RNA aptamers that bind to ASP7967 or its analogs
The AC17-4 RNA aptamer, binding to ASP7967 with low nM affinity, addresses the limitations of SELEX-designed aptamers by enabling sensitive riboswitch regulation of gene expression in mammalian cells, particularly for therapeutic uses.
Patent Information
- Application Number
- JP2025518768
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-10-07
- Filing Date
- 2023-10-06
- Publication Date
- 2025-11-05
AI Technical Summary
Existing RNA aptamers designed by SELEX for small molecules do not function effectively within mammalian cells, requiring high concentrations (approximately 100 μM or greater) to achieve gene regulation, limiting the applications of riboswitches.
Development of an RNA aptamer, AC17-4, that binds to ASP7967 or its analog ASP2905 with a dissociation constant (Kd) of approximately 50 nM, coupled with a self-cleaving ribozyme scaffold, forming a riboswitch that activates gene expression in mammalian cells, and is incorporated into an adeno-associated virus vector to regulate protein expression in vivo.
The RNA aptamer exhibits high sensitivity and specificity to ASP7967, enabling precise gene regulation with low concentrations, and is effective in regulating protein expression in mammalian cells, including therapeutic applications.
Smart Images

Figure 2025536208000011 
Figure 2025536208000012 
Figure 2025536208000013
Abstract
Description
[Technical Field]
[0001] The present invention relates to RNA aptamers that bind to ASP7967 or analogs thereof. [Background technology]
[0002] Chemical modulation of gene expression with small molecules allows precise control of the timing and level of gene expression in mammalian cells. 1 Such gene switches are highly useful for basic research and practical applications, such as metabolic engineering and gene / cell therapy. 2 Conventional gene switches based on protein transcription factors, such as the Tet-ON and Tet-OFF systems, exhibit excellent gene regulation. 3、4 However, there are several inherent difficulties for many applications, such as immunogenicity of the exogenous protein components, large gene size, and the need to use modified promoters.
[0003] Instead, riboswitches have emerged as a new class of gene switches that do not depend on exogenous protein factors. 5-7 Such riboswitches typically utilize RNA aptamers that specifically bind small molecules. The conformational changes that often accompany aptamer-ligand binding can be used to regulate gene expression by various mechanisms. 8 . Summary of the Invention [Problem to be solved by the invention]
[0004] RNA aptamers that bind to various small molecules can be selected in vitro from random RNA sequences by the in vitro evolution of RNA (SELEX) method. 9 However, such aptamers do not always function within the cellular environment and as part of a riboswitch. Thus, the small molecules and their cognate aptamers used to design mammalian riboswitches are quite limited. 10Theophylline and tetracycline, and their aptamers, discovered by SELEX, have been used extensively in synthetic mammalian riboswitches. 11-22 Similarly, we used natural aptamers from bacterial guanine-responsive riboswitches to generate mammalian riboswitches. 14、19、20、23~32 More recently, ciprofloxacin, hypoxanthine, (6R,S)-folinic acid, and cyclic di-GMP, as well as their aptamers, have been used to construct mammalian riboswitches. 16,33 It should be noted that most such riboswitches require relatively high concentrations (approximately 100 μM or greater) of small molecules to achieve maximal gene regulation. 16、20、33 .
[0005] Therefore, additional small molecules and aptamers that function in mammalian cells are needed to expand the applications of riboswitches.
[0006] It is therefore an object of the present invention to provide RNA aptamers capable of binding to ASP7967 or analogs thereof. [Means for solving the problem]
[0007] To solve the above problems, we explored a novel aptamer-ligand pair compatible with application in mammalian cells. We used the previously reported small molecule ASP2905. 34-36 and its analog ASP7967 (Fig. 2a) had a dissociation constant (K D We discovered an RNA aptamer, AC17-4, that binds to the ribozyme with approximately 50 nM. This aptamer was then coupled to a recently reported self-cleaving ribozyme scaffold (circularly-permuted pistol, CPP). 27In combination with ASP7967, we generated a riboswitch that activates gene expression in response to small molecules in HEK293 cells. The riboswitch was then incorporated into an adeno-associated virus serotype 8 (AAV8) vector expressing human erythropoietin (hEPO), which was used to regulate hEPO expression in vivo using oral administration of ASP7967.
[0008] The present invention therefore relates to the following:
[0009] (1) An RNA aptamer that binds to ASP7967 or an analog thereof, having the sequence: -X1-L1-X2-L2-X3- (In the formula, X1 has the sequence Y1GY2GY3Y4Y5, L1 is a first stem-loop nucleotide sequence comprising a first stem region, a first loop region, and a second stem region, wherein the first stem region and the second stem region are at least two base pairs in length and are substantially complementary to each other; X2 is A, G, C or U; L2 is a second stem-loop nucleotide sequence comprising a third stem region, a second loop region, and a fourth stem region, wherein the third stem region and the fourth stem region are at least two base pairs in length and are substantially complementary to each other, the first base in the third stem region is G, and the last base in the fourth stem region is C; X3 has the sequence UY6, Y1, Y2, Y3, Y4, Y5, and Y6 are each independently A, G, C, or U. contains, or array: -S1-X2-L2-X3-L3-X1-S2- (In the formula, S1 and S2 are each independently A, G, C, or U, and S1 and S2 can form a base pair or a wobble base pair with each other; L3 is a third stem-loop nucleotide sequence comprising a fifth stem region, a third loop region, and a sixth stem region, wherein the fifth stem region and the sixth stem region are at least one base pair in length and are substantially complementary to each other; X1, X2, X3, and L2 are as defined above. contains, or array: -S3-X3-L3-X1-L1-X2-S4- (In the formula, S3 is C and S4 is G, X1, X2, X3, L1, and L3 are as defined above. and an RNA aptamer. (2) Y2 is selected from A or U; Y3 is selected from A or U, and / or The RNA aptamer according to (1) above, wherein Y4 is selected from G or C. (3) Y2 is A, Y3 is A, and / or The RNA aptamer described in (2) above, wherein Y4 is G. (4) The RNA aptamer described in (1) above, wherein Y1 and Y6 are capable of forming a base pair or a wobble base pair with each other. (5) Y1 is G and Y6 is U, or The RNA aptamer described in (1) above, wherein Y1 is U and Y6 is G. (6) The RNA aptamer according to (1) above, wherein the first stem region and the second stem region are 3 to 7 base pairs in length and are substantially complementary to each other. (7) The RNA aptamer described in (1) above, wherein the first stem region and the second stem region are 5 base pairs in length and are substantially complementary to each other. (8) The RNA aptamer described in (1) above, wherein the first stem region has the sequence GACGG and the second stem region has the sequence CCGUC. (9) The RNA aptamer according to (1) above, wherein the first loop region has 3 to 7 bases. (10) The RNA aptamer according to (1) above, wherein the first loop region has the sequence AUU or UUCG. (11) The RNA aptamer according to (1) above, wherein the third stem region and the fourth stem region have 1 to 5 base pairs and are substantially complementary to each other. (12) The RNA aptamer described in (1) above, wherein the third stem region and the fourth stem region have 3 or 4 base pairs and are substantially complementary to each other. (13) the third stem region has the sequence GCG and the fourth stem region has the sequence CGC; or The RNA aptamer described in (1) above, wherein the third stem region has the sequence GCGU and the fourth stem region has the sequence ACGC. (14) The RNA aptamer according to (1) above, wherein the second loop region has 3 to 7 bases. (15) The RNA aptamer according to (1) above, wherein the second loop region has the sequence AAUUCA or UUCG. (16) The RNA aptamer according to (1) above, comprising the sequence: -X1-L1-X2-L2-X3-, and further comprising a fifth stem region adjacent to the 5' end of X1 and a sixth stem region adjacent to the 3' end of X3, wherein the fifth stem region and the sixth stem region have 1 to 15 base pairs and are substantially complementary to each other, and the fifth stem region and the sixth stem region form a double-stranded stem. (17) The RNA aptamer according to (1) above, wherein the fifth stem region and the sixth stem region are 3 to 7 base pairs in length and are substantially complementary to each other. (18) The RNA aptamer described in (1) above, wherein the fifth stem region and the sixth stem region are 4 base pairs in length and are substantially complementary to each other. (19) The RNA aptamer described in (1) above, wherein the fifth stem region has the sequence CUUG and the sixth stem region has the sequence CAAG. (20) The RNA aptamer according to (1) above, wherein the third loop region has 3 to 7 bases. (21) The RNA aptamer described in (1) above, wherein the third loop region has the sequence UUCG. (22) S1 is C and S2 is G, or The RNA aptamer described in (1) above, wherein S1 is G and S2 is C. (23) The RNA aptamer according to (1) above, comprising the sequence: -S1-X2-L2-X3-L3-X1-S2-, and further comprising a seventh stem region adjacent to the 5' end of S1 and an eighth stem region adjacent to the 3' end of S2, wherein the seventh stem region and the eighth stem region have 1 to 15 base pairs and are substantially complementary to each other, and the seventh stem region and the eighth stem region form a double-stranded stem. (24) The RNA aptamer according to (1) above, comprising the sequence: -S3-X3-L3-X1-L1-X2-S4-, and further comprising a ninth stem region adjacent to the 5' end of S3 and a tenth stem region adjacent to the 3' end of S4, wherein the ninth stem region and the tenth stem region have 1 to 15 base pairs and are substantially complementary to each other, and the ninth stem region and the tenth stem region form a double-stranded stem. (25) The RNA aptamer according to (1) above, which is a circularly permuted type. (26) The RNA aptamer described in (1) above, wherein the analog of ASP7967 is ASP2905. (27) An RNA or DNA vector comprising the RNA aptamer described in (1) above or a DNA sequence that can be transcribed into the RNA aptamer described in (1) above. (28) A riboswitch comprising the RNA aptamer described in (1) above. (29) An RNA or DNA vector comprising the riboswitch described in (28) above or a DNA sequence that can be transcribed into the riboswitch described in (28) above. (30) The RNA or DNA vector according to (29), further comprising a target sequence operably linked to the riboswitch or DNA sequence, wherein the target sequence encodes a protein, or the target sequence is either an siRNA, a miRNA precursor, a primary miRNA, an sgRNA, an lncRNA, an RNA aptamer, a ribozyme, a tRNA, or an rRNA, or a DNA sequence transcribable into an siRNA, a miRNA precursor, a primary miRNA, an sgRNA, an lncRNA, an RNA aptamer, a ribozyme, a tRNA, or an rRNA. (31) A riboswitch comprising an RNA aptamer capable of binding to ASP7967 or an analog thereof, or a DNA sequence transcribable into a riboswitch; a target sequence encoding a protein; 1. An isolated polynucleotide comprising: An isolated polynucleotide in which a riboswitch is operably linked to a target sequence such that expression of a protein is upregulated or downregulated in response to ASP7967 or an analog thereof. (32) The polynucleotide according to (31) above, wherein the target sequence comprises multiple exons. (33) The polynucleotide according to (32), wherein the target sequence comprises an alternatively spliced exon sandwiched between a 5' intron and a 3' intron, and the alternatively spliced exon comprises a stop codon that is in-frame with the protein when the alternatively spliced exon is spliced into the mRNA of the protein. (34) The polynucleotide according to (31), further comprising a 3'UTR containing a polyadenylation signal sequence, wherein a riboswitch is inserted within the 3'UTR on the 5' side of the polyadenylation signal sequence, and the function of the polyadenylation signal sequence is regulated by the riboswitch. (35) The polynucleotide according to (34), wherein the riboswitch further comprises a self-cleaving ribozyme. (36) The polynucleotide according to (35), wherein the self-cleaving ribozyme is activated when the aptamer binds to ASP7967 or an analog thereof, or the self-cleaving ribozyme is inactivated when the aptamer binds to ASP7967 or an analog thereof. (37) A kit for regulating protein expression, comprising: ASP7967 or an analog thereof, The polynucleotide according to (31) above or a vector comprising the polynucleotide according to (31) above. Includes a kit. (38) The kit according to (37) above for treating a disease. (39) The kit according to (38) above, wherein the disease is a central nervous system disease, cognitive impairment, or KCNH3-related disease. (40) The kit according to (39) above, wherein the disease is ADHD, Parkinson's disease, Alzheimer's disease, or schizophrenia. (41) A method for regulating protein expression in vivo, comprising introducing into a cell the polynucleotide according to (31) above or a vector comprising the polynucleotide according to (31) above; contacting ASP7967 or an analog thereof with said polynucleotide or said vector; A method comprising: (42) A method for treating or preventing a disease, comprising: Introducing the polynucleotide according to (31) or a vector comprising the polynucleotide according to (31) into a subject; administering ASP7967 or an analog thereof to a subject; A method comprising: (43) The method according to (42) above, wherein the disease is a central nervous system disease, cognitive impairment, or KCNH3-related disease. (44) The method according to (43) above, wherein the disease is ADHD, Parkinson's disease, Alzheimer's disease, or schizophrenia. (45) A method for treating a disease, comprising: Administering ASP7967 or an analog thereof to a subject who has undergone gene therapy using a vector containing the polynucleotide described in (31) above. A method comprising: (46) The target sequence is 4-1BB ligand, 5-helix, human CC chemokine, human L105 chemokine, human L105 chemokine named huL105_3., gamma interferon-induced monokine (MIG), CXCR4B partial protein, platelet basic protein (PBP), α1-antitrypsin, ACRP-30 homolog; complement component C1q C, adenoid-expressed chemokine (ADEC), aFGF; FGF-1, AGF, AGF protein, albumin, etoposide, angiostatin, anthrax vaccine, antibody specific for collapsin, antistasin, anti-TGF beta family antibody, antithrombin III, APM-1; ACRP-30; famoxin, apolipoprotein species, arylsulfatase B, b57 protein, BCMA, beta-thromboglobulin Protein (beta-TG), bFGF; FGF2, blood coagulation factors, BMP processing enzyme furin, BMP-10, BMP-12, BMP-15, BMP-17, BMP-18, BMP-2B, BMP-4, BMP-5, BMP-6, BMP-9, bone morphogenetic protein-2, calcitonin, calpain-10a, calpain-10b, calpain-10c, cancer vaccines, carboxypeptidases, CC chemokines, MCP2, CCR5 variants, CCR7, CCR7, CD11a mAb, CD137; 4-1BB receptor protein, CD20 mAb, CD27, CD27L, CD30, CD30 ligand, CD33 immunotoxin, CD40, CD40L, CD52Mab, Cerebus protein, chemokine eotaxin, chemokine hIL-8, chemokine hMCP1, chemokine hMCP1a, chemokine hMCP1b, chemokine hMCP2, chemokine hMCP3, chemokine hSDF1b, chemokine MCP-4, chemokine TECK and TECK variants, full-length and mature chemokine-like protein IL-8M1, full-length and mature chemokine-like protein IL-8M10, chemokine-like protein IL-8M3, full-length and mature Chemokine-like protein IL-8M8, full-length and mature chemokine-like protein IL-8M9, full-length and mature chemokine-like protein PF4-414, full-length and mature chemokine-like protein PF4-426, full-length and mature chemokine-like protein PF4-M2, cholera vaccine, chondromodulin-like proteins, c-kit ligand; SCF; mast cell growth factor; MGF; fibrosarcoma-derived stem cell factor, CNTF and its fragments, both precursor and activated forms of coagulation factors, collagen, complement C5 Mab, connective tissue activation protein III, CTAA16.88Mab, CTAP-III, CTLA4-Ig, CTLA-8, CXC3, CXC3, CXCR3; CXC chemokine receptor 3, cyanovirin N, darbepoetin, name exodus, name huL105_7, DIL-40, DNase, EDAR, EGF receptor Mab, ENA-78, endostatin, eotaxin, epithelial neutrophil-activating protein-78, EPO receptor; EPOR, erythropoietin (EPO) and EPO mimetic Mimetics, Eutropin, Exodus protein, Factor IX, Factor VII, Factor VIII, Factor X, and Factor XIII, Fas ligand inhibitor protein (DcR3), FasL, FasL, FasL, FGF, FGF-12; fibroblast growth factor homologous factor-1, FGF-15, FGF-16, FGF-18, FGF-3; INT-2, FGF-4; Gelonin, HST-1; HBGF-4, FGF-5, FGF-6; heparin-binding secreted transforming factor -2, FGF-8, FGF-9; glial activating factor, fibrinogen, flt-1, flt-3 ligand, follicle-stimulating hormone alpha subunit, follicle-stimulating hormone beta subunit, follitropin, fractalkine, fragmented myofibrillar protein troponin I, FSH, galactosidase, galectin-4, G-CSF, GDF-1, gene therapy agents, glioma-derived growth factor, glucagon, glucagon-like peptide, glucocerebrosidase, glucose oxidase , glucosidase, glycodelin-A; progesterone-related endometrial protein, GM-CSF, gonadotropin, granulocyte chemotactic protein 2 (GCP-2), granulocyte-macrophage colony-stimulating factor, growth hormone, growth-related oncogene alpha (GRO alpha), growth-related oncogene beta (GRO beta), growth-related oncogene gamma (GRO gamma), hAPO-4; TROY, hCG, hepatitis B surface antigen, hepatitis B vaccine, HER2 receptor Mab, hirudin, HIV gp120, HIVgp41, HIV inhibitory peptide, HIV inhibitory peptide, HIV inhibitory peptide, HIV protease inhibitor peptide, HIV-1 protease inhibitor, HPV vaccine, human 6CKine protein, human Act-2 protein, human adipogenesis inhibitory factor, human B-cell stimulatory factor 2 receptor, human beta-chemokine H1305 (MCP-2), human CC chemokine DGWCC, human CC chemokine ELC protein, human CC-type chemokine interleukin C, human CCC3 protein, human CCF18 chemokine, human CC-type chemokine protein name SLC (secondary lymphoid chemokine), short chain form of human chemokine beta-8, human chemokine C10, human chemokine CC-2, human chemokine CC-3, human chemokine CCR-2, human chemokine Ck beta-7, human chemokine ENA-78, human chemokine eotaxin, human Human chemokine GRO alpha, human chemokine GRO alpha, human chemokine GRO beta, human chemokine HCC-1, human chemokine HCC-1, human chemokine 1-309, human chemokine IP-10, human chemokine L105_3, human chemokine L105_7, human chemokine MIG, human chemokine MIG-beta protein, human chemokine MIP-1 alpha, human chemokine MIP1 beta , human chemokine MIP-3 alpha, human chemokine MIP-3 beta, human chemokine PF4, human chemokine protein 331D5, human chemokine protein 61164, human chemokine receptor CXCR3, human chemokine SDF1 alpha, human chemokine SDF1 beta, human chemokine ZSIG-35, human Chr19Kine protein, human CK beta-9, human CK beta-9, human CX3C 111 amino acid chemokine, human DNAX interleukin-40, human DVic-1 CC chemokine, human EDIRF I protein sequence, human EDIRFII protein sequence, human eosinophil CC-type chemokine eotaxin, human eosinophil-expressed chemokine (EEC), human fast-twitch skeletal muscle troponin C, human fast-twitch skeletal muscle troponin I, human fast-twitch skeletal muscle troponin subunit C, human fast-twitch skeletal muscle troponin subunit I protein, human fast-twitch skeletal muscle troponin subunit T, human fast-twitch skeletal muscle troponin T, human fetal spleen-expressed chemokine, FSEC, human GM-CSF receptor, human gro alpha chemokine, human gro beta chemokine, human gro gamma chemokine, human IL-16 protein, human IL-1RD10 protein sequence, human IL-1RD9, human IL-5 receptor alpha chain, human IL-6 receptor Human IL-8 receptor protein hIL8RA, human IL-8 receptor protein hIL8RB, human IL-9 receptor protein, human IL-9 receptor protein variant #3, human IL-9 receptor protein variant fragment, human IL-9 receptor protein variant fragment #3, human interleukin-1 delta, human interleukin-10, human interleukin-10, human interleukin-18, human interleukin-18 derivative, human interleukin-1 beta precursor, human interleukin-1 beta precursor, human interleukin-1 receptor accessory protein, human interleukin-1 receptor antagonist beta, human interleukin-1 type 3 receptor, human interleukin-10 (precursor), human interleukin-10 (precursor), human interleukin-11 receptor, human interleukin-12 40 kD subunit, human interleukin-12 beta-1 receptor, human interleukin-12 beta-2 receptor, human interleukin-12 p35 protein, human interleukin-12p40 protein, human interleukin-12 receptor, human interleukin-13 alpha receptor, human interleukin-13 beta receptor, human interleukin-15, human interleukin-15 receptor derived from P1 clone, human interleukin-17 receptor, human interleukin-18 protein (IL-18), human interleukin-3, human interleukin-3 receptor, human interleukin-3 variant, human interleukin-4 receptor, human interleukin-5, human interleukin-6, human interleukin-7, human interleukin-8 (IL-8), human intracellular IL-1 receptor antagonist, human IP-10, and HIV-1 gp120 hypervariable region fusion protein, human IP-10 and human Muc-1 core epitope (VNT) fusion protein, human liver- and activation-regulated chemokine (LARC), human Lkn-1 full-length and mature protein, human mammary gland-associated chemokine (MACK) full-length and mature protein, human mature chemokine Ck beta-7, human mature gro alpha, human mature gro gamma polypeptide for treating sepsis, human MCP-3 and human Muc-1 core epitope (VNT) fusion protein, human MI10 protein, human MI1A protein, human monocyte chemoattractant hMCP-1, human monocyte chemoattractant hMCP-3, human monocyte chemoattractant proprotein (MCPP) sequence, human neurotactin chemokine-like domain, human non-ELR