RNA inhibitors that inhibit LPA gene expression and uses thereof

Abstract

The present application provides an RNA inhibitor or a pharmaceutically acceptable salt thereof that inhibits the expression of the LPA gene. The RNA inhibitor is formed by base pairing between a sense strand and an antisense strand having a chain length of 15-30, preferably 19-23, and at least 85% of the bases of the sense strand and the antisense strand are complementary. The -OH at the 2'-position of the glycosyl nucleotides of some or all of the sense strand and / or the antisense strand may be substituted with a fluorine or methoxy group, and the phosphate ester bond between three adjacent nucleotides at at least one end of the sense strand and / or the antisense strand may be thiolated. The structure of the RNA inhibitor may further include carrier structures 5'MVIP and 3'MVIP. The RNA inhibitor provided herein interferes with the translation template function of LPA mRNA, efficiently and continuously inhibits the expression of the LPA gene, and can be used to treat and / or prevent diseases associated with elevated levels of LPA(a).

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to a Chinese patent application filed with the State Intellectual Property Office of China on October 24, 2022, bearing application number 202211304230.8 and entitled "RNA inhibitors inhibiting the expression of LPA gene and uses thereof," the entire contents of which are incorporated herein by reference. The present invention relates to the field of biomedicine, and specifically to an RNA inhibitor that inhibits the expression of the LPA gene and uses thereof. [Background technology]

[0002] RNAi The term RNAi (RNA interference) was first discovered in 1998 by Andrew Z. Fire and his colleagues when they performed antisense RNA inhibition experiments in the nematode Caenorhabditis elegans. They named this process RNA interference. This discovery was selected by Science magazine as one of the top ten scientific advances of 2001 and ranked first in 2002. Since then, siRNAs, which use RNA interference as their mechanism of action, have attracted widespread attention as potential gene therapy drugs. In 2006, Andrew Fire and Craig C. Mello were awarded the Nobel Prize in Physiology or Medicine for their contributions to the study of the RNA interference mechanism. RNAi is triggered by double-stranded RNA (dsRNA) in many organisms, including animals, plants, and fungi. During the RNA inhibition process, an endonuclease called "Dicer" cleaves or "scisses" long dsRNA into small fragments 21–25 nucleotides long. These small fragments are all called small interfering RNAs (siRNAs), and the antisense strand (guide strand) of each is loaded onto the Argonaute protein (AGO2). AGO2 loading occurs in the RISC-loading complex, a ternary complex consisting of the Argonaute protein, Dicer, and dsRNA-binding protein (TRBP). During loading, the sense strand (passenger strand) is cleaved and ejected by AGO2. AGO2 then uses the antisense strand to bind to mRNAs containing perfectly complementary sequences and catalyzes the cleavage of these mRNAs, thereby disrupting their role as translation templates and preventing further synthesis of associated proteins. After cleavage, the cleaved mRNA is released, and the RISC-loading complex that loaded the antisense strand is recycled for another round of cleavage.

[0003] Statistics show that over 80% of disease-related proteins in the human body are not targeted by current common small molecule drugs or large biological molecule drugs, and are therefore undruggable proteins. Gene therapy, which aims to treat diseases through functions such as gene expression and silencing, is considered the third generation of therapeutic drugs in the industry after small chemical molecule drugs and large biological molecule drugs. This therapy treats diseases at the gene level and is not restricted by undruggable proteins. RNAi technology is the most mainstream type of gene therapy, treating diseases at the mRNA level and offering higher efficiency at the protein level compared to small chemical molecule drugs and large biological molecule drugs. Using RNAi technology, highly specific and effective inhibitory siRNA sense and antisense sequences can be designed based on specific gene sequences. These single-stranded sequences are then solid-phase synthesized, and the sense and antisense strands are then paired into siRNA according to the base-pairing principle in a specific annealing buffer. Finally, the siRNA is transported to the corresponding target in the body by a carrier system, where it degrades the target mRNA and disrupts its function as a translation template, thereby blocking the synthesis of related proteins.

[0004] siRNA delivery systems siRNA is unstable in blood and tissues and is susceptible to degradation by nucleases. To improve siRNA stability, the sense and / or antisense strands of siRNA can be modified; however, these chemical modifications provide limited protection against nuclease degradation and may ultimately affect siRNA activity. Therefore, an appropriate delivery system is required to ensure that siRNA safely and efficiently crosses the cell membrane. Because siRNA has a relatively large molecular mass, a large negative charge, and high water solubility, it cannot easily pass through the cell membrane and enter cells.

[0005] The basic structure of liposomes consists of a hydrophilic core and a phospholipid bilayer, which has a biofilm-like phospholipid bilayer and is highly biocompatible, making liposomes the most popular and widely used siRNA carrier for a time. Liposome-mediated siRNA delivery is primarily achieved by encapsulating siRNA within the liposome, protecting it from nuclease degradation, and increasing the efficiency of siRNA penetration through cell membrane barriers, thereby promoting cellular uptake. Although some progress has been made in anionic liposomes, pH-sensitive liposomes, immunoliposomes, fusogenic liposomes, and cationic lipids, liposomes themselves are prone to inflammatory reactions, and therefore, prior to administration, multiple antihistamines, such as cetirizine and dexamethasone, and hormone-based drugs must be used to reduce the potential acute inflammatory reaction. Therefore, in actual clinical applications, these systems are not suitable for all therapeutic areas. In particular, in the treatment of some chronic diseases, there are potential safety concerns regarding the potential cumulative toxicity that may occur with long-term use. Therefore, a safer and more effective carrier system for siRNA delivery is needed.

[0006] The hepatic sialic acid glycoprotein receptor (ASGPR) is a receptor specifically expressed in hepatocytes and is an efficient endocytic receptor. During physiological processes, various glycoproteins undergo enzymatic or acid hydrolysis of sialic acid, resulting in the exposed secondary terminus of galactose residues. Therefore, the sugar that specifically binds to ASGPR is the galactose group, hence the name galactose-specific receptor. Monosaccharide and polysaccharide molecules, such as galactose, galactiamine, and N-acetylgalactiamine, all have high affinity for ASGPR. The primary physiological function of ASGPR is to mediate the clearance of substances such as sialic acid glycoproteins and lipoproteins from the blood, and it is closely related to the development of liver diseases such as viral hepatitis, hepatosclerosis, and liver cancer. The discovery of the specificity of ASGPR plays an important role in the diagnosis and treatment of hepatic diseases (Ashwell G, Harford J, Carbohydrate-specific Receptors of the Liver, Ann Rev Biochem 1982 51:531-554). Hepatogenic disease therapeutic agents containing galactose or galactiamine and their derivatives in their structure have active liver targeting by specific affinity to ASGPR, and do not need to be transported by other carrier systems.

[0007] LPA, apo(a) and Lp(a) LPA is the name of the gene encoding apolipoprotein(a) (apo(a)), which is expressed primarily in the liver and is limited to humans and non-primates. The hydrophilic apolipoprotein component apolipoprotein(a) binds to apo(B)-100 via disulfide bonds and, together with a lipid core, forms lipoprotein(a) (Lp(a)) particles. Lp(a) particles are special large cholesterol-rich lipoproteins whose surfaces are enveloped in cholesterol and phospholipids, and the aforementioned apolipoprotein(a) and apo(B)-100 are embedded within them. Lp(a) can enter and deposit in the vascular wall, promoting atherosclerosis. Lp(a) shares a homologous structure with plasminogen (PLG), inhibiting fibrinogen hydrolysis by competing with fibrinogen for fibrinogen binding sites, thereby promoting thrombus formation. Therefore, Lp(a) and atherosclerosis are closely related to thrombus formation. Studies have shown that blood Lp(a) levels are an independent risk factor for cardiovascular disease, stroke, and atherosclerotic stenosis.

[0008] High Lp(a) levels are primarily related to genetics and do not change significantly with changes in diet, exercise, and other lifestyle factors. A human Lp(a) level above 300 mg / L indicates elevated Lp(a). High Lp(a) levels typically indicate a significant increase in the risk of atherosclerosis and thrombosis, and detecting Lp(a) is of particular importance for early detection of atherosclerosis risk. Although approximately 330 million people in China suffer from cardiovascular disease, the general public's awareness, treatment, and control rates of dyslipidemia are generally relatively low. This leads to even lower awareness of Lp(a) risk, and most hospitals do not include this item in their general blood lipid tests. Currently, there are no clinically relevant therapeutic drugs available at home or abroad. Therefore, there is an urgent need for drugs that can effectively inhibit LPA gene expression. Summary of the Invention [Problem to be solved by the invention]

[0009] In one aspect, the present invention provides an RNA inhibitor that inhibits the expression of the LPA gene, or a pharmaceutically acceptable salt thereof. [Means for solving the problem]

[0010] In some embodiments, the RNA inhibitor of the present invention is formed by base pairing of a sense strand and an antisense strand having a strand length of 15-30, preferably 19-23, and at least 85% of the bases between the sense strand and the antisense strand are complementary, and the -OH at the 2'-position of the glycosyl nucleotides of some or all of the sense strand and / or antisense strand may be substituted, wherein the substituent is a fluorine or methoxy group, and the phosphate ester bond between three adjacent nucleotides at at least one of the ends of the sense strand and / or antisense strand may be thiolated.

[0011] In some embodiments, the RNA inhibitor of the present invention or a pharmaceutically acceptable salt thereof, wherein the antisense strand forms a region complementary to a target sequence, the target sequence being multiple regions at different locations of the LPA mRNA, and the multiple regions have at least 15 consecutive nucleotides that are the same.

[0012] In some embodiments, in the RNA inhibitor of the present invention or a pharmaceutically acceptable salt thereof, the antisense strand forms a region complementary to a target sequence, the target sequence being multiple regions at different positions in LPA mRNA, the multiple regions having at least 15 consecutive nucleotides that are the same, and the target sequence is selected from any one of nucleotide regions 312-332, 654-674, 996-1016, 1338-1358, 1680-1700, 2022-2042, and 2364-2384 in LPA mRNA (NM_005577.4). The start positions of these regions may vary depending on the version number of LPA mRNA, for example, the nucleotide region between 654 and 674 in LPA mRNA NM_005577.4.

[0013] In some embodiments, in the RNA inhibitor of the present invention or a pharmaceutically acceptable salt thereof, the antisense strand forms a region complementary to a target sequence, the target sequence being multiple regions at different positions in LPA mRNA, the multiple regions having at least 15 consecutive nucleotides that are the same, and the target sequence is selected from any one of nucleotide regions 493-512, 1861-1880, and 2203-2222 in LPA mRNA (NM_005577.4). The starting positions of these regions may vary depending on the version number of LPA mRNA, for example, the nucleotide region between 1861 and 1880 in LPA mRNA NM_005577.4.

[0014] In some embodiments, the antisense strand of the RNA inhibitor of the present invention, or a pharmaceutically acceptable salt thereof, comprises: 5'ucguauaacaauaaggagcug 3' SEQ ID NO: 25 5'auaacucuguccauuaccaug 3' SEQ ID NO: 21 or a sequence having at least 15 consecutive nucleotides identical to the antisense strand, or a sequence differing from the antisense strand by 1, 2 or 3 nucleotides; where g = guanylic acid, a = adenosinic acid, u = uridine acid, and c = nucleotide acid.

[0015] In some embodiments, the sense strand of the RNA inhibitor or a pharmaceutically acceptable salt thereof comprises: 5'cagcuccuuauuguuauacga 3' SEQ ID NO: 11 5'ugguaauggacagaguuauca 3' SEQ ID NO:8 or a sequence having at least 15 consecutive nucleotides identical to the sense strand, or a sequence having one, two or three nucleotide differences from the sense strand; where g = guanylic acid, a = adenosinic acid, u = uridine acid, and c = nucleotide acid.

[0016] In some embodiments, the sense strand of an RNA inhibitor of the present invention or a pharmaceutically acceptable salt thereof is SEQ ID NO: 11 or a sequence having at least 15 contiguous nucleotides identical thereto, or a sequence having one, two, or three nucleotide differences therefrom, and the antisense strand is SEQ ID NO: 25 or a sequence having at least 15 contiguous nucleotides identical thereto, or a sequence having one, two, or three nucleotide differences therefrom: Sense strand: 5'cagcuccuuauuguuauacga 3' SEQ ID NO: 11 Antisense strand: 5'ucguauaacaauaaggagcug 3' SEQ ID NO: 25, Alternatively, the sense strand is SEQ ID NO: 8 or a sequence having at least 15 consecutive nucleotides identical thereto, or a sequence having one, two or three nucleotide differences therefrom, and the antisense strand is SEQ ID NO: 21 or a sequence having at least 15 consecutive nucleotides identical thereto, or a sequence having one, two or three nucleotide differences therefrom; Sense strand: 5'ugguaauggacagaguuauca 3' SEQ ID NO: 8 Antisense strand: 5'auaacucuguccauuaccaug 3' SEQ ID NO: 21, where g = guanylic acid, a = adenosinic acid, u = uridine acid, and c = nucleotide acid.

[0017] In some embodiments, the RNA inhibitor of the present invention or a pharmaceutically acceptable salt thereof, wherein the sense strand is SEQ ID NO: 270 or a sequence differing therefrom by one, two, or three nucleotides, and the antisense strand is SEQ ID NO: 278 or a sequence differing therefrom by one, two, or three nucleotides; Sense strand: 5'CsAsGCUCCUfUfAfUUGUUAUACsGsA 3' SEQ ID NO: 270 Antisense strand: 5'UsfCsGfUAfUAACAAfUAfAGfGAfGCsfUsG 3' SEQ ID NO: 278, Alternatively, the sense strand is SEQ ID NO: 239 or a sequence differing therefrom by 1, 2 or 3 nucleotides, and the antisense strand is SEQ ID NO: 344 or a sequence differing therefrom by 1, 2 or 3 nucleotides; Sense strand: 5'UsGsGUfAAfUfGfGACAGAGUUAUsCsA 3' SEQ ID NO: 239 Antisense strand: 5'AsfUsAfACdTCfUGUCCAfUUfACCAsUsG 3' SEQ ID NO: 344, where G = 2'-O-methylguanylic acid, A = 2'-O-methyladenosinic acid, U = 2'-O-methyluridine acid, C = 2'-O-methylnucleotidic acid, Gs = 2'-O-methyl-3'-thioguanylic acid, As = 2'-O-methyl-3'-thioadenosinic acid, U = 2'-O-methyl-3'-thiouridine acid, Cs = 2'-O-methyl-3'-thionylic acid, fG = 2'-fulv fA = 2'-fluoroadenosinic acid, fU = 2'-fluorouridylic acid, fC = 2'-fluoronucleotide acid, fGs = 2'-fluoro-3'-thioguanylic acid, fAs = 2'-fluoro-3'-thioadenosinic acid, fUs = 2'-fluoro-3'-thiouridylic acid, fCs = 2'-fluoro-3'-thionylic acid, dT = 2'-deoxythymidylic acid.

[0018] In some embodiments, the sense or antisense strand of an RNA inhibitor of the present invention can tolerate up to three mismatched nucleotides, for example, within 5, 4, 3, or 2 nucleotides of the 5' and / or 3' end.

[0019] In the above technical method, preferably, the RNA inhibitor or its pharmaceutically acceptable salt of the present invention further comprises a carrier structure 5'MVIP and a 3'MVIP, wherein the structure of the RNA inhibitor is shown in formula Ia, Ib or Ic: JPEG2025535491000002.jpg53116Ia JPEG2025535491000003.jpg55115Ib JPEG2025535491000004.jpg57159Ic where: The carrier structure comprises 5'MVIP (5'MultiValent Import Platform) and 3'MVIP (3'MultiValent Import Platform), The 5'MVIP consists of a relay R1, a linking chain D, a joint B, a branching chain L and a liver target-specific ligand X, which is linked to the 5' end of the sense strand or the 5' end of the antisense strand via the relay R1, and its structure is shown in general formula I: TIFF2025535491000005.tif939I The 3'MVIP comprises a relay R2, a linking chain D, a joint B, a branched chain L and a liver target-specific ligand X, which is linked to the 3' end of the sense strand or the 3' end of the antisense strand via the relay R2, and its structure is shown in general formula II: TIFF2025535491000006.tif942II where: n and m are each independently any integer from 0 to 4, preferably each independently an integer from 1 to 3, and n+m=2 to 6, preferably n+m=2, 3, or 4, more preferably 4; The relay point R1 is a heterocyclic or carbocyclic structure containing N, S, or O as shown below: JPEG2025535491000007.jpg69143 Or, the R1 is -NH(CH2) x CH2O-, where x is any integer from 3 to 12, preferably any integer from 4 to 6; The relay point R2 is a heterocyclic or carbocyclic structure containing N, S, or O as shown below: JPEG2025535491000008.jpg65139, or the relay point R2 is -NH(CH2) x1 CH(OH)(CH2) x2 CH2O-, where x1 is any integer from 1 to 4 and x2 is any integer from 0 to 4; The liver target-specific ligand X is selected from structures for enhancing the uptake of the RNA inhibitor by hepatocytes, and may be the same or different within each of the 5'MVIP and the 3'MVIP or between the 5'MVIP and the 3'MVIP. It is selected from monosaccharides and derivatives thereof, preferably N-acetylgalactiamine and derivatives thereof, and more preferably selected from the following structures: JPEG2025535491000009.jpg87123Where W is -OH, -NHCOOH and -NHCO(CH2) q CH3, where q is an integer from 0 to 4; The branched chain L is the same or different within each of the 5'MVIP and 3'MVIP or between the 5'MVIP and 3'MVIP, and is selected from one or more of the following structures: TIFF2025535491000010.tif72155 TIFF2025535491000011.tif71153 where r1 is any integer between 1 and 12, r2 is any integer between 0 and 20, Z is H, an alkyl group or an amide group, and the alkyl group is, for example, a C1-C5 alkyl group; The joint B is the same or different within each of the 5'MVIP and 3'MVIP or between the 5'MVIP and 3'MVIP, and is selected from the following structures: TIFF2025535491000012.tif147163 wherein A1 and A2 each independently represent C, O, S, -NH-, a carbonyl group, an amide group, a phosphoryl group, or a thiophosphoryl group; and r represents an integer of 0 to 4; The linking chain D is the same or different within each of the 5'MVIP and 3'MVIP or between the 5'MVIP and 3'MVIP, and is selected from the following structures: TIFF2025535491000013.tif53162 TIFF2025535491000014.tif59161 TIFF2025535491000015.tif60159 TIFF2025535491000016.tif40154 TIFF2025535491000017.tif220160 where each p is independently an integer from 1 to 20, s is an integer from 2 to 13, and Z1 and Z2 are the same or different substituents, e.g., C3-C 10 It is alkyl.

