Method for bacterial quantification
The method leverages the 16S rRNA gene and SNPs to accurately quantify bacteria, addressing the limitations of current techniques and enhancing therapeutic management.
Patent Information
- Application Number
- JP2025188352
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2020-01-22
- Filing Date
- 2025-11-07
- Publication Date
- 2026-02-18
AI Technical Summary
Current methods for quantifying bacteria in biological samples, particularly in septic patients, are slow, inaccurate, and do not allow for initial pathogen level quantification, leading to ineffective therapeutic decision-making and control measures.
A method based on the high conservation of the 16S rRNA gene among prokaryotes, utilizing single nucleotide polymorphisms (SNPs) to amplify and quantify the bacterial 16S rRNA gene, enabling accurate bacterial quantification through PCR techniques and SNP analysis.
Enables rapid and reliable quantification of bacteria, aiding in prognosis and treatment decisions by providing precise bacterial concentration data.
Smart Images

Figure 2026027396000034 
Figure 2026027396000035 
Figure 2026027396000036
Abstract
Description
[Technical Field]
[0001] The present invention relates generally to methods and agents for quantifying bacteria, particularly in biological samples from subjects. The present invention also features methods for the prognosis and treatment of bacterial infections based on the quantification methods of the invention. [Background technology]
[0002] Rapid and accurate quantification of bacteria in a sample, and more particularly in a biological sample, is highly desirable.
[0003] First, and most importantly, rapid and accurate quantification of bacteria in biological samples taken from, for example, septic patients, can have prognostic value and aid clinicians in therapeutic decision-making.
[0004] Rapid and accurate quantification can also assist in the implementation of effective control measures to manage, control, eradicate and / or eliminate bacteria in contaminated solutions, materials or foods that may otherwise pose a threat to the well-being of the organism or the quality of the solution, material or food production.
[0005] Quantification is the ability to count the actual number of bacteria in each sample. Because bacteria are so small, it was traditionally nearly impossible to count individual cells. To overcome this problem, scientists and clinicians developed two general methods to help quantify a given number of pathogens in a sample. First, the sample of interest (growth medium, blood, urine, serum, etc.) was serially diluted into a plate assay. When the dilution was high enough, it was possible to count the number of individual colonies growing on these plates. Second, because it was impractical to count each individual cell without a sophisticated microscope, each individual colony was called a colony-forming unit (CFU). Since then, it has become standard in microbiology to define the number of cells in the unit CFU.
[0006] The gold standard for quantifying bacteria in samples taken from septic patients involves growing pathogens in specialized blood culture systems. Blood (8–10 ml) is drawn from patients suspected of having sepsis and placed in special growth media to grow pathogens to detectable levels. Once the machine registers growth, the culture is plated onto various growth media for identification. The two growth phases required for this process have a significant impact on how long it takes to identify a pathogen: there is a 12 ± 10 h time to determine the bacteria. Aside from the time required, the problem with this approach is that there is no opportunity to quantify the patient's initial pathogen levels. After the initial growth phase, it is nearly impossible to accurately calculate the amount of bacterial cells per ml of blood. Finally, the number of colonies is counted on the plate to determine CFU, which is highly inaccurate.
[0007] Furthermore, various molecular methods for detecting bacteria in samples taken from septic patients (e.g., those commercially available from T2 Biosystems and AusDiagnostics) only document the presence of pathogens after high levels of amplification and generally do not include specific quantification of the pathogens detected, making any assumptions regarding initial CFU highly inaccurate.
[0008] Therefore, there is a recognized need for a rapid and reliable technique for the accurate quantification of bacteria in a sample. Summary of the Invention
[0009] In various embodiments, the present invention is based in part on the high conservation of the 16S (Svedberg unit) ribosomal RNA (16S rRNA) gene among prokaryotes, including bacteria, and multiple single nucleotide polymorphisms (SNPs) therein that can aid in the identification and quantification of bacteria in a sample based on the bacterial copy number of the 16S rRNA gene in the sample.
[0010] Generally speaking, prokaryotes, including bacteria, contain 16S rRNA, which is a component of the 30S small subunit of the prokaryotic ribosome. 16S rRNA is approximately 1,500 nucleotides in length and is encoded by the 16S rRNA gene (also called 16S rDNA), which is generally part of a cotranscribed operon that also contains the 23S and 5S rRNA genes. The DNA sequence of the 16S rRNA gene (and therefore the RNA sequence of the 16S rRNA molecule) is highly conserved among prokaryotes, but there are regions of variation (Weisberg WG, et al., 1991). In the context of the present invention, the gene copy number of the 16S rRNA gene per genome is generally species- or strain-specific and consistent within it, but the copy number of this gene can vary from 1 to 15 or more among bacterial species and strains (Klappenbach JA, et al., 2001). Exemplary bacterial 16S rRNA gene sequences are shown in SEQ ID NOs: 1-15 and 38-47.
[0011] According to a first aspect of the present invention, there is provided a method for determining the amount or concentration of bacteria in a sample, comprising the steps of: (a) amplifying a bacterial target nucleic acid from genetic material obtained from the sample to form an amplification product, the target nucleic acid comprising at least a portion of a bacterial 16S rRNA gene; (b) measuring the amount or concentration of the amplification product; (c) calculating the amount or concentration of the target nucleic acid in the sample by comparing the amount or concentration of the amplification product with its reference level; and (d) quantifying the bacteria by determining the copy number of the bacterial 16S rRNA gene from the amount or concentration of the target nucleic acid in the sample, wherein the copy number is a function of or correlates with the amount of bacteria in the sample. A method is provided which includes:
[0012] Suitably, the bacterial 16S rRNA gene is selected from those set forth in SEQ ID NOs: 1-15 and 38-47, or variant nucleotide sequences thereof having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence homology or identity thereto.
[0013] Suitably, the target nucleic acid comprises one or more single nucleotide polymorphisms (SNPs) in the bacterial 16S rRNA gene. In one particular embodiment, the one or more SNPs correspond to at least one of positions 273, 378, 408, 412, 440, 488, 647, 653, 737, 755, 762, and 776 of the 16S rRNA gene as set forth in SEQ ID NO:1.
[0014] In another embodiment, the method of this aspect further comprises generating a reference level from one or more control samples, e.g., by amplifying target nucleic acids from the one or more control samples, wherein the control samples contain genetic material from known amounts or concentrations, such as obtained or derived from bacteria. In certain embodiments, amplifying target nucleic acids from the one or more control samples is performed substantially simultaneously or in parallel with step (a). In other embodiments, the one or more control samples further contain genetic material from one or more additional bacteria.
[0015] In one embodiment, the amplification of target nucleic acids from the genetic material of the sample and / or one or more control samples is carried out with a pair of primers comprising at least one of SEQ ID NOs: 16-37 and 48-51.
[0016] In certain embodiments, amplifying target nucleic acids from the genetic material of the sample and / or one or more control samples comprises the use of quantitative PCR, semi-quantitative PCR, digital PCR, end-point PCR, ligase chain reaction (LCR), Sanger sequencing, next-generation sequencing, or any combination thereof.
[0017] In certain embodiments, the method of this aspect further comprises identifying bacteria in the sample, e.g., by analyzing the amplification product for the presence or absence of at least one SNP, such that bacteria in the sample are identified based on the presence or absence of at least one SNP. By way of example, the at least one SNP can be in or correspond to the 16S rRNA gene set forth in SEQ ID NO: 38. In other embodiments, the at least one SNP is at a position corresponding to at least one of positions 273, 378, 408, 412, 440, 488, 647, 653, 737, 755, 762, and 776 in the 16S rRNA gene set forth in SEQ ID NO: 1. Preferably, bacteria are identified based on the presence of the at least one SNP.
[0018] In certain embodiments, analyzing the amplification products for the presence or absence of at least one SNP comprises the use of high-resolution melting analysis, 5' nuclease digestion, molecular beacons, oligonucleotide ligation, microarrays, restriction fragment length polymorphisms, antibody detection methods, direct sequencing, or any combination thereof.
[0019] Preferably, the copy number is determined using the following formula:
[0020]
number
[0021] In one embodiment, the sample is a biological sample taken from a subject. Preferably, the subject has a bacterial infection, such as sepsis.
[0022] According to a second aspect of the present invention, there is provided a method for determining the prognosis of a bacterial infection in a subject, the method comprising the step of quantifying bacteria in a biological sample from the subject by the method of the first aspect, thereby assessing the prognosis of the infection in the subject.
[0023] Depending on whether the concentration or amount of bacteria in the biological sample is altered, modulated, or relatively high or low in the biological sample, the prognosis may be negative or positive. In this regard, a relatively high amount or concentration or an increase in the amount or concentration of bacteria in the biological sample may indicate a negative prognosis for the subject, while a relatively low amount or concentration or a decrease in the amount or concentration of bacteria in the biological sample may indicate a positive prognosis for the subject.
[0024] In one embodiment, the amount or concentration of bacteria is determined before, during and / or after treatment, such as antibiotic treatment.
[0025] In one embodiment, the prognosis is used, at least in part, to determine whether a subject will benefit from treatment of an infection.
[0026] In one embodiment, the prognosis is used, at least in part, to develop a treatment strategy for the subject.
[0027] In one embodiment, prognosis is used, at least in part, to determine progression or recurrence of disease in a subject.
[0028] According to a third aspect of the present invention there is provided a method of treating a bacterial infection in a subject, comprising: quantitating bacteria in a biological sample from a subject by the method of the first aspect; and and initiating, continuing, modifying, or discontinuing treatment for the infection based on the quantification. A method is provided which includes:
[0029] According to a fourth aspect of the present invention there is provided a method of assessing the effectiveness of a treatment for a bacterial infection in a subject, comprising the steps of: quantitating bacteria in a biological sample from a subject by the method of the first aspect; and determining whether the treatment is effective based on whether said amount of bacteria is reduced or absent in the subject's biological sample. A method is provided which includes:
[0030] With regard to the above embodiment, the subject can have sepsis.
[0031] According to a fifth aspect of the present invention there is provided a kit or assay for quantifying bacteria in a sample, said kit or assay comprising one or more reagents for carrying out a method according to the first, second, third or fourth aspect and instructions for use.
[0032] In one embodiment, the kit or assay includes at least one isolated probe, tool, or reagent capable of identifying, partially identifying, or classifying at least one bacterium in a sample, wherein the probe, tool, or reagent is capable of binding to, detecting, or determining the presence or absence of at least one single nucleotide polymorphism (SNP), such as those described herein, in at least a portion of a bacterial 16S rRNA gene. In certain embodiments, the at least one SNP is at a position corresponding to at least one of positions 273, 378, 408, 412, 440, 488, 647, 653, 737, 755, 762, and 776 of the 16S rRNA gene set forth in SEQ ID NO:1.
[0033] In one embodiment, at least one of said isolated probes, tools or reagents is capable of distinguishing between a sample containing at least one bacterium and a sample not containing at least one bacterium.
[0034] In certain embodiments, the kit or assay is or comprises an array or microarray of oligonucleotide probes for identifying bacteria and optionally one or more additional bacteria in a sample, said probes comprising oligonucleotides that hybridize to at least one SNP in the 16S rRNA gene in the sample as broadly described above.
[0035] In another embodiment, the kit or assay is or comprises a biochip comprising a solid substrate for identifying the bacteria and optionally one or more further bacteria in a sample and at least one oligonucleotide probe, wherein at least one of said probes comprises an oligonucleotide that hybridizes to at least one SNP in the 16S rRNA gene in the sample as broadly described above.
[0036] In particular embodiments of said aspects, the sample or biological sample is or comprises sputum, blood, cerebrospinal fluid and / or urine.
[0037] Features of the first to fifth aspects of the present invention may be as described below, where applicable.
[0038] In one embodiment, the genetic material containing the target nucleic acid is extracted or obtained from the sample prior to analysis in the methods of the present invention. It is contemplated that the nucleic acid may be extracted or obtained from the sample by any method or means known in the art.
[0039] Those skilled in the art will understand that amplifying the bacterial target nucleic acid can be performed by any method known in the art, including, but not limited to, quantitative PCR, semi-quantitative PCR, digital PCR, end-point PCR, ligase chain reaction (LCR), Sanger sequencing, next-generation sequencing, or any combination thereof, using one or more oligonucleotides / primers that amplify the target nucleic acid.
[0040] When a specific target nucleic acid is amplified by one of the above methods and reaches a detectable amount with a detectable signal, such as a fluorescent signal, a sudden increase in signal intensity is observed. The cycle number at this point is called the threshold cycle (hereinafter referred to as Ct value). In PCR, DNA generally doubles with each cycle, and DNA is amplified exponentially. As the initial amount of amplification product of the target nucleic acid contained in the sample increases, it takes fewer cycles to reach the amount of signal, such as fluorescence from the bound label, that can be detected, and therefore the Ct value decreases.
[0041] Roughly speaking, there is a linear relationship between Ct value and the common logarithm of the initial amount of target nucleic acid, and a reference level that defines a calibration curve can be created based on this.In other words, by measuring the Ct value of a plurality of control samples with different DNA concentrations of target nucleic acid by this amplification method, and for example, by plotting Ct value on the vertical axis and the initial DNA amount before the start of PCR on the horizontal axis, one or more reference levels can be created.This calibration curve represents the relationship between the amount or concentration of target nucleic acid in sample and Ct value, and the amount of DNA contained in sample can then be easily determined from this relationship.
