Chromatin profiling compositions and methods

Abstract

Compositions and methods for single-reaction and multiplexed profiling of histone modifications are provided. The compositions include nucleosome-binding conjugates comprising a binding domain and an adaptor, or a binding domain conjugated to an adaptor. The method includes analyzing a plurality of nucleosomes, and includes the steps of: (i) contacting a plurality of substrates comprising the binding domain and adaptor composition with a solution containing a plurality of nucleosomes, wherein the nucleosomes comprising the histone modification or a DNA-binding protein bind to the binding domain; (ii) ligating an adaptor having a nucleic acid barcode to target DNA of the nucleosomes comprising the histone modification or the DNA-binding protein; (iii) introducing a universal sequence for amplifying the target DNA; (iv) amplifying the barcoded target DNA; and (v) analyzing the amplified barcoded target DNA by sequencing.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to U.S. Provisional Patent Application No. 63 / 427,749, filed November 23, 2022, the contents of which are incorporated herein by reference in their entirety.

[0002] Sequence Listing Reference This application contains a Sequence Listing that has been submitted electronically in XML format and is incorporated by reference in its entirety. The XML copy created on November 22, 2023, is named 5371-105PCT and is 86,016 bytes in size.

[0003] Technical Field The present disclosure relates generally to the identification and analysis of epigenetic and other modifications to the structure or characteristics of chromatin, nucleosomes, and associated nucleic acids. [Background technology]

[0004] Chromatin is a complex of DNA and proteins that organizes the genetic code within the nucleus of eukaryotic cells. The nucleosome is the basic subunit of chromatin. A nucleosome consists of an octamer of protein around which approximately two turns of DNA are wrapped and an additional DNA linker approximately 80 bp long. The two turns of DNA wrapped around the protein consist of approximately 146 base pairs. The protein octamer contains two copies each of the histone proteins H2A, H2B, H3, and H4. The 80 bp linkers connect nucleosomes to each other in a repeating pattern, which together form chromosomes.

[0005] The structural features of chromatin that control gene expression are determined by how nucleosomes and other proteins are packed together in the nucleus. Loosely packed chromatin, called euchromatin, is transcriptionally active and genes encoded in these regions are expressed. Tightly packed chromatin, called heterochromatin, is inactive for gene expression. Histone tail modifications are one of the most important features that determine how chromatin is packed. These modifications can be added or removed by the cell to regulate packing and, accordingly, gene expression.

[0006] Histone tails are disordered extensions of the N-terminal domain of each histone protein beyond the nucleosome core structure. They range in length from approximately 25 to 60 amino acids and typically contain a high concentration of basic amino acid residues, particularly lysine and arginine. Most modifications of histone tails are methylation and acetylation of specific lysine and arginine residues, but other modifications, including phosphorylation and ubiquitination, also occur naturally. These modifications are known to be closely related to cell development, tissue differentiation, aging, and the progression of diseases such as cancer. Enzymes involved in histone modification are clinically proven drug targets. For example, there are currently four FDA-approved cancer chemotherapy drugs on the market that inhibit histone deacetylation, the enzyme responsible for removing the acetyl mark from histone tails.

[0007] Another important class of gene expression regulators associated with chromatin are transcription factors. There are 1500-1600 transcription factors in the human genome. Transcription factors are DNA-binding proteins that can promote or inhibit gene expression by regulating the access of RNA polymerase II to the promoter region of genes. RNA polymerase II is another DNA-binding protein that transcribes DNA into different RNA species.

[0008] Motivated by the important role of histone modifications as regulators of chromatin packing, gene expression, and human health, numerous methods have been developed to determine which histone modifications are associated with specific DNA sequences in each nucleosome. The most widespread of these analytical methods is ChIP-seq, which combines chromatin immunoprecipitation with DNA sequencing. In ChIP-seq, antibodies specific for histone modifications are attached to beads. Chromatin samples are mechanically sheared or enzymatically treated to separate nucleosomes. The solution containing these nucleosomes is then combined with the beads under conditions appropriate for the antibody to bind to its cognate histone modification. Nucleosomes bearing this modification bind to the beads and can be isolated by isolating the beads from the solution. Following isolation, the beads are washed to remove the modified histones, and libraries are prepared for DNA sequencing. Next-generation DNA sequencing is then used to identify the specific DNA sequences corresponding to the modified nucleosomes. Antibody-guided chromatin tagmentation (ACT-seq) is an alternative to this method, which uses modification-specific antibodies to recognize histone tail modifications, but barcodes the DNA of nucleosomes using barcode-loaded transposomes if the antibody-specific histone tail modification is present.

[0009] Upon cell death, the genome is degraded and chromatin, primarily in the form of nucleosomes, is released into the blood as cell-free circulating nucleosomes that retain histone modifications.

[0010] There are over 60 different sites at which histones in a single nucleosome can be modified, and each site can have multiple modifications, allowing for a large number of potential modifications. Some of these modifications are more prevalent than others and are associated with established functional significance. The most commonly analyzed histone modifications are acetylation, methylation, phosphorylation, ubiquitination, and sumoylation. Depending on the nature and location of the modification, modifications can promote or repress gene expression. Modifications are known to act cooperatively to affect gene expression.

[0011] Conventional histone modification profiling methods provide information about the types and levels of histone modifications present in a sample, but do not reveal the spatial distribution of these molecules within the tissue.

[0012] Despite the importance and complexity of these modifications, existing histone modification analysis methods are limited in their ability to simultaneously analyze multiple modifications without splitting the sample and analyzing each modification in a separate assay. Another unmet need is the ability to obtain information about the spatial organization of chromatin and its underlying histone modifications in a tissue context. Therefore, there is a need in the art for improved compositions and methods for identifying, analyzing, quantitating, and localizing chromatin and nucleosome modifications with respect to genomic coordinates and across a broader range of tissues. Such advances would pave the way for the discovery of important regulatory mechanisms of biology in health and disease, as well as the development of new treatment paradigms in medicine. Summary of the Invention

[0013] The present invention provides compositions and methods for identifying and analyzing epigenetic and other chemical modifications to nucleic acids and nucleosomes, including histone proteins, or DNA-binding proteins. The present invention provides a highly parallel, sensitive, highly accurate, and high-throughput method for simultaneously profiling a potentially unlimited number of nucleosome modifications and DNA-binding proteins.

[0014] In some embodiments, the present disclosure provides a target-binding conjugate comprising a binding domain and an adaptor, wherein the binding domain specifically binds to a histone modification or a DNA-binding protein, and the adaptor comprises a nucleic acid barcode sequence specific to the target specifically bound by the binding domain. In some aspects, the present disclosure includes a composition comprising a nucleosome-binding conjugate and a buffer, such as a ligation buffer. In some aspects, the DNA-binding protein can be bound to a DNA region connecting two nucleosomes.

[0015] In some embodiments, the present disclosure provides a composition comprising: (i) a substrate; (ii) a binding domain bound to the substrate; and (iii) an adaptor, wherein the binding domain specifically binds to a histone modification or a DNA-binding protein, and the adaptor comprises a nucleic acid barcode sequence unique to the histone modification or DNA-binding protein.

[0016] In some embodiments, the present disclosure provides a method for analyzing a plurality of nucleosomes and protein-DNA complexes, the method comprising: (i) contacting a plurality of substrates comprising at least one composition of any one or combination of numbered aspects disclosed herein with a solution comprising a plurality of nucleosomes and protein-DNA complexes, wherein the binding domain binds to the nucleosomes comprising the DNA-binding protein or the histone modification; (ii) ligating an adapter having a nucleic acid barcode to target DNA of the nucleosomes comprising the histone modification or the DNA-binding protein; (iii) introducing, e.g., ligating, a universal nucleic acid sequence for amplifying the target DNA; (iv) amplifying the barcoded target DNA; and (v) analyzing the amplified barcoded target DNA by sequencing.

[0017] In some embodiments, the present disclosure provides a method for analyzing a plurality of nucleosomes and protein-DNA complexes, the method comprising: (i) contacting a plurality of substrates comprising at least one of any one or combination of numbered aspects disclosed herein with a solution comprising a plurality of nucleosomes and protein-DNA complexes, wherein a binding domain binds to a nucleosome comprising a DNA-binding protein or a histone modification; (ii) ligating an adapter having a nucleic acid barcode to target DNA of the nucleosome comprising the histone modification or the DNA-binding protein; (iii) releasing the nucleosome or DNA-binding protein from the substrate by cleaving the ligated adapter; (iv) repeating steps (i) to (iii) at least once; (v) introducing, e.g., ligating, a universal nucleic acid sequence for amplifying the target DNA; (vi) amplifying the barcoded target DNA; and (vii) analyzing the amplified barcoded target DNA by sequencing.

[0018] In some embodiments, the present disclosure provides a method for analyzing a plurality of nucleosomes and protein-DNA complexes, the method comprising: (i) contacting one or more substrates comprising a composition of any one or combination of numbered aspects disclosed herein with a solution comprising a plurality of nucleosomes and protein-DNA complexes, wherein a binding domain binds to nucleosomes comprising a DNA-binding protein or a histone modification; (ii) attaching adapters to the plurality of nucleosomes bound to the binding domains; (iii) ligating adapters having nucleic acid barcodes to target DNA of nucleosomes comprising the histone modification or the DNA-binding protein; (iv) releasing the nucleosomes from the binding domains by adding a buffer that prevents interaction between the binding domains and the nucleosomes; (v) repeating steps (i) through (iv) at least once; (vi) introducing, e.g., ligating, a universal nucleic acid sequence to amplify the target DNA; (vii) amplifying the barcoded target DNA; and (viii) analyzing the amplified barcoded target DNA by sequencing.

[0019] In some embodiments, the present disclosure provides a nucleosome-binding conjugate comprising: i) a binding domain; and ii) an adaptor conjugated to the binding domain, wherein the binding domain binds to a nucleosome comprising a DNA-binding protein or a histone modification, and the adaptor comprises a nucleic acid barcode sequence unique to the histone modification or DNA-binding protein.

[0020] In some embodiments, the present disclosure provides a method for analyzing a plurality of nucleosomes and protein-DNA complexes, the method comprising: (i) contacting a solution comprising a plurality of nucleosomes and protein-DNA complexes with a solution comprising at least one nucleosome-binding conjugate of any one or combination of numbered aspects disclosed herein, wherein the binding domain binds to nucleosomes comprising a DNA-binding protein or a histone modification; (ii) ligating an adapter having a nucleic acid barcode of the binding conjugate to target DNA of nucleosomes comprising the histone modification or DNA-binding protein to generate barcoded target DNA in an environment, wherein generation of off-target barcoded DNA is less than 20% of the barcoded target DNA; (iii) ligating a universal nucleic acid sequence to amplify the target DNA; (iv) amplifying the barcoded target DNA; and (v) analyzing the amplified barcoded target DNA by sequencing.

[0021] In some embodiments, the present disclosure provides a method for analyzing a plurality of nucleosomes and protein-DNA complexes, the method comprising: (i) immobilizing a plurality of nucleosomes and protein-DNA complexes on a substrate at intervals such that off-target barcoding is less than 20%; (ii) contacting the immobilized nucleosomes and protein-DNA complexes with a solution comprising at least one nucleosome-binding conjugate of any one or combination of numbered aspects disclosed herein, wherein the binding domain binds to a DNA-binding protein or a nucleosome comprising a histone modification; (iii) contacting the nucleosomes and protein-DNA complexes with a solution comprising at least one nucleosome-binding conjugate of any one or combination of numbered aspects disclosed herein, wherein the binding domain binds to a DNA-binding protein or a nucleosome comprising a histone modification; (iv) cleaving the adapter to generate a nucleic acid end having a structure suitable for ligation to another adapter; (v) repeating steps (ii) through (iv) at least once; (vi) introducing, e.g., ligating, a universal nucleic acid sequence to amplify the target DNA; (vii) amplifying the barcoded DNA; and (viii) analyzing the amplified barcoded target DNA by sequencing.

[0022] In some embodiments, the present disclosure provides a method for analyzing a plurality of nucleosomes in a tissue, the method comprising: (i) immobilizing a plurality of nucleosome-binding conjugates on a planar microarray substrate at intervals that result in less than 20% off-target barcoding, wherein the off-target barcoding is less than 20%; (ii) overlaying a tissue section on a planar microarray substrate containing a plurality of nucleosome-binding conjugates; (iii) ligating an adapter having the nucleic acid barcode and spatial identifier sequence of the nucleosome-binding conjugate to the target DNA of a nucleosome containing a histone modification or a DNA-binding protein to generate barcoded target DNA in an environment where off-target barcoded DNA is generated in less than 20% of the barcoded target DNA; (iv) cleaving the adapter to generate nucleic acid ends having a structure suitable for ligation to other adapters; (v) repeating steps (ii) to (iv) at least once; (vi) introducing a universal sequence to amplify the target DNA; (vii) amplifying the barcoded DNA; and (vii) determining the identity and spatial location on the planar microarray substrate of the amplified histone modification or DNA-binding protein based on the barcode and spatial identifier sequence.

[0023] In some embodiments, the present disclosure provides a method for analyzing a plurality of nucleosomes and protein-DNA complexes, the method comprising: (i) introducing a universal connector into target DNA of the nucleosomes or protein-DNA complexes; (ii) contacting a solution containing the plurality of nucleosomes and protein-DNA complexes with a solution containing one binding conjugate of any one or combination of numbered aspects disclosed herein, wherein the binding domain binds to a DNA-binding protein or a nucleosome containing a histone modification; (iii) connecting adapters of the bound plurality of binding conjugates by ligation; (iv) hybridizing the universal connector of the target DNA to the 5' end of the ligated adapter; (v) copying the sequence of the ligated adapter to generate a copy of a barcoded target DNA; (vi) introducing, e.g., ligating, a universal nucleic acid sequence for amplifying the target DNA; (vii) amplifying the barcoded nucleosomal DNA; and (viii) analyzing the barcoded target DNA by sequencing.

[0024] In some embodiments, the present disclosure provides a method for diagnosing a cancer or cancer subtype associated with one or more types of histone modification, comprising analyzing a plurality of nucleosomes and protein-DNA complexes according to any one or combination of the numbered aspects disclosed herein.

[0025] In some embodiments, the present disclosure provides a method of detecting the presence of cancer or monitoring cancer progression or treatment response comprising analyzing a plurality of nucleosomes and protein-DNA complexes according to any one or combination of the numbered aspects disclosed herein.

[0026] In some embodiments, the present disclosure provides methods for detecting cell-free nucleosomal histone modifications as biomarkers in plasma liquid biopsies. Cell-free nucleosomal histone modifications are informative of DNA-associated activities within the cell of origin. In some embodiments, the present disclosure provides multiplexed detection of histone modifications in low sample input scenarios, such as analysis of cell-free nucleosomes in plasma, which contains only 20-60 ng of nucleosomes per mL.

[0027] In some embodiments, the present disclosure provides the method of any one or combination of numbered aspects disclosed herein, comprising obtaining a plurality of nucleosomes and protein-DNA complexes from a blood sample.

[0028] In some embodiments, the present disclosure provides the method of any one or combination of numbered aspects disclosed herein, comprising obtaining a plurality of nucleosomes and protein-DNA complexes from a tissue biopsy sample.

[0029] In some embodiments, the present disclosure provides a kit for monitoring epigenetic changes over time in a subject undergoing treatment for cancer, comprising a composition of any of the numbered aspects or combinations disclosed herein.

[0030] In some embodiments, the present disclosure provides any of the molecules, complexes, workflows, or methods depicted in the drawings or described in the disclosure and examples below.

[0031] These and other aspects of the present invention will become apparent upon review of the following detailed description, claims, embodiments, methods, compounds, and / or compositions, and related background information and references. [Brief explanation of the drawings]

[0032] [Figure 1]Figures 1A-1B are schematic diagrams illustrating sample preparation for histone profiling, which may involve end-repair or A-tailing, and / or ligation of the ends of DNA wrapped around histones to a universal capture sequence, depending on the downstream assay chemistry. As a non-limiting example, Figure 1A shows that blood contains circulating nucleosomes that can be used directly in barcoding assays. As a non-limiting example, Figure 1B shows that tissue or cell culture samples contain nucleosomes that can be isolated by digesting chromatin with DNA nucleases and used in assays.

[0033] [Figure 2] Figures 2A-2B show the colocalization of histone modifications on the same nucleosome by DNA barcoding (Figure 2A) and the multiplexed detection of histone modifications on different nucleosomes (Figure 2B). In Figure 2A, "MBC1," "MBC2," and "MBC3" are ligated to the same target nucleic acid, indicating the presence of three different histone modifications ("Mods"). Figure 2B depicts a scenario in which multiple nucleosomes are present, each carrying a single modification.

[0034] [Figure 3] Figures 3A and 3B show that multiplexed detection of histone modifications can be performed in two configurations: adapters can be tethered to the surface in close proximity to the binding domains (Figure 3A), or the adapters can be tethered directly to the binding domains (Figure 3B). Figure 3A is a schematic diagram of a substrate-based barcoding assay in which adapters are tethered to the bead surface. A bead pool is assembled from different bead types, each exhibiting one type of binding domain and one type of barcoded adapter. Because each bead type exhibits one type of binding domain and one type of barcoded adapter, the surface density of molecules does not affect the specificity of barcoding. Figure 3B shows barcoding with nucleosome-binding conjugates spaced apart on the surface to significantly reduce off-target barcoding.

[0035] [Figure 4] Figure 4 shows a schematic of nucleosome barcoding by double-sided ligation of Y-shaped or bell-shaped adapters. "UMI" stands for unique molecular identifier. The adapters on the left represent Illumina P5 and P7 adapters, where the MBC and UMI are sequenced as part of the index read. The adapter on the right introduces the MBC and UMI in frame into sequencing read 1, and the UFP and URP sites can be used to introduce sequences for non-Illumina sequencing platforms.

[0036] [Figure 5A] Figures 5A-5B show the detection of a single histone modification (Figure 5A) or multiple histone modifications (Figure 5B) using immobilized adapters. To detect a single histone modification per nucleosome (Figure 5A), nucleosomes are first immunoprecipitated on a pool of bead substrates. Next, a forward adapter is ligated (step 1), and the histone core is removed by denaturation (step 2). The complementary DNA strand is initiated by priming the UFP region and extending the primer with DNA polymerase (step 3). Finally, the double-stranded DNA is ligated to a reverse adapter (step 4), resulting in a DNA library ready for sequencing. To detect multiple histone modifications per nucleosome (Figure 5B), the workflow employs beads equipped with cleavable adapters. After the first barcoding step by ligation (step 1), the adapters are released from the surface by cleavage at uracil bases (U) (step 2). The barcoded nucleosomes are collected, recombined with the supernatant, and exposed to a pool of beads with different binding domains. [Figure 5B] Same as above

[0037] [Figure 6]Figure 6 shows the colocalization of histone modifications by serial encoding with adapters in solution. Because the adapters are not localized to the binding domain, each barcoding cycle is performed on a single bead type.

[0038] [Figure 7A] Figures 7A-7B show the detection of one or two histone modifications by barcoding both ends of a nucleosome with a nucleosome-binding conjugate containing a binding domain and a tether adapter (Figure 7A) and the colocalization of histone modifications by sequential barcoding of substrate-bound nucleosomes (Figure 7B). [Figure 7B-1] Same as above [Figure 7B-2] Same as above

[0039] [Figure 8-1] Figure 8 shows the colocalization of histone modifications by proximity ligation. Multiple nucleosome-binding conjugates bind to the same nucleosome. Proximity adaptors are connected by splint ligation and added to nucleosomal DNA by primer extension. [Figure 8-2] Same as above

[0040] [Figure 9] Figure 9 shows the colocalization of histone modifications by serial encoding with adapters in solution, similar to Figure 6, except that the adapter structure allows for the addition of a UMI adjacent to the MBC in each barcoding cycle.

[0041] [Figure 10] FIG. 10 depicts an agarose gel showing a DNA library obtained for multiplex detection of histone modifications H3K4me3 and H3K4me2 in HeLa nucleosomes using the workflow FIG. 5A described in Example 4.

[0042] [Figure 11A]Figures 11A-11F show the sequencing results obtained for a bead-based 2-plex barcoding assay using HeLa samples spiked with a synthetic nucleosome control panel, which served as positive and negative controls. Figure 11A shows the number of sequencing reads for each MBC associated with each synthetic nucleosome. KmetStat H3K4me3 control nucleosomes were enriched in MBC101, indicating that H3K4me3 was correctly identified. KmetStat_H3K4me2 control nucleosomes were enriched in MBC103, indicating that H3K4me2 was correctly identified. KmetStat_WT nucleosomes were unmodified and received only a small number of MBCs. Figure 11B shows the number of control nucleosome sequences identified for each MBC. In MBC101, KmetStat_H3K4me3 nucleosomes were the most represented reads. In MBC103, KmetStat_H3K4me2 nucleosomes are the most commonly represented reads consistent with correct barcoding. Figures 11C and 11D show the enrichment factor calculated from raw sequencing reads. The enrichment factor is defined as the number of reads per million in the IP reaction (beads with binding domains for H3K4me3 and H3K4me2) divided by the number of reads per million in the INPUT reaction (beads for histone 3 (H3)). Figures 11E and 11F show the piles of reads showing two exemplary genes and genomic regions with modifications in HeLa cells. [Figure 11B] Same as above [Figure 11C] Same as above [Figure 11D] Same as above [Figure 11E] Same as above [Figure 11F] Same as above

[0043] [Figure 12] FIG. 12 depicts an agarose gel showing the DNA library obtained with the histone modification co-localization workflow shown in FIG. 9 and described in Example 7.

[0044] [Figure 13A] Figures 13A-13B show the results of the colocalization workflow described in Figure 9 using a HeLa sample spiked with a synthetic nucleosome control panel serving as positive and negative controls. In this example, we tested the ability to sequentially barcode nucleosomes without eluting them. In the first cycle, H3K4me3 was identified by binding MBC107. In the second cycle, H3K4me3 was again identified, this time by binding MBC109. Figure 13A shows sequencing reads that associated synthetic nucleosomes with MBC107 and MBC109. Figure 13B shows the associated enrichment factors. Figure 13C shows an example of a sequencing read demonstrating the presence of two barcodes (SEQ ID NOs: 77-89 are listed in Figure 13C). [Figure 13B] Same as above [Figure 13C] Same as above

[0045] [Figure 14] Figure 14 shows an agarose gel and library yields from an experiment optimizing conditions for eluting synthetic nucleosomes after the first barcoding cycle without causing damage that would prevent the second barcoding cycle.