CXC chemokine H174, human non-ELR CXC chemokine IP10, human non-ELRCXC chemokine Mig, human PAI-1 variant, human protein with IL-16 activity, human protein with IL-16 activity, human secondary lymphoid chemokine (SLC), human SISD protein, human STCP-1, human stromal cell-derived chemokine, SDF-1, human T-cell mixed lymphocyte reaction-expressed chemokine (TMEC), human thymus and activation-regulated cytokine (TARC), human thymus expression, human TNF-alpha, human TNF-alpha, human TNF-beta (LT-alpha), human CC-type chemokine eotaxin 3 protein sequence, human type II interleukin-1 receptor, human wild-type interleukin-4 (hIL-4) protein, human ZCHEMO-8 protein, humanized anti-VEGF antibodies and fragments thereof, humanized anti-VEGF antibodies and fragments thereof, hyaluronidase, ICE 10 kD subunit, ICE 20 kD subunit, ICE 22 kD subunit, iduronate-2-sulfatase, iduronidase, IL-1 alpha, IL-1 beta, IL-1 inhibitor (IL-1i), mature IL-1, IL-10 receptor, IL-11, IL-11, IL-12 p40 subunit, IL-13, IL-14, IL-15, IL-15 receptor, IL-17, IL-17 receptor, II-17 receptor, II-17 receptor, IL-19, IL-1i fragment, IL-1-receptor antagonist, IL-21(TIF), IL-3 containing fusion protein, IL-3 mutein, IL-3 variant, IL-3 variant, IL-4, IL-4 mutein, IL-4 mutein Y124G, IL-4 mutein Y124X, IL-4 mutein, II-5 receptor, IL-6, II-6 receptor, IL-7 receptor clone, IL-8 receptor, IL-9 mature protein variant (Met117 type), immunoglobulin or immunoglobulin-based molecule or a fragment of either (e.g., available from Small Modular ImmunoPharmaceuticals (trademark) ) (“SMIP”) or dAb, Fab′ fragment, F(ab′)2, scAb, scFv or scFv fragment), plasminogen, influenza vaccine, inhibin alpha, inhibin beta, insulin, insulin-like growth factor, integrin Mab, inter-alpha trypsin inhibitor, inter-alpha trypsin inhibitor, interferon gamma-inducing protein (IP-10), interferons (e.g., interferon alpha species and subspecies, interferon beta species and subspecies, interferon interferon (e.g., interferon alpha species and subspecies, interferon beta species and subspecies, interferon gamma species and subspecies), interleukin 6, interleukin 8 (IL-8) receptor, interleukin 8 receptor B, interleukin-1 alpha, interleukin-2 receptor-related protein p43, interleukin-3, interleukin-4 muteins, interleukin-8 (IL-8) protein, interleukin-9, interleukin-9 (IL-9) components mature proteins (Thr117 type), interleukins (e.g., IL0, IL11, and IL2), interleukins (e.g., IL0, IL11, and IL2), Japanese encephalitis vaccines, kallikrein inhibitors, keratinocyte growth factors, Kunitz domain proteins (e.g., aprotinin, amyloid precursor protein, and those described in WO03 / 066824, with or without albumin fusion), Kunitz domain proteins, proteinin, amyloid precursor protein with or without albumin fusion, LA CI, lactoferrin, latent TGF-beta binding protein II, leptin, liver-expressed chemokine-1 (LVEC-1), liver-expressed chemokine-2 (LVEC-2), LT-alpha, LT-beta, luteinizing hormone, Lyme vaccine, lymphotactin, macrophage-derived chemokine analog MDC(n+1), macrophage-derived chemokine analog MDC-eyfy, macrophage-derived chemokine analog MDC-yl, macrophage-derived chemokine MDC, macrophage-derived chemokine (MDC), maspin;Protease inhibitor 5, MCP-1 receptor, MCP-1a, MCP-1b, MCP-3, MCP-4 receptor, M-CSF, melanoma inhibitory protein, membrane-associated protein, Met117 human interleukin-9, MIP-3 alpha, MIP-3 beta, MIP-gamma, MIRAP, modified Rantes, monoclonal antibody, MP52, mutant interleukin-6 S176R, myofibrillar contractile protein troponin I, natriuretic peptide, nerve growth factor-beta, nerve growth factor-beta2, neuropilin-1, neuropilin-2, neurotactin, neurotrophin-3, neurotrophin-4, neurotrophin-4a, neurotrophin-4b, neurotrophin-4c, neurotrophin-4d, neutrophil-activating peptide-2 (NAP-2), NOGO-66 receptor, NOGO-A, NOGO-B, NOGO-C, novel beta-chemokine named PTEC, N-terminally modified chemokine GroHEK / hSDF-1alpha, N-terminally modified chemokine GroHEK / hS DF-1beta, N-terminally modified chemokine met-hSDF-1alpha, N-terminally modified chemokine met-hSDF-1beta, OPGL, bone morphogenetic protein-1; OP-1; BMP-7, bone morphogenetic protein-2, OX40; ACT-4, OX40L, oxytocin (neurophysin I), parathyroid hormone, Patched, Patched-2, PDGF-D, pertussis toxoid, pituitary-expressed chemokine (PGEC), placental growth factor, placental growth factor-2, plasminogen activator inhibitor-1; PAI-1, plasminogen activator inhibitor-2; PAI-2, plasminogen activator inhibitor-2;PAI-2, platelet-derived growth factor, platelet-derived growth factor Bv-sis, platelet-derived growth factor precursor A, platelet-derived growth factor precursor B, platelet Mab, platelet-derived endothelial cell growth factor (PD-ECGF), platelet-derived growth factor A chain, platelet-derived growth factor B chain, sepsis therapeutic polypeptide, preproapolipoprotein "Milano" variant, preproapolipoprotein "Paris" variant, prethrombin, primate CC chemokine "ILINCK", primate CXC chemokine "IBICK", proinsulin, prolactin, prolactin 2, prosaptide, protease inhibitor peptide, protein C, protein S, prothrombin, prourokinase, RANTES, RANTES 8-68, RANTES 9-68, RANTES peptide, RANTES receptor, recombinant interleukin-16, resistin, restrictocin, retroviral protease inhibitor, ricin, rotavirus vaccine, RSV Mab, saporin, sarcin, secreted and transmembrane polypeptides, secreted and transmembrane polypeptides, serum cholinesterase, serum protein, blood coagulation factor, soluble BMP receptor kinase protein-3, soluble VEGF receptor, stem cell inhibitor, staphylococcus vaccine, stromal-derived factor-1 alpha, stromal-derived factor-1 beta, substance P (tachykinin), T1249 peptide, T20 peptide, T4 endonuclease, TACI, Tarc , TGF-beta1, TGF-beta2, Thr117 human interleukin 9, thrombin, thrombopoietin, thrombopoietin derivative 1, thrombopoietin derivative 2, thrombopoietin derivative 3, thrombopoietin derivative 4, thrombopoietin derivative 5, thrombopoietin derivative 6, thrombopoietin derivative 7, thymus-expressed chemokine (TECK), thyroid-stimulating hormone, tick anticoagulant peptide, Tim-1 protein, TNF-alpha precursor, TNF-R, TNF-RII; TNF p75 receptor;Death receptor, tPA, transferrin, transforming growth factor beta, troponin peptide, truncated monocyte chemotactic protein 2(6-76), truncated monocyte chemotactic protein 2(6-76), truncated RANTES protein(3-68), tumor necrosis factor, urate oxidase, urokinase, vasopressin (neurophysin II), VEGF R-3; flt-4, VEGF receptor; KDR; flk-1, VEGF-110, VEGF-121, VEGF-138, VEGF-145, VEGF-162, VEGF-165, VEGF-182, VEGF-189, VEGF-206, VEGF-D, VEGF-E; VEGF-X, von Willebrand factor, wild-type monocyte chemotactic protein 2, wild-type monocyte chemotactic protein 2, ZTGF-beta9, beta; (T87Q) -Globin, SMN1, chimeric antigen receptor, RPE65, F8, HGF, LPL, p53, apoe2, arylsulfatase A, NAGLU, SGSH, AADC, GAD, GDNF, NRTN, LCAT, GBA, FGF-1, FGF-2, ADA, CLN2, CLN6, CLN3, IDS, huntingtin, TRAIL, dystrophin, GALGT2, accA, IDUA, GLB1, FS344, SGCA, DYSF, ABCD1, gigaxonin, and functional fragments thereof The method according to (45) above, wherein the protein encodes a protein selected from the group consisting of:
[0010] It should be noted that the above-mentioned configurations (1) to (44) can be combined by arbitrarily selecting two or more of them. [Effects of the Invention]
[0011] The RNA aptamer of the present invention has excellent binding affinity to ASP7967 or an analog thereof, and is therefore very useful, for example, for designing a riboswitch that can respond with high sensitivity to the presence of ASP7967 or an analog thereof. [Brief explanation of the drawings]
[0012] [Figure 1]Figure 1a: 1H NMR spectrum of compound 3. Figure 1b: 13C NMR spectrum of compound 3. Figure 1c: 19F NMR spectrum of compound 3. [Figure 2] Small molecules ASP2905 / ASP7967 and aptamers. a, Structures of ASP2905, ASP7967, and compound 3. b, Aptamer sequence and predicted structure. R10-6 is the original aptamer discovered by SELEX. AC17-4 was extracted from the predicted structure of R10-6, which was found to be sufficient for binding ASP2905 and ASP7967. This predicted structure is based on mFold38. c, SPR sensorgrams of an AC17-4-immobilized chip injected with ASP2905 and ASP7967 solutions. [Figure 3] ITC measurements of AC17-4 and ASP2905. Measurements were performed at 37° C. Data are the mean ± standard deviation (SD) of two independent experiments. [Figure 4] Mutational analysis of AC17-4. a, Mutations in ASP2905 and their effect on KD. Mean values in brackets represent KD measured by SPR. NB: non-binding. b, Summary of KD values for mutants shown in a. SPR sensorgrams are presented in Figure 5. [Figure 5] SPR sensorgrams of AC17-4 mutants interacting with ASP2905. Such measurements were used to generate the data shown in Figure 4. KD values are the average of two independent experiments. [Figure 6]Mammalian riboswitch based on AC17-4. a) Sequence and secondary structure of the pistol ribozyme. The arrowhead indicates the cleavage site. b) AC17-4-CPP aptazyme incorporated into the 3'UTR of EGFP mRNA. In the absence of ligand (ASP2905 or ASP7967), the active CPP ribozyme self-cleaves at the position indicated by the arrowhead (left structure). This releases the poly(A) tail and suppresses EGFP expression (OFF). In the presence of ligand, aptamer-ligand interaction stabilizes the aptazyme structure shown on the right, allowing the anti-Rz sequence (black-bordered circle) to invade the P1 stem and PK pseudoknot. This interferes with the CPP structure that inactivates the ribozyme, allowing mRNA translation (ON). c) Induction of gene expression by the riboswitch shown in b. Variants with different sizes of anti-Rz sequences were examined. Blank: no aptazyme control. Data are the average of three replicate wells, and error bars represent SD. Numbers above the bars indicate the ON / OFF ratio. d, Dose-dependent response of a8-AC17-4-CPP in response to ASP7967. Blank: no aptazyme control. Data are the average of three replicate wells, and error bars represent SD. Numbers around the data points indicate the ON / OFF ratio. [Figure 7] MTT (cell proliferation) assay of HEK293 cells cultured in the presence of ASP2095 or ASP7967. No cytotoxicity was observed up to 10 μM. Data are the average of four replicate wells, and error bars represent SD. Statistical comparisons were performed by unpaired two-tailed t-test. ns: not significant difference. [Figure 8] Riboswitch function of a8c-AC17-4-CPP in HEK293 cells. a, Sequence and secondary structure of a8c-AC17-4-CPP. b, Experimental conditions were the same as those shown in Figure 6c. Blank: control without aptazyme. Data are the average of three replicate wells, and error bars represent SD. The number above each error bar indicates the ON / OFF ratio. [Figure 9]Evaluation of a8c-AC17-4 CPP riboswitch function in AAV vectors. a, AAV vector expressing hEPO regulated by the a8c-AC17-4-CPP riboswitch. b, hEPO secretion by HEK293 cells transfected with the AAV vector plasmid in the absence or presence of ASP7967. Control: no riboswitch. Data are the mean values of three biological replicates, and error bars represent SD. c, Experimental design used for animal testing. Blood was collected 24 hours before and at multiple time points (2, 4, 6, 8, and 24 hours) after ligand administration. d, Time-dependent secretion of hEPO in mice injected with 3 × 10 vector genomes (vg) per mouse after oral administration of ASP7967. Serum hEPO protein concentrations were measured at the indicated time points. Mice were administered saline and vehicle or ASP7967 (WT_Vehicle or WT_ASP7967, n = 5), AAV8-hEPO-control and vehicle or ASP7967 (AAV8-hEPO-Control_Vehicle or AAV8-hEPO-Control_ASP7967, n = 6), AAV8-hEPO-a8c-AC17-4-CPP and vehicle (AAV8-hEPO-a8c-AC17-4-CPP_Vehicle, n = 7), or AAV8-hEPO-a8c-AC17-4-CPP and ASP7967 (AAV8-hEPO-a8c-AC17-4-CPP_ASP7967, n = 8). Data are the mean of biological replicates (n), and error bars represent SE. [Figure 10] Pharmacokinetics of ASP7967 in mice after oral administration. After oral administration of 100 mg kg to mice (BALB / c cAJcl), plasma and liver concentrations of ASP7967 were measured using liquid chromatography-tandem mass spectrometry (LC-MS / MS). ASP7967 concentrations in both plasma and liver reached a maximum at the first sampling time point of 1 hour and then decreased over time. Liver-to-plasma concentration ratios ranged from 2.7 to 30.6, suggesting that ASP7967 was distributed to the liver. [Figure 11]AC17-4-based exon-skipping riboswitch. a) Illustration of the exon-skipping riboswitch mechanism. A suicide exon containing a stop codon flanked by two intronic sequences from intron 2 of the human β-globin gene is inserted into the EGFP gene. The AC17-4 aptamer is inserted downstream of the 5'-sequence of the second intron. In the absence of a ligand, the suicide exon is incorporated into the mature mRNA. In the presence of a ligand, the 5'-sequence is blocked by the aptamer structure, resulting in exon skipping, allowing expression of the desired protein. b) EGFP expression regulated by the exon-skipping riboswitch through changes in P1 stability. Empty: no-aptazyme control. Data are the average of three replicate wells, and error bars represent SD. The numbers above each bar indicate the ON / OFF ratio. c) EGFP expression regulated by the exon-skipping / aptazyme dual riboswitch. Empty: no-aptazyme control. Data are the average of three replicate wells, error bars represent SD, and the number above each bar indicates the ON / OFF ratio. [Figure 12] Sequence and secondary structure of CPP-4a9-P3-9d and CPP-4a9-P3-9e aptazymes. [Figure 13] Map and sequence of plasmid pEGFP-BsaI-Amp. The riboswitch sequences shown in Table 5 replace the bolded and underlined sequences in the corresponding riboswitch plasmids. The CMV promoter is boxed. The egfp gene is shaded. The bla gene (AmpR) is gray. The plasmid map from Benchling is available at the following link: https: / / benchling.com / s / seq-rsh62LI9bm2tWJWB2Ecm?m=slm-aMKjz51vOZsXH6ySC4ih. [Figure 14]Map and sequence of plasmid pEGFP-ex169-AC17-4-a8. The riboswitch sequence shown in Table 6 replaces the underlined and bolded sequence in the corresponding riboswitch plasmid. For the double exon skipping / aptazyme switches (a9+g2g7 / CPP-4a9-P3-9d and a9+g2g7 / CPP-4a9-P3-9e), the ex169-AC17-4-a9+g2g7 exon skipping module plus the corresponding aptazyme sequence shown in Table 5 replaces the bolded / boxed sequence. The CMV promoter is boxed. The egfp exons are shaded / black. The introns are shaded / gray. The alternative exons are uppercase / shaded. The AC17-4 aptamer is uppercase / bold. The anti-5'ss is lowercase / bold. The bla gene (AmpR) is shown in gray. The plasmid map from Benchling is available at the following link: https: / / benchling.com / s / seq-kxeLdS2ELr9C4pnrZ8lr?m=slm-M8eUKmXbeUXSKPJpKyQe. [Figure 15] Aptamer sequence and predicted structure of circularly permuted AC17-4 (cpAC17-4). [Figure 16] SPR sensorgram of cpAC17-4 immobilized chip injected with ASP2905 solution. cpAC17-4 binds to ASP2905 with a KD of 30 nM. [Figure 17] Graph of EGFP expression regulated by an exon-skipping riboswitch. The AC17-4 aptamer (ex169-AC17-4-a7, a8, a9) in the exon-skipping riboswitch was replaced with cpAC17-4. cpAC17-4 functions as part of the riboswitch in HEK293 cells. DETAILED DESCRIPTION OF THE INVENTION
[0013] To address the above-mentioned issues, we performed in vitro selection of RNA aptamers against the small molecule ASP7967, whose structure closely resembles that of ASP2905, a known inhibitor of the voltage-gated potassium channel subfamily H member 3 (KCNH3). One of the selected aptamers (AC17-4) was found to be functional in HEK293 cells and was used to design an aptazyme-based riboswitch capable of activating gene expression (>10-fold) in the presence of as low as 5 μM of ASP2905 or ASP7967 in the culture medium. The aptazyme-based riboswitch was successfully used to regulate human erythropoietin (hEPO) expression using oral administration of ASP7967 in mice injected with an adeno-associated virus (AAV8) vector. Moreover, by combining the aptazyme-based and exon-skipping riboswitch mechanisms, ON / OFF ratios approaching 300 were achieved, along with low basal expression levels in cultured cells.
[0014] As used herein, the term "aptamer" refers to an oligonucleotide or peptide molecule that has high specificity and affinity for a particular substance. The term "aptamer" includes DNA aptamers, RNA aptamers, XNA aptamers, and peptide aptamers. Aptamers can be of any length, for example, from about 1 nucleotide to about 100 nucleotides, from about 5 nucleotides to about 50 nucleotides, or from about 10 nucleotides to about 25 nucleotides. Aptamers made of RNA are called "RNA aptamers."
[0015] In some embodiments of the present invention, aptamers can be used in the form of split aptamers. That is, the scope of the aptamers of the present invention encompasses split aptamers designed based on their parent aptamers. A split aptamer is an aptamer consisting of two fragments derived from a parent aptamer, obtained by cutting the parent aptamer sequence, for example, at the loop sequence, and can bind to a target substance by forming substantially the same structure as the parent aptamer when used. As will be readily understood by those skilled in the art, split aptamers can be used in riboswitches and other applications in the same way as parent aptamers.
[0016] In another embodiment of the present invention, the RNA aptamer of the present invention is a circularly permuted aptamer. The term "circularly permuted aptamer" or "circularly permuted aptamer" refers to an aptamer in which the order of nucleic acids within the nucleic acid sequence is changed compared to the parent RNA sequence, resulting in an RNA structure with different connectivity but an overall similar three-dimensional (3D) shape. Circular permutation of an aptamer is similar to the mathematical concept of cyclic permutation in that the sequence of a first portion of the parent aptamer (adjacent to the 5' end) is related to the sequence of a second portion of the resulting circularly permuted aptamer (near the 3' end). Circular permutation of an aptamer is obtained by genetically or artificially modifying the RNA sequence compared to its parent aptamer, "connecting" the 5' and 3' ends of the parent RNA and splitting the RNA sequence at a different site to generate new 5' and 3' ends of the aptamer. Optionally, additional sequences can be inserted between the original 5' and 3' ends. This additional sequence may form a stem-loop structure. Alternatively, when the regions near the original 5' and 3' ends form a stem structure, the length of the stem structure may be altered. The circularly permuted aptamer of the present invention is the result of connecting the 5' and 3' ends of a parent aptamer sequence and cleaving or splitting the sequence at an accessible or exposed site (preferentially a loop) of the aptamer, thereby maintaining or making the folding of the circularly permuted aptamer similar to that of the parent aptamer. The connection between the 5' and 3' ends of the circularly permuted aptamer can be the result of a phosphodiester bond, or the introduction of an RNA linker, or the formation of a phosphodiester bond between the remaining nucleic acid after deletion of a stretch of RNA sequence near the original 5' and 3' ends of the parent aptamer.
[0017] As used herein, the term "stem-loop" refers to a nucleotide secondary structure having a "loop" of unpaired nucleic acids and a "stem" formed by base pairing. A "stem" can be formed when the sequences of two regions of the same nucleotide strand are at least partially complementary, substantially complementary, form wobble base pairs, etc. A "loop" refers to a region of unpaired (i.e., non-complementary) nucleotides that connects the respective nucleotide strands of the stem and can cap the stem.
[0018] As used herein, the term "ribozyme" refers to a mediator nucleic acid molecule that is RNA and that specifically recognizes and cleaves a target nucleic acid sequence. The target can be the ribozyme itself or another nucleic acid molecule.
[0019] As used herein, the phrase "operably linked to" refers to the linking of multiple nucleic acids to form a single nucleic acid such that the function of one nucleic acid is affected by another nucleic acid.
[0020] In this specification, detailed descriptions may be cross-referenced unless otherwise stated.
[0021] <Aptamer> As described above, the RNA aptamer of the present invention is an RNA aptamer that binds to ASP7967 or an analog thereof, and has the sequence: -X1-L1-X2-L2-X3- (In the formula, X1 has the sequence Y1GY2GY3Y4Y5, L1 is a first stem-loop nucleotide sequence comprising a first stem region, a first loop region, and a second stem region (in that order), wherein the first stem region and the second stem region are at least two base pairs in length and are substantially complementary to each other; X2 is A, G, C or U; L2 is a second stem-loop nucleotide sequence comprising a third stem region, a second loop region, and a fourth stem region (in that order), wherein the third stem region and the fourth stem region are at least two base pairs in length and are substantially complementary to each other, the first base (the 5'-most base) in the third stem region is G, and the last base (the 3'-most base) in the fourth stem region is C; X3 has the sequence UY6, Y1, Y2, Y3, Y4, Y5, and Y6 are each independently A, G, C, or U. contains, or array: -S1-X2-L2-X3-L3-X1-S2- (In the formula, S1 and S2 are each independently A, G, C, or U, and S1 and S2 can form a base pair or a wobble base pair with each other; L3 is a third stem-loop nucleotide sequence comprising a fifth stem region, a third loop region, and a sixth stem region, wherein the fifth stem region and the sixth stem region are at least one base pair in length and are substantially complementary to each other; X1, X2, X3, and L2 are as defined above. contains, or array: -S3-X3-L3-X1-L1-X2-S4- (In the formula, S3 is C and S4 is G, X1, X2, X3, L1, and L3 are as defined above. It is an RNA aptamer comprising: The above sequences are written from left to right from 5' to 3' end.