[0042] It is understood that the copy number of the 16S rRNA gene can be determined or quantified by any method or algorithm known in the art, such as the dsDNA copy number calculator at https: / / cels.uri.edu / gsc / cndna.html. In this regard, the copy number calculator utilizes the following algorithm:
[0043]
number
[0044] Preferably, quantifying bacteria further comprises dividing the bacterial 16S rRNA gene copy number in the sample determined in step (d) by the bacterial 16S rRNA gene copy number in the bacteria. For example, a bacterial 16S rRNA gene copy number of at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or any range therein, can be used depending on the bacterium in question. To this end, the bacterial 16S rRNA gene copy number of a specific bacterium, such as those identified by the above-described method, can be found in the Ribosomal RNA Operon Copy Number Database (rrndb: https: / / rrndb.umms.med.umich.edu / ). In other embodiments, the gene copy number utilized can be the average or median gene copy number across several species, variants, and / or strains of bacteria. Exemplary gene copy numbers of 16S rRNA genes for a range of bacterial species are provided in Tables 1 and 15 below.
[0045] [Table 1]
[0046] Preferably, the method of the above embodiment can include a further step of identifying the bacteria. It is assumed that the bacteria can be identified by any means known in the art. Such an identification step can be further performed before, after, or simultaneously with one or more of the steps of the method for quantifying the bacteria. Preferably, the step of identifying the bacteria includes analyzing the amplification product for the presence or absence of at least one SNP, for example, the SNP described herein.
[0047] In one embodiment, the one or more SNPs in at least a portion of a bacterial 16S rRNA gene are selected from SNPs at positions corresponding to positions 273, 378, 408, 412, 440, 488, 647, and 653 of the 16S rRNA gene set forth in SEQ ID NO: 1. In some embodiments, multiple SNPs can be used in the methods of the invention. For example, at least two SNPs, at least three SNPs, at least four SNPs, at least five SNPs, at least six SNPs, or even at least seven SNPs can be used.
[0048] In another embodiment, the one or more SNPs in at least a portion of a bacterial 16S rRNA gene may be in or correspond to the 16S rRNA gene set forth in SEQ ID NO: 38. The one or more SNPs in at least a portion of a bacterial 16S rRNA gene set forth in SEQ ID NO: 38 may be at a position corresponding to at least one of positions 746, 764, 771, or 785 of the 16S rRNA gene set forth in SEQ ID NO: 38 (or positions 737, 755, 762, or 776 of the 16S rRNA gene set forth in SEQ ID NO: 1). At least one of the SNPs, at least two of the SNPs, at least three of the SNPs, or at least four of the SNPs may be used.
[0049] Thus, in some embodiments, the method comprises: extracting at least a portion of a bacterial 16S rRNA gene or gene product from a sample; single nucleotide polymorphisms in a bacterial 16S rRNA gene at positions corresponding to positions 273, 378, 408, 412, 440, 488, 647, and 653 of the 16S rRNA gene set forth in SEQ ID NO:1; or Single nucleotide polymorphisms in the bacterial 16S rRNA gene at positions corresponding to positions 746, 764, 771, and 785 of the 16S rRNA gene set forth in SEQ ID NO: 38 This includes analyzing for the presence or absence of
[0050] In a further embodiment, the method comprises: extracting at least a portion of a bacterial 16S rRNA gene or gene product from a sample; Single nucleotide polymorphisms at positions corresponding to at least four of positions 273, 378, 408, 412, 440, 488, 647, 653, 737, 755, 762, and 776 of the 16S rRNA gene set forth in SEQ ID NO:1, within at least a portion of a bacterial 16S rRNA gene or gene product. This includes analyzing for the presence or absence of
[0051] In some embodiments, the one or more bacteria are selected from among mammal- (e.g., human-) associated bacteria, soil-associated bacteria, and water-associated bacteria. In certain embodiments, the one or more bacteria may be one or more sepsis-associated bacteria.
[0052] In one embodiment, the bacterium or bacteria is or is selected from a gram-negative bacterium or a plurality of gram-negative bacteria. In one embodiment, the bacterium or bacteria is or is selected from a gram-positive bacterium or a plurality of gram-positive bacteria. In one embodiment, the bacterium or bacteria is or is selected from the phylum firmicutes. In one embodiment, the bacterium or bacteria is or is selected from the phylum actinobacteria. In one embodiment, the bacterium or bacteria is or is selected from the phylum proteobacteria.
[0053] In certain embodiments, the bacterium or bacteria is or is selected from at least one of the following: Acinetobacter species; Actinobaccillus species; Actinomadura species; Actinomyces species; Actinoplanes species; Aerococcus species; Aeromonas species; Agrobacterium species; Alistipes species; Anaerococcus species; Arthrobacter species; Bacillus species; Bacteroides Genus species;Brucella species;Bulleidia species;Burkholderia species;Cardiobacterium species;Cedecea species;Citrobacter species;Clostridium species;Cornyebacterium species;Cronobacter species;Dermatophilus species;Dorea species;Enterobacter species;Enterococcus species;Erysipelothrix species;Escherichia species;Eubacterium species;Ewar dsiella spp.;Faecalibacterium spp.;Filifactor spp.;Finegoldia spp.;Flavobacterium spp.;Francisella spp.;Gallicola spp.;Haemophilus spp.;Helococcus spp.;Holdemania spp.;Hyphomicrobium spp.;Klebsiella spp.;Lactobacillus spp.;Legionella spp.;Listeria spp.;Methylobacterium spp.;Micro Coccus species; Micromonospora species; Mobiluncus species; Moraxella species; Morganella species; Mycobacterium species; Neisseria species; Nocardia species; Paenibacillus species; Parabacteroides species; Pasteurella species; Peptoniphilus species; Peptostreptococcus species; Planococcus species; Planomicrobium species; Plesiomonas species;Porphyromonas spp.; Prevotella spp.; Propionibacterium spp.; Proteus spp.; Providentia spp.; Pseudomonas spp.; Ralstonia spp.; Rhodococcus spp.; Roseburia spp.; Ruminococcus spp.; Salmonella spp.; Sedimentibacter spp.; Serratia spp.; Shigella spp.; Shewanella spp.; Solobacterium spp.; Sphingomonas spp.; Staphylococcus spp.; Stenotrophomonas spp.; Streptococcus spp.; Streptomyces spp.; Tissierella spp.; Vibrio spp.; and Yersinia spp.
[0054] In some specific embodiments, bacteria or multiple bacteria can be selected from the following: Acinetobacter baumannii; Acinetobacter calcoaceticus; Aerococcus viridans; Bacteroides fragilis; Bacteroides vulgatus; Cedecea lapagei; Citrobacter freundii; Cronobacter dublinensis; Enterobacter aerogenes; Enterobacter cloacae; feces; Escherichia coli; Haemophilus influenzae; Klebsiella oxytoca; Klebsiella pneumoniae; Morganella morganii; Proteus mirabilis; Pseudomonas aeruginosa; Serratia marcescens; Shewanella putrefaciens; Staphylococcus aureus; Staphylococcus epidermidis; Staphylococcus hominis; Staphylococcus saprophyticus; Stenotrophomonas maltophilia; Streptococcus agalactiae; Streptococcus anginosus; Streptococcus constellatus; Streptococcus intermedius; Streptococcus milleri; Streptococcus mild; Streptococcus mutans; Streptococcus oralis; Streptococcus pneumoniae; Streptococcus pyogenes; Streptococcus sanguinis; and Streptococcus sobrinus。
[0055] In certain embodiments, the one or more bacteria are selected from at least one of the following: Acinetobacter calcoaceticus; Enterobacter aerogenes; Enterobacter cloacae; Enterococcus faecalis; Enterococcus faecium; Escherichia coli; Klebsiella pneumoniae; Proteus mirabilis; Pseudomonas aeruginosa; Serratia marcescens; Staphylococcus aureus; Staphylococcus epidermidis; Streptococcus agalactiae; Streptococcus pneumoniae; and Streptococcus pyogenes.
[0056] In certain embodiments, the one or more bacteria are selected from at least one of the following: Acinetobacter calcoaceticus; Enterobacter aerogenes; Enterobacter cloacae; Enterococcus faecalis; Enterococcus faecium; Escherichia coli; Klebsiella pneumoniae; Proteus mirabilis; Pseudomonas aeruginosa; Serratia marcescens; Staphylococcus aureus; Staphylococcus epidermidis; Streptococcus agalactiae; Streptococcus pneumoniae; Streptococcus pyogenes; Listeria monocytogenes; Clostridium perfringens; Corynebacterium jeikeium; Bacteroides fragilis; Neisseria meningitides; Haemophilus influenzae; Salmonella sp.; and Staphylococcus epidermidis.In another embodiment, the one or more bacteria are selected from among at least one of the following: Acinetobacter calcoaceticus; Enterobacter aerogenes; Enterobacter cloacae; Enterococcus faecalis; Enterococcus faecium; Escherichia coli; Klebsiella pneumoniae; Proteus mirabilis; Pseudomonas aeruginosa; Serratia marcescens; Staphylococcus aureus; Staphylococcus epidermidis; Streptococcus agalactiae; Streptococcus pneumoniae; Streptococcus pyogenes; Listeria monocytogenes; Clostridium perfringens; Corynebacterium jeikeium; Bacteroides fragilis; Neisseria meningitides; Haemophilus influenzae; Salmonella sp.; Staphylococcus epidermidis; Bacillus anthracis, Clostridium botulinum, Yersinia pestis, Francisella tularensis, Vibrio cholerae and Burkholderia pseudomallei.
[0057] In one embodiment, the one or more bacteria are security-sensitive biological agents (SSBAs). The SSBAs may be Tier 1 or Tier 2 agents. Exemplary Tier 1 agents include one or more of the following: Bacillus anthracis (anthrax) and Yesinia pestis (plague). Exemplary Tier 2 agents include one or more of the following: Clostridium botulinum (botulism, particularly toxin-producing strains); Francisella tularensis (tularemia); Salmonella Typhi (typhoid fever), and Vibrio cholerae (particularly cholera serotypes O1 or O139). In one embodiment, the one or more bacteria are selected from at least one of the group consisting of Bacillus anthracis, Clostridium botulinum, Yersinia pestis, Francisella tularensis, Vibrio cholerae, and Burkholderia pseudomallei.
[0058] In one embodiment, the bacterium is a human pathogen.
[0059] In some embodiments, the methods of the present invention can be used to analyze blood from a subject with systemic inflammatory response syndrome (SIRS) to determine the cause (e.g., bacteria) of the SIRS. In other embodiments, the methods of the present invention can be used to determine whether a subject has sepsis with a microbial infection source. In both embodiments, the methods of the present invention can be used to determine the presence, differentiation, and / or identification of microorganisms, such as bacteria, present in a sample.
[0060] SIRS is an overwhelming systemic response that can have an infectious or non-infectious etiology (i.e., infection-negative SIRS or inSIRS). Sepsis is SIRS that occurs during infection. Sepsis in this case is diagnosed by clinicians (when infection is suspected) or through organism culture. SIRS and sepsis are defined by several nonspecific host response parameters, including changes in cardiac and respiratory rate, body temperature, and white blood cell count (Levy et al., 2003; Reinhart et al., 2012).
[0061] In some embodiments, at least one SNP or at least one probe, tool, or reagent can be used to classify bacteria in a sample as one or more Gram-positive bacteria or one or more Gram-negative bacteria.
[0062] For example, in some embodiments, bacteria can be classified as Gram-positive bacteria based on any one of the above SNPs, particularly at least one of positions 273, 378, 408, 412, 440, 488, 647, and 653 of the 16S rRNA gene as set forth in SEQ ID NO: 1. In one such embodiment, bacteria can be classified based on SNPs at positions corresponding to positions 273 and 653 of the 16S rRNA gene as set forth in SEQ ID NO: 1, where an A at position 273 and a T at position 653 determine the bacteria to be Gram-positive.
[0063] For example, in another embodiment, bacteria can be classified as Gram-positive based on at least one SNP at a position corresponding to position 440 of the 16S rRNA gene set forth in SEQ ID NO: 1, where a T at position 440 determines the bacteria as Gram-positive. Conversely, an absence of a T at position 440 determines the bacteria as Gram-negative.
[0064] In yet other embodiments, the at least one SNP or at least one probe, tool or reagent can be used to classify groups of microorganisms, particularly bacteria, in a sample.
[0065] For example, in some embodiments, bacteria can be classified as belonging to a particular genus based on at least one SNP selected from those listed above. In one such embodiment, bacteria can be classified as belonging to a particular genus based on at least one SNP selected from SNPs at positions corresponding to positions 412 and 647 of the 16S rRNA gene set forth in SEQ ID NO: 1. For example, one or more bacteria in a sample can be classified as belonging to the genus Staphylococcus when there is a T at position 412. For example, one or more bacteria in a sample can be classified as belonging to the genus Enterococcus when there is a G at position 647.
[0066] In yet other embodiments, the at least one SNP or at least one probe, tool or reagent can be used to identify bacteria in a sample as described above.
[0067] For example, the bacterium Enterobacter cloacae can be identified in a sample based on at least one SNP at a position corresponding to position 653 of the 16S rRNA gene set forth in SEQ ID NO: 1, where a G at position 653 identifies the bacterium Enterobacter cloacae.
[0068] For example, bacteria selected from Streptococcus pneumoniae, Streptococcus agalactiae, and Streptococcus pyogenes can be identified in a sample based on SNPs at positions corresponding to positions 378 and 488 of the 16S rRNA gene as set forth in SEQ ID NO: 1, where the bacteria are: Streptococcus pneumoniae when there is an A at position 378 and a T at position 488; Streptococcus agalactiae when there is an A at position 378 and an A at position 488; and Streptococcus pyogenes when there is a G at position 378 and an A at position 488.