[0046] [Figure 15A] Figures 15A-15B show spatial analysis of cellular histone modifications in tissues. Nucleosome-binding conjugates containing adapters carrying modification barcodes and spatial identifier sequences are spotted onto a microarray slide. Transfer of the adapters to nucleosomes released from tissue identifies the cellular location of the tissue nucleosomes relative to the microarray. SP1 and SP2 are spatial identifiers for Spot 1 and Spot 2 (Figure 15A). As shown in Figure 15B, cells in tissue sections are permeabilized, followed by chromatin digestion. [Figure 15B] Same as above

[0047] Figure Reference Key

[0048] IP: immunoprecipitation

[0049] MBC: Modified Barcode

[0050] MOD: Modification

[0051] Read1: Read 1 primer site

[0052] Read2: Read 2 primer site

[0053] 5'-P: 5'-phosphate

[0054] U: Uracil

[0055] UL: universal ligation site

[0056] UFP: universal forward primer site

[0057] UFP: universal reverse primer site

[0058] FSA: forward sequencing adapter

[0059] RSA: reverse sequencing adapter

[0060] UMI: Unique Molecular Identifier

[0061] RE: restriction site

[0062] "MBC" means modified barcode.

[0063] "SP" stands for spatial identifier.

[0064] Detailed Description The present invention provides compositions and methods for profiling histone modifications and DNA-binding proteins. This method combines molecular recognition of histone modifications and DNA-binding proteins with the use of barcodes to write information from this recognition event into the adjacent genetic sequence of the target nucleic acid bound by the histone or DNA-binding protein. The resulting barcoded nucleic acids are then converted into a sequencing library and read, for example, by nucleic acid sequencing or other methods. This step reveals the sequence of the barcode, which correlates with the target DNA. Sequencing can also confirm the localization of histone modifications and DNA-binding proteins, such as transcription factors. The high-throughput profiling methods described herein enable the identification of the nature and location of multiple or all histone modifications in parallel. These methods can also determine the abundance and stoichiometry of histone modifications.

[0065] The disclosure of WO2022 / 115608 is incorporated herein by reference in its entirety for all purposes.

[0066] The present invention will now be described in more detail by way of example and not limitation, and with reference to the accompanying drawings. However, the present invention may be embodied in many different forms and should not be construed as being limited to the following embodiments. Rather, these embodiments are provided so that this description will be complete and will convey the scope of the present disclosure to those skilled in the art.

[0067] The method steps described herein can be performed simultaneously or sequentially unless otherwise specified, or unless it is apparent from the described method that a step must be performed first before its product can be used in a subsequent step.

[0068] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terms used in the detailed description herein are for the purpose of describing particular embodiments only and are not intended to be limiting.

[0069] All publications, patent applications, patents, GenBank / Uniprot or other accession numbers, and other references mentioned herein are incorporated herein by reference in their entirety for all purposes.

[0070] definition The following terminology is used in the specification and appended claims.

[0071] The singular forms "a", "an" and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise.

[0072] Additionally, as used herein, when referring to measurable values ​​such as amounts of polynucleotide or polypeptide sequence lengths, dosages, times, temperatures, etc., the term "about" can be used to describe reasonably understood variations, such as ±20%, ±10%, ±5%, ±1%, ±0.5%, or even ±0.1% of the stated amount.

[0073] Also, as used herein, "and / or" means and includes any possible combination of one or more of the associated listed items, as well as, when interpreted alternatively, the absence of a combination ("or").

[0074] Unless otherwise specified, it is specifically intended that the various features described herein can be used in any combination. Furthermore, in some embodiments, any of the features or combinations of features described herein can be excluded or omitted. To further illustrate, for example, when the present specification indicates that a particular DNA base can be selected from A, T, G, and / or C, this term also indicates that the base can be selected from any subset of these bases, such as A, T, G, or C; A, T, or C; T, or G; C only, etc., and each such subcombination is described as if it were explicitly described herein. Furthermore, this term also indicates that one or more of the specified bases can be excluded. For example, in some embodiments, the nucleic acid is described as not A, T, or G; not A; not G, or C, etc., as if each such possible exclusion were explicitly described herein.

[0075] As used herein, the terms "reduction," "reduction," "decreasement," and similar terms can be used to disclose a reduction of at least about 10%, about 15%, about 20%, about 25%, about 35%, about 50%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97% or more.

[0076] As used herein, the terms "increase," "improvement," "enhance," "enhance," and similar terms can be used to disclose an increase of at least about 10%, about 15%, about 20%, about 25%, about 50%, about 75%, about 100%, about 150%, about 200%, about 300%, about 400%, about 500% or more.

[0077] As used herein, the term "histone modification" refers to a modification to a chromatin-associated protein. In some embodiments, a nucleosome comprises a histone modification. In some embodiments, the histone modification is one or more of acetylation, methylation, citrullination, phosphorylation, ubiquitylation (also referred to as ubiquitination), sumoylation, ADP-ribosylation, deamination, proline isomerization, and other histone modifications known to those skilled in the art. In some embodiments, the histone modification is sumoylation of lysine or arginine. In some embodiments, the histone modification is phosphorylation of tyrosine, serine, and threonine. In some embodiments, the histone modification is any single modification or any combination of the modifications listed in Table 3.

[0078] The term "epigenetic change" is used herein to mean a phenotypic change in a living cell, organism, etc. that is not encoded in the primary sequence (i.e., A, T, C, and G) of the DNA of that cell or organism. Epigenetic changes can include, for example, chemical changes to nucleotides and / or histones (i.e., proteins involved in the coiling and packaging of DNA in the nucleus). In addition to the histone modifications discussed herein, epigenetic changes can include other histone modifications known to those skilled in the art. Common histone modifications include H3K4me1, H3K4me3, H3K36me3, H3K79me2, H3K9Ac, H3K27Ac, ​​H4K16Ac, H3K27me3, and H3K9me3. Exemplary DNA nucleotide modifications include the common epigenetic marker 5-methylcytidine (5mC) and its oxidation products 5-hydroxymethylcytidine (5hmC), 5-formylcytidine (5fC), 5-carboxymethylcytidine (5caC), etc. While 5mC is well known for its role in gene silencing, increasing evidence suggests metabolic functions for the oxidized intermediates 5hmC, 5fC, and 5caC in the 5mC demethylation pathway.

[0079] The term "genome" refers to all DNA contained in a cell or cell population, or a selection of specific types of DNA molecules (e.g., coding DNA, non-coding DNA, mitochondrial DNA, or chloroplast DNA). The term "transcriptome" refers to all RNA molecules produced in a cell or cell population, or a selection of specific types of RNA molecules contained in the complete transcriptome (e.g., mRNA vs. ncRNA, or specific mRNAs within an mRNA transcriptome). In some embodiments, the transcriptome includes multiple different types of RNA, such as coding RNA (i.e., RNA that is translated into protein, e.g., mRNA) and non-coding RNA. A non-limiting list of various types of RNA molecules found in the transcriptome may contain modified nucleosides: 7SK RNA, signal recognition particle RNA, antisense RNA, CRISPR RNA, guide RNA, long non-coding RNA, microRNA, messenger RNA, piwi-interacting RNA, repeat-associated siRNA, retrotransposon, ribonuclease MRP, ribonuclease P, ribosomal RNA, small Cajal body-specific RNA, small interfering RNA, smY RNA, small nuclear RNA, and trans-acting siRNA. As used herein, the term "chromatin" refers to the complex of molecules containing proteins and polynucleotides (e.g., DNA, RNA) found in the nucleus of eukaryotic cells. Chromatin is composed, in part, of histone proteins that form nucleosomes, genomic DNA, and other DNA-binding proteins (e.g., transcription factors) that bind to genomic DNA. The function of chromatin is to efficiently package DNA into a small volume that can fit into the cell's nucleus and protect the structure and sequence of the DNA. Packaging DNA into chromatin allows mitosis and meiosis, prevents chromosome breakage, and controls DNA accessibility for replication and gene expression.

[0080] As used herein, the term "isolated chromatin" refers to an accessible source of chromatin. Both isolated nuclei (which can be dissolved to produce chromatin) and isolated chromatin (i.e., the product of dissolved nuclei) are considered to be types of chromatin isolated from a cell population. The term "nucleosome" refers to a core complex of mammalian histone proteins (e.g., two H2A proteins, two H2B proteins, two H3 proteins, and two H4 proteins) from at least eukaryotic organisms (e.g., mammals, yeast, insects, or plants), in which an approximately 147-base pair dsDNA molecule is wrapped around the core of mammalian histone proteins. The structural characteristics of nucleosomes are well known in the art.

[0081] As used herein, the term "target nucleic acid" refers to a nucleic acid that wraps around histones to form a nucleosome. In some embodiments, the target nucleic acid is a target DNA. The target DNA may be part of a nucleosome. The binding domains described herein can recognize and bind to histone modifications or DNA-binding proteins of nucleosomes. In some embodiments, the DNA-binding protein can bind to a DNA region that connects two nucleosomes.

[0082] As used herein, the terms "surface" or "substrate" refer to any solid support. For example, a substrate can be a bead, a microarray, a chip, a flow cell, a fluidic device, a plate, a slide, a dish, a membrane, a frit, a three-dimensional matrix, or the like. A microarray is a slide onto which biomolecules, e.g., adapters or nucleosome-binding conjugates, are spotted, with each spot comprising a different composition. A flow cell is a sample cell designed to allow continuous flow of a liquid sample. As described herein, the binding domains described herein can be bound to one or more substrates, and the substrate can be bound to one or more binding domains. The substrate can be formed from a variety of materials. In some embodiments, the substrate is a resin, a membrane, a fiber, or a polymer. In some embodiments, the substrate comprises sepharose, agarose, cellulose, polystyrene, polymethacrylate, and / or polyacrylamide. In some embodiments, the substrate comprises a polymer, such as a synthetic polymer. A non-limiting list of synthetic polymers includes poly(ethylene) glycol, polyisocyanopeptide polymer, polylactic-co-glycolic acid, poly(ε-caprolactone) (PCL), polylactic acid, poly(3-hydroxybutyrate-co-3-hydroxyvalerate) (PHBV), chitosan, and cellulose.

[0083] As shown in Figure 3A, a "monoclonal substrate" can contain a binding domain and a barcoded DNA adapter. The substrate can be a bead, a portion of a microarray, a lane in a microfluidic device, or a well in a microtiter plate. Each monoclonal substrate contains one type of binding domain, e.g., an antibody, specific for a histone modification and multiple copies of a DNA adapter that displays a modification barcode (MBC). After or during immunoprecipitation of nucleosomes and DNA-binding proteins, the adapter is transferred to the DNA, displaying the modification.

[0084] As used herein, the term "barcode" refers to a synthetically produced nucleic acid. Unique barcodes may be assigned to specific nucleosome modifications or DNA-binding proteins to enable specific identification of their targets in the methods described herein. Thus, a barcode is "unique" to a histone modification when specifically used to identify that modification or protein in one or more of the methods described herein. In other examples, a barcode is "unique" to the location of a nucleosome-binding conjugate linked to the surface of a microarray. Barcodes can be produced using methods known in the art, such as solid-phase oligonucleotide synthesis. In certain embodiments, a barcode may be a DNA barcode (i.e., may comprise a DNA sequence). In some embodiments, a barcode may comprise a synthetic DNA structure, such as a peptide nucleic acid (PNA) or a locked nucleic acid (LNA). In some embodiments, the synthetic DNA structure may comprise one or more modified bases. In some embodiments, a barcode may be an RNA barcode (i.e., may comprise an RNA sequence). Barcodes may be of any length, e.g., ranging from about 4 to about 150 nucleotides in length. In some embodiments, the barcode is about 4 to about 20 nucleotides in length, e.g., about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length. Typically, the barcode may contain a rationally designed sequence that is not present in the genome of any known organism. However, in some embodiments, the barcode may contain a known sequence. For example, the barcode sequence may contain a signature associated with a pathogen or other biological substance. In some embodiments, the barcode may contain a sequence configured to facilitate a sequencing reaction. The terms "barcode" and "adapter" may be used interchangeably herein.As understood in the art, an adapter, in some aspects, is comprised of a barcode. In some aspects, an adapter can include a barcode and one or more additional elements, as described below and shown in Figures 2A-2B, 4, 7A-7B, 8, 9, and 15A-15B. In some embodiments, an "adapter" can include a spatial identifier (SP) sequence. As used herein, a "spatial identifier sequence" or "spatial identifier" defines the location of a nucleosome-binding conjugate or adapter on a microarray. In some embodiments, an "adapter" can include a sequencing adapter. In some embodiments, a sequencing adapter includes a Y-shaped sequencing adapter or a bell-shaped sequencing adapter. In some aspects, an adapter includes up to 20 random bases. In some aspects, an adapter includes one or more unnatural nucleobases or modified bases such as uracil or inosine. In some aspects, an adapter includes at least one of a universal forward primer (UFP) and a universal reverse primer (URP). In some aspects, an adapter includes a unique molecular identifier (UMI). In some embodiments, the adapter comprises one or more backbone modifications selected from locked nucleic acid (LNA), peptide nucleic acid (PNA), glycol nucleic acid (GNA), phosphorothioate, 2'-fluoro-ribose, 2'-methoxyribose, phosphorodithioate, methylphosphonate, phosphoramidate, guanidinopropyl phosphoramidate, triazole, guanidinium, morpholino, threose nucleic acid (TNA), or hexitol nucleic acid (HNA). In some embodiments, the adapter comprises one or more 3' or 5' modified groups, wherein the one or more 3' or 5' modified groups are independently selected from dideoxyribose, phosphate, amine, reverse base, linker, or one or more other modifications.

[0085] As shown in Figure 4, the substrate beads can contain a modification-specific antibody and a Y-shaped sequencing adapter. In some embodiments, the adapter is immobilized via a biotin-streptavidin interaction. In some embodiments, the adapter is immobilized via a biotin-avidin or biotin-neutravidin interaction. In some embodiments, the modified nucleosome or DNA-binding protein is captured by immunoprecipitation and then captured by adapter ligation, where the adapter comprises a modification barcode (MBC), a unique molecular identifier (UMI), a primer binding site for a sequencing read primer (Read1, Read2), and a forward sequencing adapter (FSA) and a reverse sequencing adapter (RSA). In some embodiments, the adapter comprises a UMI, an MBC, a universal forward priming site, and a universal reverse priming site (UFP, URP). In some embodiments, the adapter can additionally or alternatively be a bell-shaped adapter. For example, to detect multiple histone targets in the same reaction, corresponding bead types are combined, each displaying a uniquely barcoded adapter and modification-specific antibody (see, e.g., Figure 3A). As shown in Figure 4, before performing PCR, the histone core can be removed using denaturing conditions such as protease or DTT and heat. In some embodiments, the bell-shaped adapter can contain uracil (U) to link the sequencing adapter element of the adapter.

[0086] In some embodiments, one or more elements, e.g., adapters or binding domains, can be immobilized on a substrate using, for example, protein G, protein A, biotin, via avidin, streptavidin, or neutravidin, via a linker, or via a recognition element.

[0087] The term "amplification," when used in reference to a nucleic acid, means to generate copies of that nucleic acid. Nucleic acids can be amplified, for example, using the polymerase chain reaction (PCR). Alternative methods of nucleic acid amplification include helicase-dependent amplification (LAMP), recombinase polymerase amplification (RPA), helicase-dependent amplification (HAD), multiple strand displacement amplification (MDA), nucleic acid sequence-based amplification (NASBA), self-sustained sequence replication (3SR), and rolling circle amplification (RCA).

[0088] As used herein, the term "coupled" can be used to describe two or more components that are associated with one another. For example, a first component coupled to a second component can be covalently or non-covalently bound, or otherwise associated. In some embodiments, a binding domain can be attached to a substrate using a tether.

[0089] As used herein, the term "tether" refers to a bifunctional chemical moiety capable of attaching one component to another. In some embodiments, the first component can be a substrate and the second component can be a binding domain.

[0090] As used herein, the term "intra-complex adapter transfer" or "intra-complex barcode transfer" refers to the transfer of an adapter and / or barcode to a target nucleic acid (i.e., DNA) while a binding domain is bound to it. Accordingly, the term "complex" as used herein refers to the complex formed between a target nucleic acid and its cognate binding domain.

[0091] As used herein, the terms "crosstalk," "barcode crosstalk," and similar terms refer to off-target transfer of nucleic acid barcodes. For example, barcode crosstalk can occur when a barcode of a binding domain is transferred to a nucleic acid that is not bound to the binding domain of the binding domain.

[0092] The term "DNA address" refers to a DNA or RNA sequence and / or its complement that is used as a programmable binding element to promote a specific binding event. For example, a nucleosome can bind to a nucleic acid sequence (i.e., a first DNA address) that binds to a nucleic acid sequence (e.g., a second DNA address), and be presented by a substrate to immobilize the nucleosome thereon.

[0093] The term "restriction sequence" means a sequence recognized by a restriction enzyme specific for that sequence.

[0094] Provided herein are adaptors and binding domains, each of which is described in further detail below.

[0095] adapter As used herein, the term "adapter" refers to any short nucleic acid sequence that can be attached to the end of a DNA or RNA molecule and confers some function. For example, in some embodiments, an adapter can facilitate sequencing and / or identification of the DNA or RNA molecule.

[0096] In some embodiments, the adapter comprises a 5' phosphate. In some aspects, the adapter comprises a 3' phosphate. In certain aspects, the adapter comprises a 5' phosphate and a 3' phosphate. In some aspects, the adapter is single-stranded. In some aspects, the adapter is double-stranded. In some aspects, the double-stranded adapter can comprise a single-stranded adapter hybridized to a complementary oligonucleotide.

[0097] In some embodiments, the adapter is bound to the substrate covalently, via affinity interactions, or a combination thereof. In some embodiments, the adapter comprises a surface anchor moiety. In some embodiments, the surface anchor moiety is biotin or desthiobiotin. In some embodiments, the surface anchor moiety is transcyclooctene (TCO), methyltetrazine (mTET), dibenzocyclooctyl (DBCO), an amine, an azide, or an alkyne.

[0098] In some embodiments, the adapter is cleavable. For example, the adapter may include one or more cleavage sites. The cleavage site may include, for example, one or more uracil bases, a sequence recognized by an enzyme (e.g., a restriction enzyme or other nuclease), or a synthetic chemical moiety. In some embodiments, the adapter may be cleavable by an enzyme specific for uracil, inosine, 8-oxoG, or a ribonucleoside of the adapter. For example, the adapter may be cleavable by 8-oxoguanine-DNA glycosylase or a derivative thereof, uracil-DNA glycosylase (UDG), endonuclease III, IV, V, or VIII or a derivative thereof, or a ribonuclease or a derivative thereof. In some embodiments, the adapter includes a recognition sequence or restriction site that can be cleaved by a restriction enzyme specific for the restriction site.

[0099] In some embodiments, the adapter comprises a universal forward primer (UFP). In some embodiments, the adapter comprises a universal reverse primer (URP). In some embodiments, the adapter comprises a UFP and a URP. In some embodiments, the adapter consists of a UFP or a URP. The UFP and URP sequences are non-naturally occurring DNA sequences that allow selective amplification of only those sequences introduced into the target nucleic acid (or a copy thereof). During sequencing, the UFP and / or URP anneal to the DNA target and provide a starting site for extension of a new DNA molecule (i.e., a copy thereof). A list of exemplary UFPs and URPs is provided in Table 1. [Table 1-1] [Table 1-2]

[0100] In some embodiments, the universal primer sequences used in the adapters (and transferred to the target nucleic acid) are compatible with established DNA sequencing platforms and can be used to introduce surface adapters such as Illumina P5 and P7 in downstream PCR reactions.

[0101] In some embodiments, the adapter may include a barcode, such as a modification-encoding barcode (MBC). An MBC is a short, unique nucleic acid sequence. Each MBC is used in association with a specific epigenetic modification to aid in its identification and / or analysis. For example, an MBC may be used in an adapter conjugated to a binding domain specific for a particular histone modification. In some embodiments, the adapter may be comprised of a barcode. In some embodiments, the adapter may be comprised of an MBC.

[0102] Nucleosome-binding conjugates comprise one or more adaptor sequences. Each adaptor sequence can comprise a universal sequence, a unique molecular identifier, a modified barcode, and a spatial barcode for spatial application. The spatial barcode indicates the spatial location of the nucleosome-binding conjugate on the microarray. For example, a microarray comprises 10,000 spots, each spot representing multiple nucleosome-binding conjugates. The nucleosome-binding conjugates within a spot share a spatial barcode but may comprise different binding domains, and the modified barcodes represent the targets of the binding domains. In some embodiments, the spatial barcode is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, or 40 bases long.

[0103] In some embodiments, multiple nucleosome-binding conjugates with adapters containing unique spatial identifiers are placed on a microarray for spatial analysis of histone modifications. Array-based spatial analysis methods involve transferring one or more analytes from a biological sample to an array of features on a substrate, with each feature associated with a unique spatial location on the array. Subsequent analysis of the transferred analytes includes identifying the analyte and determining its spatial location within the biological sample. The spatial location of the analyte within the biological sample is determined based on the feature to which the analyte is bound (e.g., directly or indirectly) on the array and the relative spatial location of the feature within the array. Alternatively, specific spatial identifiers can be placed at predetermined locations on an array of features during manufacturing, such that only one type of spatial identifier is present at each location, and the spatial identifier is uniquely associated with a single feature on the array. If desired, the array can be decoded using any of the methods described herein to uniquely associate the spatial identifier with the feature location on the array, and this mapping can be stored as described above.

[0104] The present disclosure includes a spatial barcoding method that involves labeling target molecules from individual cells or regions within a tissue with spatial barcodes. These barcodes are used to identify the origin of the target molecules during sequencing and map histone modification patterns to specific locations within the tissue. This spatial information is used to understand the functional organization of tissues and the role of histone organization in various subcellular contexts.

[0105] In some embodiments, the adapter comprises a universal sequence in addition to the barcode. As used herein, "universal sequence" refers to a sequence that is not specifically associated with a binding domain or histone or nucleosome modification. For example, a universal sequence is an antibody-independent sequence, including, but not limited to, a sequence adapter.

[0106] In some embodiments, the adapter comprises a uracil base, an inosine base, an 8-oxo-G base, or a ribonucleoside.