[0022] In some embodiments, the RNA aptamer of the present invention may be circularly permuted. In other embodiments, the present invention also provides a circularly permuted RNA aptamer derived from the RNA aptamer of the present invention. In the circularly permuted RNA aptamer, the length of the first, second, and / or third stem-loop region may be 1, 2, 3, 4, or 5 base pairs longer than the unpermuted (parent) aptamer, or 1, 2, 3, or 4 base pairs shorter than the unpermuted (parent) aptamer. The cleavage site may be located within the first loop region, the second loop region, or the third loop region.
[0023] In other embodiments, the RNA aptamers of the present invention may be split aptamers.
[0024] In the present invention, Y2 is preferably A or U, more preferably A. Y3 is preferably A or U, more preferably A. Y4 is preferably G or C, more preferably G.
[0025] In the present invention, preferably, Y1 and Y6 are capable of forming a base pair or a wobble base pair with each other, and more preferably, Y1 is G and Y6 is U, or Y1 is U and Y6 is G.
[0026] In the present invention, preferably, the first stem region and the second stem region are 3 to 7 base pairs in length and are substantially complementary to each other; more preferably, the first stem region and the second stem region are 5 base pairs in length and are substantially complementary to each other; particularly preferably, the first stem region has the sequence GACGG and the second stem region has the sequence CCGUC.
[0027] In the present invention, the first loop region preferably has 3 to 7 bases, and more preferably has the sequence AUU or UUCG.
[0028] In the present invention, preferably, the third stem region and the fourth stem region have 1 to 5 base pairs and are substantially complementary to each other; more preferably, the third stem region and the fourth stem region have 3 to 4 base pairs and are substantially complementary to each other; particularly preferably, the third stem region has the sequence GCG and the fourth stem region has the sequence CGC, or the third stem region has the sequence GCGU and the fourth stem region has the sequence ACGC.
[0029] In the present invention, preferably, the second loop region has 3 to 7 bases, and more preferably, the second loop region has the sequence AAUUCA or UUCG.
[0030] In the present invention, preferably, the fifth stem region and the sixth stem region are 3 to 7 base pairs in length and are substantially complementary to each other; more preferably, the fifth stem region and the sixth stem region are 4 base pairs in length and are substantially complementary to each other; particularly preferably, the fifth stem region has the sequence CUUG and the sixth stem region has the sequence CAAG.
[0031] In the present invention, preferably, the third loop region has 3 to 7 bases, and more preferably, the third loop region has the sequence UUCG.
[0032] In the present invention, preferably, S1 is C and S2 is G, or S1 is G and S2 is C.
[0033] The RNA aptamer of the present invention has the above sequence (-X1-L1-X2-L2-X3-; -S1-X2-L2-X3-L3-X1-S2-; -S3-X3-L3-X1-L1-X2-S4-) and can bind to ASP7967 or an analog thereof, preferably ASP7967 or ASP2905. Here, ASP2905 is a compound represented by the following formula: ASP2905 is a potent and selective inhibitor of the potassium channel Kv12.2, which is encoded by the Kcnh3 / BEC1 gene. ASP2905 can cross the blood-brain barrier and has antipsychotic activity.
[0034] [ka]
[0035] ASP7967 (an ASP2905 analog) is a compound represented by the following formula:
[0036] [ka]
[0037] In the above sequence (-X1-L1-X2-L2-X3-; -S1-X2-L2-X3-L3-X1-S2-; -S3-X3-L3-X1-L1-X2-S4-), the first and second stem regions are at least two base pairs in length and are substantially complementary to each other, the third and fourth stem regions are at least two base pairs in length and are substantially complementary to each other, and the fifth and sixth stem regions are at least two base pairs in length and are substantially complementary to each other. Such complementary base pairs can form stem structures that result in an ASP7967 aptamer-like structure that has binding activity for ASP7967 or an analog thereof. The stem structure can be formed by substantially complementary base pairs (including wobble base pairs (e.g., G=U base pairs) in addition to Watson-Crick base pairs), but the number of base pairs in the stem structure is not particularly limited. The number of base pairs is 2 or more, preferably 3 or more, and more preferably 4 or more. The upper limit of the number of base pairs is not particularly limited, and is, for example, 7 or less, preferably 6 or less, and more preferably 5 or less.
[0038] In the present invention, the phrase "substantially complementary" includes not only cases where a sequence is completely complementary to another sequence, but also cases where there are one or more mismatches (including bulges) that do not interfere with the formation of the stem structure. Even if base pairs are not formed in a portion of the stem structure, the above-mentioned binding activity to ASP7967 or an analog thereof is maintained as long as the aptamer structure is formed as a whole. In the present invention, wobble base pairs (e.g., G=U base pairs) are also included in the term "complementary base pairs."
[0039] In other embodiments, aptamers of the present disclosure may comprise the AC17-4 core sequence (SEQ ID NO: 1) shown below. 5'-UGAGAGAGACGGAUUCCGUCCGCGAAUUCACGCUG-3' (SEQ ID NO: 1)
[0040] In other embodiments, aptamers of the present disclosure may include variants of SEQ ID NO:1, as shown below. 5'-UG U GAGAGACGGAUUCCGUCCGCGAAUUCACGCUG-3' (SEQ ID NO: 2) 5'-UGAG U GAGACGGAUUCCGUCCGCGAAUUCACGCUG-3' (SEQ ID NO: 3) 5'-UGAGA C AGACGGAUUCCGUCCGCGAAUUCACGCUG-3' (SEQ ID NO: 4) 5'-UGAGAG U GACGGAUUCCGUCCGCGAAUUCACGCUG-3' (SEQ ID NO: 5) 5'-UGAGAGAGACGGAUUCCGUC A GCGAAUUCACGCUG-3' (SEQ ID NO: 6) 5'- G GAGAGAGACGGAUUCCGUCCGGCGAAUUCACGCU U -3' (SEQ ID NO: 7) 5'-UGAGAGA C ACGGAUUCCGU G CGCGAAUUCACGCUG-3' (SEQ ID NO: 8) 5'-UGAGAGAGACGG UUCG CCGUCCGCGAAUUCACGCUG-3' (SEQ ID NO: 9) 5'-UGAGAGAGACGGAUUCCGUCCGCG UUUCGA CGCUG-3' (SEQ ID NO: 10) 5'-UGAGAGAGACGGAUUCCGUCGGCGAAUUC G CGCUG-3' (SEQ ID NO: 11) 5'-UGAGAGAGACGGAUUCCGUCCGCG U AUUCACGCUG-3' (SEQ ID NO: 12)
[0041] In other embodiments, the aptamers of the present disclosure may include various aptamers designed by any technique known in the art based on the AC17-4 aptamer (SEQ ID NO: 50). For example, such an aptamer includes the circularly permuted AC17-4 (cpAC17-4) shown below. 5'-GGUGUCCGCGAAUUCACGCUGCUUGUUCGCAAGUGAGAGAGACACC-3' (SEQ ID NO: 77)
[0042] In other embodiments, aptamers of the present disclosure may comprise the cpAC17-4 core sequence (SEQ ID NO: 78) shown below. 5'-CCGCGAAUUCACGCUGCUUGUUCGCAAGUGAGAGAG-3' (SEQ ID NO: 78)
[0043] In another aspect, the aptamer of the present disclosure may comprise a nucleotide sequence represented by any one of SEQ ID NOs: 1 to 12, 77, and 78, or a homologous nucleotide sequence having at least 60%, 70%, 80%, 90%, or 95% identity to the nucleotide sequence represented by any one of SEQ ID NOs: 1 to 12, 77, and 78. The homologous nucleotide sequence may be a nucleotide sequence comprising a substitution, deletion, and / or insertion of 1 to 5 nucleotides within the sequence represented by any one of SEQ ID NOs: 1 to 12, 77, and 78. The number of substitutions, deletions, and insertions in the nucleotide sequence is preferably 1 to 4 nucleotides, more preferably 1 to 3 nucleotides, and more preferably 1 or 2 nucleotides.
[0044] In the present invention, an RNA aptamer having the sequence (-X1-L1-X2-L2-X3-) may further include a fifth stem region adjacent to the 5' end of X1 and a sixth stem region adjacent to the 3' end of X3, where the fifth and sixth stem regions have 1 to 15 base pairs and are substantially complementary to each other, forming a double-stranded stem. This double-stranded stem is added to stabilize the aptamer structure substantially formed by the above sequence (-X1-L1-X2-L2-X3-). The double-stranded stem is believed to have little effect on the binding strength and binding specificity of the aptamer. Here, the double-stranded stem structure may be formed by substantially complementary base pairs (including wobble base pairs (e.g., G=U base pairs) in addition to Watson-Crick base pairs), but the number of base pairs is not particularly limited. The number of base pairs contained in the fifth stem region and the sixth stem region is preferably 2 to 10 base pairs, more preferably 6 to 9 base pairs, and particularly preferably 4 to 6 base pairs.
[0045] For example, the fifth stem region has the sequence shown below. 5'-GCAAG-3'
[0046] For example, the sixth stem region has the sequence shown below. 5'-CUUGC-3'
[0047] In the present invention, an RNA aptamer having the sequence (-S1-X2-L2-X3-L3-X1-S2-) may further include a seventh stem region adjacent to the 5' end of S1 and an eighth stem region adjacent to the 3' end of S2, where the seventh and eighth stem regions have 1 to 15 base pairs and are substantially complementary to each other, forming a double-stranded stem. This double-stranded stem is added to stabilize the aptamer structure substantially formed by the above sequence (-S1-X2-L2-X3-L3-X1-S2-). The number of base pairs in the seventh and eighth stem regions is preferably 2 to 10, more preferably 6 to 9, and particularly preferably 4 to 6.
[0048] For example, the seventh stem region has the sequence shown below. 5'-GGUGU-3'
[0049] For example, the eighth stem region has the sequence shown below. 5'-ACACC-3'
[0050] In the present invention, an RNA aptamer having the sequence (-S3-X3-L3-X1-L1-X2-S4-) may further include a ninth stem region adjacent to the 5' end of S3 and a tenth stem region adjacent to the 3' end of S4, where the ninth and tenth stem regions have 1 to 15 base pairs and are substantially complementary to each other, forming a double-stranded stem. This double-stranded stem is added to stabilize the aptamer structure substantially formed by the above sequence (-S3-X3-L3-X1-L1-X2-S4-). The number of base pairs in the ninth and tenth stem regions is preferably 2 to 10, more preferably 6 to 9, and particularly preferably 4 to 6.
[0051] The RNA aptamer of the present invention is, for example, a single-stranded RNA that has the function of binding to ASP7967 or an analog thereof. Herein, the base sequence is written from left to right from the 5' end to the 3' end.
[0052] In the present invention, the binding strength of an RNA aptamer to a substance is represented, for example, by the dissociation constant (Kd) between the RNA aptamer and the substance.The dissociation constant of the RNA of the present invention to ASP7967 by SPR is, for example, 1.0 μM or less, preferably 0.2 μM or less, more preferably 50 nM or less.The dissociation constant of the RNA of the present invention to ASP2905 by SPR is, for example, 1.0 μM or less, preferably 0.2 μM or less, more preferably 50 nM or less.
[0053] In the present invention, the RNA aptamer can specifically bind to ASP7967 or an analog thereof. As used herein, the terms "specific" or "specifically" refer to the selective binding of the RNA aptamer of the present invention to ASP7967 or an analog thereof. The binding specificity of the RNA aptamer can be determined by comparing the binding of the RNA aptamer to ASP7967 or an analog thereof (binding strength to ASP7967 or an analog thereof) with the binding of the RNA aptamer to an unrelated substance (binding strength to an unrelated substance) under specified conditions.
[0054] The RNA aptamers of the present invention may be linked to other polynucleotides.
[0055] <Riboswitch> A riboswitch generally refers to a functional unit (region or segment) of an RNA polynucleotide that regulates the activity of a target sequence on the same RNA polynucleotide, such as a protein-coding sequence or a non-protein-coding RNA (e.g., siRNA, miRNA precursor). Riboswitches typically include an aptamer, a sensor region that detects the presence of a ligand (e.g., a small molecule), and an effector region that is responsible for basic functions. Non-limiting basic functions of riboswitches include the formation of a hairpin structure that terminates transcription, blocking translation by inhibiting a ribosome-binding site, self-cleavage, and regulating alternative splicing. Riboswitches undergo a conformational change through the conformational change of the aptamer triggered by binding to a ligand, resulting in the enhancement or inhibition of the activity of the target sequence on the same RNA polynucleotide. Here, ASP7967 or its analog (ASP2095) is not cytotoxic (see Figure 7 ), making such molecules excellent ligands for regulating riboswitch function, particularly in vivo.
[0056] The riboswitch of the present invention includes, as a part thereof, the RNA aptamer of the present invention, and is capable of detecting ASP7967 or an analog thereof through the aptamer and regulating the activity of a target sequence on the same RNA polynucleotide.
[0057] In many embodiments, riboswitches of the invention can be operably linked to a target sequence such that a conformational change in the aptamer in response to binding to ASP7967 or an analog thereof results in enhanced or inhibited activity of the target sequence. Furthermore, riboswitches of the invention can be indirectly linked to a target sequence, with any base sequence between them, as long as the riboswitch can regulate the activity of the target sequence. Riboswitches of the invention can also be positioned between one portion of a target sequence and another portion of the target sequence, as long as the riboswitch can regulate the activity of the target sequence. In the present invention, the phrase "operably linked to" includes such cases. Furthermore, in the present invention, the riboswitch sequence and the target sequence can share a portion of sequence.
[0058] In the present invention, the target sequence can be a protein-coding sequence or a non-protein-coding RNA, such as an siRNA, a miRNA precursor, a primary miRNA, an sgRNA, an lncRNA, an RNA aptamer, a ribozyme, a tRNA, or an rRNA, where the protein encoded by the target sequence can be any protein.
[0059] A target sequence may comprise and / or be operably linked to functional elements that allow the target sequence to be transcribed and translated and / or expressed under appropriate conditions. Those skilled in the art will understand that transcriptional, translational or expression control sequences can be appropriately selected based on their capabilities.
[0060] In the present invention, any naturally occurring riboswitch can be used as a platform for preparing a riboswitch of the present invention. Any naturally occurring riboswitch can be modified to include an aptamer of the present invention instead of the original aptamer. Such a riboswitch can be further modified as long as the activity of the riboswitch as a whole is maintained. Examples of the naturally occurring riboswitches described above include, but are not limited to, thiamine pyrophosphate (TPP) riboswitch, adenosine cobalamin (AdoCbl) riboswitch, S-adenosylmethionine (SAM) riboswitch, SAH riboswitch, flavin mononucleotide (FMN) riboswitch, tetrahydrofolate riboswitch, lysine riboswitch, glycine riboswitch, purine riboswitch, GlmS riboswitch, and prequeosin 1 (PreQ1) riboswitch.
[0061] <Polynucleotide> The polynucleotides of the invention comprise a riboswitch or a DNA sequence transcribable into a riboswitch, which comprises an RNA aptamer capable of binding to ASP7967 or an analog thereof, and a target sequence encoding a protein, wherein the riboswitch is operably linked to the target sequence such that expression of the protein is up-regulated or down-regulated in response to ASP7967 or an analog thereof.
[0062] In some embodiments, the target sequence encoding a protein comprises multiple exons. The target sequence may, for example, comprise an alternatively spliced exon sandwiched between a 5' intron and a 3' intron, the alternatively spliced exon comprising a stop codon that is in-frame with the protein when the alternatively spliced exon is spliced into the mRNA of the protein. In this embodiment, for example, a riboswitch is placed within the 3' intron of the alternatively spliced exon. The riboswitch comprises a 5' splice site ("5'ss") sequence of the 3' intron (i.e., the intron splice site sequence immediately 3' of the alternative exon) and a sequence complementary to the 5'ss sequence of the 3' intron as an effector region. When the aptamer binds to the ligand, the effector region forms a stem, thereby preventing splicing to the splice donor site at the 3' end of the alternative exon, resulting in expression of the protein of interest. Under certain conditions (e.g., when the aptamer does not bind to its ligand), the effector region can access the splice donor site at the 3' end of the alternative exon, causing incorporation of the alternative exon into the mRNA of the protein, thereby inhibiting expression of the protein of interest (see, e.g., Figure 11a). In this case, the total length of the stem formed by the effector region is preferably between 6 and 12 base pairs, more preferably between 6 and 10 base pairs, and particularly preferably between 7 and 9 base pairs.
[0063] Examples of base sequences of riboswitches of the present invention in embodiments are shown below.
[0064] 5'-GUAAUGUUGAGAGAGACGGAUUCCGUCCGCGAAUUCACGCUGACAUUAC-3' (SEQ ID NO: 13)
[0065] 5'-GUAAUGUGUGAGAGAGACGGAUUCCGUCCGCGAAUUCACGCUGCACAUUAC-3' (SEQ ID NO: 14)
[0066] 5'-GUAAUGUGGUGAGAGAGACGGAUUCCGUCCGCGAAUUCACGCUGCCACAUUAC-3' (SEQ ID NO: 15)
[0067] 5'-GUAAUGUGGCUGAGAGAGACGGAUUCCGUCCGCGAAUUCACGCUGGCCACAUUAC-3' (SEQ ID NO: 16)
[0068] 5'-GUAAUGUGGCAUGAGAGAGACGGAUUCCGUCCGCGAAUUCACGCUGUGCCACAUUAC-3' (SEQ ID NO: 17)
[0069] 5'-GUAAUGUGGUGAGAGAGACGGAUUCCGUCCGCGAAUUCACGCUGCCGCAUUGCC-3' (SEQ ID NO: 18)
[0070] 5'-GUAAUGUCCGCGAAUUCACGCUGCUUGUUCGCAAGUGAGAGAGACAUUAC-3' (SEQ ID NO: 79)
[0071] 5'-GUAAUGUGCCGCGAAUUCACGCUGCUUGUUCGCAAGUGAGAGAGCACAUUAC-3' (SEQ ID NO: 80)
[0072] 5'-GUAAUGUGGCCGCGAAUUCACGCUGCUUGUUCGCAAGUGAGAGAGCCACAUUAC-3' (SEQ ID NO: 81)
[0073] In some embodiments, a polynucleotide of the invention comprises a 3' UTR containing a polyadenylation signal sequence, and a riboswitch of the invention is inserted within the 3' UTR 5' to the polyadenylation signal sequence. Here, the function of the polyadenylation signal sequence (including the function of the poly(A) tail) is regulated by the riboswitch. In this embodiment, for example, the riboswitch comprises a self-cleaving ribozyme. Here, the riboswitch sequence and the self-cleaving ribozyme may share a portion of their sequence.
[0074] In one embodiment, in the riboswitch, when the aptamer binds to ASP7967 or an analog thereof, the self-cleaving ribozyme structure is stabilized by a stem structure formed by the terminal sequence of the aptamer (in this case, for example, the aptamer and the self-cleaving ribozyme share a stem structure), and the self-cleaving ribozyme is then activated. The activated self-cleaving ribozyme cleaves itself, which is inserted between the target sequence and the 3'UTR, thereby inhibiting the function of the polyadenylation signal sequence.
[0075] In one embodiment, in the riboswitch, when the aptamer binds to ASP7967 or an analog thereof, the self-cleaving ribozyme structure is disrupted by the stem structure formed by the terminal sequence of the aptamer (in this case, for example, the aptamer utilizes only one of the sequences forming the stem of the self-cleaving ribozyme to form the stem structure), and the self-cleaving ribozyme is then inactivated (see, for example, Figure 6b). The inactivated self-cleaving ribozyme does not cleave itself, which is inserted between the target sequence and the 3'UTR, and the function of the polyadenylation signal sequence is maintained. Here, the total length of the stem formed by the terminal sequence of the aptamer described above is preferably between 6 and 11 base pairs, more preferably between 6 and 10 base pairs, and particularly preferably between 8 and 10 base pairs.
[0076] Examples of base sequences of riboswitches of the present invention in embodiments are shown below.