[0069] For example, in one embodiment, bacteria selected from among Acinetobacter calcoaceticus; Enterobacter cloacae; Escherichia coli; Klebsiella pneumoniae; Proteus mirabilis; Pseudomonas aeruginosa; Streptococcus agalactiae; Streptococcus pneumoniae, and Streptococcus pyogenes can be identified in a sample based on SNPs at positions corresponding to 273, 378, 408, 412, 440, 488, 647, and 653 of the 16S rRNA gene as set forth in SEQ ID NO: 1, wherein the bacteria are: Acinetobacter calcoaceticus when there is an A at positions 273, 440, and 647; Enterobacter cloacae when there is a G at position 653; and Escherichia coli when there is a T at position 273 and a T at position 653. coli when there is a T at position 273, Cs at positions 488 and 647, and A at position 653; Proteus mirabilis when there is a C at positions 440 and 488 and a T at position 647; Pseudomonas aeruginosa when there is an A at position 440 and a T at position 647; Streptococcus agalactiae when there is an A at positions 378, 488, and 647; Streptococcus pneumoniae when there is a T at positions 488 and 647; and Streptococcus pyogenes when there is a G at position 378 and an A at positions 488 and 647.
[0070] For example, in another embodiment, bacteria selected from among Acinetobacter calcoaceticus; Enterobacter cloacae; Escherichia coli; Klebsiella pneumoniae; Proteus mirabilis; Pseudomonas aeruginosa; Streptococcus agalactiae; Streptococcus pneumoniae, and Streptococcus pyogenes can be identified in a sample based on the presence of the SNPs shown in Table 2:
[0071] [Table 2]
[0072] For example, in another embodiment, bacteria selected from among Escherichia coli, Streptococcus pneumoniae, Streptococcus agalactiae, Streptococcus pyogenes, Proteus mirabilis, Enterobacter cloacae, Klebsiella pneumoniae, Pseudomonas aeruginosa, Acinetobacter calcoaceticus, Enterococcus faecalis, Listeria monocytogenes, Staphylococcus aureus, Clostridium perfringens, Corynebacterium jeikeium, Bacteroides fragilis, Neisseria meningitidis, Haemophilus influenzae, Serratia marcescens, Salmonella sp., and Staphylococcus epidermidis can be identified in a sample based on the presence of the SNPs shown in Table 3:
[0073] In another embodiment, a bacterium selected from among Bacillus anthracis, Clostridium botulinum type A, Clostridium botulinum type B, Clostridium botulinum type C, Clostridium botulinum type D, Clostridium botulinum type G, Yersinia pestis, Francisella tularensis, Vibrio cholerae, and Burkholderia pseudomallei can be identified in a sample based on a SNP at a position corresponding to position 746, 764, 771, or 785 of the 16S rRNA gene as set forth in SEQ ID NO: 38, wherein the bacterium is: Bacillus anthracis when there is a T at position 746, an A at position 764, a C at position 771, and a G at position 785; or Clostridium botulinum type A or Clostridium when there is a T at position 746, a G at position 764, a C at position 771, and a T at position 785. Clostridium botulinum type B when there is a T at position 746, an A at position 764, a T at position 771, and a T at position 785; Clostridium botulinum type C when there is a C at position 746, an A at position 764, a T at position 771, and a T at position 785; Clostridium botulinum type D when there is a C at position 746, a G at position 764, a C at position 771, and a G at position 785; Clostridium botulinum type G when there is a T at position 746, a G at position 764, a T at position 771, and a G at position 785; Yersinia pestis when there is a C at position 746, a G at position 764, a T at position 771, and a G at position 785; Francisella when there is a T at position 746, an A at position 764, a G at position 771, and a G at position 785 tularensis; when there is a C at position 746, an A at position 764, a T at position 771, and a G at position 785, it is Vibrio cholerae; when there is a C at position 746, a G at position 764, a C at position 771, and a G at position 785, it is Burkholderia pseudomallei.
[0074] For example, in another embodiment, bacteria selected from among Bacillus anthracis, Clostridium botulinum type A, Clostridium botulinum type B, Clostridium botulinum type C, Clostridium botulinum type D, Clostridium botulinum type G, Yersinia pestis, Francisella tularensis, Vibrio cholerae, and Burkholderia pseudomallei can be identified in a sample based on the presence of the SNPs shown in Table 4:
[0075] [Table 3]
[0076] [Table 4] The cumulative discrimination index of the four SNPs used to identify the above organisms is 0.667 for 1 SNP; 0.889 for 2 SNPs; 0.944 for 3 SNPs; and 0.972 for 4 SNPs.
[0077] Position 746 of the 16S rRNA gene shown in SEQ ID NO: 38 corresponds to position 737 of the 16S rRNA gene shown in SEQ ID NO: 1. Position 764 of the 16S rRNA gene shown in SEQ ID NO: 38 corresponds to position 755 of the 16S rRNA gene shown in SEQ ID NO: 1. Position 771 of the 16S rRNA gene shown in SEQ ID NO: 38 corresponds to position 762 of the 16S rRNA gene shown in SEQ ID NO: 1. Position 785 of the 16S rRNA gene shown in SEQ ID NO: 38 corresponds to position 776 of the 16S rRNA gene shown in SEQ ID NO: 1.
[0078] Thus, in another embodiment, a bacterium selected from among Bacillus anthracis, Clostridium botulinum type A, Clostridium botulinum type B, Clostridium botulinum type C, Clostridium botulinum type D, Clostridium botulinum type G, Yersinia pestis, Francisella tularensis, Vibrio cholerae and Burkholderia pseudomallei can be identified in a sample based on a SNP at a position corresponding to position 737, 755, 762 or 776 of the 16S rRNA gene as set forth in SEQ ID NO: 1, wherein the bacterium is: Bacillus anthracis when there is a T at position 737, an A at position 755, a C at position 762 and a G at position 776; Clostridium botulinum type B when there is a T at position 737, an A at position 755, a T at position 762, and a T at position 776; Clostridium botulinum type C when there is a C at position 737, an A at position 755, a T at position 762, and a T at position 776; Clostridium botulinum type D when there is a C at position 737, a G at position 755, a C at position 762, and a G at position 776; Clostridium botulinum type G when there is a T at position 737, a G at position 755, a T at position 762, and a G at position 776; Yersinia pestis when there is a C at position 737, a G at position 755, a T at position 762, and a G at position 776; Francisella when there is a T at position 737, an A at position 755, a G at position 762, and a G at position 776 tularensis; when there is a C at position 737, an A at position 755, a T at position 762, and a G at position 776, it is Vibrio cholerae; when there is a C at position 737, a G at position 755, a C at position 762, and a G at position 776, it is Burkholderia pseudomallei.
[0079] Bacteria can be identified or classified in part based on one or more of the above SNPs.
[0080] SNPs can be analyzed by any method known in the art, including, but not limited to, high-resolution melting analysis, 5' nuclease digestion (including 5' nuclease digestion), molecular beacons, oligonucleotide ligation, microarrays, restriction fragment length polymorphisms, antibody detection methods, direct sequencing, or any combination thereof. In one embodiment, the analyzing step in the method comprises determining the presence or absence of at least one SNP using high-resolution melting analysis, 5' nuclease digestion, molecular beacons, oligonucleotide ligation, microarrays, restriction fragment length polymorphisms, antibody detection methods, direct sequencing, or any combination thereof. SNPs can be detected by any method known in the art, including, but not limited to, polymerase chain reaction (PCR), ligase chain reaction (LCR), hybridization analysis, high-resolution melting analysis, nuclease digestion, including 5' nuclease digestion, molecular beacons, oligonucleotide ligation, microarrays, restriction fragment length polymorphisms, antibody detection methods, direct sequencing, or any combination thereof.
[0081] For example, in some embodiments, identifying or classifying bacteria can be further based on DNA melting characteristics of the SNPs and their surrounding DNA sequences as broadly described above, preferably high-resolution melting analysis as described in PCT / AU2018 / 050471, which is incorporated herein by reference.
[0082] For example, in some such embodiments, the methods of the present invention can further include high-resolution melting (HRM) analysis to further analyze the DNA melting properties of the SNPs and their surrounding DNA sequences as broadly described above. In certain embodiments, HRM analysis involves forming a DNA amplification product (i.e., an amplicon) containing at least one of the SNPs and at least one intercalating fluorescent dye, and determining its melting temperature (T m) can involve heating the DNA amplification products through a melting curve. HRM is monitored in real time using a fluorescent dye incorporated into the DNA amplification products. Fluorescence levels are monitored as the temperature increases, as fluorescence decreases as the amount of double-stranded DNA decreases. The changes in fluorescence and temperature can be plotted on a graph known as a melting curve.
[0083] As the skilled recipient will appreciate, the T of a DNA amplification product where the two DNA strands separate m is predictable and depends on the sequence of nucleotide bases that form the DNA amplification product. Therefore, the melting curves appear differently, making it possible to distinguish DNA amplification products, including those containing polymorphisms (i.e., one or more SNPs). In fact, in some embodiments, it is possible to distinguish DNA amplification products containing the same polymorphism based on differences in the surrounding DNA sequence.
[0084] For example, bacteria selected from among Acinetobacter calcoaceticus; Enterobacter aerogenes; Enterobacter cloacae; Enterococcus faecalis; Enterococcus faecium; Escherichia coli; Klebsiella pneumoniae; Proteus mirabilis; Pseudomonas aeruginosa; Serratia marcescens; Staphylococcus aureus; Staphylococcus epidermidis; Streptococcus agalactiae; Streptococcus pneumoniae, and Streptococcus pyogenes can be identified in a sample based on the presence of the SNPs shown in Table 5 and the DNA melting properties of the SNPs and their surrounding DNA sequences:
[0085] [Table 5]
[0086] For example, bacteria selected from among Escherichia coli, Streptococcus pneumoniae, Streptococcus agalactiae, Streptococcus pyogenes, Proteus mirabilis, Enterobacter cloacae, Klebsiella pneumoniae, Pseudomonas aeruginosa, Acinetobacter calcoaceticus, Enterococcus faecalis, Listeria monocytogenes, Staphylococcus aureus, Clostridium perfringens, Corynebacterium jeikeium, Bacteroides fragilis, Neisseria meningitidis, Haemophilus influenzae, Serratia marcescens, Salmonella sp., and Staphylococcus epidermidis can be identified in a sample based on the presence of the SNPs shown in Table 3 and the DNA melting properties of the SNPs and their surrounding DNA sequences.
[0087] In one embodiment, bacteria selected from Acinetobacter calcoaceticus; Enterobacter aerogenes; Enterobacter cloacae; Enterococcus faecalis; Enterococcus faecium; Escherichia coli; Klebsiella pneumoniae; Proteus mirabilis; Pseudomonas aeruginosa; Serratia marcescens; Staphylococcus aureus; Staphylococcus epidermidis; Streptococcus agalactiae; Streptococcus pneumoniae and Streptococcus pyogenes can be identified in a sample based on SNPs at positions corresponding to positions 273, 378, 408, 412, 440, 488, 647 and 653 of the 16S rRNA gene set forth in SEQ ID NO: 1 and high-resolution melting curve analysis of the SNPs and their surrounding DNA.
[0088] For example, bacteria selected from among Acinetobacter calcoaceticus; Enterobacter cloacae; Escherichia coli; Klebsiella pneumoniae; Proteus mirabilis; Pseudomonas aeruginosa; Streptococcus agalactiae; Streptococcus pneumoniae and Streptococcus pyogenes can be identified in a sample based on the above SNP positions and / or high-resolution melting curve analysis of the SNPs and their surrounding DNA.
[0089] In some embodiments, bacteria selected from Staphylococcus aureus; Staphylococcus epidermidis; Enterococcus faecalis; Enterococcus faecium; Serratia marcescens, and Enterobacter aerogenes can be individually identified in a sample based on SNPs at positions corresponding to positions 412, 440, 488, and 647 of the 16S rRNA gene as set forth in SEQ ID NO:1, wherein: Staphylococcus aureus and Staphylococcus epidermidis can be identified when there is a T at position 412 and can then be further distinguished from each other based on high-resolution melting curve analysis of the DNA surrounding the SNP at position 412; Enterococcus faecalis and Enterococcus faecium can be identified when there is a G at position 647 and can then be further distinguished from each other based on high-resolution melting curve analysis of the DNA surrounding the SNP at position 647; Serratia marcescens and Enterobacter aerogenes can be individually identified in a sample based on SNPs at positions corresponding to positions 412, 440, 488, and 647 of the 16S rRNA gene as set forth in SEQ ID NO:1, wherein: Staphylococcus aureus and Staphylococcus epidermidis can be identified when there is a T at position 412 and can then be further distinguished from each other based on high-resolution melting curve analysis of the DNA surrounding the SNP at position 647; aerogenes can be identified when they have a C at positions 440 and 647 and a T at position 488, and can then be further distinguished from each other based on high-resolution melting curve analysis of the DNA surrounding the SNP at any one of positions 440, 488, and 647.
[0090] In other embodiments, a bacterium selected from Enterococcus faecalis; Enterococcus faecium; Streptococcus agalactiae and Streptococcus pyogenes can be identified in a sample based on at least one SNP at a position corresponding to position 378 of the 16S rRNA gene set forth in SEQ ID NO:1 and high-resolution melting curve analysis of the DNA surrounding the SNP at position 378.
[0091] For example, bacteria selected from among Bacillus anthracis, Clostridium botulinum type A, Clostridium botulinum type B, Clostridium botulinum type C, Clostridium botulinum type D, Clostridium botulinum type G, Yersinia pestis, Francisella tularensis, Vibrio cholerae, and Burkholderia pseudomallei can be identified in a sample based on the presence of the SNPs shown in Table 6 and the DNA melting properties of the SNPs and their surrounding DNA sequences:
[0092] [Table 6]
[0093] As described above, position 746 of the 16S rRNA gene shown in SEQ ID NO: 38 corresponds to position 737 of the 16S rRNA gene shown in SEQ ID NO: 1. Position 764 of the 16S rRNA gene shown in SEQ ID NO: 38 corresponds to position 755 of the 16S rRNA gene shown in SEQ ID NO: 1. Position 771 of the 16S rRNA gene shown in SEQ ID NO: 38 corresponds to position 762 of the 16S rRNA gene shown in SEQ ID NO: 1. Position 785 of the 16S rRNA gene shown in SEQ ID NO: 38 corresponds to position 776 of the 16S rRNA gene shown in SEQ ID NO: 1.