[0107] Histones are among the most highly conserved proteins, acting as building blocks of nucleosomes, the basic structural and functional units of chromatin. Nucleosomes are octamer structures around which approximately 147 bp of DNA is wrapped, consisting of two copies of four core histones (H) H2A, H2B, H3, and H4, linked together by the linker histone H1. These five classes of histone proteins, with over 60 distinct residues, constitute the major protein components of chromatin and provide rigid packing of DNA. Meanwhile, histones have flexible N-termini, often termed "histone tails," that can undergo various combinations of post-translational modifications, dynamically enabling regulatory proteins to access DNA and fine-tune almost all chromatin-mediated processes, including chromatin condensation, gene transcription, DNA damage repair, and DNA replication. Transcriptionally active and silent chromatin are characterized by the presence or combination of histone post-translational modifications. Histone proteins can be post-translationally modified by a series of enzymes called "writers" and "erasers" that are responsible for adding and removing chemical modifications. Through different combinations and patterns of histone post-translational modifications, histones can form a "histone code."

[0108] In some embodiments, the adapter may comprise a unique molecular barcode (UMI). [UMIの長さ] For example, a 10-mer UMI consists of a short random sequence with 1,048,576 (4 10) can encode unique molecules. UMIs are used for absolute quantification of sequencing reads to correct for PCR amplification bias and errors. For example, an RNA sample may contain 100 copies of transcript A and 100 copies of transcript B. Because transcript B amplifies more efficiently, 1M copies of transcript A and 2M copies of transcript B may be detected after PCR amplification. When using UMIs for transcript A, 10,000 copies of the 100 UMI variant are detected, and 20,000 copies of the 100 UMI variant are detected for transcript B. Counting the number of UMI variants instead of counting the number of reads provides an absolute number of molecules.

[0109] Typically, the length of a UMI is selected to avoid UMI collisions, defined as the observation of two reads with the same sequence and the same UMI but originating from two different genomic molecules. UMI collisions are a function of the number of UMIs used, the number of unique alleles, and the frequency of each allele in the population. The ideal UMI length also depends on the error rate and sequencing depth of the sequencing platform. Sequencing platforms with high error rates require longer UMIs because UMI errors can lead to accidental UMI collisions. In targeted sequencing, where the sequencing depth of a selected locus is deeper than that of whole-genome sequencing, longer UMIs are also used because many alleles from different genomic molecules share the same sequence. Excessively long UMIs are avoided because they require more sequencing cycles, thus shortening the reads of the actual target sequence. Long UMIs can cause mispriming in PCR reactions, resulting in sequencing artifacts. UMIs typically range from approximately 3 to approximately 25 nucleotides. In some embodiments, the UMI is about 3 to about 20 nucleotides in length, e.g., about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, or about 20 nucleotides in length. In some embodiments, the UMI can be 8 nucleotides in length. In some embodiments, the UMI can be 10 nucleotides in length.

[0110] 2A-2B, 4, 7A-7B, and 8 show exemplary nucleic acid adapter structures, with legends providing descriptions of each element used therein.

[0111] In some embodiments, the adapters shown in Figure 2A are used in colocalization assays to convert the presence of histone modifications (e.g., Mod1, Mod2, Mod3) into corresponding modification barcodes (e.g., MBC1, MBC2, MBC3). MBCs are enzymatically attached to nucleosomal DNA along with a universal forward primer site (UFP) or reverse primer site (URP). Sequencing of the resulting NGS library provides the histone modifications present on the nucleosomes. In Figure 2B, the targeted modifications are located on different nucleosomes, as shown in the examples. Each modification barcode (MBC) identifies a different histone modification. Transfer of the MBCs, along with a universal forward primer site (UFP) or reverse primer site (URP), to nucleosomal DNA creates a sequencing library. Sequencing reveals the DNA sequence associated with a given histone and the associated histone modification, indicated by the modification barcode.

[0112] In some embodiments, the adapter comprises a UFP, a URP, or a UFP and a URP. In some embodiments, the adapter comprises a UFP and / or a URP and further comprises an MBC. In some embodiments, the adapter comprises a UFP and / or a URP, an MBC, and a UMI. In some embodiments, the adapter comprises a UFP and / or a URP, an MBC, and a UMI. In some embodiments, the adapter comprises a UFP and / or a URP, an MBC, and a UMI. In some embodiments, the adapter comprises a UFP, a URP, a UMI, and an MBC. In some embodiments, the adapter comprises a URP, a UMI, and an MBC. In some embodiments, the adapter comprises an MBC and a UMI. In some embodiments, the adapter comprises any configuration depicted in any of the figures.

[0113] In some embodiments, the adapter has a Y-shape. In some embodiments, the adapter having a Y-shape comprises a UFP, an MBC, and a URP. In some embodiments, the adapter is partially double-stranded forming a Y-shape, and each single-stranded arm can comprise a universal sequence, a modified barcode, and a unique molecular identifier.

[0114] In some embodiments, the adapter has a bell shape. In some embodiments, the adapter is partially double-stranded forming a bell shape. In some embodiments, the single-stranded loop may comprise a universal sequence, a modified barcode, and a unique molecular identifier.

[0115] In some aspects, the adapters according to one or more of the preceding embodiments are partially double-stranded with a single-stranded 3' and / or 5' overhang, or the adapters are partially double-stranded with single-stranded 3' and / or 5' overhangs on both sides. The adapters according to the preceding embodiments may be blunt-ended or may include a double-stranded end with a single 3'- and / or 5'-base overhang.

[0116] In some embodiments, the adaptors described herein may include one or more linkers, such as linkers that assist in linking the binding domain to the adaptor. Linkers include polyethylene glycol, carbohydrates, peptides, DNA, or RNA. The length of the linker can vary. Longer linkers can be used when the histone modification or DNA-binding protein is located farther from the 5' or 3' end of the nucleic acid sequence. Shorter linkers can be used when the histone modification or DNA-binding protein is located relatively closer to the 5' or 3' end of the nucleic acid sequence.

[0117] In some embodiments, the adapter, or a linker sequence contained therein, is cleavable. For example, the adapter may contain one or more cleavage sites. The adapter may be chemically, photochemically, or enzymatically cleavable. The cleavage site may include, for example, one or more uracil bases, a sequence recognized by an enzyme (e.g., uracil-DNA glycosylase, a restriction enzyme, or other nuclease), or a synthetic chemical moiety, such as a disulfide, carbonate, hydrazone, cis-aconityl, or (β-glucuronide).

[0118] As described in more detail below, adapters can be fused to single-stranded or double-stranded target nucleic acids (e.g., DNA or RNA) using a barcode transfer reaction.

[0119] As used herein, a "universal connector" refers to a sequence that can hybridize to a complementary sequence on any adapter. In some embodiments, the universal connector may be a polyA oligonucleotide sequence, such as a sequence that can be generated using dATP and the action of terminal nucleotidyl transferase. In this example, the polyA universal sequence can hybridize to an oligoT sequence contained in the connected adapter.

[0120] In some embodiments, a 3' polyA tail is added to the target, as depicted in Figure 8. The 3' polyA tail is added by polyadenylation using a known terminal nucleotidyl transferase (TD). In some embodiments, the length of the 3' polyA tail is about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, or about 60 bases in length.

[0121] In some embodiments, primer extension comprises adding a 3' poly-T tail, a 3' poly-G tail, a 3' poly-A tail, or a 3' poly-G tail to the DNA target, hi some embodiments, the length of the tail is about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, or about 60 bases.

[0122] Binding domain As used herein, the term "binding domain" refers to any nucleic acid, polypeptide, or other macromolecule that binds to a histone modification or DNA-binding protein of a target nucleosome. The term "binding domain" may be used interchangeably herein with terms such as "binding agent," "recognition element," and "antibody," as would be understood by one of skill in the art from the context. In some embodiments, the binding domain binds to a histone modification. In some embodiments, the binding domain does not bind to any nucleic acid feature adjacent to the histone modification. In some embodiments, the binding domain binds to a histone modification or a DNA-binding protein. In some embodiments, the binding domain may bind to a conserved sequence motif. In some embodiments, the binding domain does not bind to any nucleic acid feature adjacent to the histone modification or adjacent to the DNA-binding protein. In some embodiments, the binding domain binds to a histone modification that is lysine or arginine methylation, citrullination, acetylation, ubiquitination, or sumoylation. In some embodiments, the binding domain binds to tyrosine, serine, or threonine phosphorylation. In some embodiments, the binding domain binds to a DNA-binding protein that is a transcription factor or RNA polymerase.

[0123] The binding domains described herein can be any protein, nucleic acid, or fragment or derivative thereof that can recognize and bind to a histone modification or DNA-binding protein. For example, in some embodiments, the binding domain comprises an antibody, an aptamer, a reader protein, a writer protein, an eraser protein, an artificial polymer scaffold, an artificial protein scaffold, or a selective covalent capture reagent, or a fragment or derivative thereof. In some embodiments, the binding domain comprises an IgG antibody, an antigen-binding fragment (Fab), a single-chain variable fragment (scFv), or a heavy or light chain single domain (V). H and V L In some embodiments, the binding domain comprises a heavy chain antibody (hcAb) or a V H In some embodiments, the binding domain comprises an H domain (nanobody). In some embodiments, the binding domain is a bivalent binding domain for histone modifications. In some embodiments, the binding domain comprises an artificial protein scaffold such as an adnectin, affibody, affilin, anticalin, atrimer, avimer, bicyclic peptide, sentinin, cis-knot, darpin, finomer, Kunitz domain, obody, or pronectin. In some embodiments, the binding domain comprises a catalytically inactive mutant of a DNA or histone writer or eraser protein. In some embodiments, the binding domain is bound to the substrate covalently or via an affinity interaction. An affinity interaction is an interaction in which two binding partners exhibit binding affinity for each other. Examples of affinity interactions include, but are not limited to, biotin-avidin interactions or antibody-protein G interactions.

[0124] IgG antibodies are the major immunoglobulin isotype. IgG contains two identical heavy chains and two identical light chains, which are covalently stabilized through disulfide bonds. IgG consists of heavy chains (V H ) and light chain (V L) recognizes antigens via its variable N-terminal domain and six complementarity-determining regions (CDRs). Antibodies that bind to histone modification or DNA-binding proteins are commercially available, for example, from EpigenTek, Abcam, and Active Motif.

[0125] Antibodies that bind to histone modification or DNA-binding proteins can also be developed according to methods known to those skilled in the art. In some embodiments, the antibody is a monoclonal antibody, a polyclonal antibody, or a functional fragment or variant thereof. As used herein, the term "antibody" refers to any specific binding substance having a binding domain with the required specificity. Thus, the term covers antibody fragments, derivatives, functional equivalents, and antibody homologs, including any polypeptide containing an immunoglobulin-binding domain, whether natural or synthetic, monoclonal or polyclonal. Chimeric molecules containing fusions of an immunoglobulin-binding domain or equivalent with another polypeptide are also included.

[0126] In some embodiments, the binding domain may comprise a nanobody, which is a single variable domain (V) of a heavy chain antibody, such as those produced by camelids and some cartilaginous fish. H H) V H The H domain consists of three CDRs that are expanded compared to the CDRs of IgG antibodies, and is about the same size as IgG (i.e., about 800 Å). 2Nanobodies provide an antigen-interacting surface. Nanobodies bind antigens with similar affinity to IgG antibodies but offer several advantages: they are small (15 kDa), have fewer disulfide bonds and are less susceptible to reducing environments, are more soluble, and lack post-translational glycosylation. Nanobodies can be produced in bacterial expression systems, allowing affinity and specificity maturation via phage and other display technologies. Other advantages include improved thermostability and solubility, and a facile approach to site-specific labeling. Their small size allows nanobodies to form convex paratopes, making them suitable for binding to difficult-to-access antigens. Exemplary methods for producing nanobodies include immunizing the respective animal (e.g., camel) with the antigen of interest, further evolving existing naive libraries, or a combination thereof.

[0127] In some embodiments, the binding domain comprises a reader protein, a writer protein, or an eraser protein. A "reader protein" is a protein that selectively recognizes and binds to a specific chemical modification on a histone tail. A "writer protein" is a protein that adds a specific chemical modification to a histone tail. An "eraser protein" is an enzyme that removes a specific chemical modification from a histone tail. In some aspects, the binding domain comprises a fragment or derivative of a reader protein, a writer protein, or an eraser protein. In some aspects, the binding domain comprises an engineered form of a reader, writer, or eraser protein, such as a form engineered to retain nucleic acid binding but lack enzymatic activity. In some embodiments, the writer protein is a histone acetyltransferase, a CBP / P300 protein, a lysine methyltransferase, or an arginine methyltransferase. In some embodiments, the leader comprises a methyl-CpG binding domain (MBD), zinc finger protein adjacent bromodomain (BAZ), bromodomain (BRD), malignant brain tumor (MBT), plant homeodomain finger (PHD), chromatin binding (chromo), proline-tryptophan-tryptophan-proline domain (PWWP), tryptophan-aspartic acid dipeptide repeat domain (WD40), ankyrin repeat, or Tudor domain. In some embodiments, the eraser protein is a histone deacetylase, histone lysine demethylase, or histone arginine demethylase. Further, exemplary reader, writer, and eraser proteins that can be used with the binding domains described herein are listed in Table 2. Additional reader, writer, and eraser proteins are listed at the following World Wide Web address: rnawre.bio2db.com, incorporated herein by reference. [Table 2] [Table 3-1] Table 3-2 Table 3-3 Table 3-4 Table 3-5 Table 3-6 Table 3-7 Table 3-8 Table 3-9

[0128] The binding domain can be selected and / or engineered to bind to any histone modification or DNA-binding protein. For example, the histone modification can be acetylation, methylation, citrullination, phosphorylation, ubiquitylation (also called ubiquitination), sumoylation, ADP-ribosylation, deamination, or proline isomerization. In some embodiments, the histone modification is sumoylation of lysine or arginine. In some embodiments, the histone modification is phosphorylation of tyrosine, serine, and threonine. In some embodiments, the DNA-binding protein is one or more of a transcription factor, a histone-protein complex, a histone subunit, or a transcriptional repressor. The binding domain can be selected and / or engineered to bind any modification, such as acetylation, methylation, citrullination, phosphorylation, ubiquitylation (also called ubiquitination), sumoylation, ADP-ribosylation, deamination, or proline isomerization, or to a nucleosomal DNA-binding protein.

[0129] target DNA As used herein, the term "target DNA" refers to a nucleic acid sequence associated with a histone modification or a DNA-binding protein of interest. In some embodiments, the target DNA may be a nucleosomal DNA containing a histone modification. In some embodiments, the target DNA comprises a nucleosomal end. In some embodiments, the method according to one or more embodiments comprises end-repairing and / or A-tailing the nucleosomal end.

[0130] DNA-binding proteins As used herein, the term "DNA-binding protein" refers to a protein that has a general or specific affinity for single-stranded or double-stranded DNA. In some embodiments, the DNA-binding protein can be a protein associated with a nucleosome. For example, the DNA-binding protein can be a protein that binds to DNA between or associated with nucleosomes. In some embodiments, the DNA-binding protein is a transcription factor. In some embodiments, the DNA-binding protein is RNA polymerase II. In some embodiments, the DNA-binding protein is a transcription activator or a transcription repressor.

[0131] Adapter / barcode transfer reaction The binding domains described herein can be used to transfer adapters, such as adapters containing barcodes, to target nucleic acids. Thus, in some embodiments, the binding domains described herein can be used to transfer barcodes to target nucleic acids. The barcodes may be MBCs, i.e., barcodes that are specific to histone modifications and conjugate to target DNA in nucleosomes containing DNA-binding proteins. A target nucleic acid into which an adapter has been introduced is referred to herein as a "labeled target nucleic acid," "labeled target," or similar term. A target nucleic acid into which a barcode has been transferred is referred to herein as a "barcoded target nucleic acid," "barcoded target," or similar term. A reaction in which an adapter is transferred to a target nucleic acid is referred to herein as an "adapter transfer reaction." Similarly, a reaction in which a barcode is transferred to a target nucleic acid is referred to herein as a "barcode transfer reaction."

[0132] In some embodiments, the barcode is transferred to the target nucleic acid by enzymatic transfer, such as enzymatic transfer by single-strand ligation, splint ligation, primer extension, or double-strand blunt-end or sticky-end ligation. In some embodiments, the present disclosure includes ligating a universal nucleic acid sequence to the 3'-end, 5'-end, or both ends of the target DNA. In some embodiments, the present disclosure includes enzymatically tailing the 3'-end of the target DNA with multiple nucleotides of a single type. In some embodiments, the enzymatic tailing is performed with terminal nucleotidyl transferase. In some embodiments, the 3'-end of the adapter hybridizes to the 3'-end of the target DNA. In some embodiments, a modification-specific barcode is introduced, and one or both of the 3'-ends are extended by DNA polymerase. In some embodiments, an adapter with a 3'-degenerate base randomly primes the target DNA, the modification-specific barcode is introduced, and one or both of the 3'-ends are extended by DNA polymerase.

[0133] The purpose of adapter / barcode transfer is to covalently link the adapter / barcode to the target nucleic acid molecule. For example, in some embodiments, the barcode is transferred to the target nucleic acid by covalently linking the barcode to the 5' or 3' end of the target nucleic acid. In some embodiments, the barcode is transferred to the target nucleic acid by covalently linking the barcode or its complement to the 5' or 3' end of the target nucleic acid. In some embodiments, the labeled / barcoded nucleic acid molecule may be sequenced in a downstream step. In some embodiments, copies of the labeled target nucleic acid can be sequenced. Figures 4, 7A-7B, and 8 provide examples of adapter / barcode transfer reactions.

[0134] Transfer of adapters / barcodes to target DNA can be performed using one or more DNA ligases, such as T4 DNA ligase, CircLigase, T3 DNA ligase, T7 DNA ligase, 9N DNA ligase, Taq DNA ligase, or E. coli DNA ligase. 9N DNA ligase is a DNA ligase that catalyzes the formation of a phosphodiester bond between the juxtaposed 5' phosphate and 3' hydroxyl ends of two adjacent oligonucleotides that hybridize to complementary target DNA.

[0135] Splint ligation can also be used to introduce adapters / barcodes into target nucleic acids. In splint ligation, bridging DNA is used to join two nucleic acids. Splint DNA ligation can be performed using enzymes such as T4 DNA ligase, T3 DNA ligase, T7 DNA ligase, and E. coli DNA ligase.

[0136] Additionally, double-stranded ligation can also be used to transfer adapter / barcodes to target nucleic acids. In some embodiments, the target nucleic acid molecule can be double-stranded DNA and can have either blunt or sticky ends. Ligation of blunt and sticky ends of double-stranded DNA is catalyzed by T4, T3, T7, or E. coli ligase.

[0137] In some embodiments, chemical ligation can be used to introduce the adapter / barcode into the target nucleic acid.

[0138] Methods for preventing or reducing intercomplex adapter / barcode transfer by spatial separation Intra-complex transfer of adapter / barcodes can be facilitated by spatially separating the molecules involved in the reaction. Specifically, by separating the complexes containing the target nucleic acid, binding domain, and adapter, inter-complex barcode transfer, i.e., inter-complex adapter / barcode transfer, is less likely to occur. This assay configuration increases barcoding accuracy.

[0139] Barcode Transfer Each binding domain specifically binds to a target, bringing the adapter of the nucleic acid into proximity with either the 3' or 5' end of the target nucleic acid. The adapter (e.g., an adapter containing or consisting of a barcode) can then be transferred to the target nucleic acid. In some embodiments, the transfer is performed in an environment that substantially prevents off-target generation of barcoded nucleic acids. Such an environment can be, for example, an environment in which the target nucleic acids cannot interact with each other (i.e., only one binding domain can interact with each target nucleic acid). This can be achieved, for example, by performing the barcode transfer reaction in a very dilute solution or by immobilizing either the target nucleic acid or the binding domain on a substrate to achieve spatial separation. In some embodiments, the transfer is performed by copying the target nucleic acid and generating a labeled / barcoded copy of the target nucleic acid. For example, if a barcode is transferred to or adjacent to the target nucleic acid, primer extension can be used to generate a barcoded copy of the target nucleic acid. In some embodiments, the barcode transfer can occur in an environment in which off-target barcoded DNA generation is less than 20% of the total barcoded target DNA. In some embodiments, the generation of off-target barcoded DNA is less than 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% of the total barcoded target DNA. In some embodiments, an environment in which the generation of off-target barcoded DNA is less than any of the preceding percentage ranges relative to the total barcoded target DNA is an environment that allows spatial separation. In some embodiments, as described in further detail below, one or more of the target nucleic acid, binding domain, adapter, and barcode transfer are bound to a substrate, providing an environment in which the generation of off-target barcoded DNA is less than any of the preceding percentage ranges relative to the total barcoded target DNA.In some embodiments, the environment in which off-target barcoded DNA is produced less than any of the preceding percentage ranges relative to the total barcoded target DNA is an environment in which multiple copies of the adapter are bound to the substrate at a particular density, or density range, as further described below.

[0140] The barcode transfer reaction and spatial separation are described above and in Figures 7A-7B.

[0141] Barcode transfer may be performed in several different environments that allow spatial separation. Spatial separation can be achieved, for example, by highly diluting the complex containing the binding domain bound to the target in the solution. The solution must be sufficiently dilute so that the complex containing the binding domain bound to the target nucleic acid present therein can be spatially separated. Such spatial separation promotes barcode transfer within the complex and substantially prevents barcode transfer between binding domain complexes. In some embodiments, the concentration of the complex in the dilute solution is less than 1000 nM, less than 500 nM, less than 100 nM, less than 10 nM, less than 1 nM, less than 0.1 nM, less than 0.01 nM, or less than 0.001 nM.

[0142] In some embodiments, spatial separation can be achieved by immobilization on a substrate. For example, the binding domains described herein can be immobilized by binding to a substrate. Each substrate can contain only one type of binding domain, or at least two, three, four, five, or more types of binding domains. Each "type" of binding domain binds to a different histone modification or DNA-binding protein and / or contains a different barcode. In some embodiments, a first binding domain is spatially separated from a second binding domain on the surface of the substrate. Surface binding capacity and format can be adjusted to allow absolute or relative quantification of target molecules and modifications.

