Compositions and methods involving programmable snRNAs for RNA editing

Abstract

Disclosed herein are SnRNA systems containing RNA-binding sequences for RNA editing.

Description

[Technical Field]

[0001] FIELD OF THE DISCLOSURE This disclosure relates to molecular biology, gene therapy, and compositions and methods for altering the expression and activity of RNA molecules.

[0002] (CROSS-REFERENCE TO RELATED APPLICATIONS) This application claims priority to and the benefit of U.S. Provisional Patent Application No. 63 / 379,981, filed October 18, 2022, the contents of which are incorporated by reference in their entirety.

[0003] Electronic Sequence Listing Reference The contents of the electronic sequence listing (LOCN_022_001WO_SeqList_ST26.xml; size: 182,228 bytes; and creation date: October 18, 2023) are incorporated herein by reference in their entirety. [Background technology]

[0004] There is a long-standing and unmet need in the art to provide effective therapies for correcting dysfunctional messenger RNA.

[0005] Small nuclear RNAs (snRNAs) are one of the smallest types of RNA, with an average size of approximately 150 nucleotides. snRNAs are functional noncoding RNAs. Eukaryotic genomes encode a variety of noncoding RNAs, including snRNAs, which are a highly abundant class of RNAs localized in the nucleus and have important functions in intron splicing and RNA processing. snRNAs can form ribonucleoprotein particles (snRNPs) with other proteins in the pre-mRNA splicing process. These snRNPs and additional proteins form large particulate complexes (spliceosomes) bound to unspliced ​​pre-mRNA transcripts. In addition to splicing, snRNAs function in the nuclear maturation of nascent transcripts, in regulating gene expression, as splice donors in noncanonical systems, and in replication-dependent 3'-end processing of histone mRNAs. Although U7 snRNA can be programmed to bind and regulate mRNA, including editing one or more bases, without exogenous protein expression, there remains a need to develop highly specific mRNA-targeted therapeutics that minimize immunogenicity risks. Furthermore, the small size of these programmed snRNAs creates opportunities for the development of single-vector, highly specific (allele-specific), single-target, and multi-target gene therapy approaches.

[0006] Adenosine deaminases acting on RNA (ADARs) are a class of RNA-binding enzymes that convert adenosine (A) to inosine (I). The resulting inosine pairs with cytosine and is recognized as guanine by the translational machinery. As a result, the use of ADARs to introduce A to I mutations into RNA molecules such as pre-mRNA or mRNA provides a means to edit these RNA molecules in a sequence-specific manner. Such editing of pre-mRNA or mRNA molecules can be used, among other things, to edit premature stop codons to restore the reading frame to the mRNA, edit splice regulatory sequences (bpA, 3'ss, ESE) to result in targeted knockdown of the mRNA, and edit the translation initiation codon (ATG) to suppress translation.

[0007] Thus, the present disclosure provides compositions and methods comprising a novel therapeutic RNA targeting platform composed of snRNAs containing base-pairing mismatch binding sequences that recruit ADARs to targeted RNA sequences to induce A to I editing events. Summary of the Invention

[0008] The present invention provides an RNA-targeting nucleic acid molecule comprising a small nuclear RNA (snRNA) molecule, wherein the snRNA comprises at least one targeting sequence with at least one base-pairing mismatch, an Sm-binding domain (SmBD), and an snRNA stem-loop.

[0009] In some embodiments, the snRNA further comprises an adenosine deaminase acting on RNA (ADAR) recruitment domain. In some embodiments, the ADAR recruitment domain comprises the nucleotide sequence set forth in SEQ ID NO:88.

[0010] In some embodiments, the snRNA further comprises a 5' interaction stability domain (5'ISD). In some embodiments, the snRNA stem-loop is a natural stem-loop or an engineered stem-loop (eSL).

[0011] In some embodiments, the snRNA is U1 snRNA, U2 snRNA, U3 snRNA, U4 snRNA, U5 snRNA, U6 snRNA, or U7 snRNA. In some embodiments, the snRNA is U7 snRNA.

[0012] In some embodiments, the targeting sequence binds to an mRNA or pre-mRNA sequence.

[0013] In some embodiments, the targeting sequence binds to a start codon, a stop codon, or a splicing regulatory sequence, which in some embodiments is a branchpoint adenosine (bpA) sequence, a 3' acceptor splice site (3'ss) sequence, or an exon splicing enhancer (ESE) sequence.

[0014] In some embodiments, the base pairing mismatch is an adenosine (A)-cytosine (C) mismatch. In some embodiments, the adenosine is contained within an mRNA or pre-mRNA sequence. In some embodiments, the cytosine is contained within an snRNA targeting sequence.

[0015] In some embodiments, the targeting sequence is at least about 50 nucleotides in length.

[0016] In some embodiments, the snRNA further comprises one or more additional targeting sequences, in some embodiments, the one or more additional targeting sequences have at least one base pairing mismatch.

[0017] In some embodiments, the Sm binding domain (SmBD) is selected from the group consisting of U1, U2, U4, and U5 SmBDs.

[0018] In some embodiments, the interacting stability domain (5'ISD) comprises ggagt, cctct, ggaggt, cctcct, agccag, ggaag, gaagaag, gttg, ccgaa, taaggag, gaag, or ggctt.

[0019] In some embodiments, the snRNA stem loop comprises a nucleotide sequence set forth in any one of SEQ ID NOs: 1-41.

[0020] In some embodiments, the targeting sequence binds to an SOD1 RNA sequence. In some embodiments, the SOD1 RNA targeting sequence comprises a nucleotide sequence set forth in any one of SEQ ID NOs: 124-150.

[0021] In some embodiments, the targeting sequence binds to an IDUA RNA sequence. In some embodiments, the IDUA RNA targeting sequence comprises a nucleotide sequence set forth in any one of SEQ ID NO:153 or 154.

[0022] In some embodiments, the targeting sequence binds to an MBNL1 RNA sequence. In some embodiments, the MBNL1 RNA targeting sequence comprises a nucleotide sequence set forth in any one of SEQ ID NOs: 156-173.

[0023] In some embodiments, the snRNA is operably linked to a U7 promoter or a U1 promoter. In some embodiments, the snRNA is operably linked to a U7 promoter and a U1 promoter.

[0024] In some embodiments, the snRNA is operably linked to an snRNA downstream terminator (DT).

[0025] The present disclosure provides a vector comprising the snRNA of any embodiment of the present disclosure.

[0026] In some embodiments, the vector is a viral vector or a non-viral vector, hi some embodiments, the viral vector is an AAV vector.

[0027] In some embodiments, the vector comprises multiple copies of the snRNA according to any embodiment of the present disclosure, hi some embodiments, the vector comprises 2, 3, or 4 copies of the snRNA.

[0028] In some embodiments, each copy of the multiple copies of snRNA is separated by a buffer sequence, and the buffer sequence is selected from the group consisting of SEQ ID NOs: 42-48.

[0029] The present disclosure provides a method for targeting one or more target RNAs of interest and blocking, knocking down, editing, or splicing the one or more target RNAs, comprising contacting a snRNA according to any embodiment of the present disclosure with a cell containing the one or more target RNAs.

[0030] The present disclosure provides a method for editing an adenosine (A) to an inosine (I) in an RNA molecule of interest, comprising contacting the RNA molecule of interest with an snRNA according to any embodiment of the present disclosure.

[0031] In some embodiments, the A to I editing is carried out by an ADAR molecule recruited by snRNA.

[0032] The present disclosure provides a method of treating a disease or disorder in a subject in need thereof, the method comprising administering to the subject an RNA-targeting nucleic acid molecule according to any embodiment of the present disclosure or an AAV vector according to any embodiment of the present disclosure.

[0033] In some embodiments, the disease or disorder is myotonic dystrophy type 1, amyotrophic lateral sclerosis (ALS), or Hurler syndrome.

[0034] The present disclosure provides RNA-targeting nucleic acid molecules comprising a snRNA system (snRNA), wherein the snRNA system comprises at least one targeting sequence, an Sm-binding domain (SmBD), and an snRNA stem-loop, and wherein the binding sequence has extensive complementarity to the target RNA. [Brief explanation of the drawings]

[0035] [Figure 1A] Illustrates a reporter assay construct for evaluating snRNA molecules of the present disclosure.The nucleic acid comprises mCherry and GFP driven by a CMV promoter, and the mCherry and GFP sequences are separated by a linker with a UAG stop codon.Therefore, when the stop codon is left intact, mCherry is expressed, but GFP is not expressed.

[0036] [Figure 1B] This figure shows the sequence-specific editing of a reporter construct mediated by snRNA of the present disclosure. The snRNA molecule contains a target binding sequence (also referred to herein as a targeting sequence, spacer sequence, or RNA binding sequence) with a single base pair mismatch centered around the stop codon. The snRNA molecule induces an A to I editing event promoted by an ADAR protein, thereby removing the stop codon and allowing the expression of both mCherry and GFP proteins.

[0037] [Figure 2] 1A and 1B are a series of fluorescence images showing treatment of cells containing a reporter construct with snRNA molecules of the present disclosure that target the stop codon in FIGS. 1A and 1B. The images show mCherry, GFP, and a merge of images of mCherry and GFP. The columns of images show stop codon-targeting snRNA, non-targeting snRNA, no snRNA, and untransfected cells.

[0038] [Figure 3] 1 is a graph showing the ratio of GFP fluorescent signal to mCherry fluorescent signal for cells transfected with snRNA molecules of the present disclosure.

[0039] [Figure 4A] FIG. 1 is a schematic diagram of a snRNA of the present disclosure, comprising, from 5′ to 3′, an ADAR recruitment domain, a target binding sequence with a single base pair mismatch, an SM binding domain, and an snRNA stem loop.

[0040] [Figure 4B] FIG. 1 is a schematic diagram of a snRNA of the present disclosure, comprising, from 5′ to 3′, a 5′ interaction stabilizing domain (5′ ISD), a target binding sequence with a single base pair mismatch, an SM binding domain, and an snRNA stem loop.

[0041] [Figure 4C] 1 is a schematic diagram of a snRNA of the present disclosure bound to a target mRNA, showing a single base pair mismatch.

[0042] [Figure 5A] FIG. 1 is a schematic diagram of a snRNA of the present disclosure, comprising, from 5′ to 3′, an ADAR recruitment domain, a target binding sequence, a linker sequence, a target binding sequence, a linker sequence, a target binding sequence, a linker, a target binding sequence with a single base pair mismatch, an SM binding domain, and an snRNA stem loop.

[0043] [Figure 5B] FIG. 1 is a schematic diagram of a snRNA of the present disclosure, comprising, from 5' to 3', a 5' ISD, a target binding sequence, a linker sequence, a target binding sequence, a linker sequence, a target binding sequence, a linker, a target binding sequence with a single base pair mismatch, an SM binding domain, and an snRNA stem loop.

[0044] [Figure 5C]5B is a schematic diagram of the snRNA shown in FIG. 5A bound to a target mRNA with multiple target binding sequences bound to an mRNA with a single base pair mismatch of one of the target binding sequences shown. The diagram shows unbound target mRNA sequences between the snRNA binding sequences.

[0045] [Figure 6A] A schematic diagram of snRNA constructs designed to target the SOD1-AUG start codon is shown. Constructs were designed with and without the ADAR recruitment sequence. The targeting spacer varied in size from 20 to 151 nucleotides. The 20-nucleotide spacer construct contained an additional unique recruitment-binding spacer that targets the SOD1 gene. All constructs contain the U7 snRNA stem loop.

[0046] [Figure 6B] Figure 6 shows data supporting that snRNA SOD1 constructs promote A-to-I editing of the start codon in 293T cells. Editing was enhanced by snRNAs containing a cytosine mismatch (instead of uracil) at the target adenosine nucleotide. Figure 6B provides a representative Sanger sequencing chromatogram of the SOD1 start codon analyzed by EditR, with quantification of nucleotide distribution at the bottom. The top row shows the targeted sequence. The bottom four rows show the percent distribution of labeled nucleotides for each column. Sequences are shown as antisense for the sequencing primer (reverse) used. Figure 6C provides a bar graph showing the editing efficiency of SOD1-targeted snRNA constructs with or without a mismatch at the target adenosine. Non-targeted and untreated cells were used as controls. 293T cells were transfected with the constructs and harvested 48 hours later with Trizol (Invitrogen). Editing efficiency was quantified using EditR. [Figure 6C]Figure 6 shows data supporting that snRNA SOD1 constructs promote A-to-I editing of the start codon in 293T cells. Editing was enhanced by snRNAs containing a cytosine mismatch (instead of uracil) at the target adenosine nucleotide. Figure 6B provides a representative Sanger sequencing chromatogram of the SOD1 start codon analyzed by EditR, with quantification of nucleotide distribution at the bottom. The top row shows the targeted sequence. The bottom four rows show the percent distribution of labeled nucleotides for each column. Sequences are shown as antisense for the sequencing primer (reverse) used. Figure 6C provides a bar graph showing the editing efficiency of SOD1-targeted snRNA constructs with or without a mismatch at the target adenosine. Non-targeted and untreated cells were used as controls. 293T cells were transfected with the constructs and harvested 48 hours later with Trizol (Invitrogen). Editing efficiency was quantified using EditR.

[0047] [Figure 7A] Figure 7 shows that snRNA SOD1 constructs targeting the SOD1-AUG start codon reduce SOD1 mRNA levels in 293T cells. A reduction in SOD1 expression was observed regardless of the mismatch. Figure 7A provides a bar graph of SOD1 mRNA expression as shown by qRT-PCR. 293T cells were transfected with SOD1-targeting snRNA constructs with or without mismatches to the target adenosine. Non-targeted and untreated cells served as controls. Cells were transfected with the constructs for 72 hours and harvested with Trizol (Invitrogen). Sample expression was normalized to endogenous GAPDH. A schematic diagram of the snRNA SOD1 constructs is shown. [Figure 7B]Figure 7 shows that snRNA SOD1 constructs targeting the SOD1-AUG start codon reduce SOD1 mRNA levels in 293T cells. A decrease in SOD1 expression was observed regardless of the mismatch. Figure 7A provides a bar graph of SOD1 mRNA expression as shown by qRT-PCR. 293T cells were transfected with SOD1-targeting snRNA constructs with or without mismatches to the target adenosine. Non-targeted and untreated cells served as controls. Cells were transfected with the constructs for 72 hours and harvested with Trizol (Invitrogen). Sample expression was normalized to endogenous GAPDH.

[0048] FIG. 7B shows a schematic diagram of the snRNA SOD1 construct.

[0049] [Figure 8A] Figure 8A shows that snRNA constructs targeting the SOD1 AUG start codon reduce SOD1 protein levels in 293T cells. A decrease in SOD1 expression was observed regardless of the mismatch. Figure 8A provides a Western blot image of SOD1 in 293T cells transfected with SOD1-targeting snRNA constructs for 72 hours and harvested with RIPA buffer. Figure 8B provides a quantification of SOD1 protein levels in 293T cells transfected with snRNA constructs with or without target adenosine mismatches. Non-targeting and untreated conditions were used as controls. SOD1 bands were normalized to total protein. Sample intensities shown are relative to the untreated condition. [Figure 8B]Figure 8A shows that snRNA constructs targeting the SOD1 AUG start codon reduce SOD1 protein levels in 293T cells. A decrease in SOD1 expression was observed regardless of the mismatch. Figure 8A provides a Western blot image of SOD1 in 293T cells transfected with SOD1-targeting snRNA constructs for 72 hours and harvested with RIPA buffer. Figure 8B provides a quantification of SOD1 protein levels in 293T cells transfected with snRNA constructs with or without target adenosine mismatches. Non-targeting and untreated conditions were used as controls. SOD1 bands were normalized to total protein. Sample intensities shown are relative to the untreated condition. [Figure 8C] Figure 8A shows that snRNA constructs targeting the SOD1 AUG start codon reduce SOD1 protein levels in 293T cells. A decrease in SOD1 expression was observed regardless of the mismatch. Figure 8A provides a Western blot image of SOD1 in 293T cells transfected with SOD1-targeting snRNA constructs for 72 hours and harvested with RIPA buffer. Figure 8B provides a quantification of SOD1 protein levels in 293T cells transfected with snRNA constructs with or without target adenosine mismatches. Non-targeting and untreated conditions were used as controls. SOD1 bands were normalized to total protein. Sample intensities shown are relative to the untreated condition.