[0077] 5'-UCUAGACCCUGCGUCACAACGACGUGAGAGAGACGAUUCCGUCCGCGAAUUCACGCGUCGUCUGGGCGACGGUAAAAUAGGUGUUAGCCCAGAGCGGCAGGGUACAACUCCGGA-3'(sequence number 19)
[0078] 5'-UCUAGACCCUGCGUCACAGACGACGUGAGAGAGACGAUUCCGUCCGCGAAUUCACGCGUCGUCUGGGCGACGGUAAAAUAGGUGUUAGCCCAGAGCGGCAGGGUACAACUCCGGA-3'(sequence number 20)
[0079] 5'-UCUAGACCCUGCGUCACAAGACGACGUGAGAGAGACGAUUCCGUCCGCGAAUUCACGCGUCGUCUGGGCGACGGUAAAAUAGGUGUUAGCCCAGAGCGGCAGGGUACAACUCCGGA-3'(sequence number 21)
[0080] 5'-UCUAGACCCUGCGUCACACAGACGAGAGAGAGACGGAUUCCGUCCGCGAAUUCACGCGUCGUCUGGGCGACGGUAAAAUAGGUGUUAGCCCAGAGCGGCAGGGUACAACUCCGGA-3'(sequence number 22)
[0081] 5'-UCUAGACCCUGCGUCACACCAGACGACGUGAGAGAGAGACGGAUUCCGUCCGCGAAUUCACGCGUCGUCUGGGCGACGGUAAAAUAGGUGUUAGCCCAGAGCGGCAGGUACAACU-3'(sequence number 23)
[0082] 5'-UCUAGACCCUGCGUCACACCCAGACGUGAGAGAGACGGAUUCCGUCCGCGAAUUCACGCGUCGUCUGGGCGACGGUAAAAUAGGUGUUAGCCCAGAGCGGCAGGGUACAACUCCGGA-3'(sequence number 24)
[0083] 5'-UCUAGACCCUGCGUCACAAAGAAAGACGACGUGAGAGAGACGGAUUCCGUCCGCGAAUUCACGCGUCGUCUGGGCGACGGUAAAAUAGGUGUUAGCCCAGAGCGGCAGGGUACAACUCCGGA-3'(sequence number 25)
[0084] 5'-UCUAGACCCUGCGUCACAUGAGAGAGACGGAUUCCGUCCGCGAAUUCACGCUGUGACGCACGUCGUCUGGCGACGGGUAAAUAGGUGUUAGCCCAGAGCGGCAAGGUCUAACUCCGGGA-3'(sequence number 26)
[0085] 5'-UCUAGACCCUGCGUCACAUGAGAGAGACGGAUUCCGUCCGCGAAUUCACCGUGUGAGACGCACGUCGUCUGGGCGACGGUAAAAUAGGUGUUAGCCCAGAGCGGCAGAGUCUAACUCCGGGA-3'(sequence number 27)
[0086] In the present invention, the protein encoded by the target sequence may be any protein, for example, a protein used in therapy. Examples of proteins encoded by the target sequence include 4-1BB ligand, 5-helix, human CC chemokine, human L105 chemokine, human L105 chemokine (named huL105_3), monokine induced by gamma interferon (MIG), CXCR4B partial protein, platelet basic protein (PBP), α1-antitrypsin, ACRP-30 homolog; and complement component C1q. C, adenoid-expressed chemokine (ADEC), aFGF; FGF-1, AGF, AGF protein, albumin, etoposide, angiostatin, anthrax vaccine, antibody specific for collapsin, antistasin, anti-TGF beta family antibody, antithrombin III, APM-1; ACRP-30; famoxin, apolipoprotein species, arylsulfatase B, b57 protein, BCMA, beta-thromboglobulin protein (beta-T G), bFGF; FGF2, blood coagulation factors, BMP processing enzyme furin, BMP-10, BMP-12, BMP-15, BMP-17, BMP-18, BMP-2B, BMP-4, BMP-5, BMP-6, BMP-9, bone morphogenetic protein-2, calcitonin, calpain-10a, calpain-10b, calpain-10c, cancer vaccines, carboxypeptidase, CC chemokine, MCP2, CCR5 variant, CCR7, CCR7, CD11a mAb, CD137; 4-1BB receptor protein, CD20 mAb, CD27, CD27L, CD30, CD30 ligand, CD33 immunotoxin, CD40, CD40L, CD52Mab, cerebus proteins, chemokine eotaxin, chemokine hIL-8, chemokine hMCP1, chemokine hMCP1a, chemokine hMCP1b, chemokine hMCP2, chemokine hMCP3, chemokine hSDF1b, chemokine MCP-4, chemokine TECK and TECK variants, full-length and mature chemokine-like protein IL-8M1, full-length and mature chemokine-like protein IL-8M10, chemokine-like protein IL-8M3, full-length and mature chemokine-like protein IL-8M4 Chemokine-like protein IL-8M8, full-length and mature chemokine-like protein IL-8M9, full-length and mature chemokine-like protein PF4-414, full-length and mature chemokine-like protein PF4-426, full-length and mature chemokine-like protein PF4-M2, cholera vaccine, chondromodulin-like proteins, c-kit ligand; SCF; mast cell growth factor; MGF; fibrosarcoma-derived stem cell factor, CNTF and its fragments, both precursor and activated forms of coagulation factors, collagen, complement C5 Mab, connective tissue activation protein III, CTAA16.88Mab, CTAP-III, CTLA4-Ig, CTLA-8, CXC3, CXC3, CXCR3; CXC chemokine receptor 3, cyanovirin N, darbepoetin, name Exodus, name huL105_7., DIL-40, Dnase, EDAR, EGF receptor Mab, ENA-78, endostatin, eotaxin, epithelial neutrophil-activating protein-78, EPO receptor; EPOR, erythropoietin (EPO) and EPO mimetic, eutropin, exo DAS proteins, factor IX, factor VII, factor VIII, factor X, and factor XIII, FAS ligand inhibitor protein (DcR3), FasL, FasL, FasL, FGF, FGF-12; fibroblast growth factor homologous factor-1, FGF-15, FGF-16, FGF-18, FGF-3; INT-2, FGF-4; gelonin, HST-1; HBGF-4, FGF-5, FGF-6; heparin-binding secreted transforming factor-2, FGF-8, FGF-9; Glial activating factor, fibrinogen, flt-1, flt-3 ligand, follicle-stimulating hormone alpha subunit, follicle-stimulating hormone beta subunit, follitropin, fractalkine, fragmented myofibrillar protein troponin I, FSH, galactosidase, galectin-4, G-CSF, GDF-1, gene therapy agents, glioma-derived growth factor, glucagon, glucagon-like peptide, glucocerebrosidase, glucose oxidase, glucosidase , glycodelin-A; progesterone-related endometrial protein, GM-CSF, gonadotropin, granulocyte chemotactic protein 2 (GCP-2), granulocyte-macrophage colony-stimulating factor, growth hormone, growth-related oncogene alpha (GRO alpha), growth-related oncogene beta (GRO beta), growth-related oncogene gamma (GRO gamma), hAPO-4; TROY, hCG, hepatitis B surface antigen, hepatitis B vaccine, HER2 receptor Mab, hirudin, HIV gp120, HIVgp41, HIV inhibitory peptide, HIV inhibitory peptide, HIV inhibitory peptide, HIV protease inhibitor peptide, HIV-1 protease inhibitor, HPV vaccine, human 6CKine protein, human Act-2 protein, human adipogenesis inhibitory factor, human B-cell stimulatory factor 2 receptor, human beta-chemokine H1305 (MCP-2), human CC chemokine DGWCC, human CC chemokine ELC protein, human CC-type chemokine interleukin C, human CCC3 protein, human CCF18 chemokine, human CC-type chemokine protein name SLC (secondary lymphoid chemokine), short chain form of human chemokine beta-8, human chemokine C10, human chemokine CC-2, human chemokine CC-3, human chemokine CCR-2, human chemokine Ck beta-7, human chemokine ENA-78, human chemokine eotaxin, human Human chemokine GRO alpha, human chemokine GRO alpha, human chemokine GRO beta, human chemokine HCC-1, human chemokine HCC-1, human chemokine 1-309, human chemokine IP-10, human chemokine L105_3, human chemokine L105_7, human chemokine MIG, human chemokine MIG-beta protein, human chemokine MIP-1 alpha, human chemokine MIP1 beta , human chemokine MIP-3 alpha, human chemokine MIP-3 beta, human chemokine PF4, human chemokine protein 331D5, human chemokine protein 61164, human chemokine receptor CXCR3, human chemokine SDF1 alpha, human chemokine SDF1 beta, human chemokine ZSIG-35, human Chr19Kine protein, human CK beta-9, human CK beta-9, human CX3C 111 amino acid chemokine, human DNAX interleukin-40, human DVic-1 CC chemokine, human EDIRF I protein sequence, human EDIRFII protein sequence, human eosinophil CC-type chemokine eotaxin, human eosinophil-expressed chemokine (EEC), human fast-twitch skeletal muscle troponin C, human fast-twitch skeletal muscle troponin I, human fast-twitch skeletal muscle troponin subunit C, human fast-twitch skeletal muscle troponin subunit I protein, human fast-twitch skeletal muscle troponin subunit T, human fast-twitch skeletal muscle troponin T, human fetal spleen-expressed chemokine, FSEC, human GM-CSF receptor, human gro alpha chemokine, human gro beta chemokine, human gro gamma chemokine, human IL-16 protein, human IL-1RD10 protein sequence, human IL-1RD9, human IL-5 receptor alpha chain, human IL-6 receptor Human IL-8 receptor protein hIL8RA, human IL-8 receptor protein hIL8RB, human IL-9 receptor protein, human IL-9 receptor protein variant #3, human IL-9 receptor protein variant fragment, human IL-9 receptor protein variant fragment #3, human interleukin-1 delta, human interleukin-10, human interleukin-10, human interleukin-18, human interleukin-18 derivative, human interleukin-1 beta precursor, human interleukin-1 beta precursor, human interleukin-1 receptor accessory protein, human interleukin-1 receptor antagonist beta, human interleukin-1 type 3 receptor, human interleukin-10 (precursor), human interleukin-10 (precursor), human interleukin-11 receptor, human interleukin-12 40 kD subunit, human interleukin-12 beta-1 receptor, human interleukin-12 beta-2 receptor, human interleukin-12 p35 protein, human interleukin-12p40 protein, human interleukin-12 receptor, human interleukin-13 alpha receptor, human interleukin-13 beta receptor, human interleukin-15, human interleukin-15 receptor derived from P1 clone, human interleukin-17 receptor, human interleukin-18 protein (IL-18), human interleukin-3, human interleukin-3 receptor, human interleukin-3 variant, human interleukin-4 receptor, human interleukin-5, human interleukin-6, human interleukin-7, human interleukin-8 (IL-8), human intracellular IL-1 receptor antagonist, human IP-10, and HIV-1 gp120 hypervariable region fusion protein, human IP-10 and human Muc-1 core epitope (VNT) fusion protein, human liver- and activation-regulated chemokine (LARC), human Lkn-1 full-length and mature protein, human mammary gland-associated chemokine (MACK) full-length and mature protein, human mature chemokine Ck beta-7, human mature gro alpha, human mature gro gamma polypeptide for treating sepsis, human MCP-3 and human Muc-1 core epitope (VNT) fusion protein, human MI10 protein, human MI1A protein, human monocyte chemoattractant hMCP-1, human monocyte chemoattractant hMCP-3, human monocyte chemoattractant proprotein (MCPP) sequence, human neurotactin chemokine-like domain, human non-ELR CXC chemokine H174, human non-ELR CXC chemokine IP10, human non-ELRCXC chemokine Mig, human PAI-1 variant, human protein with IL-16 activity, human protein with IL-16 activity, human secondary lymphoid chemokine (SLC), human SISD protein, human STCP-1, human stromal cell-derived chemokine, SDF-1, human T-cell mixed lymphocyte reaction-expressed chemokine (TMEC), human thymus and activation-regulated cytokine (TARC), human thymus expression, human TNF-alpha, human TNF-alpha, human TNF-beta (LT-alpha), human CC-type chemokine eotaxin 3 protein sequence, human type II interleukin-1 receptor, human wild-type interleukin-4 (hIL-4) protein, human ZCHEMO-8 protein, humanized anti-VEGF antibodies and fragments thereof, humanized anti-VEGF antibodies and fragments thereof, hyaluronidase, ICE 10 kD subunit, ICE 20 kD subunit, ICE 22 kD subunit, iduronate-2-sulfatase, iduronidase, IL-1 alpha, IL-1 beta, IL-1 inhibitor (IL-1i), mature IL-1, IL-10 receptor, IL-11, IL-11, IL-12 p40 subunit, IL-13, IL-14, IL-15, IL-15 receptor, IL-17, IL-17 receptor, II-17 receptor, II-17 receptor, IL-19, IL-1i fragment, IL1-receptor antagonist, IL-21 (TIF), IL-3 containing fusion protein, IL-3 mutein, IL-3 variant, IL-3 variant, IL-4, IL-4 mutein, IL-4 mutein Y124G, IL-4 mutein Y124X, IL-4 mutein, II-5 receptor, IL-6, II-6 receptor, IL-7 receptor clone, IL-8 receptor, IL-9 mature protein variant (Met117 type), immunoglobulin or immunoglobulin-based molecule or a fragment of either (e.g., Small Modulus lar ImmunoPharmaceutical™ ("SMIP") or dAb, Fab' fragment, F(ab')2, scAb, scFv or scFv fragment), plasminogen, influenza vaccine, inhibin alpha, inhibin beta, insulin, insulin-like growth factor, integrin Mab, inter-alpha trypsin inhibitor, inter-alpha trypsin inhibitor, interferon gamma-inducing protein (IP-10), interferons (e.g., interferon alpha species and subspecies, interferon interferon beta species and subspecies, interferon gamma species and subspecies), interferons (e.g., interferon alpha species and subspecies, interferon beta species and subspecies, interferon gamma species and subspecies), interleukin 6, interleukin 8 (IL-8) receptor, interleukin 8 receptor B, interleukin-1 alpha, interleukin-2 receptor-related protein p43, interleukin-3, interleukin-4 muteins, interleukin-8 (IL-8) protein, interleukin-9, interleukin Interleukin-9 (IL-9) mature protein (Thr117 type), interleukins (e.g., IL0, IL11, and IL2), interleukins (e.g., IL0, IL11, and IL2), Japanese encephalitis vaccine, kallikrein inhibitors, keratinocyte growth factors, Kunitz domain proteins (e.g., aprotinin, amyloid precursor protein, and those described in WO 03 / 066824, with or without albumin fusion), Kunitz domain proteins, protinin, amyloid precursor protein with or without albumin fusion , LACI, lactoferrin, latent TGF-beta binding protein II, leptin, liver-expressed chemokine-1 (LVEC-1), liver-expressed chemokine-2 (LVEC-2), LT-alpha, LT-beta, luteinizing hormone, Lyme vaccine, lymphotactin, macrophage-derived chemokine analog MDC(n+1), macrophage-derived chemokine analog MDC-eyfy, macrophage-derived chemokine analog MDC-yl, macrophage-derived chemokine MDC, macrophage-derived chemokine (MDC), maspin;Protease inhibitor 5, MCP-1 receptor, MCP-1a, MCP-1b, MCP-3, MCP-4 receptor, M-CSF, melanoma inhibitory protein, membrane-associated protein, Met117 human interleukin-9, MIP-3 alpha, MIP-3 beta, MIP-gamma, MIRAP, modified Rantes, monoclonal antibody, MP52, mutant interleukin-6 S176R, myofibrillar contractile protein troponin I, natriuretic peptide, nerve growth factor-beta, nerve growth factor-beta2, neuropilin-1, neuropilin-2, neurotactin, neurotrophin-3, neurotrophin-4, neurotrophin-4a, neurotrophin-4b, neurotrophin-4c, neurotrophin-4d, neutrophil-activating peptide-2 (NAP-2), NOGO-66 receptor, NOGO-A, NOGO-B, NOGO-C, novel beta-chemokine named PTEC, N-terminally modified chemokine GroHEK / hSDF-1alpha, N-terminally modified chemokine GroHEK / hS DF-1beta, N-terminally modified chemokine met-hSDF-1alpha, N-terminally modified chemokine met-hSDF-1beta, OPGL, bone morphogenetic protein-1; OP-1; BMP-7, bone morphogenetic protein-2, OX40; ACT-4, OX40L, oxytocin (neurophysin I), parathyroid hormone, Patched, Patched-2, PDGF-D, pertussis toxoid, pituitary-expressed chemokine (PGEC), placental growth factor, placental growth factor-2, plasminogen activator inhibitor-1; PAI-1, plasminogen activator inhibitor-2; PAI-2, plasminogen activator inhibitor-2;PAI-2, platelet-derived growth factor, platelet-derived growth factor Bv-sis, platelet-derived growth factor precursor A, platelet-derived growth factor precursor B, platelet MAb, platelet-derived endothelial cell growth factor (PD-ECGF), platelet-derived growth factor A chain, platelet-derived growth factor B chain, sepsis therapeutic polypeptide, preproapolipoprotein "Milano" variant, preproapolipoprotein "Paris" variant, prethrombin, primate CC chemokine "ILINCK", primate CXC chemokine "IBICK", proinsulin, prolactin, prolactin 2, prosaptide, protease inhibitor peptide, protein C, protein S, prothrombin, prourokinase, RANTES, RANTES 8-68, RANTES 9-68, RANTES peptide, RANTES receptor, recombinant interleukin-16, resistin, restrictocin, retroviral protease inhibitor, ricin, rotavirus vaccine, RSV Mab, saporin, sarcin, secreted and transmembrane polypeptides, secreted and transmembrane polypeptides, serum cholinesterase, serum protein, blood coagulation factor, soluble BMP receptor kinase protein-3, soluble VEGF receptor, stem cell inhibitor, staphylococcus vaccine, stromal-derived factor-1 alpha, stromal-derived factor-1 beta, substance P (tachykinin), T1249 peptide, T20 peptide, T4 endonuclease, TACI, Tarc, TGF -beta1, TGF-beta2, Thr117 human interleukin 9, thrombin, thrombopoietin, thrombopoietin derivative 1, thrombopoietin derivative 2, thrombopoietin derivative 3, thrombopoietin derivative 4, thrombopoietin derivative 5, thrombopoietin derivative 6, thrombopoietin derivative 7, thymus-expressed chemokine (TECK), thyroid-stimulating hormone, tick anticoagulant peptide, Tim-1 protein, TNF-alpha precursor, TNF-R, TNF-RII; TNF p75 receptor;Death receptor, tPA, transferrin, transforming growth factor beta, troponin peptide, truncated monocyte chemotactic protein 2(6-76), truncated monocyte chemotactic protein 2(6-76), truncated RANTES protein(3-68), tumor necrosis factor, urate oxidase, urokinase, vasopressin (neurophysin II), VEGF R-3; flt-4, VEGF receptor; KDR; flk-1, VEGF-110, VEGF-121, VEGF-138, VEGF-145, VEGF-162, VEGF-165, VEGF-182, VEGF-189, VEGF-206, VEGF-D, VEGF-E; VEGF-X, von Willebrand factor, wild-type monocyte chemotactic protein 2, wild-type monocyte chemotactic protein 2, ZTGF-beta9, beta; (T87Q) -globin, SMN1, chimeric antigen receptor, RPE65, F8, HGF, LPL, p53, apoe2, arylsulfatase A, NAGLU, SGSH, AADC, GAD, GDNF, NRTN, LCAT, GBA, FGF-1, FGF-2, ADA, CLN2, CLN6, CLN3, IDS, huntingtin, TRAIL, dystrophin, GALGT2, accA, IDUA, GLB1, FS344, SGCA, DYSF, ABCD1, gigaxonin, and functional fragments thereof.
[0087] The polynucleotide of the present invention may be a polynucleotide in which the sugar residue (e.g., ribose) of each nucleotide is modified (although modifications to RNA are described herein, the description may be appropriately read as a description of modifications to DNA). Examples of modifications of sugar residues include substitution of the hydroxyl group at the 2', 3', and / or 4' position of the sugar residue with another atom. Examples of such modifications include fluorination, alkoxylation (e.g., methoxylation, ethoxylation), O-arylation, S-alkylation (e.g., S-methylation, S-ethylation), S-arylation, and amination (e.g., -NH2). Such alterations of sugar residues can be carried out by methods known per se (see, for example, Sproat et al. (1991) Nucl. Acid. Res. 19, 733-738; Cotton et al. (1991) Nucl. Acid. Res. 19, 2629-2635; Hobbs et al. (1973) Biochemistry 12, 5138-5145).
[0088] The sugar residue may also be a BNA (bridged nucleic acid) (LNA: linked nucleic acid), where the bridged structure is formed at the 2' and 4' positions. Such changes in sugar residues can be carried out by known methods (e.g., Tetrahedron Lett., 38, 8735-8738 (1997); Tetrahedron, 59, 5123-5128 (2003); Rahman SMA, Seki S, Obika S, Yoshikawa H, Miyashita K, Imanishi T, J. Am. Chem. Soc., 130, 4886-4896 (2008), etc.).
[0089] Polynucleotides of the invention may also have altered (e.g., chemically substituted) nucleobases (e.g., purines or pyrimidines). Examples of such alterations include altering a pyrimidine at position 5, altering a purine at position 6 and / or 8, altering with an exocyclic amine, substitution with 4-thiouridine, and substitution with 5-bromo- or 5-iodo-uracil.
[0090] In addition, the phosphate groups contained in the polynucleotides of the present invention can be altered to confer resistance to nucleases and hydrolysis. For example, the P(O)O group as a phosphate group can be replaced with P(O)S (thioacid), P(S)S (dithioacid), P(O)NR2 (amidoacid), P(O)R, R(O)OR', CO or CH2 (formacetal), or 3'-amine (-NH-CH2-CH2-), where each R or R' unit is independently H or substituted or unsubstituted alkyl (e.g., methyl, ethyl).
[0091] <Vector> The present invention also relates to an RNA or DNA vector comprising the RNA aptamer of the present invention or a DNA sequence transcribable into the RNA aptamer of the present invention. The RNA vector, for example, comprises the RNA aptamer of the present invention. The DNA vector, for example, comprises the DNA sequence transcribable into the RNA aptamer of the present invention.
[0092] The present invention also relates to RNA or DNA vectors comprising a riboswitch of the invention or a DNA sequence that can be transcribed into a riboswitch of the invention. An RNA vector, for example, comprises a riboswitch of the invention. A DNA vector, for example, comprises a DNA sequence that can be transcribed into a riboswitch of the invention.
[0093] The invention also relates to RNA or DNA vectors that contain a riboswitch of the invention or a DNA sequence that can be transcribed into a riboswitch of the invention and a target sequence operably linked to the riboswitch or DNA sequence. An RNA vector, for example, contains a riboswitch of the invention and a target sequence operably linked to the riboswitch. A DNA vector, for example, contains a DNA sequence that can be transcribed into a riboswitch of the invention and a target sequence operably linked to the DNA sequence.