[0020] In some embodiments, the 5'MVIP is selected from any one of 5'MVIP01 to 5'MVIP22 in Table 11.

[0021] In some embodiments, the 3'MVIP is selected from any one of 3'MVIP01 to 3'MVIP27 in Table 12.

[0022] In some embodiments, in the RNA inhibitor of the present invention or a pharmaceutically acceptable salt thereof, the 5'MVIP is 5'MVIP01 or 5'MVIP09 shown below, and the 3'MVIP is 3'MVIP01, 3'MVIP09, or 3'MVIP17 shown below. JPEG2025535491000018.jpg65165 JPEG2025535491000019.jpg129165

[0023] In some embodiments, in the RNA inhibitor of the present invention or a pharmaceutically acceptable salt thereof, the combination of the sense strand 5'MVIP and the antisense strand 3'MVIP is 5'MVIP01 / 3'MVIP01, 5'MVIP01 / 3'MVIP17, or 5'MVIP09 / 3'MVIP09, or the combination of the sense strand 5'MVIP and the sense strand 3'MVIP is 5'MVIP01 / 3'MVIP09 or 5'MVIP09 / 3'MVIP01.

[0024] On the other hand, the present invention further provides the use of the above-mentioned RNA inhibitor or a pharmaceutically acceptable salt thereof in the manufacture of a drug for treating and / or preventing diseases associated with elevated LP(a) levels, wherein the diseases associated with elevated LP(a) levels include hepatic diseases, which include inflammatory diseases, cardiovascular diseases, and metabolic diseases, wherein the cardiovascular diseases include hyperLP(a)emia, hyperlipidemia, stroke, atherosclerosis, thrombosis, coronary heart disease, and aortic valve stenosis.

[0025] According to another aspect, the present invention further provides a pharmaceutical composition, which comprises the above-mentioned RNA inhibitor that inhibits expression of the LPA gene or a pharmaceutically acceptable salt thereof and an optional pharmaceutically acceptable excipient, wherein the pharmaceutically acceptable excipient may be a pharmaceutically acceptable excipient, carrier and / or diluent, and the dosage form of the pharmaceutical composition is an oral dosage form, an intravenous injection, or a subcutaneous or intramuscular injection, preferably a subcutaneous injection.

[0026] In yet another aspect, the present invention further provides a method for treating and / or preventing a disease, condition, or syndrome associated with elevated levels of LPA(a), the method comprising administering to a subject or patient in need thereof a therapeutically effective amount of an RNA inhibitor that inhibits expression of the LPA gene or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the RNA inhibitor or a pharmaceutically acceptable salt thereof and, optionally, a pharmaceutically acceptable excipient, wherein the therapeutically effective amount is 1.0 mg / kg to 10 mg / kg of the RNA inhibitor or a pharmaceutically acceptable salt thereof. Here, administration to the subject or patient (administration route) includes oral, intravenous, subcutaneous or intramuscular injection, rectal, or intraperitoneal administration. Those skilled in the art will readily appreciate other aspects and advantages of the present application from the following detailed description. In the following detailed description, only exemplary embodiments of the present application are shown and described. As will be understood by those skilled in the art, the present application may be modified in accordance with the specific embodiments disclosed herein without departing from the spirit and scope of the present invention. Accordingly, the drawings and description herein are to be regarded as illustrative only and not restrictive. Particular features of the present invention are set forth in the appended claims. The features and advantages of the present invention will be better understood with reference to the exemplary embodiments and drawings described in detail below, the drawings being briefly described as follows: [Brief explanation of the drawings]

[0027] [Figure 1]FIG. 1 shows the inhibitory effect of different concentrations of RNA inhibitors on LPA mRNA levels in Huh7 cells in Table 3 prepared in Example 2 of the present application. [Figure 2] FIG. 1 is a high-resolution mass spectrometry diagram of ERCd-01-c2 synthesized in 3.1.15 in Example 3 of the present application. [Figure 3] FIG. 1 is a high-resolution mass spectrometry diagram of 3′MVIP17-c1 synthesized in 3.1.2.6 in Example 3 of the present application. [Figure 4] FIG. 1 is a high-resolution mass spectrometry diagram of 5′MVIP09-ERCd-PFP-c2 synthesized in 3.2.1.2 of Example 3 of the present application. [Figure 5] FIG. 1 shows the inhibitory effect of different concentrations of RNA inhibitors on LPA mRNA levels in Huh7 cells in Table 4 prepared in Example 5 of the present application. [Figure 6] FIG. 1 is a graph showing the inhibitory effect of different concentrations of RNA inhibitors on LPA mRNA levels in Huh7 cells in Table 5 prepared in Example 6 of the present application. [Figure 7] FIG. 1 shows the inhibitory effect of different concentrations of RNA inhibitors on LPA mRNA levels in Huh7 cells in Table 6 prepared in Example 7 of the present application. [Figure 8] FIG. 1 is a graph showing the inhibitory effect of different concentrations of RNA inhibitors on LPA mRNA levels in Huh7 cells in Table 7 prepared in Example 8 of the present application. [Figure 9] 1 is a graph showing the inhibitory effect of different concentrations of RNA inhibitors on LPA mRNA levels in Huh7 cells in Table 8 prepared in Example 9 of the present application. [Figure 10] FIG. 10 is a graph showing the effect of RNA inhibitors on reducing LDL-c levels in cynomolgus monkey plasma in Example 10 of the present application. [Figure 11] FIG. 10 is a graph showing the effect of RNA inhibitors on reducing Lp(a) levels in cynomolgus monkey plasma in Example 10 of the present application. DETAILED DESCRIPTION OF THE INVENTION

[0028] Hereinafter, embodiments of the present invention will be described with reference to certain specific examples, and those skilled in the art will readily appreciate other advantages and effects of the present application from the disclosure herein.

[0029] Definition of Terms In this application, the term "LPA" includes human LPA and cynomolgus monkey LPA, where the human LPA mRNA sequence may be found, for example, in GenBank NM_005577.4.

[0030] As used herein, a "target sequence" refers to a continuous portion of the nucleotide sequence of an mRNA molecule formed during transcription of the LPA gene, including the RNA processing product mRNA, which is the primary transcription product. In some embodiments, the target portion of the sequence is at least sufficiently long to serve as a substrate for degradation by an RNA inhibitor at or near that portion of the nucleotide sequence of the mRNA molecule formed during transcription of the LPA gene. The length of a "target sequence" is typically about 15-30 nucleotides.

[0031] In this application, the term "region" refers to the region from the start position to the end position of the target sequence in the LPA mRNA listed in GenBank. For example, the "region" 312-332 refers to the nucleotides from nucleotide 312 to nucleotide 332 in the LPA mRNA (NM_005577.4). The positions of these "regions" change with updates to the LPA mRNA sequence listed in GenBank, but the number and types of nucleotides covered by the region remain the same.

[0032] In this application, the term "RNA inhibitor" generally refers to an agent containing RNA as defined in the present invention, which can mediate the targeted cleavage of RNA transcripts through the RNA-induced silencing complex (RISC) pathway. Through a process called RNA inhibition, it directs the sequence-specific degradation of mRNA, thereby regulating and controlling (e.g., inhibiting) the expression of LPA gene in cells (e.g., cells in a subject, e.g., a mammalian subject).

[0033] In some embodiments, the RNA inhibitor may be a single-stranded siRNA (ssRNA inhibitor) that is introduced into a cell or organism to inhibit a target mRNA (i.e., the LPA gene). The single-stranded RNA inhibitor cleaves the target mRNA after binding to the RISC endonuclease Argonaute 2. The single-stranded siRNA is typically 15 to 30 nucleotides in length and is chemically modified.

[0034] In some embodiments, the term "RNA inhibitor" as used herein refers to double-stranded RNA and is referred to herein as a "double-stranded RNA inhibitor," a "double-stranded RNA (dsRNA, DS) molecule," a "dsRNA agent," or a "dsRNA." The term "dsRNA" refers to a complex of ribonucleic acid molecules, which have a double-stranded structure comprising two antiparallel and substantially complementary nucleic acid strands, referred to as "sense" and "antisense" orientations relative to a target mRNA. In some embodiments, the double-stranded RNA (dsRNA) triggers degradation of the target mRNA through a post-transcriptional gene silencing mechanism (referred to herein as RNA inhibition or RNA interference).

[0035] The double-stranded structure may be of any length that triggers specific degradation of the LPA mRNA via the RISC pathway, and may be within the range of about 15 to 36 base pairs in length, e.g., about 15-30 base pairs in length, e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or 36 base pairs in length. In some embodiments, the RNA inhibitors herein are 15-30 nucleotide dsRNAs that interact with a target sequence to direct cleavage of the LPA mRNA.

[0036] Typically, most nucleotides in the sense and antisense strands of a dsRNA molecule are ribonucleotides; however, as described in detail herein, they may contain one or more non-ribonucleotides, such as deoxyribonucleotides or modified nucleotides. The RNA inhibitors described herein may also contain ribonucleotides with chemical modifications, or nucleotides that can be modified in multiple regions. The term "modified nucleotide" as used herein refers to a nucleotide that independently has a modified sugar moiety, a modified internucleotide linkage, or a modified nucleobase, or any combination thereof. Therefore, the term "modified nucleotide" covers, for example, the substitution, addition, or removal of functional groups or atoms in the internucleotide linkage, sugar moiety, or nucleobase. Modifications of RNA inhibitors applicable to this application include all types of modifications disclosed herein or known in the art.

[0037] As used herein, the term "nucleotide sequence" generally refers to a series or order of nucleotides, whether modified or unmodified, designated by standard nucleotide names, and the modified nucleotide code described herein is written as a series of letters. Nucleotide sequences described herein are polymers joined by phosphodiester bonds (or related structural variants or synthetic analogs), including naturally occurring nucleotide polymers, although it should be understood that the scope of the term encompasses various analogs, including, but not limited to, peptide nucleic acids (PNAs), aminophosphates, thiophosphates, methylphosphonates, and 2'-O-methyl ribonucleic acids. Typically, there are about 15-30 nucleotides, but the term can refer to molecules of any length.

[0038] In some embodiments, a nucleotide sequence comprises one or more unmodified ribonucleosides (RNA) and / or unmodified deoxyribonucleosides (DNA) and / or one or more modified nucleotides. The term "modified nucleotide sequence" generally refers to a series or order of nucleotides that includes at least one modification and / or at least one linkage between modified nucleotides.

[0039] As used herein, the term "modified nucleotide" generally refers to a nucleotide containing at least one chemical modification compared to naturally occurring RNA or DNA nucleotides, such as 2'-deoxy-thymidylate 2'-O-methyl modified nucleotides, 2'-fluorine modified nucleotides, 2'-deoxy-modified nucleotides, locked nucleotides, abasic nucleotides, 2'-amino-modified nucleotides, 2'-O-long chain alkyl-modified nucleotides (e.g., hexadecyl), morpholino nucleotides, amino phosphate nucleotides, non-natural nucleobase nucleotides, 5'-thiophosphate nucleotides, and nucleotides linked with cholesterol group derivatives or dodecanoic acid didecylamide groups.

[0040] Modified nucleotides contain modified glycosyl and / or modified nucleobases.

[0041] As used herein, the term "nucleobase" or "base" generally refers to a heterocyclic pyrimidine or purine compound, which is a component of all nucleic acids and includes adenine, guanine, cytosine, thymine, and uracil. Nucleotides may include modified nucleotides or nucleotide mimetics, abasics, or surrogate moieties. The term "unmodified nucleobase" or "naturally occurring nucleobase" generally refers to the purine bases adenine and guanine, and the pyrimidine bases thymine, cytosine, and uracil, which are naturally occurring heterocyclic nucleobases in RNA or DNA. The term "modified nucleobase" generally refers to any non-naturally occurring nucleobase.

[0042] As used herein, the term "glycosyl" generally refers to the naturally occurring or modified glycosyl of a nucleotide. The term "naturally occurring glycosyl" generally refers to the furyl ribonucleotide group found in naturally occurring RNA or the deoxyfuryl ribonucleotide group found in naturally occurring DNA. A "modified glycosyl" refers to a substituted glycosyl or sugar substitute, e.g., a fluorine or methoxy group substituted at the glycosyl 2' position.

[0043] As used herein, the term "internucleotide linkage" generally refers to a covalent bond between adjacent nucleotides in a nucleotide sequence. A "naturally occurring internucleotide linkage" refers to a 3'-5' phosphodiester bond. A "modified internucleotide linkage" refers to any internucleotide linkage other than a naturally occurring internucleotide linkage.

[0044] As used herein, the term "antisense strand" (AS) generally refers to the strand of an RNA inhibitor (e.g., dsRNA) that contains a region that is essentially complementary to a target sequence. As used herein, the term "complementary region" generally refers to a region on the antisense strand that is essentially complementary to a sequence (e.g., a target sequence) defined herein.

[0045] In this application, the term "sense strand" (S) generally refers to a strand, such as an RNA inhibitor (e.g., dsRNA), that includes a region that is essentially complementary to a region of the "antisense strand" (AS). The "sense" strand may also be referred to as the "sense" strand, "guest" strand, or "reverse guide" strand. By borrowing the sequence of the sense strand, the antisense strand targets the desired mRNA, while the sense strand may target a different target or be degraded. Therefore, for example, when the antisense strand enters RISC, the correct target is targeted. Entry of the sense strand can result in off-target effects. These off-target effects can be limited by using modifications to the sense strand or by using a 5'-end cap.

[0046] In this application, the term "complementary" refers to the ability of two nucleotide sequences to hybridize under certain conditions, form base-pair hydrogen bonds, and form a duplex or double-helical structure. For example, an RNA inhibitor antisense strand hybridizes with an RNA inhibitor sense strand or LPA mRNA to form Watson-Crick base pairs or non-Watson-Crick base pairs, and includes natural or modified nucleotides or nucleotide mimics. "Complementary" does not require that each nucleoside has nucleobase complementarity. Conversely, some mismatches can be tolerated.

[0047] As used herein, the term "mismatch" refers to a region of complementarity that is not perfectly complementary to the target sequence, and mismatches may occur in the internal or terminal regions of the molecule. Typically, mismatches are most tolerated in the terminal regions, e.g., within 5, 4, 3, or 2 nucleotides of the 5' and / or 3' ends, with no more than three mismatches.

[0048] As used herein, the term "ligand" generally refers to any compound or molecule capable of covalently or otherwise chemically binding to a bioactive substance (e.g., dsRNA). In some embodiments, a ligand can directly or indirectly interact with another compound, such as a receptor, which may be at the cell interface or, alternatively, may be an intracellular and / or intercellular receptor, and the interaction between the ligand and receptor may result in a biochemical reaction or may be solely a physical interaction or binding.

[0049] As used herein, the term "pharmaceutically acceptable" generally refers to one or more non-toxic substances that do not interfere with the effectiveness of the biological activity of the active ingredient. Such formulations may typically include salts, excipients, buffers, preservatives, compatible carriers, and optionally other therapeutic agents. Such pharmaceutically acceptable formulations may typically include compatible solid or liquid fillers, diluents, or encapsulating materials suitable for administration to humans. For pharmaceutical use, salts should be pharmaceutically acceptable, although non-pharmaceutically acceptable salts may readily be used to prepare pharmaceutically acceptable salts and are not excluded from the scope of this application. Such pharmacologically and pharmaceutically acceptable salts include, but are not limited to, salts prepared from acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, boric acid, formic acid, malonic acid, and succinic acid. Pharmaceutically acceptable salts can be prepared as alkali metal or alkaline earth metal salts, such as sodium salts, potassium salts or calcium salts.

[0050] As used herein, the term "lipid nanoparticle" or "LNP" generally refers to a vesicle comprising a lipid layer that encapsulates a pharmacologically active molecule (e.g., dsRNA). LNPs are described, for example, in Chinese Patent No. CN103189057B, the entire contents of which are incorporated herein by reference. Details of the invention

[0051] In one aspect, the present invention provides an RNA inhibitor that inhibits the expression of the LPA gene, or a pharmaceutically acceptable salt thereof.

[0052] In some embodiments, the RNA inhibitor or pharmaceutically acceptable salt thereof, the target sequence of action includes multiple regions of LPA mRNA NM_005577.4 (SEQ ID NO: 1); SEQ ID NO:1: JPEG2025535491000020.jpg106165 JPEG2025535491000021.jpg108165 JPEG2025535491000022.jpg86165 JPEG2025535491000023.jpg98165 JPEG2025535491000024.jpg103165 JPEG2025535491000025.jpg105165 JPEG2025535491000026.jpg54165Here, g = guanylic acid, a = adenosine acid, t = thymidylic acid, and c = nucleotide acid.

[0053] In some embodiments, in an RNA inhibitor of the present invention or a pharmaceutically acceptable salt thereof, the target sequence of action comprises the double-underlined and single-underlined nucleotide regions in SEQ ID NO:1.

[0054] In some embodiments, in the RNA inhibitors of the present invention or pharmaceutically acceptable salts thereof, the target sequence of action is a sequence that includes and has at least 15 consecutive nucleotides identical to the nucleotide region between 301 and 2401 in SEQ ID NO:1.

[0055] In some embodiments, in the RNA inhibitor of the present invention or a pharmaceutically acceptable salt thereof, the antisense strand forms a region complementary to a target sequence, and the target sequence is any one of nucleotide regions 312-332, 654-674, 996-1016, 1338-1358, 1680-1700, 2022-2042 and 2364-2384 in SEQ ID NO: 1.

[0056] In some embodiments, the RNA inhibitor of the present invention or a pharmaceutically acceptable salt thereof, wherein the antisense strand forms a region complementary to a target sequence, and the target sequence is any one of nucleotide regions 493-512, 1861-1880, and 2203-2222 in SEQ ID NO: 1.

[0057] In some embodiments, the target sequences of the RNA inhibitors of the present invention are at least 15 contiguous nucleotides in these regions.