[0143] Exemplary substrates to which binding domains, adapters, and intermediate proteins, linkers, and tethers can be attached include, for example, beads, chips, plates, slides, dishes, or three-dimensional matrices. In some embodiments, the substrate is a resin, membrane, fiber, or polymer. In some embodiments, the substrate is a bead, such as beads comprising sepharose, agarose, cellulose, polystyrene, polymethacrylate, and / or polyacrylamide. In some embodiments, the support is a magnetic bead. In some embodiments, the support is a polymer, such as a synthetic polymer. A non-limiting list of synthetic polymers includes polystyrene, poly(ethylene) glycol, polyisocyanopeptide polymer, polylactic-co-glycolic acid, poly(ε-caprolactone) (PCL), polylactic acid, poly(3-hydroxybutyrate-co-3-hydroxyvalerate) (PHBV), chitosan, cellulose, and the like.

[0144] The binding domains can be directly attached to the substrate surface. For example, the molecules can be directly attached to the substrate by one or more covalent or non-covalent bonds. In embodiments where the substrate is a 3D matrix or other 3D structure, the binding domains can be attached to multiple surfaces of the substrate.

[0145] In some embodiments, the binding domain can be indirectly bound to the surface of the substrate. For example, the binding domain can be indirectly bound to the substrate surface via a capture molecule, and the capture molecule is directly bound to the substrate. The capture molecule can be a nucleic acid, protein, sugar, chemical linker, etc. that can bind or link to both the substrate and the binding domain and / or the target nucleic acid. In some embodiments, the capture molecule binds to the binding domain. In some embodiments, the capture molecule binds to the binding domain or an adapter (e.g., a linker of the adapter) of the binding domain. In some embodiments, the capture molecule binds to the target nucleic acid. For example, in some embodiments, the capture molecule can bind to the polyA tail or a specific nucleic acid sequence of the target nucleic acid.

[0146] In some embodiments, target nucleic acids can be directly attached to the surface of a substrate via reactive chemical groups. For example, nucleic acid targets can be modified with azide groups and subjected to Cu-catalyzed click chemistry with alkyne-decorated beads. Other examples include trans-cyclooctene (TCO) / methyl-tetrazine and DBCO / azide.

[0147] In some embodiments, the first binding domain is separated from the second binding domain on the substrate surface so that each binding domain can only interact with one target nucleic acid. In some embodiments, the first binding domain is separated from the second binding domain by at least 50 nm. For example, the first and second binding domains may be separated by about 50 nm to about 500 nm, e.g., about 50 nm to about 100 nm, about 100 nm to about 150 nm, about 150 nm to about 200 nm, about 200 nm to about 250 nm, about 250 nm to about 300 nm, about 300 nm to about 350 nm, about 350 nm to about 400 nm, about 400 nm to about 450 nm, or about 450 nm to about 500 nm. In some embodiments, the first and second binding domains may be separated by about 500 nm or more.

[0148] In some embodiments, the multiple copies of the adapter are about 1 adapter / 5 nm. 2 Approximately 1 adapter / 50nm 2 , e.g. 1 adapter / 20nm 2 In some embodiments, multiple copies of the binding domain are bound to the substrate at a density of 1000 nm 2 Approximately 1 binding domain per 15,000 nm 2 Approximately 1 binding domain per, e.g., 8000 nm 2 The antibodies are bound to the substrate at a density of one binding domain per antibody.

[0149] Generally, the purpose of binding a binding domain (or target nucleic acid) to a substrate is to ensure the transfer of adapters and / or barcodes within the complex. Substrates containing two or more spatially separated binding domains can be produced using methods known to those skilled in the art. The disclosures of the following documents are incorporated herein by reference in their entirety for all purposes: US20210237022A1, US20220010367A1, US20220364163A1, US20220298560, US11,519,033, US20210010070.

[0150] Attachment of the binding domain to the substrate In some embodiments, the binding domain is directly or indirectly bound to the substrate. In some embodiments, multiple binding domains are immobilized on the substrate using site-specific chemistry. For example, in some aspects, the binding domain comprises a site that can be immobilized on the substrate. Binding of the binding domain to the substrate surface is facilitated by fusing an autocatalytic protein tag (e.g., SpyCatcher, Sortase A, SNAP tag, Halo tag, CLIP tag) to the end of the binding domain. These protein tags on the binding domain can covalently react with cognate reactive sites on the substrate surface. For example, SpyCatcher protein can be artificially incorporated into the binding domain. Spy tag forms a covalent bond with Spy tag protein (13 aa peptide). When Spy tag is bound to the substrate surface, the reaction of the binding domain bound to SpyCatcher and Spy tag serves to covalently bind the binding domain to the substrate. Similarly, the binding domain can be fused to a Sortase A tag and reacted with pentaglycine bound to the substrate surface. As another example, the binding domain can be fused to a SNAP tag and react with O6-benzylguanine bound to a substrate surface. In some aspects, the binding domain can be fused to a CLIP tag and used to react with O2-benzylcytosine bound to a substrate surface. In some embodiments, the binding domain can be fused to a Halo tag, which can be used to react with alkyl halides present on the substrate surface.

[0151] In some embodiments, the binding domain may include a biotin moiety, and such binding molecules can be immobilized to a substrate surface by a capture molecule that binds to biotin (e.g., avidin, streptavidin, or neutravidin).

[0152] Figure 5A shows a binding domain attached to a substrate or surface via a tether. In some embodiments, multiple binding domains can be immobilized on a substrate using site-specific chemistry, either directly or indirectly. For example, in some embodiments, a binding domain of a binding domain may include a site that can be immobilized on a substrate and a site for tethering a DNA adapter. Conjugation of the binding domain to a substrate surface is facilitated by fusing an autocatalytic protein tag (e.g., Spycatcher, Sortase A, SNAP tag, Halo tag, and CLIP tag) to the end of the binding domain. SNAP tags are used to identify human O2. 6 SNAP tags are self-labeling proteins derived from α-alkylguanine-DNA-alkyltransferase. ... 6 The CLIP tag is a modified version of the SNAP tag, which also reacts covalently with α-benzylguanine derivatives. 6The CLIP tag is a self-labeling protein derived from -alkylguanine-DNA-alkyltransferase. Instead of benzylguanine derivatives, the CLIP tag is designed to react with benzylcytosine derivatives. These protein tags on the binding domain can be covalently reacted with cognate reactive sites on the substrate surface. For example, the Spycatcher protein can be artificially incorporated into the binding domain. The Spytag forms a covalent bond with the Spytag protein (a 13-aa peptide). When the Spytag is bound to the substrate surface, the reaction of the binding domain bound to the Spycatcher and the Spytag serves to covalently bind the binding domain to the substrate. Similarly, the binding domain can be fused with a sortase A tag and reacted with pentaglycine bound to the substrate surface. As another example, the binding domain can be fused with a SNAP tag and reacted with O6-benzylguanine bound to the substrate surface. In some embodiments, the binding domain can be fused with a CLIP tag and used to react with O2-benzylcytosine bound to the substrate surface. In some embodiments, the binding domain can be fused with a Halo tag, which can be used to react with alkyl halides present on the substrate surface.

[0153] In some embodiments, the binding molecule may include a biotin moiety, and such binding molecules can be immobilized to a substrate surface by a capture molecule (e.g., avidin, streptavidin, or neutravidin) that binds to biotin.

[0154] Binding of target nucleic acid or adapter to substrate In some embodiments, the compositions described herein comprise one substrate. In some embodiments, the compositions described herein comprise two or more substrates. In some embodiments, the compositions comprise multiple substrates, each substrate being formed from the same material. In some embodiments, the compositions comprise multiple substrates, each substrate being formed from a different material. In some embodiments, the substrate is a bead, chip, plate, tube, slide, dish, gel, or three-dimensional polymer matrix. The substrate can be formed from a variety of materials. In some embodiments, the substrate is a resin, membrane, fiber, or polymer. In some embodiments, the substrate comprises sepharose, agarose, cellulose, polystyrene, polymethacrylate, and / or polyacrylamide. In some embodiments, the substrate comprises a polymer, such as a synthetic polymer. A non-limiting list of synthetic polymers includes poly(ethylene) glycol, polyisocyanopeptide polymer, polylactic-co-glycolic acid, poly(ε-caprolactone) (PCL), polylactic acid, poly(3-hydroxybutyrate-co-3-hydroxyvalerate) (PHBV), chitosan, cellulose, and the like.

[0155] In some embodiments, the substrate can be decorated with oligonucleotide capture molecules that hybridize to features of the target nucleic acid. For example, poly(dA) tails added to nucleosomal DNA using terminal nucleotidyl transferase can be captured by hybridization to poly(dT) oligonucleotides or capture molecules containing gene-specific sequences. In some embodiments, the capture molecules are present at low substrate density to physically separate the binding domains. In some embodiments, barcode transfer from nucleosomes or protein-binding conjugates to the target nucleic acid can occur in a substrate-bound state (i.e., when the target nucleic acid is bound to the substrate).

[0156] Beads for target nucleic acid capture by hybridization can be prepared by directly attaching 5'-amino-modified oligonucleotides to substrate-activated beads. Substrate-activated beads may present epoxy, tosyl, carboxylic acid, or amine groups for covalent conjugation. Carboxylate beads typically require derivatization or derivatization with carbodiimides to facilitate peptide bond formation, while amine beads typically require bifunctional NHS-linkers. In some embodiments, the surface of the beads is passivated to prevent nonspecific binding. Passivation can be achieved in some embodiments by co-grafting polyethylene glycol (PEG) molecules with the same linking chemistry. For example, 5'-amino-modified oligonucleotides and amino-terminated polyethylene glycol (PEG) are used so that, on average, most substrate sites are occupied by PEG molecules, which serve to spatially separate the oligonucleotides. Varying the ratio of oligonucleotides to PEG molecules allows for tuning of the surface density of capture molecules.

[0157] In some embodiments, the beads are Sepharose beads made with mTet (tetrazine) and carboxy-PEG. Decreasing the ratio of mTet to carboxy-PEG reduces cross-linking between target nucleic acids. In some embodiments, the mTet:carboxy-PEG ratio is 1:500, 1:600, 1:700, 1:800, 1:900, 1:1000, 1:1100, 1:1200, 1:1300, 1:1400, 1:500, 1:1000, 1:2000, 1:3000, 1:4000, 1:5000, 1:6000, 1:7000, 1:8000, 1:9000, or 1:10000. In some embodiments, the mTet:carboxy-PEG ratio is 1:1000.

[0158] In some embodiments, the substrate comprises a plurality of the same or different binding domains, hi some embodiments, the substrate comprises a plurality of the same or different adaptors.

[0159] Nucleosome-binding conjugates Also provided herein are nucleosome-binding conjugates comprising a binding domain linked to an adaptor. In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 adaptors are conjugated to the binding domain. In some embodiments, the binding domain and adaptor comprise any of the binding domains or adaptors described in any of the preceding paragraphs.

[0160] Nucleic acid analysis method The nucleosome-binding conjugates described herein, capable of intracomplex barcode transfer as described above, can be used in various methods for analyzing nucleic acids, particularly for recognizing histone modifications or DNA-binding proteins. Accordingly, the present invention provides methods for analyzing histone modifications, including methods for profiling multiple histone and nucleosome modifications and DNA-binding proteins. In these methods, the histone modification or DNA-binding protein can be recognized by the binding domain. An adapter or a portion thereof (e.g., a barcode) is then transferred from the binding domain to the target nucleic acid (i.e., a labeled / barcoded target nucleic acid is generated). Because the barcode is unique to the histone modification, this step serves to write information from the recognition event into the nucleic acid sequence of the target nucleic acid. The barcoded target nucleic acid is converted into a sequencing library and read by nucleic acid sequencing. This step reveals the sequence of the barcode and correlates it with the histone modification or DNA-binding protein. Sequencing can also confirm the localization of the binding site of the histone modification or DNA-binding protein. The high-throughput profiling method described herein allows for the identification in parallel of the nature and location of multiple or all DNA / RNA modifications.

[0161] The methods described herein and illustrated in the drawings include a series of steps as set forth below. As will be appreciated by those skilled in the art, in some embodiments, various steps may be omitted and / or performed in a different order.

[0162] Contact between the binding domain and the target nucleic acid In some embodiments, the methods described herein include contacting one or more binding domains with a target, e.g., one or more target nucleic acids or one or more histone modifications and a DNA-binding protein. The target nucleic acid includes DNA, RNA, or a combination of DNA and RNA. The target nucleic acid can be, for example, chromatin or nucleosomal nucleic acid isolated from cells or tissues of an organism. In some embodiments, the binding domain contacts a DNA-binding protein as described herein.

[0163] The contact between the binding domain and the target can occur in solution. For example, a composition comprising one or more target nucleic acids or DNA binding proteins can be contacted with a composition comprising one or more binding domains. In some embodiments, the contact occurs in a dilute solution, and only one binding domain can interact with each target.

[0164] In some embodiments, the contacting occurs on a substrate / surface. For example, one or more targets can be bound to the substrate / surface and one or more binding domains can be contacted with the target nucleic acids bound to the substrate / surface. In some embodiments, one or more binding domains can be bound to the substrate / surface and one or more targets can be contacted with the binding domains bound to the substrate.

[0165] A target nucleic acid or DNA-binding protein may be contacted with only one binding domain protein (i.e., to detect one histone modification or DNA-binding protein), or in some embodiments, a target nucleic acid may be contacted with two or more binding domains to detect multiple histone modifications. For example, a target nucleic acid may be contacted with at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more different types of binding domains.

[0166] In some embodiments, the target is contacted with a first pool of binding domains, followed by a second pool of binding domains. In some embodiments, the pools may contain different types of binding domains (i.e., recognizing different types of modifications or proteins). In some embodiments, the pools may each contain 1-5, 5-10, 10-25, 25-50, 50-100, 100-150, 150-175, 175-200, 250, 300, 350, 400, or more different types of binding domains.

[0167] Barcode Transfer Each binding domain specifically binds to a target, bringing the adapter into proximity with either the 3' or 5' end of the target nucleic acid. The adapter (e.g., a barcode-containing or barcode-containing adapter) can then be transferred to the target nucleic acid. In some embodiments, the transfer is performed in an environment that substantially prevents off-target generation of barcoded nucleic acids. Such an environment can be, for example, an environment in which the target nucleic acids cannot interact with each other (i.e., only one binding domain can interact with each target nucleic acid). This can be achieved, for example, by performing the barcode transfer reaction in a dilute solution or by immobilizing either the target nucleic acid or the binding domain on a substrate to achieve spatial separation. In some embodiments, the transfer is performed by copying the target nucleic acid to generate a labeled / barcoded copy of the target nucleic acid. For example, if a barcode has been transferred to the target nucleic acid, a barcoded copy of the target nucleic acid can be generated using polymerase chain reaction (PCR).

[0168] The barcode transfer reaction and spatial separation are as described above and in Figures 7A-7B.

[0169] Amplification and sequencing After the target nucleic acid has been barcoded, it can be amplified and sequenced. This step reveals the sequence of the barcode, correlating the binding domain in the target nucleic acid with the histone modification to which it was originally bound. Sequencing reveals the sequence and length of the DNA fragment, allowing the localization of the histone modification. Sequencing can also reveal mutations near the histone modification, which can inform the location of the histone modification.

[0170] Therefore, in some embodiments, the methods described herein may include sequencing the barcoded target nucleic acid or a copy thereof. The sequencing step can be performed using any suitable method known in the art. For example, sequencing can be performed using next-generation sequencing (NGS), massively parallel sequencing, or deep sequencing. There are many NGS platforms that can be used in the methods of the present invention. For example, Illumina (登録商標) (Solexa (登録商標) ) sequencing works by sequencing-by-synthesis, where blocked fluorescent nucleotides are incorporated, imaged, and then unblocked prior to insertion of the next fluorescent nucleotide. Roche (登録商標) 454 sequencing is based on pyrosequencing, a technique that uses fluorescence to detect the release of pyrophosphate after a nucleotide is incorporated into a new strand of DNA by a polymerase. Ion Torrent (登録商標) (Proton / PGM Sequencing) measures the direct release of a proton (H+) from the incorporation of individual nucleotides by DNA polymerase. Oxford (登録商標) Nanopore sequencing measures the change in electrical current as nucleic acids pass through a pore, base by base. Pacific Biosciences (登録商標) Single molecule real-time (SMRT) sequencing measures the dwell time of a fluorescently labeled nucleotide as it is incorporated into DNA by a DNA polymerase molecule immobilized at the bottom of a zero-mode waveguide.

[0171] In some embodiments, sequencing is not required to detect a target nucleic acid. For example, PCR can be used to detect the presence of a target nucleic acid (e.g., a barcode). In some embodiments, the target nucleic acid is detected using a fluorescent probe (e.g., a fluorescently labeled hybridization probe). In some embodiments, the target nucleic acid is detected using a microarray or other nucleic acid array. Methods for analyzing sequencing results or data obtained from any of the methods for detecting a target nucleic acid described herein are known to those skilled in the art. For example, standard bioinformatics techniques can be used to analyze sequencing results.

[0172] In some embodiments, sequencing is not required to detect the addition of barcodes via binding domain-mediated reactions. For example, the presence of histone modifications can be confirmed by detecting the associated barcodes using nucleic acid electrophoresis, fluorescent hybridization probes, PCR, or other nucleic acid amplification methods that can be triggered by the barcodes.

[0173] Exemplary Methods for Identifying and / or Localizing Histone Modifications In some embodiments, assay beads display a modification-specific antibody and a forward adapter containing a 3' end, a blocked 3' end, and a 5' phosphate (Figure 5A). In some embodiments, nucleosomal target DNA can be end-repaired prior to immunoprecipitation. In some embodiments, histone modifications are identified by ligating a forward adapter to the target DNA during or after immunoprecipitation. In an exemplary embodiment, in Figure 5A, only the immobilized strand of the adapter is ligated due to the presence of a 3' blocking group on the other forward adapter strand or the lack of 5'-phosphorylation on the target DNA. The barcoded DNA is then primed and copied by DNA polymerase. The final step shown in Figure 5A is the ligation of a reverse adapter. In some embodiments, multiple histone targets can be detected in the same reaction using multiple combined bead types, each displaying a unique barcoded adapter and modification-specific antibody (see, e.g., Figures 3A-3B). Alternatively, two forward adapters can be attached to the substrate, as shown in Figure 5A. The forward adapter may contain a UFP, UMI, and MBC and can be ligated to target DNA in nucleosomes containing histone modifications. After ligation, a denaturation step is performed to remove the chromatin core, followed by reverse strand synthesis of the ligated target DNA to form forward and reverse strands. Reverse adapters are then ligated to the forward and reverse strands of the target DNA. The barcoded target DNA is amplified and analyzed by sequencing.

[0174] In some embodiments, assay beads display a surface adapter containing a modification-specific antibody and a UdG / endonuclease-recognized MBC and uracil. As shown in Figure 5B, the nucleosomal target DNA is end-repaired and 5'-phosphorylated prior to immunoprecipitation. The first histone modification is identified by ligating a forward adapter to the target DNA during or after immunoprecipitation, thereby adding the first MBC. The barcoded nucleosome is then released by cleaving the adapter at the uracil position using an enzyme mix containing, for example, but not limited to, UdG and an endonuclease VIII. The second histone modification is detected by repeating the above steps, this time using a different set of binding domains and introducing a second MBC. The final step is ligation of a Y-shaped sequencing adapter. The reaction scheme shown in Figure 5B allows for the use of multiple bead types with associated barcodes in each encoding cycle. In some embodiments, the release step involves adding a buffer selected from an antigen elution buffer, a histone or antibody replacement mixture, an acidic buffer at pH 6.5 or less, or an alkaline buffer at pH 8.5 or more. The elution buffer may contain a high salt solution to effectively dissociate affinity interactions while preserving the activity of both the antibody and the antigen. The histone replacement mixture may contain an excess of histones or peptides with specific modifications. The antibody replacement mixture may contain an excess of synthetic modified histone peptides as competitors to dissociate the binding domains from nucleosomes. The buffer may include a reducing agent (DTT and / or TCEP) to cleave antibody disulfide bonds, an enzyme (papain and / or pepsin) that specifically digests antibodies, a detergent (SDS, sodium deoxycholate), an acidic buffer at pH 6.5 or less (typically glycine-HCl, pH 2.5-3.0), or an alkaline buffer at pH 8.5 or more.

[0175] Figures 6 and 9 show the colocalization of histone modifications by sequential encoding using solution barcodes. In some embodiments, repeated cycles of IP and barcoding allow for the identification of multiple histone modifications on the same nucleosome. In some embodiments, the MBC is not tethered to a surface or substrate. In some instances, as depicted in Figure 9, the MBC is connected to a cleavable loop region containing a unique molecular identifier (UMI). This configuration allows for the binding of an MBC adjacent to a UMI during each barcoding cycle. Because a single bead species is present in each IP cycle, tethering the MBC to a substrate is not necessary. In some embodiments, the UMI is bound to the MBC. In each cycle, nucleosomes are immunoprecipitated, washed, and barcoded by ligating the MBC in solution. For the next encoding cycle, the nucleosomes are released from the substrate, combined with the supernatant from the previous IP cycle, and subjected to the next encoding cycle. Sequencing adapters are ligated to both ends of the nucleosomes in the final step, generating a sequencing library. In some embodiments, the sequencing adapter is Y-shaped or bell-shaped. In some embodiments, the sequencing adapter comprises a UMI. This method generates MBC tails at the ends of nucleosomes that display histone modifications.

[0176] In some embodiments, detection of multiple histone modifications can involve barcoding both nucleic acid ends of nucleosomes. As shown in Figure 7A, nucleosomes are end-repaired and adenylated, then incubated with multiple nucleosome-binding conjugates, each containing a binding domain and a modified barcode (MBC). The encoding reaction is initiated by the presence of a ligase enzyme, which transfers one or two MBCs to the target DNA. If only one adapter is transferred during the encoding step, an additional capping step with free adapters is used to obtain an amplifiable library.

[0177] In some embodiments, multiple histone modifications are detected by sequential barcoding reactions of substrate-bound nucleosomes. As shown in Figure 7B, in the first step, nucleosomes are anchored to the substrate at a single molecular distance to prevent interaction between adjacent nucleosomes. To identify the first histone modification, a barcode-labeled antibody is introduced. After washing, a ligation reagent is added, allowing the antibody barcode to bind to the free end of the nucleosome. Cleavage of the barcode with a restriction enzyme releases the antibody, generating aggregated barcode ends for the next round of encoding. This step can be repeated any number of times, adding one barcode-antibody conjugate each time. The final capping step introduces a reverse sequencing adapter and is antibody-independent. The resulting nucleosome contains a string of barcodes, each representing one of the modifications.

