;21(5):1148-57). The PRPF31 protein reportedly contains a coiled-coil domain, a Nop domain (which may provide protein and RNA binding capabilities), a flexible loop, and a C-terminal domain (which also contains a nuclear localization sequence (NLS)). Liu, S. et al., Science 2007 Apr 6;316(5821):115-20).

[0059] Various mutations in PRPF31 have been reported in the literature. See, for example, Wheway, G. et al., Exp Eye Res. 2020 Mar;192:107950. Mutations reported in the PRPF31 gene include numerous variants present in various locations in the intronic and exonic regions of the gene. In some embodiments, the PRPF31 mutation is in an intron. In some embodiments, the PRPF31 mutation is in an exon. In some embodiments, the PRPF31 mutation is at a splice site. In some embodiments, the PRPF31 mutation is a missense mutation. In some embodiments, the PRPF31 mutation is a nonsense mutation. In some embodiments, the PRPF31 mutation is a frameshift mutation. In some embodiments, the PRPF31 mutation is a loss-of-function mutation. In some embodiments, the PRPF31 mutation is a large insertion mutation. In some embodiments, the PRPF31 mutation is a large deletion mutation. In some embodiments, the PRPF31 mutation is a loss-of-expression mutation.

[0060] Research has shown that mutant PRPF31 inhibits normal splicing of the precursor mRNA for rhodopsin (RHO), resulting in reduced RHO expression in retinal cells (Yuan, L. et al., J Neurosci. 2005 Jan 19;25(3):748-57). Further research has shown that mutant PRPF31 can cause structural abnormalities in retinal ciliogenesis and lead to splicing abnormalities of various genes (Wheway, G. et al., Nat Cell Biol. 2015 Aug;17(8):1074-1087; Buskin, A. et al., 2018 Nat Commun. 2018 Oct 12;9(1):4234). Current research indicates that PRPF31-associated diseases, disorders, or conditions (e.g., retinitis pigmentosa) may be mechanistically associated with heterozygous insufficiency due to loss-of-function mutations (Abu-Safieh, L. et al., Mol Vis. 2006 Apr 18, 12:384-8; Rio Fryo, T. et al., J Clin Invest. 2008 Apr;118(4):1519-31). Thus, treatment of PRPF31-associated diseases, disorders, and conditions may be provided by providing wild-type PRPF31 to a subject using the techniques provided in this disclosure (e.g., one or more of an isolated nucleic acid, vector, rAAV, composition thereof, or method thereof).

[0061] PRPF31-Related Diseases, Disorders, and Conditions Various diseases, disorders, or conditions that are believed to be associated with PRPF31 have been reported and can be prevented or treated using the technology provided in this disclosure. Generally, PRPF31 is considered to be associated with a disease, disorder, or condition if its presence, level, activity, or form (e.g., transcript and / or encoded protein) correlates with the incidence or susceptibility of the disease, disorder, or condition (e.g., in a relevant population). In some embodiments, a PRPF31-associated disease, disorder, or condition can be treated or prevented by providing wild-type PRPF31 or a product thereof.

[0062] The present disclosure provides techniques for the prevention or treatment of various diseases, disorders, or conditions, including, among others. In some embodiments, the disease, disorder, or condition is a genetic disease, disorder, or condition. In some embodiments, the disease, disorder, or condition is autosomal dominant. In some embodiments, the disease, disorder, or condition is a retinopathy. In some embodiments, the disease, disorder, or condition is PRPF31-associated retinopathy. In some embodiments, the disease, disorder, or condition is a retinal degeneration. In some embodiments, the disease, disorder, or condition is retinitis pigmentosa (RP). In some embodiments, the disease, disorder, or condition is autosomal dominant retinitis pigmentosa (adRP). In some embodiments, the disease, disorder, or condition is retinitis pigmentosa-11 (RP11).

[0063] Isolated nucleic acids Various isolated nucleic acids may comprise a nucleic acid sequence encoding PRPF31, as provided in this disclosure. In some embodiments, the isolated nucleic acid is DNA. In some embodiments, the isolated nucleic acid is double-stranded (ds) DNA. In some embodiments, the isolated nucleic acid is single-stranded (ss) DNA. In some embodiments, the isolated nucleic acid is linear. In some embodiments, the isolated nucleic acid is circular. In some embodiments, the isolated nucleic acid is RNA.

[0064] In some embodiments, the isolated nucleic acid comprises a nucleic acid sequence encoding a PRPF31 polypeptide. In some embodiments, the PRPF31 polypeptide is a wild-type PRPF31 polypeptide. In some embodiments, the PRPF31 polypeptide is a human PRPF31 polypeptide. In some embodiments, the PRPF31 polypeptide is a wild-type human PRPF31 polypeptide. In some embodiments, the nucleic acid sequence encoding the PRPF31 polypeptide is a naturally occurring human PRPF31 complementary DNA. In some embodiments, the nucleic acid sequence encoding the PRPF31 polypeptide is a codon-optimized human PRPF31 complementary DNA. In some embodiments, the nucleic acid sequence encoding the PRPF31 polypeptide is or comprises a nucleic acid sequence having about 70% or more sequence identity to SEQ ID NO:1. In some embodiments, the nucleic acid sequence encoding the PRPF31 polypeptide is or comprises a nucleic acid sequence having about 75% or more sequence identity to SEQ ID NO:1. In some embodiments, the nucleic acid sequence encoding the PRPF31 polypeptide is or comprises a nucleic acid sequence having about 80% or more sequence identity to SEQ ID NO:1. In some embodiments, the nucleic acid sequence encoding the PRPF31 polypeptide is or comprises a nucleic acid sequence having about 85% or more sequence identity to SEQ ID NO: 1. In some embodiments, the nucleic acid sequence encoding the PRPF31 polypeptide is or comprises a nucleic acid sequence having about 90% or more sequence identity to SEQ ID NO: 1. In some embodiments, the nucleic acid sequence encoding the PRPF31 polypeptide is or comprises a nucleic acid sequence having about 95% or more sequence identity to SEQ ID NO: 1. In some embodiments, the nucleic acid sequence encoding the PRPF31 polypeptide is or comprises a nucleic acid sequence having about 99% or more sequence identity to SEQ ID NO: 1. In some embodiments, the nucleic acid sequence encoding the PRPF31 polypeptide is or comprises the nucleic acid sequence of SEQ ID NO: 1.

[0065] In some embodiments, the isolated nucleic acid comprises a nucleic acid sequence encoding a second polypeptide that is in frame with the nucleic acid sequence encoding the PRPF31 polypeptide. In some embodiments, the second polypeptide is fused to the PRPF31 polypeptide when the nucleic acid sequence encoding the second polypeptide and the nucleic acid sequence encoding the PRPF31 polypeptide are transcribed. In some embodiments, the second polypeptide is fused to the N-terminus of the PRPF31 polypeptide. In some embodiments, the second polypeptide is fused to the C-terminus of the PRPF31 polypeptide. In some embodiments, the second polypeptide is or comprises one or more epitope tags or portions thereof. Various epitope tags are known in the art, including c-Myc, FLAG, glutathione S-transferase (GST), hemagglutinin (HA), 6x-His, V5, etc. In some embodiments, the second polypeptide is any one or more of c-Myc, FLAG, glutathione S-transferase (GST), hemagglutinin (HA), 6x-His, or a V5 epitope tag, or a combination thereof. In some embodiments, the second polypeptide is or comprises a V5 epitope tag. In some embodiments, the second polypeptide is or comprises a fluorescent protein or portion thereof. Various fluorescent proteins are known in the art, such as cyan fluorescent protein (CFP), green fluorescent protein (GFP), mCherry, red fluorescent protein (RFP), and yellow fluorescent protein (YFP).

[0066] In some embodiments, the isolated nucleic acid comprises a promoter. In some embodiments, the nucleic acid sequence encoding PRPF31 is operably linked to a promoter that drives transcription of the nucleic acid sequence encoding PRPF31. Various promoters are known in the art, such as the chicken beta-actin (CBA) promoter, CAG promoter, CASI promoter, RPE65 promoter, and VMD2 promoter. In some embodiments, the promoter is constitutive or inducible. In some embodiments, the promoter is constitutive. In some embodiments, the promoter is inducible. In some embodiments, the promoter is tissue- or cell-specific. In some embodiments, the promoter is not tissue- or cell-specific. In some embodiments, the promoter comprises one or more promoters, enhancers, or other sequence elements. In some embodiments, the promoter comprises a human cytomegalovirus (CMV) enhancer or a portion thereof, a chicken beta-actin (CBA) promoter or a portion thereof, a human ubiquitin C (UbC) enhancer or a portion thereof, a splice donor, a splice acceptor, or a combination thereof. In some embodiments, the promoter comprises a human CMV enhancer or a portion thereof. In some embodiments, the promoter comprises a CBA promoter or a portion thereof. In some embodiments, the promoter comprises a human UbC enhancer or a portion thereof. In some embodiments, the promoter comprises a splice donor. In some embodiments, the promoter comprises a splice acceptor. In some embodiments, the promoter is or comprises a nucleic acid sequence having about 70% or more sequence identity to SEQ ID NO:4. In some embodiments, the promoter is or comprises a nucleic acid sequence having about 75% or more sequence identity to SEQ ID NO:4. In some embodiments, the promoter is or comprises a nucleic acid sequence having about 80% or more sequence identity to SEQ ID NO:4. In some embodiments, the promoter is or comprises a nucleic acid sequence having about 85% or more sequence identity to SEQ ID NO:4.In some embodiments, the promoter is or comprises a nucleic acid sequence having about 90% or greater sequence identity. In some embodiments, the promoter is or comprises a nucleic acid sequence having about 95% or greater sequence identity to SEQ ID NO: 4. In some embodiments, the promoter is or comprises a nucleic acid sequence having about 99% or greater sequence identity to SEQ ID NO: 4. In some embodiments, the promoter is or comprises the nucleic acid sequence of SEQ ID NO: 4.