[0050] FIG. 8C shows a schematic diagram of the snRNA SOD1 construct.

[0051] [Figure 9A]A Hurler syndrome (HS) model using patient iPSCs and fibroblasts is shown. Figure 9A shows a schematic diagram of the premature stop codon in Hurler syndrome. Figure 9B is a Western blot image showing the loss of IDUA enzyme levels in fibroblasts from HS patients compared to healthy patients. Figure 9C is a bar graph (ELISA) of IDUA levels in iPSC myotubes derived from healthy and Hurler syndrome patients. Most MPS (mucopolysaccharidosis) IH patients have premature stop codon mutations in one or both alleles. These patients are unable to synthesize full-length polypeptides, causing a loss of enzyme activity. Two α-L-iduronidase gene (IDUA) premature stop codon mutations, Q70X and W402X, are the most common (70%) mutations in MPS I patients. [Figure 9B] A Hurler syndrome (HS) model using patient iPSCs and fibroblasts is shown. Figure 9A shows a schematic diagram of the premature stop codon in Hurler syndrome. Figure 9B is a Western blot image showing the loss of IDUA enzyme levels in fibroblasts from HS patients compared to healthy patients. Figure 9C is a bar graph (ELISA) of IDUA levels in iPSC myotubes derived from healthy and Hurler syndrome patients. Most MPS (mucopolysaccharidosis) IH patients have premature stop codon mutations in one or both alleles. These patients are unable to synthesize full-length polypeptides, causing a loss of enzyme activity. Two α-L-iduronidase gene (IDUA) premature stop codon mutations, Q70X and W402X, are the most common (70%) mutations in MPS I patients. [Figure 9C]A Hurler syndrome (HS) model using patient iPSCs and fibroblasts is shown. Figure 9A shows a schematic diagram of the premature stop codon in Hurler syndrome. Figure 9B is a Western blot image showing the loss of IDUA enzyme levels in fibroblasts from HS patients compared to healthy patients. Figure 9C is a bar graph (ELISA) of IDUA levels in iPSC myotubes derived from healthy and Hurler syndrome patients. Most MPS (mucopolysaccharidosis) IH patients have premature stop codon mutations in one or both alleles. These patients are unable to synthesize full-length polypeptides, causing a loss of enzyme activity. Two α-L-iduronidase gene (IDUA) premature stop codon mutations, Q70X and W402X, are the most common (70%) mutations in MPS I patients.

[0052] [Figure 10] Schematic representation of snRNA-based mechanism of action targeting IDUA W 402 X / exon 9.

[0053] [Figure 11A] Figure 11A shows dose-dependent scAAV snRNA-mediated editing of IDUA mRNA in myotubes derived from Hurler syndrome patients (i.e., A05318 treatment of W402X Hurler syndrome myotubes). Figure 11A shows Sanger sequencing chromatograms of IDUA exon 9 demonstrating A>I (A>G) editing in A05318-treated myotubes at 1E5 and 1E6 vg / cell after 7 days. Untreated cells and AAV empty capsids at MOIs of 1E5 and 1E6 vg / cell served as negative controls for the assay. Figure 11B shows a bar graph depicting editing efficiency as determined by RT-PCR of IDUA followed by Sanger sequencing chromatograms analyzed by EditR. Untreated cells and cells treated with AAV empty capsids served as negative controls to demonstrate the lack of edited RNA in this cell line. [Figure 11B]Figure 11A shows dose-dependent scAAV snRNA-mediated editing of IDUA mRNA in myotubes derived from Hurler syndrome patients (i.e., A05318 treatment of W402X Hurler syndrome myotubes). Figure 11A shows Sanger sequencing chromatograms of IDUA exon 9 demonstrating A>I (A>G) editing in A05318-treated myotubes at 1E5 and 1E6 vg / cell after 7 days. Untreated cells and AAV empty capsids at MOIs of 1E5 and 1E6 vg / cell served as negative controls for the assay. Figure 11B shows a bar graph depicting editing efficiency as determined by RT-PCR of IDUA followed by Sanger sequencing chromatograms analyzed by EditR. Untreated cells and cells treated with AAV empty capsids served as negative controls to demonstrate the lack of edited RNA in this cell line.

[0054] [Figure 12A] We demonstrate that snRNA treatment restores IDUA enzyme activity in Hurler myotubes (by ELISA). Figure 12A shows a recombinant IDUA standard curve read by IDUA ELISA (Thermo Fisher EH247RB). Figure 12B shows the increase in IDUA protein levels in the supernatants of cocultures of healthy and untreated Hurler syndrome patient-derived myotubes at ratios of 100:0, 35:65, 50:50, 58:42, and 0:100 (by ELISA). Figure 12C shows a bar graph showing IDUA protein levels in the supernatants of A05318-treated myotubes at 1E6 vg / cell after 10 days. Untreated cells and 1E6 vg / cell of AAV empty capsid served as negative controls for the assay. Healthy myotubes were maintained as 100% to calculate the healthy percentage. Untreated cells and cells treated with AAV empty capsids serve as negative controls to demonstrate the lack of edited RNA in this cell line. [Figure 12B]We demonstrate that snRNA treatment restores IDUA enzyme activity in Hurler myotubes (by ELISA). Figure 12A shows a recombinant IDUA standard curve read by IDUA ELISA (Thermo Fisher EH247RB). Figure 12B shows the increase in IDUA protein levels in the supernatants of cocultures of healthy and untreated Hurler syndrome patient-derived myotubes at ratios of 100:0, 35:65, 50:50, 58:42, and 0:100 (by ELISA). Figure 12C shows a bar graph showing IDUA protein levels in the supernatants of A05318-treated myotubes at 1E6 vg / cell after 10 days. Untreated cells and 1E6 vg / cell of AAV empty capsid served as negative controls for the assay. Healthy myotubes were maintained as 100% to calculate the healthy percentage. Untreated cells and cells treated with AAV empty capsids serve as negative controls to demonstrate the lack of edited RNA in this cell line. [Figure 12C] We demonstrate that snRNA treatment restores IDUA enzyme activity in Hurler myotubes (by ELISA). Figure 12A shows a recombinant IDUA standard curve read by IDUA ELISA (Thermo Fisher EH247RB). Figure 12B shows the increase in IDUA protein levels in the supernatants of cocultures of healthy and untreated Hurler syndrome patient-derived myotubes at ratios of 100:0, 35:65, 50:50, 58:42, and 0:100 (by ELISA). Figure 12C shows a bar graph showing IDUA protein levels in the supernatants of A05318-treated myotubes at 1E6 vg / cell after 10 days. Untreated cells and 1E6 vg / cell of AAV empty capsid served as negative controls for the assay. Healthy myotubes were maintained as 100% to calculate the healthy percentage. Untreated cells and cells treated with AAV empty capsids serve as negative controls to demonstrate the lack of edited RNA in this cell line.

[0055] [Figure 13A]Figure 13A shows data supporting the finding that scAAV snRNA (A05318)-treated Hurler myotubes exhibit reduced GAG accumulation. Figure 13A provides immunofluorescence images showing reduced perlecan staining 10 days after treatment of myotubes with 1E6 vg / cell of A05318 using a perlecan antibody (Abcam, red). Untreated cells and cells treated with 1E6 vg / cell of AAV empty capsid served as negative controls, demonstrating high baseline staining in this cell line. DAPI staining (blue) was used to detect nuclei. Figure 13B shows a bar graph depicting the average perlecan-positive puncta in A05318-treated and untreated cells, as well as cells treated with AAV empty capsid. Figure 13C provides a bar graph depicting the frequency distribution of perlecan puncta (uM2) in A05318- and AAV empty capsid-treated myotubes. Untreated cells and cells treated with AAV empty capsids served as negative controls and show a higher abundance of larger sized perlecan puncta. [Figure 13B] Figure 13A shows data supporting the finding that scAAV snRNA (A05318)-treated Hurler myotubes exhibit reduced GAG accumulation. Figure 13A provides immunofluorescence images showing reduced perlecan staining 10 days after treatment of myotubes with 1E6 vg / cell of A05318 using a perlecan antibody (Abcam, red). Untreated cells and cells treated with 1E6 vg / cell of AAV empty capsid served as negative controls, demonstrating high baseline staining in this cell line. DAPI staining (blue) was used to detect nuclei. Figure 13B shows a bar graph depicting the average perlecan-positive puncta in A05318-treated and untreated cells, as well as cells treated with AAV empty capsid. Figure 13C provides a bar graph depicting the frequency distribution of perlecan puncta (uM2) in A05318- and AAV empty capsid-treated myotubes. Untreated cells and cells treated with AAV empty capsids served as negative controls and show a higher abundance of larger sized perlecan puncta. [Figure 13C]Figure 13A shows data supporting the finding that scAAV snRNA (A05318)-treated Hurler myotubes exhibit reduced GAG accumulation. Figure 13A provides immunofluorescence images showing reduced perlecan staining 10 days after treatment of myotubes with 1E6 vg / cell of A05318 using a perlecan antibody (Abcam, red). Untreated cells and cells treated with 1E6 vg / cell of AAV empty capsid served as negative controls, demonstrating high baseline staining in this cell line. DAPI staining (blue) was used to detect nuclei. Figure 13B shows a bar graph depicting the average perlecan-positive puncta in A05318-treated and untreated cells, as well as cells treated with AAV empty capsid. Figure 13C provides a bar graph depicting the frequency distribution of perlecan puncta (uM2) in A05318- and AAV empty capsid-treated myotubes. Untreated cells and cells treated with AAV empty capsids served as negative controls and show a higher abundance of larger sized perlecan puncta.

[0056] [Figure 14] 1 shows a targeting strategy for editing MBNL1.

[0057] [Figure 15] Adenosine-to-inosine editing of the MBNL 3'UTR at the miR30 seed binding site is shown. snRNA 1 and snRNA 2, which contain antisense sequences to the MBNL1 3'UTR at the miR30 binding site and have a mismatch to the A in the seed sequence, were transfected into HEK cells for 72 hours. RNA was extracted, reverse-transcribed, and cDNA was amplified by PCR. The resulting DNA amplicons were subjected to Sanger sequencing. Chromatographs of the amplicons were analyzed using EditR (v10 Moriarity Lab). DETAILED DESCRIPTION OF THE INVENTION

[0058] The present disclosure provides gene therapy compositions comprising a novel therapeutic RNA targeting platform composed of snRNA (snRNA) containing an RNA-binding sequence (also referred to herein as a targeting sequence or spacer sequence) with at least one base-pairing mismatch. In some embodiments, the snRNA further comprises an adenosine deaminase (ADAR) recruitment domain acting on RNA. Accordingly, herein, the inventors demonstrate the recruitment of endogenous ADAR1 enzyme to promote targeted A-to-I editing of therapeutically relevant targets. In some embodiments, A-to-I editing is used to edit the AUG start codon to reduce protein expression. In other embodiments, A-to-I editing is used to edit an miRNA-binding site to reduce miRNA binding with the intent of upregulating protein expression. By screening cells expressing disease-associated targets (e.g., SOD1 (ALS), MBNL1 (DM1), IDUA (Hurler syndrome)), the inventors identified snRNA targeting and / or recruitment spacers that can achieve A to I editing via their snRNA platform. The snRNA molecules of the present invention can be non-natural, modified, and / or engineered snRNAs (esnRNAs). esnRNA molecules comprising the disclosed editing and / or recruitment spacers have mutated snRNA stem loops. In some embodiments, snRNA molecules comprising the disclosed editing and / or recruitment spacers have natural stem loops.

[0059] Disclosed herein are compositions comprising nucleic acid molecules, and vectors comprising snRNA (snRNA) editing and / or mobilization systems.

[0060] Small nuclear ribonucleic acid (snRNA) Small nuclear ribonucleic acids (snRNAs) are essential components of small nuclear ribonucleoprotein complexes (snRNPs), which, when assembled with additional proteins, form a large ribonucleoprotein complex known as the spliceosome, a cellular machinery designated to mediate the entire mRNA maturation process. The spliceosome is responsible for pre-mRNA splicing, the process of removing introns from RNA transcripts before protein production. Individual snRNAs generally measure approximately 250 nucleotides or less in size. For example, the U1 snRNA is 164 nucleotides long and is encoded by genes present in several copies in the human genome. U1 snRNA represents the ribonucleic acid component of the nuclear particle U1 snRNP. U1 snRNAs have a three-dimensional stem-and-loop structure, and within the 5' region there is a single-stranded sequence, generally approximately 9 nucleotides long, that can bind to splice donor sites on pre-mRNA molecules through complementary base pairing. (Horowitz et al., 1994, Trends Genet., 10(3):100-6). The various spliceosomal snRNAs are named U1, U2, U4, U5, U6, U4ATAC, U6ATAC, U7, U11, and U12 based on the abundance of uridylic acid they contain (Mattaj et al., 1993, FASEB J, 15, 7:47-53).

[0061] The snRNA system of the present disclosure can be used to treat G-to-A point mutations and / or other toxic mutations. For example, antisense oligonucleotides that disrupt splice sites and regulatory elements within exons containing toxic mutations induce skipping of specific exons at the pre-mRNA level. Such antisense sequences can be delivered using viral vectors carrying genes capable of transcribing the antisense sequences contained within the snRNA molecules of the present disclosure. The U7 snRNA, which is endogenously involved in histone pre-mRNA 3'-end processing, can be converted into a versatile tool for splicing regulation by small changes in the binding sites for Sm / Lsm proteins.

[0062] Most U-rich snRNPs mediate pre-mRNA splicing. The U7 snRNP is an exception. U7 is not involved in splicing but rather is a key factor in the unique 3'-end processing of replication-dependent histone mRNAs. By modifying the U7 snRNA histone-binding sequence and Sm motif, U7 can no longer participate in histone pre-mRNA processing and instead targets pre-mRNAs or mRNAs for editing of one or more bases in the RNA sequence. In this way, U7 snRNA can be used as an effective gene therapy platform. The U7 snRNA platform also has the added advantages of being compact, capable of accumulating in the nucleus without causing cytotoxicity, and having little or no immunoreactivity. (Gadgil et al., 2021, J Gene Med, 23(4):e3321)

[0063] Adenosine deaminase acting on RNA (ADAR) Adenosine deaminases acting on RNA (ADARs) are a class of RNA-binding enzymes that convert adenosine (A) to inosine (I) through deamination. The resulting inosine pairs with cytosine and is recognized as guanine by the translational machinery. In mammals, three types of ADAR enzymes exist: ADAR1, ADARB1 (ADAR2), and ADARB2 (ADAR3). While ADAR1 and ADARB1 are present in many tissues throughout the body, ADARB2 is present only in the brain. While ADAR1 and ADARB1 are known to be catalytically active, evidence suggests that ADARB2 is inactive. ADAR1 has two known isoforms: ADAR1p150 and ADAR1p110. While ADAR1p110 is typically present in the nucleus, ADAR1p150 shuffles between the nucleus and cytoplasm, mostly residing in the cytoplasm. ADAR1 and ADARB1 share functional domains, have similar expression patterns, protein structures, and require substrate double-stranded RNA structures, but they differ in their editing activities.

[0064] ADAR recruitment domain ADARs from all characterized species have a modular domain organization consisting of one to three double-stranded RNA-binding domains (dsRBMs) followed by a conserved C-terminal catalytic adenosine deaminase domain. ADARs recognize and bind to a short nucleic acid sequence, the ADAR recruitment domain. The snRNA of the present disclosure may contain the ADAR recruitment domain. The ADAR recruitment domain binds to the dsRBD1 and dsRBD2 domains of ADAR2, and then the deaminase domain of ADAR2 binds to the AC mismatch. In some embodiments, the ADAR recruitment domain comprises, consists essentially of, or consists of a nucleic acid sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identity to GGTGTCGAGAAGAGGAGAACAATATGCTAAATGTTGTTCTCGTCTCCTCGACACC (SEQ ID NO:88).

[0065] Without wishing to be bound by theory, the ADAR recruitment domain of the snRNA of the present disclosure is bound by the ADAR protein, bringing them into close proximity and positioning so that the catalytic adenosine deaminase domain can act on the adenosine to be edited. See Wettengel et al., Nucleic Acids Res. 45, 2797-2808 (2017). See also Stefl et al., Cell. 2010; 143: 225-237.