[0094] The present invention also relates to RNA or DNA vectors comprising the polynucleotides of the present invention. The RNA vectors comprise, for example, a polynucleotide comprising a riboswitch comprising an RNA aptamer capable of binding to ASP7967 or an analog thereof and a target sequence encoding a protein, where the riboswitch is operably linked to the target sequence such that expression of the protein is up- or down-regulated in response to ASP7967 or an analog thereof. The DNA vectors comprise, for example, a DNA sequence transcribable into a polynucleotide comprising a riboswitch comprising an RNA aptamer capable of binding to ASP7967 or an analog thereof and a target sequence encoding a protein, where the riboswitch is operably linked to the target sequence such that expression of the protein is up- or down-regulated in response to ASP7967 or an analog thereof.
[0095] In the present invention, examples of vectors include, but are not limited to, plasmids, viral vectors, cosmids, artificial chromosomes, and phagemids. A vector may be a vector that can replicate in a host cell and can be further characterized by one or more endonuclease restriction enzyme recognition sites into which the vector can be cleaved and into which a desired nucleic acid sequence can be inserted. A vector may contain one or more marker sequences suitable for use in identifying and / or selecting cells that have been transformed or genomically modified by the vector or have not been cleaved.
[0096] In the present invention, a vector can further comprise additional nucleic acid elements, including nucleic acid regions or segments, that provide for replication of the vector in a cell and appropriate levels of expression of an aptamer, riboswitch, or polynucleotide of the invention in that cell. Those skilled in the art will understand that expression control sequences (promoters, enhancers, etc.) are selected based on their ability to promote their expression in the cell.
[0097] In the present invention, preferably, a viral vector may be used, examples of which include, but are not limited to, adenovirus (AV) vectors, adeno-associated virus (AAV) vectors, retrovirus vectors, lentivirus vectors, herpes simplex type 1 (HSV1) vectors, and vesicular stomatitis virus (VSV) vectors.
[0098] In the present invention, polynucleotides and vectors can be introduced into cells using viral or non-viral vector systems. Non-viral vector systems can use, for example, cationic lipids, polymers, or both as carriers. Conjugated poly-L-lysine (PLL) and polyethyleneimine (PEI) polymer systems can also be used to deliver polynucleotides or vectors into cells. Other methods for delivering polynucleotides or vectors into cells include hydrodynamic injection, electroporation, and ultrasound. For a review of viral and non-viral delivery systems for gene delivery, see Nayerossadat, N. et al. (Adv Biomed Res. 2012; 1:27; incorporated herein by reference).
[0099] <Kit> A kit for regulating the expression of a protein of the present invention comprises ASP7967 or an analog thereof and a polynucleotide of the present invention or a vector containing a polynucleotide of the present invention. Since the polynucleotide of the present invention can be used to regulate (up-regulate or down-regulate) the expression of a specific protein in response to ASP7967 or an analog thereof, the kit of the present invention can be used to regulate the expression of a specific protein encoded by a target sequence in the polynucleotide of the present invention.
[0100] As described above, ASP2905 (an analog of ASP7967) is a potent and selective inhibitor of the potassium channel Kv12.2, which is encoded by the Kcnh3 / BEC1 gene, and is capable of crossing the blood-brain barrier and has antipsychotic activity. Therefore, the kit of the present invention can be used to treat, for example, a disease, preferably a central nervous system disease, cognitive impairment, or KCNH3-related disease, more preferably ADHD, Parkinson's disease, Alzheimer's disease, or schizophrenia.
[0101] In the present invention, the protein encoded by the target sequence may be a protein used in therapy. In this case, the kit of the present invention can be used to treat any disease for which the protein encoded by the target sequence has a therapeutic effect. Examples of such proteins encoded by target sequences are described above in the section on polynucleotides of the present invention.
[0102] The kit of the present invention may further contain any component other than ASP7967 or an analog thereof, the polynucleotide of the present invention, and the vector containing the polynucleotide of the present invention, as necessary.
[0103] Methods for Regulating Protein Expression In Vivo The method of the present invention for modulating protein expression in vivo comprises (1) introducing a polynucleotide of the present invention or a vector comprising a polynucleotide of the present invention into a cell, and (2) contacting ASP7967 or an analog thereof with the polynucleotide or vector. This method allows for modulation of intracellular expression of a protein encoded by a target sequence on a polynucleotide of the present invention such that protein expression is up-regulated or down-regulated only when the polynucleotide or vector is contacted with ASP7967 or an analog thereof.
[0104] <Method for treating or preventing a disease> The method of the present invention for treating or preventing a disease comprises (1) introducing a polynucleotide of the present invention or a vector comprising the polynucleotide of the present invention into a subject, and (2) administering ASP7967 or an analog thereof to the subject. In this method, the disease can be treated or prevented by the properties of the protein encoded by ASP7967 or an analog thereof and / or the target sequence on the polynucleotide of the present invention. For example, the disease to be treated or prevented by this method includes a central nervous system disease, a cognitive disorder, or a KCNH3-related disease, preferably ADHD, Parkinson's disease, Alzheimer's disease, or schizophrenia. Here, "KCNH3-related disease" refers to a disease caused by an increase or decrease in expression or an alteration of the function of KCNH3 (BEC1). KCNH3 is a KCNH3-related protein that is preferentially distributed in the forebrain and has a restricted expression distribution in the brain. + It is a member of the channel superfamily. Its expression is prominent in the hippocampus and cerebral cortex. In addition, the hippocampus and cerebral cortex are strongly suggested to be associated with memory and learning. Therefore, "KCNH3-related diseases" include diseases associated with cognitive decline, including decline in memory and learning.
[0105] In the methods of the present invention for treating or preventing a disease, a polynucleotide of the present invention or a vector comprising a polynucleotide of the present invention is introduced into a subject, e.g., into cells of a specific tissue or organ of the subject, using methods known in the art, e.g., by using known viral or non-viral vector systems. Known methods for introducing polynucleotides or vectors can be used in the methods. Cell specificity can be controlled, for example, by a promoter or other elements within the vector.
[0106] Due to the properties of the polynucleotides of the present invention, the expression of proteins encoded by target sequences on the polynucleotides of the present invention can be modulated by administering ASP7967 or an analog thereof to a subject, where examples of proteins encoded by target sequences are described above in the section on polynucleotides of the present invention.
[0107] Delivery of the polynucleotide or vector containing the target sequence and delivery of the ligand, i.e., ASP7967 or its analog, are generally separated in time. Delivery of the ligand controls when the target gene is expressed and the level of protein expression. The ligand can be delivered by several routes, including, but not limited to, oral, intramuscular (IM), intravenous (IV), intraocular, or topical.
[0108] The timing of ligand delivery depends on the requirement for activation or inactivation of the protein encoded by the target sequence. For example, if the protein encoded by the target sequence is continuously required in therapy, the ligand can be delivered once a day or multiple times a day to ensure continuous activation or inactivation of the protein. If the protein has long-acting properties, the frequency of ligand delivery can be reduced.
[0109] Methods for Treating Disease in Gene Therapy Subjects The above-mentioned methods for treating or preventing a disease can be applied to a subject who has undergone gene therapy. Accordingly, the present invention relates to a method for treating a disease, comprising (2') administering ASP7967 or an analog thereof to a subject who has undergone gene therapy with a vector comprising the polynucleotide of the present invention. Since the method of the present invention is applied to a subject who has undergone gene therapy with a vector comprising the polynucleotide of the present invention, (1) introducing the polynucleotide of the present invention or the vector comprising the polynucleotide of the present invention into the subject is optional.
[0110] In the methods of the present invention, a subject undergoes gene therapy with a vector comprising a polynucleotide of the present invention, for example, using known gene therapy techniques. Here, "gene therapy" generally refers to the introduction of a heterologous nucleic acid into a subject with a disorder or condition seeking such therapy, for example, into cells of a specific tissue or organ of the subject. In the present invention, a vector comprising a polynucleotide of the present invention is introduced into cells in such a way that a polypeptide of the present invention is continuously or transiently expressed. Here, examples of proteins encoded by target sequences within the polynucleotides of the present invention are described above in the section on polynucleotides of the present invention. [Example]
[0111] Materials and Methods 1. Aptamer selection (SELEX) 1.1. Ligand-Coupled Sepharose Matrix Overview All chemicals and solvents (including anhydrous DMF and anhydrous dioxane) were purchased from commercial sources and used without further purification. The intermediate compound (2) shown in Scheme 1 was obtained from BioFine. Thin-layer chromatography (TLC) was performed on silica gel plates precoated with a fluorescent indicator and visualized by UV light (254 nm). Silica gel (45-75 μm) was used for column chromatography. 1 H NMR spectra were recorded on a 400 MHz Bruker or 600 MHz JEOL NMR instrument. Chemical shifts (δ) in parts per million are 1 H NMR and 13 In the C NMR spectrum, the residual proton signal (2.50 ppm) and carbon signal (39.5 ppm) of DMSO-d6 were used as references. 1 H NMR spin coupling multiplicities are reported as s (singlet), br s (broad singlet), and d (doublet). Apparent coupling constant (J) values are reported in Hz. High-resolution mass spectrometry (HRMS) data were obtained using positive ion electrospray ionization (ESI) mode.
[0112] [ka]
[0113] 1.1.2. Synthesis of Compound 3 Compound 1 in anhydrous DMF (0.8ml) 1 To a stirred solution of 2 (61 mg, 0.30 mmol) and 2 (80 mg, 0.24 mmol), DIPEA (209 μL, 1.2 mmol) was added under a N atmosphere. The resulting reaction mixture was heated to 75 °C for 19 h. The reaction mixture was then cooled to room temperature and subjected to column chromatography purification (35–80% ethyl acetate in hexanes) to isolate the newly formed product (78 mg, 70%). The resulting compound (50 mg, 0.107 mmol) was dissolved in methanol (3 mL), to which a solution of LiOH·HO (55 mg, 1.31 mmol in 0.6 mL of water) was added and stirred for 2 days. The volatiles were removed, and water (2 mL) was added to the resulting solution. The pH was adjusted to approximately 7–8 with 2 N HCl. The formed precipitate was filtered, and the residue was washed with water, followed by acetone and diethyl ether to yield the desired compound 3 (32 mg, 66%).
[0114] 1 H NMR (400 MHz, DMSO-d6): 1 H NMR (400 MHz, DMSO-d6) δ 9.17 (s, 2 H), 9.11 (br s, 2 H), 7.79 - 7.55 (m, 5 H), 6.99 - 7.12 (m, 4H), 4.76 (d, J = 5.2 Hz, 2H); 13 C NMR (150 MHz, DMSO-d6): δ 170.7, 165.8, 165.0, 163.9, 158.0, 157.3 (J = 238.5 Hz), 136.4, 121.5, 114.8 (J = 21.0 Hz), 114.5, 46.3; 19 F NMR (376 MHz, DMSO-d6) δ -121.7; HRMS (m / z): [M+H] + C 21 H17 F2N8O2 + Calculated value: 451.1437, measured value: 451.1435.
[0115] 1.1.3. Immobilization of Compound 3 on Sepharose beads EAH Sepharose 4B (Cytiva) containing a free amino group was coupled with compound 3 using PyBOP (benzotriazol-1-yl-oxy-tris-pyrrolidino-phosphonium hexafluorophosphate). Sepharose 4B (6 ml) was transferred to a 10 ml column (PD-10 Cytiva), and the ethanol solution was eluted. The matrix was washed twice with DMF (6 ml each). Compound 3 (6.2 mg, 13.76 μmol in 500 μL of anhydrous DMF), PyBOP (9.36 mg, 17.98 μmol in 500 μL of DMF), and DIPEA (5 μL, 28.7 μmol) were then added. The column containing the reaction mixture was placed on a shaker for 3 hours at 25°C. Unreacted compound was then eluted from the matrix. The matrix was washed with DMF (2 × 1 ml) and acetonitrile (2 × 6 ml). The unreacted free amino groups of the matrix were blocked with acetyl groups by treatment with Cap A solution (THF:lutidine:acetic anhydride [8:1:1]; 6 ml) for 30 minutes at 25°C. The solution was then drained from the matrix, which was washed with acetonitrile (3 x 6 ml). Finally, the matrix was stored in 50% methanol in water (6 ml) at 4°C. For negative selection, an acetylated matrix was similarly prepared by directly treating Sepharose 4B (6 ml) with Cap A solution.
[0116] 1.2. Oligonucleotides, Molecular Biology, and Buffer Reagents OneTaq 2x Master Mix Standard Buffer (NEB) and Q5 High-Fidelity 2x Master Mix (NEB) were used for PCR in the SELEX rounds and for preparation of NGS sequencing libraries, respectively. Reverse transcription reactions were performed using Superscript III Reverse Transcriptase (Thermo Scientific) with Rev primers (Table 1). The HiScribe T7 Quick High Yield RNA Synthesis Kit (NEB) was used for in vitro transcription of the initial RNA pool (700 μl) as well as for subsequent SELEX rounds (20 μl scale).
[0117] [Table 1]
[0118] SELEX buffer was used for refolding, washing, and elution, consisting of 10 mM HEPES-KOH (pH 7.4), 140 mM KCl, 10 mM NaCl, 1 mM MgCl, 5% (v / v) DMSO, and 0.01% (v / v) Tween 20. For elution only, the buffer was supplemented with 1 mM ASP7967.
[0119] 1.3. Aptamer Selection (SELEX) N40-T7Fwd (1 nmol) and N40-Rev-Lib (1 nmol; approximately 6 × 10 15Overlap extension of the nucleotides (Table 1) of the nucleotides (the unique sequences of the nucleotides) was carried out in a 1.0 ml volume containing 1x standard (Mg-free) reaction buffer, 2 mM MgCl2, 0.2 mM dNTPs, and Taq DNA polymerase (25 U, NEB) at 94°C for 2.5 min, 49°C for 30 s, and 68°C for 5.5 min. The dsDNA was then recovered by ethanol precipitation. T7 promoter-containing dsDNA (38 μg, approximately 0.57 nmol) was in vitro transcribed in a 700 μl volume at 37°C for 6 h using the HiScribe T7 Quick High Yield RNA Synthesis Kit (NEB). The solution was treated with 80 μl of 10x DNase I buffer and 20 μl of DNase I (40 U, NEB) for 45 min at 37°C. The RNA pool was extracted with phenol-chloroform and then recovered by ethanol precipitation to serve as the initial RNA pool for SELEX.
[0120] The initial RNA pool (115.8 μg, approximately 4.2 nmol) was folded by incubating in 1.2 ml of SELEX buffer (10 mM HEPES-KOH, pH 7.4, 140 mM KCl, 10 mM NaCl, 1 mM MgCl2, 5% (v / v) DMSO, 0.01% (v / v) Tween 20) at 80°C for 3 minutes and then chilling on ice. The annealed RNA library pool was then incubated with 200 μl of ligand-coupled Sepharose matrix in a column (PD-10, Cytiva) for 45 minutes at 25°C with shaking (Table 2). Unbound RNA was then removed from the column by gravity. The matrix was washed twice with SELEX buffer (1 + 0.4 ml), and the bound RNA sequences were recovered by adding 0.2 ml of SELEX buffer supplemented with ASP7967 (1 mM) after shaking for 30 minutes at 25°C. The elution was repeated once more. The eluted RNA was ethanol precipitated using Quick-Precip Plus Solution (EdgeBio). The progress of the SELEX experiment was monitored by measuring the absorbance (260 nm) of the recovered RNA (Table 3). The RNA pool was then reverse transcribed using SuperScript III Reverse Transcriptase (Thermo Fisher Scientific) with the Rev primer (Table 1) and amplified by PCR using the N40-T7Fwd primer and the Rev primer (Table 1) in OneTaq 2x Master Mix with Standard Buffer (NEB). The PCR product was used as a template for in vitro transcription, followed by DNase I treatment and ethanol precipitation to generate the RNA pool for the next round of SELEX. In subsequent SELEX rounds, the selection stringency was adjusted by changing various parameters, such as the amount of input RNA pool, temperature, volume of washing buffer, and elution time (Table 2).In the fourth round, negative selection was performed by incubating the input RNA pool with an acetyl-capped matrix (150–1000 μl) followed by incubation with a ligand-immobilized matrix to select for sequences with affinity to the gel matrix (Table 2). The RNA pools generated after rounds 7, 8, 9, and 10 were used to prepare libraries for deep sequencing analysis. RNA from each round was reverse transcribed (using a unique barcode sequence to identify the round) and individually amplified by PCR (using adapter sequences). The resulting sequencing libraries were pooled together and sequenced using the MiSeq Reagent Kit v3 (Illumina). Based on the enrichment efficiency of the final three SELEX rounds, 11 sequences were selected for ITC measurements (data not shown). R10-6 (5'-GGGAAGAGAAGGACAUAUGAUCAAGUGAGAGAGACGGAUUCCGUCCGCGAAUUCACGCUGCUUGACUAGUACAUGACCACUUGA-3' (SEQ ID NO: 31)) (Figure 2b) showed strong affinity by ITC (data not shown) and was therefore selected for further analysis.
[0121] [Table 2]
[0122] [Table 3]
[0123] 2. Affinity measurement by SPR The affinity measurement between aptamers and ligands by SPR was carried out with some modifications as described by Chang et al. 53The experiment was carried out as described in. Experiments were performed on a Biacore T200 (Cytiva) at 25°C. For immobilization of capture DNA (5'- / 5AmMC6 / TTTTTTTTTTTTTTTTTTTTTTTT-3' (SEQ ID NO: 32), / 5AmMC6 / :5' amino modifier C6, IDT), 1x HBS-N (10 mM HEPES, pH 7.4, 150 mM NaCl) was used as the running buffer. The CM5 chip surface was washed with two injections of NaOH / NaCl solution (25 mM NaOH, 1 M NaCl) at 20 μl / min for 30 seconds. A solution containing 200 mM 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) and 50 mM N-hydroxysuccinimide (NHS) was then injected into all flow cells at 10 μl / min for 7 min to activate the surface carboxylic acid groups. Capture DNA (20 μM) in 10 mM HEPES-KOH buffer (pH 7.5) supplemented with 0.6 mM cetyltrimethylammonium bromide was then injected at 5 μl / min for 10 min. Unreacted activated carboxylic acid groups were quenched by injecting 1 M ethanolamine-HCl (pH 8.5) at 10 μl / min for 7 min. To remove noncovalently adsorbed DNA on the chip surface, two 30-second injections of NaOH / NaCl solution were performed at 20 μl / min. The immobilized DNA level was 2846 ± 284 RU.
[0124] A dsDNA template for in vitro transcription of the aptamer was prepared by primer extension of two oligo DNAs using Q5 High-Fidelity DNA Polymerase (NEB). The AC17-4 RNA aptamer and its variants containing a 3' poly(A) tail (Table 4) were synthesized by in vitro transcription using the ScriptMAX Thermo T7 Transcription Kit (Toyobo Co., Ltd.) according to the manufacturer's instructions. The reaction product was treated with 2 U of TURBO DNase (Thermo Fisher Scientific) for 30 minutes at 37°C and purified using the RNA Clean & Concentrator-25 Kit (Zymo Research). The RNA concentration was determined by absorbance at 260 nm using OligoCalc. 54The RNA concentrations were determined according to the method described above. An RNA solution (approximately 3.6 μM) was prepared in water and denatured by heating at 80°C for 3 minutes. After cooling to room temperature for several minutes, the RNA solution was diluted with an equal volume of high-salt buffer (10 mM Tris-HCl, pH 7.5, 1 M NaCl, 1 mM EDTA). Stock solutions of ASP2905 and ASP7967 in DMSO (20 mM fumaric acid adduct, Astellas Pharma, Inc.) were prepared by weight. Ligand solutions of various concentrations were prepared in SPR running buffer (10 mM HEPES, pH 7.4, 150 mM NaCl, 0.05% (v / v) surfactant P-20, 1 mM MgCl2, 2% (v / v) DMSO). The RNA solution was injected at 10 μl / min for 30 seconds, followed by a 20-second injection of SPR running buffer. Association was monitored by injecting the aptamer ligand at 30 μl / min for 120 seconds, and dissociation kinetics were then monitored for 180 seconds in SPR running buffer. The sensor surface was regenerated by injecting 10 μl of 25 mM NaOH at 30 μl / min, followed by a 30-second injection of SPR running buffer. Raw data were analyzed using a 1:1 Langmuir interaction model with Biacore T200 Evaluation Software 1.0. The background signal of the reference flow cell was subtracted from the background signal of the sample flow cell, and a no-ligand sample (SPR running buffer only) was injected in each experiment (double referencing). The dissociation constant (K D ) is the ratio of the association rate constant to the dissociation rate constant (K D =k off / k on ) or by equilibrium analysis. Figures were generated using GraphPad Prism 9. Measurements were repeated at least twice to ensure reproducibility.
[0125] [Table 4]
[0126] 3. Affinity Measurement by ITC ITC experiments were performed as previously described with some modifications. 26Template DNA for in vitro transcription was prepared by primer extension using Q5 High-Fidelity DNA Polymerase. The AC17-4 RNA aptamer (5'-GCAAGUGAGAGAGACGGAUUCCGUCCGCGAAUUCACGCUGCUUGC-3' (SEQ ID NO: 50) was prepared using the HiScribe T7 High Yield RNA Synthesis Kit (NEB) according to the manufacturer's instructions. The transcript (100 μl) was treated with 2 U of TURBO DNase at 37°C for 30 minutes. The RNA was precipitated with ammonium acetate and ethanol and dissolved in water. The solution was further extracted with phenol-chloroform and then precipitated with ethanol. The RNA was purified by denaturing polyacrylamide gel electrophoresis (PAGE), and the main band was extracted from the gel using TE buffer (10 mM Tris-HCl, pH 7.0, 0.1 mM EDTA). The purified RNA was concentrated, and the buffer was filtered using an ultrafiltration device (Amicon Ultra The RNA was exchanged into nuclease-free water using a 0.5 ml 3 kDa aliquot (Merck-Millipore). RNA concentration was determined by absorbance at 260 nm according to OligoCalc. RNA was mixed with 15 μl of DMSO, diluted to 270 μl with nuclease-free water, denatured at 80°C for 3 minutes, and incubated at room temperature for 5 minutes. After adding 30 μl of 10x ITC buffer (0.2 M HEPES-KOH, pH 7.5, 1.4 M KCl, 0.1 M NaCl, 10 mM MgCl), a 7.5 μM RNA solution (300 μl) was incubated at room temperature for 30 minutes before measurement. A 75 μM ASP2905 solution was prepared in 5% (v / v) DMSO-1x ITC buffer immediately before measurement.