[0067] In some embodiments, the isolated nucleic acid comprises one or more inverted terminal repeats (ITRs). Various ITRs are known in the art, including adeno-associated virus (AAV) ITRs. AAV ITRs can be derived from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, or any combination or variant thereof. In some embodiments, the ITRs are wild-type ITRs. In some embodiments, the ITRs are modified or engineered ITRs. In some embodiments, the isolated nucleic acid comprises two ITRs. In some embodiments, the isolated nucleic acid comprises a 5' ITR and a 3' ITR. In some embodiments, the ITRs are AAV ITRs. In some embodiments, the 5' ITR is an AAV 5' ITR. In some embodiments, the 3' ITR is an AAV 3' ITR. In some embodiments, the ITRs are AAV2 ITRs. In some embodiments, the 5' ITR is an AAV2 5' ITR. In some embodiments, the 3' ITR is an AAV2 3' ITR. In some embodiments, the 5' ITR is or comprises a nucleic acid sequence having about 70% or more sequence identity to SEQ ID NO:2. In some embodiments, the 5' ITR is or comprises a nucleic acid sequence having about 75% or more sequence identity to SEQ ID NO:2. In some embodiments, the 5' ITR is or comprises a nucleic acid sequence having about 80% or more sequence identity to SEQ ID NO:2. In some embodiments, the 5' ITR is or comprises a nucleic acid sequence having about 85% or more sequence identity to SEQ ID NO:2. In some embodiments, the 5' ITR is or comprises a nucleic acid sequence having about 90% or more sequence identity to SEQ ID NO:2. In some embodiments, the 5' ITR is or comprises a nucleic acid sequence having about 95% or more sequence identity to SEQ ID NO:2. In some embodiments, the 5' ITR is or comprises a nucleic acid sequence having about 99% or more sequence identity to SEQ ID NO:2. In some embodiments, the 5' ITR is or comprises SEQ ID NO:2.In some embodiments, the 3' ITR is or comprises a nucleic acid sequence having about 70% or greater sequence identity to SEQ ID NO:3. In some embodiments, the 3' ITR is or comprises a nucleic acid sequence having about 75% or greater sequence identity to SEQ ID NO:3. In some embodiments, the 3' ITR is or comprises a nucleic acid sequence having about 80% or greater sequence identity to SEQ ID NO:3. In some embodiments, the 3' ITR is or comprises a nucleic acid sequence having about 85% or greater sequence identity to SEQ ID NO:3. In some embodiments, the 3' ITR is or comprises a nucleic acid sequence having about 90% or greater sequence identity to SEQ ID NO:3. In some embodiments, the 3' ITR is or comprises a nucleic acid sequence having about 95% or greater sequence identity to SEQ ID NO:3. In some embodiments, the 3' ITR is or comprises a nucleic acid sequence having about 99% or greater sequence identity to SEQ ID NO:3. In some embodiments, the 3' ITR is or comprises the nucleic acid sequence of SEQ ID NO:3.

[0068] In some embodiments, the isolated nucleic acid comprises a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE). In some embodiments, the WPRE is or comprises a nucleic acid sequence having about 70% or greater sequence identity to SEQ ID NO:5. In some embodiments, the WPRE is or comprises a nucleic acid sequence having about 75% or greater sequence identity to SEQ ID NO:5. In some embodiments, the WPRE is or comprises a nucleic acid sequence having about 80% or greater sequence identity to SEQ ID NO:5. In some embodiments, the WPRE is or comprises a nucleic acid sequence having about 85% or greater sequence identity to SEQ ID NO:5. In some embodiments, the WPRE is or comprises a nucleic acid sequence having about 90% or greater sequence identity to SEQ ID NO:5. In some embodiments, the WPRE is or comprises a nucleic acid sequence having about 95% or greater sequence identity to SEQ ID NO:5. In some embodiments, the WPRE is or comprises a nucleic acid sequence having about 99% or greater sequence identity to SEQ ID NO:5. In some embodiments, the WPRE is or comprises the nucleic acid sequence of SEQ ID NO:5.

[0069] In some embodiments, the isolated nucleic acid comprises a 3' untranslated region (UTR) element. Various 3'UTR elements are known in the art, including AU-rich elements (AREs), CA-rich elements (CAREs), CU-rich elements (CUREs), GU-rich elements (GREs), differentiation control elements (DICEs), microRNA response elements (MREs), polyadenylation signals, and the like. In some embodiments, the 3'UTR element confers particular properties to the isolated nucleic acid or its transcription product (e.g., increased expression and / or increased stability). In some embodiments, the 3'UTR element is a polyadenylation signal.

[0070] In some embodiments, the isolated nucleic acid comprises a polyadenylation signal. In some embodiments, the isolated nucleic acid sequence comprises a human growth hormone (hGH) polyadenylation signal. In some embodiments, the isolated nucleic acid comprises a beta globin polyadenylation signal. In some embodiments, the isolated nucleic acid comprises a human beta globin polyadenylation signal. In some embodiments, the polyadenylation signal is or comprises a nucleic acid sequence having about 70% or more sequence identity to SEQ ID NO:6. In some embodiments, the polyadenylation signal is or comprises a nucleic acid sequence having about 75% or more sequence identity to SEQ ID NO:6. In some embodiments, the polyadenylation signal is or comprises a nucleic acid sequence having about 80% or more sequence identity to SEQ ID NO:6. In some embodiments, the polyadenylation signal is or comprises a nucleic acid sequence having about 85% or more sequence identity to SEQ ID NO:6. In some embodiments, the polyadenylation signal is or comprises a nucleic acid sequence having about 90% or more sequence identity to SEQ ID NO:6. In some embodiments, the polyadenylation signal is or comprises a nucleic acid sequence having about 95% or greater sequence identity. In some embodiments, the polyadenylation signal is or comprises a nucleic acid sequence having about 99% or greater sequence identity to SEQ ID NO: 6. In some embodiments, the polyadenylation signal is or comprises the nucleic acid sequence of SEQ ID NO: 6.

[0071] In some embodiments, the isolated nucleic acid comprises a Kozak consensus sequence. Various Kozak consensus sequences are known in the art, see, for example, Kozak, M. Proc Natl Acad Sci U S A. 1990 Nov;87(21):8301-5; Kozak, MJ Cell Biol. 1991 Nov;115(4):887-903; Kozak, M. Gene. 2002 Oct 16;299(1-2):1-34. In some embodiments, the Kozak consensus sequence is located downstream (3') of the promoter. In some embodiments, the Kozak consensus sequence is located upstream (5') of the nucleic acid sequence encoding PRPF31. In some embodiments, the Kozak consensus sequence is located downstream (3') of the promoter and upstream (5') of the nucleic acid sequence encoding PRPF31.

[0072] In some embodiments, the isolated nucleic acid comprises an AAV 5' ITR, a promoter, a nucleic acid sequence encoding PRPF31, and an AAV 3' ITR. In some embodiments, the isolated nucleic acid comprises an AAV 5' ITR, a promoter, a nucleic acid sequence encoding PRPF31, a WPRE, and an AAV 3' ITR. In some embodiments, the isolated nucleic acid comprises an AAV 5' ITR, a promoter, a nucleic acid sequence encoding PRPF31, a WPRE, a polyadenylation signal, and an AAV 3' ITR. In some embodiments, the isolated nucleic acid comprises the nucleic acid sequences of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4. In some embodiments, the isolated nucleic acid comprises the nucleic acid sequences of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, and SEQ ID NO:5. In some embodiments, the isolated nucleic acid comprises the nucleic acid sequences of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6. In some embodiments, the isolated nucleic acid is or comprises a nucleic acid sequence having about 70% or greater sequence identity to SEQ ID NO:7. In some embodiments, the isolated nucleic acid is or comprises a nucleic acid sequence having about 75% or greater sequence identity to SEQ ID NO:7. In some embodiments, the isolated nucleic acid is or comprises a nucleic acid sequence having about 80% or greater sequence identity to SEQ ID NO:7. In some embodiments, the isolated nucleic acid is or comprises a nucleic acid sequence having about 85% or greater sequence identity to SEQ ID NO:7. In some embodiments, the isolated nucleic acid is or comprises a nucleic acid sequence having about 90% or greater sequence identity to SEQ ID NO:7. In some embodiments, the isolated nucleic acid is or comprises a nucleic acid sequence having about 95% or greater sequence identity to SEQ ID NO:7. In some embodiments, the isolated nucleic acid is or comprises a nucleic acid sequence having about 99% or greater sequence identity to SEQ ID NO:7. In some embodiments, the isolated nucleic acid is or comprises the nucleic acid sequence of SEQ ID NO:7.

[0073] vector Various vectors may contain the isolated nucleic acids provided in this disclosure. In some embodiments, the vector is a bacterial artificial chromosome (BAC), a cosmid, a phagemid, a plasmid, or a viral vector. In some embodiments, the vector is a recombinant vector. In some embodiments, the vector is a recombinant BAC, a recombinant cosmid, a recombinant phagemid, a recombinant plasmid, or a recombinant viral vector. Other suitable vectors are known in the art. In some embodiments, the vector is delivered using a suitable carrier, such as a liposome, a cell-penetrating peptide, an antibody, etc.

[0074] viral vectors In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is a recombinant viral vector. Recombinant viral vectors have become widely used to insert nucleic acid sequences (e.g., genes or inhibitory nucleic acids) into mammalian cells (e.g., human cells). Many types of viral vectors can be used to deliver a payload (e.g., a payload described herein, e.g., an isolated nucleic acid described herein) to a cell, tissue, or organism.

[0075] Non-limiting examples of recombinant viral vectors include, but are not limited to, adeno-associated virus (AAV), retrovirus (e.g., Moloney murine leukemia virus (MMLV), Harvey osteosarcoma virus, mouse mammary tumor virus, or Rous sarcoma virus), adenovirus, SV40 virus, polyomavirus, Epstein-Barr virus, papillomavirus, herpesvirus, vaccinia virus, baculovirus, or poliovirus.

[0076] In some embodiments, the recombinant viral vector comprises or is a retroviral vector. Retroviruses are enveloped viruses that belong to the viral family Retroviridae. Protocols for producing replication-defective retroviruses are known in the art (see, e.g., Kriegler, M., Gene Transfer and Expression, A Laboratory Manual, W.H. Freeman Co., New York (1990) and Murry, E.J., Methods in Molecular Biology, Vol. 7, Humana Press, Inc., Cliffton, NJ (1991), each of which is incorporated herein by reference in its entirety). Several retroviral systems are known in the art (see, e.g., U.S. Pat. Nos. 5,994,136, 6,165,782, and 6,428,953, each of which is incorporated herein by reference in its entirety). In some embodiments, the retrovirus comprises or is a lentivirus of the Retroviridae family. In some embodiments, the lentivirus comprises or is a human immunodeficiency virus (e.g., HIV-1 or HIV-2), a simian immunodeficiency virus (S1V), a feline immunodeficiency virus (FIV), an equine infectious anemia (EIA), or a visna virus.

[0077] In some embodiments, the recombinant viral vector comprises or is an adenoviral vector. The adenoviral vector can be derived from any origin, subgroup, subtype, serotype, or mixture thereof. For example, the adenovirus can be from subgroup A (e.g., serotype 12, 18, or 31), subgroup B (e.g., serotype 3, 7, 11, 14, 16, 21, 34, 35, or 50), subgroup C (e.g., serotype 1, 2, 5, or 6), subgroup D (e.g., serotype 8, 9, 10, 13, 15, 17, 19, 20, 22-30, 32, 33, 36-39, or 42-48), subgroup E (e.g., serotype 4), subgroup F (e.g., serotype 40 or 41), an unclassified serogroup (e.g., serotype 49 or 51), or any other adenovirus serotype. Adenovirus serotypes 1 to 51 are available from the American Type Culture Collection (ATCC, Manassas, VA, USA).

[0078] Non-group C adenoviruses, and even non-human adenoviruses, can be used to prepare replication-deficient adenoviral vectors. Non-group C adenoviral vectors, methods for generating non-group C adenoviral vectors, and methods for using non-group C adenoviral vectors are described, for example, in Adenoviral vectors are disclosed in U.S. Patent Nos. 5,801,030, 5,837,511, and 5,849,561, and International Patent Applications WO97 / 12986 and WO98 / 53087, each of which is incorporated herein by reference in its entirety. Further examples of adenoviral vectors can be found in U.S. Patent Nos. 20150093831, 20140248305, 20120283318, 20100008889, 20090175897, and 20090088398, each of which is incorporated herein by reference in its entirety.

