Model nematode for climacteric symptoms

Abstract

To provide a model nematode of climacteric symptom.SOLUTION: A nematode model for climacteric symptoms, which satisfies at least one selected from the group consisting of enhanced expression of nlp-58 gene, a functional and / or expression-reducing mutation of nlp-58 gene, enhanced expression of tkr-1 gene, and a functional and / or expression-reducing mutation of tkr-1 gene.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to a nematode model of menopausal symptoms. [Background technology]

[0002] In recent years, increasing evidence has emerged that gender-specific differences exist in the onset and manifestation of diseases. The concept of gender-specific medicine, which requires the development of treatments that take gender differences into account, has been gaining attention. In particular, it is known that there are dozens of different symptoms that occur during menopause, and there is considerable individual variation in the onset and timing of symptoms. The inability of over-the-counter medications to suppress various menopausal symptoms has become a problem. In women, menopausal symptoms are primarily caused by the expansion and overactivity of hypothalamic KNDy neurons due to a decrease in estrogen. Currently, the primary treatment is hormone replacement therapy, which supplements estrogen with medication. However, side effects such as irregular vaginal bleeding, breast tenderness and pain, and stomach upset and nausea are problematic. [Prior art documents] [Non-patent literature]

[0003] [Non-Patent Document 1] Biochem Biophys Res Commun. 2021 Jun 25:559:197-202. doi: 10.1016 / j.bbrc.2021.04.063. Summary of the Invention [Problem to be solved by the invention]

[0004] The development of animal models of menopausal symptoms is important for the development of non-hormonal drugs that improve menopausal symptoms and for elucidating the detailed molecular mechanisms of menopausal symptoms. The present inventors focused on C. elegans, which share over 70% homology with human genes, have a short life cycle that makes it easy to measure physiological changes associated with aging, and are easy to manipulate and analyze genetically.

[0005] Non-Patent Document 1 reports that in C. elegans, the nlp-58 gene encodes a putative ligand for the orphan G protein-coupled receptor (GPCR) TKR-1, an orthologue of tachykinin receptors. However, the relationship between the nlp-58 gene and the tkr-1 gene and menopausal symptoms remains unclear.

[0006] An objective of the present invention is to provide a nematode model of menopausal symptoms. [Means for solving the problem]

[0007] In light of the above-mentioned problems, the present inventors have conducted extensive research and found that the above-mentioned problems can be solved by a model nematode for menopausal symptoms that satisfies at least one of the following: enhanced expression of the nlp-58 gene; a mutation that reduces the function and / or expression of the nlp-58 gene; enhanced expression of the tkr-1 gene; and a mutation that reduces the function and / or expression of the tkr-1 gene. Based on this finding, the present inventors have conducted further research and have completed the present invention. Specifically, the present invention encompasses the following aspects:

[0008] Item 1. A model nematode for menopausal symptoms, which satisfies at least one of the following: enhanced expression of the nlp-58 gene, having a mutation that reduces the function and / or expression of the nlp-58 gene, enhanced expression of the tkr-1 gene, and having a mutation that reduces the function and / or expression of the tkr-1 gene.

[0009] Item 2. A model nematode according to Item 1, which satisfies at least one of the following conditions: expression of the nlp-58 gene is enhanced; and expression of the tkr-1 gene is enhanced.

[0010] Item 3. The enhanced expression of the nlp-58 gene is achieved by including an exogenous polynucleotide containing the nlp-58 gene coding sequence, and / or The enhanced expression of the tkr-1 gene is obtained by including an exogenous polynucleotide containing the tkr-1 gene coding sequence; The model nematode described in Section 2.

[0011] Item 4. The nlp-58 gene (a) a gene encoding a protein comprising an amino acid sequence X1 shown in SEQ ID NO: 1 or an amino acid sequence X2 having 70% or more identity to the amino acid sequence X1, the protein comprising a peptide sequence having agonistic activity against the tkr-1 protein; or (b) a gene encoding a peptide containing the amino acid sequence xa1 shown in SEQ ID NO: 2, the amino acid sequence xb1 shown in SEQ ID NO: 3, the amino acid sequence xc1 shown in SEQ ID NO: 4, or the amino acid sequence xabc2 in which one or more amino acids are mutated from the amino acid sequence xa1, the amino acid sequence xb1, or the amino acid sequence xc1 and the C-terminal three residues are GLR in single-letter code; is and / or The tkr-1 gene is a gene encoding a protein comprising the amino acid sequence Y1 shown in SEQ ID NO: 7 or an amino acid sequence Y2 having 70% or more identity to the amino acid sequence Y1, and having receptor activity for the nlp-58 peptide. Item 4. A model nematode according to any one of Items 1 to 3.

[0012] Item 5. The model nematode according to any one of Items 1 to 4, which is Caenorhabditis elegans.

[0013] Item 6. The model nematode according to any one of Items 1 to 5, wherein the menopausal symptom is at least one abnormality selected from the group consisting of thermoregulatory function, reproductive function, digestive function, feeding behavior, aging, sleep, metabolism, stress response, and lifespan.

[0014] Item 7. The model nematode according to Item 6, wherein the menopausal symptom is at least one abnormality selected from the group consisting of thermoregulatory function, reproductive function, and digestive function.

[0015] Item 8. A fertilized egg or embryo developed in the model nematode according to any one of Items 1 to 7.

[0016] Item 9. A cell derived from the model nematode according to any one of Items 1 to 7.

[0017] Item 10. A method for screening for a preventive agent, ameliorator, or exacerbating agent for menopausal symptoms, comprising using a test substance with the model nematode according to any one of Items 1 to 7, a fertilized egg or embryo developed in the model nematode, or a cell derived from the model nematode.