[0094] In one embodiment, a bacterium selected from Bacillus anthracis, Clostridium botulinum type A, Clostridium botulinum type B, Clostridium botulinum type C, Clostridium botulinum type D, Clostridium botulinum type G, Yersinia pestis, Francisella tularensis, Vibrio cholerae, and Burkholderia pseudomallei can be identified in a sample based on a SNP at a position corresponding to position 746, 764, 771, or 785 of the 16S rRNA gene set forth in SEQ ID NO: 38 (or position 737, 755, 762, or 776 of the 16S rRNA gene set forth in SEQ ID NO: 1) and high-resolution melting curve analysis of the SNPs and their surrounding DNA.
[0095] For example, bacteria selected from among Bacillus anthracis, Clostridium botulinum type A, Clostridium botulinum type B, Clostridium botulinum type C, Clostridium botulinum type D, Clostridium botulinum type G, Yersinia pestis, Francisella tularensis, Vibrio cholerae, and Burkholderia pseudomallei can be identified in a sample based on the above SNP positions and / or high-resolution melting curve analysis of the SNPs and their surrounding DNA.
[0096] In some embodiments, the methods of the invention can further include administering a therapeutic agent, such as an antibiotic or antimicrobial agent, to the subject. In another embodiment, the method of assessing treatment effectiveness (e.g., as in the fourth aspect of the invention) can further include determining whether at least one bacterium is at least partially susceptible and / or resistant to the therapeutic agent.
[0097] In one embodiment, the methods described herein further comprise selecting a treatment for the infection based on the amount or concentration of bacteria in the sample or biological sample.
[0098] It will be appreciated that methods of treating an infection can include the administration of a therapeutically effective amount of one or more therapeutic agents to facilitate that treatment. By way of example only, these can include: antibiotic agents (including small molecule antibiotics, molecules that are inherently antimicrobial, natural or synthetic peptide antimicrobials and / or proteins with antimicrobial properties), anti-inflammatory agents (e.g., nonsteroidal anti-inflammatory drugs (NSAIDs), corticosteroids), immunosuppressants, immunomodulators, oxygen, intravenous fluids, and vasopressors.
[0099] Exemplary antibiotic agents include fluoroquinolones (including ciprofloxacin), tetracyclines (including doxycycline), macrolides (including erythromycin, cethromycin, azithromycin, and clarithromycin), 3-lactams (including penicillin, imipenem, and ampicillin), ansamycins (including rifampin), phenicols (including chloramphenicol), streptogramins (including quinupristin-dalfopristin), aminoglycosides (including gentamicin), oxazolidinones (including linezolid), tetracyclines, glycylglycines (including tigecycline), cyclic lipopeptides (including daptomycin), and lincosamines (including clindamycin). Specific examples of other antibiotic agents include fusidic acid, trimethoprim, sulfadiazine, sulfamethoxazole, penicillin, monobactam, penam, penem, clavam, clavem, carbopenam, carbopenem, cefam, cephem, oxacepham, oxacephem, carbocepham, carbocepham, cephalosporin, tetracycline, tetracycline-derived antibacterials, glycylcycline, glycylcycline-derived antibacterials, minocycline, minocycline-derived antibacterials, and sancycline. , sancycline-derived antibacterials, methacycline, methacycline-derived antibacterials, oxazolidinone antibacterials, aminoglycoside antibacterials, quinolone antibacterials, daptomycin, daptomycin-derived antibacterials, rifamycin, rifamycin-derived antibacterials, rifampin, rifampin-derived antibacterials, rifalazil, rifalazil-derived antibacterials, rifabutin, rifabutin-derived antibacterials, rifapentine, rifapentine-derived antibacterials, rifaximin, and rifaximin-derived antibacterials.
[0100] As will be appreciated, the amount or concentration of bacteria in a biological sample generally increases as the disease progresses.
[0101] In this regard, an increase in the amount or concentration of bacteria in a biological sample from a subject receiving treatment may indicate progression of the disease in the subject and that the treatment is ineffective (e.g., drug resistance), while a decrease in the amount or concentration of bacteria in a biological sample from a subject receiving treatment generally indicates remission or regression of the disease in the subject and therefore that the treatment is effective.
[0102] In some embodiments, multiple time points can be selected before, during, and / or after treatment of a subject with an infection, and the amount or concentration of bacteria in biological samples taken from the subject at these multiple time points can be determined to determine prognosis or treatment effectiveness. For example, the amount or concentration of bacteria can be determined at an initial time point, and then again at one, two, three, or more subsequent time points.
[0103] Preferably, the time points for taking the biological sample can be selected from the entire treatment cycle or from a desired period. For example, the time points can be before treatment, during treatment, and / or after completion of treatment. Preferably, the altered or modulated amount or concentration level of bacteria in the biological sample from the first to the second and / or third time points, for example, a decrease or reduction, can be used by the method of the present invention to provide a positive prognosis for a subject with a bacterial infection. Alternatively, the altered or modulated amount or concentration level of bacteria in the biological sample from the first to the second and / or the third time points, for example, an increase, can provide a poor prognosis for a subject with a bacterial infection.
[0104] As will be appreciated by one of skill in the art, the amount or concentration of bacteria in said biological sample may also be related to the severity, stage, recurrence or progression of the infection and / or the effectiveness of treatment.
[0105] In one embodiment, a biological sample can be provided and / or collected from the subject at the time of diagnosis and then prior to each cycle of treatment. Suitably, there can be any number of treatment cycles, including but not limited to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, and / or 20 cycles, depending on the subject and the nature and / or stage of the infection. Treatment cycles can be close together, spread out over a period of time, and / or focused cycles at defined time points over a period of time, or any combination of the above.
[0106] In further embodiments, samples can be taken both during treatment and / or after the completion of treatment.Preferably, samples can be provided from the subject at any time after the completion of treatment, for example, 1, 2, 3, 4, 5, 10, 15, 20, 25, and / or 30 days after treatment, 1, 2, and / or 3 weeks after treatment, and / or 1, 3, 6, and / or 9 months after treatment, and / or 1, 2, 3, 4, 5, 10, 15, 20, and / or 30 years after treatment.Depending on the subject and the infection, the subject can be in remission or can complete treatment after at least one or more treatment cycles.
[0107] In one embodiment, any suitable sample, such as an environmental sample or a biological sample, can be used in the methods of the present invention. Exemplary biological samples can include sputum, saliva, blood, cerebrospinal fluid, or urine samples. As used herein, the term "blood" includes whole blood or any fraction of blood, such as serum and plasma, as conventionally defined.
[0108] Some embodiments allow for the use of internal or external standards to quantify the amplification products.
[0109] A probe, tool, or reagent may be, without limitation, an oligonucleotide, primer, nucleic acid, polynucleotide, DNA, cDNA, RNA, peptide, or polypeptide, which may be, for example, single-stranded or double-stranded, and may be naturally occurring, isolated, purified, chemically modified, recombinant, or synthetic.
[0110] The probe, tool or reagent may be, without limitation, an antibody or other type of molecule or chemical entity that is capable of specifically binding to, detecting or identifying at least a portion of the 16S rRNA gene in a sample containing at least one SNP.
[0111] The probes, tools or reagents may be any number or combination of those described above, the number and combination depending on the desired result to be achieved - for example, detection of SNPs at the genome level (genotyping) or RNA transcription level.
[0112] The probe, tool, or reagent may be isolated. The probe, tool, or reagent may be detectably labeled. The detectable label may be included in the amplification reaction. Suitable labels include fluorescent dyes, such as fluorescein isothiocyanate (FITC), rhodamine, Texas Red, phycoerythrin, allophycocyanin, 6-carboxyfluorescein (6-FAM), 2',7'-dimethoxy-4',5'-dichloro-6-carboxyfluorescein (JOE), 6-carboxy-X-rhodamine (ROX), 6-carboxy-2',4',7',4,7-hexachlorofluorescein (HEX), 5-carboxyfluorescein (5-FAM) or N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA), radioactive labels, such as 32 P, 35 S, 3H; etc. Labeling may be a two-step system in which the amplified DNA is conjugated to biotin, a hapten, etc., with a high-affinity binding partner, such as avidin, a specific antibody, etc., where the binding partner is conjugated to a detectable label. The label may be conjugated to one or both of the primers. Alternatively, the pool of nucleotides used in the amplification is labeled to incorporate the label into the amplification product.
[0113] In certain embodiments, at least one probe, tool or reagent is for specific binding, detection or identification of a SNP at the genomic or transcriptional level, preferably the former.
[0114] In a preferred embodiment, at least one probe, tool or reagent is for specifically binding to, detecting or identifying at least a portion of the 16S rRNA gene in a sample containing at least one SNP as described herein.
[0115] For this method, a single probe (especially a primer) can be used in each sample and / or control sample, or multiple probes (especially primers) can be used in each sample and / or control sample (i.e., in one pot). Such probes (especially primers) can be added to the raw solution obtained from the amplification (e.g., PCR).
[0116] In one embodiment, at least one probe, tool, or reagent can include two primers, each of which hybridizes to at least a portion of a bacterial 16S rRNA gene (or gene product) containing the SNP described above.
[0117] In one embodiment, at least one of the probes, tools, or reagents comprises an oligonucleotide having (or comprising or consisting of) a nucleotide sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity or homology to at least one of SEQ ID NOs: 16-37. The probe, tool, or reagent may be a primer. The probe, tool, or reagent may comprise an oligonucleotide having a nucleotide sequence as set forth in at least one of SEQ ID NOs: 16-37.
[0118] Suitable primers for identifying SNPs in the 16S rRNA sequence shown in SEQ ID NO: 38 (particularly for identifying SNPs in Table 4) may be as shown in Table 7 below.
[0119] [Table 7]
[0120] Any of the features described herein may be combined in any combination with any one or more of the other features described herein within the scope of the present invention.
[0121] The above mainly discusses the use of 16S rRNA gene. However, the above is also applicable to 16S rRNA and other 16S rRNA gene products. Thus, in some embodiments (where applicable), references to upper and lower 16S rRNA genes can be replaced with 16S rRNA gene products (or 16S rRNA).
[0122] The reference to any prior art in this specification is not, and should not be taken as, an acknowledgment or any form of suggestion that the prior art forms part of the common general knowledge.