[0058] In some embodiments, the target sequences of the RNA inhibitors of the present invention are at least 30 contiguous nucleotides extending across these regions.

[0059] In some embodiments, the target sequence of an RNA inhibitor of the present invention is: cagctcc ttattgttat acga (SEQ ID NO: 2), where g=guanylic acid, a=adenosinic acid, t=thymidylic acid, and c=nucleotide acid.

[0060] In some embodiments, the target sequence of an RNA inhibitor of the present invention is: tggtaatggacagagttat (SEQ ID NO: 3), where g=guanylic acid, a=adenosinic acid, t=thymidylic acid, and c=nucleotide acid.

[0061] In some embodiments, the target sequence of an RNA inhibitor of the present invention is a target sequence that differs from SEQ ID NO:2 by one, two, or three nucleotides.

[0062] In some embodiments, the target sequence of an RNA inhibitor of the present invention is a target sequence having at least 15 contiguous nucleotides identical to SEQ ID NO:2.

[0063] In some embodiments, the target sequence of an RNA inhibitor of the present invention is a target sequence that differs from SEQ ID NO:3 by one, two, or three nucleotides.

[0064] In some embodiments, the target sequence of an RNA inhibitor of the present invention is a target sequence having at least 15 contiguous nucleotides identical to SEQ ID NO:3.

[0065] In some embodiments, the target sequence of the RNA inhibitors of the present invention may be a sequence of 15-30 nucleotides on any other region outside of those regions mentioned above in SEQ ID NO:1.

[0066] In some embodiments, the RNA inhibitors of the present invention comprise double-stranded ribonucleic acid (dsRNA) molecules for inhibiting expression of the LPA gene in a cell, e.g., in a subject (e.g., a mammal, e.g., a human susceptible to an LPA-related disorder, e.g., a human with high LPA(a) levels). The antisense strand of the dsRNA contains a complementary region that is essentially complementary to, and typically perfectly complementary to, the target sequence. The sense strand contains a region complementary to the antisense strand, such that when combined under appropriate conditions, the two strands can hybridize to form a duplex structure. Typically, the length of the duplex structure is 15 to 30 base pairs. Similarly, the length of the region complementary to the target sequence is 15 to 30 nucleotides.

[0067] In some embodiments, the RNA inhibitors of the present invention are formed by base pairing between sense and antisense strands having a length of 15-30 bases, with a length of 19-23 being preferred.

[0068] In some embodiments, there is at least 85% base complementarity between the sense strand and the antisense strand of the RNA inhibitor of the present invention;

[0069] In some embodiments, the sense strand of an RNA inhibitor of the present invention is selected from the sequences in Table 1 below: [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] where g = guanylic acid, a = adenosinic acid, u = uridine acid, and c = nucleotide acid.

[0070] In some embodiments, the antisense strand of an RNA inhibitor of the present invention is selected from the sequences in Table 2 below: [Table 2-1] [Table 2-2] [Table 2-3] where g = guanylic acid, a = adenosinic acid, u = uridine acid, c = nucleotide acid, and t = thymidylic acid.

[0071] In some embodiments, the sense strand in Table 1 is complementary to the corresponding antisense strand in Table 2 to form a dsRNA, and may be partially or fully complementary. The partially complementary may be at least 85% base pairing.

[0072] In some embodiments, the RNA inhibitor of the present invention is selected from Table 3 below. [Table 3]

[0073] In some embodiments, the RNA inhibitors can be added to cell lines for sequence screening using cell transfection methods or liposome-nucleic acid nanoparticle methods well known to those skilled in the art. The entire disclosures of related lipid compounds and methods for preparing liposome-nucleic acid nanoparticles in patents US9233971B2, US9080186B2, CN102985548B, and CN103189057B are incorporated herein by reference.

[0074] In some embodiments, wherein the amphoteric lipids in the lipid compound are preferably macrocyclic aliphatic compounds D1C1, T1C1, T1C6, T4C4, B2C1, B2C6, B2C7, and M10C1.

[0075] As known to those skilled in the art, dsRNAs having approximately 20-23 base pairs, e.g., 21 base pair duplex structures, have been found to be particularly effective in inducing RNA inhibition (Elbashir et al., EMBO 2001, 20:6877-6888). However, others have demonstrated that shorter or longer RNA duplex structures are also effective (Chu and Rana (2007) RNA 14:1714-1719; Kim et al. (2005) Nat Biotech 23:222-226). Given the sequences in Tables 1, 2, and 3, one can reasonably expect that duplexes with a few nucleotides added or removed from one or both ends may be similarly effective compared to the dsRNAs listed above. Therefore, any inhibiting dsRNA having a sequence of at least 15, 16, 17, 18, 19, 20, 21 or more consecutive nucleotides of one of the sequences in Tables 1, 2 and 3, and whose ability to inhibit expression of the LPA gene differs from that of a dsRNA containing the entire sequence by no more than about 5, 10, 15, 20, 25 or 30%, is within the scope of the present application.

[0076] The dsRNA described herein may further include one or more single-stranded nucleotide overhangs, for example, 1, 2, 3, or 4 nucleotides. The nucleotide overhangs may include nucleotide / nucleoside analogs or combinations thereof, including deoxynucleotides. The overhangs may be in the sense strand, the antisense strand, or a combination thereof. The nucleotides in the overhangs may be located at the 5'-end, 3'-end, or both ends of the antisense or sense strand of the dsRNA. The overhangs may be formed such that one strand is longer than the other, or may be formed alternately by two strands of the same length. The overhangs may be in the antisense strand and may be mismatched or complementary to the LPA mRNA, forming a different sequence. For example, the overhangs may be located at the 3'-end of the sense strand, or alternatively, at the 3'-end of the antisense strand.

[0077] The dsRNA may further have a flat end. By flat end, it is meant that the dsRNA has unpaired nucleotides at its ends, i.e., no nucleotide overhangs. The flat end may be located at the 5' end of the antisense strand and the 3' end of the sense strand, or vice versa, or a double-ended blunt-ended dsRNA is double-stranded throughout its entire length, i.e., has no nucleotide overhangs at either end of the molecule.

[0078] In some embodiments, the sense or antisense strand of the dsRNA has a nucleotide overhang at the 3' end, the overhang comprising 1, 2, 3, or 4 nucleotides, while the 5' end is plain.

[0079] In some embodiments, the overhangs are present on both the 3'-end of the sense strand and the antisense strand, and the overhangs comprise 1, 2, 3, or 4 nucleotides.

[0080] In some embodiments, the dsRNA is blunt-ended, 19, 21, or 23 nucleotides in length, and the entire length is double-stranded dsRNA, i.e., there are no nucleotide overhangs on either end of the molecule.

[0081] In some embodiments, the dsRNA has a length of 21 nucleotides, and both the sense strand and the antisense strand have a 2-nucleotide overhang at the 3' end.

[0082] To enhance the in vivo stability of the present RNA inhibitors, and thus enhance their activity, the sense and antisense strands of the RNA inhibitors can be modified, and nucleotides therein may have modified groups, and the entire strand or a portion of the strand may be modified. In some embodiments, one or more nucleotides on the sense and / or antisense strands are modified to form modified nucleotides.

[0083] In some embodiments, the sense and antisense strands of the RNA inhibitors (e.g., dsRNA) of the present application are unmodified. In other embodiments, the sense and antisense strands of the RNA inhibitors of the present application are modified to enhance stability or other advantageous properties through chemical modifications or couplings known in the art and described herein. In other embodiments of the present application, all or essentially all nucleotides of the RNA inhibitors of the present application may be modified, i.e., the strands of the RNA inhibitors have no more than 5, 4, 3, 2, or 1 unmodified nucleotide.

[0084] The sense and antisense strands of the RNA inhibitors of the present application may be synthesized and / or modified by methods known in the art, such as those described in "Current Protocols in Nucleic Acid Chemistry," Beaucage, SL et al. (eds.), John Wiley & Sons, Inc., New York, NY, USA, which is incorporated herein by reference. Modifications include, for example, terminal modifications such as 5'-end modifications (phosphorylation, coupling, reverse ligation) or 3'-end modifications (coupling, DNA nucleotides, reverse ligation, etc.), base modifications using stabilizing bases, labile bases, or removable bases (abasic nucleotides) or coupling bases, sugar modifications (e.g., at the 2'- or 4'-position) or sugar substitutions, or backbone modifications including modification or substitution of phosphodiester linkages. In the RNA inhibitors of the present application, both the sense and antisense strands of the RNA inhibitor need not be uniformly modified; one or more types of modifications may be incorporated into a single nucleotide.

[0085] In some embodiments, the modified nucleotides are selected from deoxyribonucleotides, nucleotide mimetics, abasic nucleotides, 2'-modified nucleotides, 3'-3' linked (inverted) nucleotides, nucleotides containing unnatural bases, bridged nucleotides, peptide nucleic acids (PNAs), unlocked nucleobase analogs, locked nucleotides, 3'-O-methoxy (2' internucleoside linkage) nucleotides, 2'-F-arabinonucleotides, 5'-Me / 2'-fluoro nucleotides, morpholino nucleotides, vinylphosphonate deoxyribonucleotides, vinylphosphonate-containing nucleotides and cyclopropylphosphonate-containing nucleotides.

[0086] In some embodiments, the 2'-modified nucleotides comprise 2'-O-methyl nucleotides, 2'-deoxy-2'-fluoro nucleotides, 2'-deoxy nucleotides, 2'-methoxyethyl nucleotides, 2'-amino nucleotides, and / or 2'-alkyl nucleotides.

[0087] In some embodiments, wherein at least two or more even-numbered 2'-position glycosyl nucleotides starting from the 5'-end of the antisense strand are fluorine.

[0088] In some embodiments, all 2'-positions of glycosyl nucleotides on even-numbered positions starting from the 5'-end of the antisense strand are fluorine.

[0089] In some embodiments, at least one of the glycosyl 2'-positions of nucleotides at positions 2, 4, 6, 8, 12, and 14, starting from the 5'-end of the antisense strand, is fluorine, e.g., wherein the glycosyl 2'-positions of nucleotides at positions 2, 4, 6, 8, 12, and 14, starting from the 5'-end of the antisense strand, are all fluorine.

[0090] In some embodiments, the antisense strand has at least one 2'-position glycosyl group in the remaining nucleotides, except for nucleotides at positions 2, 6, 8, 10, 14, and 16 starting from the 5'-end, which is a methoxy group.

[0091] In some embodiments, the antisense strand has at least one 2'-position glycosyl group in the remaining nucleotides, excluding nucleotides 2, 4, 6, 8, 14, and 16 starting from the 5'-end, that are methoxy groups.

[0092] In some embodiments, the antisense strand has at least one glycosyl 2'-position of the remaining nucleotides, except for nucleotides 2, 4, 6, 8, 14, 16, 18, and 20 starting from the 5'-end, that is a methoxy group.

[0093] In some embodiments, at least two or more nucleotide glycosyl 2' positions on odd-numbered positions starting from the 5' end of the sense strand are fluorine.

[0094] In some embodiments, all 2'-positions of glycosyl nucleotides on odd-numbered positions starting from the 5'-end of the sense strand are fluorine.

[0095] In some embodiments, at least one of the 2'-position glycosyl groups of nucleotides at positions 5, 7, 8, and 9, starting from the 5'-end of the sense strand, is fluorine. For example, the 2'-position glycosyl groups of nucleotides at positions 5, 7, 8, and 9, starting from the 5'-end of the sense strand, are all fluorine.

[0096] In some embodiments, the sense strand has at least one glycosyl 2'-position of the remaining nucleotides, excluding nucleotides at positions 5, 7, 8, and 9 starting from the 5'-end, that is a methoxy group.

[0097] In some embodiments, at least one of the 2'-position glycosyl groups of nucleotides at positions 7, 9, 10, and 11, starting from the 5'-end of the sense strand, is fluorine. For example, the 2'-position glycosyl groups of nucleotides at positions 7, 9, 10, and 11, starting from the 5'-end of the sense strand, are all fluorine.

[0098] In some embodiments, the sense strand has at least one 2'-position glycosyl group in the remaining nucleotides, excluding nucleotides at positions 7, 9, 10, and 11 starting from the 5'-end, that are methoxy groups.

[0099] In some embodiments, at least one of the 2'-position glycosyl groups of nucleotides at positions 3, 5, 7, 9, 10, 11, 13, and 15, starting from the 5'-end of the sense strand, is fluorine. For example, the 2'-position glycosyl groups of nucleotides at positions 3, 5, 7, 9, 10, 11, 13, and 15, starting from the 5'-end of the sense strand, are all fluorine.

[0100] In some embodiments, the sense strand has at least one glycosyl 2'-position of the remaining nucleotides, excluding nucleotides at positions 3, 5, 7, 9, 10, 11, 13, and 15 starting from the 5'-end, that is a methoxy group.

[0101] In some embodiments, the sense strand has at least one 2'-position glycosyl group in the remaining nucleotides, excluding nucleotides at positions 7, 8, 9, and 10 starting from the 5'-end, that are methoxy groups.

[0102] For example, some or all of the -OH at the 2'-position of glycosyl in nucleotides in the sense strand and / or antisense strand may be substituted, wherein the substituent is a fluorine or methoxy group. Preferably, the 2'-positions of glycosyl in nucleotides at positions 9, 10, and 11, starting from the 5'-end of the sense strand, are fluorine, and the 2'-positions of glycosyl in nucleotides at positions 2, 4, 6, 12, 14, 16, 18, and 20, starting from the 5'-end of the antisense strand, are fluorine, and the remaining 2'-positions of glycosyl in nucleotides are all methoxy groups; or preferably, the 2'-positions of glycosyl in nucleotides at positions 5, 7, 8, and 9, starting from the 5'-end of the sense strand, are fluorine, and the 2'-positions of glycosyl in nucleotides at positions 2, 4, 8, 14, and 16, starting from the 5'-end of the antisense strand, are fluorine, and the remaining 2'-positions of glycosyl in nucleotides are all methoxy groups.

[0103] In some embodiments, there are at least two consecutive phosphorothioate bonds between nucleotides of the sense and / or antisense strands.

[0104] In some embodiments, there are at least two consecutive phosphorothioate bonds between three consecutive nucleotides at at least one of the ends of the sense strand and / or the antisense strand.

[0105] For example, there are at least two consecutive phosphorothioate bonds between three consecutive nucleotides at the 5' and 3' ends of the sense and antisense strands.

[0106] For example, the 2'-positions of glycosyl nucleotides at positions 9, 10, and 11 starting from the 5'-end of the sense strand are fluorine, and the 2'-positions of glycosyl nucleotides at positions 2, 4, 6, 12, 14, 16, 18, and 20 starting from the 5'-end of the antisense strand are fluorine, and the 2'-positions of glycosyl nucleotides at the remaining positions are all methoxy groups, and there are at least two consecutive thiophosphate bonds between three consecutive nucleotides at the 5'-end and 3'-end of the sense strand and antisense strand.

[0107] In some embodiments, the 2' positions of some nucleotides in the sense strand are fluorine or methoxy, and phosphate bonds between at least three adjacent nucleotides at the end of the antisense strand may be thiolated. The 2' positions of nucleotides 5, 7, 8, and 9, or 3, 5, 7, 8, 9, 11, 13, and 15, starting from the 5' end of the sense strand, are fluorine, and the 2' positions of the remaining nucleotides are methoxy, and phosphate bonds between at least three adjacent nucleotides at the end of the antisense strand may be thiolated.

[0108] In some embodiments, the 2' positions of some nucleotides in the sense strand are fluorine or methoxy, and phosphate bonds between at least three adjacent nucleotides at the end of the antisense strand may be thiolated. The 2' positions of nucleotides 9, 10, and 11, or 3, 5, 7, 8, 9, 11, 13, 15, and / or 17 starting from the 5' end of the sense strand are fluorine, and the 2' positions of the remaining nucleotides are methoxy, and phosphate bonds between at least three adjacent nucleotides at the end of the antisense strand may be thiolated.

[0109] In some embodiments, the sense and antisense strands in the RNA inhibitors of the present invention are selected from Table 4 below: [Table 4-1] [Table 4-2] where G = 2'-O-methylguanylic acid, A = 2'-O-methyladenosinic acid, U = 2'-O-methyluridine acid, C = 2'-O-methylnucleotidic acid, Gs = 2'-O-methyl-3'-thioguanylic acid, As = 2'-O-methyl-3'-thioadenosinic acid, U = 2'-O-methyl-3'-thiouridine acid, Cs = 2'-O-methyl-3'-thionylic acid, fG = 2'-fluoroguanylic acid, fA = 2'-fluoroadenosinic acid, fU = 2'-fluorouridylic acid, fC = 2'-fluoronucleotide acid, fGs = 2'-fluoro-3'-thioguanylic acid, fAs = 2'-fluoro-3'-thioadenosinic acid, fUs = 2'-fluoro-3'-thiouridylic acid, fCs = 2'-fluoro-3'-thionylic acid, T = 2'-deoxy-thymidylic acid, dT = 2'-deoxy-thymidylic acid.

[0110] In some embodiments, the sense and antisense strands of the RNA inhibitors of the present invention are selected from Table 5 below: [Table 5-1] [Table 5-2] where G = 2'-O-methylguanylic acid, A = 2'-O-methyladenosinic acid, U = 2'-O-methyluridine acid, C = 2'-O-methylnucleotidic acid, Gs = 2'-O-methyl-3'-thioguanylic acid, As = 2'-O-methyl-3'-thioadenosinic acid, U = 2'-O-methyl-3'-thiouridine acid, Cs = 2'-O-methyl-3'-thionylic acid, fG = 2'-fulv fA = 2'-fluoroadenosinic acid, fU = 2'-fluorouridylic acid, fC = 2'-fluoronucleotide acid, fGs = 2'-fluoro-3'-thioguanylic acid, fAs = 2'-fluoro-3'-thioadenosinic acid, fUs = 2'-fluoro-3'-thiouridylic acid, fCs = 2'-fluoro-3'-thionylic acid, dT = 2'-deoxythymidylic acid.