[0018] Item 11. (a) A step of contacting a test substance with the model nematode according to any one of Items 1 to 7, a fertilized egg or embryo developed in the model nematode, or a cell derived from the model nematode; (b) evaluating the model nematode, the fertilized egg or embryo, or the cell contacted with the test substance for menopausal symptoms; and (c1) selecting the test substance as an agent for preventing or ameliorating menopausal symptoms when the menopausal symptoms have been cured or alleviated; or (c2) if the phenotype is worsened, selecting the test substance as a substance that causes an exacerbation of menopausal symptoms; Item 11. The screening method according to Item 10, comprising: [Effects of the Invention]

[0019] The present invention can provide a model nematode for menopausal symptoms, temperature regulation, reproduction (fertilized eggs, sperm, or embryos), digestion, excretion, and sleep that occur in the model nematode, or genes and cells derived from the model nematode.Furthermore, the present invention can also provide a screening method for agents for preventing, ameliorating, or exacerbating menopausal symptoms using these. [Brief explanation of the drawings]

[0020] [Figure 1]The gene solution to be microinjected and the injection site for the production of a nematode strain (IK4741 (njEx2134)) overexpressing the nlp-58 gene are shown. [Figure 2] An outline of the thermotaxis behavior assay and a method for calculating the TTX index are shown. [Figure 3] The results of the thermotaxis behavior assay in Example (1) are shown. dhs-4 indicates a dhs-4-deficient strain, nlp-58O / E indicates a strain overexpressing the nlp-58 gene (IK4741 (njEx2134)), tkr-1 indicates a tkr-1 gene-deficient strain, and tkr-1; nlp-58O / E indicates a strain deficient in the tkr-1 gene and overexpressing the nlp-58 gene. [Figure 4] The results of measuring the number of eggs laid in Example (2) are shown below. wt indicates a wild-type strain, tkr-1 indicates a tkr-1 gene-deficient strain, nlp-58O / E indicates a strain overexpressing the nlp-58 gene (IK4741 (njEx2134)), tkr-1; nlp-58O / E indicates a strain deficient in the tkr-1 gene and overexpressing the nlp-58 gene, and nlp-58 indicates a strain deficient in the nlp-58 gene. [Figure 5] The results of measuring the excretion cycle in Example (3) are shown below. wt indicates a wild-type strain, tkr-1 indicates a tkr-1 gene-deficient strain, nlp-58O / E indicates an nlp-58 gene-overexpressing strain (IK4741 (njEx2134)), tkr-1; nlp-58O / E indicates a tkr-1 gene-deficient and nlp-58 gene-overexpressing strain, and nlp-58 indicates an nlp-58 gene-deficient strain. [Figure 6] 1 shows the results of a thermotaxis behavior assay in examining the drug effect of fezolinetant in Example (4). [Figure 7] The results of the thermotaxis assay performed in Example (5) using the wild-type strain, IK4770, and IK4782 to IK4785 strains are shown below. * indicates a significant difference from the wild-type strain N2. * p<0.05, ** p<0.01, ** p<0.0001. # indicates a significant difference from IK4770. # p<0.05, ## p<0.01. DETAILED DESCRIPTION OF THE INVENTION

[0021] 1.Definition In this specification, the expressions "contain" and "comprise" include the concepts of "contain," "comprise," "consist essentially of," and "consist only of."

[0022] "Identity" of amino acid sequences refers to the degree of correspondence between the amino acid sequences of two or more comparable amino acid sequences. Thus, the greater the correspondence between two amino acid sequences, the greater the identity or similarity between those sequences. The level of identity of amino acid sequences can be determined, for example, using the sequence analysis tool FASTA with default parameters. Alternatively, it can be determined using the BLAST algorithm by Karlin and Altschul (Karlin S, Altschul S F. "Methods for assessing the statistical significance of molecular sequence features by using general scoring schemes," Proc. Natl. Acad. Sci. USA. 87:2264-2268 (1990); Karlin S, Altschul S F. "Applications and statistics for multiple high-scoring segments in molecular sequences," Proc. Natl. Acad. Sci. USA. 90:5873-7 (1993)). A program called BLASTX has been developed based on the BLAST algorithm. Specific techniques for these analysis methods are known and can be found on the National Center of Biotechnology Information (NCBI) website (http: / / www.ncbi.nlm.nih.gov / ). The "identity" of nucleotide sequences is also defined in the same manner as above.

[0023] As used herein, "conservative substitution" refers to the substitution of an amino acid residue with an amino acid residue having a similar side chain. For example, substitution between amino acid residues having basic side chains such as lysine, arginine, and histidine constitutes a conservative substitution. Other examples of conservative substitution include substitution between amino acid residues having acidic side chains such as aspartic acid and glutamic acid; amino acid residues having uncharged polar side chains such as glycine, asparagine, glutamine, serine, threonine, tyrosine, and cysteine; amino acid residues having nonpolar side chains such as alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, and tryptophan; amino acid residues having β-branched side chains such as threonine, valine, and isoleucine; and amino acid residues having aromatic side chains such as tyrosine, phenylalanine, tryptophan, and histidine.

[0024] 2. Model C. elegans and Cells In one aspect, the present invention relates to a model nematode of menopausal symptoms (sometimes referred to herein as the "model nematode of the present invention") that satisfies at least one of the following conditions: enhanced expression of the nlp-58 gene; having a mutation that reduces the function and / or expression of the nlp-58 gene; enhanced expression of the tkr-1 gene; and having a mutation that reduces the function and / or expression of the tkr-1 gene. This is described below.