[0123] Various embodiments of the present invention will now be described with reference to the following drawings. [Brief explanation of the drawings]
[0124] [Figure 1] FIG. 1 shows a standard curve generated from control samples correlating amplicon DNA (ng) with sample volume (μL). [Figure 2] FIG. 2 shows a schematic of the spiking of control blood and its serial dilution to generate a series of control samples of known bacterial concentrations. [Figure 3] Figure 3 provides comparative flow cytometry and plate count data results for E. coli and S. aureus. [Figure 4] FIG. 4 shows the high resolution melting (HRM) curves of the spiked blood control samples for Bacteroides fragilis tested in Example 2. [Figure 5] FIG. 5 shows the high resolution melting (HRM) curves of the spiked blood control samples for Haemophilus influenzae tested in Example 2. [Figure 6] FIG. 6 shows the high resolution melting (HRM) curves of the spiked blood control samples for Pseudomonas aeruginosa tested in Example 2. [Figure 7] FIG. 7 shows the high resolution melting (HRM) curves of the spiked blood control samples for Streptococcus pneumoniae tested in Example 2. [Figure 8] FIG. 8 shows the high resolution melting (HRM) curves of the spiked blood control samples for Klebsiella pneumoniae tested in Example 2. [Figure 9] FIG. 9 shows the high resolution melting (HRM) curves of the spiked blood control samples for Escherichia coli tested in Example 2. [Figure 10]FIG. 10 shows the high resolution melting (HRM) curves of the spiked blood control samples for Enterobacter cloacae tested in Example 2. [Figure 11] FIG. 11 shows the high resolution melting (HRM) curves of the spiked blood control samples for Serratia marcescens tested in Example 2. [Figure 12] FIG. 12 shows the high resolution melting (HRM) curves of the spiked blood control samples for Proteus mirabilis tested in Example 2. [Figure 13] Figure 13 shows a CLUSTALW sequence alignment of representative genes encoding 16S rRNA molecules from the following bacterial species: Acinetobacter calcoaceticus; Enterobacter aerogenes; Enterobacter cloacae; Enterococcus faecalis; Enterococcus faecium; Escherichia coli; Klebsiella pneumoniae; Proteus mirabilis; Pseudomonas aeruginosa; Serratia marcescens; Staphylococcus aureus; Staphylococcus epidermidis; Streptococcus agalactiae; Streptococcus pneumoniae, and Streptococcus pyogenes. Variable sequences determined by the CLUSTALW alignment were removed. SNPs at positions corresponding to positions 273, 378, 408, 412, 440, 488, 647 and 653 of the 16S rRNA gene from E. coli shown in SEQ ID NO: 1 are highlighted along with the corresponding nucleotides in the aligned sequences. [Figure 14] Figure 14 illustrates an example of a typical standard curve of Ct versus log copy number (Figure 14A) and Ct values obtained from an amplification plot showing the change in normalized signal (expressed in copy number) of five standards between 20 and 40 cycles of PCR (Figure 14B). DETAILED DESCRIPTION OF THE INVENTION
[0125] Key to the sequence table SEQ ID NO: 1: 16S rRNA gene of Escherichia coli in Figure 13 (Genbank accession number NR_102804.1);
[0126] SEQ ID NO: 2: 16S rRNA gene of Staphylococcus aureus in Figure 13 (Genbank accession number NR_075000.1);
[0127] SEQ ID NO: 3: 16S rRNA gene of Staphylococcus epidermidis in Figure 13 (Genbank accession number NR_074995.1);
[0128] SEQ ID NO: 4: 16S rRNA gene of Streptococcus pneumoniae in Figure 13 (Genbank accession number NR_074564.1);
[0129] SEQ ID NO: 5: 16S rRNA gene of Streptococcus agalactiae in Figure 13 (Genbank accession number NR_040821.1);
[0130] SEQ ID NO: 6: 16S rRNA gene of Streptococcus pyogenes in Figure 13 (Genbank accession number NR_074091.1);
[0131] SEQ ID NO: 7: 16S rRNA gene of Enterococcus faecalis in Figure 13 (Genbank accession number NR_074637.1);
[0132] SEQ ID NO: 8: 16S rRNA gene of Enterococcus faecium in Figure 13 (Genbank accession number NR_042054.1);
[0133] SEQ ID NO: 9: 16S rRNA gene of Proteus mirabilis in Figure 13 (Genbank accession number NR_074898.1);
[0134] SEQ ID NO: 10: 16S rRNA gene of Serratia marcescens in Figure 13 (Genbank accession number NR_041980.1);
[0135] SEQ ID NO: 11: 16S rRNA gene of Enterobacter aerogenes in Figure 13 (Genbank accession number NR_024643.1);
[0136] SEQ ID NO: 12: 16S rRNA gene of Enterobacter cloacae in Figure 13 (Genbank accession number NR_028912.1);
[0137] SEQ ID NO: 13: 16S rRNA gene of Klebsiella pneumoniae in Figure 13 (Genbank accession number NR_036794.1);
[0138] SEQ ID NO: 14: 16S rRNA gene of Pseudomonas aeruginosa in Figure 13 (Genbank accession number NR_074828.1);
[0139] SEQ ID NO: 15: 16S rRNA gene of Acinetobacter calcoaceticus in Figure 13 (Genbank accession number AB302132.1);
[0140] SEQ ID NO: 16: forward primer (CCTCTTGCCATCGGATGTG);
[0141] SEQ ID NO: 17: reverse primer (CCAGTGTGGCTGGTCATCCT);
[0142] SEQ ID NO: 18: forward primer (GGGAGGCAGCAGTAGGGAAT);
[0143] SEQ ID NO: 19: forward primer (CCTACGGGAGGCAGCAGTAG);
[0144] SEQ ID NO: 20: reverse primer (CGATCCGAAAACCTTCTTCACT);
[0145] SEQ ID NO: 21: forward primer (AAGACGGTCTTGCTGTCACTTATAGA);
[0146] SEQ ID NO: 22: reverse primer (CTATGCATCGTTGCCTTGGTAA);
[0147] SEQ ID NO: 23: forward primer (TGCCGCGTGAATGAAGAA);
[0148] SEQ ID NO: 24: forward primer (GCGTGAAGGATGAAGGCTCTA);
[0149] SEQ ID NO: 25: forward primer (TGATGAAGGTTTTCGGATCGT);
[0150] SEQ ID NO: 26: reverse primer (TGATGTACTATTAACACATCAACCTTCCT);
[0151] SEQ ID NO: 27: reverse primer (AACGCTCGGATCTTCCGTATTA);
[0152] SEQ ID NO: 28: reverse primer (CGCTCGCCACCTACGTATTAC);
[0153] SEQ ID NO: 29: forward primer (GTTGTAAGAGAAGAACGAGTGTGAGAGT);
[0154] SEQ ID NO: 30: reverse primer (CGTAGTTAGCCGTCCCTTTCTG);
[0155] SEQ ID NO: 31: forward primer (GCGGTTTGTTAAGTCAGATGTGAA);
[0156] SEQ ID NO: 32: forward primer (GGTCTGTCAAGTCGGATGTGAA);
[0157] SEQ ID NO: 33: forward primer (TCAACCTGGGAACTCATTCGA);
[0158] SEQ ID NO: 34: reverse primer (GGAATTCTACCCCCCTCTACGA);
[0159] SEQ ID NO: 35: reverse primer (GGAATTCTACCCCCCTCTACAAG);
[0160] SEQ ID NO: 36: forward primer (GTGTAGCGGTGAAATGCGTAGAG);
[0161] SEQ ID NO: 37: reverse primer (TCGTTTACCGTGGACTACCAGGG);
[0162] SEQ ID NO: 38: 16S ribosomal RNA gene, partial sequence of Bacillus anthracis strain 2000031664 (GenBank accession number AY138383.1); TIFF2026027396000010.tif218160
[0163] SEQ ID NO: 39: 16S rRNA gene of Burkholderia pseudomallei (GenBank accession number AJ131790.1); TIFF2026027396000011.tif231160
[0164] SEQ ID NO: 40: 16S RNA rrn gene of Clostridium botulinum type A (GenBank accession number X68185.1); TIFF2026027396000012.tif218160
[0165] SEQ ID NO: 41: 16S RNA rrn gene of Clostridium botulinum type B (GenBank accession number X68186.1); TIFF2026027396000013.tif217160
[0166] SEQ ID NO: 42: 16S rRNA rrn gene of Clostridium botulinum type C (GenBank accession number X68315.1); TIFF2026027396000014.tif215160
[0167] SEQ ID NO: 43: 16S RNA rrn gene of Clostridium botulinum type D (GenBank accession number X68187.1 ); TIFF2026027396000015.tif218160
[0168] SEQ ID NO: 44: 16S rRNA rrn gene of Clostridium botulinum type G (GenBank accession number X68317.1); TIFF2026027396000016.tif216160
[0169] SEQ ID NO: 45: 16S ribosomal RNA of Francisella tularensis strain B-38, partial sequence (GenBank accession number / NCBI reference sequence: NR_029362.1); TIFF2026027396000017.tif218160
[0170] SEQ ID NO: 46: 16S ribosomal RNA gene of Vibrio cholerae strain DL2, partial sequence (GenBank accession number MG062858.1); TIFF2026027396000018.tif210160
[0171] SEQ ID NO: 47: 16S rRNA gene of Yersinia pestis, isolate: SS-Yp-116 (GenBank accession number AJ232238.1); TIFF2026027396000019.tif207160
[0172] SEQ ID NO: 48: forward primer (TCCTACGGGAGGCAGCAGTAGGG);
[0173] SEQ ID NO: 49: reverse primer (CCGCTACACATGGAATTCCAC);
[0174] SEQ ID NO: 50: forward primer (GACTCCTACGGGAGGCAGCAGTGGG);
[0175] SEQ ID NO: 51: reverse primer (GGTATTAACTTACTGCCCTTCCTCCC);
[0176] 1.Definition Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are described. For purposes of the present invention, the following terms are defined below.
[0177] The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.
[0178] "Amplification product" or "amplicon" means a nucleic acid product produced by a nucleic acid amplification technique.
[0179] As used herein, the term "biological sample" refers to a sample derived from a patient or subject, which may be extracted, raw, treated, diluted, or concentrated. Preferably, the biological sample is selected from any part of the patient's or subject's body, including, but not limited to, hair, skin, nails, tissue, or bodily fluids, such as sputum, saliva, cerebrospinal fluid, urine, and blood.
[0180] In this specification and claims (if any), the word "comprising" and its derivatives, including "comprises" and "comprise," include each of the specified integers but do not exclude the inclusion of one or more additional integers.
[0181] As used herein, the term "copy number" refers to the number of copies of a nucleic acid sequence, such as a 16S rRNA gene or portion thereof, present in a test sample.
[0182] As used herein, "corresponding" nucleic acid positions or nucleotides refer to positions or nucleotides present in aligned loci of two or more nucleic acid molecules. Related or variant polynucleotides can be aligned by any method known to those of skill in the art. Such methods generally maximize correspondence and include the use of manual alignment as well as the use of numerous alignment programs available (e.g., BLASTN) and others known to those of skill in the art. By aligning the sequences of polynucleotides, one of skill in the art can identify corresponding nucleotides or positions using identical nucleotides as a guide. For example, by aligning the sequence of the gene encoding the 16S rRNA of E. coli (set forth in SEQ ID NO: 1) with a gene encoding the 16S rRNA from another species, one of skill in the art can identify corresponding positions and nucleotides using conserved nucleotides as a guide.
[0183] "Gene" means a unit of heredity that occupies a specific locus in the genome and consists of transcriptional and / or translational regulatory sequences and / or coding regions and / or untranslated sequences (i.e., introns, 5' and 3' untranslated sequences).
[0184] "Gene product" means the product of a gene. For example, the gene product of the 16S rRNA gene includes 16S rRNA. Gene products also include, for example, cDNA sequences derived from rRNA sequences. Gene products can also include the product of rRNA, where a SNP in an rRNA gene will result in a corresponding change in the product.
[0185] As used herein, the term "gene copy number" refers to the number of copies of a nucleic acid molecule in a cell. The gene copy number includes the number of copies of a gene in the genomic (chromosomal) DNA of a cell. In bacteria, under normal conditions, the copy number of a nucleic acid, such as the 16S rRNA gene, can vary between species. Therefore, the copy number of the 16S rRNA gene can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, etc., depending on the specific bacterium in question.
[0186] "Homology" refers to the percentage of nucleic acids or amino acids that are identical or that constitute conservative substitutions. Homology can be determined using sequence comparison programs such as GAP (Deveraux et al. 1984), which is incorporated herein by reference. In this method, sequences of similar or substantially different lengths to those cited herein can be compared by inserting gaps into the alignment, with such gaps being determined, for example, by the comparison algorithm used by GAP.
[0187] As used herein, "hybridization" is used to refer to the pairing of complementary nucleotide sequences to produce a DNA-DNA hybrid or a DNA-RNA hybrid. In DNA, A pairs with T and C pairs with G. In RNA, U pairs with A and C pairs with G. In this regard, the terms "match" and "mismatch" as used herein refer to the potential for hybridization of paired nucleotides in complementary nucleic acid strands. Matching nucleotides, such as the classical AT and GC base pairs noted above, hybridize efficiently. Mismatches are other combinations of nucleotides that do not hybridize efficiently. Nucleotide symbols are shown in Table 8:
[0188] [Table 8]
[0189] "Isolated" means material that is substantially or virtually free from components which normally accompany it in its natural state.
[0190] As used herein, the term "oligonucleotide" refers to a polymer composed of multiple nucleotide residues (deoxynucleotides or ribonucleotides, or related structural variants or synthetic analogs thereof) linked through phosphodiester bonds (or related structural variants or synthetic analogs thereof). Thus, while the term "oligonucleotide" generally refers to a nucleotide polymer in which the nucleotide residues and linkages between them are naturally occurring, it is understood that the term also encompasses various analogs, including, but not limited to, peptide nucleic acids (PNAs), phosphoramidates, phosphorothioates, methylphosphonates, 2-O-methylribonucleic acids, and the like. The exact size of the molecule can vary depending on the particular application. Oligonucleotides are generally quite short, typically about 10 to 30 nucleotide residues in length, although the term can refer to molecules of any length, with the terms "polynucleotide" or "nucleic acid" being commonly used for larger oligonucleotides.
[0191] The terms "patient" and "subject" are used interchangeably and refer to human or other mammalian patients and subjects, including any individual who is examined or treated using the methods of the present invention. However, it is understood that "patient" does not imply the presence of symptoms. Suitable mammals within the scope of the present invention include, but are not limited to, primates, livestock animals (e.g., sheep, cows, horses, donkeys, pigs), laboratory animals (e.g., rabbits, mice, rats, guinea pigs, hamsters), companion animals (e.g., cats, dogs), and wild game animals (e.g., koalas, bears, wild cats, wild dogs, wolves, dingoes, foxes, etc.).
[0192] As used herein, the term "polymorphism" refers to a difference in the nucleotide or amino acid sequence of a given region compared with the nucleotide or amino acid sequence of a homologous region of another individual, particularly a difference in the nucleotide or amino acid sequence of a given region that differs between individuals of the same species. Polymorphisms are generally defined relative to a reference sequence. Polymorphisms include single nucleotide differences, differences in multiple nucleotides, and single or multiple nucleotide insertions, inversions, and deletions; as well as single amino acid differences, differences in the sequence of multiple amino acids, and single or multiple amino acid insertions, inversions, and deletions. A "polymorphic site" is a genetic locus where mutations occur. When a polymorphism exists in a nucleic acid sequence and refers to the presence of a specific base or bases at a polymorphic site, it should be understood that the present invention also encompasses one or more complementary bases on the complementary strand of that site.
[0193] As used herein, the term "polynucleotide" or "nucleic acid" refers to mRNA, RNA, rRNA, cRNA, cDNA, or DNA. The term generally refers to oligonucleotides greater than 30 nucleotide residues in length.
[0194] "Primer" refers to an oligonucleotide that, when paired with a strand of DNA, is capable of initiating the synthesis of a primer extension product in the presence of a suitable polymerization agent. Primers are preferably single-stranded for maximum amplification efficiency, but may alternatively be double-stranded. A primer must be sufficiently long to prime the synthesis of an extension product in the presence of a polymerization agent. The length of a primer depends on many factors, including the application, temperature used, template reaction conditions, other reagents, and the source of the primer. For example, depending on the complexity of the target sequence, an oligonucleotide primer typically contains 15 to 35 or more nucleotide residues, although it can contain fewer nucleotide residues. A primer can be a large polynucleotide, e.g., from about 200 nucleotides to several kilobases or more. A primer can be selected to be "substantially complementary" to a sequence on a template to which it is designed to hybridize and serve as a site for initiation of synthesis. "Substantially complementary" means that the primer is sufficiently complementary to hybridize with a target polynucleotide. In some embodiments, a primer contains no mismatches with the template to which it is designed to hybridize, although this is not required. For example, a non-complementary nucleotide residue can be attached to the 5' end of the primer, while the remainder of the primer sequence is complementary to the template. Alternatively, a non-complementary nucleotide residue or stretches of non-complementary nucleotide residues can be interspersed throughout the primer, provided that the primer sequence has sufficient complementarity with the template sequence to hybridize therewith and thereby form a template for synthesis of a primer extension product.