[0111] In some embodiments, the sense and antisense strands in the RNA inhibitors of the present invention are selected from Table 6 below: [Table 6-1] [Table 6-2] where G = 2'-O-methylguanylic acid, A = 2'-O-methyladenosinic acid, U = 2'-O-methyluridine acid, C = 2'-O-methylnucleotidic acid, Gs = 2'-O-methyl-3'-thioguanylic acid, As = 2'-O-methyl-3'-thioadenosinic acid, U = 2'-O-methyl-3'-thiouridine acid, Cs = 2'-O-methyl-3'-thionylic acid, fG = 2'-fluoroguanylic acid, fA = 2'-fluoroadenosinic acid, fU = 2'-fluorouridylic acid, fC = 2'-fluoronucleotide acid, fGs = 2'-fluoro-3'-thioguanylic acid, fAs = 2'-fluoro-3'-thioadenosinic acid, fUs = 2'-fluoro-3'-thiouridylic acid, fCs = 2'-fluoro-3'-thionylic acid, T = 2'-deoxy-thymidylic acid, dT = 2'-deoxy-thymidylic acid.

[0112] In some embodiments, the sense and antisense strands of the RNA inhibitors of the present invention are selected from Table 7 below: [Table 7-1] [Table 7-2] where G = 2'-O-methylguanylic acid, A = 2'-O-methyladenosinic acid, U = 2'-O-methyluridine acid, C = 2'-O-methylnucleotidic acid, Gs = 2'-O-methyl-3'-thioguanylic acid, As = 2'-O-methyl-3'-thioadenosinic acid, U = 2'-O-methyl-3'-thiouridine acid, Cs = 2'-O-methyl-3'-thionylic acid, fG = 2'-fulv fA = 2'-fluoroadenosinic acid, fU = 2'-fluorouridylic acid, fC = 2'-fluoronucleotide acid, fGs = 2'-fluoro-3'-thioguanylic acid, fAs = 2'-fluoro-3'-thioadenosinic acid, fUs = 2'-fluoro-3'-thiouridylic acid, fCs = 2'-fluoro-3'-thionylic acid, dT = 2'-deoxythymidylic acid.

[0113] In some embodiments, the sense and antisense strands in the RNA inhibitors of the present invention are selected from Table 8 below: [Table 8-1] [Table 8-2] where G = 2'-O-methylguanylic acid, A = 2'-O-methyladenosinic acid, U = 2'-O-methyluridine acid, C = 2'-O-methylnucleotidic acid, Gs = 2'-O-methyl-3'-thioguanylic acid, As = 2'-O-methyl-3'-thioadenosinic acid, U = 2'-O-methyl-3'-thiouridine acid, Cs = 2'-O-methyl-3'-thionylic acid, fG = 2'-fulv fA = 2'-fluoroadenosinic acid, fU = 2'-fluorouridylic acid, fC = 2'-fluoronucleotide acid, fGs = 2'-fluoro-3'-thioguanylic acid, fAs = 2'-fluoro-3'-thioadenosinic acid, fUs = 2'-fluoro-3'-thiouridylic acid, fCs = 2'-fluoro-3'-thionylic acid, dT = 2'-deoxythymidylic acid.

[0114] In some embodiments, the sense or antisense strand of an RNA inhibitor of the present invention has a sequence having at least 15 contiguous nucleotides that are identical to the sense or antisense strand in Tables 4 to 8, or a sequence that differs by one, two, or three nucleotides.

[0115] In some embodiments, the incorporation of a ligand for a target tissue receptor into the carrier alters the distribution, targeting, or stability of the RNA inhibitor. For example, a specific ligand can provide enhanced affinity for a selected target (e.g., molecule, cell or cell type, region (e.g., cell or organ region, body tissue, organ, or region)) compared to the species in the absence of the ligand.

[0116] Ligands may include naturally occurring substances such as proteins (e.g., human serum albumin (HSA), low density lipoprotein (LDL), or globulins), carbohydrates (e.g., dextran, fungal polysaccharides, chitosan, shellfish shell, inulin, cyclodextrin, N-acetylglucosamine, N-acetylgalactiamine, or hyaluronic acid), or lipids. Ligands may also be recombinant or synthetic molecules, such as synthetic polymers, e.g., synthetic polyamino acids.

[0117] The ligand may comprise a targeting group, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid, or protein, e.g., an antibody, that binds to a specified cell type, e.g., kidney cells. The targeting group may be thyroid hormone, biotin, lectin, glycoprotein, surfactant protein A, mucin carbohydrate, polyvalent lactose, polyvalent galactose, N-acetyl-galactiamine, N-acetyl-glucosamine, polyvalent mannose, polyvalent lithophoric acid, glycosylated polyamino acid, polyvalent galactose, transferrin, bisphosphonate, polyglutamic acid, polyaspartic acid, lipid, cholesterol, steroid, cholic acid, folic acid, vitamin B12, vitamin A, biotin, or an RGD peptide or RGD peptidomimetic. In some embodiments, the ligand is a polyvalent galactose, e.g., N-acetyl-galactiamine.

[0118] The sense and antisense strands contained in the RNA inhibitors of the present invention can be easily and routinely produced by the well-known technique of solid-phase synthesis. Any other method for such synthesis known in the art, such as liquid-phase synthesis or fermentation, can be used separately or alternatively.

[0119] In some embodiments, except for commercially available and commonly used standard and non-standard nucleoside phosphoramidite monomers, the sense and antisense strands contained in the RNA inhibitors of the present application can be synthesized by the phosphoramidite method derived from carrier-nucleoside phosphoramidite monomers using an automated synthesizer.

[0120] In some embodiments, the ligands of the present invention are coupled to the 5' and / or 3' ends of the antisense strand and / or the 5' and / or 3' ends of the sense strand by a carrier structure.

[0121] For example, the carrier structure may be coupled to the 5' and / or 3' end of the sense strand, or the carrier structure may be coupled to the 5' end of the antisense strand and the carrier structure is coupled to the 3' end of the sense strand, or the carrier structure may be coupled to the 3' end of the antisense strand and the ligand is coupled to the 5' end of the sense strand.

[0122] In some embodiments, the carrier structure comprises a 5'MVIP and a 3'MVIP, wherein the 5'MVIP is coupled to the 5' end of the sense strand and / or antisense strand and the 3'MVIP is coupled to the 3' end of the antisense strand and / or sense strand, the structure of the 5'MVIP being shown in Formula I and the structure of the 3'MVIP being shown in Formula II: TIFF2025535491000045.tif939I TIFF2025535491000046.tif942II where: X is a liver target-specific ligand; L is a branched chain; B is the joint, D is a linking chain, R1 and R2 are relay points, The 5'MVIP is linked to the 5' end of the sense strand or the 5' end of the antisense strand via relay R1, and the 3'MVIP is linked to the 3' end of the sense strand or the 3' end of the antisense strand via relay R2, where n and m are each independently any integer from 0 to 4, and n+m=2 to 6, preferably n+m=2, 3, or 4, and more preferably 4.

[0123] In some embodiments, the linkage between R1 or R2 and the sense or antisense strand is a phosphate or modified phosphate, and R1 or R2 is preferably linked to the sense or antisense strand via a phosphate or thiophosphate.

[0124] In some embodiments, m or n can be 0, ie, there is no 3'MVIP or 5'MVIP.

[0125] In some embodiments, when n=0 (ie, there is no 5'MVIP), the structure of the 3'MVIP may be: JPEG2025535491000047.jpg74142 JPEG2025535491000048.jpg92149

[0126] In some embodiments, when n=1, the structure of the 3'MVIP may be: JPEG2025535491000049.jpg79149

[0127] In some embodiments, when n=2, the structure of the 3'MVIP may be: JPEG2025535491000050.jpg142134

[0128] In some embodiments, when n=3, the structure of the 3'MVIP may be: JPEG2025535491000051.jpg119138

[0129] In some embodiments, when n=4, the structure of the 3'MVIP may be: JPEG2025535491000052.jpg126147

[0130] In some embodiments, n refers to the sum of n in the 5'-end 5'MVIP of the sense strand and antisense strand placed simultaneously on the RNA inhibitor, and m refers to the sum of m in the 3'-end 3'MVIP of the sense strand and antisense strand placed simultaneously on the RNA inhibitor.

[0131] In some embodiments, the R1 and R2 structures include -NH-, -S-, and / or -O-, and R1 and R2 are connected to the linking strand D and the 5' end and 3' end of the sense strand and / or antisense strand, respectively, via -NH-, -S-, or -O- in the structures, and R1 and R2 are the same or different.

[0132] In some embodiments, R1 and R2 are optionally linear carbon chains or linear carbon chains with amide groups, carboxyl or alkyl branched chains, or cyclic structures, wherein the cyclic structures include saturated or unsaturated aliphatic carbocyclic groups, or 5- or 6-membered heterocyclic groups or aromatic hydrocarbon groups containing sulfur, oxygen or nitrogen atoms.

[0133] In some embodiments, R1 and / or R2 are 、 -E1(CH2) x CH2E2-, where x is any integer from 3 to 12, and the groups E1 and E2 may each be -NH-, -S-, or -O-.

[0134] In some embodiments, R1 and / or R2 are -E1(CH2) x1 CH(OH)(CH2) x2E2-, where x1 or x2 is each independently an integer of 3 to 10, and E1 and E2 may each be -NH-, -S-, or -O-.

[0135] In some embodiments, R1 is a heterocyclic or carbocyclic structure containing N, S, or O, as shown below. JPEG2025535491000053.jpg69152

[0136] In some embodiments, the relay R1 is -NH(CH2) x CH2O-, where x is any integer from 3 to 12, preferably any integer from 4 to 6, which may be introduced in the following two types of phosphoramidite monomers:

[0137] i. One -O- or -S- in the R1 structure is used to synthesize an R1 phosphoramidite monomer, which accesses the 5' end of the sense or antisense strand of the RNA inhibitor by solid-phase synthesis. -NH-, -S-, or -O- in the structure is used to introduce a liver target-specific ligand X into the 5' end of the sense or antisense strand of the RNA inhibitor by linking it to the linker D in the 5'MVIP. Exemplary structures of monomers introduced into the 5' end of the sense or antisense strand of the RNA inhibitor are as follows: TIFF2025535491000054.tif3260

[0138] In some embodiments, the following structure is preferred: One of the -NH-, -S- or -O- groups in the TIFF2025535491000055.tif3390ii.R1 structure is first linked to the linker chain D, and the other -NH-, -S- or -O- group is used to form an ester with the phosphoramidite in the synthesis of the 5'MVIP phosphoramidite monomer. Examples showing the structure of the sense strand or antisense strand 5'MVIP phosphoramidite monomer are as follows. TIFF2025535491000056.tif44110

[0139] In some embodiments, the sense or antisense strand 5'MVIP phosphoramidite monomer preferably has the following structure: TIFF2025535491000057.tif39132

[0140] When n in the general formula is 1-4, the joint B portion in the above monomer can be branched 1 to 4 times to obtain the corresponding monomeric compound, and the liver-targeting-specific ligand X can be introduced into the 5'-end of the sense strand or antisense strand by solid-phase synthesis using the above monomeric compound.

[0141] In some embodiments, the relay R1 is -NH(CH2) x CH2O-, where x can be any integer from 3 to 12, and preferably any integer from 4 to 6.

[0142] In some embodiments, the structure of the 5'MVIP phosphoramidite monomer is selected from the following structures: TIFF2025535491000058.tif235153 TIFF2025535491000059.tif139153 TIFF2025535491000060.tif103161 TIFF2025535491000061.tif54159 TIFF2025535491000062.tif56150

[0143] In some embodiments, the relay R2 is a heterocyclic or carbocyclic structure containing N, S, or O, as shown below: TIFF2025535491000063.tif66162

[0144] In some embodiments, the relay point R2 is 、 -NH(CH2) x1 CH(OH)(CH2) x2CH2O-, where x1 is any integer from 1 to 4, and x2 is any integer from 0 to 4.

[0145] The relay R2 described in this application forms an -NH-, -S-, or -O-ester or amide in the R2 structure using succinic anhydride, which simultaneously couples with the -NH- in the blank solid support to form a 3'MVIP solid support, and then the 3'MVIP is introduced to the 3' end of the sense strand or antisense strand by phosphoramidite solid phase synthesis.

[0146] In some embodiments, the heterocycle in the relay R2 structure is a pyrrolyl ring or a piperidine ring, and is linked to the linker chain D of the 3'MVIP via the nitrogen heteroatom in the ring. An exemplary structure of the 3'MVIP solid support to be introduced is as follows: JPEG2025535491000064.jpg55158 In the general formula, when m is 1-4, the joint B portion in the above monomer can branch 1 to 4 times to obtain the corresponding solid support.

[0147] In some embodiments, the relay point R2 is 、 -B4(CH2) x1 CH(OH)(CH2) x2 CH2B5-, where x1 is any integer from 1 to 4, x2 is any integer from 0 to 4, and B4 and B5 are -NH-, -S-, or -O-, respectively. An exemplary structure of the introduced 3'MVIP solid support is as follows: JPEG2025535491000065.jpg35124 In the general formula, when m is 1-4, the joint B portion in the above monomer can branch 1 to 4 times to obtain the corresponding solid support.

[0148] In some embodiments, R2 is 、 An exemplary structure of the introduced 3'MVIP solid support is: -NHCH2CH(OH)CH2O-. JPEG2025535491000066.jpg34121

[0149] When m is 1-4 in the general formula, the joint B moiety in the above monomer can branch 1 to 4 times to obtain the corresponding solid support.

[0150] In some embodiments, the 3'MVIP solid support structure is as follows: JPEG2025535491000067.jpg170150 JPEG2025535491000068.jpg243129 JPEG2025535491000069.jpg144137 JPEG2025535491000070.jpg161153

[0151] In some embodiments, the liver-targeting-specific ligand X is selected from structures for enhancing uptake of the RNA inhibitor by hepatocytes, and may be a lipid, steroid, vitamin, sugar, protein, peptide, polyamine, or peptide simulation structure. In the RNA inhibitor of the present application, the liver-targeting-specific ligand X introduced at the end of the sense strand or antisense strand of the RNA inhibitor may be the same or different. For example, some may have properties that enhance liver targeting, some may have a structure that regulates the pharmacokinetics of the RNA inhibitor in vivo, or some may have a structure that has solubility activity in vivo. In some embodiments, the liver-targeting-specific ligand X is selected from one or more monosaccharides and derivatives thereof having the following structures:

[0152] In some embodiments, the monosaccharide is selected from one or more of the following structures: mannose, galactose, D-arabinose, glucose, fructose, xylose, glucosamine, and ribose. The monosaccharide derivative is selected from mannose derivatives, galactose derivatives, glucose derivatives, ribonucleotide derivatives, and other derivatives.

[0153] In some embodiments, the liver target-specific ligand X is selected from galactose, galactiamine, N-acetylgalactiamine, and derivatives thereof, and has the general structural formula: TIFF2025535491000071.tif3455 where W1 is hydrogen or a hydroxyl protecting group and may be the same or different, and W is -OH, -NHCOOH, or -NHCO(CH2) q CH3, where q is an integer from 0 to 4, and W2 is 、 -NH-, O, S or C.

[0154] In some embodiments, the liver target-specific ligand X is N-acetylgalactiamine and its derivatives.

[0155] In some embodiments, the liver target-specific ligand X is selected from the following structures: TIFF2025535491000072.tif108153Where W is -OH, -NHCOOH or -NHCO(CH2) q CH3, where q is an integer from 0 to 4.

[0156] In some embodiments, the liver target-specific ligands X may be the same or different in the same 5'MVIP or 3'MVIP structure.

[0157] In some embodiments, X between the 5'MVIP and the 3'MVIP may be the same or different.

[0158] In some embodiments, the branched chain L is selected from the group consisting of -NH-, -C(=O)-, -O-, -S-, an amide group, a phosphoryl group, a thiophosphoryl group, a C4-C 10 C4-C, including aliphatic carbocyclic groups, phenyl, or combinations of these groups 18 It is a carbon chain.

[0159] In some embodiments, the branched chain L further comprises a hydroxyethyl or carboxylic acid side chain.

[0160] In some embodiments, the branched chain L is a C7-C aryl group containing an amide group or a 6-membered aliphatic carbocyclic group. 18 It is a carbon chain.

[0161] In some embodiments, the branched chain L is selected from one or more of the following structures: TIFF2025535491000073.tif77164 where r1 is any integer from 1 to 12, r2 is any integer from 0 to 20, and Z is H, an alkyl group or an amide group, the alkyl group being, for example, a C1-C5 alkyl.

[0162] In some embodiments, the structure of the joint B is related to the number of X that can be introduced, and the joint B includes -NH-, C, O, S, an amide group, a phosphoryl group, and a thiophosphoryl group. When n or m is 1, it is a linear carbon chain, and when n or m is 2, 3, or 4, the number of branches is 2, 3, or 4, respectively.

[0163] In some embodiments, the joint B is selected from the following structures: JPEG2025535491000074.jpg157158Here, A1 and A2 are each independently C, O, S, -NH-, a carbonyl group, an amide group, a phosphoryl group, or a thiophosphoryl group, and r is an integer of 0 to 4.

[0164] In some embodiments, the joint B is selected from the following structures: JPEG2025535491000075.jpg93163 JPEG2025535491000076.jpg108163 JPEG2025535491000077.jpg219148Here, r is any integer between 0 and 4.

[0165] In some embodiments, the joint B is selected from the following structures: JPEG2025535491000078.jpg214151 JPEG2025535491000079.jpg143155 TIFF2025535491000080.tif95147 JPEG2025535491000081.jpg64162

[0166] In some embodiments, the joint B is selected from the following structures: JPEG2025535491000082.jpg100150

[0167] In some embodiments, the linking chain D is -NH-, C=O, O, S, an amide group, a phosphoryl group, a thiophosphoryl group, an aromatic hydrocarbon group, a C4-C 10 C3-C, including aliphatic carbocyclic groups, 5- or 6-membered heterocyclic groups of 1-3 nitrogen atoms, or combinations of these groups 18 It is a carbon chain.

[0168] In some embodiments, the linking chain D further comprises a side chain of hydroxymethyl, methyl tert-butyl, methyl phenol group, or C5-C6 aliphatic ring group.

[0169] In some embodiments, the linking chain D is a C3-C aryl group containing two C=O, a 6-membered aliphatic carbocyclic group, or a phenyl. 10 It is a carbon chain.

[0170] In some embodiments, the linking chain D is a C3-C 10 It is a carbon chain.