[0066] snRNA Disclosed herein are snRNA platforms comprising RNA-binding sequences (also referred to herein as targeting sequences or spacer sequences) with extensive complementarity and / or at least one base-pairing mismatch. The snRNAs of the present disclosure may further comprise an Sm-binding domain and an snRNA stem-loop. Extensive complementarity is complementarity of 30 or more contiguous nucleotides, or complementarity of about 30 to about 200 contiguous nucleotides. In some embodiments, extensive complementarity is at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, or at least about 200 contiguous nucleotides. In some embodiments, the extensive complementarity comprises at least one base-pairing mismatch. In some embodiments, the extensive complementarity comprises exactly one base-pairing mismatch. In some embodiments, the base-pairing mismatch occurs at the adenosine to be edited on the target RNA sequence.

[0067] In some embodiments, the snRNA stem loop is an engineered stem loop. In some embodiments, the snRNA stem loop is a natural snRNA stem loop. In some embodiments, the snRNA of the present disclosure further comprises an adenosine deaminase (ADAR) recruitment domain that acts on RNA.

[0068] Engineered stem-loop In some embodiments, the snRNA molecules disclosed herein may comprise a natural snRNA stem loop. In some embodiments, the snRNA molecules disclosed herein may comprise an engineered stem loop (eSL) that includes compensatory modifications to the natural snRNA stem loop. The compensatory modifications made to the natural stem loop sequence create an engineered stem loop (eSL) that more effectively communicates (folds, anneals) with the snRNA interaction stabilization domain (ISD), which in turn creates an snRNA platform with increased stability. U7 snRNA has previously been shown to be programmable to regulate mRNA. Disclosed herein are improved programmed snRNAs that can be used as gene therapy tools. In one embodiment, these snRNAs are human snRNAs. In one embodiment, the U7 snRNA is human U7 snRNA. In another embodiment disclosed herein, the snRNA comprises various types of snRNA (e.g., U1-U12) by combining domains of endogenous snRNAs to fine-tune the stabilization of the platform and / or reduce off-target effects. For example, in one embodiment, the engineered snRNA system comprises a combination of human U7 and human U1 snRNA components.

[0069] Additional elements that can regulate RNA processing and abundance can be engineered into snRNAs, including eSLs. In one embodiment, additional elements that can regulate snRNA processing, stability, and abundance can be engineered into the 5' or 3' end of the snRNA. In another embodiment, such elements can include, but are not limited to, stem-loops, hairpins, GC clamps, kissing loops, triplexes, quadruplexes, and protein-binding sites. Engineered stem-loops are described in WO2023168458, the contents of which are incorporated herein by reference in their entirety for examples of eSL sequences that can be used in the constructs described herein.

[0070] The snRNA (snRNA) systems disclosed herein can include engineered stem-loop (eSL) sequences that contain compensatory modifications to the native snRNA stem-loop. These modifications result in increased stability of the snRNA compared to snRNAs containing unmodified stem-loop sequences. The eSLs disclosed herein can be derived from any snRNP U1-U12. In one embodiment, the eSL is a U7 eSL. In another embodiment, the human eSL comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical (or any percentage therebetween) to the following nucleotide sequence: · ggctttctggctccttaccggaaagcc(SEQ ID NO:1) · ggctttctgggaggttaccggaaagcc(SEQ ID NO:2) · ggctttctggcctccttaccggaaagcc(SEQ ID NO:3) · ggctttctggggaggttaccggaaagcc(SEQ ID NO:4) · ggctttctggctggctaccggaaagcc(SEQ ID NO:5) · ggctttctggcttccccggaaagcc(SEQ ID NO:6) · ggctttctggcttcttcccggaaagcc(SEQ ID NO:7) · ggctttctggcaacttaccggaaagcc(SEQ ID NO:8) · ggctttctggttcggtaccggaaagcc(SEQ ID NO:9) · ggctttctggaagccttaccggaaagcc(SEQ ID NO:10) · ggctttctggcttcttaccggaaagcc(SEQ ID NO:11), or · GGCTTTCTGGCCTCCGCCGGAAAGCCCCT(SEQ ID NO:12).

[0071] In some embodiments, human eSL comprises the sequence set forth in SEQ ID NO:1. In some embodiments, human eSL comprises the sequence set forth in SEQ ID NO:2. In some embodiments, human eSL comprises the sequence set forth in SEQ ID NO:3. In some embodiments, human eSL comprises the sequence set forth in SEQ ID NO:4. In some embodiments, human eSL comprises the sequence set forth in SEQ ID NO:5. In some embodiments, human eSL comprises the sequence set forth in SEQ ID NO:6. In some embodiments, human eSL comprises the sequence set forth in SEQ ID NO:7. In some embodiments, human eSL comprises the sequence set forth in SEQ ID NO:8. In some embodiments, human eSL comprises the sequence set forth in SEQ ID NO:9. In some embodiments, human eSL comprises the sequence set forth in SEQ ID NO:10. In some embodiments, human eSL comprises the sequence set forth in SEQ ID NO:11. In some embodiments, human eSL comprises the sequence set forth in SEQ ID NO:12.

[0072] In some embodiments, the mouse eSL comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical (or any percentage therebetween) to one or more of the following nucleotide sequences: · ggctttctggctccttaccggaaagcccct(SEQ ID NO:13) · Ggttttctgacctccgtcggaaaacccct(SEQ ID NO:14) · ggttttctgacctccttcggtcggaaaacccct(SEQ ID NO:15) · Ggttttctgacctccgtcggaaaacc(SEQ ID NO:16) · GGTTTTCTGACACTCCGTCGGAAAACCCCT(SEQ ID NO:17) GGTTTTCTGATCTCCATCGGAAAACCCCT (SEQ ID NO: 18), or · GGTTTTCCGACCTCCGTCGGAAACCCCT(SEQ ID NO:19).

[0073] In some embodiments, the mouse eSL comprises the sequence set forth in SEQ ID NO:13. In some embodiments, the mouse eSL comprises the sequence set forth in SEQ ID NO:14. In some embodiments, the mouse eSL comprises the sequence set forth in SEQ ID NO:15. In some embodiments, the mouse eSL comprises the sequence set forth in SEQ ID NO:16. In some embodiments, the mouse eSL comprises the sequence set forth in SEQ ID NO:17. In some embodiments, the mouse eSL comprises the sequence set forth in SEQ ID NO:18. In some embodiments, the mouse eSL comprises the sequence set forth in SEQ ID NO:19.

[0074] In some embodiments, the human or mouse eSL comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical (or any percentage therebetween) to one or more of the following nucleotide sequences: · GGCTTTCTGGCACTCCACCGGAAAGCCCCT(SEQ ID NO:20) · GGCTTTCTGGCACTCCGCCGGAAAGCCCCT(SEQ ID NO:21), or · GGCTTTCTGGCCTCCACCGGAAAGCCCCT(SEQ ID NO:22).

[0075] In some embodiments, the human or mouse eSL comprises the sequence set forth in SEQ ID NO: 20. In some embodiments, the human or mouse eSL comprises the sequence set forth in SEQ ID NO: 21. In some embodiments, the human or mouse eSL comprises the sequence set forth in SEQ ID NO: 22.

[0076] In some embodiments, the canine or feline eSL comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage therebetween) identical to the nucleotide sequence GGTTTTCCGGTCTCCACCGGAAAGCCCCC (SEQ ID NO:23).

[0077] In some embodiments, the bovine, ovine, or caprine eSL comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical (or any percentage therebetween) to one or more of the following nucleotide sequences: · GGCTTTCCGGTCTCCACCGGAAAGCCCCT(SEQ ID NO:24), or · GGCTTTCCGGCCTCCGCCGGAAAGCCCCT(SEQ ID NO:25).

[0078] In some embodiments, the bovine, ovine, or caprine eSL comprises the sequence set forth in SEQ ID NO: 24. In some embodiments, the bovine, ovine, or caprine eSL comprises the sequence set forth in SEQ ID NO: 25.

[0079] In some embodiments, the porcine eSL comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical (or any percentage therebetween) to one or more of the following nucleotide sequences: · GGTTTTCCGGTCTCCACCGGAAAACCCTT(SEQ ID NO:26), · GGTTTTCCGTGCTCCCACGGAAAACCCTT(SEQ ID NO:27), · GGTTTTCCGGCCTCCGCCGGAAAACCCTT(SEQ ID NO:28), GGTTTTCCGTGACTCCCACGGAAAACCCTT (SEQ ID NO: 29), or · GGTTTTCCGGCACTCCGCCGGAAAACCCTT(SEQ ID NO:30).

[0080] In some embodiments, the porcine eSL comprises the sequence set forth in SEQ ID NO:26. In some embodiments, the porcine eSL comprises the sequence set forth in SEQ ID NO:27. In some embodiments, the porcine eSL comprises the sequence set forth in SEQ ID NO:28. In some embodiments, the porcine eSL comprises the sequence set forth in SEQ ID NO:29. In some embodiments, the porcine eSL comprises the sequence set forth in SEQ ID NO:30.

[0081] In some embodiments, the equine eSL comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical (or any percentage therebetween) to one or more of the following nucleotide sequences: · GGTCTTCCGGTCTCCTCCGGAAGGCCCCC(SEQ ID NO:31), or · GGTCTTCCGGCTCCCCGGAAGGCCCCC(SEQ ID NO:32).

[0082] In some embodiments, the equine eSL comprises the sequence set forth in SEQ ID NO: 31. In some embodiments, the equine eSL comprises the sequence set forth in SEQ ID NO: 32.

[0083] In some embodiments, the ovine eSL comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical (or any percentage therebetween) to one or more of the following nucleotide sequences: · GGCTTTCCGTGCTCCCACGGAAAGCCCCT(SEQ ID NO:33), · GGCTTTCCGTGACTCCCCACGGAAAGCCCCT(SEQ ID NO:34), or · GGCTTTCCGGCACTCCGCCGGAAAGCCCCT(SEQ ID NO:35).

[0084] In some embodiments, the ovine eSL comprises the sequence set forth in SEQ ID NO: 33. In some embodiments, the ovine eSL comprises the sequence set forth in SEQ ID NO: 34. In some embodiments, the ovine eSL comprises the sequence set forth in SEQ ID NO: 35.

[0085] In some embodiments, a snRNA molecule of the present disclosure comprises a naturally occurring snRNA stem loop comprising the sequence set forth in SEQ ID NO: 36. In some embodiments, a naturally occurring snRNA stem loop comprises the sequence set forth in SEQ ID NO: 37. In some embodiments, a naturally occurring snRNA stem loop comprises the sequence set forth in SEQ ID NO: 38. In some embodiments, a naturally occurring snRNA stem loop comprises the sequence set forth in SEQ ID NO: 39.

[0086] In some embodiments, the engineered stem loop results in enhanced stability of the snRNA compared to a snRNA comprising a naturally occurring stem loop. In some embodiments, the naturally occurring snRNA stem loop comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical (or any percentage therebetween) to one or more of the following nucleotide sequences: · Ggttttctgacttcggtcggaaaacccct(SEQ ID NO:36), · ggttttctgacttcggtcggaaaacc(SEQ ID NO:37), · Ggctttctggctttttaccggaaagcc(SEQ ID NO:38), · ggctttctggctttttaccggaaagccCCT(SEQ ID NO:39), · GGCTTTCCGGCCTCCGCCGGAAAGCCCCT(SEQ ID NO:40), or · GGCTTTCCGGCCTCCGCCGGAAAGCC(SEQ ID NO:41).

[0087] 5' interacting stability domain The eSL disclosed herein has a 5' interacting stability domain (5'ISD) that provides more efficient folding and annealing properties, which in turn results in increased stability of the esnRNA compared to unengineered snRNA. The 5'ISD has nucleotides complementary to nucleotides in the engineered SL, and while not wishing to be bound by theory, it is predicted that the interaction between the 5'ISD and the eSL forms a secondary structure that protects the 5' end of the snRNA. In some embodiments, the 5'ISD anneals and / or hybridizes to the eSL of the present disclosure. In some embodiments, the 5'ISD is a sequence that is complementary and / or reverse complementary to a sequence present in the eSL of the present disclosure. In some embodiments, the 5'ISD disclosed herein can comprise or consist of one of the following nucleotide sequences: · ggagt, · cctct, · ggaggt, · cctcct, · agccag, · ggaag, · gaagaag, · gttg, · ccgaa, · taaggag, gaag, and · ggctt.

[0088] RNA targeting sequence The snRNA system can be programmed to contain one or more RNA targeting sequences (TSs) (also called "spacer sequences") that target one or more RNAs of interest (also called spacers). In one example, the U7 snRNA can be programmed by replacing the histone mRNA binding sequence with a sequence complementary to the target of interest.

[0089] In some embodiments, the targeting sequence binds to an mRNA or pre-mRNA sequence. In some embodiments, at least one targeting sequence of the present disclosure comprises at least one base-pairing mismatch. In some embodiments, the base-pairing mismatch is an adenosine (A)-cytosine (C) mismatch. In some embodiments, the adenosine is located on the mRNA or pre-mRNA sequence targeting sequence and the cytosine is located on the snRNA binding sequence.

[0090] The targeting sequences of the present disclosure can bind to (target) any sequence or region of an mRNA or pre-mRNA sequence. In some embodiments, the targeting sequences of the present disclosure bind to a start codon, a stop codon, or a splicing regulatory sequence. In some embodiments, the splicing regulatory sequence is a branchpoint adenosine (bpA) sequence, a 3' acceptor splice site (3'ss) sequence, a 5'ss (beyond GU), or an exonic splicing enhancer (ESE) sequence. In some embodiments, the targeting sequences of the present disclosure bind to an intronic or exonic sequence of a pre-mRNA. The targeting sequences of the present disclosure include extensive complementarity and either intramolecular or intermolecular base pairing and / or base pair mismatches between adenosines on the target RNA sequence and cytosines on the snRNA targeting sequence. This mismatch allows adenosine deamination by ADAR, thereby converting adenosine to inosine. Inosine is recognized as guanine by the translational machinery. In embodiments of broad complementarity greater than about 30 nucleotides, the RNA-binding sequence of the present disclosure comprises a targeting sequence of greater than about 30 nucleotides, with or without base pair mismatches between adenosine on the target RNA sequence and cytosine on the snRNA-binding sequence (also referred to as a targeting sequence). Thus, when an A-to-I editing event is initiated by a snRNA molecule of the present disclosure, the resulting target RNA bearing an inosine is recognized as bearing a guanine instead of an adenosine. In some embodiments, a guanine-to-adenosine point mutation can be corrected using a snRNA molecule of the present disclosure. In some embodiments, an A-to-I editing event can result in a single amino acid mutation in the expressed protein of interest. An A-to-I editing event can remove a stop codon in the mRNA sequence. In some embodiments, the stop codon is a premature stop codon. Thus, removal of the premature stop codon can result in rescued translation of the protein of interest.

[0091] In some embodiments, the targeting sequences of the present disclosure contain at least one base pair mismatch and are at least about 1, at least about 5, at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, or at least about 200 nucleotides in length. In some embodiments, the targeting sequences of the present disclosure are at least about 10, 20, 30, 40, 50, 60, or about 70 nucleotides in length.

[0092] In some embodiments, targeting sequences of the present disclosure include extended complementarity with no base pair mismatches and are at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, or at least about 200 nucleotides in length.

[0093] In some embodiments, editing efficiency correlates with the length of the targeting sequence.

[0094] In some embodiments, the targeting sequence of the present disclosure comprises perfect sequence complementarity to the target RNA sequence, except for an AC mismatch at the site of the edited adenosine.

[0095] The targeting sequences of the present disclosure can comprise, consist essentially of, or consist of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical (or any percentage therebetween) to the following nucleic acid sequence: [Table 1]

[0096] An exemplary snRNA molecule containing a base pair mismatch targeting sequence is shown in Figures 4A and 4B. Figure 4C shows an exemplary snRNA bound to a target mRNA sequence. The binding site contains an AC mismatch at the adenosine editing site.

[0097] The snRNA molecule of the present disclosure can comprise one or more additional targeting sequences that bind to the target RNA sequence of the present disclosure.In some embodiments, one or more additional targeting sequences comprise the complete sequence that is complementary to the target RNA sequence.In some embodiments, one or more additional targeting sequences can comprise base pair mismatch.