[0178] In some embodiments, the colocalization of histone modifications can be determined by proximity ligation. In some embodiments, closely spaced barcodes are annealed to a bridge splint oligo, followed by ligation of closely spaced barcodes. In some embodiments, nucleosomes can be A-tailed to hybridize with the poly-T ends of the barcodes. As shown in Figure 8, A-tailed nucleosomes are incubated with a mixture of barcode-antibody conjugates. When the antibody binds to its target, adjacent barcodes are bridged and ligated by the splint oligo. The A-tails of the nucleosomes prime the ligated barcodes, and copies are generated by adding DNA polymerase. This process appends a string of barcodes to the nucleosomes, each identifying a modification.

[0179] In some embodiments, histone modifications in tissues can be analyzed by immobilizing nucleosome-binding conjugates containing spatial identifiers on a microarray slide and overlaying the microarray with the tissue. The tissue can be fresh-frozen tissue sections or formalin-fixed, paraffin-embedded (FFPE) tissue. Cells are permeabilized with detergents (e.g., digitonin, TritonX, or NP40), followed by enzymatic shearing of chromatin and release of nucleosomes (e.g., using micrococcal nuclease (MNase) or DNAse). Nucleosomes diffuse out of the cells and are captured by the immobilized binding domains. The final step is transfer of the spatial identifier to nucleosomes by ligation (Figures 15A-15B), resulting in nucleosomes labeled with the modified barcode and spatial identifier.

[0180] The methods described herein can be used to diagnose a disease, disorder, or condition. For example, in some embodiments, the methods can be used to diagnose cancer in a subject in need thereof. In some embodiments, the kits can be used to monitor a disease, disorder, or condition over time, such as response to one or more treatments. For example, the kits can be used to monitor epigenetic changes over time in a subject undergoing cancer treatment (i.e., chemotherapy, radiation therapy, etc.). In some embodiments, the methods can be used to analyze cells or tissues from a subject in need thereof. For example, the methods can be used to detect histone modifications in cells or tissues isolated from blood samples, biopsy samples, autopsy samples, etc.

[0181] In some embodiments, the nucleosomes can be obtained as cell-free circulating nucleosomes, for example, cell-free circulating nucleosomes can be obtained from the patient's blood or from the extracellular tumor environment or microenvironment.

[0182] In some embodiments, the nucleosomes can be obtained from a single cell. In some embodiments, the nucleosomes can be obtained from a single isolated cell. In some embodiments, the nucleosomes can be obtained from multiple clonal cells derived from a single cell.

[0183] In some embodiments, the present disclosure provides a method for diagnosing a cancer or cancer subtype associated with one or more types of histone modification, comprising analyzing a plurality of nucleosomes according to any of the numbered aspects. In some embodiments, the present disclosure provides a method for monitoring cancer progression or treatment response, comprising analyzing a plurality of nucleosomes according to any of the numbered aspects. In some embodiments, the plurality of nucleosomes is analyzed from a patient blood sample. In some embodiments, the plurality of nucleosomes is analyzed from a patient tissue biopsy sample. In some embodiments, the present disclosure provides a kit for monitoring epigenetic changes over time in a subject undergoing cancer treatment, comprising any of the compositions or nucleosome-binding conjugates disclosed herein.

[0184] Because histone modifications on cell-free nucleosomes are informative of DNA-related activity within the cell of origin, this disclosure includes methods for using histone modifications on cell-free nucleosomes as biomarkers in plasma liquid biopsies. This disclosure also includes the use of multiplexed detection of histone modifications in low sample input scenarios, such as the analysis of cell-free nucleosomes in plasma containing only 20-60 ng of nucleosomes per mL.

[0185] In some embodiments, the methods may be used to detect and / or monitor epigenetic changes in cells used commercially for the production of one or more products, such as cells used in industrial fermentation. In some embodiments, the methods may be used to detect and / or monitor epigenetic changes in plant cells or tissues.

[0186] Compositions Comprising Binding Domains The present invention also provides compositions comprising one or more binding domains described herein. In some embodiments, the compositions comprise one or more types of binding domains. For example, the compositions may comprise a first binding domain that binds to a first histone modification or a first DNA-binding domain, and a second binding domain that binds to a second histone modification or a second DNA-binding protein. In some embodiments, the compositions may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 or more different types of binding domains.

[0187] Also provided herein are compositions comprising one or more complexes, each complex comprising a binding domain bound to a target nucleic acid.

[0188] In some embodiments, the compositions described herein include one or more carriers, excipients, buffers, etc. The compositions may have a pH of about 0.5, about 1.0, about 1.5, about 2.0, about 2.5, about 3.0, about 3.5, about 4.0, about 4.5, about 5.0, about 5.5, about 6.0, about 6.5, about 7.0, about 7.5, about 8.0, about 8.5, about 9.0, about 9.5, about 10.0, about 10.5, about 11.0, about 11.5, about 12.0, about 12.5, about 13.0, about 13.5, or about 14.0. In some aspects, the compositions may have a pH of 2-12, 3-11, 4-10, 5-9, 6-8, or 6.5-7.5, or any range within these ranges. In some embodiments, the compositions are pharmaceutical compositions. In some embodiments, the compositions are diagnostic compositions.

[0189] Histone modification analysis kit The binding domains described herein can be provided in kits (e.g., as components of a kit). For example, the kit can include the binding domain, or one or more components thereof, and informational material. The kit can also include any reagents and materials necessary to perform the assays described in this disclosure, including the Examples. These reagents and materials can include adaptors, substrates (beads), and enzymes (ligases, polymerases). The informational material can be, for example, explanatory, instructional, marketing, or other materials regarding the methods and / or use of the binding domains described herein. The format of the informational material in the kit is not limited. In some embodiments, the informational material can include information regarding the production of the binding domain, molecular weight, concentration, expiration date, batch or origin information, etc. In some embodiments, the informational material can include a list of disorders and / or conditions that can be diagnosed or evaluated using the kit.

[0190] In some embodiments, the binding domains may be provided in a manner suitable for use in the methods described herein (e.g., easy-to-use tubes, appropriate concentrations, etc.). In some embodiments, the kits may require some preparation or manipulation of the binding domains prior to use. In some embodiments, the binding domains are provided in liquid, dried, or lyophilized form. In some embodiments, the binding domains are provided in an aqueous solution. In some embodiments, the binding domains are provided in a sterile, nucleic acid-free solution. In some embodiments, the binding domains are provided in a composition that is substantially free of nucleic acids other than those that may comprise the molecule itself.

[0191] In some embodiments, the kit may include one or more syringes, tubes, ampoules, foil packages, or blister packs. The containers of the kit may be airtight, waterproof (i.e., to prevent changes in moisture or evaporation), and / or light-tight.

[0192] In some embodiments, the kit can be used to perform one or more of the methods described herein, such as methods for analyzing a population of target nucleic acids. In some embodiments, the kit can be used to diagnose a disease, disorder, or condition. For example, in some embodiments, the kit can be used to diagnose cancer. In some embodiments, the kit can be used to monitor a disease, disorder, or condition over time, such as response to one or more treatments. For example, the kit can be used to monitor epigenetic changes over time in a subject undergoing treatment for cancer. [Example]

[0193] The following non-limiting examples further illustrate aspects of the compositions and methods of the present invention.

[0194] Example 1: Preparation of bead substrate for modification-specific barcoding of nucleosomes Magnetic beads are a convenient substrate for library preparation workflows because they facilitate buffer exchange and purification steps. This example describes the co-loading of magnetic beads with antibodies (Abs) and adapters containing modified barcodes (MBCs). Each bead type was loaded with one type of antibody and one type of adapter at an optimal ratio. Multiple bead types can be combined into bead pools to detect any number of histone modifications (Figure 3A). The beads described are for analyzing histone modifications in multiple nucleosomes using the workflow depicted in Figure 5A. The bead loading protocol can be easily adapted using different adapter sequences in the workflows shown in Figures 4 and 5B. Two types of beads were prepared: one targeting the H3K4me3 modification and the other targeting the H3K4me2 modification.

[0195] Two bead loading mixes were prepared, each containing a 3' biotinylated adapter, biotinylated protein G, and an antibody against the target histone modification in a molar ratio of 3:6:4, mixed with biotinylated small molecule PEG in HBST300 buffer (10 mM HEPES pH 7.6, 300 mM NaCl, 0.1 mM EDTA, 0.05% Tween 20). The loading mix for the first bead type contained Protein G, Ab42 (Histone H3K4me3 antibody, EpiCypher, cat#13-0041), and The loading mix for the second bead type contained Protein G, Ab70 (Histone H3K4me2 antibody, Thermo Fisher Scientific, cat#MA5-33383), and JPEG2025539357000015.jpg10148. For the input control, the loading mix contained Protein G, Ab67 (histone H3 antibody, Thermo Fisher Cat# 39064), and rcMBC103. rcMBC contained 7 bases of MBC (italic), 5 bases of UMI (N), a 22-base Illumina P5 adapter, 1 uracil for cleavage, and 5 T for added flexibility. The bead loading mix was incubated at room temperature for 5 minutes to allow Protein G to bind to the Fc region of the antibody. Meanwhile, streptavidin-coated magnetic beads were washed and combined with the bead loading mix. Binding of the biotinylated components was completed after a 30-minute incubation with gentle agitation.

[0196] Antibody loading yield was determined by eluting the antibody from Protein G at pH 2 and examining the eluate by SDS gel electrophoresis. Immobilized Protein G and adapter were quantified by separating components on a TBE gel after elution in 95% formamide at 95°C for 5 minutes. Washed beads were stored individually at 4°C and combined for multiplex barcoding assays.

[0197] Example 2: Digestion of chromatin into mononucleosomes To make genomic DNA more compact and dense, eukaryotic cells organize it into "chromatin." Chromatin contains DNA and histone proteins and is organized as an octamer containing two copies of histones H2A, H2B, H3, and H4. Each histone octamer is wrapped around a 140-bp-long DNA molecule. A unit of DNA and histone octamer is called a nucleosome. Nucleosomes are organized into a 30-nm highly ordered structure called a chromatin fiber. The modification profiling method described herein uses single nucleosomes ("mononucleosomes") as input. This example provides a protocol for extracting chromatin from yeast cells and then digesting the chromatin into mononucleosomes and / or DNA-protein complexes.

[0198] Yeast cells at an A of 0.8 600 The cells are cultured until OD . At this stage, DNA-binding proteins such as transcription factors and histone octamers are chemically cross-linked to DNA by formaldehyde treatment. To this end, cells are incubated in 1% formaldehyde at room temperature for 1–25 minutes, depending on the desired degree of cross-linking. After quenching the reaction with 2.5 M glycine, the cells are ready to be harvested by centrifugation.

[0199] Cells were resuspended in lysis buffer (1 M sorbitol, 50 mM Tris-HCl pH 7.4, 10 mM beta-mercaptoethanol, 10 mg / mL dimolyase) and incubated at room temperature until the cell wall was mostly digested. Spheroblasts were isolated and resuspended in digestion buffer (0.5 M spermidine, 1 mM beta-mercaptoethanol, 0.075% NP-40, 50 mM NaCl, 10 mM Tris-HCl pH 7.4, 5 mM MgCl2, 1 mM CaCl2). Micrococcus nuclease was then added to a final concentration of 0.07 units / µL. The reaction was incubated at 37°C for 25 minutes, during which time the chromatin was digested into mononucleosomes. Excess EDTA was added to stop the reaction, and the nucleosomes were further purified using an anion exchange midi column (Epoch Life Sciences). Nucleosomes are loaded in buffer A (25 mM MES pH 6, 10% sucrose, 10% glycerol, 400 mM NaCl) with a moderate salt concentration. After washing three times with buffer A, nucleosomes are eluted with buffer B (25 mM MES pH 6, 10% sucrose, 10% glycerol, 750 mM NaCl, 1 mM EDTA). Nucleosomes can be diluted with buffer C (10 mM Tris-HCl pH 7.5, 1 mM EDTA, 25 mM NaCl, 2 mM DTT, 20% glycerol) and stored at -80 °C. The aforementioned protocol typically produces >80% mononucleosomes.

[0200] Example 3: Nucleosomal DNA end repair method Mechanical and enzymatic shearing of chromatin generates nucleosomes with heterogeneous DNA ends. For example, 3' ends are degraded, and a mixture of 3' and 5' phosphorylated ends may be present. The barcoding methods described below employ different ligation methods, requiring 5' phosphorylation and 3' dephosphorylation, blunt ends ("blunt-end ligation"), or single 3' dA overhangs ("sticky-end ligation"). This example demonstrates how nucleosomal DNA can be repaired to make it compatible with these barcoding chemistries.

[0201] Blunt-end ligation. Nucleosomal DNA was dephosphorylated by incubation in Buffer 1 (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 100 μg / ml recombinant albumin, pH 7.9 at 25°C) with 1 unit of recombinant shrimp alkaline phosphatase (rSAP) for 30 minutes at 37°C. The reaction was stopped by adding excess EDTA and used as input for immunoprecipitation (IP) using a pool of two bead types prepared according to Example 1. Blunting of nucleosomal DNA was performed using T4 DNA polymerase. This enzyme exhibits strong 3'-5' exonuclease activity and prevents the formation of 3' overhangs in gap-fill reactions. After immunoprecipitation, the beads were resuspended in blunting buffer (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 μg / ml recombinant albumin, pH 7.9 at 25°C). 0.5 units of T4 DNA polymerase was added to the DNA in the presence of 0.1 mM dNTPs and incubated at room temperature for 15 minutes. The reaction was stopped by the addition of EDTA.

[0202] Sticky-end ligation. Nucleosomal DNA was dephosphorylated as described above and used as input for immunoprecipitation. After immunoprecipitation, blunt-ends were prepared as described above, followed by washing of beads with HBST300 buffer. The beads were incubated with 5 units of Klenow fragment 3' to 5' exo in adenylation buffer (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT, pH 7.9 at 25°C), and 0.1 mM dATP was added to introduce a single-base 3' dA overhang. The reaction was stopped by adding EDTA.

[0203] Example 4: Detection of histone modifications H3K4me3 and H3K4me2 by bead-based barcoding This example describes a protocol for simultaneously identifying one or more histone modifications using the library preparation workflow depicted in Figure 5A. The protocol steps include immunoprecipitation and end-repair of nucleosomes, followed by barcoding by ligation to identify the modification state, removal of the histone core to improve DNA accessibility, reverse strand synthesis, ligation of a second adapter, and PCR amplification.

[0204] One microgram of HeLa mononucleosomes (EpiCypher Cat#16-0002) was combined with 0.25 μL of SNAP-ChIP® K-MetStat Panel (EpiCypher Cat#19-1001) and 0.5 μL of SNAP-ChIP® K-AcylStat Panel (EpiCypher Cat#19-3001). SNAP-ChIP® panels are commercially available pools of synthetic mononucleosomes with known modification states. For example, the SNAP-ChIP® K-MetStat Panel contains distinctly modified mononucleosomes assembled from recombinant human histones expressed in E. coli wrapped around 147 base pairs of barcoded Widom601 positioning sequence DNA. This panel contains a pool of 12 histone H3 post-translational modifications, including one unmodified nucleosome and H3K4me1, H3K4me2, H3K4me3, H3K9me1, H3K9me2, H3K9me3, H3K27me1, H3K27me2, H3K27me3, H3K36me1, H3K36me2, and H3K36me3. Each distinctly modified nucleosome is distinguishable by a unique DNA sequence ("barcode") at its 3' end, which can be decoded by next-generation sequencing. Each of the 16 nucleosomes in the pool is wrapped with two types of DNA containing different barcodes ("A" and "B"), allowing for internal technical replication. The SNAP-ChIP® K-AcylStat Panel is manufactured from the same building blocks, including one unmodified and a pool of 15 H3 histone modifications: H3K4ac, H3K9ac, H3K14ac, H3K18ac, H3K23ac, H3K27ac, H3K36ac, H3K9bu, H3K9cr, H3K18bu, H3K18cr, H3K27bu, H3K27cr, H3K27acS28phos, and H3K4, 9, 14, and 18ac. This 2-plex experiment is expected to generate positive signals for H3K4me3 and H3K4me2, and negative signals for unmodified or differentially modified nucleosomes.

[0205] Nucleosomes were dephosphorylated according to Example 3 and diluted in HBST300 buffer. 10% of the dephosphorylated nucleosomes were transferred to a new tube and processed in parallel as an input control. For the IP sample, nucleosomes were immunoprecipitated using a pool of H3K4me3 and H3K4me2 bead types prepared according to Example 1. Nucleosomes for the input control were immunoprecipitated using a single bead type prepared with a general histone H3 binding domain and rcMBC adaptor. While the IP reaction enriches for nucleosomes exhibiting the modification targeted by the binding domain, the intent of the input control is to capture all nucleosomes with an H3 histone core, regardless of modification status. This type of input normalization is necessary to control for heterogeneity in genomic representation in the input. To identify histone modification regions, the read coverage obtained in the IP was divided by the reads observed in the input sample.

[0206] Immunoprecipitation was performed at room temperature for 1 hour, and excess nucleosomes were removed by washing with RIPA buffer (50 mM Tris HCl, 300 mM NaCl, 1.0% (v / v) NP-40, 0.5% (w / v) sodium deoxycholate, 1.0 mM EDTA, 0.1% (w / v) SDS) and HBST300 buffer. DNA from the immunoprecipitated nucleosomes was blunt-ended as described in Example 3. Adapter ligation was induced by suspending bead-bound nucleosomes in ligation buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10 mM MgCl2, 1 mM ATP, 10% PEG-8K, 0.05% Tween 20, and 400 U T4 DNA ligase) and adding 0.5 μM each of MBC101 (5-deoxyI / / ideoxyI / / ideoxyI / CGATCAC) and MBC103 (5-deoxyI / / ideoxyI / / ideoxyI / AATGCGG). The purpose of the MBC oligos is to provide a double-stranded ligation junction, but because the 5' end of the nucleosome is not phosphorylated, only the adapter strand bound to the bead was intentionally ligated. This method introduced MBC to only one end of the DNA.

[0207] After barcoding, the beads were incubated in removal buffer (5 mM DTT, 10 mM HEPES pH 7.5, 50 mM NaCl, 0.05% Tween 20) to remove histones and antibodies. A standard primer extension reaction was performed using 8 units of Bst3.0 DNA polymerase in extension buffer (1 mM each dNTP, 20 mM Tris-HCl, 10 mM (NH4)2SO4, 50 mM KCl, 2 mM MgSO4, 0.1% Tween® 20, pH 8.8 at 25°C, and 0.5 μM extension primer (GTCAGATGTGTATAAGAGACAG; SEQ ID NO: 3)) using the following thermocycler program: 72°C for 2 minutes, 55°C for 5 minutes, 65°C for 15 minutes, 72°C for 5 minutes, 80°C for 5 minutes, and a 16°C hold. The second sequencing adapter was introduced by repeating the same ligation step used to introduce the MBC adapter, but in the presence of 100 units of T4 DNA ligase and 10 units of T4 polynucleotide kinase to phosphorylate the 5' ends of the bead strands. The second adapter was universal and contained only the Illumina P7 adapter (AGACGTGTGCTCTTCCGATCT; SEQ ID NO: 4) and its complement (GATCGGAAGAGC; SEQ ID NO: 5). The adapter-ligated DNA was treated with 0.1 N NaOH to remove the complementary DNA strand that was not bound to the beads. The bead-bound DNA was PCR amplified using Illumina index primers and NEBNext Ultra II Q5master mix (NEB) according to the manufacturer's protocol. The indexed library was purified with AMPure beads, examined on a 4% agarose gel, quantified, and sequenced using Qubit (Thermo Fisher Scientific).

[0208] Figure 10 shows a library QC gel. A sharp band of the expected size, approximately 310 bp, was observed in the IP and input libraries with minimal by-products. After sequencing, raw reads were aligned to the human genome (for HeLa samples) and SNAP-CHIP sequence references. Each SNAP-Chip nucleosome was identified based on its Widom601 barcode. Reads with MBCs introduced by the barcoding assay were located, deduplicated based on UMI, and normalized to reads per million (RPM) to account for variations in sequencing depth. Figure 11A shows the MBC distribution of the SNAP-CHIP spike-in control. The KmetStat_H3K4me3 fragment is enriched for MBC101, consistent with the bead design that binds H3K4me3 to the MBC101 adaptor. Similarly, the KmetStat_H3K4me2 fragment is precisely enriched in MBC103. The KmetStat_WT unmodified fragment had almost no reads in either MBC101 or MBC102 compared to the H3K4me3 and H3K4me2 fragments, suggesting very low nonspecific background. Figure 11B shows SNAP-CHIP spike-in control representations for each MBC. In MBC101, the KmetStat_H3K4me3 fragment was most abundant. In MBC103, the KmetStat_H3K4me2 fragment was most abundant. Figures 11C and 11D show the corresponding enrichment analyses. The enrichment value is an indicator of signal-to-noise and is calculated by dividing RPM (IP) by RPM (input). Crosstalk is determined by the ratio of enrichment of off-target MBCs to enrichment of on-target MBCs. The crosstalk between the KmetStat_H3K4me2 and KmetStat_H3K4me3 fragments was 25-28% and 1.3-1.5%, respectively, indicating that H3K4me2 antibodies are less specific than H3K4me3 antibodies. Figures 11E and 11F provide examples of genomic regions with histone modifications for a HeLa sample.Raw reads along genomic coordinates for IP sequencing reads showing MBC101 (top track) or MBC103 (middle track). The input sample (bottom track) shows uniform read coverage along genomic coordinates, while the MBC track shows spikes indicating enrichment of reads in genomic regions with histone modifications.

[0209] In summary, this example demonstrates the identification of two histone modifications (H3K4me2 and H3K4me2) in HeLa and synthetic control nucleosomes using a bead-based barcoding format that employs a pool of different bead types. Each bead type exhibits one binding domain and one barcoded adapter to interrogate one type of histone modification. The binding domain attracts target nucleosomes to the bead surface, where they are barcoded with the barcoded surface adapter.