[0079] In some embodiments, the recombinant viral vector comprises or is an alphavirus. Exemplary alphaviruses include, but are not limited to, Sindbis virus, Aura virus, Babanki virus, Barmah Forest virus, Bebaru virus, Cabassou virus, Chikungunya virus, Eastern equine encephalitis virus, Everglades virus, Fort Morgan virus, Getah virus, Highlands J virus, Kyzylagach virus, Mayaro virus, MeTri virus, Middelburg virus, Mosso das Pedras virus, Mucambo virus, Ndumu virus, O'nyong-nyong virus, Pixuna virus, Rio Negro virus, Ross River virus, Salmon pancreas disease virus, Semliki Forest virus, Southern elephant seal virus, Tonate virus, Trocara virus, Una virus, Venezuelan equine encephalitis virus, Western equine encephalitis virus, and Wataroa virus. Generally, the genomes of such viruses encode nonstructural proteins (e.g., replicons) and structural proteins (e.g., capsids and envelopes) that can be translated in the cytoplasm of host cells. Ross River virus, Sindbis virus, Semliki Forest virus (SFV), and Venezuelan equine encephalitis virus (VEEV) have all been used to develop viral transfer vectors for transgene delivery. Pseudotyped viruses can be formed by combining the envelope glycoproteins of an alphavirus with the capsid of a retrovirus. Examples of alphavirus vectors can be found in U.S. Patent Nos. 20150050243, 20090305344, and 20060177819, each of which is incorporated herein by reference in its entirety.

[0080] In some embodiments, recombinant viral vector comprises or is AAV vector.AAV system is generally well known in the art (see, for example, Kelleher and Vos, Biotechniques, 17(6):1110-17(1994); Cotten et al., PNAS USA, 89(13):6094-98(1992); Curiel, Nat Immun, 13(2-3):141-64(1994); Muzyczka, Curr Top Microbiol Immunol, 158:97-129(1992); and Asokan A, et al., Mol. Ther., 20(4):699-708(2012), each of which is incorporated herein by reference in its entirety). Methods for producing and using AAV vectors are described, for example, in U.S. Patent Nos. 5,139,941 and 4,797,368, each of which is incorporated by reference herein in its entirety.

[0081] Generally, the AAV vectors for use in the methods, compositions, and systems described herein can be of any AAV serotype. AAV serotypes generally have different tropisms for infecting different tissues. In some embodiments, the AAV serotype is selected based on tropism. Multiple AAV serotypes have been identified, including, but not limited to, AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAVrhlO, AAVrhl74, AAV-HSC1-17, AAV-CBr, AAV-CLv, AAV-CLg, AAV-DJ, AAV-PHP.B, AAV-PHP.N, or AAV.CAP-B1 through AAV.CAP-B25, and variants or hybrids thereof.

[0082] In some embodiments, the AAV vector is selected from the group consisting of those described in U.S. Patent Nos. 7,906,111; 6,759,237; 7,105,345; 7,186,552; 9,163,260; 9,567,607; 4,797,368; 5,139,941; 5,252,479; 6,261,834; 7,718,424; 8,507,267; 8,846,389; 6,984,517; 7,479,554; 6,156,30 No. 3; No. 8,906,675; No. 7,198,951; No. 10,041,090; No. 9,790,472; No. 10,308,958; No. 10,526,617; No. 7,282,199; No. 7,790,449; No. 8, No. 962,332; No. 9,587,250; No. 10,590,435; No. 10,265,417; No. 10,485,883; No. 7,588,772; No. 8,067,01; No. 8,574,583; No. 8,906,387; Nos. 8,734,809; 9,284,357; 10,035,825; 8,628,966; 8,927,514; 9,623,120; 9,777,291; 9,783,825; 9,803,218; 9,834,789, 9,839,696, 9,585,971, or 10,519,198, U.S. Publication Nos. 2017 / 0166926, 2019 / 0015527; or 2020 / 0080109; or International Publication Nos. WO2018 / 160582, WO2020 / 028751, or WO2020 / 068990, each of which is incorporated by reference in its entirety.

[0083] In some embodiments, the AAV vector comprises or is a single-stranded (ss) or self-complementary (sc) AAV vector. In some embodiments, the AAV vector comprises an expression construct and one or more regions containing ITR sequences (e.g., wild-type ITR sequences or engineered or modified ITR sequences) flanking the expression construct. In some embodiments, the expression construct comprises any one or combination of an enhancer, a promoter, a nucleic acid sequence encoding a desired product (e.g., a polypeptide), a WPRE, or a 3'UTR element (e.g., a polyadenylation signal).

[0084] Adeno-associated virus (AAV) Various adeno-associated viruses (AAVs) are provided herein. In some embodiments, the present disclosure provides a recombinant AAV (rAAV). In some embodiments, the present disclosure provides a rAAV comprising (i) a capsid and (ii) an isolated nucleic acid described herein or a vector described herein.

[0085] AAV is a small, non-enveloped virus that packages a single-stranded, linear DNA genome approximately 4.7–5 kb in length. AAV, a member of the Parvoviridae family, was discovered in 1965 as a contaminant of an adenovirus isolate. AAV has not been associated with human or animal disease, despite most humans (>70%) being seropositive for one or more serotypes (Calcedo et al. (2011); Calcedo et al. (2009)). Both positive and negative DNA strands are packaged equally, and infection can be initiated with particles containing either strand. The virus possesses a T=1 icosahedral capsid (25 nm in diameter) and is considered highly stable. It has been shown to be resistant to heat, acidic pH, and brief exposure to proteases. The viral genome contains three open reading frames (ORFs), rep (replication), cap (capsid), and aap (assembly activating protein), which together encode eight proteins (Rep78, Rep68, Rep52, Rep40, VP1, VP2, VP3, and AAP) expressed from three promoters (p5, p19, and p40). The mature capsid consists of one ORF (cap) and the amino acid sequence of the packaged DNA. Therefore, recombinant AAV (rAAV) vectors can present a small target to the host immune system.

[0086] Inverted terminal repeats (ITRs) The present disclosure recognizes that the coding region of AAV is typically 145 bases long in wild-type AAV and is flanked by inverted terminal repeats (ITRs) with a complex T-shaped structure. These repeats are the origin of DNA replication and act as a primary packaging signal (McLaughlin et al. (1988); Hauswirth et al. (1977)). The present disclosure further recognizes that the ITRs are the only cis-acting sequences required for rAAV production and are the only AAV coding sequences present in AAV vectors (McLaughlin et al. (1988); Samulski et al. (1989)). AAV ITRs have enhancer activity in the presence of Rep proteins but minimal promoter or enhancer activity in the absence of Rep proteins. Therefore, transgenes cloned into AAV vectors must be designed with appropriate enhancers, promoters, polyadenylation signals, and / or splice sites to ensure correct gene expression.

[0087] Various ITRs are provided by the present disclosure. In some embodiments, the ITRs of the present disclosure can include ITRs from any AAV serotype. In some embodiments, the ITRs of the present disclosure can include ITRs from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, or any combination thereof. In some embodiments, the ITRs of the present disclosure can include ITRs that have been engineered or modified using methods known in the art. In some embodiments, the ITRs of the present disclosure can include one or more sequence modifications (e.g., deletions, substitutions) compared to wild-type ITR sequences.

[0088] The ITRs of the AAV vector can be derived from any AAV serotype (e.g., AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAVrh10, AAVrh74, AAV-HSC1-17, AAV-CBr, AAV-CLv, AAV-CLg, AAV-DJ, AAV-PHP.B, AAV-PHP.N, or AAV.CAP-B1 through AAV.CAP-B25, or variants or hybrids thereof).In some embodiments, the ITR is a hydroxybenzoate or hydroxybenzoate derivative, as described in, for example, U.S. Patent Nos. 7,906,111; 6,759,237; 7,105,345; 7,186,552; 9,163,260; 9,567,607; 4,797,368; 5,139,941; 5,252,479; 6,261,834; 7,718,424; 8,507,267; 8,846,389; 6 ,984,517; 7,479,554; 6,156,303; 8,906,675; 7,198,951; 10,041,090; 9,790,472; 10,308, 958; 10,526,617; 7,282,199; 7,790,449; 8,962,332; 9,587,250; 10,590,435; 10,265,417; No. 10,485,883; No. 7,588,772; No. 8,067,01; No. 8,574,583; No. 8,906,387; No. 8,734,809; No. 9,284,357; No. 10,035, 825; 8,628,966; 8,927,514; 9,623,120; 9,777,291; 9,783,825; 9,803,218; 9,834,789; Nos. 9,839,696; 9,585,971; or 10,519,198; U.S. Publication Nos. 2017 / 0166926; 2019 / 0015527; 2019 / 0054188; or 2020 / 0080109; or International Publication Nos. WO2018 / 160582; WO2020 / 028751; or WO2020 / 068990, each of which is incorporated by reference herein in its entirety.

[0089] ITR sequences and plasmids containing ITR sequences are known in the art and are commercially available (e.g., products and services available from Vector Biolabs (Philadelphia, PA), Cellbiolabs (San Diego, CA), Agilent Technologies (Santa Clara, CA), and Addgenes (Cambridge, MA), as well as those described in Kessler et al. PNAS. 1996 Nov 26;93(24):14082-7; Machida. Methods in Molecular Medicine™. Viral Vectors for Gene Therapy Methods and Protocols. 10.1385 / 1-59259-304-6:201 (c) Humana Press Inc. 2003. Chapter 10. Targeted Integration by Adeno-Associated Virus, and U.S. Patent Nos. 5,139,941 and 5,962,313, each of which is incorporated herein by reference in its entirety.

[0090] Capsid The present disclosure encompasses the recognition that over 110 different primate AAV capsid sequences have been isolated. Each of these AAV capsids, with its own unique serological profile, is designated as a specific AAV serotype. It is further understood that the present disclosure describes at least 12 primate serotypes (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12). Capsids from any serotype can be used in some embodiments of the present disclosure. In some embodiments, modified or engineered capsids, including but not limited to those described herein, can be used in accordance with the present disclosure.

[0091] This disclosure recognizes that numerous studies have evaluated and compared serotypes with respect to their transduction efficiency in in vivo tissues. For example, in striated muscle, these studies achieved high transduction efficiency with AAV1, AAV6, and AAV7. Similarly, AAV8 and AAV9 have been confirmed to transduce striated muscle with at least high efficiency. AAV8 and AAV9 are believed to have the highest hepatocyte transduction levels. In the pulmonary system, rAAV6 and rAAV9 transduce much of the entire airway epithelium, while rAAV5 transduction is limited to alveolar cells. With regard to central nervous system transduction, rAAV serotypes 1, 4, 5, 7, and 8 have been found to be efficient transducers of neurons in various regions of the brain. rAAV1 and rAAV5 have also been reported to transduce ependymal and glial cells. In the eye, rAAV serotypes 1, 4, 5, 7, 8, and 9 efficiently transduce the retinal pigment epithelium, while rAAV5, rAAV7, and rAAV8 transduce photoreceptors as well. rAAV1, rAAV8, and rAAV9 demonstrate the highest reported transduction in pancreatic tissue, primarily acinar cells. The kidney is considered a relatively difficult organ to transduce, although proximal tubule cells are transduced at low levels by rAAV2, as are glomeruli by rAAV9. Furthermore, rAAV1 has been shown to transduce adipose tissue, even with the aid of non-ionic detergents.