[0098] The additional targeting sequences of the present disclosure can be utilized to confer enhanced binding affinity or specificity to the snRNA for the target RNA. In some embodiments, the snRNA of the present disclosure comprises at least one, at least two, at least three, at least four, at least five, at least six, at least seven, or at least eight additional targeting sequences. In some embodiments, a nucleic acid linker sequence is used to separate the binding sites. Exemplary snRNA molecules comprising additional targeting sequences are shown in Figures 5A and 5B. Figure 5C shows a multi-binding site snRNA bound to a target mRNA sequence. Binding site 1 contains an AC mismatch at the site of adenosine editing. Binding sites 2-4 do not contain base pair mismatches.

[0099] The present disclosure provides snRNA molecules that can bind to RNA sequences encoding SOD1. Accordingly, the present disclosure provides SOD1 targeting sequences. The targeting sequences that bind to SOD1 can comprise, consist essentially of, or consist of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical (or any percentage therebetween) to one or more of the following nucleotide sequences shown in the table below: [Table 2-1] [Table 2-2]

[0100] The present disclosure provides snRNA molecules that can bind to RNA sequences encoding IDUA. Accordingly, the present disclosure provides IDUA targeting sequences. Targeting sequences that bind to IDUA can comprise, consist essentially of, or consist of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical (or any percentage therebetween) to one or more of the following nucleotide sequences listed in Table 1 below: [Table 3]

[0101] The present disclosure provides snRNA molecules that can bind to an RNA sequence encoding MBNL1. Accordingly, the present disclosure provides MBNL1 targeting sequences. Targeting sequences that bind to MBNL1 can comprise, consist essentially of, or consist of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical (or any percentage therebetween) to one or more of the following nucleotide sequences listed in the table below: [Table 4]

[0102] Sm-binding domain The snRNA systems disclosed herein utilize Sm-binding domains (SmBDs). The Sm protein ring that assembles around the SmBD domain to form snRNPs includes SmB / B', SmD1, SmD2, SmD3, SmE, SmF, and SmG. The U7 Sm-binding site can recruit endogenous RNA-binding factors and replace non-U7 snRNAs, making the snRNA more stable. In one embodiment, the SmBD is selected from the group consisting of U1, U2, U4, and U5 snRNAs. In another embodiment, the SmBD is derived from a pseudo-snRNA. In another embodiment, the SmBD is a nucleotide sequence comprising SEQ ID NO:49 (aATTTTTGGAGca). In another embodiment, the SmBD is a nucleotide sequence comprising SEQ ID NO:50 (ATTTTT). In another embodiment, the SmBD comprises a nucleotide sequence selected from the group consisting of SEQ ID NO:51 (AATTTTTGG), SEQ ID NO:52 (AATTTGTGG), SEQ ID NO:53 (AATTTGTGG), SEQ ID NO:54 (AATTTCTGG), SEQ ID NO:55 (GATTTTTGG), SEQ ID NO:56 (AATTTTTGA), and SEQ ID NO:57 (AATTTTTTG). In another embodiment, the SmBD is a nucleotide sequence comprising SEQ ID NO:92 (AATTTTTGGAGTA).

[0103] snRNA promoter The gene therapy and RNA-targeting snRNA gene therapy compositions of the present disclosure contain promoter sequences derived from snRNA. A "promoter" is a regulatory sequence that is a region of a polynucleotide sequence where the initiation and rate of transcription are controlled. It can contain genetic elements to which regulatory proteins and molecules (e.g., RNA polymerase and other transcription factors) can bind.

[0104] The snRNA system disclosed herein is operably linked to a snRNA promoter derived from any of U1 to U12. In one embodiment, the snRNA promoter is a U7 promoter. In another embodiment, the U7 promoter is a human U7 promoter (hU7) or a mouse U7 promoter (mU7). In another embodiment, the U7 promoter is an endogenous human U7 promoter that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO:58:TACTGCCGAATCCAGGTCTCCGGGCTTAACAACAACGAAGGGGCTGTGACTGGCTGCTTTCTCAACCAATCAGCACCGAACTCATTTGCATGGGCTGAGAACAAATGTTCGCGAACTCTAGAAATGAATGACTTAAGTAAGTTCCTTAGAATATTATTTTTCCTACTGAAAGTTACCACATGCGTCGTTGTTTATACAGTAATAGGAACAAGAAAAAAGTCACCTAAGCTCACCCTCATCAATTGTGGAGTTCCTTTATATCCCATCTTCTCTCCAAACACATACGCA. In one embodiment, the snRNA promoter is a U1 promoter. In another embodiment, the U1 promoter is a human U1 promoter or a mouse U1 promoter.

[0105] In other embodiments, the snRNA promoter is a Pol II promoter or a Pol III promoter. In other embodiments, the snRNA promoter comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical (or any percentage therebetween) to a promoter and / or promoter sequence listed in the following exemplary promoter table: [Table 5-1] [Table 5-2] [Table 5-3]

[0106] Terminator sequence The snRNA system disclosed herein comprises a snRNA downstream terminator (DT). In one embodiment, the snRNA DT is U7 DT, which comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical (or any percentage therebetween) to SEQ ID NO:72:CCTCTTATGATGTTTGTTGCCAATGATAGATTGTTTTCACTGTGCAAAAATTATGGGTAGTTTTGGTGGTCTTGATGCAGTTGTAAGCTTGGAG.

[0107] In another embodiment, the snRNA system disclosed herein comprises any promoter selected from the exemplary promoter table above and any DT selected from the exemplary DT table below. Such promoters and DTs do not have to correspond to each other (e.g., U1 promoter, U1 DT) (e.g., U7 promoter, U1 DT).

[0108] In another embodiment, the DT comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical (or any percentage therebetween) to the exemplary DT and / or DT sequences listed in the exemplary DT table below: [Table 6]

[0109] AAV vectors In one embodiment, the snRNA is delivered in an AAV vector.

[0110] In some embodiments, the AAV vector comprises multiple copies of the snRNA. In some embodiments, the multiple copies of the snRNA are 2, 3, or 4 copies of the snRNA. In some embodiments, the multiple copies of the snRNA are 4 or more copies of the snRNA. In some embodiments, the AAV vector comprises multiple snRNAs, each of which targets a different RNA sequence.

[0111] Buffer array In some embodiments, each snRNA in the multiple copies of the snRNA is separated by a nucleic acid buffer sequence derived from a human non-coding genomic sequence downstream of the snRNA. In one embodiment, the buffer sequence is derived from a human genomic sequence downstream of U7.

[0112] In one embodiment, the buffer sequence comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical (or any percentage therebetween) to the group consisting of the following nucleic acid sequences:

[0113] Buffer 1 (30bp) CAAACTACAGAGCCAAGTGCTATCCACAGA(SEQ ID NO:42),

[0114] Buffer 2 (30bp) GAGCTTTCTGGGTTGCCATCTCAAGCAGAC(SEQ ID NO:43),

[0115] Buffer 3 (30 bp) TACAAGGCCATCAGCTCATACTCACAATTG (SEQ ID NO: 44), and combinations thereof.

[0116] In another embodiment, the buffer sequence comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical (or any percentage therebetween) to the group consisting of the following nucleic acid sequences:

[0117] Buffer 1 (100bp) CAAACTACAGAGCCAAGTGCTATCCACAGAGAGCTTTCTGGGTTGCCATCTCAAGCAGACTACAAGGCCATCAGCTCATACTCACAATTGACTTTGAGAG(SEQ ID NO:45)

[0118] Buffer 2 (100bp) TTGACCACATACGTGCTCTTTCAAAGTTCTGTGTTTGAAGTTATGTTAGTAACAACTGATGCCCATCCTGCAATGACAAATCCAATTCTCAGTGCAGCTC(SEQ ID NO:46),

[0119] and combinations thereof.

[0120] In another embodiment, the buffer sequence comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical (or any percentage therebetween) to the group consisting of the following nucleic acid sequences:

[0121] Buffer 1 (500bp) CAAACTACAGAGCCAAGTGCTATCCACAGAGAGCTTTCTGGGTTGCCATCTCAAGCAGACTACAAGGCCATCAGCTCATACTCACAATTGACTTTGAGAGTCATTTTCCAATGCTCCTACACACCCCTTCTTCACAATCCCCAACAAATCTGAGGCTGGAACTTGGTACCATAACAATCATTACATTATTTCACCAGAAGTACACCTTGCCTGGAAGATTGGCATTATAGCATCTTCTAACATTGTGAAAGTTAGTGACCAATGAGGAGATCCAAGTCAGTTCCAGTTGGATTTCTCTATACTCTATAATAAATATATATGGTGTCTTCAACAATAGGACTTTGCCATCCAGTGATGCTAAAAATCAATAACAATGGCAATAACCTGCCCTGTTTGGAAAGCCTCTGGCTTCCATGACTAACAATTCAAGGCAGGTCTCCTATACCTAGTACTGAGATTTTTATTTGATAAACTATATCTTCTGGGAGGAGAAGCATTGT(SEQ ID NO:47)

[0122] Buffer 2 (500bp) TTGACCACATACGTGCTCTTTCAAAGTTCTGTGTTTGAAGTTATGTTAGTAACAACTGATGCCCATCCTGCAATGACAAATCCAATTCTCAGTGCAGCTCTCTGAAATAGTTTTGCTTTCTCTCTCTAGGTCTGTTCTATACTCCTAACTCTCCAGGAGTTTACAAGGAATAAAATCTCTTCCAAATGCTTTCTGTTGCAACAACTGGACCATACTGAAAGCTGAGGCCCACAATTGCAATCTAGGTTAGCAGGTAATCATTGTTGGTGAGGTCCTCCCTTTCCCCAGGCTCGTGTTTGTATTGGGGAGCAGGAAATTTTTGCTAGAGCAGCACTGCCATCTCTCTACACTCCACCTGATTGGTGGGATGGACCAGAGAAATGGACATTCCCAACACAGTCCCTCCTTTCACATCTGCTCACCTGCCCACAGGATACTTTCCACCATGCATACTGGGCTCTGCACCAACCATTCAGCAGTGATGAAGAGGAAACTTGAAC(SEQ ID NO:48), and / or combinations thereof.

[0123] The 100-bp and 500-bp buffer 1 sequences are derived from sequences starting 100 bp downstream of mouse (Mus musculus) U7 pseudogene 8 (Location Chromosome 14: 4,409,359-4,409,421, reverse strand). GRCm39:CM001007.3). The 100-bp and 500-bp buffer 2 are derived from sequences starting 130 bp downstream of human U7 pseudogene 5 (Chromosome X: 140,451,148-140,451,208, forward strand). GRCm39:CM001007.3). Both 100-bp buffers are the first 100 bp of the corresponding 500-bp buffers. 30-bp buffers 1, 2, and 3 are contiguous 30-bp sequences within "100-bp buffer 1" downstream of Mus musculus U7 pseudogene 8. These downstream sequences were selected due to the lack of repetitive sequences, 40-60% GC content for the entire buffer, 40-60% GC content in the 20 bp regions on either side of the buffer, and minimal sequence complexity, as well as the absence of any known regulatory sites or genes within or near the sequence (using Gencode / Ensembl).

[0124] An exemplary snRNA construct is as follows:

[0125] SOD1 (superoxide dismutase) contains a toxic mutation that results in the SOD1 protein causing ALS (amyotrophic lateral sclerosis). The disclosed editing snRNAs provided herein can be used to target and edit the SOD1 start codon, resulting in reduced SOD1 expression.

[0126] Exemplary SOD1 editing constructs are as follows: [Table 7] [Table 8] [Table 9] [Table 10] Table 11 Table 12 Table 13 Table 14 Table 15 Table 16 Table 17 Table 18 Table 19 Table 20 Table 21 Table 22 Table 23 Table 24 Table 25 Table 26 Table 27 Table 28 [Table 29] [Table 30] [Table 31] [Table 32] [Table 33] [Table 34] [Table 35] [Table 36] [Table 37] [Table 38]

[0127] IDUA (α-L-iduronidase (IDUA): Most MPS (mucopolysaccharidosis) IH patients have premature stop codon mutations in one or both alleles, resulting in the inability to synthesize full-length polypeptides and loss of enzyme activity. Two premature stop codons in the α-L-iduronidase (IDUA) gene, Q70X and W402X, are the most common (70%) mutations in MPS I patients, a rare recessive lysosomal storage disease, a progressive multisystemic disorder caused by reduced or absent IDUA enzyme activity secondary to biallelic loss-of-function variants in IDUA. snRNA-mediated targeting of IDUA W402X / exon 9 results in improved stability and reduced immunogenicity / off-target potential compared to prime editors or conventional gene therapy enzyme replacement.

[0128] An exemplary IDUA editing construct is as follows: [Table 39]

[0129] In one embodiment, the A05318 vector comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical (or any percentage in between) to SEQ ID NO:177. [Table 40]

[0130] In one embodiment, the A05319 vector comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical (or any percentage in between) to SEQ ID NO:178. [Table 41]

[0131] In one embodiment, the A05320 vector comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical (or any percentage in between) to SEQ ID NO:179. [Table 42]

[0132] In one embodiment, the A05322 vector comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical (or any percentage therebetween) to SEQ ID NO:180. [Table 43]

[0133] In one embodiment, the A05488 vector comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical (or any percentage therebetween) to SEQ ID NO:181. [Table 44]

[0134] In one embodiment, the A05489 vector comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical (or any percentage in between) to SEQ ID NO:182. [Table 45]

[0135] In one embodiment, the A05490 vector comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical (or any percentage therebetween) to SEQ ID NO:183. [Table 46]

[0136] In one embodiment, the A05492 vector comprises, consists essentially of, or consists of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical (or any percentage therebetween) to SEQ ID NO:184.

[0137] MBNL1 (Muscleblind-like protein 1) is an RNA-binding protein that is sequestered by pathological CUG repeats, resulting in a loss of functional MBNL1 in myotonic dystrophy (DM1). Targeting and editing the MBNL1 binding site results in increased MBNL1 expression, thereby treating DM1.

[0138] An exemplary MBNL1 editing construct is as follows: [Table 47] [Table 48] [Table 49] [Table 50] [Table 51] [Table 52] [Table 53] [Table 54] [Table 55] [Table 56] Table 57 Table 58 Table 59 Table 60 Table 61 Table 62 Table 63 Table 64 Table 65 Table 66 Table 67 Table 68 Table 69 Table 70 Table 71 Table 72 Table 73 Table 74 [Table 75] [Table 76] [Table 77] [Table 78] [Table 79] [Table 80] [Table 81] [Table 82] Further exemplary RNA targeting constructs of the present disclosure are as follows: [Table 83] [Table 84] [Table 85] [Table 86] [Table 87] [Table 88] [Table 89] [Table 90] [Table 91] [Table 92] [Table 93] [Table 94] [Table 95] [Table 96] [Table 97] [Table 98] [Table 99] [Table 100]

[0139] vector Also provided herein are vectors (e.g., recombinant expression vectors) comprising the snRNAs of the present disclosure. In one embodiment, the snRNAs are delivered in a vector.

[0140] In some embodiments of the compositions and methods of the invention, the vector comprises the snRNA. In some embodiments, the therapeutic snRNA is in a single or single vector.

[0141] In some embodiments of the compositions and methods of the present disclosure, the RNA-binding snRNA system capable of targeting a G to A mutation or other specific adenine in a target RNA sequence is in a single vector.

[0142] One type of vector is a "plasmid," which refers to a circular double-stranded DNA loop into which additional DNA segments can be inserted, such as by standard molecular cloning techniques. Another type of vector is a viral vector, in which virally derived DNA or RNA sequences are present in the vector for packaging into a virus (e.g., retrovirus, replication-deficient retrovirus, adenovirus, replication-deficient adenovirus, and adeno-associated virus). Viral vectors also include polynucleotides carried by the virus for transfection into host cells. In some embodiments, the vector is a lentivirus (e.g., an integration-deficient lentiviral vector) or an adeno-associated virus (AAV) vector. Vectors can replicate autonomously in host cells into which they are introduced; for example, bacterial vectors and episomal mammalian vectors having a bacterial origin of replication, and other vectors, such as non-episomal mammalian vectors, are integrated into the genome of the host cell upon introduction into the host cell, thereby replicating along with the host genome.