[0210] Example 5: Preparation of nucleosome-binding molecules Nucleosome-binding molecules were generated by site-specifically labeling antibodies using the SiteClick Antibody Azide Modification Kit (Thermo Fisher, cat. no. S20026). SiteClick labeling uses an enzyme to specifically attach an azide moiety to the heavy chain of an IgG antibody, ensuring that the antigen-binding domain remains unchanged for binding to the antigen target. This site selectivity is achieved by targeting the glycan domain, which is present in essentially all IgG antibodies, regardless of isotype and host species. Beta-galactosidase catalyzes the hydrolysis of β-1,4-linked D-galactopyranosyl residues and the subsequent attachment of azido-galactopyranosyl using β-1,4-galactosyltransferase. Once azide-modified, a DBCO (dibenzocyclooctyl)-labeled ds-MBC adapter was conjugated to the Fc region. In the first barcoding cycle, the ligation junction on the nucleosome side exhibits a single 3' A overhang, which is why the DBCO oligo terminates with a single 3' T. For example, JPEG2025539357000016.jpg12134. The DBCO-labeled oligo in the first cycle contains a PacI restriction site (underlined and italic, the slash indicates the cleavage site), a short 4-base filler sequence, a 7-base MBC (bold italic), and a phosphorothioate ( * ), and a 3'T overhang. In the second and subsequent barcoding cycles, after the first adapter is released by PacI digestion, the ligation junction on the nucleosome side displays a 3'TA overhang, and the DBCO oligo then ligates to a 5'AT JPEG2025539357000017.jpg13134 must end. PacI was chosen as the restriction enzyme because its recognition motif is extremely rare in the human genome. Unbound MBC adapters are removed using a size exclusion column. SiteClick (商標) Labeling resulted in antibodies displaying one or two adapters, as could be estimated by gel electrophoresis.

[0211] Example 6: Colocalization of histone modifications H3K4me3 and H3K9ac on the same nucleosome by sequential barcoding In this example, we employ nucleosome-binding molecules, including antibodies tethered to MBC adaptors, to identify histone modifications. This method can be used to detect a single modification per nucleosome, or multiple modifications depending on the number of barcoding cycles.

[0212] The first step is the preparation of a surface presenting P7 Illumina adapters spaced one molecule apart. In the second step, nucleosomal DNA is ligated to the P7 adapters, generating a substrate with immobilized nucleosomes that are spatially separated and cannot interact with their nearest neighbors. This is done by attaching streptavidin beads to 3'-biotinylated double-stranded Illumina P7 adapters. This is achieved by suspending the antibody in a mixture containing JPEG2025539357000018.jpg10138 and a 100,000 molar excess of biotinylated PEG (Broadpharm, cat# BP-23759) in 1X PBST buffer. The biotinylated PEG acts as a lateral diluent and passivates the surface, reducing nonspecific binding.

[0213] Multiple nucleosomes are prepared for sticky-end ligation and ligated to P7 adapters using T4 DNA ligase (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10 mM MgCl2, 1 mM ATP, 10% PEG-8K, 0.05% Tween 20, 400 U of T4 DNA ligase) according to Example 3 above. After washing with RIPA buffer, the bead substrate is suspended in a solution containing single or multiple nucleosome-binding molecules displaying the adapter structure designed for the first barcoding cycle. The antibody-adapter conjugate is bound, and the first MBC adapter is ligated to the free end of the nucleosome using T4 DNA ligase as described above. To release the antibody, the adapter is cleaved by treatment with PacI restriction enzyme in CutSmart buffer (50 mM potassium acetate, 20 mM Tris acetate, 10 mM magnesium acetate, 100 μg / ml BSA). The second barcoding cycle begins by repeating the binding step with a pool of single or multiple nucleosome-binding molecules bearing the adapter structure designed for the second barcoding cycle. After restriction enzyme digestion, this process can be repeated any number of times, using nucleosome-binding molecules that exhibit MBCs specific to the cycle number and binding domain in each cycle. To complete the library, nucleosomal DNA is ligated to double-stranded caps containing P5 Illumina adapters (CTACACGACGCTCTTCCGATCT*A*T (SEQ ID NO: 12) and 5Phos / AGATCGGAAGAGCGTCGTGTAG (SEQ ID NO: 13)) and subjected to index PCR using NEBNext Ultra II Q5master mix (NEB) as described in Example 4.

[0214] The described barcoding format is compatible with flat or beaded surfaces, as long as the immobilized nucleosomes are spaced apart to preclude interactions with their nearest neighbors. Each barcoding step can employ a single type of nucleosome-binding conjugate or a pool of different conjugates. This assay binds the MBC sequence representing the identified modification to nucleosomal DNA, providing the first assay to colocalize histone modifications with single-molecule resolution.

[0215] Example 7: Cycle encoding of immunoprecipitated nucleosomes on bead substrates. In this example, we use multiple barcoding cycles, each cycle using an adapter in solution in the presence of a single binding domain, to attach MBCs to the DNA ends of immunoprecipitated nucleosomes in a modification-specific manner. This protocol describes the steps of immunoprecipitation, end repair, barcoding, gap filling, elution, and a final capping step to add sequencing adapters, applicable to the workflows shown in Figures 6 and 9. In this example, we use hairpin (HP) adapters, which allow for the introduction of UMIs adjacent to the MBC, as shown in Figure 9. Despite the importance of UMIs for PCR error correction and deduplication of sequencing reads, introducing UMIs by double-stranded ligation is important because their complements must be synthesized in situ.

[0216] Bead substrates were prepared by loading histone H3 or modification-specific antibodies onto magnetic Protein G beads according to the manufacturer's protocol. For IP samples, Ab42 (histone H3K4me3 antibody, Epicypher, cat#13-0041) was loaded onto Protein G beads. For input controls, Ab67 (histone H3 antibody, Thermo Fisher, cat#39064) was loaded onto Protein G beads in a separate loading reaction.

[0217] One microgram of HeLa mononucleosomes (EpiCypher Cat#16-0002) was combined with 0.25 μL of SNAP-ChIP® K-MetStat Panel (EpiCypher Cat#19-1001) and 0.5 μL of SNAP-ChIP® K-AcylStat Panel (EpiCypher Cat#19-3001). The nucleosome mix was diluted with HBST300 buffer and split into two reactions. 90% and 10% of the nucleosome mix were used as input for immunoprecipitation with Ab42-loaded beads and Ab67-loaded beads, respectively. The immunoprecipitation was performed at room temperature with gentle agitation for 1 hour.

[0218] The initial end repair involves the steps of blunting, 5' phosphorylation, and 3' dA tailing. Blunting and 5' phosphorylation of DNA on immunoprecipitated nucleosomes were performed in a single reaction using T4 DNA polymerase and T4 polynucleotide kinase. After immunoprecipitation, the beads were resuspended in 1X NEB r2.1 buffer. 0.5 units of T4 DNA polymerase and 5 units of T4 polynucleotide kinase were added to the beads in the presence of 0.1 mM dNTPs, 1 mM ATP, and 2 mM DTT, and the mixture was incubated at 16°C for 15 minutes and at 23°C for 15 minutes. The reaction was stopped by the addition of EDTA, followed by washing with HBST300. The beads were resuspended in 1X NEB r2.1 buffer. Nucleosomal DNA ends were fitted with single-base 3' A tails by incubation with 2.5 units of Klenow fragment 3' to 5' exo in 1X NEB r2.1 buffer supplemented with 0.1 mM dATP for 15 min at 37°C. The reaction was stopped by the addition of EDTA, followed by washing with HBST300 buffer.

[0219] Barcoding was achieved by ligating HP-MBC adapters to the nucleosomal DNA ends. The HP-MBC adapters contain a double-stranded MBC ligation junction with a single 3'dT overhang. The other end of the double-stranded MBC region is connected by a single-stranded loop segment consisting of a uracil and UMI sequence. To focus the experiment on testing cycle barcoding chemistry, the elution and re-immunoprecipitation steps were omitted in this example. Instead, H3K4me3 was detected in MBC107 in the first cycle and in MBC109 in the second cycle without eluting the nucleosomes.

[0220] Barcoding is HP-MBC107 with 0.5uM The barcoding reaction was induced by suspending the bead-bound nucleosomes in ligation buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10 mM MgCl2, 1 mM ATP, 10% PEG-8K, 0.05% Tween 20, and 400 units of T4 DNA ligase) supplemented with JPEG2025539357000019.jpg7127. The purpose of the HP-MBC adapter was to provide a double-stranded sticky-end ligation junction; however, because the 5' end of the HP-MBC adapter was not phosphorylated, only the 3' dT end was intentionally attached to the nucleosomal DNA end. The barcoding reaction was then incubated at 20°C for 15 min and then at -25°C for 15 min, after which it was stopped by the addition of EDTA and washed with HBST300 buffer.

[0221] After MBC107 ligation, the barcoded nucleosomal DNA ends were cleaved at the uracil site to prepare for subsequent gap-filling. The cleavage reaction was performed by incubating the beads with 0.5 units of USER enzyme in 1X NEB rCutSmart buffer at 37°C for 15 minutes. The reaction was washed with HBST300 buffer to expose single-stranded 5' overhangs consisting of the MBC and UMI.

[0222] The 5' overhangs were gap-filled and 3' dA-tailed by adding 2.5 units of Klenow fragment 3' to 5' exo in 1X NEB r2.1 buffer, 0.2 mM dNTPs, and incubating with 2.5' dA for 15 minutes at 37°C. The reaction was stopped by adding EDTA, followed by washing with HBST300 buffer. This completes the first cycle of barcoding.

[0223] Because the barcoded nucleosomal DNA ends are not tethered to the bead surface, nucleosomes can be eluted from the bead surface and used as input for subsequent immunoprecipitation and barcoding cycles. This allows for sequential barcoding of histone modifications that coexist on the same nucleosome. Nucleosomes can be eluted using various methods, as described in Example 8. As mentioned above, in this example, we skipped nucleosome elution and proceeded to ligate MBC109 after ligating MBC107.

[0224] The beads with nucleosomes barcoded by HP-MBC107 in the previous step were then transferred to HP-MBC109. JPEG2025539357000020.jpg6123, and subjected to a new cycle of barcoding ligation, cleavage with the USER enzyme, gap filling, and 3'dA tailing.

[0225] After the final barcoding cycle, the nucleosomes underwent a capping cycle, and universal sequencing adapters were ligated to the DNA ends for library amplification by PCR. 0.5 μM HP-U adapters The bead-bound nucleosomes were suspended in ligation buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10 mM MgCl2, 1 mM ATP, 10% PEG-8K, 0.05% Tween 20, and 400 units T4 DNA ligase) supplemented with JPEG2025539357000021.jpg5160, and the ligation reaction was initiated. The HP-U adapters provided a bell-shaped conformation with a priming site for library amplification and a double-stranded sticky-end ligation junction. The adapter ligation reaction was incubated at 20°C for 15 minutes and then 25°C for 15 minutes, after which it was stopped by the addition of EDTA and washed with HBST300 buffer. After adapter ligation, the looped ends were separated into Y-shaped ends by cleavage with the USER enzyme. The cleavage reaction was carried out by incubating the beads with 0.5 units of USER enzyme in 1× NEB rCutSmart buffer for 15 minutes at 37° C. The reaction was washed with HBST300 buffer.

[0226] The adapter-ligated nucleosomal DNA was then eluted by incubation with 0.12 units of Thermolabile Proteinase K (New England Biolabs, Cat# P8111S) in a reaction mix consisting of RIPA buffer supplemented with 0.4% SDS and 5 mM DTT. The DNA elution reaction was performed at 37°C for 1 hour, followed by 65°C for 10 minutes. The eluate was further purified using AMPure beads. DNA was amplified by PCR using Illumina index primers and NEBNext Ultra II Q5master mix (NEB) according to the manufacturer's protocol. Indexed libraries were purified with AMPure beads, evaluated on agarose gels, quantified, and sequenced using Qubit (Thermo Fisher). DNA was amplified by PCR using Illumina index primers and NEBNext Ultra II Q5master mix (NEB) according to the manufacturer's protocol. Indexed libraries were purified with AMPure beads, evaluated on agarose gels, quantified, and sequenced using Qubit (Thermo Fisher).

[0227] Figure 12 shows an agarose gel of the IP and input libraries generated by the above protocol. The gel shows a clear library approximately 320 bp in size, as theoretically predicted. Figure 13A shows the number of SNAP-Chip fragments containing MBC107 and MBC109 after IP and barcoding relative to the input control. The KmetStat_H3K4me3 fragment was clearly enriched for MBC109, consistent with the experimental design.

[0228] Figure 13B shows the associated enrichment values. Figure 13C shows an example of sequencing reads showing two consecutive barcoding cycles. In summary, the above data validates the barcoding chemistry in consecutive barcoding cycles.

[0229] Example 8: Method for eluting immunoprecipitated nucleosomes from the bead surface This example describes a method for initially eluting immunoprecipitated nucleosomes and associated DNA from the bead surface. Elution of nucleosomes in an intact form, with DNA still wrapped around the histone octamer, is essential to allow further immunoprecipitation and barcoding of coexisting histone modifications within the same nucleosome. In this example, we tested the effectiveness of three approaches for nucleosome elution: a) competitive displacement of nucleosomes with modified histone peptides, b) competitive displacement of antibodies with protein G, and c) elution with a high-salt buffer.

[0230] Protein G magnetic beads were loaded with Ab43 (histone H3K9ac antibody, Active Motif, Cat# 91103) or Ab67 (histone H3 antibody, Thermo Fisher, Cat# 39064) according to the manufacturer's protocol.

[0231] HeLa mononucleosomes (EpiCypher Cat#16-0002) were spiked into SNAP-ChIP® K-MetStat Panel (EpiCypher Cat#19-1001), SNAP-ChIP® K-AcylStat Panel (EpiCypher Cat#19-3001), and recombinant mononucleosomal H3K9ac (EPL, Active Motif, Cat#81075). The nucleosome mix was diluted with HBST300 and applied to Ab43-loaded protein G beads for 1 hour at room temperature.

[0232] Immunoprecipitated nucleosomes were 5′ phosphorylated with T4 polynucleotide kinase, 3′ blunt-ended with T4 DNA polymerase, and then 3′ dA-tailed with Klenow fragment 3′ to 5′ exo as described in Example 7.

[0233] After end repair, the immunoprecipitated nucleosomes were incubated with an excess of biotinylated histone acetyl H3K9ac peptide (EpiGenTek, Cat#R-1010-100) for 30 minutes at room temperature to displace nucleosomes from antibody binding sites by competition. The supernatant containing the released nucleosomes was transferred to magnetic streptavidin beads and incubated for 15 minutes at room temperature to purify the nucleosomes from excess biotinylated H3K9ac peptide. The supernatant was then collected and prepared for repeating the immunoprecipitation with Ab67-loaded protein A beads (targeting H3).

[0234] In a separate reaction, the immunoprecipitated nucleosomes were subjected to an excess of protein G molecules to displace the nucleosome-antibody complexes from the protein G beads. After a 30-minute incubation at room temperature, the supernatant containing the released nucleosome-antibody complexes was transferred to Ab67-loaded protein A beads, and the immunoprecipitation was repeated.

[0235] In the third reaction, immunoprecipitated nucleosomes were eluted by incubation in Gentle Ag / Ab Elution Buffer (Thermo Fisher Scientific, Cat. #21027) for 30 min at room temperature. The supernatant containing the eluted nucleosomes was diluted with 10 mM HEPES buffer, pH 7.5, and then applied to Ab67-loaded Protein A beads, and the immunoprecipitation was repeated.

[0236] A no-elution control reaction was performed in parallel in which Ab43 (targeting H3K9ac) immunoprecipitated nucleosomes were retained on protein G beads without elution.

[0237] The no-elution control beads and the remaining Protein G beads from each of the above nucleosome elution reactions were washed with HBST300 buffer and used as input for the capping step, in which library adapters were ligated to nucleosomal DNA.

[0238] The second immunoprecipitation reaction proceeded on Ab67-loaded protein A beads for 1 hour at room temperature and washed with HBST300 buffer.

[0239] All beads prepared above underwent a capping step to attach universal sequencing adapters to the DNA ends for PCR library amplification. The ligation reaction was initiated as described in Example 7 by suspending the bead-bound nucleosomes in ligation buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10 mM MgCl2, 1 mM ATP, 10% PEG-8K, 0.05% Tween 20, and 400 units T4 DNA ligase) supplemented with 0.5 μM HP-U adapters. The adapter ligation reaction was incubated at 20°C for 15 minutes and at -25°C for 15 minutes, then stopped by adding EDTA and washed with HBST300 buffer. After adapter ligation, the looped ends were separated into Y-shaped ends by cleavage with USER enzyme. The cleavage reaction was carried out by incubating the beads with 0.5 units of USER enzyme in 1X NEB rCutSmart buffer for 15 minutes at 37° C. The reaction was washed with HBST300 buffer.

[0240] The nucleosomal DNA ligated with the library adapters was then eluted by incubation with 0.12 units of Thermolabile Proteinase K (New England Biolabs, Cat# P8111S) in a reaction mix consisting of RIPA buffer supplemented with 0.4% SDS and 5 mM DTT. The DNA elution reaction was carried out at 37°C for 1 hour, followed by 65°C for 10 minutes. The eluate was further purified with AMPure beads. DNA was PCR amplified using Illumina index primers and NEBNext Ultra II Q5master mix (NEB) according to the manufacturer's protocol. The indexed library was purified with AMPure beads and quantified using Qubit (Thermo Fisher). 2 μL of the amplified library was then transferred to a 4% E-Gel (商標)We analyzed the efficiency of nucleosome elution strategies using a 100% RT-PCR assay on EX Agarose Gel (Thermo Fisher, Cat# G401004) (Figure 14). Nucleosome elution was most efficient with a mild elution buffer (lanes 6 and 7), followed by elution with Protein G (lanes 4 and 5), and least efficient with H3K9ac peptide (lanes 2 and 3). In this example, we identify a mild elution buffer as the best option for removing nucleosomes from the binding domain after the barcoding cycle. The next step is to integrate this step into the workflow described in Example 7.

[0241] Example 9: Methods for identifying the spatial distribution of histone modifications in tissue samples. This example describes the preparation of microarrays using spatially encoded nucleosome-binding conjugates and an end-to-end workflow for identifying spatially resolved H3K4me3.

[0242] An array with 96 spots was prepared, each featuring a nucleosome-binding conjugate with a unique spatial identifier and a modified barcode for H3K4me3. The nucleosome-binding conjugate was prepared using the SiteClick Antibody Azido Modification Kit (Thermo Fisher, cat. No. S20026), Ab42 (histone H3K4me3 antibody, EpiCypher, cat. #13-0041), and rcMBC101 / 5Phos / GTGATCGNNNNNCTGTCTCTTATACACATCTGACUTTTTT (SEQ ID NO: 1) / DBCO as described in Example 5. The array was a protein G-coated slide, and each spot was prepared by natural immobilization of the nucleosome-binding conjugate via protein G-antibody interaction. Each spot had a unique spatial identifier determined by the barcode contained in the conjugate spotted at that position on the slide.

[0243] Tissue sections are prepared by cryostat cryosectioning and securely mounted on microarray slides. The thickness of the tissue sections can range from 10 to 40 μm. To prevent dissociation of DNA-binding proteins and nucleosome degradation, tissue sections are warmed to room temperature, fixed in 0.2% formaldehyde for 5 minutes, and quenched in 1.25 M glycine for 5 minutes at room temperature. The tissue is washed using a wash buffer containing protease inhibitors, rinsed with pure water and then isopropanol, and air-dried. To document the orientation of the tissue sections relative to the microarray, standard hematoxylin-eosin (HE) staining is performed. Hematoxylin stains cell nuclei purplish-blue, eosin stains extracellular matrix and cytoplasm pink, and other structures appear in various shades, hues, or combinations of these colors. The microarrays containing HE-stained tissue sections are imaged under a light microscope before proceeding to cell permeabilization.

[0244] The tissue sections are then permeabilized with NP40-Digitonin Wash Buffer. Chromatin is then digested with micrococcal nuclease (NEB) using the supplier's recommended buffer. After further washing with NP40-Digitonin Wash Buffer, nucleosomes are captured with an immobilized nucleosome-binding conjugate and washed with RIPA buffer (see above). Nucleosomal DNA ends are repaired according to the blunt-end protocol described in Example 3. Blunt-end ligation of adapters is induced by suspending surface-bound nucleosomes in ligation buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10 mM MgCl2, 1 mM ATP, 10% PEG-8K, 0.05% Tween 20, and 400 units T4 DNA ligase) supplemented with 0.5 μM each of MBC101 (5-deoxy I, 5-deoxy I, 5-deoxy I, 5-deoxy I, 5-deoxy I, 5-deoxy I, 5-deoxy CGATCAC). After barcoding, adapters are released from the antibody by USER treatment (NEB), which cleaves a single uracil that is part of the adapter sequence. The complementary DNA strand is synthesized in a standard primer extension reaction using 8 units of Bst3.0 DNA polymerase in extension buffer (1 mM each dNTP, 20 mM Tris-HCl, 10 mM (NH)SO, 50 mM KCl, 2 mM MgSO, 0.1% Tween® 20, pH 8.8 at 25°C, 0.5 μM extension primer (GTCAGATGTGTATAAGAGACAG; SEQ ID NO: 3)) using the following thermocycler program: 72°C 2 min, -55°C 5 min, -65°C 15 min, -72°C 5 min, -80°C 5 min, -16°C hold. The second sequencing adapter is introduced by repeating the same ligation step used to introduce the spatial MBC adapter, but in the presence of 100 units of T4 DNA ligase and 10 units of T4 polynucleotide kinase to phosphorylate the 5' ends of the bead strands. The second adapter is universal and contains only the Illumina P7 adapter (AGACGTGTGCTCTTCCGATCT; SEQ ID NO: 4) and its complement (GATCGAGAGC; SEQ ID NO: 5).Barcoded DNA was purified with Ampure beads and PCR amplified using NEBNext Ultra II Q5master mix (NEB) according to the manufacturer's protocol. Indexed libraries were purified with AMPure beads, examined on a 4% agarose gel, quantified, and sequenced using Qubit (Thermo Fisher). The result of this experiment is a sequencing library that spatially encodes the histone modification H3K4Me3 present in the tissue sample.

[0245] Various aspects Notwithstanding the claims set forth below, the following numbered embodiments also form part of the present invention and are examples and representative species of the present application. [1] i) base material; ii) a binding domain bound to a substrate, and iii) an adapter, including The binding domain binds to nucleosomes containing DNA-binding proteins or histone modifications, The composition, wherein the adaptor comprises a nucleic acid barcode sequence that is specific to a histone modification or a DNA binding protein. [2] The composition of any one or combination of numbered aspects disclosed herein, wherein the substrate is a bead, a microarray, a chip, a flow cell, or a fluidic device. [3] The composition of any one or combination of numbered embodiments disclosed herein, wherein the binding domain comprises an antibody, an scFv, a Fab fragment, an antibody light chain (VL), an antibody heavy chain (VH), a variable fragment (Fv), a F(ab')2 fragment, a diabody, a VHH domain, a nanobody, a bispecific antibody, a bivalent binding domain directed against two histone modifications, an aptamer, an engineered polymeric scaffold, an engineered protein scaffold, or a selective covalent capture agent, or a fragment or derivative thereof. [4] The composition of any one or combination of the numbered aspects disclosed herein, wherein the binding domain comprises a histone modification reader protein, writer protein, or eraser protein. [5] The composition of any one or combination of the numbered aspects disclosed herein, wherein the writer protein is a histone acetyltransferase, a lysine methyltransferase, an arginine methyltransferase. [6] The composition of any one or combination of numbered embodiments disclosed herein, wherein the reader protein comprises a methyl-CpG-binding domain (MBD), a bromodomain adjacent to zinc finger protein (BAZ) domain, a bromodomain (BRD), a malignant brain tumor (MBT) domain, a plant homeodomain finger (PHD) domain, a chromatin-binding (chromo) domain, a proline-tryptophan-tryptophan-proline domain (PWWP) domain, a tryptophan-aspartic acid dipeptide repeat domain (WD40), or a Tudor domain. [7] The composition of any one or combination of the numbered aspects disclosed herein, wherein the eraser protein is a histone deacetylase, a histone lysine demethylase, or a histone arginine demethylase. [8] The composition of any one or combination of the numbered aspects disclosed herein, wherein the binding domain comprises a catalytically inactive mutant of a histone modification writer or eraser protein. [9] The composition of any one or combination of the numbered aspects disclosed herein, wherein the binding domain is bound to the substrate covalently, via an affinity interaction, or via a combination thereof.

[10] The composition of any one or combination of the numbered aspects disclosed herein, wherein the adaptor is attached to the substrate.

[11] The composition of any one or combination of the numbered aspects disclosed herein, wherein the adaptor is attached to the substrate covalently, via an affinity interaction, or via a combination thereof.

[12] The composition of any one or combination of the numbered aspects disclosed herein, wherein the adapter comprises at least one universal sequence element in addition to the barcode.

[13] The composition of any one or combination of the numbered aspects disclosed herein, wherein the adapter comprises a unique molecular identifier in addition to the barcode.

[14] The composition of any one or combination of the numbered aspects disclosed herein, wherein the adapter comprises a spatial identifier sequence in addition to the barcode.

[15] The composition of any one or combination of the numbered embodiments disclosed herein, wherein the adapter comprises a uracil base, an inosine base, an 8-oxo-G base, a ribonucleoside, or a restriction sequence.

[16] The composition of any one or combination of the numbered embodiments disclosed herein, wherein the adaptor comprises a recognition sequence for a restriction enzyme, 8-oxoguanine-DNA glycosylase, uracil-DNA glycosylase (UDG), an endonuclease, or a ribonuclease.

[17] The composition of any one or combination of the numbered aspects disclosed herein, wherein the adapter comprises a substrate anchoring moiety.

[18] The composition of any one or combination of the numbered aspects disclosed herein, wherein the substrate anchoring moiety is biotin or desthiobiotin.

[19] The composition of any one or combination of numbered embodiments disclosed herein, wherein the substrate anchoring moiety is trans-cyclooctene (TCO), methyl-tetrazine (mTET), dibenzocyclooctyl (DBCO), azide, or alkyne.

[20] The composition of any one or combination of numbered aspects disclosed herein, wherein the adaptor is partially double-stranded and forms a Y-shape, the double-stranded portion being configured for ligation to the target nucleic acid, and each single-stranded arm comprising a universal sequence, a modified barcode, and a unique molecular identifier. [twenty one] The composition of any one or combination of numbered aspects disclosed herein, wherein the adaptor is partially double-stranded and forms a hairpin comprising a backbone portion configured for ligation to a target nucleic acid and a single-stranded loop, the single-stranded loop comprising a universal sequence, a modified barcode, and a unique molecular identifier. [twenty two] The composition of any one or combination of the numbered embodiments disclosed herein, wherein the adapter is partially double-stranded with a single-stranded 3' overhang. [twenty three] The composition of any one or combination of the numbered embodiments disclosed herein, wherein the adapter is partially double-stranded with single-stranded 3' overhangs on both sides. [twenty four] The composition of any one or combination of the numbered aspects disclosed herein, wherein the double-stranded ends are either blunt ended or have a single 3'-base overhang. [twenty five] The composition of any one or combination of numbered aspects disclosed herein, wherein the histone modification is lysine or arginine methylation, citrullination, acetylation, ubiquitination, ADP-ribosylation, deamination, proline isomerization, or sumoylation.

[26] The composition of any one or combination of the numbered aspects disclosed herein, wherein the histone modification is tyrosine, serine, or threonine phosphorylation.

[27] The composition of any one or combination of the numbered aspects disclosed herein, wherein the DNA binding protein is a transcription factor or RNA polymerase II.

[28] 1. A method for analyzing a plurality of nucleosomes, comprising: (i) contacting a plurality of substrates comprising at least one composition of any one of the numbered aspects or combinations disclosed herein with a solution comprising a plurality of nucleosomes, wherein the binding domain binds to a nucleosome comprising a DNA binding protein or a histone modification; (ii) ligating an adapter having a nucleic acid barcode to the target DNA of a nucleosome containing a histone modification or a DNA-binding protein; (iii) introducing a universal sequence for amplifying the target DNA; (iv) amplifying the barcoded target DNA; and (v) analyzing the amplified barcoded target DNA by sequencing; A method comprising:

[29] 1. A method for analyzing a plurality of nucleosomes, comprising: (i) contacting a plurality of substrates comprising at least one composition of any one of the numbered aspects or combinations disclosed herein with a solution comprising a plurality of nucleosomes, wherein the binding domain binds to a nucleosome comprising a DNA binding protein or a histone modification; (ii) ligating an adapter having a nucleic acid barcode to the target DNA of a nucleosome containing a histone modification or a DNA-binding protein; (iii) releasing the nucleosomes from the substrate by cleaving the ligated adapters; (iv) steps (i) to (iii) are repeated at least once; (v) introducing a universal nucleic acid sequence for amplifying the target DNA; (vi) amplifying the barcoded target DNA; and (vii) analyzing the amplified barcoded target DNA by sequencing; A method comprising:

[30] The method of any one or combination of numbered aspects disclosed herein, wherein steps (i) to (iii) are repeated at least twice.

[31] The method of any one or combination of numbered aspects disclosed herein, wherein the releasing step comprises cleavage of the ligated adapter at the restriction site, uracil, inosine, 8-oxoG, or ribocleoside of the adapter with an enzyme specific for these bases.

[32] The method of any one or combination of numbered aspects disclosed herein, wherein the releasing step comprises cleaving the recognition sequence of the adapter with a restriction enzyme, 8-oxoguanine-DNA glycosylase, uracil-DNA glycosylase (UDG), an endonuclease, a ribonuclease, or a derivative of any of these enzymes.

[33] The method of any one or combination of numbered aspects disclosed herein, wherein steps (i) through (iii) are carried out using two or more different types of substrate, each comprising an adapter having a different binding domain and nucleic acid barcode.

[34] The method of any one or combination of numbered aspects disclosed herein, wherein both the binding domain and the adapter are attached to the substrate covalently, via affinity interactions, or via a combination thereof.

[35] The method of any one or combination of numbered aspects disclosed herein, comprising using a different binding domain and adaptor each time steps (i)-(iii) are repeated.

[36] 1. A method for analyzing a plurality of nucleosomes, comprising: (i) contacting one type of substrate comprising a composition of any one of the numbered aspects or combinations disclosed herein with a solution comprising a plurality of nucleosomes, wherein the binding domain binds to a nucleosome comprising a DNA binding protein or a histone modification; (ii) attaching an adaptor to the plurality of nucleosomes bound to the binding domain; (iii) ligating an adapter having a nucleic acid barcode to the target DNA of a nucleosome containing a histone modification or a DNA-binding protein; (iv) releasing the nucleosomes from the binding domains by adding a buffer that prevents interactions between the binding domains and the nucleosomes; (v) steps (i) to (iv) are repeated at least once; (vi) introducing a universal sequence for amplifying the target DNA; (vii) amplifying the barcoded target DNA; and (viii) analyzing the amplified barcoded target DNA by sequencing; A method comprising:

[37] The method of any one or combination of numbered aspects disclosed herein, wherein steps (i) through (iv) are repeated at least twice.

[38] The method of any one or combination of numbered aspects disclosed herein, wherein ligating the adapters comprises T4 DNA ligase, CircLigase, T3 DNA ligase, T7 DNA ligase, 9N DNA ligase, Taq DNA ligase, or E. coli DNA ligase.

[39] The method of any one or combination of numbered aspects disclosed herein, wherein the step of introducing the universal sequence comprises ligating a partially double-stranded Y-shaped adapter or a partially double-stranded bell-shaped adapter to the adapter bearing the nucleic acid barcode to the target DNA.

[40] The method of any one or combination of numbered aspects disclosed herein, wherein the releasing step comprises adding a reducing agent, an enzyme that specifically digests the antibody (e.g., papain and / or pepsin), a synthetic modified histone peptide that acts as a competitive binding agent, a detergent (e.g., SDS, sodium deoxycholate), an acidic buffer of pH 6.5 or less, or an alkaline buffer of pH 8.5 or more, a buffer comprising about 0.3 M to about 2 M NaCl, or about 0.5 M to about 1 M NaCl.

[41] 1. A nucleosome-binding conjugate comprising: i) a binding domain, and ii) an adaptor conjugated to a binding domain. the binding domain binds to a nucleosome containing a DNA-binding protein or a histone modification; A nucleosome-binding conjugate, wherein the adaptor comprises a nucleic acid barcode sequence that is specific for a histone modification or a DNA-binding protein.

[42] The nucleosome-binding conjugate of any one or combination of numbered embodiments disclosed herein, wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 adaptors are conjugated to the nucleosome-binding conjugate.

[43] The nucleosome-binding conjugate of any one or combination of numbered embodiments disclosed herein, wherein the binding domain comprises an antibody, an scFv, a Fab fragment, an antibody light chain (VL), an antibody heavy chain (VH), a variable fragment (Fv), a F(ab')2 fragment, a diabody, a VHH domain, a nanobody, a bispecific antibody, a bivalent binding domain directed against two histone modifications, an aptamer, an engineered polymeric scaffold, an engineered protein scaffold, or a selective covalent capture agent, or a fragment or derivative thereof.

[44] The nucleosome-binding conjugate of any one or combination of numbered embodiments disclosed herein, wherein the binding domain comprises a DNA or chromatin reader protein, writer protein, or eraser protein.

[45] The nucleosome-binding conjugate of any one or combination of numbered embodiments disclosed herein, wherein the writer protein is a DNA methyltransferase, histone acetyltransferase, lysine methyltransferase, or arginine methyltransferase.

[46] The nucleosome-binding conjugate of any one or combination of numbered embodiments disclosed herein, wherein the leader comprises an MBD domain, a BAZ domain, a BRD domain, an MBT domain, a PHD domain, a chromodomain, a PWWP domain, a WD40 domain, or a Tudor domain.

[47] The nucleosome-binding conjugate of any one or combination of numbered aspects disclosed herein, wherein the eraser protein is a methylcytosine dioxygenase, a histone deacetylase, or a histone lysine demethylase.

[48] The nucleosome-binding conjugate of any one or combination of numbered aspects disclosed herein, wherein the binding domain comprises a catalytically inactive mutant of a histone modification writer or eraser protein.

[49] The nucleosome-binding conjugate of any one or combination of numbered aspects disclosed herein, wherein the adapter comprises a universal sequence in addition to the barcode.

[50] The nucleosome-binding conjugate of any one or combination of numbered aspects disclosed herein, wherein the adapter comprises a unique molecular identifier in addition to the barcode.

[51] The composition of any one or combination of the numbered aspects disclosed herein, wherein the adapter comprises a spatial identifier sequence in addition to the barcode.

[52] The nucleosome-binding conjugate of any one or combination of numbered embodiments disclosed herein, wherein the adaptor comprises a uracil base, an inosine base, an 8-oxo-G base, a ribonucleoside, or a restriction sequence.

[53] The nucleosome-binding conjugate of any one or combination of numbered embodiments disclosed herein, wherein the adaptor comprises a recognition sequence for a restriction enzyme, 8-oxoguanine-DNA glycosylase, uracil-DNA glycosylase (UDG), an endonuclease, a ribonuclease, or a derivative of any of these enzymes.

[54] The nucleosome-binding conjugate of any one or combination of numbered embodiments disclosed herein, wherein the adaptor is partially double-stranded and forms a Y-shape, the double-stranded portion being configured for ligation to a target nucleic acid, and each single-stranded arm can comprise a universal sequence, a modified barcode, a unique molecular identifier, and optionally, a spatial identifier sequence.

[55] The nucleosome-binding conjugate of any one or combination of numbered embodiments disclosed herein, wherein the adaptor is partially double-stranded and forms a hairpin comprising a backbone portion configured for ligation to a target nucleic acid and a single-stranded loop, the single-stranded loop comprising a universal sequence, a modified barcode, a unique molecular identifier, and optionally, a spatial identifier sequence.

[56] The nucleosome-binding conjugate of any one or combination of numbered embodiments disclosed herein, wherein the adapter is partially double-stranded with a single-stranded 3' overhang.

[57] The nucleosome-binding conjugate of any one or combination of numbered embodiments disclosed herein, wherein the adaptor is partially double-stranded with single-stranded 3' overhangs on both sides.

[58] The nucleosome-binding conjugate of any one or combination of numbered embodiments disclosed herein, wherein the double-stranded ends are either blunt-ended or have a single 3'-base overhang.

[59] The nucleosome-binding conjugate of any one or combination of numbered embodiments disclosed herein, wherein the histone modification is lysine or arginine methylation, citrullination, acetylation, ubiquitination, ADP-ribosylation, proline isomerization, or sumoylation.

[60] The nucleosome-binding conjugate of any one or combination of numbered embodiments disclosed herein, wherein the histone modification is phosphorylation of tyrosine, serine, and threonine.

[61] The nucleosome-binding conjugate of any one or combination of numbered embodiments disclosed herein, wherein the DNA-binding protein is a transcription factor or RNA polymerase II.

[62] 1. A method for analyzing a plurality of nucleosomes, comprising: (i) contacting a solution comprising a plurality of nucleosomes with a solution comprising at least one nucleosome-binding conjugate of any one or combination of the numbered embodiments disclosed herein; wherein the binding domain binds to a DNA-binding protein or a nucleosome containing a histone modification, (ii) ligating an adapter bearing a nucleic acid barcode of a nucleosome-binding conjugate to target DNA of a nucleosome containing a histone modification or a DNA-binding protein to generate barcoded target DNA in an environment where off-target barcoded DNA is generated at less than 20% of the barcoded target DNA; (iii) introducing a universal sequence to amplify the target DNA; (iv) amplifying the barcoded target DNA; and (v) analyzing the amplified barcoded target DNA by sequencing.

[63] The method of any one or combination of the numbered aspects disclosed herein, comprising transferring adapters of one or two nucleosome-binding conjugates to the same target DNA.

[64] The method of any one or combination of the numbered aspects disclosed herein, comprising transferring adapters of two nucleosome-binding conjugates to the same target DNA.

[65] The method of any one or combination of numbered aspects disclosed herein, comprising limiting off-target barcoding by performing the ligation step in a micromolar, nanomolar, picomolar, femtomolar, attomolar, or zeptomolar solution of nucleosomes and nucleosome-binding conjugates.

[66] 1. A method for analyzing a plurality of nucleosomes, comprising: (i) immobilizing a plurality of nucleosomes on a substrate at intervals such that off-target barcoding is less than 20%; (ii) contacting the immobilized nucleosomes with a solution comprising at least one nucleosome-binding conjugate of any one or combination of the numbered embodiments disclosed herein; wherein the binding domain binds to a DNA-binding protein or a nucleosome containing a histone modification, (iii) ligating an adapter bearing the nucleic acid barcode of the nucleosome-binding conjugate to the target DNA of a nucleosome containing a histone modification or a DNA-binding protein; (iv) cleaving the adapter to generate nucleic acid ends with a structure suitable for ligation to another adapter; (v) steps (ii) to (iv) are repeated at least once; (vi) introducing a universal nucleic acid sequence to amplify the target DNA; (vii) amplifying the barcoded DNA; and (viii) analyzing the amplified barcoded target DNA by sequencing.

[67] The method of any one or combination of numbered aspects disclosed herein, wherein steps (ii) to (iv) are repeated at least twice.

[68] The method of any one or combination of numbered aspects disclosed herein, comprising limiting off-target barcoding by immobilizing nucleosomes on the substrate at a spacing distance of 50 nm or more, e.g., 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 50-500, 50-400, 50-300, 50-250, 50-200, 50-100, or any integer, value, or range between 50 and 1000 nm.

[69] The method of any one or combination of numbered aspects disclosed herein, comprising cleaving the adapter at the uracil, inosine, 8-oxoG, or ribonucleoside of the adapter by an enzyme specific for the uracil, inosine, 8-oxoG, or ribonucleoside of the adapter.

[70] The method of any one or combination of numbered aspects disclosed herein, comprising cleaving the recognition sequence of the adapter with a restriction enzyme.

[71] The method of any one or combination of the numbered aspects disclosed herein, wherein the adaptor comprises a recognition sequence for a restriction enzyme, 8-oxoguanine-DNA glycosylase, uracil-DNA glycosylase (UDG), an endonuclease, or a ribonuclease.

[72] The method of any one or combination of numbered aspects disclosed herein, wherein steps (ii)-(iv) are repeated each time using a different binding domain and a different adaptor.

[73] The method of any one or combination of numbered embodiments disclosed herein, wherein ligation comprises using T4 DNA ligase, CircLigase, T3 DNA ligase, T7 DNA ligase, 9N DNA ligase, Taq DNA ligase, or E. coli ligase.

[74] 1. A method for analyzing multiple nucleosomes in a tissue, comprising: (i) immobilizing a plurality of nucleosome-binding conjugates on a planar microarray substrate at intervals that result in less than about 20% off-target barcoding; (ii) overlaying the tissue section on a planar microarray substrate comprising a plurality of nucleosome-binding conjugates; (iii) permeabilizing the tissue cells; (iv) digesting the chromatin with an endonuclease and capturing the nucleosomes with an immobilized nucleosome-binding conjugate; (v) ligating an adaptor having a nucleic acid barcode and spatial identifier sequence of a nucleosome-binding conjugate to target DNA of a nucleosome containing a histone modification or DNA-binding protein to generate barcoded target DNA in an environment where off-target barcoded DNA is generated at less than 20% of the barcoded target DNA; (vi) introducing a universal sequence for amplifying the target DNA; (vii) amplifying the barcoded target DNA; (vii) analyzing the amplified barcoded target DNA by sequencing; and (viii) determining the identities of the histone modifications or DNA binding proteins and their spatial locations on the planar microarray substrate based on the barcode and spatial identifier sequences; A method comprising:

[75] The method of any one or combination of numbered aspects disclosed herein, comprising limiting off-target barcoding by immobilizing nucleosomes or nucleosome-binding conjugates on the substrate at a spacing distance of 50 nm or greater.

[76] 1. A method for analyzing a plurality of nucleosomes, comprising: (i) introducing a universal connector into the target DNA of the nucleosome; (ii) contacting a solution comprising a plurality of nucleosomes with a solution comprising at least one nucleosome-binding conjugate of any one or combination of the numbered embodiments disclosed herein; wherein the binding domain binds to a DNA-binding protein or a nucleosome containing a histone modification, (iii) connecting the adapters of the bound plurality of nucleosome-bound conjugates by ligation; (iv) hybridizing a universal connector of the target DNA to the 3' end of the ligated adapter; (v) copying the sequences of the ligated adapters to create copies of the barcoded target DNA; (vi) introducing a universal nucleic acid sequence for amplifying the target DNA; (vii) amplifying the barcoded nucleosomal DNA; (viii) analyzing the barcoded target DNA by sequencing; A method comprising:

[77] The method of any one or combination of the numbered aspects disclosed herein, wherein the step of introducing a universal sequence comprises ligating a forward or reverse sequencing adapter to the barcode.

[78] The method of any one or combination of numbered aspects disclosed herein, wherein the binding domain of the nucleosome-binding conjugate is linked to an internal position of the nucleic acid adaptor.

[79] The method of any one or combination of numbered aspects disclosed herein, comprising A-tailing the nucleosomes in step (i).

[80] The method of any one or combination of numbered aspects disclosed herein, comprising ligating a universal connector sequence in step (i).

[81] The method of any one or combination of numbered aspects disclosed herein, comprising connecting the adaptors of the bound plurality of nucleosome-binding conjugates by double-stranded, single-stranded, or splint ligation.

[82] The method of any one or combination of numbered aspects disclosed herein, wherein amplifying the barcoded target DNA comprises generating substrate-tethered colonies of monoclonal copies of the target DNA by surface amplification.

[83] The method of any one or combination of numbered aspects disclosed herein, wherein analyzing the amplified barcoded target DNA comprises in situ sequencing of substrate-tethered colonies of monoclonal copies of the target DNA.

[84] The method of any one or combination of numbered aspects disclosed herein, wherein analyzing the barcoded target DNA comprises analyzing the barcoded DNA by nucleic acid probe hybridization.

[85] The method of any one or combination of numbered aspects disclosed herein, wherein analyzing the barcoded target DNA comprises analyzing the barcoded DNA by PCR.

[86] The method of any one or combination of numbered aspects disclosed herein, comprising obtaining nucleosomes from cell-free circulating nucleosomes.

[87] The method of any one or combination of numbered aspects disclosed herein, comprising obtaining nucleosomes from chromatin by enzymatic or mechanical shearing.

[88] The method of any one or combination of numbered aspects disclosed herein, comprising obtaining nucleosomes from a single cell.