[0195] "Probe" refers to a molecule that binds to a specific sequence or subsequence or other portion of another molecule. Unless otherwise indicated, the term "probe" generally refers to a polynucleotide probe that binds to another polynucleotide, often referred to as a "target polynucleotide," through complementary base pairing. Depending on the stringency of the hybridization conditions, a probe can bind to a target polynucleotide that lacks complete sequence complementarity with the probe. A probe can be directly or indirectly labeled.
[0196] The terms "prognosis" and "prognostic" are used herein to include prognosis, which allows for predicting clinical outcomes (with or without medical treatment), selecting an appropriate course of treatment (or whether treatment is effective), and / or monitoring current treatment and potentially modifying it. This can be based at least in part on quantifying bacteria by the methods of the present invention, which can be combined with bacterial identification. Prognosis can also include prediction, forecasting, or anticipation of any lasting or permanent physical or mental effects of an infection that a subject will suffer from after the bacterial infection has been successfully treated or otherwise resolved. Furthermore, prognosis can include one or more of the following: the likelihood or occurrence of sepsis, determining treatment responsiveness, implementing an appropriate treatment regimen, determining the probability, likelihood, or likelihood of infection recurrence after therapy, and predicting the development of resistance to established therapy (e.g., antibiotics). A positive prognosis generally refers to a favorable clinical outcome or outlook, such as long-term survival without recurrence of the bacterial infection in a subject, while a negative prognosis can be understood to generally mean a negative clinical outcome or outlook, such as recurrence or progression of the bacterial infection.
[0197] As used herein, the term "quantify" means measuring, calculating or estimating, preferably by quantitative, semi-quantitative or relative methods, a product such as an amplification product, a target nucleic acid, the copy number of a 16S rRNA gene and / or the amount or concentration of bacteria.
[0198] As used herein, "resistance" refers to the diminished or absent response of an organism, disease, tissue, or cell, e.g., a bacterium, to the intended effectiveness of a treatment, e.g., a chemical or drug (e.g., an antibiotic). Resistance to a treatment may already be present at the time of diagnosis or initiation of treatment (i.e., intrinsic resistance), or may develop with or after treatment (i.e., acquired resistance).
[0199] As used herein, the term "sepsis" is used in accordance with its ordinary meaning in clinical medicine and includes systemic and / or blood-borne infections such as, for example, bacterial infections.
[0200] The term "sepsis-associated bacteria" refers to bacteria that have been identified as being capable of causing sepsis in a subject or that have been identified in the blood of a septic subject. Thus, "mammalian (e.g., human) sepsis-associated bacteria" refers to bacteria that have been identified as being capable of causing sepsis in a mammalian (e.g., human) subject or that have been identified in the blood of a septic mammalian (e.g., human) subject. Examples of mammalian (e.g., human) sepsis-associated bacteria include Acinetobacter baumannii, Actinobacillus hominis, Actinomyces massiliensis, Aeromonas hydrophila, Bacillus anthracis, Bacteroides fragilis, Brucella abortus, Burkholderia cepacia, Campylobacter coli, Campylobacter fetus, Campylobacter jejuni, Campylobacter lari, Cardiobacterium valvarum, Chlamydia trachomatis, Chlamydophila abortus, Chlamydophila pneumoniae, Citrobacter freundii, Clostridium difficile, Clostridium perfringens, Corynebacterium diphtheriae, Corynebacterium jeikeium, Corynebacterium urealyticum, Dermatophilus congolensis, Edwardsiella tarda, Enterobacter aerogenes, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Erysipelothrix rhusiopathiae, Escherichia coli, Eubacterium desmolans, Flavobacterium ceti, Haemophilus ducreyi, Haemophilus influenzae, Haemophilusparahaemolyticus, Haemophilus parainfluenzae, Helicobacter cinaedi, Helicobacter pylori, Klebsiella oxytoca, Klebsiella pneumonia, Lactobacillus intestinalis, Legionella pneumophila, Leptospira interrogans, Listeria monocytogenes, Micrococcus luteus, Mobiluncus curtisii, Moraxella catarrhalis, Morganella morganii, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroids, Nocardia brasiliensis, Pasteurella multocida, Peptostreptococcus stomatis, Porphyromonas gingivalis, Prevotella buccae, Prevotella intermedia, Prevotella melaninogenica, Proteus mirabilis, Providencia alcalifaciens, Pseudomonas aeruginosa, Rhodococcus equi, Salmonella enterica, Serratia marcescens, Shigella dysenteriae, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Staphylococcus hominis, Staphylococcus saprophyticus, Stenotrophomonas maltophila、Streptococcus agalactiae、Streptococcus anginosus、Streptococcus bovis、Streptococcus constellatus、Streptococcusdysgalactiae, Streptococcus intermedins, Streptococcus mitis, Streptococcus mutans, Streptococcus oralis, Streptococcus pneumoniae, Streptococcus pyogenes, Streptococcus sanguinis, Streptococcus sobrinus, Streptomyces anulatus, Streptomyces somaliensis, Veillonella atypica, Veillonella denticariosi, Veillonella dispar, Veillonella parvula, Veillonella rogosae, Vibrio cholerae, Yersinia enterocolitica and Yersinia pestis.
[0201] As used herein, "sepsis" is defined as SIRS with a presumed or confirmed infectious process. Confirmation of the infectious process can be determined using microbiological culture or isolation of the infectious agent. From an immunological perspective, sepsis can be viewed as a systemic response to a microbial or systemic infection.
[0202] As used herein, "systemic inflammatory response syndrome (SIRS)" refers to a clinical response resulting from a nonspecific insult that has two or more of the following measurable clinical characteristics: body temperature above 38°C or below 36°C, heart rate above 90 beats per minute, respiratory rate above 20 breaths per minute, and blood pressure above 1 mmHg. 3 More than 12,000 per mm or 1 mm 3 A white blood cell count (total white blood cells) of less than 4,000 per 1000, or a band neutrophil percentage of greater than 10%. From an immunological perspective, it can be seen as representing a systemic response to injury (e.g., major surgery) or systemic inflammation. Thus, as used herein, "infection-negative SIRS (inSIRS)" includes the clinical responses described above, but in the absence of a discernible infectious process.
[0203] As used herein, the term " sequence identity " refers to the degree to which sequences are identical in nucleotide or amino acid bases across comparison window.Therefore, " sequence identity percentage " is calculated by: comparing two optimally aligned sequences across comparison window, determining the number of positions where the same nucleic acid base (for example, A, T, C, G) exists in both sequences, thereby giving the number of matched positions; dividing the number of matched positions by the total number of positions in comparison window (i.e., window size), and multiplying the result by 100 to give the sequence identity percentage (% sequence identity).
[0204] As used herein, the term "single nucleotide polymorphism" or "SNP" refers to a nucleotide sequence variation that occurs when a single nucleotide (A, T, C, or G) in a genomic sequence is altered (e.g., through a substitution, addition, or deletion). SNPs can occur in both coding (gene) and non-coding regions of a genome, such as the genome of a prokaryotic or eukaryotic microorganism.
[0205] As used herein, the terms "treatment," "treating," and the like refer to obtaining a desired pharmacological and / or physiological effect. This effect may be prophylactic, in that it completely or partially prevents an infection, condition, or its symptoms, and / or therapeutic, in that it partially or completely cures the infection, condition, and / or the deleterious effects caused by the infection or condition. As used herein, "treatment" encompasses any treatment of an infection or condition in a mammal (e.g., a human), including (a) suppressing the infection or condition, i.e., inhibiting its development; and (b) relieving the infection or condition, i.e., causing regression of the infection or condition.
[0206] 2. Quantification of bacteria using SNPs and gene copy number variation in 16S rRNA The present invention provides a method for quantifying bacteria in a sample, such as a biological sample from a subject. To this end, the invention is based in part on the determination that SNPs in the 16S rRNA gene (and thus in the 16S rRNA molecule) and gene copy number that are specific to a particular bacterium can be used to quantify individual species or strains of bacteria.
[0207] Most particularly, the present invention provides a method for quantifying microorganisms such as bacterial species selected from among: Aerococcus viridans; Acinetobacter calcoaceticus; Bacteroides fragilis; Cedecea lapagei; Citrobacter freundii; Cronobacter dublinensis; Enterobacter aerogenes; Enterobacter cloacae; Enterococcus cecorum; Enterococcus faecalis; Enterococcus faecium; Escherichia coli; Haemophilus influenzae; Klebsiella pneumoniae; Proteus mirabilis; Pseudomonas aeruginosa; Serratia marcescens; Shewanella putrefaciens; Staphylococcus aureus; Staphylococcus epidermidis; Streptococcus agalactiae; Streptococcus pneumoniae and Streptococcus pyogenes. In one embodiment, the present invention provides a method for quantifying microorganisms such as bacterial species selected from among: Acinetobacter calcoaceticus; Bacteroides fragilis; Enterobacter aerogenes; Enterobacter cloacae; Enterococcus faecalis; Enterococcus faecium; Escherichia coli; Haemophilus influenzae; Klebsiella pneumoniae; Proteus mirabilis; Pseudomonas aeruginosa; Serratia marcescens; Staphylococcus aureus; Staphylococcus epidermidis; Streptococcus agalactiae; Streptococcus pneumoniae and Streptococcus pyogenes.
[0208] For example, a method for quantifying one of the bacteria listed in the paragraph above in a sample includes amplifying a target nucleic acid from the bacterial 16S rRNA gene of the microorganism in question from genetic material obtained from the sample to form an amplification product, measuring the amount or concentration of the amplification product, and calculating the amount or concentration of the target nucleic acid in the sample by comparing the amount or concentration of the amplification product with its reference level.
[0209] Suitably, the target nucleic acid is amplified by PCR, such as quantitative PCR, semi-quantitative PCR, digital PCR and end-point PCR, or ligase chain reaction (LCR).
[0210] During PCR, the amount of DNA (e.g., target nucleic acid) theoretically doubles with each cycle to produce an amplification product. After each cycle, the amount of DNA in the amplification product is roughly twice as much as before.
[0211] The absolute quantity of a target nucleus in a sample is preferably determined using a reference level, curve, or value generated from one or more control samples or external standards. The control sample is usually very similar to the sample, so that the genetic material of the control sample contains primer binding sites that should be identical to those in the sequence of the target nucleic acid. This ensures that the target nucleic acid in the one or more control samples and the sample is amplified with similar efficiency, which is generally required for quantification. In certain embodiments, the control sample contains genetic material obtained from a known amount or concentration of bacteria. This can include a known amount or concentration of live and / or dead bacteria, and / or genetic material extracted from a known amount or concentration of bacteria. In alternative embodiments, the control sample contains a known amount or concentration of synthetic oligonucleotides containing the target nucleic acid; for example, the target nucleic acid can be substantially equivalent to a known amount or concentration of bacteria. Preferably, to avoid issues of variability between experiments (e.g., between runs, between machines), amplifying the target nucleic acid from one or more control samples is performed substantially simultaneously or in parallel with amplifying the target nucleic acid from the sample.
[0212] It is contemplated that the one or more control samples may further comprise genetic material from one or more additional bacteria, such as those described above. To this end, the method may be utilized to quantify at least two bacteria, at least three bacteria, at least four bacteria, at least five bacteria, at least six bacteria, at least seven bacteria, at least eight bacteria, at least nine bacteria, at least ten bacteria, etc., in a sample.
[0213] Furthermore, the bacteria in the sample may be unknown, but once identified, the amplification products can be compared to reference levels corresponding to one or more control samples derived from the identified bacteria.
[0214] Using PCR techniques such as quantitative PCR, a detectable label, such as a fluorescent label, is detected and measured in a PCR thermocycler, and its geometric increase, which corresponds to the exponential increase of the product, is used to determine the threshold cycle (C) for each reaction. t ) is determined.
[0215] Preferably, the bacterial target nucleic acid from each of the sample and control samples is amplified in separate tubes. Different dilutions of the control sample are used to generate a standard curve (C t A plot of the crossover point versus the log of the C value / amount of standard can then be made. t The values are then compared to result reference levels or standard curves for the appropriate bacterial class, genus, or species, allowing for calculation of the initial amount of target nucleic acid in the sample. To generate a standard curve, preferably at least two, at least three, at least four, at least five, or at least six different amounts of target nucleic acid should be quantified, and the amount of target nucleic acid in the sample should fall within the range of the standard curve.
[0216] The quantification method described herein can further comprise a step of identifying bacteria in a sample.As will be understood by those skilled in the art, this can be performed before, after, or simultaneously with the method.In addition, and as mentioned above, the identification of bacteria can assist in the selection of appropriate reference levels and gene copy numbers corresponding to the specific bacterial class, genus, and / or species to be identified.
[0217] In one embodiment, identifying the bacteria comprises analyzing the amplification product for the presence or absence of at least one SNP. As described herein, polymorphisms at nucleotide positions in the gene encoding 16S rRNA (and thus the 16S rRNA molecule itself) corresponding to any one of positions 273, 378, 408, 412, 440, 488, 647, and 653 of the E. coli 16S rRNA gene set forth in SEQ ID NO: 1 can be used to identify bacteria in a sample, particularly those containing mammalian (e.g., human) pathogens, including the most commonly found bacterial species isolated by blood culture (Karlowsky et al. 2004).