[0143] In some embodiments, vectors, such as expression vectors, can direct the expression of genes to which they are operably linked. Common expression vectors are often in the form of plasmids. In some embodiments, the recombinant expression vector contains a nucleic acid provided herein, such as, for example, snRNA, in a form suitable for expression of a protein in a host cell. The recombinant expression vector includes one or more regulatory elements operably linked to the nucleic acid sequence to be expressed, which may be selected based on the host cell used for expression. Within the recombinant expression vector, "operably linked" is intended to mean that the nucleotide sequence of interest is linked to a regulatory element in a manner that allows for expression of the nucleotide sequence, for example, in an in vitro transcription / translation system or in a host cell when the vector is introduced into the host cell.

[0144] The particular embodiment of the vector will depend on factors such as the choice of host cell to be transformed and the desired expression level, etc. The vector can be introduced into a host cell to thereby produce the transcripts, proteins, or peptides, including fusion proteins or peptides, encoded by the nucleic acids described herein, e.g., snRNAs, CRISPR transcripts, proteins, enzymes, mutant forms thereof, fusion proteins thereof, etc.

[0145] In some embodiments of the compositions and methods of the present disclosure, the expression vectors, viral vectors, or non-viral vectors provided herein include, but are not limited to, expression control elements. As used herein, "expression control elements" refers to any sequence that regulates the expression of a coding sequence, such as a gene. Exemplary expression control elements include, but are not limited to, promoters, enhancers, microRNAs, post-transcriptional regulatory elements, polyadenylation signal sequences, and introns. Expression control elements can be, for example, constitutive, inducible, repressible, or tissue-specific. A "promoter" is a regulatory sequence that is a region of a polynucleotide sequence where the initiation and rate of transcription are controlled. It can contain genetic elements to which regulatory proteins and molecules (e.g., RNA polymerase and other transcription factors) can bind. An "enhancer" is a region of DNA that can be bound by an activating protein to increase the likelihood or frequency of transcription.

[0146] In some embodiments of the compositions and methods of the present disclosure, the expression vectors, viral vectors or non-viral vectors provided herein include vector elements such as, but not limited to, buffering sequences derived from human genomic sequences downstream of the snRNAs, thus providing the ability to encode multiple snRNAs from a single construct.

[0147] In some embodiments, the snRNA constructs disclosed herein comprise a bidirectional snRNA promoter for expressing the snRNA.

[0148] In another embodiment, the vector construct may include a linker, a signal sequence, and / or a tag.

[0149] viral vectors In some embodiments of the compositions and methods of the present disclosure, the vector of the present disclosure is a viral vector. In some embodiments, the viral vector comprises sequences isolated or derived from a retrovirus. In some embodiments, the viral vector comprises sequences isolated or derived from a lentivirus. In some embodiments, the viral vector comprises sequences isolated or derived from an adenovirus. In some embodiments, the viral vector comprises sequences isolated or derived from an adeno-associated virus (AAV). In some embodiments, the viral vector is replication-incompetent. In some embodiments, the viral vector is isolated or recombinant. In some embodiments, the viral vector is self-complementary.

[0150] Adeno-associated virus vector In some embodiments, the vectors described herein are AAV viral vectors. The terms "adeno-associated virus" or "AAV," as used herein, refer to members of a class of viruses related to this name and belonging to the genus Dexyparvovirus, family Parvoviridae. Adeno-associated viruses are single-stranded DNA viruses that grow in cells, with certain functions provided by a co-infecting helper virus. General information and reviews of AAV can be found, for example, in Carter, 1989, Handbook of Parvoviruses, Vol. 1, pp. 169-228, and Berns, 1990, Virology, pp. 1743-1764, Raven Press, New York. It is fully expected that the same principles described in these reviews will be applicable to additional AAV serotypes characterized after the publication date of these reviews, as the various serotypes are well known to be very closely related structurally, functionally, and at the genetic level. (See, e.g., Blacklowe, 1988, pp. 165-174 of Parvoviruses and Human Disease, J.R.P.Tattison, ed., and Rose, Comprehensive Virology 3:1-61 (1974)). For example, all AAV serotypes clearly exhibit very similar replication characteristics mediated by homologous rep genes; and all possess three related capsid proteins, such as those expressed in AAV2. The degree of relatedness is further suggested by extensive cross-hybridization between serotypes along the length of the genome; and heteroduplex analysis, which reveals the presence of similar self-annealing segments at the ends corresponding to "inverted terminal repeats" (ITRs). Similar infectivity patterns also suggest that the replication functions in each serotype are under similar regulatory control. Multiple serotypes of this virus are known to be suitable for gene delivery. All known serotypes are capable of infecting cells from a variety of tissue types.

[0151] AAV has unique features that make it attractive as a vector for delivering foreign DNA to cells, for example, in gene therapy. AAV infection of cells in culture is noncytopathic, and natural infection in humans and other animals is silent and asymptomatic. Furthermore, AAV infects many mammalian cell types, enabling the possibility of targeting many different tissues in vivo. Furthermore, AAV can slowly transduce dividing and non-dividing cells and persist essentially for the lifespan of these cells as a transcriptionally active nuclear episome (extrachromosomal element). The AAV proviral genome is inserted as cloned DNA into plasmids, which allows for the construction of recombinant genomes. Furthermore, because signals directing AAV replication and genome encapsidation are contained within the ITRs of the AAV genome, some or all of the internal approximately 4.3 kb of the genome (encoding the replication and structural capsid proteins, rep-cap) can be replaced with foreign DNA to generate AAV vectors. The rep and cap proteins can be provided in trans. Another important feature of AAV is that it is an extremely stable and robust virus. It easily withstands the conditions used to inactivate adenovirus (56-65°C for several hours), making cryopreservation of AAV less important. AAV can also be lyophilized. Finally, AAV-infected cells are not resistant to superinfection.

[0152] The recombinant AAV (rAAV) genome of the present invention can comprise, consist essentially of, or consist of ITRs encoding at least one esnRNA and one or more AAV ITRs flanking that ITR. The production of pseudotyped rAAV is disclosed, for example, in WO2001083692. Other types of rAAV variants, such as rAAVs with capsid mutations, are also contemplated. See, for example, Marsic et al., Molecular Therapy, 22(11):1900-1909 (2014). The nucleotide sequences of the genomes of various AAV serotypes are known in the art.

[0153] The AAV vectors described herein can comprise, consist essentially of, or consist of one or more nucleic acid molecules and one or more AAV ITRs. In some embodiments, they encode the esnRNAs of the invention. Such AAV vectors, when present in a host cell that provides the functionality of the rep and cap gene products, can be replicated and packaged into infectious viral particles, e.g., by transfection of the host cell. In some embodiments, the AAV vector contains a promoter, at least one nucleic acid capable of encoding at least one protein or RNA, and / or an enhancer and / or terminator within the flanking ITRs that are packaged into infectious AAV particles. The encapsidated nucleic acid portion may be referred to as the AAV vector genome. Plasmids containing AAV vectors may also contain elements for manufacturing purposes (e.g., antibiotic resistance genes, origin of replication sequences, etc.), but these are not encapsidated and therefore do not form part of the AAV particle.

[0154] In some embodiments, an AAV vector may comprise at least one nucleic acid encoding a snRNA of the present disclosure. In some embodiments, an AAV vector may comprise at least one regulatory sequence. In some embodiments, an AAV vector may comprise at least one AAV inverted terminal repeat (ITR) sequence. In some embodiments, an AAV vector may comprise a first ITR sequence and a second ITR sequence. In some embodiments, an AAV vector may comprise at least one promoter sequence. In some embodiments, an AAV vector may comprise at least one enhancer sequence. In some embodiments, an AAV vector may comprise at least one terminator sequence. In some embodiments, an AAV vector may comprise at least one polyA sequence. In some embodiments, an AAV vector may comprise at least one linker sequence. In some embodiments, an AAV vector may comprise at least one buffer sequence. In some embodiments, an AAV vector of the present disclosure may comprise at least one nuclear localization signal, nuclear export signal, and / or both.

[0155] In some embodiments, an AAV vector can comprise a first AAV ITR sequence, a promoter sequence, an snRNA sequence, a terminator sequence, and a second AAV ITR sequence. In some embodiments, an AAV vector can comprise, in the 5' to 3' direction, a first AAV ITR sequence, a promoter sequence, an snRNA sequence, a terminator sequence, and a second AAV ITR sequence.

[0156] In some embodiments, an AAV vector may comprise a first AAV ITR sequence, a first promoter sequence, a first snRNA sequence, a termination sequence, a second promoter sequence, a second snRNA sequence, a second termination sequence, and a second AAV ITR sequence. In some embodiments, an AAV vector may comprise a first AAV ITR sequence, a first promoter sequence, a first snRNA sequence, a termination sequence, a second promoter sequence, a second snRNA sequence, a second termination sequence, a third promoter sequence, a third snRNA sequence, a third termination sequence, and a second AAV ITR sequence. In some embodiments, an AAV vector may comprise a first AAV ITR sequence, a first promoter sequence, a first snRNA sequence, a termination sequence, a second promoter sequence, a second snRNA sequence, a second termination sequence, and a second AAV ITR sequence. In some embodiments, the AAV vector may comprise a first AAV ITR sequence, a first promoter sequence, a first snRNA sequence, a termination, a second promoter sequence, a second snRNA sequence, a second termination sequence, a third promoter sequence, a third snRNA sequence, a third termination sequence, a fourth promoter sequence, a fourth snRNA sequence, a fourth termination sequence, and a second AAV ITR sequence.

[0157] In some embodiments of the compositions and methods of the present disclosure, the viral vector comprises sequences isolated or derived from an adeno-associated virus (AAV). In some embodiments, the viral vector comprises ITR sequences or capsid sequences isolated or derived from an AAV of serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrhlO, AAVll, or AAV12. In some embodiments, the AAV is AAVrhl.74. In one embodiment, the AAV vector comprises a modified capsid. In one embodiment, the AAV vector is an AAV2-Tyr mutant vector. In one embodiment, the AAV vector comprises a capsid with a non-tyrosine amino acid at a position corresponding to the surface-exposed tyrosine residue at Tyr252, Tyr272, Tyr275, Tyr281, Tyr508, Tyr612, Tyr704, Tyr720, Tyr730, or Tyr673 of wild-type AAV2. See also WO 2008 / 124724, which is incorporated herein in its entirety. In some embodiments, the AAV vector comprises an engineered capsid. AAV vectors comprising engineered capsids include, but are not limited to, AAV2.7m8, AAV9.7m8, AAV2 2tYF, and AAV8 Y733F. In some embodiments, the capsid is a ubiquitination-resistant capsid. In another embodiment, the ubiquitination capsid is an AAV2 capsid containing tyrosine (Y) and serine (S) mutations. In another embodiment, the AAV2 capsid comprises Y, S, and threonine (T) mutations. In another embodiment, the AAV2 capsid comprises AAV2 capsid mutants such as, but not limited to, T455V, T491V, T550V, T659V, Y444+500+730F, and Y444+500+730F+T491V. In some embodiments, the viral vector is replication-incompetent. In some embodiments, the viral vector is isolated or recombinant (rAAV). In some embodiments, the viral vector is self-complementary (rAAV). In some embodiments, the viral vector is single-stranded (ssAAV).

[0158] In some embodiments, the snRNA provided herein is comprised within a single-stranded AAV (ssAAV). In some embodiments, the snRNA provided herein is comprised within a self-complementary AAV (scAAV). The single-stranded nature of the parvoviral genome requires the use of cellular machinery to provide a complementary strand for gene expression. This cell recruitment activity is thought to be a rate-limiting factor in the efficiency of transduction and gene expression in parvoviruses and parvoviral particles. The use of scAAV over ssAAV ameliorates this well-known problem by packaging both strands as a single double-stranded DNA molecule (or inverted repeat genome) that can fold into dsDNA as a result of the self-complementary viral genomic sequences. In this respect, the need for base pairing between the viral genomes prior to DNA synthesis is eliminated.

[0159] AAV ITR sequences In some embodiments of the compositions and methods of the present disclosure, the AAV inverted terminal repeat sequences can comprise any AAV ITR sequence known in the art. In some embodiments, the AAV ITR sequences can comprise or consist of an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrhlO, AAV11, AAV12, AAV13, or AAVrhl74 ITR sequence.

[0160] In some embodiments, the ITR sequences may comprise modified AAV ITR sequences.

[0161] In some embodiments, the AAV ITR sequences may comprise, consist essentially of, or consist of a nucleic acid sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical (or any percentage in between) to SEQ ID NO:89 or SEQ ID NO:90.

[0162] In some embodiments, the AAV vectors provided herein comprise first and second AAV ITR sequences. In some embodiments, the first AAV ITR sequence can comprise, consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO:89 or SEQ ID NO:90, and the second AAV ITR sequence can comprise, consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% (or any percentage in between) identical to SEQ ID NO:89 or SEQ ID NO:90. In some embodiments, the first AAV ITR sequence is located 5' of the AAV vector. In some embodiments, the second AAV ITR sequence is located 3' of the AAV vector.

[0163] In some embodiments, the first AAV ITR sequence comprises the amino acid sequence set forth in SEQ ID NO:89 or SEQ ID NO:90. In some embodiments, the second AAV ITR sequence comprises the amino acid sequence set forth in SEQ ID NO:89 or SEQ ID NO:90. In some embodiments, the AAV vectors provided herein comprise a first AAV ITR sequence comprising the sequence set forth in SEQ ID NO:89 and a second AAV ITR sequence comprising the sequence set forth in SEQ ID NO:90. In some embodiments, the first AAV ITR sequence is located 5' of the AAV vector. In some embodiments, the second AAV ITR sequence is located 3' of the AAV vector.

[0164] In some embodiments of the compositions and methods of the present disclosure, the viral vector comprises sequences isolated or derived from an adeno-associated virus (AAV).

[0165] In some embodiments of the compositions and methods of the present disclosure, the vector of the present disclosure is a non-viral vector. In some embodiments, the vector comprises or consists of a nanoparticle, a micelle, a liposome or lipoplex, a polymersome, a polyplex, or a dendrimer. In some embodiments, the vector is an expression vector or a recombinant expression system. As used herein, the term "recombinant expression system" refers to a genetic construct for the expression of specific genetic material formed by recombination.

[0166] Non-viral vectors In some embodiments of the compositions and methods of the present disclosure, the vector of the present disclosure is a non-viral vector. In some embodiments, the vector comprises or consists of a nanoparticle, a micelle, a liposome or lipoplex, a polymersome, a polyplex, or a dendrimer. In some embodiments, the vector is an expression vector or a recombinant expression system. As used herein, the term "recombinant expression system" refers to a genetic construct for the expression of specific genetic material formed by recombination.

[0167] Promoter sequence The gene therapy and RNA-targeted snRNA gene therapy compositions of the present disclosure include promoter sequences derived from snRNA.

[0168] A "promoter" is a control sequence that is a region of a polynucleotide sequence at which the initiation and rate of transcription are controlled. It can contain genetic elements to which regulatory proteins and molecules (e.g., RNA polymerase and other transcription factors) can bind.

[0169] In some embodiments of the compositions and methods of the present disclosure, the expression vectors, viral vectors, or non-viral vectors provided herein include, but are not limited to, expression control elements. As used herein, "expression control elements" refers to any sequence that regulates the expression of a coding sequence, such as a gene. Exemplary expression control elements include, but are not limited to, promoters, enhancers, microRNAs, post-transcriptional regulatory elements, polyadenylation signal sequences, and introns. Expression control elements can be, for example, constitutive, inducible, repressible, or tissue-specific. A "promoter" is a regulatory sequence that is a region of a polynucleotide sequence where the initiation and rate of transcription are controlled. It can contain genetic elements to which regulatory proteins and molecules (e.g., RNA polymerase and other transcription factors) can bind. An "enhancer" is a region of DNA that can be bound by an activating protein to increase the likelihood or frequency of transcription.

[0170] In some embodiments of the compositions and methods of the present disclosure, the expression vectors, viral vectors or non-viral vectors provided herein include vector elements such as, but not limited to, buffering sequences derived from human genomic sequences downstream of the snRNAs, thus providing the ability to encode multiple snRNAs from a single construct.

[0171] In some embodiments, the snRNA constructs disclosed herein comprise a bidirectional promoter for expressing the snRNA.

[0172] In another embodiment, the vector construct may include a linker, a signal sequence, and / or a tag.