[0127] Titrations were performed at 37°C using a MicroCal PEAQ-ITC (Malvern). Injection parameters were as follows: an initial delay of 300 seconds, a single injection of 0.4 μl, and 24 consecutive injections of 1.5 μl at 120-second intervals. The stirring speed and reference power were set to 750 rpm and 5 μcal / s, respectively. Raw data were analyzed using a one-site binding model with MicroCal PEAQ-ITC analysis software version 1.0.0.1259. Control titrations (ASP2905 to buffer, buffer to AC17-4 RNA aptamer, buffer to buffer) were subtracted from sample measurements. Measurements were repeated twice to ensure reproducibility.
[0128] 4. Design and Construction of Riboswitch Plasmids The aptazyme sequences shown in Figures 6b, 8a, and 12 were cloned into the 3'UTR of the EGFP mRNA encoded by pEGFP-BsaI-Amp (Figure 13). The sequence is shown in Table 5. An exon-skipping riboswitch cassette was inserted between codons 169 and 170 of the EGFP coding sequence in pEGFP-BsaI-Amp. The complete plasmid sequence of ex169-AC17-4-a8 (pEGFP-ex-169-AC17-4-a8) is presented in Figure 14. Other variant sequences are listed in Table 6. pEGFP-BsaI-Amp was used as an "empty vector" control in transfection experiments.
[0129] [Table 5]
[0130] [Table 6]
[0131] 5. Riboswitch assay using HEK293 cells HEK293 cells were cultured in 2 mM L-glutamine and 100 units ml -1Cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% heat-inactivated FBS (Gibco) containing 10% penicillin-streptomycin (DMEM-FBS). Cells were maintained in a 37°C incubator with 5% CO2 and passaged periodically upon reaching 90% confluency. Approximately 20 hours prior to transfection, cells were trypsinized and cultured at approximately 2.7 x 10 5 cells ml -1 The cells were diluted to 100 μl per well and seeded onto a 96-well plate. Each well was then conjugated with 100 ng of EGFP aptazyme plasmid and pCMV-mCherry. 27 20 ng of the transfection control was co-transfected with 0.3 μl of TransIT-293 Transfection Reagent (Mirus) according to the manufacturer's instructions. Five hours after transfection, the medium in each well was replaced with fresh medium with or without ASP2905 or ASP7967 (up to 5 μM). The aptamer ligand was dissolved in DMSO at a concentration of 1000x. 48 hours after transfection, the medium in each well was replaced with 100 μl of phosphate-buffered saline (PBS), and fluorescence intensity was measured using an Infinite M1000 PRO microplate reader (Tecan). Fluorescence intensity was measured at excitation 484 nm / emission 510 nm / bandwidth 5 nm for EGFP and excitation 587 nm / emission 610 nm / bandwidth 10 nm for mCherry. Background fluorescence measured using untransfected cells was subtracted from EGFP and mCherry fluorescence values. EGFP fluorescence was then normalized by mCherry fluorescence to account for variations in transfection efficiency and cell number. All values reported are the average of three replicate wells.
[0132] 6. MTT Assay MTT assay was performed using the MTT Cell Count Kit (Nacalai Tesque). HEK293 cells were trypsinized and 2.4 × 10 5 cells ml -1The solutions were diluted to 0.05 mL and 100 μl was seeded per well onto a 96-well plate. Cells were cultured for 24 hours at 37°C under 5% CO2. The medium was replaced with fresh medium (DMEM-FBS supplemented with 0.1% (v / v) DMSO) containing 0, 2, 5, or 10 μM ASP2905 or ASP7967. Cells were cultured for an additional 18 hours at 37°C under 5% CO2. Subsequently, 10 μl of MTT solution was added to each well, and the cells were incubated for 3 hours at 37°C under 5% CO2. Then, 100 μl of solubilization solution was added to each well. The plates were incubated for 2 hours at 37°C to dissolve the precipitated formazan. Absorbance at 570 nm (reference wavelength: 700 nm) was measured using an Infinite M1000 PRO microplate reader (Tecan). Reported values are the average of four replicate wells. The assay was repeated three times to ensure reproducibility.
[0133] 7. In Vitro hEPO Assay For the hEPO ELISA assay in Figure 9b, HEK293 cells were trypsinized and 2.0 × 10 5 cells ml -1The cells were diluted to 100 μl per well and seeded onto a 96-well collagen plate. Each well was transfected with 100 ng of pAAV-MCS-based plasmids encoding human EPO with or without the pAAV-CMV-hEPO-p3-d, pAAV-CMV-hEPO-control, or CPP-a8c-AC17-4 riboswitch using 0.3 μl of TransIT-293 Transfection Reagent according to the manufacturer's instructions. Five hours after transfection, the medium in each well was replaced with fresh medium with or without ASP7967 (up to 10 μM). 24 hours after transfection, the medium from each well was collected and stored at -20°C. To measure hEPO concentrations, the medium was diluted 50-fold with PBS and then further diluted 50-fold with the sample dilution buffer provided in the ELISA kit. The diluted samples were measured using the Human Erythropoietin / EPO Quantikine ELISA Kit (R&D systems, Inc.) and an Infinite M200 PRO microplate reader (TECAN).
[0134] 8. In Vivo hEPO Assay For AAV production, 293T cells seeded on CellStack 5 (Corning) were co-transfected with 227.9 μg of a plasmid encoding the AAV8 replication and capsid proteins, 455.8 μg of a plasmid encoding the helper proteins, and 227.9 μg of pAAV-CMV-hEPO-a8c or -control using PEI MAX (Polysciences Inc.). Six days after transfection, cells and supernatants were harvested, filtered, and concentrated using a KrosFlo Research IIi (Spectrum Labs, Inc.), followed by affinity chromatography for AAV purification using an AKTA avant 25 (GE Healthcare). The virus solution was then ultracentrifuged and dialyzed. The titer of the AAV solution was determined by quantitative PCR using the AAVpro Titration Kit (for real-time PCR) Ver. 2 (Takara).
[0135] For in vivo animal experiments, 7-week-old male BALB / c cAJcl mice (CLEA Japan, Inc.) were injected with 200 μl of PBS (control group) or purified AAV8 particles (3.0 × 10 per mouse) carrying the hEPO gene with or without the CPP-a8c-AC17-4 riboswitch. 10 The viral genome (vg) was intravenously injected. Thirteen days after AAV injection, 24 μl of blood was collected from the tail vein of each mouse, and the blood sample was immediately diluted with 96 μl. 24 hours after blood collection, the mice were orally administered 100 mg / kg of ASP7967 in 0.5% methylcellulose (Fujifilm Wako Pure Chemical Industries, Ltd.) or 0.5% methylcellulose as a vehicle solution. Blood samples were collected as described above at 2, 4, 6, 8, and 24 hours after ASP7967 administration. The blood samples were incubated on ice and then centrifuged at 1,200 × g for 15 minutes at 4°C to collect serum samples. The serum samples were stored at -80°C and used to measure serum hEPO concentrations by ELISA.
[0136] All animal experimental procedures were approved by the Institutional Animal Care and Use Committee of Astellas Pharma Inc. Additionally, the Astellas Pharma Inc. Tsukuba Research Center is accredited by the Association for the Assessment and Accreditation of Laboratory Animal Care and Use International (AAALAC International).
[0137] <Result> 1. Aptamer Selection (SELEX) and Characterization Conventional SELEX requires immobilization of target molecules on a solid phase to which a pool of RNA containing randomized sequences is applied. We synthesized a carboxylic acid derivative of ASP7967 (3) that couples to amino-group-containing agarose beads (EAH Sepharose 4B). Approximately 6 × 10 15 Unique sequence of 37Starting with a random RNA pool containing 40 nucleotides with degenerate bases, we performed 10 rounds of affinity selection with increasing stringency (Table 2). The sequences enriched in the SELEX experiment were analyzed by high-throughput (Illumina) sequencing. After extensive screening of the enriched individual sequences after SELEX (data not shown), we identified the sixth most abundant sequence in the final pool (R10-6) as the most promising lead aptamer, with a putative binding motif containing a randomized region (Fig. 2b). The minimal binding motif, AC17-4 (Fig. 2b), was confirmed by surface plasmon resonance (SPR) to bind to both ASP2905 and ASP7967 with comparable affinity (Fig. 2c). AC17-4 exhibited K values of 7.7 nM and 12 nM for ASP2905 and ASP7967, respectively. D The binding of AC17-4 to ASP2905 and ASP7967 at 25°C was measured by isothermal titration calorimetry (ITC) and showed a K of 48 nM. D was obtained (Figure 3).
[0138] Mutational analysis of the AC17-4 aptamer was performed using SPR (Figures 4 and 5). The affinities of the mutants generally confirm the secondary structure depicted in Figure 4a. Single mutations at G2C, A3U, G4C, A5U, G6C, C20A, A30G, U34C, and U34G abolished or significantly impaired binding, suggesting that these nucleotides play important roles in aptamer structure or binding. The L2 and L4 loops are unlikely to be involved in aptamer-ligand or tertiary interactions, as they can be substituted for the canonical UUCG tetraloop (M12, M13) without loss of affinity. The putative base pair substitutions M9 and M11 negatively affected binding, raising several questions about these interactions. Further biochemical and structural investigations of aptamer-ligand interactions to improve affinity and riboswitch design strategies are currently underway.
[0139] 2. Mammalian Riboswitches The present inventors then sought to regulate gene expression in mammalian cells using AC17-4 and small molecule ligands. One of the most widely adopted strategies for regulating gene expression in mammalian cells based on aptamer-ligand interactions is to insert one or more allosteric self-cleaving ribozymes (aptazymes) into the untranslated region (UTR) of the mRNA encoding the gene of interest. 5、6 Self-cleavage of the ribozyme (activated or inhibited by aptamer-ligand interaction) leads to mRNA degradation and suppression of protein expression. 39 .
[0140] We recently developed the circularly permuted pistol (CPP) ribozyme as a scaffold for engineering aptazymes and riboswitches that function in mammalian cells. 27 The natural 5' and 3' ends of the natural pistol ribozyme structure are linked together. 40 The CPP was designed by generating a new terminus by cleaving the natural L3 loop (Fig. 6a, b). The base sequence of the pistol ribozyme (Fig. 6a) is as follows: 5'-CGUCGUCUGGGCGACGGUAAAUAGGUGUUAGGCCCAGAGCGGCAGGGUUCUUCCCUGCGUCACA-3' (SEQ ID NO: 66). We have shown that this scaffold can accommodate RNA aptamers at multiple positions to engineer functional riboswitches in mammalian cells. Here, we inserted the AC17-4 aptamer between the P2 and P1 stems of the linker with an anti-ribozyme (anti-Rz) sequence complementary to the ribozyme sequence downstream of the aptamer (Figure 6b). The principle of this aptazyme design is that the ribozyme is active in the absence of a ligand (gene expression OFF), but upon binding of the aptamer to the ligand, the anti-Rz binds to the base stem (P aptThis ligand-bound structure disrupts the ribozyme's folding, thereby inhibiting self-cleavage (gene expression ON) (Fig. 6b). We demonstrated that the ability of this switch can be tuned by adjusting the size of the anti-Rz.
[0141] As shown in Figure 6b, AC17-4 was inserted into the CPP scaffold. The anti-Rz sequence was varied from 6 to 10 nucleotides, and the aptazyme was inserted into the 3'UTR of the EGFP transcript. The base sequence shown in Figure 6b is as follows: 5'-CUCUAGACCCUGCGUCACAGCAGCAUGAGAGAGACGGAUUCCGUCCGCGAAUUCACGCUGCGUCGUCUGGGCGACGGUAAAUAGGUGUUAGGCCCAGAGCGGCAGGGUACAACU-3' (SEQ ID NO: 67) 5'-CUCUAGACCCUGCGUCACAGCAGCAGUGAGAGAGACGGAUUCCGUCCGCGAAUUCACGCUGCGUCGUCUGGGCGACGGUAAAUAGGUGUUAGGCCCAGAGCGGCAGGGUACAACU-3' (SEQ ID NO: 68) 5'-CUCUAGACCCUGCGUCACAGCAGCAGAUGAGAGAGACGGAUUCCGUCCGCGAAUUCACGCUGCGUCGUCUGGGCGACGGUAAAUAGGUGUUAGGCCCAGAGCGGCAGGGUACAACU-3' (SEQ ID NO: 69) 5'-CUCUAGACCCUGCGUCACAGCAGCAGACUGAGAGAGACGGAUUCCGUCGGCGAAUUCACGCUGCGUCGUCUGGGCGACGGUAAAUAGGUGUUAGGCCCAGAGCGGCAGGGUACAACU-3' (SEQ ID NO: 70) 5'-CUCUAGACCCUGCGUCACAGCAGCAGACCUGAGAGAGACGGAUUCCGUCGGCGAAUUCACGCUGCGUCGUCUGGGCGACGGUAAAUAGGUGUUAGGCCCAGAGCGGCAGGGUACAACU-3' (SEQ ID NO: 71) Here, in each base sequence, the EGFP sequence is linked to the 5' end and the polyA tail is linked to the 3' end.
[0142] An EGFP riboswitch plasmid and an mCherry expression plasmid (transfection control) were cotransfected into HEK293 cells in the absence or presence of ASP2905 or ASP7967 (5 μM). EGFP and mCherry fluorescence was measured 2 days after transfection, and EGFP fluorescence was normalized to mCherry fluorescence to account for variability in transfection efficiency. As expected, weak anti-Rz antibodies resulted in low EGFP levels, while strong anti-Rz antibodies resulted in elevated EGFP levels, regardless of the presence or absence of ligand. The optimal switch response was observed with an 8-nucleotide anti-Rz antibody (a8-AC17-4-CPP), which activated EGFP expression approximately 10-fold in the presence of ASP2905 or ASP7967 (Figure 6c). A significant deviation from this trend was the 7-nucleotide anti-Rz antibody (a7-AC17-4-CPP), which showed higher ON and OFF expression levels. We attribute this to the coincident complementarity of the nucleotides (CA) preceding the anti-Rz to the ribozyme sequence, which results in an effective anti-Rz sequence that is longer than intended. Nevertheless, semi-rational tuning of the anti-Rz length has proven to be an effective strategy for optimizing CPP aptazymes.
[0143] The riboswitch a8-AC17-4-CPP was further analyzed for its dose-dependent response to ASP7967 (Fig. 6d). The riboswitch response was nearly saturated at 5 μM ASP7967, with an EC of approximately 1.1 μM. 50 The ON level of fully induced a8-AC17-4-CPP was approximately 50% of that of the empty vector. 27 As can be seen, the ON and OFF levels and the ON / OFF ratio can be fine-tuned to some extent by modifying the design of the aptazyme sequence.
[0144] Growth of HEK293 cells was not significantly affected by ASP2905 or ASP7967 added to the culture medium at up to 10 μM ( FIG. 7 ), so we further explored the possibility of using riboswitches to chemically regulate gene expression in mice.
[0145] 3. Regulation of hEPO Expression in Mice To demonstrate riboswitch function in vivo, we sought to regulate hEPO expression in mice using an adeno-associated virus (AVV) vector. hEPO is commonly used to treat anemia associated with chronic kidney disease. 41 a8c-AC17-4-CPP represents a class of genes that could benefit from chemical modulation of their expression by gene therapy vectors. After preliminary screening of additional riboswitch variants (data not shown), we decided to use a8c-AC17-4-CPP for in vivo testing due to the low basal (OFF) expression levels of the riboswitch variants in HEK293 cells (Figure 8). The base sequence shown in Figure 8a is: 5'-CUCUAGACCCUGCGUCACAAAGAAAAGACGACGUGAGAGAGACGGAUUCCGUCCGCGAAUUCACGCUGCGUCGUCUGGGCGACGGUAAAUAGGUGUUAGGCCCAGAGCGGCAGGGUACAACU-3' (SEQ ID NO: 72), in which the EGFP sequence is linked to the 5' end and a polyA tail is linked to the 3' end.
[0146] Next, a8c-AC17-4-CPP was inserted into the 3'UTR region of the hEPO gene, which was expressed from the CMV promoter in a plasmid containing AAV2 inverted terminal repeats (ITRs) (pAAV-CMV-hEPO-a8c-AC17-4-CPP) (Figure 9a). The plasmid pAAV-CMV-hEPO-a8c-AC17-4-CPP was transfected into HEK293 cells in the absence or presence of ASP7967 (0.1-10 μM). Two days after transfection, the hEPO concentration in the culture medium was measured by ELISA. In the absence of ligand, hEPO secretion was attenuated to 2.8% compared to a control plasmid (pAAV-CMV-hEPO-control) that did not contain a riboswitch. As expected, in the presence of 10 μM ligand, hEPO levels in the medium reached 29% of control levels, corresponding to a 10-fold induction by ASP7967 (Figure (Figure9b). 5b). These results confirm that the riboswitch functions to regulate hEPO expression in the context of an AAV vector.
[0147] We then tested the efficacy and functionality of the riboswitch in vivo. We selected the liver as the target tissue because of the high concentration of ASP7967 in the liver after oral administration (Figure 10), and we selected AAV8 because of its strong liver tropism. Mice were intravenously injected with the viral vectors AAV8-CMV-hEPO-control, AAV8-CMV-hEPO-a8c-AC17-4-CPP, or saline (WT). Two weeks after AAV injection, a 100 mg / kg dose of ASP7967 was orally administered to induce expression by the riboswitch-regulated vector. Blood was collected at multiple time points before and after oral administration (Figure 9c). The secreted hEPO level in the serum of mice injected with the control AAV (AAV8-CMV-hEPO-control) was approximately 550 mIU / mL, and administration of a 100 mg / kg dose of the ligand had no effect during the observation period (Figure 9D, upper right). On the other hand, upon administration of a 100 mg / kg dose of the ligand, the hEPO secretion level induced by the riboswitch-regulated vector (AAV8-CMV-hEPO-a8c-AC17-4-CPP) reached approximately 115 mIU / mL 6 to 8 hours after administration, corresponding to a 7.2-fold increase over vehicle-administered mice (Figure 9D, lower left). Thereafter, serum hEPO levels declined in accordance with the corresponding decrease in ligand concentration in the liver (Figure 10).
[0148] The moderate ON / OFF ratio of our riboswitch, approximately 10, is typical of mammalian riboswitches. 5、6 Tight regulation of gene expression is desirable in many applications. 42We describe the mechanism of a riboswitch based on exon skipping induced by aptamer-ligand interaction. In this strategy, a suicide exon containing an internal stop codon sandwiched between two introns is inserted into the gene to be regulated (Figure 11a). The aptamer is placed immediately downstream of the 5' splice site (5'-ss) of the second intron. In the absence of a ligand, the suicide exon is included in the spliced transcript, resulting in the OFF state. The aptamer-ligand interaction induces a stable stem that shields the 5'-ss, triggering exon skipping and resulting in expression of the desired protein (Figure 11a). The key variable is the stability of the base aptamer stem (P1): if it is excessively unstable, the suicide exon is constitutively incorporated; however, if the P1 stem is excessively stable, the exon is always skipped.
[0149] We inserted an exon-skipping switch module between the 169th and 170th codons of EGFP. Various sizes of P1 stems revealed that an 8-bp stem (ex169-AC17-4-a8) resulted in robust activation of EGFP expression with an ON / OFF ratio of 114 (Figure 11b). To search for a riboswitch with a higher ON level, we screened variants with different P1 sequences and stabilities (data not shown). One such variant, ex169-AC17-4-a9+g2g7, exhibited approximately 75% EGFP expression in the presence of ASP7967 compared to the control, which had a lower ON / OFF ratio of 58. To further increase the ON / OFF ratio, the CPP-based aptazyme variants CPP-AC17-4-a9-P3-9d and CPP-AC17-4-a9-P3-9e (Figure 12) were inserted into the 3'UTR. The base sequences shown in Figure 12 are as follows: 5'-CUCUAGACCCUGCGUCACAUGAGAGAGACGGAUUCCGUCCGCGAAUUCACGCUGUGUGACACGUCGUCUGGGCGACGGUAAAUAGGUGUUAGGCCCAGAGCGGCAAGGUCUAACU-3' (SEQ ID NO: 73) 5'-CUCUAGACCCUGCGUCACAUGAGAGAGACGGAUUCCGUCCGCGAAUUCACGCUGUGUGACACGUCGUCUGGGCGACGGUAAAUAGGUGUUAGGCCCAGAGCGGCAGAGUCUAACU-3' (SEQ ID NO: 74) Here, in each base sequence, the EGFP sequence is linked to the 5' end and the polyA tail is linked to the 3' end.
[0150] The double exon skipping / aptazyme constructs a9+g2g7 / CPP-4a9-P3-9d and a9+g2g7 / CPP-4a9-P3-9e showed excellent ON / OFF ratios of 177 and 296, with ON levels of 64% and 52% of the control, respectively.
[0151] <Consideration> Synthetic riboswitches offer several advantages for mammalian applications, such as a lower risk of immunogenic complications and the small gene size of the constructs. 6 Although promising, several challenges remain before it can be widely adopted by researchers. Here, we sought to expand the scope of the repertoire of aptamer-ligand pairs available for constructing mammalian riboswitches. ASP2905 was originally developed as an inhibitor of voltage-gated potassium channel subfamily H member 3 (KCNH3) to test its effects on animal cognition. 35 This small molecule has been used in vitro in CHO cells stably expressing KCNH3 and in cultured rat hippocampal neurons. Oral administration of ASP2905 at doses up to 10 mg / kg has been reported in rats. 34Although the results have not been disclosed, ASP2905 has undergone Phase I clinical trials targeting Alzheimer's disease and schizophrenia (Annual Report 2010, Astellas, Inc., https: / / www.astellas.com / system / files / annual2010_en_0.pdf). ASP2905 is commercially available from multiple sources.