[0218] In one embodiment, the identified bacteria is selected from the group consisting of: Aerococcus viridans; Acinetobacter calcoaceticus; Bacteroides fragilis; Cedecea lapagei; Citrobacter freundii; Cronobacter dublinensis; Enterobacter aerogenes; Enterobacter cloacae; Enterococcus cecorum; Enterococcus faecalis; Enterococcus faecium; Escherichia coli; Haemophilus influenzae; Klebsiella pneumoniae; Proteus mirabilis; Pseudomonas aeruginosa; Serratia marcescens; Shewanella putrefaciens; Staphylococcus aureus; Staphylococcus epidermidis; Streptococcus agalactiae; Streptococcus pneumoniae and Streptococcus pyogenes. In one embodiment, the identified bacteria is selected from the group consisting of: Acinetobacter calcoaceticus; Enterobacter aerogenes; Enterobacter cloacae; Enterococcus faecalis; Enterococcus faecium; Escherichia coli; Klebsiella pneumoniae; Proteus mirabilis; Pseudomonas aeruginosa; Serratia marcescens; Staphylococcus aureus; Staphylococcus epidermidis; Streptococcus agalactiae; Streptococcus pneumoniae and Streptococcus pyogenes.
[0219] General rules for identifying the bacterial species in a sample using the SNPs are described above.
[0220] Any method known in the art for detecting one or more SNPs can be used in the methods described herein to identify one or more bacterial species in a sample.In certain embodiments, this method facilitates narrowing down or, in some cases, confirming one bacterial species rather than another.Many methods are known in the art for determining the presence of nucleotides at specific positions corresponding to single nucleotide polymorphisms in a sample.Various tools for detecting polymorphisms include, but are not limited to, DNA sequencing, scanning technology, hybridization-based technology, extension-based analysis, high-resolution melting analysis, integration-based technology, restriction enzyme-based analysis, and ligation-based technology.
[0221] Nucleic acids can be obtained from a biological sample from a subject, or from an environmental sample, such as air, soil, or water samples, filtrate, food, or manufactured products, or from a surface, such as a medical instrument or a workplace surface. The subject can be a human or non-human subject, such as a mammalian subject, such as a primate, livestock animal (e.g., sheep, cows, horses, donkeys, pigs), laboratory animals (e.g., rabbits, mice, rats, guinea pigs, hamsters), companion animals (e.g., cats, dogs), and wild game animals (e.g., koalas, bears, wild cats, wild dogs, wolves, dingoes, foxes, etc.). A biological sample from a subject can be from any part of the subject's body, including, but not limited to, bodily fluids, such as blood, saliva, sputum, urine, cerebrospinal fluid, feces, cells, tissues, or biopsies. In another example, nucleic acids are obtained from cultured cells.
[0222] The nucleic acids analyzed by the methods of the present invention can be analyzed while they are in the sample, or they can be first extracted, e.g., isolated, from the sample before analysis. Any method for isolating nucleic acids from a sample can be used in the methods of the present invention, and such methods are well known to those skilled in the art. The extracted nucleic acids can include DNA and / or RNA (including mRNA or rRNA). In some cases, the method can include an additional step of reverse transcription before analysis. Thus, the analyzed nucleic acids can include a 16S rRNA gene, 16S rRNA, a DNA copy of 16S rRNA, or any combination thereof. The nucleic acid can also contain a portion of the 16S rRNA gene, 16S rRNA, or a DNA copy of 16S rRNA, providing a portion containing the nucleic acid position to be analyzed for SNPs.
[0223] Such a method can utilize one or more oligonucleotide probes or primers, including, for example, an amplification primer pair that selectively hybridizes to a target polynucleotide containing one or more SNPs.The oligonucleotide probe useful in carrying out the method of the present invention can, for example, comprise an oligonucleotide that is complementary to and spans a portion of the target polynucleotide that includes the SNP position, and the presence of a specific nucleotide at the polymorphic site (i.e., SNP) is detected by the presence or absence of selective hybridization of the probe.Such a method can further comprise contacting the target polynucleotide and the hybridized oligonucleotide with an endonuclease, and detecting the presence or absence of the cleavage product of the probe based on whether the nucleotide at the polymorphic site is complementary to the corresponding nucleotide of the probe.
[0224] Primers can be produced using any convenient synthesis method. Examples of such methods can be found in "Protocols for Oligonucleotides and Analogues; Synthesis and Properties", Methods in Molecular Biology Series, Volume 20, Ed. Sudhir Agrawal, Humana ISBN: 0-89603-247-7, 1993. Primers can also be labeled to facilitate detection.
[0225] Any method useful for detecting SNPs can be used in the present invention, and many different methods for SNP genotyping are known in the art (for reviews, see Syvanen, A.C. (2001); Kim, S. and Misra, A., (2007)). Such methods can consist of the use of three consecutive steps, including "reaction" (e.g., hybridization, ligation, extension, and cleavage) followed by "separation" (e.g., solid-phase microtiter plate, microparticle or array, gel electrophoresis, solution-phase homogeneous or semi-homogeneous). No single SNP genotyping method is ideal for all applications, and it is within the skill of one of ordinary skill in the art to determine the most appropriate method, taking into account various parameters, such as sample size and number of SNPs to be analyzed.
[0226] Exemplary techniques that are particularly useful for clinical use and rely on interrogating a small number of SNPs are rapid, sensitive (through amplification of nucleic acids in the sample), single-step, have real-time measurement output, can be multiplexed and automated, relatively inexpensive, and accurate; examples include, but are not limited to, TaqMan® assays (5' nuclease assays, Applied Biosystems), high-resolution melting analysis, molecular beacon probes such as LUX® (Invitrogen) or Scorpion® probes (Sigma Aldrich), and template-directed dye incorporation (TDI, Perkin Elmer).
[0227] For example, TaqMan® (Applied Biosystems) uses a combination of hybridization with allele-specific probes, a homogeneous solution phase, and fluorescence resonance energy transfer. The TaqMan® assay relies on forward and reverse primers for amplifying nucleic acids and Taq DNA polymerase, along with the 5'-nuclease activity of Taq DNA polymerase to degrade labeled probes designed to bind across the SNP site(s). The reaction, separation, and detection are all performed simultaneously, allowing real-time readings of the results as the reaction progresses. While such an approach is not conducive to analyzing a large number of SNPs simultaneously, it is particularly suitable for rapidly, sensitively, and accurately querying a small number of SNPs at a reasonable cost.
[0228] Any method known in the art for detecting one or more SNPs to classify and / or identify the bacteria and / or bacteria in a sample can be used in the methods described herein, although some methods may be more suitable than others.
[0229] However, in a preferred embodiment, detecting the presence or absence of at least one SNP involves the use of high-resolution melting (HRM) analysis. To this end, the utilization of high-resolution melting analysis in the present method advantageously allows both quantification and identification of bacteria to be achieved from a single amplification step of a target nucleic acid in the bacterial 16S rRNA gene.
[0230] HRM is a method for determining whether PCR products (i.e., amplicons) stained by an intercalating fluorescent dye reach their melting temperature (T m In contrast to traditional melting, information in HRM analysis is based on the precise monitoring of fluorescence changes as the sample is heated through a calculated T mBecause the data is not only collected but also in the form of a melting curve, HRM can be considered a form of spectroscopy. HRM analysis is a single-step, closed-tube method, and amplification and melting can be performed as a single protocol on a real-time PCR instrument.
[0231] In an embodiment of the invention, the method utilizes amplification primer pairs that selectively hybridize to target polynucleotides containing one or more of the SNPs described herein. The amplification reaction mixture contains a fluorescent dye, which is incorporated into the resulting amplicon.
[0232] The resulting amplicon is then subjected to HRM at gradually increasing temperatures (i.e., 0.01-0.5°C) ranging from about 50°C to about 95°C. At some point during this process, the melting temperature of the amplicon is reached and the two strands of DNA separate or "melt" apart.
[0233] HRM is monitored in real time using a fluorescent dye that is incorporated into the amplicon. The fluorescence level of the dye is monitored as the temperature is increased, and fluorescence decreases as the amount of double-stranded DNA decreases. The changes in fluorescence and temperature can be plotted on a graph known as a melting curve.
[0234] As the skilled recipient will appreciate, the T of the amplicon where the two DNA strands separate m is predictable and depends on the sequence of nucleotide bases that form the amplicon.Therefore, the melting curves appear differently, so it is possible to distinguish amplicons, including amplicons that contain polymorphisms (i.e., one or more SNPs).In fact, in some embodiments, it is possible to distinguish amplicons that contain the same polymorphism based on the difference in the surrounding DNA sequence.
[0235] HRM curves can be distinguished from one another by many different strategies. For example, in many cases, HRM curves can be distinguished based on clear differences in curve shape and / or based on Tm, with a difference of 0.2°C being considered significant. In other cases, difference graph analysis can be used, in which a given curve is used as a baseline and other normalized curves are plotted against the baseline (see Price, E. P. et al. 2007). In still other cases, a difference graph-based method can be used, involving deriving the 3rd and 97th percentile values from the mean ± 1.96 standard deviation for fluorescence at all temperatures (see Andersson, P. et al. 2009 and Merchant-Patel, S. et al. 2008).
[0236] 3. Kit This specification describes how various SNPs and gene copy numbers in the 16S rRNA gene can be used as "tools" to quantify bacteria in a sample. These findings of the present invention enable the inventors to develop gene / allele-based and gene product-based probes, tools, reagents, methods, and assays for quantifying bacteria in a sample.
[0237] In this regard, the kit may include one or more control samples, such as those described herein, for determining the reference level, value, or curve, and / or information regarding obtaining the reference level, value, or curve. In some embodiments, the kit may further include instructions for using the kit to quantify bacteria, as described herein.
[0238] In one embodiment, the kit or assay includes at least one isolated probe, tool, or reagent capable of identifying, partially identifying, or classifying at least one bacterium in a sample, wherein the probe, tool, or reagent is capable of binding to, detecting, or determining the presence or absence of at least one single nucleotide polymorphism (SNP), such as those described herein, in at least a portion of a bacterial 16S rRNA gene. In certain embodiments, the at least one SNP is at a position corresponding to at least one of positions 273, 378, 408, 412, 440, 488, 647, 653, 737, 755, 762, and 776 of the 16S rRNA gene set forth in SEQ ID NO:1.
[0239] In one embodiment, at least one of said isolated probes, tools or reagents is capable of distinguishing between a sample containing at least one bacterium and a sample not containing at least one bacterium.
[0240] In certain embodiments, the kit or assay is or comprises an array or microarray of oligonucleotide probes for identifying bacteria and optionally one or more additional bacteria in a sample, said probes comprising oligonucleotides that hybridize to at least one SNP in the 16S rRNA gene in the sample as broadly described above.
[0241] In another embodiment, the kit or assay is or comprises a biochip comprising a solid substrate and at least one oligonucleotide probe for identifying the bacteria and optionally one or more further bacteria in the sample, wherein at least one of said probes comprises an oligonucleotide that hybridizes to at least one SNP in the 16S rRNA gene in the sample as broadly described above.
[0242] All essential materials and reagents required for amplifying a target nucleic acid in a sample and / or one or more control samples and / or for detecting one or more SNPs in the 16S rRNA gene according to the present invention can be assembled together in a kit. The kit may include appropriate reagents for detecting labels, positive and negative controls, fluorescent dyes, wash solutions, blotting membranes, microtiter plates, dilution buffers, etc. For example, a nucleic acid-based detection kit for identifying polymorphisms may include one or more of the following: (i) nucleic acid from Gram-positive and / or Gram-negative cells (which can be used as a positive control); and (ii) primers and / or probes that specifically hybridize to at least a portion of the 16S rRNA gene containing the SNP position(s) to be analyzed, and, optionally, one or more other markers at or surrounding the suspected SNP site. Enzymes suitable for nucleic acid amplification, including various polymerases (e.g., reverse transcriptase, Taq, Sequenase™ DNA ligase, etc., depending on the nucleic acid amplification technique used), deoxynucleotides, and buffers may also be included to provide the reaction mixture required for amplification. Such kits will also typically include, in suitable means, separate containers for each individual reagent and enzyme, and each primer or probe. The kits may also feature various equipment and reagents for performing one of the assays described herein; and / or printed instructions for using the kit to identify the presence of a SNP as defined herein.
[0243] In some embodiments, the methods generally described herein are performed, at least in part, by a processing system, such as a suitably programmed computer system. Standalone computers with microprocessor-executed application software enabling the execution of the methods can be used. Alternatively, the methods can be performed, at least in part, by one or more processing systems operating as part of a distributed architecture. For example, a processing system can be used to calculate the amount or concentration of a target nucleic acid in a sample by measuring the amount or concentration of an amplification product and comparing the amount or concentration of the amplification product to its reference level, and / or to quantify bacteria by determining genome copy number from the amount or concentration of the target nucleic acid in a sample. A processing system can also be used to identify bacteria based on the detection of one or more SNPs. In some examples, commands entered into the processing system by a user can assist the processing system in these determinations.
[0244] In one example, the processing system includes at least one microprocessor, memory, input / output devices such as a keyboard and / or display device, and an external interface interconnected through a bus. The external interface can be utilized to connect the processing system to peripheral devices such as a communication network, database, or storage device. The microprocessor can execute instructions in the form of application software stored in memory to enable the execution of SNP detection and / or bacterial quantification processes, as well as to perform any other required processing, such as communication with a computer system. The application software can include one or more software modules and can be executed within a suitable execution environment, such as an operating system environment.
[0245] 3.1 Primers, probes, kits, and processing systems for the 16S rRNA gene Non-limiting examples of primers and probes useful for the methods of the present invention are provided below in which SNPs in the 16S rRNA of a bacterial species at positions corresponding to positions 273, 378, 408, 412, 440, 488, 647 and / or 653 of the 16S rRNA gene set forth in SEQ ID NO: 1 are analyzed.