[0173] In some embodiments, the vector is a viral vector. In some embodiments, the vector is an adenoviral vector, an adeno-associated viral (AAV) vector, or a lentiviral vector. In some embodiments, the vector is a retroviral vector, an adenoviral / retroviral chimeric vector, a herpes simplex virus I or II vector, a parvoviral vector, a reticuloendotheliosis virus vector, a poliovirus vector, a papillomavirus vector, a vaccinia virus vector, or any hybrid or chimeric vector incorporating preferred aspects of two or more viral vectors. In some embodiments, the vector further comprises one or more expression control elements operably linked to the polynucleotide. In some embodiments, the vector further comprises one or more selectable markers. In some embodiments, the AAV vector has low toxicity. In some embodiments, the AAV vector does not integrate into the host genome, thereby reducing the likelihood of insertional mutagenesis. In some embodiments, the AAV vector can encode a total polynucleotide in the range of 4.5 kb to 4.75 kb. In some embodiments, exemplary AAV vectors that may be used in any of the compositions, systems, methods, and kits described herein are AAV1 vectors, modified AAV1 vectors, AAV2 vectors, modified AAV2 vectors, AAV2-Tyr mutant vectors, AAV3 vectors, modified AAV3 vectors, AAV4 vectors, modified AAV4 vectors, AAV5 vectors, modified AAV5 vectors, AAV6 vectors, modified AAV6 vectors, AAV7 vectors, modified AAV7 vectors, AAV8 vectors, AAVrh8 vectors, and AAVrh8 vectors. vectors, AAV9 vectors, AAV.rh10 vectors, modified AAV.rh10 vectors, AAVrh.74, AAV.rh32 / 33 vectors, modified AAV.rh32 / 33 vectors, AAV.rh43 vectors, modified AAV.rh43 vectors, AAV.rh64R1 vectors, and modified AAV.rh64R1 vectors, AAV-Tyr mutant vectors, AAV-Tyr-Ser mutant vectors, AAV-Tyr-Ser-Thr mutant vectors, and any combination or equivalent thereof.

[0174] Lentiviral vectors In some embodiments, the lentiviral vector is an integrase-competent lentiviral vector (ICLV). In some embodiments, the lentiviral vector can refer to a transgene plasmid vector, as well as a transgene plasmid vector together with related plasmids (e.g., packaging plasmids, rev expression plasmids, envelope plasmids), and lentivirus-based particles that can introduce exogenous nucleic acids into cells via a viral or viral-like entry mechanism. Lentiviral vectors are well known in the art (see, for example, Trono D. (2002) Lentiviral vectors, New York: Spring-Verlag Berlin Heidelberg and Durand et al. (2011) Viruses 3(2):132-159 doi:10.3390 / v3020132). In some embodiments, exemplary lentiviral vectors that may be used in any of the compositions, systems, methods, and kits described herein are human immunodeficiency virus (HIV) 1 vectors, modified human immunodeficiency virus (HIV) 1 vectors, human immunodeficiency virus (HIV) 2 vectors, modified human immunodeficiency virus (HIV) 2 vectors, Susmangakayi Immunodeficiency Virus (SIVSM) vectors, modified Susmangakayi Immunodeficiency Virus (SIVSM) vectors, African green monkey immunodeficiency virus (SIVAGM) vectors, modified African green monkey immunodeficiency virus (SIVSM) vectors, The vector may comprise a rusal immunodeficiency virus (SIVAGM) vector, an equine infectious anemia virus (EIAV) vector, a modified equine infectious anemia virus (EIAV) vector, a feline immunodeficiency virus (FIV) vector, a modified feline immunodeficiency virus (FIV) vector, a visna / maedi virus (VNV / VMV) vector, a modified visna / maedi virus (VNV / VMV) vector, a caprine arthritis encephalitis virus (CAEV) vector, a modified caprine arthritis encephalitis virus (CAEV) vector, a bovine immunodeficiency virus (BIV), or a modified bovine immunodeficiency virus (BIV).

[0175] nucleic acid A NOI (nucleotide sequence of interest) includes, but is not limited to, any nucleotide sequence or transgene that can be delivered by a vector. A NOI can be synthetic, derived from naturally occurring DNA or RNA, codon-optimized, recombinant RNA / DNA, cDNA, partial genomic DNA, and / or combinations thereof. A NOI can be, but does not have to be, a coding region or partial coding region. A NOI can be RNA / DNA in sense or antisense orientation. A NOI can be snRNA. A NOI is also referred to herein as, but is not limited to, a transgene, a heterologous sequence, a gene, or a therapeutic gene. A NOI can also encode an RNA (ribonucleoprotein complex), a POI (protein of interest), a partial POI, a mutated version or variant of a POI. A POI can be similar to or correspond to a wild-type protein. A POI can also be a fusion protein or a ribonucleoprotein complex, such as an snRNP. In some embodiments, the RNA sequences disclosed herein may be expressed as DNA sequences, and it is within the skill of one of ordinary skill in the art to derive the sequence of an RNA sequence from a DNA sequence. For example, the spacer sequences of the present disclosure may represent a uracil base as either U or T. Those skilled in the art will readily understand that RNA sequences may use T or U interchangeably to represent uracil.

[0176] Codon optimization In some embodiments the NOI or transgene such as a nucleic acid sequence of the present disclosure is a codon optimised nucleic acid sequence.

[0177] In some embodiments, the NOI or transgene or GOI, such as a nucleic acid sequence encoding an RNA-targeting snRNA of the present disclosure, is a codon-optimized nucleic acid sequence. In some embodiments, the codon-optimized sequence exhibits at least 5%, at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, at least 100%, at least 200%, at least 300%, at least 500%, or at least 1000% increased transcription or translation in a human subject compared to a wild-type or non-codon-optimized nucleic acid sequence.

[0178] In some embodiments, the codon-optimized nucleic acid sequence exhibits increased stability. In some embodiments, the codon-optimized nucleic acid sequence exhibits increased stability through increased resistance to hydrolysis. In some embodiments, the codon-optimized sequence exhibits at least 5%, at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, at least 100%, at least 200%, at least 300%, at least 500%, or at least 1000% increased stability compared to a wild-type or non-codon-optimized nucleic acid sequence. In some embodiments, the codon-optimized sequence exhibits at least 5%, at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, at least 100%, at least 200%, at least 300%, at least 500%, or at least 1000% increased resistance to hydrolysis in a human subject compared to a wild-type or non-codon-optimized nucleic acid sequence.

[0179] In some embodiments, a codon-optimized nucleic acid sequence may contain no donor splice sites. In some embodiments, a codon-optimized nucleic acid sequence may contain about 1, or about 2, or about 3, or about 4, or about 5, or about 6, or about 7, or about 8, or about 9, or about 10 or fewer donor splice sites. In some embodiments, a codon-optimized nucleic acid sequence contains at least 1, or at least 2, or at least 3, or at least 4, or at least 5, or at least 6, or at least 7, or at least 8, or at least 9, or at least 10 fewer donor splice sites compared to a non-codon-optimized nucleic acid sequence.

[0180] Without wishing to be bound by theory, removal of donor splice sites in codon-optimized nucleic acid sequences can unexpectedly and unpredictably increase the expression of a protein of interest in vivo because cryptic splicing is prevented. Furthermore, cryptic splicing can vary between different subjects, meaning that the expression level of a protein containing a donor splice site can vary unpredictably between different subjects. Such unpredictability is unacceptable in the context of human therapy. Thus, codon-optimized nucleic acid sequences lacking donor splice sites unexpectedly and surprisingly enable increased protein expression in human subjects and regulate protein expression across different human subjects.

[0181] In some embodiments, the codon-optimized nucleic acid sequence may have a GC content that is different from the GC content of the non-codon-optimized nucleic acid sequence encoding the RNA-targeting snRNA. In some embodiments, the GC content of the codon-optimized nucleic acid sequence is more evenly distributed throughout the nucleic acid sequence compared to the non-codon-optimized nucleic acid sequence.

[0182] Without wishing to be bound by theory, by distributing GC content more evenly throughout the nucleic acid sequence, codon-optimized nucleic acid sequences exhibit a more uniform melting temperature ("Tm") across the length of the transcript. Uniformity of melting temperature unexpectedly results in increased expression of codon-optimized nucleic acids in human subjects, as transcription and / or translation of the nucleic acid sequence occurs with less stalling of polymerases and / or ribosomes.

[0183] In some embodiments, a codon-optimized nucleic acid sequence may have fewer inhibitory microRNA target binding sites compared to a non-codon-optimized nucleic acid sequence, hi some embodiments, a codon-optimized nucleic acid sequence may have at least one, or at least two, or at least three, or at least four, or at least five, or at least six, or at least seven, or at least eight, or at least nine, or at least ten, or at least ten fewer inhibitory microRNA target binding sites compared to a non-codon-optimized nucleic acid sequence.

[0184] Without wishing to be bound by theory, codon-optimized nucleic acid sequences unexpectedly exhibit increased expression in human subjects due to fewer inhibitory microRNA target binding sites.

[0185] Provided herein are nucleic acid sequences encoding gene therapy compositions or RNA-targeting snRNA systems for use in the gene transfer and expression techniques described herein. It is understood, although not always explicitly stated, that the sequences provided herein can be used to provide expression products, as well as substantially identical sequences that encode RNA or express and produce proteins with the same biological properties. These "biologically equivalent" or "biologically active" or "equivalent" polypeptides are encoded by equivalent polynucleotides described herein. They may have primary amino acid sequences that are at least 60%, or alternatively at least 65%, or alternatively at least 70%, or alternatively at least 75%, or alternatively at least 80%, or alternatively at least 85%, or alternatively at least 90%, or alternatively at least 95%, or alternatively at least 98% identical to a reference polypeptide when compared using sequence identity methods performed under default conditions. Specific polypeptide sequences are provided as examples of specific embodiments. Sequence modifications to amino acids with similarly charged replacement amino acids are also provided. Furthermore, an equivalent polynucleotide is a polynucleotide that hybridizes under stringent conditions to a reference polynucleotide or its complement, or, with respect to polypeptides, a polypeptide or its complement encoded by a polynucleotide that hybridizes under stringent conditions to a reference encoding polynucleotide. Alternatively, an equivalent polypeptide or protein is one that is expressed from an equivalent polynucleotide.

[0186] The NOI or nucleic acid sequences (e.g., polynucleotide sequences) disclosed herein can be codon-optimized, a technique well known in the art. Codon optimization refers to the fact that different cells differ in their use of certain codons. This codon bias corresponds to a bias in the relative abundance of a particular tRNA in a cell type. Expression can be increased by altering the codons in a sequence to match the relative abundance of the corresponding tRNA. Expression can also be decreased by deliberately selecting codons whose corresponding tRNAs are known to be rare in a particular cell type. Codon usage tables are known in the art for mammalian cells, as well as for a variety of other organisms. Nucleic acid sequences encoding, for example, snRNAs can be generated based on the genetic code. In some embodiments, such sequences are optimized for expression in a host or target cell, such as a host cell used to express the snRNA or a cell in which the disclosed method is performed (e.g., a mammalian cell, e.g., a human cell). Codon preference and a codon usage table for a particular species can be used to engineer an isolated nucleic acid molecule encoding an snRNA that utilizes the codon usage preference of that particular species. For example, snRNAs disclosed herein can be designed to have codons preferentially used by a particular organism of interest. In one example, the snRNA nucleic acid sequence is optimized for expression in human cells, e.g., having at least 70%, at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity to its corresponding wild-type or source nucleic acid sequence. In some embodiments, an isolated nucleic acid molecule (which may be part of a vector) encoding at least one snRNA comprises at least one snRNA coding sequence that is codon-optimized for expression in eukaryotic cells or at least one snRNA coding sequence that is codon-optimized for expression in human cells.In one embodiment, such codon-optimized snRNA coding sequences have at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to their corresponding wild-type or originating sequences. In another embodiment, eukaryotic codon-optimized nucleic acid sequences encode snRNAs that have at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to their corresponding wild-type or originating sequences. In another embodiment, various clones containing functionally equivalent nucleic acids (e.g., nucleic acids that differ in sequence but encode the same snRNA sequence) can be routinely generated. Silent variations in coding sequences arise from the degeneracy (i.e., redundancy) of the genetic code, whereby more than one codon may encode the same amino acid residue. Thus, for example, leucine can be encoded by CTT, CTC, CTA, CTG, TTA, or TTG; serine can be encoded by TCT, TCC, TCA, TCG, AGT, or AGC; asparagine can be encoded by AAT or AAC; aspartic acid can be encoded by GAT or GAC; cysteine ​​can be encoded by TGT or TGC; alanine can be encoded by GCT, GCC, GCA, or GCG; glutamine can be encoded by CAA or CAG; tyrosine can be encoded by TAT or TAC; and isoleucine can be encoded by ATT, ATC, or ATA. Tables showing the standard genetic code can be found in various sources (see, e.g., Stryer, 1988, Biochemistry, 3rd Edition, WH5 Freeman and Co., NY).

[0187] "Hybridization" refers to a reaction in which one or more polynucleotides react to form a complex stabilized through hydrogen bonding between the bases of the nucleotide residues. The hydrogen bonds may occur by Watson-Crick base pairing, Hoogsteen binding, or any other sequence-specific manner. The complex may comprise two strands forming a duplex structure, three or more strands forming a multistranded complex, a single self-hybridizing strand, or any combination thereof. A hybridization reaction may constitute a step in a more extensive process, such as the initiation of a PCR reaction or the enzymatic cleavage of a polynucleotide by a ribozyme.

[0188] Examples of stringent hybridization conditions include an incubation temperature of about 25°C to about 37°C, a hybridization buffer concentration of about 6xSSC to about 10xSSC, a formamide concentration of about 0% to about 25%, and a wash solution of about 4xSSC to about 8xSSC. Examples of moderate hybridization conditions include an incubation temperature of about 40°C to about 50°C, a buffer concentration of about 9xSSC to about 2xSSC, a formamide concentration of about 30% to about 50%, and a wash solution of about 5xSSC to about 2xSSC. Examples of high stringency conditions include an incubation temperature of about 55°C to about 68°C, a buffer concentration of about 1xSSC to about 0.1xSSC, a formamide concentration of about 55% to about 75%, and a wash solution of about 1xSSC, 0.1xSSC, or deionized water. Generally, hybridization incubation times range from 5 minutes to 24 hours, with one, two, or more wash steps, with wash incubation times of about 1, 2, or 15 minutes. SSC is a 0.15 M NaCl and 15 mM citrate buffer. It is understood that equivalents of SSC using other buffer systems can be used.

[0189] "Homology" or "identity" or "similarity" refers to sequence similarity between two peptides or two nucleic acid molecules. Homology can be determined by comparing a position in each sequence, which can be aligned for purposes of comparison. When a position in the compared sequences is occupied by the same base or amino acid, the molecules are homologous at that position. The degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. An "unrelated" or "non-homologous" sequence shares less than 40% identity, or alternatively less than 25% identity, with one of the sequences of the present invention.

[0190] cell In some embodiments of the compositions and methods of the present disclosure, the cells of the present disclosure are prokaryotic cells.

[0191] In some embodiments of the compositions and methods of the present disclosure, the cell of the present disclosure is a eukaryotic cell. In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is a bovine, murine, feline, equine, porcine, canine, simian, or human cell. In some embodiments, the cell is a non-human mammalian cell, such as a non-human primate cell.

[0192] In some embodiments, the cells of the present disclosure are somatic cells. In some embodiments, the cells of the present disclosure are germline cells. In some embodiments, the germline cells of the present disclosure are not human cells.

[0193] In some embodiments of the compositions and methods of the present disclosure, the cells of the present disclosure are stem cells. In some embodiments, the cells of the present disclosure are embryonic stem cells. In some embodiments, the embryonic stem cells of the present disclosure are not human cells. In some embodiments, the cells of the present disclosure are pluripotent stem cells or multipotent stem cells. In some embodiments, the cells of the present disclosure are adult stem cells. In some embodiments, the cells of the present disclosure are induced pluripotent stem cells (iPSCs). In some embodiments, the cells of the present disclosure are hematopoietic stem cells (HSCs).

[0194] In some embodiments of the compositions and methods of the present disclosure, the somatic cells of the present disclosure are neuronal cells. In one embodiment, the patient's cells(s) treated with the compositions disclosed herein include, but are not limited to, central nervous system (neurons), peripheral nervous system (neurons), peripheral motor neurons, and / or sensory neurons. In one embodiment, the neuronal cells are glial cells.