[0152] For better synthetic accessibility of 3 immobilized on agarose beads, we performed SELEX on ASP7967, which contains an additional fluorine atom in the pendant phenyl group of ASP2905. Large-scale screening of aptamer candidates enriched after 10 rounds of SELEX yielded AC17-4, which has a compact 35-nt core motif (Figure 2b). AC17-4 bound to ASP2905 and ASP7967 with similar affinity (Figure 2c). The binding mechanism of these compounds to aptamers remains unclear, but mutational analysis (Figure 4b) and structural studies may enable further refinement of the aptamer-ligand interaction. However, a notable advantage of RNA-based genetic devices, such as riboswitches, is that detailed structural information is not always required to engineer such devices. Here, we hypothesize that the putative P1 stem of AC17-4 (Fig. 4a) is stabilized upon ligand binding, as observed by other aptamers, and we have previously constructed guanine- and tetracycline-responsive riboswitches. 27 The CPP ribozyme scaffold used in
[0153] We discovered a8-AC17-4-CPP, which functions as an ON switch in response to ASP2905 and ASP7967. Gene expression in cultured mammalian cells was upregulated approximately 10-fold in the presence of 5 μM of the ligand (Figure 6c). Notably, most other aptamer ligands used for mammalian riboswitches require concentrations of 100 μM or greater in the culture medium to fully activate or repress gene expression. 16、20、33Moreover, the observed ON / OFF ratio is the largest among aptazyme-based mammalian ON switches reported to date. 12、16、18、20、21、23、26、27、30、43 However, the moderate baseline expression (OFF level) of these riboswitches largely precludes applications requiring tight gene regulation. 42 A recent patent disclosed by claims an outstanding ON / OFF ratio from a riboswitch based on an exon-skipping mechanism (Fig. 11a). We adapted this riboswitch structure to our AC17-4 aptamer and observed excellent switching properties, particularly at low baseline expression levels (Fig. 11b, c). Combining the exon-skipping switch with a CPP aptazyme further improved the ON / OFF ratio to 296. This level of switching ability should significantly expand its applicability.
[0154] We demonstrated that our riboswitch can regulate transgene expression in mice in response to oral administration of ASP7967. Oral administration of 100 mg / kg of ASP7967 upregulated serum hEPO concentrations by approximately 7.2-fold compared to vehicle control (Figure 9d). Because in vivo transgene expression levels depend on the pharmacokinetics of the ligand in target tissues, the pharmacokinetics of ASP7967 was evaluated to verify the relationship between target tissue concentration and efficacy. Transgene expression was found to decrease as the ligand concentration in the target tissue decreased (Figures 9d and 10). Furthermore, re-administration of the ligand reactivated hEPO (data not shown). Our riboswitch can stimulate transgene expression when the ligand is administered as needed, and transgene expression is stopped when the ligand is removed from plasma and target tissues. Therefore, riboswitch-regulated gene therapy vectors can be used to regulate transgenes, such as MeCP2. 44、45 , insulin 46、47 , and erythropoietin 48 It may be possible to reduce the side effects caused by overexpression of the ligand by appropriate administration of the ligand.
[0155] In addition to riboswitches based on small molecule aptamer binding, several chemically regulated riboswitches have recently been reported in mammalian cells and animal models. Monteys et al. used the small molecule drug LMI070 as a trigger to induce the incorporation of a synthetic exon in clinical trials for the treatment of spinal muscular atrophy (SMA). 49 This molecule functions by stabilizing U1 small nuclear RNA interactions near the splice site. The engineered switch was optimized to function at low LMI070 concentrations, where most endogenous splicing events are unaffected, but prolonged exposure to the compound may result in adverse events. Riboswitch molecules are also somewhat large, requiring 1.16 kbp and 560 bp for the largest and smallest modules, respectively. Furthermore, developing orthogonal switches that respond to additional molecules based on this strategy may be more challenging. Furthermore, aptamers, which are utilized to regulate gene expression by multiple distinct mechanisms, are also being used. 6 In contrast, the use of LMI070 is likely to be limited to systems based on the regulation of pre-mRNA splicing. Alternatively, morpholino oligonucleotides have been used to interfere with ribozyme cleavage to achieve high ON / OFF ratios. 50 However, one major challenge is the delivery of oligonucleotide effectors for in vivo applications. 51 .
[0156] The lack of small molecules and their aptamers that function efficiently in vivo or in clinical settings remains a major challenge in the biomedical application of synthetic riboswitches. 52 However, the development of new small molecule-aptamer pairs for applications in mammalian cells and animals has been scarce. This work represents such an effort, resulting in new mammalian riboswitches with improved properties. Further improvements in riboswitch performance (sensitivity to inducer molecules, ON / OFF ratio, etc.) may be possible through aptamer sequence optimization and / or chemical modification of ASP2905 / ASP7967.
[0157] <Cyclic replacement type AC17-4 (cpAC17-4)> Circularly permuted AC17-4 (cpAC17-4) was designed based on the AC17-4 aptamer (SEQ ID NO: 50). The nucleotide sequence of cpAC17-4 is shown below. 5'-GGUGUCCGCGAAUUCACGCUGCUUGUUCGCAAGUGAGAGAGACACC-3' (SEQ ID NO: 77)
[0158] The affinity of the cpAC17-4 aptamer to its ligand was measured by SPR as described above, using a synthesized cpAC17-4 RNA aptamer containing a 3' poly(A) tail. 5'-GGUGUCCGCGAAUUCACGCUGCUUGUUCGCAAGUGAGAGAGACACCAAAAAAAAAAAAAAAAAAAAAAAA-3' (SEQ ID NO: 82) Affinity measurements revealed that cpAC17-4 binds ASP2905 with a K of 30 nM. D It was decided to combine them.
[0159] The exon-skipping riboswitch cassettes containing the cpAC17-4 aptamer (ex169-cpAC17-4-a7, ex169-cpAC17-4-a8, and ex169-cpAC17-4-a9) were prepared by replacing the AC17-4 aptamer in the exon-skipping riboswitch cassettes (ex169-AC17-4-a7, ex169-AC17-4-a8, and ex169-AC17-4-a9; Table 6) with the cpAC17-4 aptamer (core sequence; SEQ ID NO: 83). The exon-skipping riboswitch cassettes were inserted between the 169th and 170th codons of the EGFP coding sequence of pEGFP-BsaI-Amp. 5'-CCGCGAATTCACGCTGCTTGTTCGCAAGTGAGAG-3' (SEQ ID NO: 83)
[0160] [Table 7]
[0161] Riboswitch assays for exon-skipping riboswitches carrying cassettes containing the cpAC17-4 aptamer were performed in the same manner as for ex169-AC17-4-a7, etc., as described above. These assays confirmed that cpAC17-4 functions similarly to AC17-4 as part of a riboswitch in HEK293 cells.
[0162] References 1. Buskirk, AR & Liu, DR Creating small-molecule-dependent switches to modulate biological functions. Chem. Biol. 12, 151-61 (2005). 2. Xie, M. & Fussenegger, M. Designing cell function: assembly of synthetic gene circuits for cell biology applications. Nat. Rev. Mol. Cell Biol. 19, 507-525 (2018). 3. Gossen, M. & Bujard, H. Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proc. Natl. Acad. Sci. USA 89, 5547-51 (1992). 4. Gossen, M. et al. Transcriptional activation by tetracyclines in mammalian cells. Science 268, 1766-9 (1995). 5. Auslander, S. & Fussenegger, M. Synthetic RNA-based switches for mammalian gene expression control. Curr. Opin. Biotechnol. 48, 54-60 (2017). 6. Yokobayashi, Y. Aptamer-based and aptazyme-based riboswitches in mammalian cells. Curr. Opin. Chem. Biol. 52, 72-78 (2019). 7. Panchapakesan, S.S.S. & Breaker, R.R. The case of the missing allosteric ribozymes. Nat. Chem. Biol. 17, 375-382 (2021). 8. Garst, A.D., Edwards, A.L. & Batey, R.T. Riboswitches: structures and mechanisms. Cold Spring Harb. Perspect. Biol. 3(2011). 9. Dunn, M.R., Jimenez, R.M. & Chaput, J.C. Analysis of aptamer discovery and technology. Nat. Rev. Chem. 1, 0076 (2017). 10. Berens, C., Groher, F. & Suess, B. RNA aptamers as genetic control devices: the potential of riboswitches as synthetic elements for regulating gene expression. Biotechnol. J. 10, 246-57 (2015). 11. Auslander, S., Ketzer, P. & Hartig, J.S. A ligand-dependent hammerhead ribozyme switch for controlling mammalian gene expression. Mol. Biosyst. 6, 807-14 (2010). 12. Chen, Y.Y., Jensen, M.C. & Smolke, C.D. Genetic control of mammalian T-cell proliferation with synthetic RNA regulatory systems. Proc. Natl. Acad. Sci. U. S. A. 107, 8531-6 (2010). 13. Ketzer, P., Haas, S.F., Engelhardt, S., Hartig, J.S. & Nettelbeck, D.M. Synthetic riboswitches for external regulation of genes transferred by replication-deficient and oncolytic adenoviruses. Nucleic Acids Res. 40, e167 (2012). 14. Nomura, Y., Zhou, L., Miu, A. & Yokobayashi, Y. Controlling mammalian gene expression by allosteric hepatitis delta virus ribozymes. ACS Synth. Biol. 2, 684-9 (2013). 15. Bell, C.L. et al. Control of alphavirus-based gene expression using engineered riboswitches. Virology 483, 302-11 (2015). 16. Xiang, J.S. et al. Massively parallel RNA device engineering in mammalian cells with RNA-Seq. Nat. Commun. 10, 4327 (2019). 17. Pu, Q. et al. Intracellular Selection of Theophylline-Sensitive Hammerhead Aptazyme. Mol. Ther. Nucleic Acids 20, 400-408 (2020). 18. Beilstein, K., Wittmann, A., Grez, M. & Suess, B. Conditional control of mammalian gene expression by tetracycline-dependent hammerhead ribozymes. ACS Synth. Biol. 4, 526-34 (2015). 19. Zhong, G., Wang, H., Bailey, C.C., Gao, G. & Farzan, M. Rational design of aptazyme riboswitches for efficient control of gene expression in mammalian cells. Elife 5(2016). 20. Strobel, B. et al. High-throughput identification of synthetic riboswitches by barcode-free amplicon-sequencing in human cells. Nat. Commun. 11, 714 (2020). 21. Strobel, B. et al. A Small-Molecule-Responsive Riboswitch Enables Conditional Induction of Viral Vector-Mediated Gene Expression in Mice. ACS Synth. Biol. 9, 1292-1305 (2020). 22. Lin, Y.H. & Chang, K.Y. Rational design of a synthetic mammalian riboswitch as a ligand-responsive -1 ribosomal frame-shifting stimulator. Nucleic Acids Res. 44, 9005-9015 (2016). 23. Dhamodharan, V., Nomura, Y., Dwidar, M. & Yokobayashi, Y. Optochemical control of gene expression by photocaged guanine and riboswitches. Chem. Commun. (Camb.) 54, 6181-6183 (2018). 24. Kim, N. & Yokobayashi, Y. Novel RNA Viral Vectors for Chemically Regulated Gene Expression in Embryonic Stem Cells. ACS Synth. Biol. 10, 2959-2967 (2021). 25. Kobori, S., Nomura, Y., Miu, A. & Yokobayashi, Y. High-throughput assay and engineering of self-cleaving ribozymes by sequencing. Nucleic Acids Res. 43, e85 (2015). 26. Mustafina, K., Fukunaga, K. & Yokobayashi, Y. Design of Mammalian ON-Riboswitches Based on Tandemly Fused Aptamer and Ribozyme. ACS Synth. Biol. 9, 19-25 (2020). 27. Mustafina, K., Nomura, Y., Rotrattanadumrong, R. & Yokobayashi, Y. Circularly-Permuted Pistol Ribozyme: A Synthetic Ribozyme Scaffold for Mammalian Riboswitches. ACS Synth. Biol. 10, 2040-2048 (2021). 28. Nomura, Y., Kumar, D. & Yokobayashi, Y. Synthetic mammalian riboswitches based on guanine aptazyme. Chem. Commun. (Camb.) 48, 7215-7 (2012). 29. Sporing, M., Boneberg, R. & Hartig, J.S. Aptamer-Mediated Control of Polyadenylation for Gene Expression Regulation in Mammalian Cells. ACS Synth. Biol. 9, 3008-3018 (2020). 30. Stifel, J., Sporing, M. & Hartig, J.S. Expanding the toolbox of synthetic riboswitches with guanine-dependent aptazymes. Synth. Biol. (Oxf.) 4, ysy022 (2019). 31. Strobel, B. et al. Riboswitch-mediated Attenuation of Transgene Cytotoxicity Increases Adeno-associated Virus Vector Yields in HEK-293 Cells. Mol. Ther. 23, 1582-91 (2015). 32. Takahashi, K. & Yokobayashi, Y. Reversible Gene Regulation in Mammalian Cells Using Riboswitch-Engineered Vesicular Stomatitis Virus Vector. ACS Synth. Biol. 8, 1976-1982 (2019). 33. Groher, F. et al. Riboswitching with ciprofloxacin-development and characterization of a novel RNA regulator. Nucleic Acids Res. 46, 2121-2132 (2018). 34. Takahashi, S., Ohmiya, M., Honda, S. & Ni, K. The KCNH3 inhibitor ASP2905 shows potential in the treatment of attention deficit / hyperactivity disorder. PLoS One 13, e0207750 (2018). 35. Takahashi, S. et al. Neurochemical and neuropharmacological characterization of ASP2905, a novel potent selective inhibitor of the potassium channel KCNH3. Eur. J. Pharmacol. 810, 26-35 (2017). 36. Takahashi, S., Okamura, A., Yamazaki, M. & Ni, K. ASP2905, a specific inhibitor of the potassium channel Kv12.2 encoded by the Kcnh3 gene, is psychoactive in mice. Behav. Brain Res. 378, 112315 (2020). 37. Dwidar, M. et al. Programmable Artificial Cells Using Histamine-Responsive Synthetic Riboswitch. J. Am. Chem. Soc. 141, 11103-11114 (2019). 38. Zuker, M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31, 3406-15 (2003). 39. Yen, L. et al. Exogenous control of mammalian gene expression through modulation of RNA self-cleavage. Nature 431, 471-6 (2004). 40. Weinberg, Z. et al. New classes of self-cleaving ribozymes revealed by comparative genomics analysis. Nat. Chem. Biol. 11, 606-10 (2015). 41. Hayat, A., Haria, D. & Salifu, M.O. Erythropoietin stimulating agents in the management of anemia of chronic kidney disease. Patient Prefer Adherence 2, 195-200 (2008). 42. Boyne, A.R., Danos, F.O., Volles, J.M. & Guo, X. Regulation of gene expression by aptamer-mediated modulation of alternative splicing. WO / 2016 / 126747 (2016). 43. Reid, C.A., Nettesheim, E.R., Connor, T.B. & Lipinski, D.M. Development of an inducible anti-VEGF rAAV gene therapy strategy for the treatment of wet AMD. Sci. Rep. 8, 11763 (2018). 44. Collins, A.L. et al. Mild overexpression of MeCP2 causes a progressive neurological disorder in mice. Hum. Mol. Genet. 13, 2679-89 (2004). 45. Gadalla, K.K.E. et al. Development of a Novel AAV Gene Therapy Cassette with Improved Safety Features and Efficacy in a Mouse Model of Rett Syndrome. Mol. Ther. Methods Clin. Dev. 5, 180-190 (2017). 46. Gan, S.U. et al. Correction of Murine Diabetic Hyperglycaemia With A Single Systemic Administration of An AAV2 / 8 Vector Containing A Novel Codon Optimized Human Insulin Gene. Curr. Gene Ther. 16, 65-72 (2016). 47. Thule, P.M. et al. Long-term glycemic control with hepatic insulin gene therapy in streptozotocin-diabetic mice. J. Gene Med. 17, 141-52 (2015). 48. Zhang, M. et al. Erythropoietin promotes abdominal aortic aneurysms in mice through angiogenesis and inflammatory infiltration. Sci. Transl. Med. 13, eaaz4959 (2021). 49. Monteys, A.M. et al. Regulated control of gene therapies by drug-induced splicing. Nature 596, 291-295 (2021). 50. Zhong, G. et al. A reversible RNA on-switch that controls gene expression of AAV-delivered therapeutics in vivo. Nat. Biotechnol. 38, 169-175 (2020). 51. Roberts, T.C., Langer, R. & Wood, M.J.A. Advances in oligonucleotide drug delivery. Nat. Rev. Drug Discov. 19, 673-694 (2020). 52. Tickner, Z.J. & Farzan, M. Riboswitches for Controlled Expression of Therapeutic Transgenes Delivered by Adeno-Associated Viral Vectors. Pharmaceuticals (Basel) 14, 554 (2021). 53. Chang, A.L., McKeague, M., Liang, J.C. & Smolke, C.D. Kinetic and equilibrium binding characterization of aptamers to small molecules using a label-free, sensitive, and scalable platform. Anal. Chem. 86, 3273-8 (2014). 54. Kibbe, W.A. OligoCalc: an online oligonucleotide properties calculator. Nucleic Acids Res. 35, W43-6 (2007). 55. Salado, I.G. et al. Optimization of the pharmacokinetic properties of potent anti-trypanosomal triazine derivatives. Eur. J. Med. Chem. 151, 18-26 (2018). 56. Dwidar, M. et al. Programmable Artificial Cells Using Histamine-Responsive Synthetic Riboswitch. J. Am. Chem. Soc. 141, 11103-11114 (2019).
Claims
1. An RNA aptamer that binds to ASP7967 or an analog thereof, having the sequence: -X 1 -L 1 -X 2 -L 2 -X 3 - (In the formula, X 1 is the array Y 1 GY 2 GY 3 Y 4 Y 5 and L 1 is a first stem-loop nucleotide sequence comprising a first stem region, a first loop region, and a second stem region, wherein the first stem region and the second stem region are at least two base pairs in length and are substantially complementary to each other; X 2 is A, G, C or U, L 2 is a second stem-loop nucleotide sequence comprising a third stem region, a second loop region, and a fourth stem region, wherein the third stem region and the fourth stem region are at least two base pairs in length and are substantially complementary to each other, the first base in the third stem region is G and the last base in the fourth stem region is C; X 3 is the array UY 6 and Y 1 , Y 2 , Y 3 , Y 4 , Y 5 , and Y 6 are each independently A, G, C, or U. contains, or array: -S 1 -X 2 -L 2 -X 3 -L 3 -X 1 -S 2 - (In the formula, S 1 and S 2 are each independently A, G, C, or U, and S 1 and S 2 are capable of forming base pairs or wobble base pairs with each other, L 3 is a third stem-loop nucleotide sequence comprising a fifth stem region, a third loop region, and a sixth stem region, wherein the fifth stem region and the sixth stem region are one or more base pairs in length and are substantially complementary to each other; X 1 , X 2 , X 3 , and L 2 is as defined above) contains, or array: -S 3 -X 3 -L 3 -X 1 -L 1 -X 2 -S 4 - (In the formula, S 3 is C and S 4 is G, X 1 , X 2 , X 3 , L 1 , and L 3 is as defined above) An RNA aptamer comprising:
2. Y 2 is selected from A or U; Y 3 is selected from A or U, and / or Y 4 The RNA aptamer of claim 1 , wherein is selected from G or C.
3. Y 2 But A, Y 3 is A, and / or Y 4 The RNA aptamer of claim 2, wherein is G.
4. Y 1 and Y 6 The RNA aptamer of claim 1, wherein the RNA aptamer is capable of forming base pairs or wobble base pairs with each other.
5. Y 1 is G and Y 6 is U, or Y 1 is U and Y 6 The RNA aptamer of claim 1, wherein is G.
6. The RNA aptamer of claim 1, wherein the first stem region and the second stem region are 3 to 7 base pairs in length and are substantially complementary to each other.
7. The RNA aptamer of claim 1 , wherein the first stem region and the second stem region are 5 base pairs in length and are substantially complementary to each other.
8. 2. The RNA aptamer of claim 1, wherein the first stem region has the sequence GACGG and the second stem region has the sequence CCGUC.
9. The RNA aptamer of claim 1, wherein the first loop region has 3 to 7 bases.
10. The RNA aptamer of claim 1 , wherein the first loop region has the sequence AUU or UUCG.
11. The RNA aptamer of claim 1, wherein the third stem region and the fourth stem region have 1 to 5 base pairs and are substantially complementary to each other.
12. The RNA aptamer of claim 1 , wherein the third stem region and the fourth stem region have 3 or 4 base pairs and are substantially complementary to each other.
13. the third stem region has the sequence GCG and the fourth stem region has the sequence CGC; or The RNA aptamer of claim 1 , wherein the third stem region has the sequence GCGU and the fourth stem region has the sequence ACGC.
14. The RNA aptamer of claim 1, wherein the second loop region has 3 to 7 bases.
15. The RNA aptamer of claim 1 , wherein the second loop region has the sequence AAUUCA or UUCG.
16. Sequence: -X 1 -L 1 -X 2 -L 2 -X 3 -, including X 1 the fifth stem region adjacent to the 5' end of X 3 The RNA aptamer of claim 1, further comprising a sixth stem region adjacent to the 3' end of said fifth stem region, wherein the fifth stem region and the sixth stem region have 1 to 15 base pairs and are substantially complementary to each other, and the fifth stem region and the sixth stem region form a double-stranded stem.
17. The RNA aptamer of claim 1, wherein the fifth stem region and the sixth stem region are 3 to 7 base pairs in length and are substantially complementary to each other.
18. The RNA aptamer of claim 1 , wherein the fifth stem region and the sixth stem region are four base pairs in length and are substantially complementary to each other.