[0171] In some embodiments, the linking chain D is selected from the following structures: JPEG2025535491000083.jpg53162 JPEG2025535491000084.jpg59162 JPEG2025535491000085.jpg58157 JPEG2025535491000086.jpg60136 JPEG2025535491000087.jpg87162 JPEG2025535491000088.jpg119147 where each p is independently an integer of 1 to 20, s is an integer of 2 to 13, and Z1 and Z2 are the same or different substituents, for example, C3-C 10 It is alkyl.

[0172] In some embodiments, the linking chain D is selected from the following structures: JPEG2025535491000089.jpg35166 JPEG2025535491000090.jpg243160 JPEG2025535491000091.jpg82154

[0173] In some embodiments, the linking chain D is selected from the following structures: JPEG2025535491000092.jpg138159

[0174] In some embodiments, (XL) in the 5'MVIP structure n -BD- and 3'MVIP structure (XL) m -BD- is selected from one or more of the following structures: JPEG2025535491000093.jpg247168 JPEG2025535491000094.jpg109168 JPEG2025535491000095.jpg135115 JPEG2025535491000096.jpg82162 JPEG2025535491000097.jpg230148 JPEG2025535491000098.jpg106150 JPEG2025535491000099.jpg197169 JPEG2025535491000100.jpg46107 JPEG2025535491000101.jpg4997 JPEG2025535491000102.jpg5796 JPEG2025535491000103.jpg43113 JPEG2025535491000104.jpg40109 JPEG2025535491000105.jpg5196 JPEG2025535491000106.jpg49119 JPEG2025535491000107.jpg47119 JPEG2025535491000108.jpg59104 JPEG2025535491000109.jpg71115 JPEG2025535491000110.jpg59120 JPEG2025535491000111.jpg60103 JPEG2025535491000112.jpg55115 JPEG2025535491000113.jpg39169 JPEG2025535491000114.jpg87170 JPEG2025535491000115.jpg53161 JPEG2025535491000116.jpg45168 JPEG2025535491000117.jpg49161 JPEG2025535491000118.jpg46126 JPEG2025535491000119.jpg175170 JPEG2025535491000120.jpg39157 JPEG2025535491000121.jpg229161 JPEG2025535491000122.jpg100169 JPEG2025535491000123.jpg126169 JPEG2025535491000124.jpg238169 JPEG2025535491000125.jpg114134 JPEG2025535491000126.jpg22119

[0175] In some embodiments, X, L, B and D are the same or different within each of the 5'MVIP and 3'MVIP or between the 5'MVIP and 3'MVIP.

[0176] In some embodiments, (XL) in the 5'MVIP structure n -BD- is selected from the structures shown in Table 9. [Table 9-1] [Table 9-2] [Table 9-3] [Table 9-4]

[0177] In some embodiments, the 5'MVIP may be absent, in which case m may be any integer from 2-4.

[0178] In some embodiments, (XL) in the 3'MVIP structure m -BD- is selected from the structures shown in Table 10. [Table 10-1] [Table 10-2] [Table 10-3] [Table 10-4]

[0179] In some embodiments, the carrier structure (XL) in 5'MVIP n Table 11 shows the combinations of -BD- and R1. [Table 11]

[0180] In some embodiments, the 3'MVIP may be absent, in which case n may be any integer from 2-4.

[0181] In some embodiments, the (XL) in the carrier structure 3'MVIP m The combinations of -BD- and R2 are shown in Table 12. [Table 12-1] [Table 12-2]

[0182] In some embodiments, the 5'MVIP is selected from any one or more of 5'MVIP01 through 5'MVIP22 in Table 11.

[0183] In some embodiments, the 3'MVIP is selected from any one or more of 3'MVIP01 through 3'MVIP27 in Table 12.

[0184] In some embodiments, a 5'MVIP in Table 11 can be combined with any one of the 3'MVIPs in Table 12, where n+m=2, 3, 4, 5, or 6.

[0185] In some embodiments, the sense strand in the RNA inhibitor may be selected from the sequences in Table 13 below. [Table 13]

[0186] In some embodiments, the sense strand of the RNA inhibitors of the present application has a sequence having at least 15 contiguous nucleotides that is identical to the sense strand in Table 13, or a sequence that differs from the sense strand in Table 13 by one, two, or three nucleotides.

[0187] In some embodiments, the antisense strand in the RNA inhibitor may be selected from the sequences in Table 14 below. [Table 14]

[0188] In some embodiments, the antisense strand of the RNA inhibitor of the present application has a sequence having at least 15 contiguous nucleotides that is identical to the antisense strand in Table 14, or a sequence that differs from the antisense strand in Table 14 by one, two, or three nucleotides.

[0189] In some in vivo test embodiments, the RNA inhibitor of the present application is selected from the sequences in Table 15. [Table 15-1] [Table 15-2]

[0190] In some embodiments, the sense and antisense strands of the RNA inhibitors of the present invention are sequences having at least 15 contiguous nucleotides that are identical to the sense and antisense strands in Table 15, or that differ by one, two, or three nucleotides from each sequence in Table 15.

[0191] In some embodiments, the antisense strand of the RNA inhibitor of the present invention is UsfCsGfUAfUAACAAfUAfAGfGAfGCsfUsG (SEQ ID NO:278), and its 5' end and / or 3' end are linked to a 5'MVIP and / or a 3'MVIP of a different structure, and the antisense strand of the linked carrier structure is selected from Table 16 below: [Table 16-1] [Table 16-2] [Table 16-3] [Table 16-4]

[0192] In some embodiments, the antisense strand of an RNA inhibitor of the present invention has a sequence having at least 15 contiguous nucleotides that is identical to the antisense strand in Table 16, or a sequence that differs from the antisense strand in Table 16 by one, two, or three nucleotides.

[0193] In some embodiments, the antisense strand of an RNA inhibitor of the present invention may be obtained by coupling an antisense strand in Tables 5-8 to a 5'MVIP and / or a 3'MVIP.

[0194] In some embodiments, the antisense strand of the RNA inhibitor of the present invention may be a sequence having at least 15 consecutive nucleotides that is identical to the antisense strand in Tables 5-8, or may be obtained by coupling a sequence that differs from the antisense strand in Tables 5-8 by one, two, or three nucleotides to a 5'MVIP and / or a 3'MVIP.

[0195] In some embodiments, the sense strand of the RNA inhibitor of the present invention is CsAsGCUCCUfUfAfUUGUUAUACsGsA (SEQ ID NO:270), and its 5' and / or 3' ends are linked to 5'MVIP and / or 3'MVIP of different structures, and the sense strand of the linked carrier structure is selected from Table 17 below. [Table 17-1] [Table 17-2] [Table 17-3]

[0196] In some embodiments, the sense strand of an RNA inhibitor of the present invention has a sequence having at least 15 consecutive nucleotides that is identical to the sense strand in Table 17, or a sequence that differs from the sense strand in Table 17 by one, two, or three nucleotides.

[0197] In some embodiments, the sense strand of an RNA inhibitor of the present invention may be obtained by coupling a sense strand in Tables 5-8 to a 5'MVIP and / or a 3'MVIP.

[0198] In some embodiments, the sense strand of the RNA inhibitor of the present invention has a sequence having at least 15 consecutive nucleotides that is identical to the sense strand in Tables 5-8, or is obtained by coupling a sequence that differs from the sense strand in Tables 5-8 by one, two, or three nucleotides to a 5'MVIP and / or a 3'MVIP.

[0199] In some embodiments, the RNA inhibitors of the present application are formed by randomly pairing an antisense strand in Table 16 or a sequence that differs from these antisense strands by one, two, or three nucleotides with a sense strand in Table 17 or a sequence that differs from these sense strands by one, two, or three nucleotides.

[0200] In some embodiments, the sense and / or antisense strands of the RNA inhibitor are identical in at least 15 consecutive nucleotides to the sense and / or antisense strands in Table 19, or differ by 1, 2, or 3 nucleotides.

[0201] Patent CN113171371B provides a detailed investigation into the influence of differences in X, L, B, D, R1, and R2 in the 5'MVIP and / or 3'MVIP structures on the activity of RNA inhibitors, and the entire text of this patent is incorporated herein by reference.

[0202] When X is galactose, galactiamine, N-acetylgalactiamine, or a derivative thereof, it is preferable that N-acetylgalactiamine and a derivative thereof are liver-targeting specific ligands in the RNA inhibitor according to the present invention. TIFF2025535491000149.tif164106

[0203] The length of L has a significant effect on the efficacy of RNA inhibitors, and the L chain should not be too short or too long. When it contains -NH-, C=O, O, S, an amide group, a phosphoryl group, a thiophosphoryl group, an aliphatic carbocyclic group such as cyclohexane, or a combination of these groups, or when the L structure of the same 5'MVIP and 3'MVIP is different from that of the 5'MVIP and 3'MVIP, the carbon chain length should be in the range of C7-C18, so that the activity of the resulting RNA inhibitors does not differ significantly. TIFF2025535491000150.tif214133 TIFF2025535491000151.tif177130

[0204] In addition to the structure of joint B being changed, when X, L, D and R1 / R2 are the same as those of the combination 5'MVIP09 / 3'MVIP09, A1 and A2 in the general formula of joint B are each independently C, O, S, -NH-, a carbonyl group, an amide group, a phosphoryl group or a thiophosphoryl group, and r is any integer from 0 to 4. When joint B is the same or different between 5'MVIP and 3'MVIP, the activity of the resulting RNA inhibitors does not differ significantly. TIFF2025535491000152.tif204137 TIFF2025535491000153.tif243137 TIFF2025535491000154.tif234138 TIFF2025535491000155.tif235137 TIFF2025535491000156.tif235138 TIFF2025535491000157.tif250136 TIFF2025535491000158.tif243138 TIFF2025535491000159.tif245137 TIFF2025535491000160.tif246138 TIFF2025535491000161.tif223137

[0205] When the MVIP structure and RNA inhibitor are the same, different linker chains D affect the activity of the RNA inhibitor, where the effects of D1, D2, and D4 are close to and superior to D3. TIFF2025535491000162.tif234141 TIFF2025535491000163.tif90141

[0206] Different relay sites R1 affect the activity of the RNA inhibitor, and the activity of the RNA inhibitor obtained with R1-1 as the relay site is the best. TIFF2025535491000164.tif64143

[0207] Different relay sites R2 affect the activity of the RNA inhibitor, where the RNA inhibitor is most effective when R2-1 is the relay site. TIFF2025535491000165.tif216122 TIFF2025535491000166.tif116123

[0208] In some embodiments, n+m in the RNA inhibitors of the present invention are 2, 3, 4, 5, and 6, respectively. Positions for coupling to 5'MVIP and / or 3'MVIP include the 5'-end and / or 3'-end of the antisense strand, the 5'-end and / or 3'-end of the sense strand, the 5'-end of the antisense strand and the 3'-end of the sense strand, and the 5'-end of the sense strand and the 3'-end of the antisense strand.

[0209] In some embodiments, n+m in the RNA inhibitors of the present invention are 2, 3, 4, 5, and 6, respectively. The positions for coupling to 5'MVIP and / or 3'MVIP include the 5'-end and / or 3'-end of the antisense strand in Tables 5-8, the 5'-end and / or 3'-end of the sense strand in Tables 5-8, the 5'-end of the antisense strand and the 3'-end of the sense strand in Tables 5-8, and the 5'-end of the sense strand and the 3'-end of the antisense strand in Tables 5-8, and the resulting combinations of 5'MVIP and 3'MVIP are shown in Table 18. [Table 18-1] [Table 18-2]

[0210] In some embodiments, n and m are each independently any integer from 0 to 4, preferably 1 to 3, and n+m=2 to 6, preferably n+m=2, 3, or 4, more preferably 4.

[0211] In some embodiments, the RNA inhibitor is selected from Table 19: [Table 19-1] [Table 19-2]

[0212] In some embodiments, the sense and / or antisense strands of the RNA inhibitor have a sequence that is identical to the sense and / or antisense strands in Table 19 with at least 15 contiguous nucleotides, or a sequence that differs from the sense and / or antisense strands in Table 19 by one, two, or three nucleotides.

[0213] In some embodiments, the RNA inhibitors of the present application or their pharmaceutically acceptable salts are preferably manufactured or synthesized in the form of sodium salts, triethylamine salts, or other pharmaceutically acceptable salts.

[0214] In some embodiments, the RNA inhibitors of the present application or pharmaceutically acceptable salts thereof are more preferably sodium or triethylamine salts thereof.

[0215] On the other hand, the present application further provides a pharmaceutical composition comprising the above RNA inhibitor or a pharmaceutically acceptable salt thereof.

[0216] In some embodiments, the present invention provides pharmaceutical compositions comprising the RNA inhibitors or pharmaceutically acceptable salts thereof, and optionally pharmaceutically acceptable adjuvants. Pharmaceutical compositions comprising the RNA inhibitors provided herein may be used to prevent and / or treat related disorders, such as hypertension. Such pharmaceutical compositions are formulated according to the mode of delivery. In one illustrative embodiment, compositions are prepared for systemic administration outside the gastrointestinal tract, for example, subcutaneous (SC), intramuscular (IM), or intravenous (IV) delivery. The pharmaceutical compositions provided herein can be administered at a dose sufficient to inhibit expression of the LPA gene.

[0217] A pharmaceutically acceptable "auxiliary material" or "excipient" is a pharmaceutically acceptable solvent, suspending agent, or any other pharmaceutically inert vehicle for delivering one or more nucleic acids to an animal. The excipient may be liquid or solid and is selected taking into account the intended mode of administration to provide the necessary volume, viscosity, etc. when combined with the nucleic acid and other components in a given pharmaceutical composition. The RNA inhibitors of the present invention can be delivered in a manner that targets specific tissues (e.g., liver cells).

[0218] In some embodiments, the pharmaceutical composition of the present invention further comprises a delivery vehicle (e.g., a nanoparticle, a dendrimer, a polymer, a liposome, or a cationic delivery system); In some embodiments, the delivery vehicle of the present invention comprises a liposome.

[0219] In some embodiments, the delivery vehicle of the present invention comprises a nanolipid, which is capable of forming a liposome-nucleic acid nanoparticle with a nucleic acid molecule.

[0220] In some embodiments, the delivery vehicle of the present invention comprises the amphoteric lipid compound M10C1.

[0221] The pharmaceutical compositions provided herein include, but are not limited to, solutions, emulsions, and liposomal formulations. These compositions can be made from multiple components, including, but not limited to, preformed liquids, self-emulsifying solids, and self-emulsifying semisolids. These formulations include those targeted to the liver. The drug formulations of the present application, which can be readily presented in unit dosage form, can be prepared according to common techniques known in the pharmaceutical industry. These techniques include combining the active ingredient with a pharmaceutically acceptable excipient or vehicle.

[0222] Purpose On the other hand, the present application provides a method for reducing LPA mRNA or protein expression in a cell or tissue, which comprises contacting the cell or tissue with an effective amount of an RNA inhibitor or a pharmaceutically acceptable salt thereof that inhibits expression of the aforementioned LPA gene, and / or said pharmaceutical composition.

[0223] Cells suitable for treatment with the methods of the present application can be any cells that express the LPA gene, such as liver cells, brain cells, gallbladder cells, heart cells, or kidney cells, but are preferably liver cells. Cells suitable for the methods of the present application can also be mammalian cells, and when contacted with cells that express the LPA gene, the RNA inhibitor inhibits expression of the LPA gene (e.g., human, primate, non-primate, or rat LPA gene) by at least about 50%, as measured, for example, by PCR or branched DNA (bDNA)-based methods, or by protein-based methods such as immunofluorescence analysis, Western blotting, or flow cytometry.

[0224] In some embodiments, the tissue is liver tissue.

[0225] In some embodiments, the cells and tissues are in vitro.

[0226] In some embodiments, the cells and tissues are in vivo in a subject.

[0227] As used herein, the term "inhibition" can be used interchangeably with "decrease," "reduction," "silencing," "pulling down," "suppression," and other similar terms, and includes any level of inhibition. Expression of the LPA gene can be assessed according to the level or change in level of any variable associated with expression of the LPA gene, such as LPA mRNA level. This level can be analyzed in a single cell or in a group of cells (e.g., including a sample from a subject). The control level can be any type of control level employed in the art, such as a baseline level before administration or a level measured from a similar subject, cell, or sample that is untreated or receives a control treatment (e.g., a buffer-only control or an inactive agent control).

[0228] Inhibition of expression of the LPA gene is manifested by a reduction in the amount of mRNA that inhibits expression in a first cell or group of cells (such cells may be present, for example, in a sample derived from a subject) in which the LPA gene is transcribed and processed (e.g., by contacting one or more cells with an RNA inhibitor of the present application or by administering an RNA inhibitor of the present application to a subject in which such cells are present) compared to a second cell or group of cells that is essentially the same as, but not treated with, an RNA inhibitor of the target gene of interest (control cells that are not treated with an RNA inhibitor or an RNA inhibitor of the target gene of interest).

[0229] In a preferred embodiment, siRNA is used at appropriate concentrations to assess cell lines that highly express LPA, and mRNA levels in participating target cells are expressed as a percentage of mRNA levels in non-participating control cells.

[0230] In other embodiments, inhibition of LPA gene expression can be assessed by a parameter functionally related to LPA gene expression, e.g., a reduction in LPA(a) levels in the subject's blood or serum. LPA gene inhibition can be measured in any LPA-expressing cell (endogenous or exogenous via an expression construct) and by any assay known in the art.

[0231] Inhibition of LPA expression can be manifested as a decrease in the level of LPA(a) expressed in a cell or group of cells or in a sample from a subject (eg, protein levels in a blood sample from a subject).

[0232] Control cells, cell populations, or subject samples that can be used to assess LPA gene inhibition include samples from cells, cell populations, or subjects that have not been contacted with the subject RNA inhibitors. For example, control cell, cell population, or subject samples can be derived from a single subject (e.g., a human or animal subject) prior to treatment with the RNA inhibitor or from an appropriately matched population control.

[0233] The level of LPA mRNA expressed by a cell or group of cells can be measured by any method known in the art for assessing mRNA expression. For example, qRT-PCR can be used to assess reduced gene expression. Reduced protein production can be assessed by any method known in the art, such as ELISA. In some embodiments, a needle liver biopsy sample is used as the tissue source for monitoring reduced LPA gene expression. In other embodiments, a blood sample is used as the subject's sample for monitoring reduced LPA(a) expression.