[89] A method of diagnosing cancer or cancer subtypes associated with one or more types of histone modifications comprising analyzing a plurality of nucleosomes of any or combination of the numbered aspects disclosed herein.

[90] A method of monitoring cancer progression or treatment response comprising analyzing a plurality of nucleosomes of any or combination of the numbered aspects disclosed herein.

[91] The method of any one or combination of numbered aspects disclosed herein, comprising obtaining a plurality of nucleosomes from a blood sample.

[92] The method of any one or combination of numbered aspects disclosed herein, comprising obtaining a plurality of nucleosomes from a tissue biopsy sample.

[93] A kit for monitoring epigenetic changes over time in a sample obtained from a subject undergoing treatment, comprising a composition of any of the numbered aspects or combinations disclosed herein or a nucleosome-binding conjugate of any of the numbered aspects or combinations disclosed herein and instructions for using the composition or nucleosome-binding conjugate to monitor epigenetic changes over time.

[94] The kit of any one or combination of numbered aspects disclosed herein, wherein the subject is being treated for cancer.

Claims

1. i) base material; ii) a binding domain bound to a substrate, and iii) an adapter; the binding domain binds to a DNA-binding protein or a nucleosome containing a histone modification; A composition, wherein the adaptor comprises a nucleic acid barcode sequence that is specific to a histone modification or a DNA binding protein.

2. The composition of claim 1 , wherein the substrate is a bead, a microarray, a chip, a flow cell, or a fluidic device.

3. 2. The composition of claim 1, wherein the binding domain comprises an antibody, scFv, Fab fragment, antibody light chain (VL), antibody heavy chain (VH), variable fragment (Fv), F(ab')2 fragment, diabody, VHH domain, nanobody, bispecific antibody, bivalent binding domain directed against two histone modifications, aptamer, engineered polymeric scaffold, engineered protein scaffold, or selective covalent capture agent, or fragment or derivative thereof.

4. The composition of claim 1 , wherein the binding domain comprises a histone modification reader protein, writer protein, or eraser protein.

5. The composition of claim 4 , wherein the writer protein is a histone acetyltransferase, a lysine methyltransferase, or an arginine methyltransferase.

6. 5. The composition of claim 4, wherein the reader protein comprises a methyl-CpG-binding domain (MBD), a bromodomain adjacent to zinc finger protein (BAZ) domain, a bromodomain (BRD), a malignant brain tumor (MBT) domain, a plant homeodomain finger (PHD) domain, a chromatin-binding (chromo) domain, a proline-tryptophan-tryptophan-proline domain (PWWP) domain, a tryptophan-aspartic acid dipeptide repeat domain (WD40), or a Tudor domain.

7. The composition of claim 4 , wherein the eraser protein is a histone deacetylase, a histone lysine demethylase, or a histone arginine demethylase.

8. The composition of claim 1 , wherein the binding domain comprises a catalytically inactive mutant of a histone modification writer or eraser protein.

9. The composition of claim 1 , wherein the binding domain is bound to the substrate covalently, through an affinity interaction, or through a combination thereof.

10. The composition of any one of claims 1 to 9, wherein the adaptor is attached to a substrate.

11. The composition of claim 10 , wherein the adaptor is bound to the substrate covalently, through an affinity interaction, or through a combination thereof.

12. The composition of any one of claims 1 to 11, wherein the adapter comprises at least one universal sequence element in addition to the barcode.

13. The composition of any of claims 1 to 12, wherein the adapter comprises a unique molecular identifier in addition to the barcode.

14. The composition of any one of claims 1 to 13, wherein the adapter comprises a spatial identifier sequence in addition to the barcode.

15. The composition of any one of claims 1 to 14, wherein the adapter comprises a uracil base, an inosine base, an 8-oxo-G base, a ribonucleoside, or a restriction sequence.

16. The composition of any one of claims 1 to 15, wherein the adaptor comprises a recognition sequence for a restriction enzyme, 8-oxoguanine-DNA glycosylase, uracil-DNA glycosylase (UDG), an endonuclease, or a ribonuclease.

17. The composition of any preceding claim, wherein the adapter comprises a substrate anchoring moiety.

18. The composition of any of claims 1 to 17, wherein the substrate anchoring moiety is biotin or desthiobiotin.

19. The composition of any preceding claim, wherein the substrate anchoring moiety is trans-cyclooctene (TCO), methyl-tetrazine (mTET), dibenzocyclooctyl (DBCO), an azide, or an alkyne.

20. 20. The composition of any of claims 1-19, wherein the adaptor is partially double-stranded and forms a Y-shape, the double-stranded portion being configured for ligation to a target nucleic acid, and each single-stranded arm comprising a universal sequence, a modified barcode, and a unique molecular identifier.

21. 21. The composition of any of claims 1-20, wherein the adaptor is partially double-stranded and forms a hairpin comprising a backbone portion configured for ligation to a target nucleic acid and a single-stranded loop, wherein the single-stranded loop comprises a universal sequence, a modified barcode, and a unique molecular identifier.

22. The composition of any one of claims 1 to 21, wherein the adapter is partially double-stranded with a single-stranded 3' overhang.

23. 23. The composition of any one of claims 1 to 22, wherein the adapter is partially double-stranded with single-stranded 3' overhangs on both sides.

24. The composition of any of claims 20 to 22, wherein the double-stranded ends are either blunt-ended or have a single 3'-base overhang.

25. The composition of any one of claims 1 to 24, wherein the histone modification is lysine or arginine methylation, citrullination, acetylation, ubiquitination, ADP-ribosylation, deamination, proline isomerization, or sumoylation.

26. The composition of any one of claims 1 to 25, wherein the histone modification is phosphorylation of tyrosine, serine, or threonine.

27. The composition of any one of claims 1 to 26, wherein the DNA-binding protein is a transcription factor or RNA polymerase II.

28. 1. A method for analyzing a plurality of nucleosomes, comprising: (i) contacting a plurality of substrates comprising at least one composition of any one of claims 1 to 27 with a solution comprising a plurality of nucleosomes, wherein the binding domain binds to a DNA binding protein or a nucleosome comprising a histone modification; (ii) ligating an adapter bearing a nucleic acid barcode to the target DNA of a nucleosome containing a histone modification or a DNA-binding protein; (iii) introducing a universal sequence for amplifying the target DNA; (iv) amplifying the barcoded target DNA; and (v) analyzing the amplified barcoded target DNA by sequencing; A method comprising:

29. 1. A method for analyzing a plurality of nucleosomes, comprising: (i) contacting a plurality of substrates comprising at least one composition of any one of claims 1 to 27 with a solution comprising a plurality of nucleosomes, wherein the binding domain binds to a DNA binding protein or a nucleosome comprising a histone modification; (ii) ligating an adapter bearing a nucleic acid barcode to the target DNA of a nucleosome containing a histone modification or a DNA-binding protein; (iii) releasing the nucleosomes from the substrate by cleaving the ligated adapters; (iv) steps (i) to (iii) are repeated at least once; (v) introducing a universal nucleic acid sequence for amplifying the target DNA; (vi) amplifying the barcoded target DNA; and (vii) analyzing the amplified barcoded target DNA by sequencing; A method comprising:

30. 30. The method of claim 29, wherein steps (i) to (iii) are repeated at least twice.

31. 30. The method of claim 29, wherein the releasing step comprises cleaving the ligated adapter at the restriction site, uracil, inosine, 8-oxoG, or ribocleoside of the adapter with an enzyme specific for these bases.

32. 30. The method of claim 29, wherein the releasing step comprises cleaving the recognition sequence of the adapter with a restriction enzyme, 8-oxoguanine-DNA glycosylase, uracil-DNA glycosylase (UDG), an endonuclease, a ribonuclease, or a derivative of any of these enzymes.

33. 30. The method of Claim 29, wherein steps (i) through (iii) are carried out using two or more different types of substrates, each comprising an adapter with a different binding domain and nucleic acid barcode.

34. 30. The method of claim 29, wherein both the binding domain and the adapter are bound to the substrate covalently, via affinity interactions, or via a combination thereof.

35. 30. The method of claim 29, comprising using a different binding domain and adaptor each time steps (i) to (iii) are repeated.

36. 1. A method for analyzing a plurality of nucleosomes, comprising: (i) contacting a type of substrate comprising a composition of any one of claims 1 to 27 with a solution comprising a plurality of nucleosomes, wherein the binding domain binds to a nucleosome comprising a DNA-binding protein or a histone modification; (ii) attaching an adaptor to the plurality of nucleosomes bound to the binding domain; (iii) ligating an adapter having a nucleic acid barcode to the target DNA of a nucleosome containing a histone modification or a DNA-binding protein; (iv) releasing the nucleosomes from the binding domains by adding a buffer that prevents interactions between the binding domains and the nucleosomes; (v) steps (i) to (iv) are repeated at least once; (vi) introducing a universal sequence for amplifying the target DNA; (vii) amplifying the barcoded target DNA; and (viii) analyzing the amplified barcoded target DNA by sequencing; A method comprising:

37. 37. The method of claim 36, wherein steps (i) to (iv) are repeated at least twice.

38. 38. The method of any of claims 28-37, wherein ligating the adapters comprises T4 DNA ligase, CircLigase, T3 DNA ligase, T7 DNA ligase, 9N DNA ligase, Taq DNA ligase, or E. coli DNA ligase.

39. 38. The method of any of claims 28-37, wherein the step of introducing a universal sequence comprises ligating a partially double-stranded Y-shaped adapter or a partially double-stranded bell-shaped adapter to an adapter bearing a nucleic acid barcode to the target DNA.

40. 37. The method of claim 36, wherein the releasing step comprises adding a reducing agent, an enzyme that specifically digests the antibody (e.g., papain and / or pepsin), a synthetic modified histone peptide that acts as a competitive binding agent, a detergent (e.g., SDS, sodium deoxycholate), an acidic buffer of pH 6.5 or less, or an alkaline buffer of pH 8.5 or more, a buffer containing about 0.3 M to about 2 M NaCl, or about 0.5 M to about 1 M NaCl.

41. 1. A nucleosome-binding conjugate comprising: i) a binding domain, and ii) an adapter conjugated to a binding domain; the binding domain binds to a nucleosome containing a DNA-binding protein or a histone modification; A nucleosome-binding conjugate, wherein the adaptor comprises a nucleic acid barcode sequence that is unique to a histone modification or a DNA-binding protein.

42. 42. The nucleosome-binding conjugate of claim 41, wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 adaptors are conjugated to the nucleosome-binding conjugate.

43. 42. The nucleosome-binding conjugate of claim 41 , wherein the binding domain comprises an antibody, scFv, Fab fragment, antibody light chain (VL), antibody heavy chain (VH), variable fragment (Fv), F(ab′)2 fragment, diabody, VHH domain, nanobody, bispecific antibody, bivalent binding domain directed against two histone modifications, aptamer, engineered polymeric scaffold, engineered protein scaffold, or selective covalent capture agent, or fragment or derivative thereof.

44. 42. The nucleosome-binding conjugate of claim 41, wherein the binding domain comprises a DNA or chromatin reader protein, writer protein, or eraser protein.

45. 45. The nucleosome-binding conjugate of claim 44, wherein the writer protein is a DNA methyltransferase, a histone acetyltransferase, a lysine methyltransferase, or an arginine methyltransferase.

46. 45. The nucleosome-binding conjugate of claim 44, wherein the leader comprises an MBD domain, a BAZ domain, a BRD domain, an MBT domain, a PHD domain, a chromodomain, a PWWP domain, a WD40 domain, or a Tudor domain.

47. 45. The nucleosome-binding conjugate of claim 44, wherein the eraser protein is a methylcytosine dioxygenase, a histone deacetylase, or a histone lysine demethylase.

48. 42. The nucleosome-binding conjugate of claim 41, wherein the binding domain comprises a catalytically inactive mutant of a histone modification writer or eraser protein.

49. 42. The nucleosome-binding conjugate of claim 41, wherein the adapter comprises a universal sequence in addition to the barcode.

50. 42. The nucleosome-binding conjugate of claim 41 , wherein the adapter comprises a unique molecular identifier in addition to the barcode.

51. 42. The composition of claim 41, wherein the adapter comprises a spatial identifier sequence in addition to the barcode.

52. 42. The nucleosome-binding conjugate of claim 41, wherein the adaptor comprises a uracil base, an inosine base, an 8-oxo-G base, a ribonucleoside, or a restriction sequence.

53. 42. The nucleosome-binding conjugate of claim 41, wherein the adaptor comprises a recognition sequence for a restriction enzyme, 8-oxoguanine-DNA glycosylase, uracil-DNA glycosylase (UDG), an endonuclease, a ribonuclease, or a derivative of any of these enzymes.

54. 42. The nucleosome-binding conjugate of claim 41, wherein the adaptor is partially double-stranded and forms a Y-shape, the double-stranded portion being configured for ligation to a target nucleic acid, and each single-stranded arm may comprise a universal sequence, a modified barcode, a unique molecular identifier, and optionally, a spatial identifier sequence.

55. 42. The nucleosome-binding conjugate of claim 41 , wherein the adaptor is partially double-stranded and forms a hairpin comprising a backbone portion configured for ligation to a target nucleic acid and a single-stranded loop, wherein the single-stranded loop comprises a universal sequence, a modified barcode, a unique molecular identifier, and optionally, a spatial identifier sequence.

56. 42. The nucleosome-binding conjugate of claim 41, wherein the adaptor is partially double-stranded with a single-stranded 3' overhang.

57. 42. The nucleosome-binding conjugate of claim 41, wherein the adaptor is partially double-stranded with single-stranded 3' overhangs on both sides.

58. 58. The nucleosome-binding conjugate of any of claims 54 to 57, wherein the double-stranded ends are either blunt-ended or have a single 3'-base overhang.

59. The nucleosome-binding conjugate of any one of claims 41 to 58, wherein the histone modification is lysine or arginine methylation, citrullination, acetylation, ubiquitination, ADP-ribosylation, proline isomerization, or sumoylation.

60. 60. The nucleosome-binding conjugate of any one of claims 41 to 59, wherein the histone modifications are phosphorylation of tyrosine, serine, and threonine.

61. 60. The nucleosome-binding conjugate of any one of claims 41 to 59, wherein the DNA-binding protein is a transcription factor or RNA polymerase II.

62. 1. A method for analyzing a plurality of nucleosomes, comprising: (i) contacting a solution comprising a plurality of nucleosomes with a solution comprising at least one nucleosome-binding conjugate of any one of claims 41 to 61; wherein the binding domain binds to a DNA-binding protein or a nucleosome containing a histone modification; (ii) ligating an adapter bearing a nucleic acid barcode of a nucleosome-binding conjugate to target DNA of a nucleosome containing a histone modification or a DNA-binding protein to generate barcoded target DNA in an environment where off-target barcoded DNA is generated at less than 20% of the barcoded target DNA; (iii) introducing a universal sequence to amplify the target DNA; (iv) amplifying the barcoded target DNA; and (v) analyzing the amplified barcoded target DNA by sequencing.

63. 63. The method of claim 62, comprising transferring adapters of one or two nucleosome-binding conjugates to the same target DNA.

64. 64. The method of claim 63, comprising transferring the adapters of two nucleosome-binding conjugates to the same target DNA.

65. 65. The method of any of claims 62-64, comprising limiting off-target barcoding by performing the ligation step in micromolar, nanomolar, picomolar, femtomolar, attomolar, or zeptomolar solutions of nucleosomes and nucleosome-binding conjugates.

66. 1. A method for analyzing a plurality of nucleosomes, comprising: (i) immobilizing a plurality of nucleosomes on a substrate at intervals that result in less than 20% off-target barcoding; (ii) contacting the immobilized nucleosomes with a solution comprising at least one nucleosome-binding conjugate according to any one of claims 41 to 61; wherein the binding domain binds to a DNA-binding protein or a nucleosome containing a histone modification; (iii) ligating an adapter bearing the nucleic acid barcode of the nucleosome-binding conjugate to the target DNA of a nucleosome containing a histone modification or a DNA-binding protein; (iv) cleaving the adapter to generate a nucleic acid terminus having a structure suitable for ligation to another adapter; (v) steps (ii) to (iv) are repeated at least once; (vi) introducing a universal nucleic acid sequence to amplify the target DNA; (vii) amplifying the barcoded DNA; and (viii) analyzing the amplified barcoded target DNA by sequencing.

67. 67. The method of claim 66, wherein steps (ii) to (iv) are repeated at least twice.

68. 67. The method of claim 66, comprising limiting off-target barcoding by immobilizing nucleosomes on the substrate at a spacing distance of 50 nm or greater.

69. 67. The method of claim 66, comprising cleaving the adapter at the uracil, inosine, 8-oxoG, or ribonucleoside of the adapter by an enzyme specific for the uracil, inosine, 8-oxoG, or ribonucleoside of the adapter.

70. 67. The method of claim 66, comprising cleaving the recognition sequence of the adapter with a restriction enzyme.

71. 67. The method of claim 66, wherein the adaptor comprises a recognition sequence for a restriction enzyme, 8-oxoguanine-DNA glycosylase, uracil-DNA glycosylase (UDG), an endonuclease, or a ribonuclease.

72. 67. The method of claim 66, wherein steps (ii) to (iv) are repeated each time using a different binding domain and a different adapter.

73. 73. The method of any of claims 62-72, wherein ligation comprises using T4 DNA ligase, CircLigase, T3 DNA ligase, T7 DNA ligase, 9N DNA ligase, Taq DNA ligase, or E. coli ligase.

74. 1. A method for analyzing multiple nucleosomes in a tissue, comprising: (i) immobilizing a plurality of nucleosome-binding conjugates on a planar microarray substrate at intervals that result in less than 20% off-target barcoding; (ii) overlaying the tissue section on a planar microarray substrate comprising a plurality of nucleosome-binding conjugates; (iii) permeabilizing the tissue cells; (iv) digesting the chromatin with an endonuclease and capturing nucleosomes with an immobilized nucleosome-binding conjugate; (v) ligating an adaptor having a nucleic acid barcode and spatial identifier sequence of a nucleosome-binding conjugate to target DNA of a nucleosome containing a histone modification or a DNA-binding protein to generate barcoded target DNA in an environment where off-target barcoded DNA is generated at less than 20% of the barcoded target DNA; (vi) introducing a universal sequence for amplifying the target DNA; (vii) amplifying the barcoded target DNA; (vii) analyzing the amplified barcoded target DNA by sequencing; and (viii) determining the identities of the histone modifications or DNA binding proteins and their spatial locations on the planar microarray substrate based on the barcode and spatial identifier sequences; A method comprising:

75. 75. The method of any of claims 62-74, comprising limiting off-target barcoding by immobilizing nucleosomes or nucleosome-binding conjugates on a substrate with a spacing distance of 50 nm or greater.

76. 1. A method for analyzing a plurality of nucleosomes, comprising: (i) introducing a universal connector into the target DNA of the nucleosome; (ii) contacting a solution comprising a plurality of nucleosomes with a solution comprising at least one nucleosome-binding conjugate of any one of claims 41 to 61; wherein the binding domain binds to a DNA-binding protein or a nucleosome containing a histone modification; (iii) connecting the adapters of the bound plurality of nucleosome-bound conjugates by ligation; (iv) hybridizing the universal connector of the target DNA to the 3' end of the ligated adapter; (v) copying the sequences of the ligated adapters to create copies of the barcoded target DNA; (vi) introducing a universal nucleic acid sequence for amplifying the target DNA; (vii) amplifying the barcoded nucleosomal DNA; (viii) analyzing the barcoded target DNA by sequencing; A method comprising:

77. 77. The method of any of claims 28-40 and 62-76, wherein the step of introducing a universal sequence comprises ligating a forward or reverse sequencing adapter to the barcode.

78. 80. The method of any one of claims 28, 29, 36, 62, 66, and 76, wherein the binding domain of the nucleosome-binding conjugate is linked to an internal position of the nucleic acid adapter.

79. 80. The method of any one of claims 28, 29, 36, 62, 66, and 76, comprising A-tailing the nucleosomes in step (i).

80. 77. The method of claim 76, comprising ligating a universal connector sequence in step (i).

81. 77. The method of claim 76, comprising connecting the adaptors of the bound plurality of nucleosome-binding conjugates by double-stranded, single-stranded, or splint ligation.

82. 80. The method of any one of claims 28, 29, 36, 62, 66, and 76, wherein amplifying the barcoded target DNA comprises generating substrate-tethered colonies of monoclonal copies of the target DNA by surface amplification.

83. 80. The method of any one of claims 28, 29, 36, 62, 66, and 76, wherein analyzing the amplified barcoded target DNA comprises in situ sequencing of substrate-tethered colonies of monoclonal copies of the target DNA.

84. 80. The method of any of claims 28, 29, 36, 62, 66, and 76, wherein analyzing the barcoded target DNA comprises analyzing the barcoded DNA by nucleic acid probe hybridization.

85. 80. The method of any one of claims 28, 29, 36, 62, 66, and 76, wherein analyzing the barcoded target DNA comprises analyzing the barcoded DNA by PCR.

86. 80. The method of any one of claims 28, 29, 36, 62, 66, and 76, comprising obtaining nucleosomes from cell-free circulating nucleosomes.

87. 80. The method of any of claims 28, 29, 36, 62, 66, and 76, comprising obtaining nucleosomes from chromatin by enzymatic or mechanical shearing.

88. 80. The method of any one of claims 28, 29, 36, 62, 66, and 76, comprising obtaining nucleosomes from a single cell.

89. 80. A method for diagnosing cancer or cancer subtypes associated with one or more types of histone modifications, comprising analyzing a plurality of nucleosomes according to any one of claims 28, 29, 36, 62, 66, and 76.

90. 80. A method for monitoring cancer progression or treatment response comprising analyzing a plurality of nucleosomes described in any one of claims 28, 29, 36, 62, 66, and 76.

91. 91. The method of any of claims 89-90, comprising obtaining a plurality of nucleosomes from a blood sample.

92. 91. The method of any of claims 89-90, comprising obtaining a plurality of nucleosomes from a tissue biopsy sample.

93. 62. A kit for monitoring epigenetic changes over time in a sample obtained from a subject undergoing treatment, comprising a composition of any one of claims 1 to 27 or a nucleosome-binding conjugate of any one of claims 41 to 61 and instructions for using the composition or nucleosome-binding conjugate to monitor epigenetic changes over time.

94. 94. The kit of claim 93, wherein the subject is being treated for cancer.

Images