[0025] The nematode is not particularly limited as long as it is an animal belonging to the phylum Nematoda. From the viewpoint of ease of handling as a model animal, the nematode preferably has an adult body length of, for example, 30 mm or less, preferably 20 mm or less, more preferably 10 mm or less, even more preferably 5 mm or less, and even more preferably 2 mm or less, and is preferably 0.1 mm or more, 0.2 mm or more, or 0.5 mm or more. As the nematode, a nematode belonging to the order Rhabditida is preferred, a nematode belonging to the family Rhabditidae is more preferred, a nematode belonging to the genus Caenorhabditis is even more preferred, and Caenorhabditis elegans (C. elegans) is particularly preferred.

[0026] The nlp-58 gene encodes a protein containing a peptide sequence that exhibits agonistic activity against the G protein-coupled receptor tkr-1 protein. The nucleotide and amino acid sequences of nlp-58 genes in various nematodes are publicly known or can be easily determined based on the nucleotide and amino acid sequences of known nlp-58 genes (e.g., by identity analysis). For example, the amino acid sequence encoded by the nlp-58 gene of C. elegans is shown in SEQ ID NO: 1, and the nucleotide sequence encoding this amino acid sequence is shown in SEQ ID NO: 5. Furthermore, the amino acid sequence encoded by the nlp-58 gene includes a peptide sequence (nlp-58 peptide) that exhibits agonistic activity against the tkr-1 protein, and the gene encoding this peptide is also included in the nlp-58 gene. Examples of such peptide sequences in C. elegans include the amino acid sequences shown in SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4.

[0027] The tkr-1 gene is a G protein-coupled receptor that encodes a protein with receptor activity for the NLP-58 peptide. The nucleotide and amino acid sequences of the tkr-1 gene in various nematodes are publicly known or can be easily determined based on the nucleotide and amino acid sequences of known tkr-1 genes (e.g., by identity analysis). For example, the amino acid sequence encoded by the tkr-1 gene of C. elegans is shown in SEQ ID NO: 7, and the nucleotide sequence encoding this amino acid sequence is shown in SEQ ID NO: 8.

[0028] The nlp-58 gene / tkr-1 gene also includes functionally normal mutants that may occur in nature. The nlp-58 gene / tkr-1 gene of interest in the present invention may have base mutations such as substitutions, deletions, additions, and insertions, as long as the activity of the encoded protein / peptide is not significantly impaired. Preferred gene mutations are those that do not result in amino acid substitutions in the protein encoded by the gene or those that result in conservative amino acid substitutions.

[0029] The nlp-58 gene / tkr-1 gene includes, for example, genes whose encoded protein amino acid sequences share, for example, 95% or more, preferably 98% or more, and more preferably 99% or more identity with the amino acid sequence of the protein encoded by the wild-type nlp-58 gene / tkr-1 gene of the same animal species. The nlp-58 gene / tkr-1 gene also includes, for example, genes whose encoded protein amino acid sequences are identical to the amino acid sequence of the protein encoded by the wild-type nlp-58 gene / tkr-1 gene of the same animal species, or genes whose encoded protein ...

[0030] The nlp-58 gene is preferably (a) a gene encoding a protein comprising an amino acid sequence X1 shown in SEQ ID NO: 1 or an amino acid sequence X2 having 70% or more (preferably 80% or more, more preferably 85% or more, even more preferably 90% or more, still more preferably 95% or more, particularly preferably 99% or more) identity to the amino acid sequence X1, the protein comprising a peptide sequence having agonistic activity against the tkr-1 protein; or (b) a gene encoding an amino acid sequence xa1 shown in SEQ ID NO: 2, an amino acid sequence xb1 shown in SEQ ID NO: 3, an amino acid sequence xc1 shown in SEQ ID NO: 4, or a peptide comprising an amino acid sequence xabc2 in which one or more (preferably 1 to 5, more preferably 1 to 3, even more preferably 1 to 2, particularly preferably 1) amino acids have been mutated from the amino acid sequence xa1, the amino acid sequence xb1, or the amino acid sequence xc1 and in which the C-terminal three residues are GLR in single-letter abbreviation; is.

[0031] The tkr-1 gene is preferably A gene encoding a protein comprising the amino acid sequence Y1 shown in SEQ ID NO: 7 or an amino acid sequence Y2 having 70% or more (preferably 80% or more, more preferably 85% or more, even more preferably 90% or more, still more preferably 95% or more, particularly preferably 99% or more) identity to the amino acid sequence Y1, wherein the protein has receptor activity for the nlp-58 peptide (preferably the peptide (b) above). is.

[0032] Agonistic activity against the tkr-1 protein can be evaluated using the calcium ion concentration that flows into cells expressing wild-type tkr-1 protein in the presence of a test peptide as an indicator. That is, if the intracellular calcium ion concentration of the cells in the presence of the test peptide is higher than the intracellular calcium ion concentration of the cells in the absence of the test peptide, the test peptide can be determined to have agonistic activity against the tkr-1 protein. Specifically, this can be measured according to the method described in Non-Patent Document 1.

[0033] Receptor activity for NLP-58 peptide can be evaluated using the calcium ion concentration that flows into cells expressing the test protein in the presence of NLP-58 peptide as an indicator. That is, if the intracellular calcium ion concentration of the cells in the presence of NLP-58 peptide is higher than the intracellular calcium ion concentration of the cells in the absence of NLP-58 peptide, the test protein can be determined to have receptor activity for NLP-58 peptide. Specifically, measurement can be performed according to the method described in Non-Patent Document 1.

[0034] Enhanced expression of the nlp-58 gene / tkr-1 gene refers to, but is not limited to, an increase in the expression level of the nlp-58 gene / tkr-1 gene compared to the wild-type strain (e.g., an increase in the expression level of the protein / peptide / mRNA that is at least 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, or 100-fold that of the wild-type strain). Specifically, enhanced expression of the nlp-58 gene / tkr-1 gene refers to the presence of an exogenous polynucleotide containing the nlp-58 gene / tkr-1 gene coding sequence.

[0035] The term "exogenous" means that the base sequence is different from that encoded in the genome of the nematode and has been introduced into the nematode from outside.

[0036] The exogenous polynucleotide is not particularly limited as long as it is capable of expressing the nlp-58 gene / tkr-1 gene. For example, it can be a polynucleotide (e.g., DNA) comprising a promoter and a coding sequence for the nlp-58 gene / tkr-1 gene, or an mRNA comprising a coding sequence for the nlp-58 gene / tkr-1 gene.

[0037] The promoter is not particularly limited, and may be the promoter of the nlp-58 gene / tkr-1 gene, or may be another promoter.

[0038] As a promoter for the nlp-58 gene, for example, a promoter consisting of the base sequence shown in SEQ ID NO: 6, or a base sequence that has 70% or more identity to the base sequence (preferably 80% or more, more preferably 85% or more, even more preferably 90% or more, even more preferably 95% or more, and particularly preferably 99% or more) and has transcriptional activity can be used.

[0039] As a promoter for the tkr-1 gene, for example, a promoter consisting of the base sequence shown in SEQ ID NO: 9, or a base sequence that has 70% or more identity to the base sequence (preferably 80% or more, more preferably 85% or more, even more preferably 90% or more, even more preferably 95% or more, and particularly preferably 99% or more) and has transcriptional activity can be used.

[0040] Other promoters include, for example, promoters capable of inducing expression in a tissue-specific manner. Examples of such promoters include the unc-104 promoter, which induces expression in all neural cells, the intestinal ges-1 promoter, the unc-47 promoter in excretory cells, and the muscle myo-3 promoter. In addition to these, constitutive expression promoters such as the CMV promoter, EF1 promoter, SV40 promoter, MSCV promoter, hTERT promoter, β-actin promoter, and CAG promoter can also be used. Various drug-inducible promoters and tissue-specific (e.g., bone tissue-specific) inducible promoters can also be used.

[0041] The exogenous polynucleotide may be integrated into the genome, or may be a molecule separate from the genome.

[0042] Having a mutation that reduces the function and / or expression of the nlp-58 gene / tkr-1 gene means that a mutation has been introduced into the nlp-58 gene / tkr-1 gene so that the function and / or expression of the nlp-58 gene / tkr-1 gene is lost or reduced. "Function" refers to having the above-mentioned activity. "Expression" encompasses both expression of nlp-58 / tkr-1 mRNA and expression of nlp-58 / tkr-1 protein, but preferably refers to expression of nlp-58 / tkr-1 protein. "Deficient" refers to the activity of nlp-58 / tkr-1 protein and / or the expression level of nlp-58 / tkr-1 gene being below the detection limit in a sample obtained from the model nematode of the present invention. Furthermore, "decreased" means that in a sample obtained from a model nematode of the present invention, the activity of the nlp-58 / tkr-1 protein and / or the expression level of the nlp-58 / tkr-1 gene are lower than the activity of the nlp-58 / tkr-1 protein and / or the expression level of the nlp-58 / tkr-1 gene before the mutation was introduced (e.g., 1 / 2, 1 / 5, 1 / 10, 1 / 20, 1 / 50, 1 / 100, 1 / 200, 1 / 500, 1 / 1000, 1 / 2000, 1 / 5000, 1 / 10000 or less).

[0043] The mutation introduced into the nlp-58 gene / tkr-1 gene is not particularly limited, as long as it results in a loss or reduction in the function and / or expression of the nlp-58 gene / tkr-1 gene. Examples of such mutations include gene deletion (gene disruption), mutations in protein-coding regions, mutations in splicing regulatory regions, and mutations in expression control regions (e.g., promoters, activators, enhancers, etc.). Examples of mutations in protein-coding regions include frameshift mutations in the human nlp-58 gene / tkr-1 protein. Among these, gene deletion (gene disruption) is preferred. The model nematode of the present invention has a mutation in the nlp-58 gene / tkr-1 gene in only one or both of the paired chromosomes.

[0044] The model nematode of the present invention exhibits menopausal symptoms. Examples of menopausal symptoms include at least one abnormality selected from the group consisting of thermoregulatory function, reproductive function, digestive function, feeding behavior, aging, sleep, metabolism, stress response, and lifespan. The menopausal symptoms are preferably at least one abnormality selected from the group consisting of thermoregulatory function, reproductive function, and digestive function.

[0045] In one aspect, the present invention relates to cells derived from the model nematode of the present invention (cells of the present invention). The cells of the present invention can be obtained by collecting cells from the model nematode of the present invention that satisfy at least one of the following characteristics: enhanced expression of the nlp-58 gene; a mutation that reduces the function and / or expression of the nlp-58 gene; enhanced expression of the tkr-1 gene; and a mutation that reduces the function and / or expression of the tkr-1 gene. The cells of the present invention can be primary cultured cells or can be established cell lines of the primary cultured cells.

[0046] The cells of the present invention can be used as model cells for menopausal symptoms, for example, to analyze the pathology of menopausal symptoms, and to screen for preventive, ameliorating, or exacerbating agents for menopausal symptoms. The cells of the present invention are, for example, neurons, preferably interneurons, particularly preferably cells corresponding to the AIY / RIA cells of C. elegans or other nematodes.

[0047] The model nematodes and cells of the present invention can be prepared according to or in accordance with known methods.

[0048] Expression of the nlp-58 gene / tkr-1 gene can be enhanced, for example, by introducing a polynucleotide containing the nlp-58 gene / tkr-1 gene coding sequence into a nematode or its cells. The method of introduction is not particularly limited, and microinjection can be used, for example. After introduction of the polynucleotide, if necessary, the polynucleotide can be inserted into the genome by irradiation with high-energy rays (ultraviolet rays, radioactive rays, etc.).

[0049] Mutations that reduce the function and / or expression of the nlp-58 / tkr-1 gene can be introduced into C. elegans using target-specific nucleases (e.g., using the CRSPR / Cas system), optionally with donor DNA.

[0050] Fertilized eggs and embryos (for example, frozen embryos) that develop into the model nematode of the present invention, obtained in the course of the above-mentioned production method, are also an aspect of the present invention.

[0051] 3. Applications of Model C. elegans and Cells The model nematode of the present invention, the fertilized eggs and embryos that develop therefrom, and the cells of the present invention can be used for analyzing the pathology of menopausal symptoms / menopausal disorders, developing preventive methods, developing treatment methods, etc.

[0052] In one aspect, the present invention relates to a method for screening for agents for preventing, ameliorating, or aggravating menopausal symptoms, characterized by using a test substance with the model nematode of the present invention, a fertilized egg or embryo developed in the model nematode, or a cell derived from the model nematode.

[0053] More specifically, the screening method includes, for example, steps (a), (b), and (c1) or (c2): (a) contacting a test substance with the model nematode of the present invention, a fertilized egg or embryo developed in the model nematode, or a cell derived from the model nematode; (b) evaluating the model nematode, the fertilized egg or embryo, or the cell contacted with the test substance for menopausal symptoms; and (c1) selecting the test substance as an agent for preventing or ameliorating menopausal symptoms when the menopausal symptoms have been cured or alleviated; or (c2) if the phenotype is worsened, selecting the test substance as a substance that causes an exacerbation of menopausal symptoms; The type of test substance is not particularly limited as long as it can be a candidate for a therapeutic drug, and examples include proteins, peptides, non-peptide compounds (nucleotides, amines, carbohydrates, lipids, etc.), low molecular weight organic compounds, inorganic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, etc.

[0054] The evaluation of menopausal symptoms can be carried out according to or in accordance with known methods, for example, according to or in accordance with Examples (1) to (3) described below.

[0055] The selected test substances are used as candidate therapeutic substances and further analysis is carried out to select useful therapeutic drugs. [Example]

[0056] The present invention will be described in detail below based on examples, but the present invention is not limited to these examples.

[0057] Materials and Methods <Material> 10 mM Fezolinetant in 1 ml DMSO; purchased from MedChemExpress (product number: HY-19632).

[0058] <Nematode strain> C. elegans was reared according to standard methods. The strains of C. elegans were as follows:

[0059] ·IK4741 njEx2134[nlp-58(+), ges-1p::TagRFP] (Extrachromosomal array) ·IK4770 njIs191[nlp-58(+), ges-1p::TagRFP], ·IK4771 njIs192[nlp-58(+), ges-1p::TagRFP], ·IK4772 njIs193[nlp-58(+), ges-1p::TagRFP], ·IK4773 njIs194[nlp-58(+), ges-1p::TagRFP], ·IK4774 njIs195[nlp-58(+), ges-1p::TagRFP], ·IK4782 njEx2143[nlp-58p::nlp-58, ges-1p::TagRFP] ·IK4783 njEx2144[nlp-58p::nlp-58, ges-1p::TagRFP] ·IK4784 njEx2145[ttx-3p::nlp-58, ges-1p::TagRFP] ·IK4785 njEx2146[ttx-3p::nlp-58, ges-1p::TagRFP] *IK4782 (njEx2143) to IK4785 (njEx2136) were strains created using the method described below. *IK4741(njEx2134) was created using the method described below. IK4770-IK4774 are nematode strains in which the nlp-58 genome fragment was inserted into the genomic region of the IK4741(njEx2134) nematode strain by irradiating it with cobalt-60 gamma rays.

[0060] ·IK4763 nlp-58(nj429) *This is a strain in which the exon region of nlp-58 has been deleted using CRISPR-Cas9.

[0061] IK4758 tkr-1(tm1765) *This is a tkr-1 gene-deficient strain. It was purchased from the Caenorhabditis Genetics Center (CGC) and crossed twice with a wild-type strain to more accurately examine the phenotype caused by the gene deficiency of the target gene, tkr-1, resulting in the strain having all mutated regions other than tkr-1 replaced with the wild-type genome.

[0062] ·IK4759 tkr-1 (tm1765); njEx2134[nlp-58(+), ges-1p::TagRFP] ※It is a strain with tkr-1 gene deficiency and overexpression of nlp-58 gene.

[0063] ·FX02418 dhs-4(tm2418) ※It is a dhs-4 gene-deficient strain. It is a strain purchased from the National BioResource Project (NBRP).

[0064] <Generation of C. elegans strains with overexpression of nlp-58 gene> 1. Generation of IK4741(njEx2134) A 7104-bp genomic region containing the coding region (SEQ ID NO: 5) and promoter region (SEQ ID NO: 6) of the C. elegans nlp-58 gene was amplified by PCR reaction and purified using a column (Wizard (registered trademark) SV Gel and PCR Clean-Up System, Promega).

[0065]

Table 1

[0066] The PCR product was loaded onto a 1% agarose gel and electrophoresed to confirm an approximately 7-kb nlp-58 genomic fragment. To overexpress nlp-58 in the wild-type strain N2, a gene solution was prepared by mixing the following DNAs and injected into the gonads of N2 (Figure 1).

[0067] (Gene solution) ·50 ng of 7-kb nlp-58 genomic fragment ·80 ng of ges-1p::TagRFP (injection marker, TagRFP expressed in the intestine).

[0068] After culturing for 4 days at 20°C, we isolated and cultivated a transgenic nematode strain expressing the TagRFP fluorescent protein, and created a nematode strain overexpressing nlp-58 (we determined that expression of TagRFP in the intestine was responsible for nlp-58 expression). We named this nlp-58-overexpressing nematode strain IK4741 (njEx2134).

[0069] 2. Preparation of IK4782 (njEx2143) and IK4783 (njEx2144) The C. elegans nlp-58 gene coding region (SEQ ID NO: 5) and promoter region (SEQ ID NO: 6) were amplified by PCR using primers 1 to 4. The amplified DNA fragments were purified using a column (Wizard® SV Gel and PCR Clean-Up System, Promega). They were then cloned into the pPD95.75 vector. These plasmids were designated pMJ100 and pMJ105. pMJ100 was then digested with AgeI / SpeI restriction enzymes, and the 1171-bp fragment containing the nlp-58 gene coding region was cloned into the corresponding restriction enzyme site of pMJ105. This plasmid was designated pMJ104 pPD95.75-nlp-58p::nlp-58. To overexpress nlp-58 in the wild-type strain N2, a gene solution containing the following DNA was prepared and injected into the gonads of N2 mice (Figure 1).

[0070] (gene solution) ·pMJ104 pPD95.75-nlp-58p::nlp-58 50ng ·ges-1p::TagRFP (injection marker, TagRFP expressed in the intestine) 50ng

[0071] After culturing for 4 days at 20°C, we isolated and cultured transgenic nematode strains expressing the TagRFP fluorescent protein, and generated nematode strains overexpressing nlp-58 (based on the assumption that nlp-58 expression is due to the expression of TagRFP in the intestine). These nlp-58-overexpressing nematode strains were named IK4782 (njEx2143) and IK4783 (njEx2144). These two nematodes exhibit similar genotypes. Primer Amplification of the nlp-58 gene coding region primer1 for 5'-gtaccggtagaaaaaatgatctccaaatgttctgtgatgggtcttc-3' (SEQ ID NO: 10) primer2 rev 5'- ggaattctacgaatgttattgttcctcttgtccatcaaagatacgt-3' (SEQ ID NO: 11) Amplification of the nlp-58 gene promoter region primer3 for 5'- actgcagaaagttgagcgatgagcgga -3' (SEQ ID NO: 12) primer4 rev 5'- gtaccggtgacggcagatgaatggaagaagg-3' (SEQ ID NO: 13).

[0072] 3. Generation of IK4784 (njEx2145) and IK4785 (njEx2146) The ttx-3 promoter region (844 bp), which specifically drives gene expression in the AIY(R / L) interneuron, a component of the thermoneural circuit in C. elegans, was amplified by PCR using primers 5 and 6. The amplified region was digested with SalI and Acc65I restriction enzymes, and the resulting 844-bp DNA fragment was purified using a column (Wizard® SV Gel and PCR Clean-Up System, Promega). This DNA fragment was cloned into pMJ100, which had been similarly digested with the restriction enzymes. This plasmid was designated pMJ114 pPD95.75-ttx-3p::nlp-58. To overexpress nlp-58 in the AIY(R / L) interneuron in wild-type N2, a gene solution containing the following DNA was prepared and injected into the gonads of N2 mice (Figure 1).

[0073] (gene solution) ·pMJ114 pPD95.75-ttx-3p::nlp-58 50ng ·ges-1p::TagRFP (injection marker, TagRFP expressed in the intestine) 50ng

[0074] After culturing for 4 days at 20°C, we isolated and cultured transgenic nematode strains expressing the TagRFP fluorescent protein, and generated nematode strains overexpressing nlp-58 (based on the assumption that nlp-58 expression is due to the expression of TagRFP in the intestine). These nlp-58-overexpressing nematode strains were named IK4784 (njEx2145) and IK4785 (njEx2146). These two nematodes exhibit similar genotypes. Primer Amplification of the nlp-58 gene coding region primer1 for 5'-gtaccggtagaaaaaatgatctccaaatgttctgtgatgggtcttc-3' (SEQ ID NO: 10) primer2 rev 5'- ggaattctacgaatgttattgttcctcttgtccatcaaagatacgt-3' (SEQ ID NO: 11) Amplification of the ttx-3 gene promoter region primer5 for 5'- cgtcgacggatccaagcttttttgaaacg -3' (SEQ ID NO: 14) primer6 rev 5'- cggtaccggatcctttgacaccgaagac -3' (SEQ ID NO: 15). <Thermotaxis behavior assay> Adult nematodes were reared at 23°C for 3 days and then collected into test tubes using NG buffer (3g NaCl, 1ml of 1M CaCl2, 1ml of 1M MgSO4, 25ml of 1M KPO4, pH 6.0 in 1L of H2O). The nematodes were then placed at approximately 20°C on a thermotaxis assay plate (3g NaCl, 25ml of 1M KPO4, pH 6.0, 20g Bacto Agar in 1L of H2O) with a temperature gradient ranging from 17°C to 23°C. After 1 hour, the thermotaxis assay plate was removed, and 8-minute square lines were drawn on the back of the plate. The number of nematodes that landed in each line was counted. The TTX index was calculated to quantify thermotaxis behavior (Figure 2). <Measurement of egg number> Adult worms were reared at 23°C for three days, and their bodies were lysed in a mixed solution of sodium hypochlorite and potassium hydroxide (alkali bleach), and only the eggs were collected. This allowed for the matching of nematode developmental stages. After rearing the eggs at 23°C for two days, larval stage 4 (Larvae4) nematodes were individually transferred to fresh nematode rearing medium (NGM: 3g NaCl, 2.5g Bact Pepton, 20g Agar in 1L H2O). After another day of rearing at 23°C, the nematode stocks were removed. The eggs present in the nematode rearing medium were then counted under a stereomicroscope.

[0075] <Measurement of excretion cycle> Eggs from adult nematodes reared at 23°C for 3 days were collected by bleaching. After rearing at 23°C, the excretion cycles of 2-day (Day 1 adults), 3-day (Day 2 adults), 4-day (Day 3 adults), and 5-day (Day 4 adults) nematodes were measured under a stereomicroscope.

[0076] <Examination of the Effect of Fezolinetant Adult worms reared at 23°C for 3 days were collected into 1.5-ml Eppendorf tubes using M9 buffer (6 g Na2HPO4, 3 g KH2PO4, 5 g NaCl, 1 ml of 1 M MgSO4 in 1 L H2O). After the nematodes had sedimented, the supernatant was discarded and the worms were washed twice with 1 ml of M9 buffer. Next, 0.5 ml of S-basal medium (1 L of S basal (5.8 g NaCl, 1 ml of 5 mg / ml cholesterol, 50 ml 1 M KPO4), 10 ml of 1 M potassium citrate pH 6, 10 ml of trace metals solution, 3 ml of 1 M CaCl2, 3 ml of 1 M MgSO4) was added, and DMSO or fezolinetant was added to concentrations of 0.05 mM, 0.1 mM, and 0.15 mM. Subsequently, the worms were further incubated at 23°C for one day with rotation. The tubes containing the nematodes were left standing for a while. After the nematodes had sedimented, the supernatant was discarded, and the worms were washed with 1 ml of NG buffer before performing the thermotaxis assay.

[0077] Experimental results (1) The ability to process temperature information declines in menopausal model nematodes Thermotaxis behavior was used to assess thermal information processing. C. elegans were reared with food at a specific temperature and then placed on a temperature gradient, exhibiting locomotor behavior toward the rearing temperature. This behavior can be observed within an hour. Thermotaxis was measured using the menopausal model C. elegans strain nlp-58O / E (an nlp-58 overexpression strain) as well as menopausal-related C. elegans strains dhs-4 (an estrogen biosynthesis gene deletion strain), tkr-1 (a tachykinin receptor gene deletion strain), and tkr-1; nlp-58O / E (an nlp-58 overexpression strain). Wild-type strains reared with food at 23°C exhibited locomotor behavior toward the rearing temperature (23°C) on the temperature gradient (Figure 3, wild-type strain). The dhs-4 estrogen biosynthesis gene is involved in thermosensory perception, and its deletion is known to result in abnormal thermotaxis behavior (Nat Neurosci, no. 8, pp. 984-992, Aug. 2011, doi: 10.1038 / nn.2854.). Furthermore, our thermotaxis analysis revealed that both the dhs-4 and nlp-58 O / E strains exhibited abnormal thermotaxis behavior (Figure 3, dhs-4, nlp-58 O / E). However, the abnormal thermotaxis behavior of the nlp-58 O / E strain was restored by deleting the nlp-58 receptor gene tkr-1 (Figure 3, tkr-1; nlp-58 O / E). Furthermore, a strain lacking the tkr-1 gene alone showed no abnormalities in thermotaxis behavior (Fig. 3, tkr-1), suggesting that the NLP-58 / TKR-1 signaling pathway is involved in temperature information processing.

[0078] (2) Reproductive function declines in menopausal model nematodes C. elegans are either male or hermaphrodite, with males producing only sperm. Hermaphrodites, on the other hand, produce sperm and eggs, which self-fertilize within the individual and produce offspring. When reared at 23°C with abundant food, fertilized eggs mature into adults and lay eggs in approximately two and a half days. Using menopausal C. elegans strains, we measured egg production as a method for assessing reproductive function. Fourth-stage larvae (Larvae4) C. elegans hatched from eggs were reared in fresh nematode rearing medium at 23°C for 20 hours, after which the adult C. elegans were removed from the medium. The number of eggs remaining in the medium was then counted under a stereomicroscope. While approximately 100 eggs were observed in the wild-type strain, egg production was reduced in all strains, including the tkr-1-deficient, nlp-58 O / E, and tkr-1; nlp-58 O / E strains (Figure 4). However, the nlp-58-deficient strain (IK4763 strain) did not show any abnormalities in fecundity (Fig. 4), suggesting that the NLP-58 neuropeptide and the TKR-1 receptor are each involved in reproductive function.

[0079] (3) Digestive function declines in menopausal model nematodes The excretion cycle was measured as a method for assessing digestive function. C. elegans consume E. coli as food, digesting it through the peristaltic movement of their intestines, which involves periodic muscle contractions and relaxations, and excreting waste materials through the anus. The excretion cycle can be observed under a stereomicroscope. Here, the excretion cycle was measured for adult worms from day 1 to day 4 after adulthood. Young wild-type worms on day 1 exhibited excretion behavior at approximately 50-second intervals (Figure 5, first white bar from the left for day 1). This excretion cycle lengthened with age (approximately 70 seconds for day 2 worms, approximately 89 seconds for day 3 worms, and approximately 106 seconds for day 4 worms). On the other hand, the excretion cycle of the aged nlp-58 O / E nematode strain was found to be longer than that of the wild-type strain. We also observed increased variability in the excretion cycle between individuals (Figure 5, third white bar from the left for day 3 worms). These defects in the excretory cycle were restored by tkr-1 deletion, whereas the defects were not observed in the nlp-58-deficient strain (IK4763 strain).This suggests that NLP-58 / TKR-1 signaling is involved in digestive function, particularly in the excretory cycle.

[0080] (4) Treatment with fezolinetant, a non-hormonal hot flash medication, improves temperature processing in menopausal nematodes. Fezolinetant (Astellas Pharma) is an antagonist of the human neurokinin B receptor TKR-1 and is the first non-hormonal hot flash treatment recently approved by the FDA. To evaluate its potential use in screening for drugs that improve menopausal symptoms, we examined the effect of fezolinetant on the thermotaxis behavior of C. elegans.

[0081] C. elegans (IK4741), a model of menopause, were cultured at 23°C for 3 days and then treated with fezolinetant at concentrations of 0.05 mM, 0.1 mM, or 0.15 ml, followed by overnight incubation. DMSO-treated IK4741 served as a control. Thermotaxis behavior was examined using these two experimental groups. The control group, aged C. elegans (IK4741), exhibited abnormal thermotaxis behavior (Figure 6, black line). However, treatment with fezolinetant improved the thermotaxis behavior of IK4741 in a concentration-dependent manner (Figure 6, magenta line). These results demonstrate that a human therapeutic agent can intervene in the thermotaxis processing of C. elegans.

[0082] (5) NLP-58 functions in the interneuron AIY, which controls thermobehavior. Previous studies have identified a neural circuit controlling thermotaxis in the nematode C. elegans (M. Ikeda et al. PNAS, 2020; I. Mori and Y. Ohshima, Nature, 1995). The sensory neurons in the AFD (R / L) sense external temperature changes, and temperature information from the AFD is transmitted to the primary interneurons AIY (R / L) (S. Nakano et al. PNAS, 2020; N. Ohnish et al. EMBO, 2011). In this study, we investigated whether abnormal thermotaxis in a climacteric model nematode (C. elegans) is due to overexpression of the NLP-58 neuropeptide in the AIY. NLP-58 peptide production was driven by either the nlp-58 promoter or the ttx-3 promoter. These nematode strains, IK4782–IK4785, showed no behavioral abnormalities under standard conditions. Figure 7 shows the results of a thermotaxis assay using the wild-type strain, IK4770, and IK4782-IK4785 strains. Wild-type nematodes reared at 23°C for 3 days exhibited behavior toward the rearing temperature of 23°C on an agar medium with a temperature gradient from 17°C to 23°C (Figure 7, left). In contrast, a high proportion of nematodes in the menopausal model nematode IK4770 remained at around 21°C to 22°C (Figure 7, right). This phenomenon was also observed in NLP-58 overexpression strains (IK4782, IK4783) using the nlp-58 promoter (Figure 7, second and third from the left). Furthermore, the nematode strains IK4784 and IK4785, which overexpressed NLP-58 specifically in the AIY interneurons, also exhibited abnormal thermotaxis toward the rearing temperature, similar to IK4770, IK4782, and IK4783 (Figure 7, fourth and fifth panels from the left). This suggests that the NLP-58 peptide may cause abnormal processing of temperature information, from thermosensation to behavioral output.

Claims

1. A model nematode for menopausal symptoms that satisfies at least one of the following conditions selected from the group consisting of increased expression of the nlp-58 gene, having a mutation that reduces the function and / or expression of the nlp-58 gene, increased expression of the tkr-1 gene, and having a mutation that reduces the function and / or expression of the tkr-1 gene.

2. The model nematode of claim 1, which satisfies at least one of the following conditions: increased expression of the nlp-58 gene and increased expression of the tkr-1 gene.

3. The enhanced expression of the nlp-58 gene is due to the inclusion of an exogenous polynucleotide containing the nlp-58 gene coding sequence, and / or The enhanced expression of the tkr-1 gene is obtained by including an exogenous polynucleotide containing the tkr-1 gene coding sequence; The model nematode according to claim 2.

4. The nlp-58 gene is (a) a gene encoding a protein comprising an amino acid sequence X1 shown in SEQ ID NO: 1 or an amino acid sequence X2 having 70% or more identity to the amino acid sequence X1, the protein comprising a peptide sequence having agonistic activity against the tkr-1 protein; or (b) a gene encoding a peptide containing the amino acid sequence xa1 shown in SEQ ID NO: 2, the amino acid sequence xb1 shown in SEQ ID NO: 3, the amino acid sequence xc1 shown in SEQ ID NO: 4, or the amino acid sequence xabc2 in which one or more amino acids have been mutated from the amino acid sequence xa1, the amino acid sequence xb1, or the amino acid sequence xc1 and in which the C-terminal three residues are GLR in single-letter abbreviation; is and / or The tkr-1 gene is a gene encoding a protein comprising the amino acid sequence Y1 shown in SEQ ID NO: 7 or an amino acid sequence Y2 having 70% or more identity to the amino acid sequence Y1, and having receptor activity for the nlp-58 peptide. The model nematode of claim 1.

5. The model nematode of claim 1, which is Caenorhabditis elegans.

6. The model nematode according to claim 1, wherein the menopausal symptoms are at least one abnormality selected from the group consisting of thermoregulatory function, reproductive function, digestive function, feeding behavior, aging, sleep, metabolism, stress response, and lifespan.

7. The model nematode according to claim 6, wherein the menopausal symptom is at least one abnormality selected from the group consisting of thermoregulatory function, reproductive function, and digestive function.

8. A fertilized egg or embryo developed in the model nematode according to any one of claims 1 to 7.

9. A cell derived from the model nematode according to any one of claims 1 to 7.

10. A method for screening for a preventive agent, an ameliorator, or a substance that exacerbates menopausal symptoms, characterized by using a test substance with a model nematode according to any one of claims 1 to 7, a fertilized egg or embryo developed in said model nematode, or a cell derived from said model nematode.

11. (a) contacting a test substance with the model nematode according to any one of claims 1 to 7, a fertilized egg or embryo developed in the model nematode, or a cell derived from the model nematode; (b) evaluating the model nematode, the fertilized egg or embryo, or the cell contacted with the test substance for menopausal symptoms; and (c1) selecting the test substance as an agent for preventing or ameliorating menopausal symptoms when the menopausal symptoms have been cured or alleviated; or (c2) if the phenotype is worsened, selecting the test substance as a substance that causes an exacerbation of menopausal symptoms; The screening method according to claim 10, comprising:

Images