[0234] On the other hand, in the use of the RNA inhibitor or a pharmaceutically acceptable salt thereof that inhibits the expression of the above-mentioned LPA gene according to the present application, or the pharmaceutical composition, in the manufacture of a drug, the drug is used to prevent and / or treat a disease or symptom, or to reduce the risk of a disease or symptom.

[0235] In some embodiments, the disease or condition of the present invention comprises a disease or condition associated with the LPA gene, such as cardiovascular disease.

[0236] In some embodiments, the disease or condition of the present invention is selected from hyperlipidemia, hyperlipidemia, stroke, atherosclerosis, thrombosis, coronary heart disease, aortic stenosis, vascular lesions, myocardial infarction, angina pectoris, kidney disease, renal failure, obesity, poor glucose tolerance, type 2 diabetes (non-insulin dependent diabetes mellitus), and metabolic syndrome.

[0237] On the other hand, the present application provides a method for preventing and / or treating a disease or condition, the method comprising administering to a subject in need thereof an effective amount of an RNA inhibitor that inhibits the expression of the aforementioned LPA gene or a pharmaceutically acceptable salt thereof, and / or the pharmaceutical composition.

[0238] The in vivo method of the present application may include administering to a subject a pharmaceutical composition comprising an RNA inhibitor, wherein the RNA inhibitor comprises a nucleotide sequence complementary to at least a portion of the LPA mRNA of the mammal receiving the RNA inhibitor. The pharmaceutical compositions of the present invention may be administered by any method known in the art, including, but not limited to, oral, intraperitoneal, or parenteral routes, including intracranial (e.g., intracerebroventricular, intraparenchymal, and intrathecal), intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), nasal, rectal, and topical (including buccal and sublingual) administration. In some embodiments, the pharmaceutical composition is administered by intravenous infusion or injection. In some embodiments, the pharmaceutical composition is administered by subcutaneous injection. In some embodiments, the composition is administered by intramuscular injection.

[0239] The RNA inhibitors of the present application can be administered as "free RNA inhibitors." Free RNA inhibitors are administered in the absence of a pharmaceutical composition. The nude RNA inhibitors can be in a suitable buffer. The buffer can include acetate, citrate, alcoholic acid, carbonate, or phosphate, or any combination thereof. In one embodiment, the buffer is phosphate buffered saline (PBS). The pH and osmolality of the buffer containing the RNA inhibitor can be adjusted to accommodate administration to a subject.

[0240] Alternatively, the RNA inhibitors of the present application can be administered as pharmaceutical compositions, such as liposomal formulations.

[0241] The pharmaceutical compositions of the present application can be administered in a dose sufficient to inhibit the expression of the LPA gene. Typically, a suitable dose of the RNA inhibitor of the present application is within the range of about 0.001 to about 200.0 mg per kilogram of subject body weight per day, usually within the range of about 1 to 50 mg per kilogram of subject body weight per day. Typically, a suitable dose of the RNA inhibitor of the present application is within the range of about 0.1 mg / kg to about 5.0 mg / kg, for example, within the range of about 0.3 mg / kg to about 3.0 mg / kg.

[0242] In one embodiment, the method comprises reducing expression of the target LPA gene by administering the pharmaceutical composition of the invention, for example, about 1, 2, 3, 4, 5, 6, 1-6, 1-3, or 3-6 months per dose, In some embodiments, the pharmaceutical composition is administered once every 3-6 months.

[0243] In some embodiments, after an initial treatment regimen, treatments are administered less frequently. A dose overlap regimen involves administering a therapeutic amount of the RNA inhibitor on a regular basis, which may include, for example, once a month to once a year. In some embodiments, the RNA inhibitor is administered from about once a month to about once every three months, or from about once every three months to about once every six months.

[0244] After the initial treatment regimen is completed, the RNA inhibitor can be administered less frequently, and the duration of treatment can be determined based on the severity of the disease.

[0245] In other embodiments, the single dose of the pharmaceutical composition may be administered chronically, such that the doses are administered at intervals of no more than 1, 2, 3, or 4 months. In some embodiments of the present application, the single dose of the pharmaceutical composition is administered approximately once a month. In other embodiments of the present application, the single dose of the pharmaceutical composition is administered quarterly (i.e., approximately every 3 months). In other embodiments of the present application, the single dose of the pharmaceutical composition is administered twice a year (i.e., approximately once every 6 months).

[0246] It should be understood by those skilled in the art that several factors can affect the dosage and duration of administration required to effectively treat a subject, including, but not limited to, mutations present in the subject, previous treatments, the general health or age of the subject, and other diseases present. Furthermore, preventing and / or treating a subject, as appropriate, may involve a single treatment or a series of treatments.

[0247] In some embodiments, the method further comprises measuring the level of LP(a) in a sample from the subject.

[0248] For example, the method further comprises measuring the level of LP(a) in a blood, serum, or urine sample from the subject.

[0249] In some embodiments, the method further comprises administering to the subject another therapeutic agent for treating hyperlipidemia, hyperlipidemia, stroke, atherosclerosis, thrombosis, coronary heart disease, and aortic stenosis.

[0250] For example, the additional therapeutic agent may be selected from statin drugs such as atorvastatin, rosuvastatin, etc., cholesterol absorption inhibitors such as ethizimb, PCSK9 inhibitors, ANGPTL3 inhibitors, APOC3 inhibitors, and AGT inhibitors.

[0251] In yet another aspect, the present application provides a cell, which comprises an RNA inhibitor that inhibits expression of the LPA gene, or a pharmaceutically acceptable salt thereof.

[0252] On the other hand, the present application provides a pharmaceutical cassette, which comprises an RNA inhibitor that inhibits the expression of the aforementioned LPA gene, or a pharmaceutically acceptable salt thereof, or said pharmaceutical composition.

[0253] The following examples are intended to describe the RNA inhibitors, production methods, uses, etc. provided herein without being bound by theory, and are not intended to limit the scope of the present application.

[0254] Example explanation: DMSO stands for dimethyl sulfoxide, The name DMF is N,N-dimethylformamide, The name HOBt is 1-hydroxylbenzotriazole, The name of HBTU is O-benzotriazole-tetramethyluronium hexafluorophosphate ester. The name of DIPEA (DIEA) is N,N-diisopropylethylamine, DCM is the name for dichloromethane. The name of DMAP is 4-dimethylaminopyridyl, The name DMT-CL is 4,4'-dimethoxyphenylchloromethane, The name MEOH is methanol, The name of TBTU is O-benzotriazole-N,N,N',N'-tetramethyluronium tetrafluoroborate. JPEG2025535491000171.jpg88 is a solid support, such as macroporous aminomethyl resin.

[0255] Example 1 Synthesis of RNA inhibitors The sense and antisense strands of the uncoupled carrier structures were synthesized using a multichannel solid-phase synthesizer using standard solid-phase phosphoramidite methods, followed by complementary annealing of the sense strand with the corresponding antisense strand to prepare the corresponding RNA inhibitor.

[0256] The basic steps of the solid phase phosphoramidite method include: 1) Deprotection: The hydroxyl protecting group (DMTr) of the starting monomer solid support is removed. 2) Coupling: Add the first phosphoramidite monomer and perform a coupling reaction in the 3'-5' direction. 3) Oxidation: The resulting nucleoside phosphite is oxidized to a more stable nucleoside phosphate (i.e., the trivalent phosphorus is oxidized to a pentavalent phosphorus), 4) Blocking: The 5'-OH of the nucleotide sequence that failed in the previous step is blocked by capping to prevent it from participating in future reactions. The above steps are repeated until the last phosphoramidite monomer is accessed, and then the ester bond between the solid support and the starting monomer is cleaved with aqueous methylamine and ammonia water. The protecting groups on each base and phosphate in the resulting nucleotide sequence are removed, and the resulting product is separated and purified by HPLC, filtered to sterilize, and freeze-dried to obtain the corresponding sense or antisense strand.

[0257] Description of the synthesis process of RNA inhibitors The freeze-dried powders of the sense and antisense strands were reconstituted and mixed equimolarly. An appropriate amount of water for injection and an appropriate amount of TRIS buffer solution were added. The mixture was gently shaken for approximately 1-2 minutes to mix uniformly. The water bath was heated to 92-95°C. The reaction solution was placed in the water bath and heated for 3-5 minutes, gently shaken to heat the solution uniformly. The mixture was then allowed to cool to room temperature. A colorless or slightly yellowish, transparent liquid was obtained, which was sampled and tested for concentration.

[0258] Example 2 In vitro inhibition test 1 of LPA gene expression by RNA inhibitors The RNA inhibitors in this example were selected from Table 3 and prepared by the method described in Example 1. Plasmid DNA (LPA_PSICHECK™-2 plasmid) was transferred into Huh7 cells using Fugene HD. Transfected cells were seeded into a 96-well plate at a density of 10,000 cells per well, with 100 μL of culture medium per well. The cells were cultured overnight in a 5% CO2, 37°C incubator. Then, RNA inhibitor sample solutions were prepared by coating the RNA inhibitor with nanolipids at the corresponding concentrations in PBS. RNAiMAX / Opti-MEM was placed in each well at the corresponding positions, and the diluted RNA inhibitor sample solution was added to the well, mixed uniformly, and incubated. The incubated mixture was then mixed uniformly with DMEM containing 10% FBS. After removing the medium from each well by aspiration, fresh medium containing the sample was added and the wells were then cultured in a 5% CO2, 37°C incubator. The final concentrations of the samples were measured to be 5 nM, 0.5 nM, and 0.05 nM.

[0259] The cells were removed from the incubator, the supernatant aspirated and discarded, and fresh medium and detection reagent were added. After the cells were fully cleaved, the samples were transferred to a light-opaque whiteboard for detection of firefly luminescence signals. Dual-Glo® Stop & Glo® detection reagent was added to each well, and the wells were shaken in the dark to detect Renilla enzyme signals. The ratio of the main reporter gene signal to the internal reference reporter gene signal for each well was calculated. The test results are shown in Table 20 below and Figure 1.

[0260] [Table 20]

[0261] The test results in Table 3 show that the RNA inhibitors at different concentrations exhibited different degrees of inhibitory effects on LPA mRNA levels in Huh7 cells, and exhibited significant dose-dependence. At a low concentration of 0.05 nM, Kylo-11-DS-03, Kylo-11-DS-17, Kylo-11-DS-20, Kylo-11-DS-24 and Kylo-11-DS-27 had inhibitory rates of less than 40%, while the remaining inhibitors all had inhibitory rates greater than 40%.

[0262] Example 3 Synthesis of support structure When the carrier structure 3'MVIP is coupled to the 3' end of the sense or antisense strand of the RNA inhibitor of the present application, the solid support of the 3'MVIP is the starting monomer in solid-phase synthesis. When the carrier structure 5'MVIP is coupled to the 5' end of the sense or antisense strand of the RNA inhibitor of the present application, the 5'MVIP phosphoramidite monomer is the last monomer in solid-phase synthesis.

[0263] The general formula of the solid support of 3'MVIP is as follows: When JPEG2025535491000173.jpg33114m is 1-4, the joint B portion in the general formula branches 1 to 4 times, respectively, to obtain the corresponding 3'MVIP solid support.

[0264] The general formula for a 5'MVIP phosphoramidite monomer is: When JPEG2025535491000174.jpg48170n is 1-4, the joint B moiety in the general formula branches one to four times, respectively, to give the corresponding 5'MVIP phosphoramidite monomer.

[0265] The following is an exemplary list of chemical synthesis processes for some 3'MVIP solid supports and 5'MVIP phosphoramidite monomers. By referring to the methods described in the Examples, those skilled in the art can easily synthesize the remaining 3'MVIP solid supports and 5'MVIP phosphoramidite monomers involved in the present invention. The synthesis process is described as follows: 3.1 Synthesis of 3'MVIP solid support 3.1.1 Synthesis of 3'MVIP09 Solid Support JPEG2025535491000175.jpg461443'MVIP09 Solid Support Description of the synthesis process 3.1.1.1 Synthesis of ERC-01-c1 2-Amino-1,3-propanediol (5.0 g, 54.9 mmol) was weighed, 50 mL of DMSO, and 5 mL of sodium hydroxide solution (1 g / mL) were added. The mixture was cooled to 0 °C, and tert-butyl propylene oxide (20 mL, 137.8 mol) was added dropwise. After 2 hours of addition, the mixture was allowed to react at room temperature for 48 hours. Petroleum ester (100 mL) was added, and the mixture was washed twice with saturated brine. The organic layer was dried. A chromatography column (eluent: ethyl acetate: petroleum ester = 25%-75%) was used. 0.05% triethylamine was added to the column, yielding 6.2 g of a colorless oil.

[0266] 3.1.1.2 Synthesis of ERC-01-c2 JPEG2025535491000177.jpg43146ERC-01-c1 (6.2 g, 17.9 mmol) was weighed, 50 mL of dichloromethane and 23 mL of sodium carbonate solution (25%) were added, and benzyl chloroformate (8.2 mL, 57.4 mmol) was added dropwise at room temperature. After the dropwise addition for 2 hours, the mixture was allowed to react at room temperature overnight, washed three times with saturated brine, dried over anhydrous sodium sulfate, and the solvent was evaporated to dryness. The mixture was passed through a chromatography column (ethyl acetate:petroleum ester = 5%-30%) to obtain 4.0 g of an oil.

[0267] 3.1.1.3 Synthesis of ERC-01-c3 JPEG2025535491000178.jpg38156ERC-01-c2 (4.0 g, 8.3 mmol) was taken, and 12 mL of formic acid was added, and the mixture was allowed to react at room temperature overnight. The solvent was evaporated to dryness under reduced pressure to obtain 2.8 g of the product.

[0268] 3.1.1.4 Synthesis of ERCd-01-c1 JPEG2025535491000179.jpg111114 Compound ERC-01-c3 (1.11 g, 3.0 mmol) and dlSANC-c4 (3.6 g, 8.04 mmol) were added to DMF (60 mL), followed by HOBt (2.24 g) and HBTU (3.36 g), followed by slowly adding DIEA (4.16 mL). The reaction mixture was stirred at room temperature for 3 hours. Water was then added, and the aqueous layer was extracted with dichloromethane (2 x 10 mL). The combined organic layers were washed sequentially with saturated sodium bicarbonate (80 mL), water (2 x 60 mL), and saturated brine (60 mL). The mixture was dried over anhydrous sodium sulfate, evaporated to dryness under reduced pressure, and purified by silica gel column chromatography (eluent: 3-15% MeOH in DCM) to give 3.24 g of a pale yellow solid.

[0269] 3.1.1.5 Synthesis of ERCd-01-c2 ERCd-01-c1 (3.24 g, 2.6 mmol) was dissolved in methanol (60 mL), and 10% palladium-carbon (0.3 g) and acetic acid (2.0 mL) were added. The mixture was then hydrogenated under atmospheric pressure and allowed to react overnight. The reaction mixture was filtered through diatomaceous earth, and the filtrate was evaporated to dryness under reduced pressure to obtain 2.9 g of oil, ERCd-01-c2. The high-resolution mass spectrum of the product is shown in Figure 2.

[0270] 3.1.1.6 Synthesis of 3'MVIP09-c1 JPEG2025535491000181.jpg127151 SANCd-01-c0 (0.824 g, 1.5 mmol) and ERCd-01-c2 (1.09 g, 1.0 mmol) were added sequentially to a reaction flask, followed by 10 mL of DCM, which was stirred to dissolve. TBTU (0.963 g) and DIPEA (0.517 g) were added sequentially, and the mixture was allowed to react overnight. Water was then added, and the mixture was extracted with DCM. The organic phase was further washed with saturated brine, dried, filtered, concentrated, and finally purified using a silica gel column to obtain 1.3 g of product.

[0271] JPEG2025535491000182.jpg961473.1.1.7 Synthesis of 3'MVIP09-c2 3'MVIP09-c1 (1.62 g, 1 μmol) and 10 mL of DCM were added to a reaction flask in sequence, and the mixture was stirred at room temperature to dissolve. Then, DMAP (0.366 g) and succinic anhydride (0.2 g, 3 μmol) were added in sequence, and the mixture was stirred at room temperature to react. After TLC analysis, the reaction was passed. The DCM was concentrated, water was added, and the mixture was extracted with DCM. The organic phase was further washed with saturated brine, dried over anhydrous sodium sulfate, filtered, concentrated, and finally purified on a silica gel column to obtain 1.55 g of product.

[0272] 3.1.1.8 Solid Support Synthesis of 3'MVIP09 JPEG2025535491000183.jpg95150 3'MVIP09-c2 (0.86 g, 0.5 μmol) and 10 mL DMF were added sequentially to a reaction flask and dissolved. After dissolving, HBTU (0.19 g), DIPEA (0.194 g), and macroporous aminomethyl resin (2.0 g) were added sequentially. The mixture was shaken for 24 hours, filtered, and the resin was washed with 10% methanol / DCM and capped with 25% acetic acid / pyridyl acetate. The degree of substitution was 150 μmol / g.

[0273] 3.1.2 Synthesis of 3'MVIP17 solid support JPEG2025535491000184.jpg641533'MVIP17 Solid Support

[0274] 3.1.2.1 Synthesis of SANC-01-c1 For the JPEG2025535491000185.jpg60145 synthesis step, refer to 3.1.1.1.ERC-01-c1 Synthesis.

[0275] 3.1.2.2 Synthesis of SANC-01-c2 For the JPEG2025535491000186.jpg55142 synthesis step, refer to 3.1.1.2.ERC-01-c2 Synthesis.

[0276] 3.1.2.3 Synthesis of SANC-01-c3 For the JPEG2025535491000187.jpg50143 synthesis step, refer to 3.1.1.3.ERC-01-c3 Synthesis.

[0277] 3.1.2.4 Synthesis of SANCd-01-c1 JPEG2025535491000188.jpg49163For the synthesis step, refer to 3.1.1.4.ERCd-01-c1 Synthesis.

[0278] 3.1.2.5 Synthesis of SANCd-01-c2 JPEG2025535491000189.jpg60165For the synthesis step, refer to 3.1.1.5.ERCd-01-c2 Synthesis.

[0279] 3.1.2.6 Synthesis of 3'MVIP17-c1 JPEG2025535491000190.jpg162145 For the synthesis steps, see 3.1.1.6.Synthesis of 3'MVIP09-c1, and the high-resolution mass spectrometry diagram of the synthesized 3'MVIP17-c1 is shown in Figure 3.