[0195] In some embodiments of the compositions and methods of the present disclosure, the somatic cells of the present disclosure are fibroblasts or epithelial cells. In some embodiments, the epithelial cells of the present disclosure form squamous cell epithelium, cuboidal cell epithelium, columnar cell epithelium, stratified cell epithelium, pseudostratified columnar cell epithelium, or transitional cell epithelium. In some embodiments, the epithelial cells of the present disclosure form glands, including, but not limited to, the pineal gland, thymus-derived glands, pituitary gland, thyroid gland, adrenal gland, apocrine glands, holocrine glands, merocrine glands, serous glands, mucous glands, and sebaceous glands. In some embodiments, the epithelial cells of the present disclosure contact the outer surface of an organ, including, but not limited to, the lung, spleen, stomach, pancreas, bladder, intestine, kidney, gallbladder, liver, larynx, or pharynx. In some embodiments, the epithelial cells of the present disclosure contact the outer surface of a blood vessel or vein.

[0196] In some embodiments of the present disclosure, the somatic cells are ocular cells. Ocular cells include, but are not limited to, corneal epithelial cells, keratocytes, retinal pigment epithelial (RPE) cells, lens epithelial cells, iris pigment epithelial cells, conjunctival fibroblasts, non-pigmented ciliary epithelial cells, trabecular meshwork cells, choroidal fibroblasts, and conjunctival epithelial cells. In some embodiments, the ocular cells are retinal cells or corneal cells. In one embodiment, the retinal cells are photoreceptor cells or retinal pigment epithelial cells. In another embodiment, the retinal cells are ganglion cells, amacrine cells, bipolar cells, horizontal cells, Müller glial cells, rod cells, or cone cells. In some embodiments of the compositions and methods of the present disclosure, the somatic cells of the present disclosure are primary cells.

[0197] In some embodiments of the compositions and methods of the present disclosure, the somatic cells of the present disclosure are cultured cells.

[0198] In some embodiments of the compositions and methods of the present disclosure, the somatic cells of the present disclosure are in vivo, in vitro, ex vivo, or in situ.

[0199] In some embodiments of the compositions and methods of the present disclosure, the somatic cells of the present disclosure are autologous or allogeneic.

[0200] How to use The present disclosure provides methods of encoding RNA or expressing NOIs in cells using the snRNA systems disclosed herein. In one embodiment, the present disclosure provides a method of modifying the activity of an RNA or protein encoded by an RNA molecule, comprising contacting a composition of the present disclosure with a target RNA molecule under conditions suitable for binding to the target RNA molecule.

[0201] The present disclosure provides methods for modifying the expression level of a target RNA molecule of the present disclosure or a protein encoded by the target RNA molecule, the method comprising contacting a composition of the present disclosure with a cell containing the target RNA molecule under conditions suitable for binding to the target RNA molecule. In some embodiments, the immune cell is in vitro, ex vivo, or in vivo. In some embodiments, the composition of the present disclosure comprises a vector comprising at least one snRNA sequence. In some embodiments, the vector is AAV.

[0202] The present disclosure provides methods for modifying the expression level of an RNA molecule of the present disclosure or a protein encoded by the RNA molecule, comprising contacting the RNA molecule with a composition of the present disclosure under conditions suitable for knocking down, blocking, splicing, multi-targeting, or editing the target RNA. In some embodiments, the vector is AAV.

[0203] The present disclosure provides a method for editing an adenosine (A) to an inosine (I) in an RNA molecule of interest, the method comprising contacting the RNA molecule of interest with a snRNA molecule of the present disclosure. In some embodiments, a guanine to adenosine point mutation can be corrected using a snRNA molecule of the present disclosure. In some embodiments, the A to I editing event can result in a single amino acid mutation in the expressed protein of interest. The A to I editing event can remove a stop codon in the mRNA sequence. In some embodiments, the stop codon is a premature stop codon. Thus, removal of the premature stop codon can result in rescued translation of the protein of interest.

[0204] The present disclosure provides methods for modifying the activity of a target RNA or a protein encoded by an RNA molecule, comprising contacting a composition with a cell containing the RNA molecule under conditions suitable for knockdown, blocking, splicing, multi-targeting, or editing of the target RNA. In some embodiments, the immune cell is in vitro, ex vivo, or in vivo. In some embodiments, the composition comprises a vector comprising a snRNA sequence disclosed herein. In some embodiments, the vector is AAV.

[0205] The present disclosure provides a method of treating a disease or disorder, comprising administering to a subject a therapeutically effective amount of an snRNA composition of the present disclosure.

[0206] MBNL1 disorders Pathogenic sequestration of MBNL1 (muscleblind-like protein 1) caused by a CUG repeat expansion in the DMPK 3'UTR functionally reduces MBNL1 protein availability and contributes to the phenotypic characteristics seen in myotonic dystrophy type 1. A proposed solution to alleviate reduced MBNL1 activity is enhancing MBNL1 protein. One proposed strategy to boost MBNL1 expression is through disruption of post-transcriptional regulation of miRNA targeting, whereby snRNA-mediated A-to-I editing of critical miRNA seed regions prevents recruitment of MBNL1-targeting miRNAs. mir30 and mir23, which target MBNL1, bind to adenosine nucleotides within their miRNA seed regions and are therefore good candidates for disrupting seed base pairing via A-to-I editing.

[0207] Thus, the present disclosure provides a method for treating myotonic dystrophy type 1 (DM1) in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of a snRNA composition of the present disclosure. In some embodiments, the snRNA composition of the present disclosure targets MBNL1.

[0208] SOD1 disorder Amyotrophic lateral sclerosis (ALS) is a neurodegenerative disease characterized by muscle atrophy caused by selective loss of motor neurons. A common molecular contributor to the pathogenesis of ALS is the toxic gain of functional activity of superoxide dismutase (SOD1), which acts in a dominant manner. For this reason, SOD1 has emerged as a primary target in ALS patients and a promising candidate for snRNA-mediated regulation. By targeting the adenosine within the start codon of SOD1, snRNA-mediated A-to-I editing prevents the ribosomal machinery from recognizing the start site, thereby reducing the expression of mutant SOD1 protein.

[0209] Thus, the present disclosure provides a method for treating amyotrophic lateral sclerosis (ALS) in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of a snRNA composition of the present disclosure. In some embodiments, the snRNA composition of the present disclosure targets SOD1.

[0210] Most patients with MPS (mucopolysaccharidosis) IH have premature stop codon mutations in one or both alleles, resulting in the inability to synthesize full-length polypeptides and loss of enzyme activity. Two premature stop codons in the alpha-L-iduronidase (IDUA) gene, Q70X and W402X, are the most common (70%) mutations in MPS I patients (also known as Hurler syndrome), a rare recessive lysosomal storage disorder, a progressive multisystemic disease caused by reduced or absent IDUA enzyme activity secondary to biallelic loss-of-function variants in IDUA. snRNA-mediated targeting of IDUA W402X / exon 9 results in improved stability and reduced immunogenicity / off-target potential compared to prime editors or conventional gene therapy enzyme replacement.

[0211] Thus, the present disclosure provides a method for treating Hurler syndrome in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of a snRNA composition of the present disclosure. In some embodiments, the snRNA composition of the present disclosure targets IDUA.

[0212] Huntington's disease (HD) is a neurodegenerative disorder caused by an expansion of a CAG trinucleotide repeat found in the gene encoding huntingtin (HTT), which encodes a toxic polyglutamine expansion within exon 1. Targeting HTT mRNA to reduce its expression has been proposed as a therapeutic strategy, which can be achieved by disrupting the start codon of HTT by snRNA-mediated editing.

[0213] Thus, the present disclosure provides a method for treating Huntington's disease in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of a snRNA composition of the present disclosure. In some embodiments, the snRNA composition of the present disclosure targets HTT.

[0214] The snRNA compositions of the present disclosure can also be used to target amyloid beta precursor protein (APP), which contributes to the formation of brain aggregates in Alzheimer's disease. Editing the APP gene can result in a decrease in protein expression.

[0215] Thus, the present disclosure provides a method for treating Alzheimer's disease in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of a snRNA composition of the present disclosure. In some embodiments, the snRNA composition of the present disclosure targets APP.

[0216] Nonsense mutations in methyl-CpG-binding protein 2 (MeCP2) have been demonstrated as a major cause of Rett syndrome, a neurodevelopmental disorder primarily seen in females. U7 snRNA, which targets MeCP2 mutations such as R168X, R255X, and 270X, is a good candidate for RNA editing.

[0217] Thus, the present disclosure provides a method for treating Rett syndrome in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of a snRNA composition of the present disclosure. In some embodiments, the snRNA composition of the present disclosure targets MeCP2.

[0218] Abnormal expression of the double homeobox 4 (DUX4) gene is associated with the development of facioscapulohumeral muscular dystrophy (FSHD). Although it is normally silenced in healthy individuals, patients with FSHD experience sporadic derepression of DUX4. Targeting the start codon of the DUX4 transcript using snRNA to suppress its expression in FSHD patients may provide therapeutic benefit to patients. Furthermore, this RNA editing strategy to suppress expression can be extended to edit the polyadenylation sequence of DUX4.

[0219] Thus, the present invention provides a method for treating facioscapulohumeral muscular dystrophy (FSHD) in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a snRNA composition of the present invention. In some embodiments, the snRNA composition of the present disclosure targets DUX4.

[0220] Individuals with mutations in the SERPINA1 gene, which encodes alpha-1 antitrypsin, develop alpha-1 antitrypsin deficiency, a disorder that predisposes patients to lung and liver disease. Mutations such as SERPINA1 E342K can be targeted by snRNA-mediated editing.

[0221] Thus, the present disclosure provides a method for treating alpha-1 antitrypsin deficiency in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of a snRNA composition of the present disclosure. In some embodiments, the snRNA composition of the present disclosure targets SERPINA1.

[0222] The present disclosure provides a method of treating a disease in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of a snRNA composition of the present disclosure, wherein the composition comprises a vector comprising an snRNA sequence disclosed herein, and wherein the composition alters, reduces, disrupts, knocks down, or eliminates the expression level of a target RNA (compared to the expression level of the target RNA treated with a non-targeting (NT) control or compared to untreated). In another embodiment, the level of reduction is 1-fold or greater. In another embodiment, the level of reduction is 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, or 10-fold. In another embodiment, the level of reduction is 10-fold or greater. In another embodiment, the level of reduction is 10-fold to 20-fold. In another embodiment, the level of reduction is 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, or 20-fold. In another embodiment, the gene therapy compositions disclosed herein, when administered to a patient, result in 20% to 100% destruction of the target RNA. In one embodiment, the % elimination of toxic RNA is 20% to 99%, 25% to 99%, 50% to 99%, 80% to 99%, 90% to 99%, or 95% to 99%. In one embodiment, the % elimination is 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In another embodiment, the % elimination is complete or 100% elimination of the target RNA.

[0223] The present disclosure provides a method of treating a disease in a patient in need thereof, comprising administering to the patient a therapeutically effective amount of a snRNA composition of the present disclosure, wherein the composition comprises a vector comprising an snRNA sequence disclosed herein, and wherein the composition enhances expression of a protein encoded by a target RNA of interest (compared to the level of expression of the protein encoded by the target RNA treated with a non-targeting (NT) control, or compared to untreated). In another embodiment, the level of enhancement is 1-fold or greater. In another embodiment, the level of enhancement is 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, or 10-fold. In another embodiment, the level of enhancement is 10-fold or greater. In another embodiment, the level of enhancement is 10-fold to 20-fold. In another embodiment, the level of enhancement is 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, or 20-fold. In another embodiment, the gene therapy compositions disclosed herein, when administered to a patient, result in an increase of 0.0001% to 100% in protein encoded by the target RNA. In one embodiment, the % increase in protein encoded by the target RNA is 20% to 99%, 25% to 99%, 50% to 99%, 80% to 99%, 90% to 99%, or 95% to 99%. In one embodiment, the % increase is 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

[0224] In some embodiments of the methods of the present disclosure, the subject of the present disclosure has been diagnosed with the disease to be treated. In some embodiments, the subject of the present disclosure exhibits at least one sign or symptom of the disorder or disease to be treated. In some embodiments, the subject of the present disclosure exhibits at least one sign or symptom of the disease.

[0225] In some embodiments of the methods of the present disclosure, the subject of the present disclosure is a female. In some embodiments of the methods of the present disclosure, the subject of the present disclosure is a male. In some embodiments, the subject of the present disclosure has two XX or XY chromosomes. In some embodiments, the subject of the present disclosure has two XX or XY chromosomes and a third chromosome, either X or Y.

[0226] In some embodiments of the methods of the present disclosure, the subject of the present disclosure is a newborn, infant, child, adult, elderly adult, or older adult. In some embodiments of the methods of the present disclosure, the subject of the present disclosure is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or 31 days old. In some embodiments of the methods of the present disclosure, the subject of the present disclosure is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months old. In some embodiments of the methods of the present disclosure, the subject of the present disclosure is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, or any number or partial years in between.

[0227] In some embodiments of the methods of the present disclosure, the subject of the present disclosure is a mammal. In some embodiments, the subject of the present disclosure is a non-human mammal.

[0228] In some embodiments of the methods of the present disclosure, the subject of the present disclosure is a human.

[0229] In some embodiments of the disclosed methods, the therapeutically effective amount comprises a single administration of the disclosed composition. In some embodiments, the therapeutically effective amount comprises at least one dose of the disclosed composition. In some embodiments, the therapeutically effective amount comprises one or more doses of the disclosed composition.

[0230] In some embodiments of the disclosed methods, the therapeutically effective amount eliminates a sign or symptom of the disease or disorder. In some embodiments, the therapeutically effective amount reduces the severity of a sign or symptom of the disease or disorder.

[0231] In some embodiments of the disclosed methods, the therapeutically effective amount eliminates the disease or disorder.

[0232] In some embodiments of the disclosed methods, the therapeutically effective amount prevents the onset of a disease or disorder. In some embodiments, the therapeutically effective amount delays the onset of a disease or disorder. In some embodiments, the therapeutically effective amount reduces the severity of a sign or symptom of a disease or disorder. In some embodiments, the therapeutically effective amount improves the prognosis of a subject.

[0233] In some embodiments of the methods of the present disclosure, the compositions of the present disclosure are administered to the subject via intracerebral administration. In some embodiments, the compositions of the present disclosure are administered to the subject via an intrastriatal route. In some embodiments, the compositions of the present disclosure are administered to the subject by stereotactic injection or infusion. In some embodiments, the compositions are administered systemically to the subject. In some embodiments of the methods of the present disclosure, the compositions of the present disclosure are administered locally to the subject.

[0234] In some embodiments, the compositions disclosed herein are formulated as pharmaceutical compositions. Briefly, pharmaceutical compositions for use as disclosed herein may contain a protein or a polynucleotide encoding a protein optionally contained in an AAV, which may also be immuno-orthogonal, in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents, or excipients. Such compositions may include one or more buffers, such as neutral buffered saline, phosphate buffered saline, etc.; carbohydrates, such as glucose, mannose, sucrose, or dextran, mannitol; proteins; polypeptides or amino acids, such as glycine; antioxidants; chelating agents, such as EDTA or glutathione; adjuvants, such as aluminum hydroxide; and preservatives. Compositions of the present disclosure may be formulated for routes of administration such as, for example, oral, enteral, topical, transdermal, intranasal, and / or inhalation; and for routes of administration by injection or infusion such as, for example, intravenous, intramuscular, subpial, intrathecal, intraparenchymal, intrathecal, intrastriatal, subcutaneous, intradermal, intraperitoneal, intratumoral, intravenous, intraocular, and / or parenteral administration. In certain embodiments, compositions of the present disclosure are formulated for intracerebral or intrastriatal administration. [Example]

[0235] Example 1: snRNA-targeted stop codons in mCherry / GFP reporter assays Materials and Methods:

[0236] Day 1: Seed 96-well plates (clear F-bottom, black border) with 100k / ml HeLa cells at 0.1 ml per well.

[0237] Day 2: Lipofectamine

[0238] Dilute all DNA to 100 ng / µL.

[0239] Make Master Mix A (1 µL P3000 + 25 µL OMEM + 0.25 µL P03685 / sample = (22 x) 550 µL OMEM + 22 µL P3000 + 5.5 µL P03685 reporter plasmid).