[0092] This disclosure further recognizes that it may be advantageous to modify or engineer wild-type AAV capsids to achieve modified tissue tropism and / or immune system evasion. One way to achieve these benefits is to produce vectors in the presence of cap genes from multiple serotypes. Depending on the ratio of capsid proteins from each serotype, the resulting "mosaic" virions may exhibit combined tropism for cell types or, in some cases, tropism not exhibited by either serotype individually. Some studies have involved attaching exogenous molecules to the capsid. One example utilizes a bispecific antibody, obtained by fusing the Fc regions of two different antibodies, an anti-capsid antibody and an anti-cell marker antibody, to confer rAAV2 tropism to a transduction-resistant megakaryocytic cell line. Another example employs an approach in which the capsid is biotinylated and then bound to a streptavidin conjugate carrying epidermal growth factor or fibroblast growth factor. This approach has been shown to result in at least a ten-fold increase in the transduction of cells highly expressing epidermal growth factor or fibroblast growth factor receptors, respectively.

[0093] The present disclosure also recognizes that instead of attaching molecules to the capsid surface, it may be advantageous to engineer modifications directly into the capsid gene. As a non-limiting example, green fluorescent protein (GFP) (238 amino acids) can be inserted into AAV2VP1 and VP2. The transduction efficiencies of the VP1-GFP and VP2-GFP vectors were three and five orders of magnitude lower, respectively, than those of wild-type capsids, but transduction did occur in HeLa cells, suggesting tolerance to the inserted sequences in the capsid protein. As another non-limiting example, to modify capsid genes for tissue targeting, several researchers have inserted peptide sequences based on known ligand-receptor interactions or selected peptides in phage display libraries. Another strategy involves inserting random sequences of amino acids and then selecting the best-performing capsids in vitro. Instead of introducing target-specific peptides, some experiments modified the capsid generically, reserving subsequent modification for selected targets. For example, antibody Fc binding sites have been inserted into the capsid, followed by binding of different antibodies specific to receptors on various cell lines. Another such modification is the insertion of biotin-binding sites into the capsid. This facilitates metabolic biotinylation and allows for flexible targeting with any avidin-conjugated ligand. Some experiments have utilized peptide insertions and mosaic capsids, using virions containing both wild-type and engineered capsid proteins, or virions containing a combination of multiple different modified capsid proteins. Other techniques aimed at evading the immune system are under investigation, including coating the capsid with polymers.

[0094] production Methods for producing and isolating rAAVs having desired isolated nucleic acid sequences or vectors and capsids are known in the art. The rAAVs of the present disclosure can be produced and isolated according to any suitable method, for example, the methods described in Clement and Grieger (2016), Grieger et al. (2016), and Martin et al. (2013), the contents of each of which are incorporated herein by reference in their entirety. Without wishing to be bound by any particular theory or process, this method typically involves culturing a host cell containing a nucleic acid sequence encoding an AAV capsid protein or a fragment thereof (e.g., a cap gene), a functional rep gene, AAV ITRs (e.g., an AAV 5' ITR and an AAV 3' ITR), and a nucleic acid sequence encoding a product of interest (e.g., a polypeptide, e.g., a wild-type polypeptide), as well as sufficient helper functions to package the recombinant AAV vector into the AAV capsid protein.

[0095] Components cultured in a host cell to package an isolated nucleic acid sequence or vector into an AAV capsid can be provided in trans to the host cell. Alternatively, any one or more of the necessary components (e.g., the isolated nucleic acid sequence or vector, the rep sequence, the cap sequence, and / or helper functions) can be provided by a stable host cell engineered to contain one or more of the necessary components using methods known to those skilled in the art. Most suitably, such a stable host cell contains the necessary component(s) under the control of an inducible promoter. However, the necessary component(s) can also be under the control of a constitutive promoter. Examples of suitable promoters are provided herein. In yet another alternative, the selected stable host cell can contain selected component(s) under the control of a constitutive promoter and other selected component(s) under the control of one or more inducible promoters. For example, stable host cells can be generated derived from 293 cells (containing E1 helper functions under the control of a constitutive promoter) but containing the rep and / or cap proteins under the control of an inducible promoter. Additionally, other stable host cells are known in the art or can be generated by one skilled in the art.

[0096] The isolated nucleic acid sequences or vectors, rep sequences, cap sequences, and helper functions necessary to produce the rAAV of the present disclosure can be delivered to a packaging host cell using any suitable genetic elements (e.g., vectors). The selected genetic elements can be delivered by any suitable method (e.g., transfection), such as those described herein. The methods used to construct any embodiment of the present disclosure are known to those skilled in the art of nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY. Similarly, methods for producing rAAV virions are well known, and the selection of a suitable method is not a limitation of the present disclosure. See, e.g., K. Fisher et al., 1993 and U.S. Patent No. 5,478,745.

[0097] In some embodiments, rAAV can be produced using a triple transfection method (e.g., as described in detail in U.S. Pat. No. 6,001,650, the disclosure of which is incorporated herein by reference). rAAV is produced by transfecting a host cell with a suitable vector (comprising a nucleic acid sequence encoding a product of interest, e.g., a polypeptide) to be packaged into rAAV particles, an AAVrep / cap vector, and a helper function vector. The AAVrep / cap vector encodes the rep and cap AAV sequences that function in trans for productive AAV replication and encapsidation. In some embodiments, the AAVrep / cap vector supports efficient AAV vector production without producing any detectable wild-type AAV virions (e.g., AAV virions containing functional rep and cap genes). Non-limiting examples of vectors suitable for use in the present disclosure include pHLP19, described in U.S. Patent No. 6,001,650, and the pRep6cap6 vector, described in U.S. Patent No. 6,156,303, both of which are incorporated herein by reference in their entireties. Helper function vectors encode nucleotide sequences for non-AAV-derived viral and / or cellular functions (e.g., "helper functions") on which AAV replication depends. Helper functions include functions required for AAV replication, such as, but not limited to, those involved in activation of AAV gene transcription, stage-specific AAV mRNA splicing, AAV DNA replication, synthesis of cap expression products, and AAV capsid assembly. Viral-based helper functions can be derived from any of the known helper viruses, such as adenovirus, herpesvirus (other than herpes simplex virus type 1), and vaccinia virus.

[0098] Recombinant viral particles The present disclosure provides, among other things, methods, compositions, and systems for comprising or producing recombinant viral particles (e.g., recombinant adeno-associated virus rAAV particles). In some embodiments, the rAAV particles comprise an isolated nucleic acid described herein. In some embodiments, the rAAV particles comprise a vector described herein. In some embodiments, the rAAV particles comprise an AAV genome and a capsid. In some embodiments, the rAAV particles comprise an AAV genome comprising an isolated nucleic acid as described herein, and a capsid. In some embodiments, the rAAV particles comprise an AAV genome comprising a vector and a capsid described herein. In some embodiments, the rAAV particles comprise a modified AAV genome and capsid comprising a nucleic acid sequence encoding a polypeptide. In some embodiments, the rAAV particles comprise a modified AAV genome and capsid comprising (i) a promoter, (ii) a nucleic acid sequence encoding a polypeptide, and (iii) a WPRE. In some embodiments, the rAAV particle comprises a modified AAV genome including (i) a 5' ITR, (ii) a promoter, (iii) a nucleic acid sequence encoding a polypeptide, (iv) a WPRE, and (v) a 3' ITR, and a capsid. In some embodiments, the rAAV particle comprises a modified AAV genome including (i) a 5' ITR, (ii) a promoter, (iii) a nucleic acid sequence encoding a polypeptide, (iv) a WPRE, (v) a 3' UTR element, and (vi) a 3' ITR, and a capsid. In some embodiments, the polypeptide is PRPF31. In some embodiments, the PRPF31 polypeptide is wild-type PRPF31.

[0099] In some embodiments, AAV serotypes may have or include mutations in the AAV2 sequence (e.g., as described in Wu et al., J Virol. 2000 Sep;74(18):8635-47, herein incorporated by reference in its entirety). Other AAVs are, for example, as described in Sharma et al., Brain Res Bull. 2010 Feb 15;81(2-3):273, herein incorporated by reference in its entirety.

[0100] In some embodiments, the AAV comprises or is a naturally occurring AAV. In some embodiments, the AAV is a modified AAV or a variant of a naturally occurring AAV. In some embodiments, the AAV can be generated by directed evolution (e.g., DNA shuffling, peptide insertion, or random mutation) to introduce modifications into the AAV sequence to improve one or more properties in gene therapy. In some embodiments, such modifications avoid or reduce immune responses or recognition by neutralizing antibodies and / or allow for more efficient and / or targeted delivery (see, e.g., Asuri et al., Molecular Therapy 20.2(2012):329-338, which is incorporated herein by reference in its entirety). Methods for engineering AAV using directed evolution can be found, for example, in U.S. Patent No. 8,632,764, which is incorporated herein by reference in its entirety. In some embodiments, the modified AAV is modified to contain a specific tropism.

[0101] In some embodiments, the AAV may be a dual or triple AAV composition, e.g., to address safety concerns and / or to deliver large payloads (e.g., payloads greater than about 5 kb). In some embodiments, a dual AAV composition may comprise two separate AAV particles, each containing fragments of the complete sequence of a large payload of interest, which, when recombined, form the complete sequence of the large payload of interest or a functional portion thereof. In some embodiments, a triple AAV vector may comprise three separate AAV vectors, each containing fragments of the sequence of a large payload of interest, which, when recombined, form the complete sequence of the large payload of interest or a functional portion thereof.

[0102] Multiple AAVs (e.g., double or triple AAV compositions) can be delivered and co-transduced into the same cell, where fragments of the payload of interest recombine to generate a single mRNA transcript of the entire payload of interest. In some embodiments, the fragmented payloads comprise non-overlapping sequences. In some embodiments, the fragmented payloads comprise one or more specified overlapping sequences. In some embodiments, the multiple AAVs for double or triple transfection can be of the same type (e.g., the same serotype and / or the same construct). In some embodiments, the multiple AAVs for double or triple transfection can be of different types (e.g., different serotypes and / or different constructs).

[0103] In some embodiments, the rAAV comprises an isolated nucleic acid or vector (e.g., an AAV vector) described herein. In some embodiments, the rAAV comprises an AAV vector encapsidated by a viral capsid. In some embodiments, the viral capsid comprises 60 capsid protein subunits. In some embodiments, the viral capsid comprises VP1, VP2, and VP3. In some embodiments, the VP1, VP2, and VP3 subunits are present in the capsid in a ratio of about 1:1:10, respectively.

[0104] The rAAV vector may comprise or be based on a serotype selected from any of the following serotypes or variants thereof, including, but not limited to, AAV9.68, AAV1, AAV10, AAV106.1 / hu.37, AAV11, AAV114.3 / hu.40, AAV 12, AAV127.2 / hu.41, AAV127.5 / hu.42, AAV128.1 / hu.43, AAV128.3 / hu.44, AAV130.4 / hu.48, AAV145.1 / hu.53, AAV145.5 / hu.54, AAV145.6 / hu.55, AAV16.12 / hu.11, AAV16.3, AAV16.8 / hu.10, AAV161.10 / hu.60, AAV161 .6 / hu.61, AAV1-7 / rh.48, AAV1-8 / rh.49, AAV2, AAV2.5T, AAV2-15 / rh.62, AAV223.1, AAV223.2, AAV223.4, AA V223.5, AAV223.6, AAV223.7, AAV2-3 / rh.61, AAV24.1, AAV2-4 / rh.50, AAV2-5 / rh.51, AAV27.3, AAV29.3 / bb. l, AAV29.5 / bb.2, AAV2G9, AAV-2-pre-miRNA-101, AAV3, AAV3.1 / hu.6, AAV3.1 / hu.9, AAV3-11 / rh.53, AAV3-3, AAV33.12 / hu.l7, AAV33.4 / hu.l5, AAV 33.8 / hu.l6, AAV3-9 / rh.52, AAV3a, AAV3b, AAV4, AAV4-19 / rh.55, AAV42.12, AAV42-10, AAV42-11, AAV42-12, AAV42-13, AAV42-15, AAV42-lb, AAV42- 2, AAV42-3a, AAV42-3b, AAV42-4, AAV42-5a, AAV42-5b, AAV42-6b, AAV42-8, AAV42-aa, AAV43-1, AAV43-12, AAV43-20, AAV43-21, AAV43-23, AAV43-25 , AAV43-5, AAV4-4, AAV44.1, AAV44.2, AAV44.5, AAV46.2 / hu.28, AAV46.6 / hu.29, AAV4-8 / r11.64, AAV4-8 / rh.64, AAV4-9 / rh.54, AAV5, AAV52.1 / hu.20、AAV52 / hu.19、AAV5-22 / rh.58、AAV5-3 / rh.57、AAV54.1 / hu.21、AAV54.2 / hu.22、AAV54.4R / hu.27、AAV54.5 / hu.23、AAV54.7 / hu.24、AAV58.2 / hu.25、AAV6、AAV6.1、AAV6.1.2、AA V6.2、AAV7、AAV7.2、AAV7.3 / hu.7、AAV8、AAV-8b、AAV-8h、AAV9、AAV9.11、AAV9.13、AAV9.1 6、AAV9.24、AAV9.45、AAV9.47、AAV9.61、AAV9.84、AAV9.9、AAVA3.3、AAVA3.4、AAVA3.5、AAV A3.7、AAV-b、AAVC1、AAVC2、AAVC5、AAVCh.5、AAVCh.5R1、AAVcy.2、AAVcy.3、AAVcy.4、AAVcy.5、AAVCy.5R 1、AAVCy.5R2、AAVCy.5R3、AAVCy.5R4、AAVcy.6、AAV-DJ、AAV-DJ8、AAVF3、AAVF5、AAV-h、AAVH-1 / hu.l、AA VH2、AAVH-5 / hu.3、AAVH6、AAVhE1.1、AAVhER1.14、AAVhEr1.16、AAVhEr1.18、AAVhER1.23、AAVhEr1.35、AAVhEr1.35 AVhEr1.36、AAVhEr1.5、AAVhEr1.7、AAVhEr1.8、AAVhEr2.16、AAVhEr2.29、AAVhEr2.30、AAVhEr2.31、AAVh Er2.36、AAVhEr2.4、AAVhEr3.1、AAVhu.1、AAVhu.10、AAVhu.11、AAVhu.12、AAVhu.13、AAVhu.14 / 9、AAVhu .15、AAVhu.16、AAVhu.17、AAVhu.18、AAVhu.19、AAVhu.2、AAVhu.20、AAVhu.21、AAVhu.22、AAVhu.23.2、AAVhu. AVhu.24、AAVhu.25、AAVhu.27、AAVhu.28、AAVhu.29、AAVhu.29R、AAVhu.3、AAVhu.31、AAVhu.32、AAVhu.3 4、AAVhu.35、AAVhu.37、AAVhu.39、AAVhu.4、AAVhu.40、AAVhu.41、AAVhu.42、AAVhu.43、AAVhu.44、AAVhu.44R1、AAVhu.44R2、AAVhu.44R3、AAVhu.45、AAVhu.46、AAVhu.47、AAVhu.48、AAVhu.48R1、A AVhu.48R2、AAVhu.48R3、AAVhu.49、AAVhu.5、AAVhu.51、AAVhu.52、AAVhu.53、AAVhu.54、A AVhu.55、AAVhu.56、AAVhu.57、AAVhu.58、AAVhu.6、AAVhu.60、AAVhu.61、AAVhu.63、AAVhu.64、AAVhu.66、AAVhu.67、AAVhu.7、AAVhu.8、AAVhu.9、AAVhu.t19、AAVLG-10 / rh.40、AAVLG -4 / rh.38、AAVLG-9 / hu.39、AAVLG-9 / hu.39、AAV-LK01、AAV-LK02、AAVLK03、AAV-LK03、AAV -LK04、AAV-LK05、AAV-LK06、AAV-LK07、AAV-LK08、AAV-LK09、AAV-LK10、AAV-LK11、AAV-LK1 2、AAV-LK13、AAV-LK14、AAV-LK15、AAV-LK17、AAV-LK18、AAV-LK19、AAVN721-8 / rh.43、AAV-PAEC、AAV-PAEC11、AAV-PAEC12、AAV-PAEC2、AAV-PAEC4、AAV-PAEC6、AAV-PAEC7、AAV-PAEC 8、AAVpi.1、AAVpi.2、AAVpi.3、AAVrh.10、AAVrh.12、AAVrh.13、AAVrh.13R、AAVrh.14、AAVrh.17、AAVrh.18、AAVrh.19、AAVrh.2、AAVrh.20、AAVrh.21、AAVrh.22、AAVrh.23、AAVrh.24、AAVrh.25、AAVrh.2R、AAVrh.31、AAVrh.32、AAVrh.33 ,AAVrh.34,AAVrh.35,AAVrh.36,AAVrh.37,AAVrh.37R2,AAVrh.38,AAVrh.39,AAVrh.40,AAVrh.43,AAVrh.44,AAVrh.45,AAVrh.46,AAVrh.47,AAVrh.48,AAVrh.48,AAVrh.48.1,AAVrh.48.1.2,AAVrh.48.2,AAVrh.49,AAVrh.50,AAVrh.51, AAVrh.52, AAVrh.53, AAVrh.54, AAVrh.55, AAVrh.56, AAVrh.57, AAVrh.58, AAVrh.59, AAVrh.60, AAVrh.61, AAVrh.62, AAVrh.64, AAVrh.6 4R1, AAVrh.64R2, AAVrh.65, AAVrh.67, AAVrh.68, AAVrh.69, AAVrh.70, AAVrh.72, AAVrh.73, AAVrh.74, AAVrh.8, AAVrh.8R, AAVrh8R, AAVrh8R A586R variant, AAVrh8R R533A variant, BAAV, B P61 AAV, B P62AAV, B P63 AAV, bovine AAV, caprine AAV, Japan AAV10, true type AAV (ttAAV), UPENN AAV10, AAV-LK16, AAAV, AAV Shuffle 100-1, AAV Shuffle 100-2, AAV Shuffle 100-3, AAV Shuffle 100-7, AAV Shuffle 10-2, AAV Shuffle 10-6, AAV Shuffle 10-8, AAV SM100-10, AAV SM100-3, AAV SM10-1, AAV SM10-2, and AAV SM10-8.

[0105] The AAV serotype can be derived from any number of species. For example, the AAV can be or include avian AAV (AAAV), for example, as described in U.S. Patent No. 9,238,800 (incorporated herein by reference in its entirety). The AAV serotype can be or include bovine AAV (BAAV), for example, as described in U.S. Patent No. 9,193,769 or 7,427,396 (each of which is incorporated herein by reference in its entirety). The AAV can be or include caprine AAV, for example, as described in U.S. Patent No. 7,427,396 (incorporated herein by reference in its entirety). The AAV serotype can also be a variant or hybrid of any of the foregoing. In some embodiments, the rAAV can be or include a serotype generated from an AAV2 capsid library.

[0106] In some embodiments, the rAAV comprises a capsid, such as a modified capsid protein (e.g., a capsid protein comprising a modified VP3 region). Methods for producing modified capsid proteins are known in the art (see, e.g., US20130310443, which is incorporated herein by reference in its entirety). In some embodiments, the rAAV comprises a modified capsid protein comprising at least one unnatural amino acid substitution at a position corresponding to a surface-exposed amino acid (e.g., a surface-exposed tyrosine) in the wild-type capsid protein. In some embodiments, the rAAV comprises a modified capsid protein comprising a non-tyrosine amino acid (e.g., phenylalanine) at a position corresponding to a surface-exposed tyrosine amino acid in the wild-type capsid protein, a non-threonine amino acid (e.g., valine) at a position corresponding to a surface-exposed threonine amino acid in the wild-type capsid protein, a non-lysine amino acid (e.g., glutamic acid) at a position corresponding to a surface-exposed lysine amino acid in the wild-type capsid protein, a non-serine amino acid (e.g., valine) at a position corresponding to a surface-exposed serine amino acid in the wild-type capsid protein, or a combination thereof. In some embodiments, the rAAV comprises a capsid comprising a modified capsid protein with at least one, two, three, four, five, six, seven, eight, nine, ten, or more amino acid substitutions.

[0107] Further methods for producing and isolating rAAV suitable for delivery to a subject are described, for example, in U.S. Pat. No. 7,790,449; U.S. Pat. No. 7,282,199; WO2003 / 042397; WO2005 / 033321; WO2006 / 110689; and U.S. Pat. No. 7,588,772, each of which is incorporated by reference herein in its entirety.

[0108] Characterization and evaluation In some embodiments, the properties and / or activities of the provided isolated nucleic acids, vectors, rAAV, and compositions thereof may be characterized or evaluated using a variety of techniques available to those of skill in the art, such as biochemical assays, cell-based assays, animal models, or clinical trials. Particular useful techniques are described in the Examples. Those skilled in the art, upon reading this disclosure, will readily appreciate that other techniques (e.g., in vitro models (e.g., cell lines) of various diseases, disorders, or conditions, animal models of various diseases, disorders, or conditions, etc.) can be designed and / or utilized to evaluate the techniques (e.g., isolated nucleic acids, vectors, rAAV, compositions, or methods) provided in accordance with the present disclosure.

[0109] Biological applications As will be appreciated by those skilled in the art, the isolated nucleic acids, vectors, and rAAVs are useful for many purposes. In some embodiments, the provided technology (e.g., isolated nucleic acids, vectors, rAAVs, compositions thereof, methods thereof) is useful for increasing the level and / or activity of PRPF31 transcripts (e.g., mRNAs) and / or products encoded thereby (e.g., polypeptides and / or proteins). In some embodiments, the provided technology increases the level and / or activity of wild-type PRPF31 transcripts. In some embodiments, the provided technology increases the level and / or activity of wild-type PRPF31 polypeptides.

[0110] In some embodiments, the present disclosure provides a method for increasing PRPF31 expression in a system, comprising administering or delivering to the system an isolated nucleic acid, vector, rAAV, or composition thereof provided herein. In some embodiments, the present disclosure provides a method for increasing PRPF31 expression in a system, comprising administering or delivering to the system an effective amount of an isolated nucleic acid, vector, rAAV, or composition thereof provided herein. In some embodiments, the present disclosure provides a method for increasing PRPF31 levels in a system, comprising administering or delivering to the system an isolated nucleic acid, vector, rAAV, or composition thereof provided herein. In some embodiments, the present disclosure provides a method for increasing PRPF31 polypeptide expression in a system, comprising administering or delivering to the system an effective amount of an isolated nucleic acid, vector, rAAV, or composition thereof provided herein. In some embodiments, the present disclosure provides a method for increasing phagocytosis by retinal pigment epithelial (RPE) cells, comprising administering or delivering to the system an isolated nucleic acid, vector, rAAV, or composition thereof provided herein. In some embodiments, the present disclosure provides a method for increasing phagocytosis by cells of the retinal pigment epithelium (RPE), comprising administering or delivering to a system a therapeutically effective amount of an isolated nucleic acid, vector, rAAV, or composition thereof provided herein. In some embodiments, phagocytosis is quantified by the number of phagosomes in the retinal pigment epithelium (RPE). In some embodiments, phagocytosis is quantified by the binding and internalization of a payload, such as a fluorescent marker.

[0111] In some embodiments, the system is an in vitro system. In some embodiments, the system is an in vivo system. In some embodiments, the system comprises a cell. In some embodiments, the system is a cell. In some embodiments, the system comprises a population of cells. In some embodiments, the system is a population of cells. In some embodiments, the cell is a cell in the eye. In some embodiments, the cell is a retinal cell. In some embodiments, the cell is a cell in the retinal pigment epithelium (RPE). In some embodiments, the cell has one or more characteristics, properties, and / or activities of a retinal cell.

[0112] In some embodiments, the system is a tissue. In some embodiments, the system comprises a tissue. In some embodiments, the system is an organ. In some embodiments, the system comprises an organ. In some embodiments, the system is an eye or a portion thereof. In some embodiments, the system comprises an eye or a portion thereof. In some embodiments, the system is an organism. In some embodiments, the system comprises an organism. In some embodiments, the system is a subject. In some embodiments, the system is a mammal, e.g., a mouse, a rat, a monkey, or a human. In some embodiments, the system is a human.

[0113] In some embodiments, the level is increased by about 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, or more compared to the absence of a provided isolated nucleic acid, vector, rAAV, or composition thereof and / or the presence of a control (e.g., vehicle only). In some embodiments, the level is increased by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500% or more compared to the absence of a provided isolated nucleic acid, vector, rAAV, or composition thereof and / or the presence of a control (e.g., vehicle only).

[0114] In some embodiments, the present disclosure provides a cell comprising an isolated nucleic acid, vector, or rAAV provided herein. In some embodiments, the present disclosure provides a method of administering or delivering an isolated nucleic acid, vector, rAAV, or composition thereof provided herein to a cell. In some embodiments, the present disclosure provides a method of increasing PRPF31 expression in a cell, comprising administering or delivering an isolated nucleic acid, vector, rAAV, or composition thereof provided herein to a cell. In some embodiments, the present disclosure provides a method of increasing PRPF31 expression in a cell, comprising administering or delivering a therapeutically effective amount of an isolated nucleic acid, vector, rAAV, or composition thereof provided herein to a cell. In some embodiments, the present disclosure provides a method of increasing the level of PRPF31 polypeptide in a cell, comprising administering or delivering an isolated nucleic acid, vector, rAAV, or composition thereof provided herein to a cell. In some embodiments, the present disclosure provides a method of increasing PRPF31 polypeptide expression in a cell, comprising administering or delivering a therapeutically effective amount of an isolated nucleic acid, vector, rAAV, or composition thereof provided herein to a cell. In some embodiments, the cell is an isolated cell. In some embodiments, the isolated cell is a prokaryotic cell. In some embodiments, the isolated cell is a eukaryotic cell. In some embodiments, the isolated cell is a mammalian cell. In some embodiments, the isolated cell is an induced pluripotent stem cell (iPSC). In some embodiments, the isolated cell is an iPSC-derived cell. In some embodiments, the isolated cell is a retinal cell. In some embodiments, the isolated cell is a retinal pigment epithelial (RPE) cell. In some embodiments, the cell is a host cell. In some embodiments, the host cell is a prokaryotic cell. In some embodiments, the host cell is a eukaryotic cell. In some embodiments, the host cell is a mammalian cell. In some embodiments, the host cell is a human cell. In some embodiments, the host cell is a retinal cell. In some embodiments, the host cell is an RPE cell.

[0115] In some embodiments, the present disclosure provides a method of administering to a subject an isolated nucleic acid, vector, rAAV, or composition thereof provided herein. In some embodiments, the present disclosure provides a method of administering to a subject a therapeutically effective amount of an isolated nucleic acid, vector, rAAV, or composition thereof provided herein. In some embodiments, the isolated nucleic acid of the present disclosure is administered or delivered via a vector. In some embodiments, the isolated nucleic acid of the present disclosure is administered or delivered via an rAAV.

[0116] In some embodiments, the present disclosure provides a method for increasing expression of PRPF31 in a subject, comprising administering to the subject an isolated nucleic acid, vector, rAAV, or composition thereof provided herein. In some embodiments, the present disclosure provides a method for increasing expression of PRPF31 in a subject, comprising administering to the subject a therapeutically effective amount of an isolated nucleic acid, vector, rAAV, or composition thereof provided herein.

[0117] In some embodiments, the present disclosure provides a method for increasing expression of a PRPF31 polypeptide in a subject, comprising administering an isolated nucleic acid, vector, rAAV, or composition thereof provided herein. In some embodiments, the present disclosure provides a method for increasing the level of a PRPF31 polypeptide in a subject, comprising a therapeutically effective amount of an isolated nucleic acid, vector, rAAV, or composition thereof provided herein.

[0118] In some embodiments, the present disclosure provides a method of treating a subject having a disease, disorder, or condition, comprising administering an isolated nucleic acid, vector, rAAV, or composition thereof provided herein. In some embodiments, the present disclosure provides a method of treating a subject having a disease, disorder, or condition, comprising administering a therapeutically effective amount of an isolated nucleic acid, vector, rAAV, or composition thereof provided herein.

[0119] Various diseases, disorders, or conditions associated with PRPF31 can be prevented or treated using the provided technology. In some embodiments, a subject would benefit from increased levels of wild-type PRPF31 transcript, polypeptide, and / or activity in certain cells, tissues, and / or organs. In some embodiments, the disease, disorder, or condition is retinal degeneration. In some embodiments, the disease, disorder, or condition is retinitis pigmentosa (RP). In some embodiments, the disease, disorder, or condition is retinitis pigmentosa-11 (RP11). In some embodiments, the disease, disorder, or condition is associated with PRPF31. In some embodiments, the disease, disorder, or condition is associated with a mutation in PRPF31.

[0120] In some embodiments, the isolated nucleic acids, vectors, rAAVs, or compositions thereof provided herein may be utilized in combination with another therapy, e.g., another therapeutic agent. In some embodiments, the isolated nucleic acids, vectors, rAAVs, or compositions thereof provided herein may be utilized in combination with one or more immunosuppressants. Various immunosuppressants are known in the art. In some embodiments, the immunosuppressant is a steroid. In some embodiments, the immunosuppressant is a corticosteroid. In some embodiments, the immunosuppressant may be an inhibitor of Janus kinase (JAK). In some embodiments, the immunosuppressant may be a calcineurin inhibitor. In some embodiments, the immunosuppressant may be a cysteine ​​proteinase. In some embodiments, the immunosuppressant may be an antibody or fragment thereof. In some embodiments, the immunosuppressant may be a proteasome inhibitor. In some embodiments, the immunosuppressant is abrocitinib, baricitinib, cyclosporine, dexamethasone (dex), intravenous immunoglobulin (IVIG), methylprednisolone, mycophenolate mofetil (MMF), mycophenolate sodium, prednisone, rituximab, ruxolitinib, sirolimus (rapamycin), tacrolimus (Tacro), tofacitinib (Tofa), hydroxychloroquine, rabbit antithymocyte globulin (rATG), imlifidar, and upadacitinib.

[0121] In some embodiments, one or more immunosuppressants may be administered or delivered prior to the administration of an isolated nucleic acid, vector, rAAV, or composition thereof. In some embodiments, the interval between administration of one or more immunosuppressants provided herein and administration of an isolated nucleic acid, vector, rAAV, or composition thereof may be at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 1 week, at least 2 weeks, at least 3 weeks, at least 1 month, at least 2 months, at least 3 months, at least 6 months, or at least 1 year or more. In some embodiments, one or more immunosuppressants may be administered multiple times prior to administration of an isolated nucleic acid, vector, rAAV, or composition thereof provided herein. In some embodiments, one or more immunosuppressants may be administered at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 1 week, at least 2 weeks, at least 1 month, at least 2 months, at least 3 months, at least 6 months, or at least 1 year prior to administration of an isolated nucleic acid, vector, rAAV, or composition thereof described herein. In some embodiments, one or more immunosuppressants may be administered or delivered simultaneously prior to administration of the isolated nucleic acids, vectors, rAAVs, or compositions thereof described herein. In some embodiments, one or more immunosuppressants may be administered or delivered after administration of the isolated nucleic acids, vectors, rAAVs, or compositions thereof provided herein. In some embodiments, the interval between administration of the isolated nucleic acids, vectors, rAAVs, or compositions thereof provided herein and administration of the one or more immunosuppressants may be at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 1 week, at least 2 weeks, at least 3 weeks, at least 1 month, at least 2 months, at least 3 months, at least 6 months, or at least 1 year or more. In some embodiments, one or more immunosuppressants may be administered in multiple doses after administration of the isolated nucleic acids, vectors, rAAVs, or compositions thereof provided herein.In some embodiments, one or more immunosuppressive agents may be administered at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 1 week, at least 2 weeks, at least 1 month, at least 2 months, at least 3 months, at least 6 months, or at least 1 year after administration of an isolated nucleic acid, vector, rAAV, or composition thereof described herein. In some embodiments, one or more immunosuppressive agents may be administered before and after administration of an isolated nucleic acid, vector, rAAV, or composition thereof provided herein. In some embodiments, one or more immunosuppressive agents may be administered before and simultaneously with administration of an isolated nucleic acid, vector, rAAV, or composition thereof provided herein. In some embodiments, one or more immunosuppressive agents may be administered after and simultaneously with administration of an isolated nucleic acid, vector, rAAV, or composition thereof provided herein. In some embodiments, one or more immunosuppressive agents may be administered before, after, and simultaneously with administration of an isolated nucleic acid, vector, rAAV, or composition thereof provided herein.

[0122] In some embodiments, the provided technology (e.g., isolated nucleic acids, vectors, rAAV, compositions, methods, etc.) delays or prevents the onset of one or more symptoms and / or characteristics of a disease, disorder, or condition. In some embodiments, the provided technology delays, slows, or prevents the progression of a disease, disorder, or condition. In some embodiments, the provided technology alleviates, improves, reduces, inhibits, prevents the onset of, delays the onset of, reduces the severity of, and / or reduces the incidence of one or more symptoms or characteristics of a disease, disorder, or condition. In some embodiments, the provided technology improves the subject's performance in one or more clinical assessments. In some embodiments, the provided technology independently improves the outcome of one or more clinical assessments in a subject.

[0123] Pharmaceutical Composition Generally, the compositions of the present disclosure can be administered in any form, such as tablets, powders, or liquids, formulated in a pharmaceutically acceptable carrier or excipient, depending on the patient's condition. Furthermore, non-active ingredients known in the art, such as binders, fillers, coating agents, preservatives, coloring agents, flavoring agents, and other additives, can be optionally combined with one or more dosage forms, or can be completely omitted if they pose a risk of adverse side effects to the patient, such as increased risk of enteritis or inhibition of absorption of certain compounds.

[0124] In some embodiments, the present disclosure provides pharmaceutical compositions comprising the provided compositions, e.g., isolated nucleic acids, vectors, or rAAVs. In some embodiments, the isolated nucleic acids, vectors, or rAAVs are provided as pharmaceutical compositions, e.g., for therapeutic and clinical purposes.

[0125] In some embodiments, the pharmaceutical composition is suitable for administration or delivery of an isolated nucleic acid, vector, or rAAV to an area or portion of the body affected by a disease, disorder, or condition. In some embodiments, the pharmaceutical composition comprises a therapeutically effective amount of an isolated nucleic acid, vector, or rAAV provided herein. In some embodiments, the pharmaceutical composition comprises a therapeutically effective amount of an isolated nucleic acid, vector, or rAAV and a pharmaceutically acceptable carrier or excipient. In some embodiments, the pharmaceutically acceptable carrier is a buffer.

[0126] In some embodiments, the pharmaceutical composition is formulated for intravenous injection, oral administration, buccal administration, inhalation, intranasal administration, topical administration, ophthalmic administration, or otic administration. In some embodiments, the pharmaceutical composition is a tablet, pill, capsule, liquid, inhalant, nasal spray solution, suppository, suspension, gel, colloid, dispersion, suspension, solution, emulsion, ointment, lotion, eye drops, or ear drops. In some embodiments, the pharmaceutical composition is formulated for subretinal administration.

[0127] Various techniques can be used to administer or deliver the provided isolated nucleic acids, vectors, rAAVs, or compositions thereof. In some embodiments, the provided isolated nucleic acids, vectors, or rAAVs, or compositions thereof, are delivered to the eye. In some embodiments, the provided isolated nucleic acids, vectors, or rAAVs, or compositions thereof, are delivered to the subretinal space. In some embodiments, the provided isolated nucleic acids, vectors, or rAAVs, or compositions thereof, are delivered to a subject by subretinal administration. In some embodiments, the subretinal administration is performed by injection, for example, using a syringe. In some embodiments, the injection is a bolus injection.

[0128] The provided isolated nucleic acids, vectors, and rAAVs, and compositions thereof, can be administered over a wide range of doses. In some embodiments, the vector or rAAV, or composition thereof, is administered at least 10 times per subject. 8 , at least 10 9 , at least 10 10 , at least 10 11 , at least 10 12 , at least 10 13 , at least 10 14 , at least 10 15 , at least 10 16 , at least 10 17 , at least 10 18 , at least 10 19 , at least 10 20 , at least 10 21 , at least 10 22 , at least 10 23 , at least 10 24 , at least 10 25 , or at least 10 26 In some embodiments, the vector or rAAV, or composition thereof, is administered to a subject at a dose of up to 10 genome copies per subject. 8 , up to 10 9 , up to 10 10 , up to 10 11 , up to 1012 , up to 10 13 , up to 10 14 , up to 10 15 , up to 10 16 , up to 10 17 , up to 10 18 , up to 10 19 , up to 10 20 , up to 10 21 , up to 10 22 , up to 10 23 , up to 10 24 , up to 10 25 , or up to 10 26 In some embodiments, the vector or rAAV, or composition thereof, is administered to a subject at a dose of at least 10 genome copies per eye, ... 10 , at least 10 11 , at least 10 12 , at least 10 13 , or at least 10 14 In some embodiments, the vector or rAAV, or composition thereof, is administered to a subject at a dose of up to 10 genome copies per eye. 8 , up to 10 9 , up to 10 10 , up to 10 11 , up to 10 12 , up to 10 13 , or up to 10 14 In some embodiments, the vector or rAAV, or composition thereof, is administered to a subject at a dose of about 10 genome copies per subject. 8 ~about 10 26 , about 10 10 ~about 10 24 , or about 10 12 ~about 10 22 In some embodiments, the vector or rAAV, or composition thereof, is administered to a subject at a dose in the range of about 10 genome copies per eye. 8 ~about 10 14 genome copies, approximately 10 9 ~about 10 13 genome copies, or approximately 10 10 ~about 1012 In some embodiments, the vector or rAAV, or composition thereof, is administered to a subject at a dose in the range of about 10 genome copies per eye. 9 In some embodiments, the vector or rAAV, or composition thereof, is administered to a subject at a dose of about 5x10 genome copies per eye. 9 In some embodiments, the vector or rAAV, or composition thereof, is administered to a subject at a dose of about 10 genome copies per eye. 10 In some embodiments, the vector or rAAV, or composition thereof, is administered to a subject at a dose of about 5x10 genome copies per eye. 10 In some embodiments, the vector or rAAV, or composition thereof, is administered to a subject at a dose of about 10 genome copies per eye. 11 In some embodiments, the vector or rAAV, or composition thereof, is administered to a subject at a dose of about 5x10 genome copies per eye. 11 In some embodiments, the vector or rAAV, or composition thereof, is administered to a subject at a dose of about 10 genome copies per eye. 12 is administered to the subject at a dose of 100 genome copies.

[0129] array A variety of nucleic acid sequences can be used in the techniques provided in this disclosure. Exemplary sequences are provided below. SEQ ID NO:1 - Human PRPF31 cDNA (complementary DNA) SEQ ID NO:2 - AAV2 5'ITR CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT SEQ ID NO:3 - AAV2 3'ITR AGGAACCCCTAGTGATGGAGTTGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG SEQ ID NO:4 - promoter Array number 5-WPRE CAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAATCATCGTCCTTTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGC Array number 6 - Human beta globin polyadenylation signal GCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAATGATGTATTTAAATTATTTCTGAATATTTTACTAAAAAAGGGAATGTGGGAGGTCAGTGCATTT AAAACATAAAGAAATGAAGAGCTAGTTCAAACCTTGGGAAAATACACTATATCTTAAACTCCATGAAAGAAGGTGAGGCTGCAAACAGCTAATGCACATTGGCAACAGCCCCTGATGCATATGCCTTATTCATCCCTCAGAAAAGGATTCAAGTAGAGGCTTGATTTGGAGGTTAAAGTTTTGCTATGCTGTATTTTA SEQ ID NO:7 - Exemplary AAV vector [Example]

[0130] Example 1. The provided techniques can provide robust PRPF31 expression in target cells in vivo. An isolated nucleic acid similar to that depicted in Figure 1 was constructed. It consisted of, from 5' to 3', the AAV2 5' inverted terminal repeat (ITR) (SEQ ID NO: 2); a promoter (SEQ ID NO: 4) containing the human cytomegalovirus (CMV) enhancer, chicken β-actin (CBA) promoter, splice donor, and human ubiquitin C (UbC) enhancer; a splice acceptor; an N-terminal V5 epitope tag fused to human native PRPF31 complementary DNA (SEQ ID NO: 1); a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) (SEQ ID NO: 5); a human β-globin polyadenylation signal (SEQ ID NO: 6); and the AAV2 3' ITR (SEQ ID NO: 3). The isolated nucleic acid was used as a substrate for AAV vectors, and recombinant AAV (rAAV) was assembled using a triple transfection method according to methods described herein and known to those skilled in the art. The rAAV containing vector containing the isolated nucleic acid described above was designated AAV-PRPF31.

[0131] Non-human primates (cynomolgus monkeys) were injected with AAV-PRPF31 at 5 × 10 per eye. 11 The rAAV was subretinal injected at a dose of 0.05 mg / kg. The animals were treated with methylprednisolone the day before rAAV administration and weekly thereafter. Successful subretinal bleb formation in the animals was monitored by fundus photography (data not shown). Furthermore, inflammation was assessed on day 12 before administration and on days 3, 7, 14, 21, and 28 after administration. Inflammation was assessed using a uveitis scoring system (0 = none, 1 = minimal, 2 = mild, 3 = moderate, 4 = marked, 5 = severe). As shown in Figure 3B, minimal inflammation was observed at all time points. This indicates that administration of immunosuppressants before and after administration of the rAAV described herein (e.g., AAV-PRPF31) can result in reduced inflammation in subjects.

[0132] Twenty-eight days after administration, the animals were euthanized, and the eyes were harvested, fixed, and processed into retinal cross sections for histological analysis as known in the art. Retinal cross sections were immunolabeled with an antibody against the V5 epitope tag (to identify vector-derived PRPF31) and DAPI. Imaging revealed strong vector-mediated PRPF31 expression throughout the retinal pigment epithelium (RPE), photoreceptor layers (e.g., inner and outer segments), and inner retina (e.g., outer nuclear layer) (Figure 3A). These results demonstrate that the rAAV described herein (e.g., AAV-PRPF31) can provide strong expression of PRPF31 in target cells in vivo, for example, in the retina.

[0133] Example 2. The provided techniques can result in increased PRPF31 expression in target cells in vivo. Mutant (Prpf31 + / - ) mice, 2 × 10 per eye 9 vg of AAV-PRPF31 (assembled as described in Example 1) or vehicle control was subretinal injected. + / + ) mice were also examined. 13 weeks after injection, animals were sacrificed, retinal tissue was harvested, and vector-derived PRPF31 expression in the retinal pigment epithelium (RPE) was examined. Retinal cross-sections were immunolabeled with antibodies against PRPF31, V5, and DAPI. AAV-PRPF31-injected mutant (Prpf31) mice were also examined. + / - ) mice, retinal tissue was examined from within and outside the subretinal bleb area (formed by subretinal injection as shown in Figure 2).

[0134] An exemplary micrograph image is shown in Figure 4. + / - In the micrographs (column 3) from subretinal blebs of mice treated with the vehicle control alone, expression of vector-derived PRPF31 was clearly observed. + / - ) mice (column 2) and untreated wild-type (Prpf31 + / +In mice (row 1), no significant PRPF31 expression is observed outside the subretinal bleb (row 4). These results demonstrate that the rAAV described herein (e.g., AAV-PRPF31) can result in increased expression of PRPF31 in vivo, for example, in the RPE.

[0135] Example 3. The provided techniques can result in increased PRPF31 expression in target cells in vivo. Mutant (Prpf31 + / - ) mice, 2 × 10 per eye 9 (low dose) or 2x10 10 A (high-dose) vg of AAV-PRPF31 (assembled as described in Example 1) or vehicle control was injected subretinally. Thirteen weeks after injection, the animals were sacrificed and the eyes were harvested. The posterior eye cup (PEC), containing the retinal pigment epithelium (RPE) layer, was isolated from the neural retina and protein extraction was performed. Protein content was analyzed by Western blot. A band of approximately 54 kDa associated with PRPF31 was observed, and PRPF31 expression was quantified and normalized to the corresponding expression of GAPDH (low-dose mice) or β-actin (high-dose mice).

[0136] As shown in the graph in Figure 5A, a significant increase (more than two-fold difference) in PRPF31 expression was observed in samples collected from mice administered a low dose of AAV-PRPF31 compared to mice administered the vehicle control. Meanwhile, as shown in Figure 5B, a significant increase (approximately four-fold difference) in PRPF31 expression was observed in samples collected from mice administered a high dose of AAV-PRPF31 compared to mice administered the vehicle control. These results demonstrate that the rAAV described herein (e.g., AAV-PRPF31) can result in increased PRPF31 expression in vivo at various doses, for example, in the RPE.

[0137] Example 4. The provided techniques can result in increased phagocytosis in target cells in vivo. Mutant (Prpf31 + / -) mice, 2 × 10 per eye 9 (low dose) or 2x10 10 (High dose) vg of AAV-PRPF31 (assembled as described in Example 1), or vehicle control, was subretinal injected. + / + ) mice were also examined. Thirteen weeks after injection, animals were sacrificed, retinal tissue was harvested, and phagocytosis in the retinal pigment epithelium (RPE) was examined. Retinal cross sections were immunolabeled with antibodies against PRPF31, F-actin, and rhodopsin (RHO) and DAPI. RHO phagosomes in the RPE layer were quantified in every 100 μm section by microscopic observation.

[0138] Exemplary micrograph images are shown in Figures 6A and 6B. As shown in Figure 6C, untreated wild-type (Prpf31 + / + ) mice were treated with vehicle and the mutant (Prpf31 + / - ) mice showed significantly more RHO phagosomes than those treated with low or high doses of AAV-PRPF31. + / - ) mice were wild-type (Prpf31 + / + ) mice showed similar amounts of RHO phagosomes as vehicle-treated mutant (Prpf31 + / - ) mice had significantly more RHO phagosomes than mice (Figure 6C). These results demonstrate that the rAAV described herein (e.g., AAV-PRPF31) can result in increased phagocytosis in vivo at various doses, for example, in the RPE.

[0139] Example 5. The techniques provided can increase phagocytosis in target cells in vitro. Wild type (Prpf31 + / + ) and mutant (Prpf31 + / -Retinal pigment epithelial (RPE) cells derived from induced pluripotent stem cells (iPSCs) were cultured and matured for 3 weeks. AAV-PRPF31 (rAAV containing the construct shown in Figure 1) was constructed as described in Example 1 and administered to the cultures at a multiplicity of infection (MOI) of 5 x 10. After 3 weeks of culture, the cells were assayed for phagocytosis by treatment with fluorescein isothiocyanate (FITC)-labeled photoreceptor outer segments (POS). The cells were then evaluated by microscopy.

[0140] As shown in Figure 7, the mutant (Prpf31 + / - ) cells were wild-type (Prpf31 + / + ) cells, the ability to bind and internalize POS is reduced compared to untreated cells. This is evident from the decreased FITC signal in the micrographs of the untreated columns (compare the first and third columns of the micrographs). In contrast, AAV-PRPF31-treated cells restored phagocytosis, as evidenced by the increased FITC signal after POS binding and internalization (the rightmost column of the micrographs in Figure 7). These results suggest that the rAAV described herein (e.g., AAV-PRPF31) can result in increased phagocytosis in vitro.

[0141] While various embodiments have been described and illustrated herein, those skilled in the art will readily conceive of various other means and / or structures for achieving the functions or obtaining the results or obtaining one or more of the advantages disclosed herein. Any such variations and / or modifications are deemed to be encompassed by this specification. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are exemplary, and that the actual parameters, dimensions, materials, and / or configurations may vary depending on the particular application or uses for which the teaching(s) of the present disclosure are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the embodiments described in this disclosure. Accordingly, it should be understood that the above-described embodiments are illustrative only and that, within the scope of the appended claims and their equivalents, the claimed technology may be practiced otherwise than as specifically described and claimed. Furthermore, combinations of two or more features, systems, articles of manufacture, materials, kits, and / or methods are within the scope of the present disclosure, if such features, systems, articles of manufacture, materials, kits, and / or methods are not mutually inconsistent.

Claims

1. 1. An isolated nucleic acid comprising: (i) adeno-associated virus (AAV) 5′ inverted terminal repeat (ITR); (ii) a promoter; (iii) a nucleic acid sequence encoding a PRPF31 polypeptide; (iv) woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), and (v) the isolated nucleic acid, comprising an adeno-associated virus (AAV) 3' inverted terminal repeat (ITR).

2. The isolated nucleic acid of claim 1 , wherein the PRPF31 polypeptide is a wild-type PRPF31 polypeptide.

3. 3. The isolated nucleic acid of claim 1 or 2, wherein the nucleic acid sequence encoding the PRPF31 polypeptide is or comprises the nucleic acid sequence of SEQ ID NO:

1.

4. 4. The isolated nucleic acid of any one of claims 1 to 3, wherein the promoter comprises a human cytomegalovirus (CMV) enhancer or a portion thereof, a chicken beta-actin (CBA) promoter or a portion thereof, a human ubiquitin C (UbC) enhancer or a portion thereof, a splice donor, a splice acceptor, or a combination thereof.

5. 5. The isolated nucleic acid of any one of claims 1 to 4, wherein the promoter is or comprises the nucleic acid sequence of SEQ ID NO:

4.

6. 6. The isolated nucleic acid of claim 1, wherein the 5' ITR is or comprises an AAV2 5' ITR and / or the 3' ITR is or comprises an AAV2 3' ITR.

7. The isolated nucleic acid of any one of claims 1 to 6, wherein the 5' ITR is or comprises the nucleic acid sequence of SEQ ID NO:

2.

8. The isolated nucleic acid of any one of claims 1 to 7, wherein the 3' ITR is or comprises the nucleic acid sequence of SEQ ID NO:

3.

9. 9. The isolated nucleic acid of claim 8, wherein the WPRE is or comprises the nucleic acid sequence of SEQ ID NO:

5.

10. The isolated nucleic acid of any one of claims 1 to 9, wherein the isolated nucleic acid further comprises a 3' untranslated region (UTR) element.

11. The isolated nucleic acid of claim 10, wherein the 3'UTR element comprises a polyadenylation signal.

12. 12. The isolated nucleic acid of claim 11, wherein the polyadenylation signal comprises a human beta globin polyadenylation signal.

13. 13. The isolated nucleic acid of claim 11 or 12, wherein the polyadenylation signal is or comprises the nucleic acid sequence of SEQ ID NO:

6.

14. The isolated nucleic acid of any one of claims 1 to 13, wherein the isolated nucleic acid is or comprises the nucleic acid sequence of SEQ ID NO:

7.

15. A vector comprising the isolated nucleic acid of any one of claims 1 to 14.

16. The vector of claim 15 , wherein the vector is a viral vector.

17. The vector of claim 15, wherein the vector is a recombinant AAV (rAAV) vector.

18. A recombinant adeno-associated virus (rAAV), comprising: (i) a capsid, and (ii) A recombinant adeno-associated virus (rAAV) comprising the isolated nucleic acid of any one of claims 1 to 14 or the vector of any one of claims 15 to 17.

19. 19. The rAAV of claim 18, wherein the capsid is an AAV2 capsid.

20. A pharmaceutical composition comprising an isolated nucleic acid according to any one of claims 1 to 14, a vector according to any one of claims 15 to 17, or an rAAV according to claim 18 or claim 19.

21. 21. The pharmaceutical composition of claim 20, further comprising a pharmaceutically acceptable carrier or excipient.

22. A cell comprising the isolated nucleic acid of any one of claims 1 to 14, the vector of any one of claims 15 to 17, or the rAAV of claim 18 or claim 19.

23. A method for increasing expression of PRPF31 in a subject, the method comprising administering to the subject a therapeutically effective amount of an isolated nucleic acid described in any one of claims 1 to 14, a vector described in any one of claims 15 to 17, an rAAV described in claim 18 or claim 19, or a pharmaceutical composition described in claim 20 or claim 21.

24. 24. The method of claim 23, wherein the subject is susceptible to or suffering from a disease, disorder, or condition.

25. 19. A method of treating a subject susceptible to or suffering from a disease, disorder, or condition, comprising administering to the subject a therapeutically effective amount of the isolated nucleic acid of any one of claims 1-14, the vector of claims 15-17, the rAAV of claim 18 or claim 19, or the pharmaceutical composition of claim 20 or claim 21.

26. 26. The method of claim 24 or claim 25, wherein the disease, disorder, or condition is retinal degeneration.

27. 27. The method of claim 26, wherein the disease, disorder, or condition is retinitis pigmentosa.

28. 28. The method of claim 27, wherein the disease, disorder, or condition is retinitis pigmentosa-11 (RP11).

29. 29. The method of any one of claims 23 to 28, wherein the subject has a mutation in one or both of the PRPF31 genes.

30. The method of any one of claims 23 to 29, wherein the subject is a human.

31. The method of any one of claims 23 to 30, wherein the isolated nucleic acid, vector, rAAV, or pharmaceutical composition is administered by subretinal injection.

32. The vector, rAAV, or pharmaceutical composition is administered in an amount of about 1000 mg / eye. ８ ~about 10 １４ 32. The method of any one of claims 23 to 31, administered at a dose in the range of vector genome copies (vg).

33. The vector, rAAV, or pharmaceutical composition is administered in an amount of about 1000 mg / eye. ８ , about 10 ９ , about 10 １０ , about 10 １１ , about 10 １２ , about 10 １３ , or about 10 １４ 33. The method of any one of claims 23 to 32, wherein the vector is administered at a dose of vector genome copies (vg).

34. 34. The method of any one of claims 23 to 33, wherein the method further comprises administering one or more immunosuppressive agents.

35. 35. The method of claim 34, wherein one or more immunosuppressive agents are administered prior to administration of the isolated nucleic acid, vector, rAAV, or pharmaceutical composition.

36. 36. The method of any one of claims 34-35, wherein one or more immunosuppressive agents are administered simultaneously with administration of the isolated nucleic acid, vector, rAAV, or pharmaceutical composition.

37. 37. The method of any one of claims 34 to 36, wherein one or more immunosuppressive agents are administered after administration of the isolated nucleic acid, vector, rAAV, or pharmaceutical composition.

38. 39. The method of any one of claims 34 to 38, wherein the one or more immunosuppressive agents comprises a steroid.

Images