[0280] 3.1.2.7 Synthesis of 3'MVIP17-c2 JPEG2025535491000191.jpg122141For the synthesis step, refer to 3.1.1.7 Synthesis of 3'MVIP09-c2.

[0281] 3.1.2.8 Solid Support Synthesis of 3'MVIP17 JPEG2025535491000192.jpg129147For the synthesis step, refer to 3.1.1.8 Solid Support Synthesis of 3'MVIP09.

[0282] 3.1.3 Synthesis of 3'MVIP01 Solid Support: JPEG2025535491000193.jpg311543'MVIP01 Solid Support

[0283] About the synthesis process: 3.1.3.1 Synthesis of 3'MVIP01-c1 JPEG2025535491000194.jpg77139For the synthesis step, refer to synthesis in 3.1.1.6.3'MVIP09-c1.

[0284] 3.1.3.2 Synthesis of 3'MVIP01-c2 JPEG2025535491000195.jpg73149For the synthesis step, refer to synthesis in 3.1.1.7.3'MVIP09-c2.

[0285] 3.1.3.3 Solid Support Synthesis of 3'MVIP01 JPEG2025535491000196.jpg76148For the synthesis step, refer to 3.1.1.8.3'MVIP09 Solid Support Synthesis.

[0286] 3.2 Synthesis of 5'MVIP phosphoramidite monomer 3.2.1 Synthesis of 5'MVIP09 phosphoramidite monomer: JPEG2025535491000197.jpg381605'MVIP09 phosphoramidite monomer 3.2.1.1 Synthesis of 5'MVIP09-ERCd-PFP-c1 JPEG2025535491000198.jpg53165ERCd-01-c2 (2.18 g, 2.0 mmol) was weighed and dissolved in DMF (50 mL), glutaric acid monobenzyl ester (0.53 g, 2.4 mmol), DIPEA (0.78 g) and TBTU (0.84 g) were added, stirred at room temperature overnight, quenched by adding water (50 mL), extracted with DCM (30 mL * 3), washed with 10% citric acid (50 mL * 3), saturated sodium bicarbonate (50 mL) and pyridinium chloride (100 mL), dried over anhydrous sodium sulfate, filtered, rotary evaporated and purified by column chromatography to obtain product 5'MVIP09-ERCd-PFP-c1 (2.15 g).

[0287] 3.2.1.2 Synthesis of 5'MVIP09-ERCd-PFP-c2 JPEG2025535491000199.jpg27166 5'MVIP09-ERCd-PFP-c1 (2.15 g, 1.66 mmol) and 10% palladium on carbon (0.21 g) were weighed, methanol (50 mL) was added, and the mixture was stirred at room temperature and hydrogenated overnight. After the reaction was complete, the palladium on carbon was filtered through diatomaceous earth and rotary evaporated to give crude 5'MVIP09-ERCd-PFP-c2 (1.9 g). Its high-resolution mass spectrum is shown in Figure 4.

[0288] 3.2.1.3 Synthesis of 5'MVIP09-ERCd-PFP JPEG2025535491000200.jpg29168 5'MVIP09-ERCd-PFP-c2 The crude product (1.9 g, 1.58 mmol) was weighed and dissolved in DCM (60 mL), DIPEA (1.33 g) was added, cooled, trifluoroacetic acid pentafluorophenol ester (2.21 g, 7.9 mmol) was added, and the mixture was stirred at room temperature for 2 h. The mixture was then rotary evaporated and further dissolved in DCM (60 mL). The mixture was washed with saturated sodium bicarbonate (30 mL), 10% citric acid (30 mL), and saturated brine (50 mL), dried over anhydrous sodium sulfate, filtered, and rotary evaporated to give crude 5'MVIP09-ERCd-PFP (2.35 g). This was used directly in the next reaction without further purification after vacuum drying.

[0289] 3.2.1.4 Synthesis of 5'MVIP09 phosphoramidite monomer-c1 The crude 5'MVIP09-ERCd-PFP product (2.35 g, 1.58 mmol) was dissolved in DCM (60 mL), DIPEA (0.82 g, 6.32 mmol), and 6-amino-1-hexanol (0.37 g, 3.16 mmol) were added, and the mixture was stirred at room temperature overnight. 10% citric acid (30 mL) was added, and the mixture was extracted with DCM (30 mL), washed with saturated brine (50 mL), dried over anhydrous sodium sulfate, filtered, rotary evaporated, and purified by column chromatography to obtain the product 5'MVIP09 monomer-c1 (1.73 g).

[0290] 3.2.1.5 5'MVIP09 phosphoramidite monomer JPEG2025535491000202.jpg96165 5'MVIP09 phosphoramidite monomer-c1 (1.3 g, 1.0 mmol) was weighed and dissolved in acetonitrile (30 mL), diisopropylammonium triazole (0.22 g) was added, and bis-(diisopropylamino)(2-cyanoethoxy)phosphine (0.36 g, 1.2 mmol) was added dropwise in an ice bath, and the reaction was carried out at room temperature for 4 hours. The reaction was controlled by HPLC, and after passing the reaction, it was purified using a concentration column to obtain the product 5'MVIP09 monomer (1.2 g).

[0291] 3.2.2 Synthesis of 5'MVIP01 phosphoramidite monomer: JPEG2025535491000203.jpg251505'MVIP01 phosphoramidite monomer Add the phosphoramidite monomer of 5'MVIP01 to YICd-01-c2 (1.12 g, 2.0 mmol) and follow the remaining procedures in 3.2.1.1 to 3.2.1.5.

[0292] Example 4 Synthesis of Carrier-Coupled RNA Inhibitors For the synthesis of the antisense strand of the coupling support (3'MVIP 09 coupling), the reagent bottle was purged with argon gas for at least 2 min. The phosphoramidite monomer and acetonitrile were added to the reagent bottle in that order, and the bottle was then capped and shaken until the solid was completely dissolved by visual inspection. 3A molecular sieves were then added and the mixture was left to stand for at least 8 h before use. The reagent bottle was purged with argon gas for at least 2 min. Hydrogenated xanthan gum and dried pyridyl were added to the reagent bottle in that order, and the bottle was then capped and shaken until the solid was completely dissolved by visual inspection. The mixture was then temporarily stored for use. The following procedures were performed under ambient conditions at room temperature (20-30°C): the 3'MVIP solid support was weighed and added to the reagent bottle, followed by acetonitrile, which was then shaken to homogenize the mixture and transferred to a synthesis column. The remaining acetonitrile was then eluted and transferred to the synthesis column. After elution was complete, acetonitrile was added to fill the synthesis column, and the amount of acetonitrile used was recorded. The synthesis column was installed and secured according to the instrument operation.

[0293] The monomer solution, CAP A, CAP B, oxidizing agent, thio reagent, activating agent, decapping agent and acetonitrile prepared above were connected to the corresponding lines of the AKTA PILOT100, ensuring that the lines were inserted into the bottom of the reagent bottle.

[0294] After setting up the synthesis method, the instrument operations were prepared and clicked to start the synthesis. The area of ​​each detritylation peak was monitored and recorded online. Additional operations were performed during the synthesis process based on the actual amount of deprotection reagent used.

[0295] After the synthesis was completed, the synthesis column was purged with argon gas for at least 2 hours and then unloaded according to the operating protocol. The solid support in the synthesis column was transferred to a reaction flask, and methylamine aqueous solution and ammonia water were added. The reaction flask was placed on a shaker and reacted at 35°C for 2-3 hours. The solution was filtered into a round-bottom flask, and the remaining solid phase was washed with 50% ethanol aqueous solution. This was then filtered again and combined with the previous filtrate. The round-bottom flask was then connected to a rotary evaporator, set to 50°C, and distilled until no more distillate remained. Ethanol was added to the round-bottom flask, mixed uniformly, and redistilled until no more distillate remained. This procedure was repeated until a white powder appeared at the bottom of the flask. The resulting white powder was prepared into a solution and purified using a reverse chromatography column. Samples were taken to check OD260 and purity. The purified antisense strand solution was dispensed into vials for storage, lyophilized, and the product was sealed and stored in a -20°C refrigerator.

[0296] The synthesis procedure for the sense strand of the coupling support (5'MVIP09 coupling) was the same as for the antisense strand, except that the column solid support was a Universal Support. DIPEA was added to the resulting intermediate to prepare a solution, and 5'MVIP phosphoramidite monomer was added and mixed uniformly. The reaction flask was placed in a shaker and incubated at 35°C for 2-3 hours.

[0297] Description of the synthesis annealing process of RNA inhibitors The resulting sense and antisense strands were mixed in a 1:1 equimolar ratio in a reaction flask and placed in a water bath at 95°C for 5 minutes. The water bath was then turned off and the mixture was allowed to cool to below 40°C. 3M sodium acetate solution was added to the double-stranded solution and mixed thoroughly. An appropriate volume of absolute ethanol was added and mixed thoroughly. The reaction mixture was then placed in a -20°C refrigerator for 45 minutes. A refrigerated high-speed centrifuge was pre-cooled to 4°C. After the temperature reached the desired temperature, the double-stranded solution was added and the centrifuge was started. After centrifugation, the double-stranded solution was removed, the supernatant was discarded, and ultrapure water was added to completely dissolve the solid. Samples were then taken to determine OD260 and purity. The RNA inhibitors listed in Table 14 were obtained. The purified finished product was dispensed into vials and lyophilized for use. The product was then sealed and stored in a -20°C refrigerator.

[0298] The above only exemplifies the synthesis of RNA inhibitors with 5'MVIP09 / 3'MVIP09 coupling. However, this rule also applies to all RNA inhibitors described in the present invention but not listed here. That is, when the carrier structure 3'MVIP is coupled to the 3' end of the sense or antisense strand of the RNA inhibitor, the solid support of the 3'MVIP is the starting monomer in solid-phase synthesis. When the carrier structure 5'MVIP is coupled to the 5' end of the sense or antisense strand of the RNA inhibitor, the 5'MVIP phosphoramidite monomer is the final monomer in solid-phase synthesis. By referring to the methods described in this example, those skilled in the art can easily synthesize the remaining RNA inhibitors of the present invention.

[0299] Example 5 In vitro inhibition test 2 of LPA gene expression by RNA inhibitors The RNA inhibitors of this example are selected from Table 4 and have a methoxy group or fluorine modification at the glycosyl 2'-position of different nucleotides in the sense and antisense strands.

[0300] RNA inhibitors were prepared using the method described in Example 4. The inhibitory effect of RNA inhibitors on LPA mRNA in Huh7 cells at concentrations of 5 nM and 0.5 nM was examined using the test method described in Example 2. The test results are shown in Table 21 and Figure 5.

[0301] [Table 21] The test results show that the RNA inhibitor Kylo-11-DS53, at different concentrations, has a significant inhibitory effect on LPA mRNA levels in Huh7 cells. Its characteristics are that the 2'-positions of glycosyl nucleotides at positions 5, 7, 8, and 9, starting from the 5'-end of the sense strand, are all fluorine, the remaining are methoxy groups, and the phosphate ester bonds between the three consecutive nucleotides at the 5'- and 3'-ends are thio groups; and the 2'-positions of glycosyl nucleotides at positions 2, 4, 8, 14, and 16, starting from the 5'-end of the antisense strand, are all fluorine, the remaining are methoxy groups, and the phosphate ester bonds between the three consecutive nucleotides at the 5'- and 3'-ends are thio groups.

[0302] Example 6 In vitro inhibition test 3 of LPA gene expression by RNA inhibitors The RNA inhibitors of this example are selected from Table 5 and have a methoxy group or fluorine modification at the glycosyl 2'-position of different nucleotides in the sense and antisense strands.

[0303] RNA inhibitors were prepared using the method described in Example 4. The inhibitory effects of the RNA inhibitors on LPA mRNA in Huh7 cells at concentrations of 5 nM and 0.5 nM were examined using the test method described in Example 2. The test results are shown in Table 22 and Figure 6.

[0304] [Table 22] The test results showed that the RNA inhibitors Kylo-11-DS65, Kylo-11-DS71, Kylo-11-DS72, and Kylo-11-DS74 significantly inhibited LPA mRNA levels in Huh7 cells at different concentrations. Kylo-11-DS65 is characterized by the following: the 2'-positions of the glycosyl nucleotides at positions 5, 7, 8, and 9 on the sense strand are all fluorine, the remaining methoxy groups are present, and the phosphate linkages between the three consecutive nucleotides at the 5' and 3' ends are thio groups; the 2'-positions of the glycosyl nucleotides at positions 2, 4, 8, 14, and 16 on the antisense strand are all fluorine, the remaining methoxy groups are present, and the phosphate linkages between the three consecutive nucleotides at the 5' and 3' ends are thio groups.

[0305] Kylo-11-DS71 and Kylo-11-DS72 are characterized in that the 2'-positions of glycosyl nucleotides at positions 3, 5, 7, 8, 9, 10, 11, 13, and 15, starting from the 5'-end of the sense strand, are all fluorine, the remaining are methoxy groups, and there is a thio group in the phosphate ester bond between three consecutive nucleotides at the 5'- and 3'-ends; and the 2'-positions of glycosyl nucleotides at positions 2, 4, 6, 8, 14, and 16, starting from the 5'-end of the antisense strand, are all fluorine, the remaining are methoxy groups, and there is a thio group in the phosphate ester bond between three consecutive nucleotides at the 5'- and 3'-ends. Kylo-11-DS74 is characterized by the following: the 2'-positions of glycosyl nucleotides at positions 9, 10, and 11, starting from the 5'-end of the sense strand, are all fluorine; the remaining 2'-positions are methoxy groups; and there is a thio group in the phosphate ester bond between three consecutive nucleotides at the 5'- and 3'-ends; and the 2'-positions of glycosyl nucleotides at positions 2, 4, 6, 8, 14, 16, 18, and 20, starting from the 5'-end of the antisense strand, are all fluorine; the remaining 2'-positions are methoxy groups; and there is a thio group in the phosphate ester bond between three consecutive nucleotides at the 5'- and 3'-ends.

[0306] Example 7 In vitro inhibition test 4 of LPA gene expression by RNA inhibitors The RNA inhibitors of this example are selected from the RNA inhibitors in Table 6. The sense and antisense strands of candidate RNA inhibitors Kylo-11-DS81 to Kylo-11-DS105 have different nucleotide glycosyl 2'-positions modified with a methoxy group or fluorine.

[0307] RNA inhibitors were prepared using the method described in Example 4. The inhibitory effects of the RNA inhibitors on LPA mRNA in Huh7 cells at concentrations of 5 nM and 0.5 nM were examined using the test method described in Example 2. The test results are shown in Table 23 and Figure 7.

[0308] [Table 23] The test results show that the RNA inhibitors Kylo-11-DS87, Kylo-11-DS88, Kylo-11-DS91, Kylo-11-DS92, Kylo-11-DS97, Kylo-11-DS98, Kylo-11-DS101, Kylo-11-DS102 and Kylo-11-DS104 have significant inhibitory effects on LPA mRNA levels in Huh7 cells at different concentrations. Kylo-11-DS87 is characterized by the fact that the 2'-positions of glycosyl nucleotides at positions 7, 8, 9, and 10, starting from the 5'-end of the sense strand, are all fluorine, while the 2'-positions of glycosyl nucleotides at positions 2, 4, 6, 8, and 14, starting from the 5'-end of the antisense strand, are all fluorine. Kylo-11-DS88 is characterized by the fact that the 2'-positions of glycosyl nucleotides at positions 5, 8, 9, and 10, starting from the 5'-end of the sense strand, are all fluorine, while the 2'-positions of glycosyl nucleotides at positions 1, 2, 3, 4, 5, 6, 8, and 14, starting from the 5'-end of the antisense strand, are all fluorine. The 2'-positions of glycosyl nucleotides at positions 2, 15, and 17 are all fluorine; Kylo-11-DS91 is characterized by the 2'-positions of glycosyl nucleotides at positions 8, 9, and 10, starting from the 5'-end of the sense strand, all being fluorine; and the 2'-positions of glycosyl nucleotides at positions 2, 4, 12, and 14, starting from the 5'-end of the antisense strand, all being fluorine; and Kylo-11-DS92 is characterized by the 2'-positions of glycosyl nucleotides at positions 7, 8, 9, and 10, starting from the 5'-end of the sense strand, all being fluorine. Kylo-11-DS97 is characterized by the fact that the 2'-positions of glycosyl nucleotides at positions 5, 7, 8, and 9 starting from the 5'-end of the sense strand are all fluorine, and the 2'-positions of glycosyl nucleotides at positions 7, 12, and 14 starting from the 5'-end of the antisense strand are all fluorine. Kylo-11-DS98 is characterized by the fact that the 2'-positions of glycosyl nucleotides at positions 7, 9, 10, and 11 starting from the 5'-end of the sense strand are all fluorine, and the 2'-positions of glycosyl nucleotides at positions 2 and 14 starting from the 5'-end of the antisense strand are all fluorine. Kylo-11-DS101 is characterized by the fact that the 2'-positions of glycosyl nucleotides at positions 7, 9, 10, and 11 starting from the 5'-end of the sense strand are all fluorine, and the 2'-positions of glycosyl nucleotides at positions 2 and 14 starting from the 5'-end of the antisense strand are all fluorine.Kylo-11-DS102 is characterized by fluorine at the 2'-positions of glycosyl nucleotides at positions 5, 7, 8, and 9 starting from the 5' end of the sense strand, and fluorine at the 2'-positions of glycosyl nucleotides at positions 2, 6, 8, 10, 14, and 16 starting from the 5' end of the antisense strand. Kylo-11-DS104 is characterized by fluorine at the 2'-positions of glycosyl nucleotides at positions 9, 10, and 11 starting from the 5' end of the sense strand, and fluorine at the 2'-positions of glycosyl nucleotides at positions 14 and 16 starting from the 5' end of the antisense strand. These RNA inhibitors share the common features of fluorine at the 2'-positions of glycosyl nucleotides at the above positions, methoxy groups at the remaining 2'-positions, and thio groups in the phosphate ester bonds between the three consecutive nucleotides at the 5' and 3' ends. Here, the inhibitory effect of Kylo-11-DS102 on LPA mRNA levels in Huh7 cells was optimal, reaching 72.99% inhibition at a concentration of 0.5 nM.