19. The RNA aptamer of claim 1 , wherein the fifth stem region has the sequence CUUG and the sixth stem region has the sequence CAAG.
20. The RNA aptamer of claim 1, wherein the third loop region has 3 to 7 bases.
21. The RNA aptamer of claim 1 , wherein the third loop region has the sequence UUCG.
22. S 1 is C and S 2 is G, or S 1 is G and S 2 The RNA aptamer of claim 1, wherein is C.
23. Sequence: -S 1 -X 2 -L 2 -X 3 -L 3 -X 1 -S 2 -, S 1 The seventh stem region and S 2 The RNA aptamer of claim 1, further comprising an eighth stem region adjacent to the 3' end of the seventh stem region and the eighth stem region having 1 to 15 base pairs and being substantially complementary to each other, and the seventh stem region and the eighth stem region forming a double-stranded stem.
24. Sequence: -S 3 -X 3 -L 3 -X 1 -L 1 -X 2 -S 4 -, S 3 The ninth stem region and S 4 The RNA aptamer of claim 1, further comprising a tenth stem region adjacent to the 3' end of the ninth stem region and the tenth stem region, wherein the ninth stem region and the tenth stem region have 1 to 15 base pairs and are substantially complementary to each other, and the ninth stem region and the tenth stem region form a double-stranded stem.
25. The RNA aptamer of claim 1, which is of the circular permutation type.
26. The RNA aptamer of claim 1, wherein the analog of ASP7967 is ASP2905.
27. An RNA or DNA vector comprising the RNA aptamer of claim 1 or a DNA sequence that can be transcribed into the RNA aptamer of claim 1.
28. A riboswitch comprising the RNA aptamer of claim 1.
29. 30. An RNA or DNA vector comprising the riboswitch of claim 28 or a DNA sequence transcribable into the riboswitch of claim 28.
30. 30. The RNA or DNA vector of claim 29, further comprising a target sequence operably linked to the riboswitch or DNA sequence, wherein the target sequence encodes a protein, or the target sequence is either an siRNA, miRNA precursor, primary miRNA, sgRNA, lncRNA, RNA aptamer, ribozyme, tRNA, or rRNA, or a DNA sequence transcribable into an siRNA, miRNA precursor, primary miRNA, sgRNA, lncRNA, RNA aptamer, ribozyme, tRNA, or rRNA.
31. a riboswitch or a DNA sequence transcribable into a riboswitch, comprising an RNA aptamer capable of binding to ASP7967 or an analog thereof; a target sequence encoding a protein; 1. An isolated polynucleotide comprising: An isolated polynucleotide in which a riboswitch is operably linked to a target sequence such that expression of a protein is up-regulated or down-regulated in response to ASP7967 or an analog thereof.
32. 32. The polynucleotide of claim 31 , wherein the target sequence comprises multiple exons.
33. 33. The polynucleotide of claim 32, wherein the target sequence comprises an alternatively spliced exon sandwiched between a 5' intron and a 3' intron, the alternatively spliced exon comprising a stop codon that is in-frame with the protein when the alternatively spliced exon is spliced into the mRNA of the protein.
34. 32. The polynucleotide of claim 31, further comprising a 3'UTR comprising a polyadenylation signal sequence, wherein a riboswitch is inserted within the 3'UTR 5' to the polyadenylation signal sequence, and wherein the function of the polyadenylation signal sequence is regulated by the riboswitch.
35. 35. The polynucleotide of claim 34, wherein the riboswitch further comprises a self-cleaving ribozyme.
36. 36. The polynucleotide of claim 35, wherein the self-cleaving ribozyme is activated when the aptamer binds to ASP7967 or an analog thereof, or the self-cleaving ribozyme is inactivated when the aptamer binds to ASP7967 or an analog thereof.
37. A kit for regulating protein expression, comprising: ASP7967 or an analog thereof; A polynucleotide according to claim 31 or a vector comprising the polynucleotide according to claim 31. Includes a kit.
38. 38. The kit of claim 37 for treating a disease.
39. The disease is a central nervous system disease, cognitive impairment, or KCNH 3 39. The kit of claim 38, wherein the kit is a disease associated with a rheumatoid arthritis.
40. 40. The kit of claim 39, wherein the disease is ADHD, Parkinson's disease, Alzheimer's disease, or schizophrenia.
41. 1. A method for modulating protein expression in vivo, comprising: introducing into a cell the polynucleotide of claim 31 or a vector comprising the polynucleotide of claim 31; contacting ASP7967 or an analog thereof with said polynucleotide or said vector; A method comprising:
42. 1. A method for treating or preventing a disease, comprising: Introducing the polynucleotide of claim 31 or a vector comprising the polynucleotide of claim 31 into a subject; administering ASP7967 or an analog thereof to said subject; A method comprising:
43. The disease is a central nervous system disease, cognitive impairment, or KCNH 3 43. The method of claim 42, wherein the disease is an associated disease.
44. 44. The method of claim 43, wherein the disease is ADHD, Parkinson's disease, Alzheimer's disease or schizophrenia.
45. 1. A method for treating a disease, comprising: Administering ASP7967 or an analog thereof to a subject undergoing gene therapy with a vector comprising the polynucleotide of claim 31. A method comprising:
46. The target sequence is 4-1BB ligand, 5-helix, human C-C chemokine, human L105 chemokine, human L105 chemokine named huL105_3., gamma interferon-induced monokine (MIG), CXCR4B partial protein, platelet basic protein (PBP), α1-antitrypsin, ACRP-30 homolog; complement component C1q C, adenoid-expressed chemokine (ADEC), aFGF; FGF-1, AGF, AGF protein, albumin, etoposide, angiostatin, anthrax vaccine, antibody specific for collapsin, antistasin, anti-TGF beta family antibody, antithrombin III, APM-1; ACRP-30; famoxin, apolipoprotein species, arylsulfatase B, b57 protein, BCMA, beta-thromboglobulin protein (beta-TG ), bFGF; FGF2, blood coagulation factors, BMP processing enzyme furin, BMP-10, BMP-12, BMP-15, BMP-17, BMP-18, BMP-2B, BMP-4, BMP-5, BMP-6, BMP-9, bone morphogenetic protein-2, calcitonin, calpain-10a, calpain-10b, calpain-10c, cancer vaccines, carboxypeptidase, C-C chemokine, MCP2, CCR5 variant, CCR7, CCR7, CD11a Mab, CD137; 4-1BB receptor protein, CD20 Mab, CD27, CD27L, CD30, CD30 ligand, CD33 immunotoxin, CD40, CD40L, CD52Mab, cerebus proteins, chemokine eotaxin, chemokine hIL-8, chemokine hMCP1, chemokine hMCP1a, chemokine hMCP1b, chemokine hMCP2, chemokine hMCP3, chemokine hSDF1b, chemokine MCP-4, chemokine TECK and TECK variants, full-length and mature chemokine-like protein IL-8M1, full-length and mature chemokine-like protein IL-8M10, chemokine-like protein IL-8M3, full-length and mature chemokine-like protein IL-8M1 chemokine-like protein IL-8M8, full-length and mature chemokine-like protein IL-8M9, full-length and mature chemokine-like protein PF4-414, full-length and mature chemokine-like protein PF4-426, full-length and mature chemokine-like protein PF4-M2, cholera vaccine, chondromodulin-like proteins, c-kit ligand; SCF; mast cell growth factor; MGF; fibrosarcoma-derived stem cell factor, CNTF and its fragments, both precursor and activated forms of coagulation factors, collagen, complement C5 Mab, connective tissue activation protein III, CTAA16.88Mab, CTAP-III, CTLA4-Ig, CTLA-8, CXC3, CXC3, CXCR3; CXC chemokine receptor 3, cyanovirin N, darbepoetin, name Exodus, name huL105_7., DIL-40, DNase, EDAR, EGF receptor Mab, ENA-78, endostatin, eotaxin, epithelial neutrophil-activating protein-78, EPO receptor; EPOR, erythropoietin (EPO) and EPO mimetics, eutropin, Exodus protein, factor IX, factor VII, factor VIII, factor X, and factor XIII, FAS ligand inhibitory protein (DcR3), FasL , FasL, FasL, FGF, FGF-12; fibroblast growth factor homologous factor-1, FGF-15, FGF-16, FGF-18, FGF-3; INT-2, FGF-4; gelonin, HST-1; HBGF-4, FGF-5, FGF-6; heparin-binding secreted transforming factor-2, FGF-8, FGF-9; glial activating factor, fibrinogen, flt-1, flt-3 ligand, follicle-stimulating hormone alphasa subunit, follicle-stimulating hormone beta subunit, follitropin, fractalkine, fragmented myofibrillar protein troponin I, FSH, galactosidase, galectin-4, G-CSF, GDF-1, gene therapy agents, glioma-derived growth factor, glucagon, glucagon-like peptide, glucocerebrosidase, glucose oxidase, glucosidase, glycodelin-A; progesterone-related endometrial protein, GM-CSF, gonadotropins, granulocyte chemotactic protein 2 (GCP-2), granulocyte-macrophage colony-stimulating factor, growth hormone, growth-related oncogene alpha (GRO alpha), growth-related oncogene beta (GRO beta), growth-related oncogene gamma (GRO gamma), hAPO-4; TROY, hCG, hepatitis B surface antigen, hepatitis B vaccine, HER2 receptor Mab, hirudin, HIV gp120, HIVgp41, HIV inhibitory peptide, HIV inhibitory peptide, HIV inhibitory peptide, HIV protease inhibitor peptide, HIV-1 protease inhibitor, HPV vaccine, human 6CKine protein, human Act-2 protein, human adipogenesis inhibitory factor, human B-cell stimulatory factor 2 receptor, human beta-chemokine H1305 (MCP-2), human C-C chemokine DGWCC, human CC chemokine ELC protein, human Human CC-type chemokine interleukin C, human CCC3 protein, human CCF18 chemokine, human CC-type chemokine protein named SLC (secondary lymphoid chemokine), short chain form of human chemokine beta-8, human chemokine C10, human chemokine CC-2, human chemokine CC-3, human chemokine CCR-2, human chemokine Ck beta-7, human chemokine ENA-78, human chemokine eotaxin, Human chemokine GRO alpha, human chemokine GRO alpha, human chemokine GRO beta, human chemokine HCC-1, human chemokine HCC-1, human chemokine 1-309, human chemokine IP-10, human chemokine L105_3, human chemokine L105_7, human chemokine MIG, human chemokine MIG-beta protein, human chemokine MIP-1 alpha, human chemokine MIP1 beta , human chemokine MIP-3 alpha, human chemokine MIP-3 beta, human chemokine PF4, human chemokine protein 331D5, human chemokine protein 61164, human chemokine receptor CXCR3, human chemokine SDF1 alpha, human chemokine SDF1 beta, human chemokine ZSIG-35, human Chr19Kine protein, human CK beta-9, human CK beta-9, human CX3C 111 amino acid chemokine, human DNAX interleukin-40, human DVic-1 C-C chemokine, human EDIRF I protein sequence, human EDIRFII protein sequence, human eosinophil CC-type chemokine eotaxin, human eosinophil-expressed chemokine (EEC), human fast-twitch skeletal troponin C, human fast-twitch skeletal troponin I, human fast-twitch skeletal troponin subunit C, human fast-twitch skeletal troponin subunit I protein, human fast-twitch skeletal troponin subunit T, human fast-twitch skeletal troponin T, human fetal spleen-expressed chemokine, FSEC, human GM-CSF receptor, human gro alpha chemokine, human gro beta chemokine, human gro gamma chemokine, human IL-16 protein, human IL-1RD10 protein sequence, human IL-1RD9, human IL-5 receptor alpha chain, human IL-6 receptor human IL-8 receptor protein hIL8RA, human IL-8 receptor protein hIL8RB, human IL-9 receptor protein, human IL-9 receptor protein variant #3, human IL-9 receptor protein variant fragment, human IL-9 receptor protein variant fragment #3, human interleukin-1 delta, human interleukin-10, human interleukin-10, human interleukin-18, human interleukin-18 derivative, human interleukin-1 beta precursor, human interleukin-1 beta precursor, human interleukin-1 receptor accessory protein, human interleukin-1 receptor antagonist beta, human interleukin-1 type 3 receptor, human interleukin-10 (precursor), human interleukin-10 (precursor), human interleukin-11 receptor, human interleukin-12 40 kD subunit, human interleukin-12 beta-1 receptor, human interleukin-12 beta-2 receptor, human interleukin-12 p35 protein, human interleukin-12p40 protein, human interleukin-12 receptor, human interleukin-13 alpha receptor, human interleukin-13 beta receptor, human interleukin-15, P1 clone-derived human interleukin-15 receptor, human interleukin-17 receptor, human interleukin-18 protein (IL-18), human interleukin-3, human interleukin-3 receptor, human interleukin-3 variant, human interleukin-4 receptor, human interleukin-5, human interleukin-6, human interleukin-7, human interleukin-7, human interleukin-8 (IL-8), human intracellular IL-1 receptor antagonist, human IP-10, and HIV-1 gp120 hypervariable region fusion protein, human IP-10 and human Muc-1 core epitope (VNT) fusion protein, human liver and activation-regulated chemokine (LARC), human Lkn-1 full-length and mature protein, human mammary gland-associated chemokine (MACK) full-length and mature protein, human mature chemokine Ck beta-7, human mature gro alpha, human mature gro gamma polypeptide for treating sepsis, human MCP-3 and human Muc-1 core epitope (VNT) fusion protein, human MI10 protein, human MI1A protein, human monocyte chemoattractant hMCP-1, human monocyte chemoattractant hMCP-3, human monocyte chemoattractant proprotein (MCPP) sequence, human neurotactin chemokine-like domain, human non-ELR CXC chemokine H174, human non-ELR CXC chemokine IP10, human non-ELRCXC chemokine Mig, human PAI-1 variant, human protein with IL-16 activity, human protein with IL-16 activity, human secondary lymphoid chemokine (SLC), human SISD protein, human STCP-1, human stromal cell-derived chemokine, SDF-1, human T-cell mixed lymphocyte reaction-expressed chemokine (TMEC), human thymus- and activation-regulated cytokine (TARC), human thymus-expressed, human TNF-alpha, human TNF-alpha, human TNF-beta (LT-alpha), human CC-type chemokine eotaxin 3 protein sequence, human type II interleukin-1 receptor, human wild-type interleukin-4 (hIL-4) protein, human ZCHEMO-8 protein, humanized anti-VEGF antibodies and fragments thereof, humanized anti-VEGF antibodies and fragments thereof, hyaluronidase, ICE 10 kD subunit, ICE 20 kD subunit, ICE 22 kD subunit, iduronate-2-sulfatase, iduronidase, IL-1 alpha, IL-1 beta, IL-1 inhibitor (IL-1i), mature IL-1, IL-10 receptor, IL-11, IL-11, IL-12 p40 subunit, IL-13, IL-14, IL-15, IL-15 receptor, IL-17, IL-17 receptor, II-17 receptor, II-17 receptor, IL-19, IL-1i fragment, IL1-receptor antagonist, IL-21 (TIF), IL-3 containing fusion protein, IL-3 mutein, IL-3 variant, IL-3 variant, IL-4, IL-4 mutein, IL-4 mutein Y124G, IL-4 mutein Y124X, IL-4 mutein, II-5 receptor, IL-6, II-6 receptor, IL-7 receptor clone, IL-8 receptor, IL-9 mature protein variant (Met117 type), immunoglobulin or immunoglobulin-based molecule or a fragment of either (e.g., Small Modular ImmunoPharmaceutical™ ("SMIP") or dAb, Fab' fragment, F(ab')2, scAb, scFv or scFv fragment), plasminogen, Influenza vaccine, inhibin alpha, inhibin beta, insulin, insulin-like growth factor, integrin Mab, inter-alpha trypsin inhibitor, inter-alpha trypsin inhibitor, interferon gamma-inducible protein (IP-10), interferon (e.g., interferon alpha species and subspecies, interferon beta species and subspecies, interferon gamma species and subspecies), interferon (e.g., interferon alpha species and subspecies, interferon beta species and subspecies, interferon gamma species and subspecies), interleukin 6, interleukin 8 (IL-8) receptor, interleukin 8 receptor B, interleukin-1 alpha, interleukin-2 receptor-related protein p43, interleukin-3, interleukin-4 mutein, interleukin-8 (IL-8) protein, interleukin-9, interleukin-9 (IL-9) mature protein (Thr117 type), interleukin ( interleukins (e.g., IL0, IL11, and IL2), Japanese encephalitis vaccines, kallikrein inhibitors, keratinocyte growth factors, Kunitz domain proteins (e.g., aprotinin, amyloid precursor protein, and those described in WO 03 / 066824, with or without albumin fusion), Kunitz domain proteins, protinin, amyloid precursor protein with or without albumin fusion, LACI, lactoferrin, latent TGF -beta binding protein II, leptin, liver expressed chemokine-1 (LVEC-1), liver expressed chemokine-2 (LVEC-2), LT-alpha, LT-beta, luteinizing hormone, Lyme vaccine, lymphotactin, macrophage-derived chemokine analog MDC(n+1), macrophage-derived chemokine analog MDC-eyfy, macrophage-derived chemokine analog MDC-yl, macrophage-derived chemokine MDC, macrophage-derived chemokine (MDC), maspin;Protease inhibitor 5, MCP-1 receptor, MCP-1a, MCP-1b, MCP-3, MCP-4 receptor, M-CSF, melanoma inhibitory protein, membrane-associated protein, Met117 human interleukin 9, MIP-3 alpha, MIP-3 beta, MIP-gamma, MIRAP, modified Rantes, monoclonal antibody, MP52, mutant interleukin 6 S176R, myofibrillar contractile protein troponin I, natriuretic peptide, nerve growth factor-beta, nerve growth factor-beta2, neuropilin-1, neuropilin-2, neurotactin, neurotrophin-3, neurotrophin-4, neurotrophin-4a, neurotrophin-4b, neurotrophin-4c, neurotrophin-4d, neutrophil-activating peptide-2 (NAP-2), NOGO-66 receptor, NOGO-A, NOGO-B, NOGO-C, novel beta-chemokine named PTEC, N-terminally modified chemokine GroHEK / hSDF-1alpha, N-terminally modified chemokine GroHEK / hS DF-1beta, N-terminally modified chemokine met-hSDF-1alpha, N-terminally modified chemokine met-hSDF-1beta, OPGL, bone morphogenetic protein-1; OP-1; BMP-7, bone morphogenetic protein-2, OX40; ACT-4, OX40L, oxytocin (neurophysin I), parathyroid hormone, Patched, Patched-2, PDGF-D, pertussis toxoid, pituitary-expressed chemokine (PGEC), placental growth factor, placental growth factor-2, plasminogen activator inhibitor-1; PAI-1, plasminogen activator inhibitor-2; PAI-2, plasminogen activator inhibitor-2;PAI-2, platelet-derived growth factor, platelet-derived growth factor Bv-sis, platelet-derived growth factor precursor A, platelet-derived growth factor precursor B, platelet Mab, platelet-derived endothelial cell growth factor (PD-ECGF), platelet-derived growth factor A chain, platelet-derived growth factor B chain, polypeptide for treating sepsis, preproapolipoprotein "Milano" variant, preproapolipoprotein "Paris" variant, prethrombin, primate CC chemokine "ILINCK", primate CXC chemokine "IBICK", proinsulin, prolactin, prolactin 2, prosaptide, protease inhibitor peptide, protein C, protein S, prothrombin, prourokinase, RANTES, RANTES 8-68, RANTES 9-68, RANTES peptide, RANTES receptor, recombinant interleukin-16, resistin, restrictocin, retroviral protease inhibitor, ricin, rotavirus vaccine, RSV Mab, saporin, sarcin, secreted and transmembrane polypeptides, secreted and transmembrane polypeptides, serum cholinesterase, serum protein, blood clotting factor, soluble BMP receptor kinase protein-3, soluble VEGF receptor, stem cell inhibitor, staphylococcus vaccine, stromal-derived factor-1 alpha, stromal-derived factor-1 beta, substance P (tachykinin), T1249 peptide, T20 peptide, T4 endonuclease, TACI, Tarc, TGF -beta1, TGF-beta2, Thr117 human interleukin 9, thrombin, thrombopoietin, thrombopoietin derivative 1, thrombopoietin derivative 2, thrombopoietin derivative 3, thrombopoietin derivative 4, thrombopoietin derivative 5, thrombopoietin derivative 6, thrombopoietin derivative 7, thymus-expressed chemokine (TECK), thyroid-stimulating hormone, tick anticoagulant peptide, Tim-1 protein, TNF-alpha precursor, TNF-R, TNF-RII; TNF p75 receptor;Death receptor, tPA, transferrin, transforming growth factor beta, troponin peptide, truncated monocyte chemotactic protein 2 (6-76), truncated monocyte chemotactic protein 2 (6-76), truncated RANTES protein (3-68), tumor necrosis factor, urate oxidase, urokinase, vasopressin (neurophysin II), VEGF R-3; flt-4, VEGF receptor; KDR; flk-1, VEGF-110, VEGF-121, VEGF-138, VEGF-145, VEGF-162, VEGF-165, VEGF-182, VEGF-189, VEGF-206, VEGF-D, VEGF-E; VEGF-X, von Willebrand factor, wild-type monocyte chemotactic protein 2, wild-type monocyte chemotactic protein 2, ZTGF-beta9, β; (T87Q) -globin, SMN1, chimeric antigen receptor, RPE65, F8, HGF, LPL, p53, apoe2, arylsulfatase A, NAGLU, SGSH, AADC, GAD, GDNF, NRTN, LCAT, GBA, FGF-1, FGF-2, ADA, CLN2, CLN6, CLN3, IDS, huntingtin, TRAIL, dystrophin, GALGT2, accA, IDUA, GLB1, FS344, SGCA, DYSF, ABCD1, gigaxonin and functional fragments thereof 46. The method of claim 45, wherein the protein encodes a protein selected from the group consisting of: