Agricultural composition and use thereof

Abstract

To provide a new composition containing a microorganism whose nematicidal activity has been newly found, and to provide its use and the like.SOLUTION: One embodiment of the present invention is a nematicidal composition containing one or more kinds of fungi selected from the group consisting of Blastomonasnatatoria, Methylobacteriumradiotolerans, a fungus of the genus Agromyces, which is Agromycesallii or Agromycesarachidis, and a fungus of the genus Rhizorhabdus, which is Rhizorhabdusitchiii, Rhizorhabdusargentea, Rhizorhabdusphycosphaerae, or Rhizorhabdusdicambivorans, or containing a culture supernatant of the fungi.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to a novel composition exhibiting anti-nematode activity and its use. [Background technology]

[0002] In the agricultural field, soil-dwelling nematodes are considered difficult-to-control pests, causing reduced crop yields and poor quality. Nematode damage primarily progresses in the underground parts of plants, resulting in symptoms such as wilting and dieback in the above-ground parts of plants. Damage to above-ground parts of plants is similar to symptoms seen in other diseases, making it difficult to identify nematode damage and often making appropriate control difficult.

[0003] Nematodes that cause damage in the agricultural field are mainly classified into root-knot nematodes (Meloidogyne spp.), root-lesion nematodes (Pratylenchus spp.), and cyst nematodes (Heterodera spp.). [Prior art documents] [Non-patent literature]

[0004] [Non-Patent Document 1] "Perennial Crops and Nematodes": Plant Protection, Vol. 21, No. 10 (1967) Summary of the Invention [Problem to be solved by the invention]

[0005] Various pesticides have been developed and are on the market to combat nematodes that cause damage in the agricultural sector. Soil fumigation using pesticides is a common method for exterminating nematodes, but this method is accompanied by problems such as the significant damage it causes to the environment, and some pesticides, such as 1,2-dibromoethane, have already been banned.

[0006] In recent years, in the name of sustainable agriculture, there has been a growing trend toward farming with reduced use of chemical pesticides and fertilizers, and research into the use of microorganisms that exhibit anti-nematode activity has become more active.

[0007] However, there are still many cases where specific microorganisms exhibiting anti-nematicidal activity have not yet been identified, and it is difficult to say that the lineup of microorganisms is complete enough to replace chemical pesticides. In other words, there is still much room for improvement in terms of the search for microorganisms exhibiting anti-nematicidal activity.

[0008] One aspect of the present invention has been made in consideration of the above-mentioned problems, and aims to provide a novel composition comprising a microorganism newly discovered to have anti-nematode activity, and uses thereof. [Means for solving the problem]

[0009] The present inventors have conducted extensive research to address the problem of providing a new composition that utilizes microorganisms and exhibits anti-nematode activity. As a result, they have discovered new microorganisms that exhibit significant anti-nematode activity, leading to the invention of the present application. That is, in order to solve the above problem, the present invention provides, for example, the following aspects. 1) An anti-nematode composition comprising one or more bacteria selected from the group consisting of: Blastomonas natatoria; Methylobacterium radiotolerans; Agromyces bacteria such as Agromyces allii or Agromyces arachidis; and Rhizorhabdus bacteria such as Rhizorhabdus wittichii, Rhizorhabdus argentea, Rhizorhabdus phycosphaerae, or Rhizorhabdus dicambivorans, or comprising a culture supernatant of the bacteria. 2) The composition according to 1), which contains at least Blastomonas natatoria or a culture supernatant of said bacterium. 3) The composition according to 1) or 2) above, which contains at least a bacterium of the genus Agromyces, which is Agromyces allii or Agromyces arachidis, or a culture supernatant of said bacterium. 4) The composition according to any one of 1) to 3), which contains at least Methylobacterium radiotolerans or a culture supernatant of said bacterium. 5) The composition according to any one of 1) to 4), which contains at least a bacterium of the genus Rhizorhabdus, which is Rhizorhabdus wittichii, Rhizorhabdus argentea, Rhizorhabdus phycosphaerae, or Rhizorhabdus dicambivorans, or which contains a culture supernatant of the bacterium. 6) An anti-nematode composition comprising: Blastomonas natatoria; and Methylobacterium radiotolerans; and an Agromyces bacterium such as Agromyces allii or Agromyces arachidis; and a Rhizorhabdus bacterium such as Rhizorhabdus wittichii, Rhizorhabdus argentea, Rhizorhabdus phycosphaerae, or Rhizorhabdus dicambivorans. 7) A method for using an anti-nematode composition, comprising the step of applying any of the compositions described above in 1) to 6). More specifically, the method is for preventing, reducing, or ameliorating nematode damage in agricultural crops by applying the anti-nematode composition. [Effects of the Invention]

[0010] According to one aspect of the present invention, it is possible to provide a novel composition comprising a microorganism newly found to have anti-nematode activity, and uses thereof. [Brief explanation of the drawings]

[0011] [Figure 1] FIG. 1 shows the results (colony formation) according to an example of the present invention. [Figure 2] FIG. 1 shows the results (anti-nematode activity) according to an example of the present invention. DETAILED DESCRIPTION OF THE INVENTION

[0012] 1. Anti-nematode Composition (Summary of Anti-Nematode Compositions) An anti-nematode composition according to one embodiment of the present invention (hereinafter sometimes simply referred to as "composition") comprises a specific microorganism that exhibits significant anti-nematode activity, selected from existing microorganisms. Specific microorganisms that exhibit anti-nematode activity will be described later. An anti-nematode composition according to another embodiment of the present invention comprises a secretion (culture supernatant) or extract of a specific microorganism that exhibits anti-nematode activity, as will be described later.

[0013] (Microorganisms (bacteria) contained in the composition) The composition according to one embodiment of the present invention comprises: ·Blastomonas natatoria; ·Methylobacterium radiotolerans; Agromyces species that are Agromyces allii or Agromyces arachidis; and ·Bacteria of the genus Rhizorhabdus, which are Rhizorhabdus wittichii, Rhizorhabdus argentea, Rhizorhabdus phycosphaerae, or Rhizorhabdus dicambivorans; The microorganisms contain one or more bacteria selected from the group consisting of:

[0014] Among these fungi, in terms of exhibiting significant anti-nematode activity, it may be preferable to include at least Blastomonas natatoria or at least the above-mentioned Agromyces fungus, it may be preferable to include at least Blastomonas natatoria, or it may be preferable to include both Blastomonas natatoria and the above-mentioned Agromyces fungus.

[0015] A composition according to another embodiment of the present invention comprises at least Methylobacterium radiotolerans or at least the Rhizorhabdus bacterium. In one example, the composition comprises at least Methylobacterium radiotolerans and Blastomonas natatoria, or at least Methylobacterium radiotolerans and the Agromyces bacterium, or at least Methylobacterium radiotolerans, Blastomonas natatoria, and the Agromyces bacterium. In another example, the composition comprises at least the Rhizorhabdus bacterium and Blastomonas natatoria, or at least the Rhizorhabdus bacterium and the Agromyces bacterium, or at least the Rhizorhabdus bacterium, Blastomonas natatoria, and the Agromyces bacterium.

[0016] A composition according to yet another embodiment of the present invention comprises Blastomonas natatoria; and Methylobacterium radiotolerans; and the above-mentioned Agromyces bacterium; and the above-mentioned Rhizorhabdus bacterium.

[0017] As shown in the Examples, each of the above microorganisms exhibits anti-nematode activity when used alone, and also when used in combination with multiple species (multiple species of bacteria).

[0018] (Anti-nematode effect) The anti-nematic activity exhibited by a composition according to one embodiment of the present invention refers to the activity of suppressing nematode activity, and more specifically includes, for example, the activity of suppressing nematode growth, the activity of reducing parasitism in plants, the activity of reducing other activities, and the nematicidal activity (the activity of killing nematodes). The suppression of nematode activity refers to the suppression of activity compared to the absence of a composition according to one embodiment of the present invention. When focusing on the nematicidal activity, the survival rate of nematodes in the absence of a composition according to one embodiment of the present invention is, for example, 60 or less, 50 or less, 40 or less, 30 or less, 20 or less, or 10 or less, with the survival rate in the absence of a composition according to one embodiment of the present invention being 100.

[0019] In one embodiment of the present invention, nematodes refer to nematodes that cause damage in agricultural fields, and are mainly nematodes classified into root-knot nematodes (Meloidogyne spp.), root-lesion nematodes (Pratylenchus spp.), and cyst nematodes (Heterodera spp.). Examples of root-knot nematodes include Meloidogyne incognita, Meloidogyne nigricans, and Meloidogyne arenariana. Examples of root-lesion nematodes include Meloidogyne nigricans and Meloidogyne nigricans. Examples of cyst nematodes include Meloidogyne gracilis, Meloidogyne glycine, and Meloidogyne clover.

[0020] (Form of composition) The form of the composition according to one embodiment of the present invention is not particularly limited, and may be, for example, a solid form such as pellets, a semi-solid form such as gel, or a liquid form such as an aqueous dispersion or an aqueous solution. The form of the composition is preferably a liquid form such as an aqueous dispersion or an aqueous solution.

[0021] 2. Method for producing an anti-nematode composition The compositions described in the above section [1. Anti-nematode Composition] can be manufactured as agricultural materials containing bacteria according to a method appropriate for the form. For example, in the case of solid forms such as pellets, they can be manufactured by granulating a raw material mixture of pellets containing bacteria and drying it. In the case of semi-solid forms such as gels, for example, bacteria can be mixed into a solution (e.g., agar solution) that gels in the presence of salts or a change in temperature, and then gelling can be performed to produce a form in which the bacteria are encapsulated in the gel. In the case of liquid forms such as aqueous dispersions or aqueous solutions, the dispersions or aqueous solutions can be produced by adding bacteria and other raw materials to water and stirring, etc. Note that during the manufacturing process, the environment, such as temperature, is controlled to prevent the bacteria from being killed.

[0022] The method for obtaining the raw material bacteria is not particularly limited, and may include, for example, purchasing a commercially available product or isolating and culturing from nature. For example, Blastomonas natatoria can be isolated from aquatic environments such as the ocean. Methylobacterium radiotolerans can be isolated from plants or soil. Methylobacterium radiotolerans has been reported as an endophytic bacterium of rice and is known to be present in plants of the Asteraceae family and potato. Bacteria of the genus Agromyces have been reported to be isolated from lichens and soil in fields, for example. Bacteria of the genus Rhizorhabdus have been reported to be isolated from cyanobacteria and soil used for growing vegetables, for example. Furthermore, all of these bacteria are aerobic and can be grown using common aerobic culture methods.

[0023] 3. Method of using the anti-nematode composition The compositions described in the above section [1. Anti-nematode Compositions] are used, for example, as soil improvement materials, plant growth regulators, fungicides, etc., focusing on their anti-nematode activity, but are not limited to these uses. These compositions are used, for example, for the purpose of preventing, reducing, and ameliorating nematode damage to agricultural crops.

[0024] The timing of application of the composition is not particularly limited, and examples thereof include the occurrence of a nematode-related disease, before sowing, during seedling raising, before planting seedlings, after planting seedlings, and any timing during the growth stage of the plant. The method of application of the composition is not particularly limited, and examples thereof include a method of application to the surface of the soil or a soil substitute, or a method of application into the soil or a soil substitute (for example, by plowing into the entire soil before planting seedlings or before sowing; by application into a planting hole for planting seedlings; by digging a hole around the plant and applying).

[0025] In terms of the plants to which the composition is applied, there are no particular limitations as long as they are parasitized by nematodes. Examples of crops to which the composition can be applied include: Solanaceae crops such as tomatoes, eggplants, and chili peppers (including bell peppers); Cucurbitaceae crops such as cucumbers, watermelons, melons, and pumpkins; fruit vegetables including strawberries; leafy vegetables including spinach; root vegetables including carrots, radishes, and burdock; tubers including sweet potatoes, yams, potatoes, and taro; beans including soybeans, adzuki beans, kidney beans, and cowpeas; flowering trees including cyclamen, carnations, and roses; and fruit trees including figs, grapes, peaches, and pears. [Example]

[0026] Example 1: Isolation of useful microorganisms and confirmation of anti-nematode activity An embodiment of the present invention will be described below.

[0027] <Isolation and cultivation of useful microorganisms> The following experiment was conducted to isolate a bacterial strain from one of the culture solutions containing useful microorganisms (hereafter referred to as the stock solution) that has been subcultured and maintained by Sanshin Co., Ltd. It has been confirmed that the stock solution and its water dilution exhibit nematode-killing activity (root-knot nematode-killing activity).

[0028] Isolation of the strain was attempted using the dilution plate method from a 100-fold dilution of the stock solution. The 100-fold dilution of the stock solution was further diluted 10 times with sterile 0.7% saline. 3 , 104 , 10 5 The solution was serially diluted 1:1, and 100 μl of each dilution was applied to a plate containing 100-fold diluted nutrient bouillon agar medium.

[0029] The plates were incubated at 25°C for 7 days, and the number of colonies was counted, with the morphological characteristics of the major colonies noted. Four major colony types were identified (see Figure 1), and strains were isolated and purified from each type. This strain isolation method was used to isolate aerobic bacteria that can be cultured on normal broth agar medium. Figure 1 shows eight colonies formed on one plate, and the colonies numbered 1 through 8 correspond to these colonies. Colonies No. 1 and 2 are relatively large white colonies, colonies No. 3 and 4 are transparent colonies, colonies No. 5 and 6 are pink colonies, and colonies No. 7 and 8 are small white colonies.

[0030] <Identification of useful microorganisms based on 16S rRNA sequences> The constituent bacteria of each of the eight colonies shown in Figure 1 were sampled, and genomic DNA was extracted by heat treatment at 98°C for 3 minutes. The extracted genomic DNA was then heat denatured at 94°C for 3 minutes, followed by 30 cycles of (94°C for 1 minute, 55°C for 1 minute, and 72°C for 1.5 minutes), followed by PCR amplification at 72°C for 7 minutes to obtain an amplified DNA fragment encoding the target sequence of 16S rRNA. The PCR primer sequences used were 27f (AGAGTTTGATCCTGGCTCAG) and 1378r (CGGTGTGTACAAGGCCCGGGAACG). Next, the base sequence of the amplified DNA fragment obtained by PCR amplification was determined, and the base sequence of the amplified DNA fragment obtained by PCR amplification was compared with the base sequence of 16S rRNA of known bacteria using NCBI Blast. The results are shown in Table 1. In this comparative analysis method, a sequence identity of 99% or more can be considered to be the same species. [Table 1]

[0031] <Confirmation of nematode killing ability> Next, the anti-nematicidal (nematicidal) activity of the constituent bacteria of each colony No. 1 to No. 8 was evaluated. Specifically, the constituent bacteria of each colony No. 1 to No. 8 were cultured in nutrient bouillon medium for 2 days, and the culture solution was centrifuged (14,000 rpm x 5 min) to obtain a culture supernatant. Then, 0.1 ml of this culture supernatant and 0.1 ml of a suspension of second-stage larvae of Meloidogyne incognita (containing 20 to 30 individuals) were added to a 96-well plate and immersed for 24 hours. The percentage of live nematodes (%) was evaluated. As controls, experiments using tap water and nutrient bouillon medium instead of the culture supernatant were also conducted. The results are shown in Figure 2. All constituent bacteria exhibited excellent nematicidal activity. Note that the "culture solution" on the horizontal axis in Figure 2 refers to the experiment using nutrient bouillon medium, and 1 to 8 refer to the experiments using the culture supernatants of colonies No. 1 to 8, respectively. [Industrial Applicability]

[0032] The present invention can be widely used in the agricultural field.

Claims

1. An anti-nematode composition comprising one or more bacteria selected from the group consisting of Blastomonas natatoria; Methylobacterium radiotolerans; Agromyces bacteria such as Agromyces allii or Agromyces arachidis; and Rhizorhabdus bacteria such as Rhizorhabdus wittichii, Rhizorhabdus argentea, Rhizorhabdus phycosphaerae, or Rhizorhabdus dicambivorans, or comprising a culture supernatant of the bacteria.

2. The composition according to claim 1, which contains at least Blastomonas natatoria or a culture supernatant of said bacterium.

3. The composition according to claim 1 or 2, which comprises at least a bacterium of the genus Agromyces, which is Agromyces allii or Agromyces arachidis, or a culture supernatant of said bacterium.

4. The composition according to claim 1 or 2, which contains at least Methylobacterium radiotolerans or a culture supernatant of said bacterium.

5. The composition according to claim 1 or 2, which contains at least a fungus of the genus Rhizorhabdus, which is Rhizorhabdus wittichii, Rhizorhabdus argentea, Rhizorhabdus phycosphaerae, or Rhizorhabdus dicambivorans, or contains a culture supernatant of such a fungus.

6. Blastomonas natatoria; and Methylobacterium radiotolerans; and Agromyces sp., which is Agromyces allii or Agromyces arachidis; and Bacteria of the genus Rhizorhabdus, which are Rhizorhabdus wittichii, Rhizorhabdus argentea, Rhizorhabdus phycosphaerae, or Rhizorhabdus dicambivorans; An anti-nematode composition comprising:

Images