[0240] Vortex gently.

[0241] Add 25 µL per sample of Master Mix A to 5 µL of diluted DNA sample.

[0242] Vortex gently.

[0243] Make a master mix of 25 μL OMEM per sample + 1.25 μL Lipofectamine per sample (22×=550 μL OMEM + 27.5 μL Lipofectamine).

[0244] Vortex gently and pipette 25 µL per sample to dilute the DNA with a P3000.

[0245] Mix gently, incubate at room temperature for 10 minutes, and add 10 μL dropwise to the cells in quadruplicate.

[0246] Day 4: Read fluorescence and extract RNA.

[0247] Remove the medium and add 100 μL of PBS to each well.

[0248] GFP and mCherry fluorescence is read on a BioTek reader.

[0249] Take an image with a microscope.

[0250] RNA was extracted using a 96-well Qiagen RNeasy Plus kit and amplified using the standard Promega GoTaq protocol with 59°C annealing, 40 seconds extension, and 32x cycles using the forward primer 5'-CGCCTACAACGTCAACATCA-3' (SEQ ID NO: 93) and the reverse primer 5'-TGGTGCAGATGAACTTCAGG-3' (SEQ ID NO: 94). PCR products were then submitted for Sanger sequencing using the PCR primers.

[0251] Objective: To determine whether an editing event can be induced from snRNP A to I containing a target binding sequence with a single base pair mismatch targeting the stop codon in the reporter vector shown in Figure 1A to restore GFP expression.

[0252] basis: U7 snRNA can be programmed to target mRNAs by replacing its histone mRNA annealing sequence with a sequence complementary to the intended target, in this case a stop codon, to create a snRNA (snRNA). Stop codon-targeting constructs were tested to determine whether they could induce an A-to-I editing event mediated by ADAR proteins. Such an editing event removes the stop codon, allowing dual expression of both mCherry and GFP (Figure 1B).

[0253] The snRNA constructs targeting the stop codon and a control containing a non-targeting snRNA were transiently transfected into HeLa cells expressing the mCherry / GFP reporter construct, which is shown in Table 1.

[0254] [Table 101]

[0255] Cells were plated, fixed on chamber slides, and imaged using a fluorescence microscope to detect mCherry and GFP expression (Figure 2). SnRNA targeting a stop codon induced GFP expression in addition to mCherry, whereas non-targeting snRNA, dummy (no construct) transfection, and untransfected cells showed only mCherry expression (Figure 2).

[0256] Next, additional stop codon-targeting snRNA constructs were evaluated. The snRNA molecules evaluated include those detailed in Table 2. Constructs containing various combinations of additional features outside the stop codon-targeting sequence were developed, including engineered stem-loops, sm-binding domains with or without ADAR recruitment domains, and / or 5' interaction stabilization domains (5'ISDs). Non-targeting versions of each construct were also evaluated. The ratio of GFP expression to mCherry expression was determined for each construct and is shown in Figure 3. Non-targeting snRNAs did not induce GFP expression. Multiple stop codon-targeting snRNAs induced GFP expression, indicating that an A-to-I editing event had occurred, allowing construct readthrough to allow mCherry and GFP expression. Importantly, A-to-I editing was observed to be achieved by constructs containing the ADAR recruitment domain and constructs lacking the ADAR recruitment domain.

[0257] [Table 102]

[0258] Example 2: snRNA-mediated SOD1 RNA editing in 293T cells Materials and Methods:

[0259] Transfection of 293T cells: 293T cells were plated at 5E4 cells per well in 24-well TC-treated plates and grown overnight. The following day, cells were transfected using 500 ng of plasmid DNA per reaction with 1 μL of P3000 and 1.5 μL of Lipofectamine 3000 reagent. Cells were grown for 48-72 hours and then harvested for downstream or RNA analysis.

[0260] RNA preparation and qRT-PCR analysis: Total RNA was prepared in 500 μL of Trizol (Invitrogen) and extracted using the Zymo direct-zol RNA microprep kit (Zymo Research). 50 ng of RNA was reverse transcribed using qScript Ultra SuperMix (Qantabio) followed by PCR. Samples were PCR purified (Qiagen) and sent for Sanger sequencing.

[0261] Protein extraction and analysis by Western blot: Samples used for protein extraction were lysed using 50uL of RIPA buffer supplemented with cOmplete™, a mini protease inhibitor cocktail (Roche). Samples were incubated on ice for 30 minutes and vortexed every 5 minutes. Samples were then spun at 14,000g for 10 minutes. The supernatant was then transferred to a new tube and the protein concentration was quantified using the Pierce™ BCA protein assay. 1.5ug of sample was loaded onto a Jess (Protein Simple) centrifuge.

[0262] Conclusion: Transient transfection of 293T cells with constructs targeting the SOD1 codon promoted RNA editing. Editing was enhanced by the presence of a cytosine-adenosine mismatch. Targeting the SOD1 start codon resulted in reduced SOD1 expression (see Figures 6-8). This strategy may be utilized to target other therapeutically relevant transcripts, such as aberrant expression of double homeobox 4 (DUX4) to treat skeletal muscle deterioration and weakness in facioscapulohumeral muscular dystrophy (FSHD).

[0263] Example 3: scAAV snRNA-mediated ADAR recruitment for mRNA editing in skeletal muscle cells from Hurler syndrome patients Most MPS IH patients have premature stop codon mutations in one or both alleles, resulting in the inability to synthesize full-length polypeptides and loss of enzyme activity. Two premature stop codons in the α-L-iduronidase (IDUA) gene, Q70X and W402X, are the most common (70%) mutations in MPS I patients. snRNA-mediated targeting of IDUA W402X / exon 9 results in improved stability and reduced immunogenicity / off-target potential compared to prime editor or conventional gene therapy enzyme replacement. See Figures 9-10.

[0264] Hurler syndrome myotubes were transduced with scAAV A05318 targeting W420X exon 9. Sanger sequencing of IDUA exon 9 demonstrated A>I (A>G) editing in A05318-treated myotubes at 1E5 and 1E6 vg / cell after 7 days. RT-PCR of IDUA editing efficiency was performed, and chromatograms were analyzed by EditR. Untreated cells and AAV empty capsid at MOIs of 1E5 and 1E6 vg / cell served as negative controls for the assay. Untreated cells and cells treated with AAV empty capsid served as negative controls to demonstrate the lack of edited RNA in this cell line. This study demonstrates dose-dependent snRNA-mediated editing of IDUA in patient myotubes. See Figure 11. ELISA (Thermo Fisher EH247RB) was performed, and the results indicate that snRNA treatment restores the IDUA enzyme in Hurler myotubes. Increase in IDUA protein levels in the supernatant of co-cultures of healthy and untreated Hurler syndrome patient-derived myotubes at ratios of 100:0, 35:65, 50:50, 58:42, and 0:100. IDUA protein levels in the supernatant of A05318-treated myotubes at 1E6 vg / cell after 10 days. Untreated cells and 1E6 vg / cell of AAV empty capsid served as negative controls for the assay. Healthy myotubes were maintained as 100% to calculate the healthy percentage. Untreated cells and cells treated with AAV empty capsid served as negative controls to demonstrate the lack of edited RNA in this cell line. See Figure 12.

[0265] Myotubes were treated with A05318 and analyzed by immunofluorescence. Images show a decrease in perlecan staining 10 days after treatment of myotubes with 1E6 vg / cell of A05318 with perlecan antibody (Abcam, red). Untreated cells and cells treated with 1E6 vg / cell of AAV empty capsid served as negative controls, showing high baseline staining in this cell line. DAPI staining (blue) was used to detect nuclei. See Figure 13.

[0266] Conclusions: This study demonstrates efficient snRNA-mediated editing in Hurler patient cells. High and sustained levels of RNA editing were observed at days 7 and 14 post-transduction. A05318 demonstrated dose-dependent editing at the two doses tested: 1E5 and 1E6 vg / cell. scAAV9 U7-snRNA A05318 treatment restored functional IDUA protein and reduced GAG (perlecan) accumulation at day 10 post-transduction.

[0267] Example 4: Targeting and editing the MBNL1 binding site increases MBNL expression Pathogenic sequestration of MBNL1 (muscleblind-like protein 1) caused by a CUG repeat expansion in the DMPK 3'UTR functionally reduces MBNL1 protein availability and contributes to the phenotypic characteristics seen in myotonic dystrophy type 1 (DM1). A proposed solution to alleviate reduced MBNL1 activity is enhancing MBNL1 protein expression. One proposed strategy to boost MBNL1 expression is through disruption of post-transcriptional regulation of miRNA targeting, whereby snRNA-mediated A-to-I editing of critical miRNA seed regions prevents recruitment of MBNL1-targeting miRNAs. mir30 and mir23, which target MBNL1, bind to adenosine nucleotides within their miRNA seed regions and are therefore good candidates for disrupting seed base pairing via A-to-I editing.

[0268] Adenosine-to-inosine editing of MBNL 3'UTR at miR30 seed binding sites HEK cells were transfected with snRNA 1 and snRNA 2, which contain antisense sequences to the MBNL1 3'UTR in the miR30 binding site and a mismatch to the A in the seed sequence, for 72 hours. RNA was extracted, reverse transcribed, and cDNA was amplified by PCR. The resulting DNA amplicons were subjected to Sanger sequencing. Chromatographs of the amplicons were analyzed by EditR.

[0269] Incorporation by Reference All documents cited herein, including cross-referenced or related patents or applications, are incorporated herein by reference in their entirety, unless expressly excluded or limited. The citation of any document is not an admission that it is prior art to any invention disclosed or embodied herein, or that it alone, or in any combination with any other reference, teaches, suggests, or discloses any such invention. Furthermore, to the extent that any meaning or definition of a term in this document conflicts with any meaning or definition of the same term in a document incorporated by reference, the meaning or definition assigned to that term in this document shall govern.

[0270] Other embodiments While particular embodiments of the present disclosure have been illustrated and described, various other changes and modifications can be made without departing from the spirit and scope of the present disclosure, and the appended claims encompass within their scope all such changes and modifications that are within the scope of the present disclosure.

Claims

1. 1. An RNA-targeting nucleic acid molecule comprising a small nuclear RNA (snRNA) molecule, wherein the snRNA molecule comprises at least one targeting sequence having at least one base-pairing mismatch, an Sm-binding domain (SmBD), and an snRNA stem-loop.

2. 2. The RNA-targeting nucleic acid molecule of claim 1, wherein the snRNA further comprises an adenosine deaminase (ADAR) recruitment domain that acts on RNA.

3. The RNA-targeting nucleic acid molecule of claim 1, wherein the snRNA further comprises a 5' interacting stability domain (5'ISD).

4. 2. The RNA-targeting nucleic acid molecule of claim 1, wherein the snRNA stem-loop is a natural stem-loop or an engineered stem-loop (eSL).

5. 2. The RNA-targeting nucleic acid molecule of claim 1, wherein the snRNA is a U1 snRNA, a U2 snRNA, a U3 snRNA, a U4 snRNA, a U5 snRNA, a U6 snRNA, or a U7 snRNA.

6. The RNA-targeting nucleic acid molecule of claim 5 , wherein the snRNA is U7 snRNA.

7. The RNA-targeting nucleic acid molecule of claim 1 , wherein the targeting sequence binds to an mRNA or pre-mRNA sequence.

8. The RNA targeting nucleic acid molecule of claim 1 , wherein the targeting sequence binds to a start codon, a stop codon, or a splicing regulatory sequence.

9. 9. The RNA-targeting nucleic acid molecule of claim 8, wherein the splicing regulatory sequence is a branchpoint adenosine (bpA) sequence, a 3' acceptor splice site (3'ss) sequence, or an exon splicing enhancer (ESE) sequence.

10. 2. The RNA targeting nucleic acid molecule of claim 1, wherein the base pairing mismatch is an adenosine (A)-cytosine (C) mismatch.

11. The RNA-targeting nucleic acid molecule of claim 10, wherein the adenosine is contained within the mRNA or pre-mRNA sequence.

12. The RNA-targeting nucleic acid molecule of claim 10, wherein the cytosine is contained within the snRNA-targeting sequence.

13. The RNA target nucleic acid molecule of claim 1 , wherein the targeting sequence is at least 50 nucleotides in length.

14. 2. The RNA-targeting nucleic acid molecule of claim 1, wherein the snRNA further comprises one or more additional targeting sequences.

15. 15. The RNA-targeting nucleic acid molecule of Claim 14, wherein the one or more additional targeting sequences have at least one base-pairing mismatch.

16. 2. The RNA-targeting nucleic acid molecule of claim 1, wherein the Sm-binding domain (SmBD) is selected from the group consisting of U1, U2, U4, and U5 SmBDs.

17. 4. The RNA-targeting nucleic acid molecule of claim 3, wherein the interacting stability domain (5'ISD) comprises ggagt, cctct, ggaggt, cctcct, agccag, ggaag, gaagaag, gttg, ccgaa, taaggag, gaag, or ggctt.

18. 3. The RNA-targeting nucleic acid molecule of claim 2, wherein the ADAR recruitment domain comprises the nucleotide sequence set forth in SEQ ID NO:

88.

19. 5. The RNA-targeting nucleic acid molecule of claim 4, wherein the snRNA stem-loop comprises a nucleotide sequence set forth in any one of SEQ ID NOs: 1-41.

20. The RNA-targeting nucleic acid molecule of claim 1 , wherein the targeting sequence binds to an SOD1 RNA sequence.

21. 21. The RNA-targeting nucleic acid molecule of claim 20, wherein the SOD1 RNA-targeting sequence comprises a nucleotide sequence set forth in any one of SEQ ID NOs: 124-150.

22. The RNA-targeting nucleic acid molecule of claim 1 , wherein the targeting sequence binds to an IDUA RNA sequence.

23. 23. The RNA-targeting nucleic acid molecule of claim 22, wherein the IDUA RNA-targeting sequence comprises a nucleotide sequence set forth in any one of SEQ ID NOs: 153 or 154.

24. The RNA-targeting nucleic acid molecule of claim 1 , wherein the targeting sequence binds to an MBNL1 RNA sequence.

25. 25. The RNA-targeting nucleic acid molecule of claim 24, wherein the MBNL1 RNA-targeting sequence comprises a nucleotide sequence set forth in any one of SEQ ID NOs: 156-173.

26. The RNA-targeting nucleic acid molecule of claim 1 , wherein the snRNA is operably linked to a U7 promoter or a U1 promoter.

27. The RNA-targeting nucleic acid molecule of claim 1 , wherein the snRNA is operably linked to a U7 promoter and a U1 promoter.

28. The RNA-targeting nucleic acid molecule of claim 1, wherein the snRNA is operably linked to an snRNA downstream terminator (DT).

29. A vector comprising the snRNA of claim 1.

30. 30. The vector of claim 29, wherein the vector is a viral vector or a non-viral vector.

31. 30. The vector of claim 29, wherein the viral vector is an AAV vector.

32. 30. The vector of claim 29, comprising multiple copies of the snRNA of claim 1.

33. 33. The vector of claim 32, wherein the vector comprises 2, 3 or 4 copies of the snRNA.

34. 33. The vector of claim 32, wherein each copy of the plurality of copies of the snRNA is separated by a buffer sequence, and the buffer sequence is selected from the group consisting of SEQ ID NOs: 42-48.

35. 10. A method for targeting one or more target RNAs of interest and blocking, knocking down, editing, or splicing said one or more target RNAs, comprising contacting the snRNA of claim 1 with a cell containing said one or more target RNAs.

36. 10. A method for editing adenosine (A) to inosine (I) in a target RNA molecule, comprising contacting the target RNA molecule with the snRNA of claim 1.

37. 37. The method of claim 36, wherein the A to I editing is performed by an ADAR molecule recruited by the snRNA.

38. 32. A method of treating a disease or disorder in a subject in need thereof, comprising administering to the subject an RNA-targeting nucleic acid molecule of claim 1 or an AAV vector of claim 31.

39. 39. The method of claim 38, wherein the disease or disorder is myotonic dystrophy type 1, amyotrophic lateral sclerosis (ALS), or Hurler syndrome.

40. 1. An RNA-targeting nucleic acid molecule comprising a snRNA system (snRNA), wherein the snRNA system comprises at least one targeting sequence, an Sm-binding domain (SmBD), and an snRNA stem-loop, and wherein the binding sequence has extensive complementarity to the target RNA.

Images