[0309] Example 8 In vitro inhibition test 5 of LPA gene expression by RNA inhibitors The RNA inhibitors of this example are selected from Table 7 and have a methoxy group or fluorine modification at the glycosyl 2'-position of different nucleotides in the sense and antisense strands.

[0310] RNA inhibitors were prepared using the method described in Example 4. The inhibitory effect of the RNA inhibitors on LPA mRNA in Huh7 cells at concentrations of 5 nM and 0.5 nM was examined using the test method described in Example 2. The test results are shown in Table 24 and Figure 8.

[0311] [Table 24] The test results showed that the RNA inhibitors Kylo-11-DS106 to Kylo-11-DS110, Kylo-11-DS112 to Kylo-11-DS117 and Kylo-11-DS119 had significant inhibitory effects on LPA mRNA in Huh7 cells at different concentrations. wherein Kylo-11-DS106 to Kylo-11-DS110, Kylo-11-DS112 to Kylo-11-DS114, and Kylo-11-DS116 have at least 15 consecutive nucleotides that are identical to each other, and the 2'-positions of glycosyl nucleotides at positions 3, 5, 7, 8, 9, 10, 11, 13, and 15 starting from the 5'-end of the sense strand are all fluorine, the remaining 2'-positions are methoxy groups, and the phosphate ester bonds between three consecutive nucleotides at the 5'- and 3'-ends are thio groups; and the 2'-positions of glycosyl nucleotides at positions 2, 4, 6, 8, 14, and 16 starting from the 5'-end of the antisense strand are All of them are fluorine, the remainder are methoxy groups, and there is a thio group in the phosphate ester bond between the three consecutive nucleotides at the 5' and 3' ends. Both the sense and antisense strands contain 21 nucleotides (except Kylo-11-DS109), and the 3' ends of the sense and antisense strands each have a two-nucleotide overhang. Kylo-11-DS106 and Kylo-11-DS115 differ by only one nucleotide; the 6th nucleotide starting from the 5' end of the antisense strand is fU in the former and dT in the latter. The activities of both are similar, and both have relatively high inhibitory activity. The unmodified sequences of the sense and antisense strands of Kylo-11-DS116 and Kylo-11-DS117 are the same, i.e., SEQ ID NO: 8 and SEQ ID NO: 21, respectively. However, the modification characteristics of the two strands are different: the 2'-position glycosyl groups of the nucleotides at positions 5, 7, 8, and 9 starting from the 5'-end of the sense strand of the latter are all fluorine, and the 2'-position glycosyl groups of the nucleotides at positions 2, 6, 8, 10, 14, and 16 starting from the 5'-end of the antisense strand are all fluorine.The unmodified sequences of the sense and antisense strands of the RNA inhibitor Kylo-11-DS119 are SEQ ID NO: 11 and SEQ ID NO: 25, respectively. The modification features are that the 2'-position glycosyl of the nucleotides at positions 9, 10, and 11 starting from the 5'-end of the sense strand is all fluorine, and the 2'-position glycosyl of the nucleotides at positions 2, 4, 6, 12, 14, 16, 18, and 20 starting from the 5'-end of the antisense strand is all fluorine, and both the sense and antisense strands contain 21 nucleotides, with both ends flat.

[0312] Example 9 In vitro inhibition test 6 of LPA gene expression by RNA inhibitors The RNA inhibitors in this example were selected from Table 8 and had methoxy or fluorine modifications at the 2' position of the glycosyl nucleotides in the sense and antisense strands, respectively. The RNA inhibitors were prepared using the method described in Example 4. The inhibitory effect of the RNA inhibitors on LPA mRNA in Huh7 cells was examined at concentrations of 5 nM and 0.5 nM using the test method described in Example 2. The test results are shown in Table 25 and Figure 9.

[0313] [Table 25] The test results showed that the RNA inhibitors Kylo-11-DS-124, Kylo-11-DS-126, Kylo-11-DS-130, and Kylo-11-DS-131 had significant inhibitory effects on LPA mRNA in Huh7 cells at different concentrations. These RNA inhibitors share a common feature: the 2'-position glycosyl groups at positions 9, 10, and 11 of the sense strand, starting from the 5' end, are all fluorine; the remaining 2'-positions are methoxy groups; and the phosphate ester bonds between the three consecutive nucleotides at the 5' and 3' ends are thio groups. The 2'-position glycosyl groups at positions 2, 4, 6, 12, 14, 16, 18, and 20 of the antisense strand, starting from the 5' end, are all fluorine. The sense and antisense strands of Kylo-11-DS-126 and Kylo-11-DS-131 each contain 21 nucleotides and have a two-nucleotide overhang at the 3' end, except that the nucleotide at position 6 of the 5' end of the antisense strand of the former is fA, while the same position of the latter is dT, resulting in similar activity. The sense and antisense strands of Kylo-11-DS-124 and Kylo-11-DS-130 contain 19 nucleotides and 21 nucleotides, respectively, with a two-nucleotide overhang at the 3' end of the antisense strand and flat ends at the 3' and 5' ends of the sense and antisense strands, resulting in similar activity.

[0314] Example 10: Evaluating the in vivo activity of RNA inhibitors using cynomolgus monkeys Experiments were conducted in age-appropriate cynomolgus monkeys to evaluate the RNA inhibitors Kylo-11-DS148, Kylo-11-DS146, and Kylo-11-DS163. Each was administered by subcutaneous injection at 6 mg / kg on Day 0. After administration, blood samples were taken weekly to measure LDL-c and Lp(a) levels. The LDL-c and Lp(a) level results after RNA inhibitor administration are shown in Tables 26-27 and Figures 10-11.

[0315] [Table 26] [Table 27] The test results showed that the RNA inhibitors Kylo-11-DS146, Kylo-11-DS 148, and Kylo-11-DS163 could reduce LDL-c levels in cynomolgus monkey plasma and significantly and sustainably reduce Lp(a) levels in plasma. After Kylo-11-DS 146 was administered, the plasma Lp(a) levels of individuals were reduced by up to 95.25% by day 77 compared to before administration, with an average reduction rate of 89.98% maintained.

[0316] Example 11 Comparison of the in vitro inhibitory effects of different double-stranded forms CN202210241706.1 (hereinafter referred to as D1) is a Chinese invention patent application filed by the applicant "Xiamen Ganbaoli Biopharmaceutical Co., Ltd." on March 11, 2022, with the invention title LPA inhibitors and their uses and publication number CN114703184A. The applicant has conducted the following test procedures for different double-stranded bodies: TIFF2025535491000211.tif67163 Huh7 cells were first washed with PBS, then digested with 0.05% trypsin. The cells were gently sprayed into single cells in DMEM containing 10% FBS and then counted. Plasmid DNA was transferred into Huh7 cells using Fugene HD. Transfected cells were seeded into 96-well plates at a density of 10,000 cells per well, with 100 μL of culture medium per well. The cells were cultured overnight in a 5% CO2, 37°C incubator.

[0317] RNAiMAX transfection reagent was prepared and placed in a 15mL centrifuge tube at a ratio of 1.5:48.5 RNAiMAX:Opti-MEM as needed. The appropriate volume was then vortexed for 15 seconds, mixed evenly, and incubated at room temperature for 15 minutes. 60μL of RNAiMAX / Opti-MEM was added to each well in the corresponding position, and 60μL of diluted compound at the corresponding concentration was added to the well, mixed evenly, and incubated for 15 minutes. After aspirating and removing the medium from each well, fresh medium containing the compound was added. Each well now contained 120μL of medium, and the wells were then placed in a 5% CO2, 37°C incubator. The final compound concentrations were measured at 5nM, 0.5nM, and 0.05nM.

[0318] The experimental procedure, briefly described in the DUAL-GLO® Dual Luciferase Detection System instruction manual, was as follows: cells were removed from the incubator, the supernatant was aspirated and discarded, and 75 μL of fresh medium and 75 μL of detection reagent were added. After 10 minutes of shaking and avoiding light, the cells were fully lysed. 100 μL of the sample was transferred to a light-impermeable whiteboard for detection of firefly luminescence signals. 50 μL of Dual-Glo® Stop & Glo® Detection Reagent was added to each well. After 10 minutes of shaking and avoiding light, the Renilla luminescence signals were detected. The ratio of the main reporter gene signal to the internal reference reporter gene signal for each well was calculated, and this ratio was used to calculate the % inhibition rate.

[0319] The test results are as follows: TIFF2025535491000212.tif76160 As shown in the above test results, the region of LPA mRNA NM_005577.4 (sequence number 1) contained in the target sequence that acts on the two pairs of original sequences protected by the present application is different from D1, and is expanded two positions before or one position after the region in D1, and Kylo-11-DS13 and Kylo-11-DS11 in the present application have higher inhibition rates at concentrations of 5 nM, 0.5 nM and 0.05 nM than Kylo-11-DS12 and Kylo-11-DS08 in D1, respectively.

Claims

1. An RNA inhibitor that inhibits the expression of the LPA gene or a pharmaceutically acceptable salt thereof, The RNA inhibitor is formed by base pairing between a sense strand and an antisense strand having a strand length of 15-30, and the strand length is preferably 19-23, and at least 85% of the bases are complementary between the sense strand and the antisense strand; -OH at the 2'-position of glycosyl in some or all of the nucleotides in the sense strand and / or the antisense strand may be substituted, wherein the substituent is a fluorine or a methoxy group; and wherein the phosphate bonds between three adjacent nucleotides at at least one of the ends of the sense strand and / or the antisense strand may be thiolated, or an RNA inhibitor or a pharmaceutically acceptable salt thereof.

2. 2. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 1, wherein the antisense strand forms a region complementary to a target sequence, the target sequence being a plurality of regions at different positions in LPA mRNA, the plurality of regions having at least 15 consecutive nucleotides that are the same, and the target sequence being selected from any one of nucleotide regions 312-332, 654-674, 996-1016, 1338-1358, 1680-1700, 2022-2042, and 2364-2384 in LPA mRNA (NM_005577.4).

3. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 1, wherein the antisense strand forms a region complementary to a target sequence, the target sequence being a plurality of regions at different positions in LPA mRNA, the plurality of regions having at least 15 consecutive nucleotides that are the same, and the target sequence being selected from any one of nucleotide regions 493-512, 1861-1880, and 2203-2222 in LPA mRNA (NM_005577.4).

4. The antisense strand is 5'ucguauaacaauaaggagcug 3' SEQ ID NO: 25; and 5' auaacucuguccauuaccaug 3' SEQ ID NO: 21; and or a sequence having at least 15 consecutive nucleotides identical to the antisense strand, or a sequence differing from the antisense strand by 1, 2 or 3 nucleotides; 4. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 3, wherein g=guanylic acid, a=adenosinic acid, u=uridine acid, and c=nucleic acid.

5. The sense strand is 5' cagcuccuuauuguuuauacga 3' SEQ ID NO: 11; and 5' ugguaauggacagaguuauca 3' SEQ ID NO: 8; and or a sequence having at least 15 consecutive nucleotides that are the same as the sense strand, or a sequence that differs from the sense strand by 1, 2 or 3 nucleotides; 4. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 3, wherein g=guanylic acid, a=adenosinic acid, u=uridine acid, and c=nucleic acid.

6. the sense strand is SEQ ID NO: 11 or a sequence having at least 15 consecutive nucleotides identical thereto, or a sequence having one, two or three nucleotide differences therefrom, and the antisense strand is SEQ ID NO: 25 or a sequence having at least 15 consecutive nucleotides identical thereto, or a sequence having one, two or three nucleotide differences therefrom; Sense strand: 5'cagcuccuuauuguuuauacga 3' SEQ ID NO: 11 Antisense strand: 5'ucguauaacaauaaggagcug 3' SEQ ID NO: 25; or the sense strand is SEQ ID NO: 8 or a sequence having at least 15 consecutive nucleotides identical thereto, or a sequence having one, two or three nucleotide differences therefrom, and the antisense strand is SEQ ID NO: 21 or a sequence having at least 15 consecutive nucleotides identical thereto, or a sequence having one, two or three nucleotide differences therefrom; Sense strand: 5'ugguaauggacagaguuauca 3' SEQ ID NO: 8 Antisense strand: 5' auaacucuguccauuuaccaug 3' SEQ ID NO: 21, 6. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 5, wherein g=guanylic acid, a=adenosinic acid, u=uridine acid, and c=nucleic acid.

7. the sense strand is SEQ ID NO: 270 or a sequence differing therefrom by 1, 2 or 3 nucleotides, and the antisense strand is SEQ ID NO: 278 or a sequence differing therefrom by 1, 2 or 3 nucleotides; Sense strand: 5'CsAsGCUCCUfUfAfUUGUUAUACsGsA 3' SEQ ID NO: 270 Antisense strand: 5' UsfCsGfUAfUAACAAfUAfAGfGAfGCsfUsG 3' SEQ ID NO: 278, or the sense strand is SEQ ID NO: 239 or a sequence differing therefrom by 1, 2 or 3 nucleotides, and the antisense strand is SEQ ID NO: 344 or a sequence differing therefrom by 1, 2 or 3 nucleotides; Sense strand: 5'UsGsGUfAAfUfGfGACAGAGUUAUsCsA 3' SEQ ID NO: 239 Antisense strand: 5' AsfUsAfACdTCfUGUCCAfUUfACCAsUsG 3' SEQ ID NO: 344, where G = 2'-O-methylguanylic acid, A = 2'-O-methyladenosinic acid, U = 2'-O-methyluridylic acid, C = 2'-O-methylnucleotidic acid, Gs = 2'-O-methyl-3'-thioguanylic acid, As = 2'-O-methyl-3'-thioadenosinic acid, U = 2'-O-methyl-3'-thiouridylic acid, Cs = 2'-O-methyl-3'-thionylic acid, fG = 2'-fluoroguanylic acid, fA = 2'- 7. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 6, wherein fU = 2'-fluoroadenosinic acid, fC = 2'-fluoronucleotide acid, fGs = 2'-fluoro-3'-thioguanylic acid, fAs = 2'-fluoro-3'-thioadenosinic acid, fUs = 2'-fluoro-3'-thiouridic acid, fCs = 2'-fluoro-3'-thionyl acid, and dT = 2'-deoxythymidylic acid.

8. The RNA inhibitor further comprises a carrier structure 5'MVIP and a 3'MVIP, wherein the structure of the RNA inhibitor is shown in Formula Ia, Ib, or Ic: Ia Ib Ic where: The 5'MVIP is a relay point R 1 , a linking chain D, a joint B, a branching chain L and a liver targeting specific ligand X, which is 1 and the structure thereof is shown in general formula I, I The 3'MVIP is a relay point R 2 , a linking chain D, a joint B, a branching chain L and a liver targeting specific ligand X, which is 2 and the structure thereof is shown in general formula II, II where: n and m each independently represent any integer from 0 to 4, preferably an integer from 1 to 3, and n+m=an integer from 2 to 6, preferably n+m=2, 3, or 4, more preferably 4; The relay point R 1 is a heterocyclic or carbocyclic structure containing N, S or O, as shown below: Or, the R 1 is -NH(CH 2 ) x CH 2 O—, where x is any integer from 3 to 12, preferably any integer from 4 to 6; The relay point R 2 is a heterocyclic or carbocyclic structure containing N, S or O as shown below: Or, the relay point R 2 is -NH(CH 2 ) x1 CH(OH)(CH 2 ) x2 CH 2 O-, where x1 is any integer from 1 to 4 and x2 is any integer from 0 to 4; The liver target-specific ligand X is the same or different within each of 5'MVIP and 3'MVIP or between 5'MVIP and 3'MVIP, and is selected from monosaccharides and derivatives thereof, preferably N-acetylgalactiamine and derivatives thereof, and more preferably selected from the following structures: Here, W is -OH, -NHCOOH and -NHCO(CH 2 ) q CH 3 and wherein q is an integer from 0 to 4; The branched chain L is the same or different within each of the 5'MVIP and 3'MVIP or between the 5'MVIP and 3'MVIP, and is selected from one or more of the following structures: where r1 is any integer between 1 and 12, r2 is any integer between 0 and 20, Z is H, an alkyl group or an amide group, and the alkyl group is, for example, C 1 -C 5 is an alkyl group, The joint B is the same or different within each of the 5'MVIP and 3'MVIP or between the 5'MVIP and 3'MVIP, and is selected from the following structures: Here, A 1 and A 2 are each independently C, O, S, —NH—, a carbonyl group, an amide group, a phosphoryl group, or a thiophosphoryl group, and r is an integer of 0 to 4, The linking chain D is the same or different within each of the 5'MVIP and 3'MVIP or between the 5'MVIP and 3'MVIP, and is selected from the following structures: where each p is independently an integer from 1 to 20, s is an integer from 2 to 13, and Z 1 and Z 2 The RNA inhibitor or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 7, wherein are the same or different substituents.

9. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 8, wherein the 5'MVIP is 5'MVIP01 or 5'MVIP09 as shown below, and the 3'MVIP is 3'MVIP01, 3'MVIP09 or 3'MVIP17 as shown below.

10. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 9, wherein the combination of the sense strand 5'MVIP and the antisense strand 3'MVIP is 5'MVIP01 / 3'MVIP01, 5'MVIP01 / 3'MVIP17 or 5'MVIP09 / 3'MVIP09, or the combination of the sense strand 5'MVIP and the sense strand 3'MVIP is 5'MVIP01 / 3'MVIP09 or 5'MVIP09 / 3'MVIP01.

11. 11. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 10, wherein the RNA inhibitor is selected from Kylo-11-DS146, Kylo-11-DS148 and Kylo-11-DS163.

12. 12. Use of the RNA inhibitor or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 11 in the manufacture of a medicament for treating and / or preventing diseases associated with elevated levels of L-Protein (a), said diseases including, but not limited to, inflammatory diseases, cardiovascular diseases, and metabolic diseases, wherein said cardiovascular diseases include hyper-L-Protein (a)emia, hyperlipidemia, stroke, atherosclerosis, thrombosis, coronary heart disease, and aortic valve stenosis.

13. A pharmaceutical composition comprising the RNA inhibitor or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 11 and a pharmaceutically acceptable excipient, the dosage form of which is an oral agent, an intravenous injection, or a subcutaneous or intramuscular injection, preferably a subcutaneous injection.

Images