[0246] For example, to detect the SNP at position 273, exemplary forward primers include CCTCTTGCCATCGGATGTG (SEQ ID NO: 16), and exemplary reverse primers include CCAGTGTGGCTGGTCATCCT (SEQ ID NO: 17), CGATCCGAAAACCTTCTTCACT (SEQ ID NO: 20), CTATGCATCGTTGCCTTGGTAA (SEQ ID NO: 22), TGATGTACTATTAACACATCAACCTTCCT (SEQ ID NO: 26), AACGCTCGGATCTTCCGTATTA (SEQ ID NO: 27), CGCTCGCCACCTACGTATTAC (SEQ ID NO: 28), CGTAGTTAGCCGTCCCTTTCTG (SEQ ID NO: 30), GGAATTCTACCCCCCTCTACGA (SEQ ID NO: 34), and GGAATTCTACCCCCCTCTACAAG (SEQ ID NO: 35).
[0247] To detect the SNP at position 378, exemplary forward primers include CCTCTTGCCATCGGATGTG (SEQ ID NO: 16), CCTACGGGAGGCAGCAGTAG (SEQ ID NO: 18), GGGAGGCAGCAGTAGGGAAT (SEQ ID NO: 19), and GGTATTAACTTACTGCCCTTCCTCCC (SEQ ID NO: 48); and exemplary reverse primers include CGATCCGAAAACCTTCTTCACT (SEQ ID NO: 20), CTATGCATCGTTGCCTTGGTAA (SEQ ID NO: 22), TGATGTACTATTAACACATCAACCTTCCT (SEQ ID NO: 26), AACGCTCGGATCTTCCGTATTA (SEQ ID NO: 27), CGCTCGCCACCTACGTATTAC (SEQ ID NO: 28), CGTAGTTAGCCGTCCCTTTCTG (SEQ ID NO: 30), GGAATTCTACCCCCCTCTACGA (SEQ ID NO: 34), GGAATTCTACCCCCCTCTACAAG (SEQ ID NO: 35), and CCGCTACACATGGAATTCCAC (SEQ ID NO: 49).
[0248] To detect the SNP at position 408, an exemplary forward primer includes GACTCCTACGGGAGGCAGCAGTGGG (SEQ ID NO: 50) and an exemplary reverse primer includes GGTATTAACTTACTGCCCTTCCTCCC (SEQ ID NO: 51).
[0249] To detect the SNP at position 412, exemplary forward primers include CCTCTTGCCATCGGATGTG (SEQ ID NO: 16), CCTACGGGAGGCAGCAGTAG (SEQ ID NO: 18), GGGAGGCAGCAGTAGGGAAT (SEQ ID NO: 19), and AAGACGGTCTGCTGTCACTTATAGA (SEQ ID NO: 21); and exemplary reverse primers include CTATGCATCGTTGCCTTGGTAA (SEQ ID NO: 22), TGATGTACTATTAACACATCAACCTTCCT (SEQ ID NO: 26), AACGCTCGGATCTTCCGTATTA (SEQ ID NO: 27), CGCTCGCCACCTACGTATTAC (SEQ ID NO: 28), CGTAGTTAGCCGTCCCTTTCTG (SEQ ID NO: 30), GGAATTCTACCCCCCTCTACGA (SEQ ID NO: 34), and GGAATTCTACCCCCCTCTACAAG (SEQ ID NO: 35).
[0250] To detect the SNP at position 440, exemplary forward primers include CCTCTTGCCATCGGATGTG (SEQ ID NO: 16), CCTACGGGAGGCAGCAGTAG (SEQ ID NO: 18), GGGAGGCAGCAGTAGGGAAT (SEQ ID NO: 19), AAGACGGTCTGCTGTCACTTATAGA (SEQ ID NO: 21), TGCCGCGTGAATGAAGAA (SEQ ID NO: 23), GCGTGAAGGATGAAGGCTCTA (SEQ ID NO: 24), and TGATGAAGGTTTTCGGATCGT (SEQ ID NO: 25); and exemplary reverse primers include TGATGTACTATTAACACATCAACCTTCCT (SEQ ID NO: 26), AACGCTCGGATCTTCCGTATTA (SEQ ID NO: 27), CGCTCGCCACCTACGTATTAC (SEQ ID NO: 28), CGTAGTTAGCCGTCCCTTTCTG (SEQ ID NO: 30), GGAATTCTACCCCCCTCTACGA (SEQ ID NO: 34), and GGAATTCTACCCCCCTCTACAAG (SEQ ID NO: 35).
[0251] To detect the SNP at position 488, exemplary forward primers include CCTCTTGCCATCGGATGTG (SEQ ID NO: 16), CCTACGGGAGGCAGCAGTAG (SEQ ID NO: 18), GGGAGGCAGCAGTAGGGAAT (SEQ ID NO: 19), AAGACGGTCTGCTGTCACTTATAGA (SEQ ID NO: 21), TGCCGCGTGAATGAAGAA (SEQ ID NO: 23), GCGTGAAGGATGAAGGCTCTA (SEQ ID NO: 24), TGATGAAGGTTTTCGGATCGT (SEQ ID NO: 25), and GTTGTAAGAGAAGAACGAGTGTGAGAGT (SEQ ID NO: 29); and exemplary reverse primers include CGTAGTTAGCCGTCCCTTTCTG (SEQ ID NO: 30), GGAATTCTACCCCCCTCTACGA (SEQ ID NO: 34), and GGAATTCTACCCCCCTCTACAAG (SEQ ID NO: 35).
[0252] To detect SNPs at positions 647 and / or 653, exemplary forward primers include CCTCTTGCCATCGGATGTG (SEQ ID NO: 16), CCTACGGGAGGCAGCAGTAG (SEQ ID NO: 18), GGGAGGCAGCAGTAGGGAAT (SEQ ID NO: 19), AAGACGGTCTGCTGTCACTTATAGA (SEQ ID NO: 21), TGCCGCGTGAATGAAGAA (SEQ ID NO: 23), GCGTGAAGGATGAAGGCTCTA (SEQ ID NO: 24), TGATGAAGGTTTTCGG ATCGT (SEQ ID NO: 25), GTTGTAAGAGAAGAACGAGTGTGAGAGT (SEQ ID NO: 29), GCGGTTTGTTAAGTCAGATGTGAA (SEQ ID NO: 31), GGTCTGTCAAGTCGGATGTGAA (SEQ ID NO: 32), and TCAACCTGGGAACTCATTCGA (SEQ ID NO: 33); and exemplary reverse primers include GGAATTCTACCCCCCTCTACGA (SEQ ID NO: 34), and GGAATTCTACCCCCCTCTACAAG (SEQ ID NO: 35).
[0253] Similarly, non-limiting examples of primers and probes useful for the methods of the invention in which SNPs in the 16S rRNA gene or 16S rRNA of a bacterial species are analyzed at positions corresponding to positions 746, 764, 771, or 785 of the 16S rRNA gene set forth in SEQ ID NO:38 (or positions 737, 755, 762, or 776 of the 16S rRNA gene set forth in SEQ ID NO:1) include those set forth in Table 7.
[0254] 4. Application of the method of the present invention The methods of the present invention are useful for quantifying one or more bacteria in a sample, such as a sample from a subject, or an environmental sample, such as a soil or water sample, or a sample taken from a device or instrument (e.g., a medical or surgical instrument) or a work surface. Such quantification can then be used, for example, to determine a course of treatment to remove, eradicate, or reduce the number of bacteria. Any two or more of the methods of the present invention may be combined. For example, bacteria in a biological sample from a subject with a bacterial infection can be quantified to determine the subject's prognosis and how to treat the infection.
[0255] Clinicians in clinics, emergency rooms, general wards, and intensive care units are often presented with subjects with an infection or suspected infection. Such patients often have nondiagnostic clinical signs, such as an abnormal body temperature, increased heart and respiratory rates, and abnormal white blood cell counts. Clinicians must determine whether the patient has an infection, the severity of the infection, whether to admit the patient to a hospital (if not already hospitalized), the source of the infection, whether to use antibiotics, and if so, the type, route, and dose of antibiotics. The presence of infection in a patient is most commonly investigated by taking a sample from the patient and growing organisms in culture medium. Once grown, organisms can be identified by Gram staining. However, such methods do not accurately quantify the level of bacterial infection in a subject and therefore cannot provide an outlook for the patient's prognosis. Without quantifying bacteria, clinicians must rely on their clinical judgment to determine the subject's treatment.
[0256] Thus, the methods of the present invention are particularly useful for helping clinicians determine prognosis, appropriate courses of treatment, and treatment efficacy based on quantification and, where appropriate, identification of the bacteria causing the infection. In certain embodiments, the methods of the present invention can be used to determine antibiotic resistance in a subject.
[0257] The methods of the present invention can also be performed in an efficient time frame, so that results are available to clinicians within hours rather than days. Such attributes enable clinicians to sensitively quantify bacterial levels in a subject and make informed treatment decisions. These improvements can result in reduced patient hospitalizations, more sensitive detection of bacteria, infection severity, reduced use of broad-spectrum antibiotics / medications, reduced patient time on broad-spectrum antibiotics, reduced toxicity from antibiotics / medications, and reduced development of drug resistance (especially antibiotic resistance).
[0258] Based on the results of the methods of the present invention, the subject can be appropriately managed and therapy administered, if necessary. For example, management of a bacterial infection can include administration of a therapeutic agent, such as, for example, a course of a therapeutically effective antibiotic.
[0259] Generally, therapeutic agents are administered in the form of pharmaceutical (or veterinary, if the subject is a non-human subject) compositions together with a pharmaceutically acceptable carrier, and in an amount effective to achieve their intended purpose. The dose of the active compound administered to a subject should be sufficient to achieve a beneficial response in the subject over time, such as reduction or alleviation of symptoms of infection and / or reduction or elimination of bacteria from the subject. The amount of pharmaceutically active compound(s) to be administered may depend on the subject being treated, for example, its age, sex, weight, and general health. In this regard, the precise amount of active compound(s) for administration depends on the judgment of the practitioner. In determining the effective amount of active compound(s) to be administered in the treatment or prevention of bacterial infection, the practitioner can assess the severity of the infection and the severity of any symptoms associated with the infection, including inflammation, abnormal blood pressure, tachycardia, rapid breathing, fever, chills, vomiting, diarrhea, skin rash, headache, confusion, muscle pain, and seizures. In any event, one of ordinary skill in the art can readily determine suitable dosages of therapeutic agents and suitable treatment regimens without undue experimentation.
[0260] Therapeutic agents can be administered in conjunction with supportive (symptomatic) therapies to increase oxygen delivery to vital organs, increase blood flow to vital organs, and / or reduce inflammatory responses. Illustrative examples of such supportive therapies include nonsteroidal anti-inflammatory drugs (NSAIDs), intravenous saline, and oxygen.
[0261] Embodiments of the present invention are further described in the following sections: [Section 1] 1. A method for determining the amount or concentration of bacteria in a sample, comprising: (a) amplifying said bacterial target nucleic acid from genetic material obtained from said sample to form an amplification product, said target nucleic acid comprising at least a portion of a bacterial 16S rRNA gene; (b) measuring the amount or concentration of the amplification product; (c) calculating the amount or concentration of the target nucleic acid in the sample by comparing the amount or concentration of the amplification product with its reference level; and (d) determining the copy number of the bacterial 16S rRNA gene in the sample from the amount or concentration of the target nucleic acid in the sample, wherein the copy number is a function of or correlates with the amount of the bacterium in the sample. A method comprising: [Section 2] Item 1. The method according to item 1, wherein the target nucleic acid comprises one or more single nucleotide polymorphisms (SNPs) in the bacterial 16S rRNA gene. [Section 3] Item 3. The method according to item 2, wherein the one or more SNPs correspond to at least one of positions 273, 378, 408, 412, 440, 488, 647, 653, 737, 755, 762 and 776 of the 16S rRNA gene as set forth in SEQ ID NO:1. [Section 4] The method of any one of the preceding clauses, further comprising generating said reference level from one or more control samples. [Section 5] 5. The method of claim 4, wherein the step of generating the reference level comprises amplifying the target nucleic acid from the one or more control samples, the control samples comprising a known amount or concentration of genetic material. [Section 6] 6. The method according to paragraph 5, wherein amplifying the target nucleic acid from the one or more control samples is carried out substantially simultaneously or in parallel with step (a). [Section 7] 7. The method of any one of paragraphs 4 to 6, wherein the one or more control samples further comprise genetic material from one or more additional bacteria. [Section 8] A method according to any one of paragraphs 1 to 7, wherein amplifying the target nucleic acid from the genetic material of the sample and / or the one or more control samples is carried out using a pair of primers comprising at least one of SEQ ID NOs: 16 to 37 and 48 to 51. [Section 9] 9. The method of any one of paragraphs 1 to 8, wherein amplifying the target nucleic acid from the genetic material of the sample and / or the one or more control samples comprises the use of quantitative PCR, semi-quantitative PCR, digital PCR, end-point PCR, ligase chain reaction (LCR), Sanger sequencing, next-generation sequencing, or any combination thereof. [Section 10] 10. The method according to any one of items 1 to 9, further comprising identifying the bacteria in the sample. [Section 11] 11. The method according to claim 10, wherein the step of identifying the bacterium comprises analyzing the amplification product for the presence or absence of at least one SNP. [Section 12] Item 12. The method according to item 11, wherein the at least one SNP is located at a position corresponding to at least one of positions 273, 378, 408, 412, 440, 488, 647, 653, 737, 755, 762, and 776 of the 16S rRNA gene as set forth in SEQ ID NO:1. [Section 13] 13. The method of claim 11 or 12, wherein the step of analyzing the amplification products for the presence or absence of the at least one SNP comprises the use of high-resolution melting analysis, 5' nuclease digestion, molecular beacons, oligonucleotide ligation, microarrays, restriction fragment length polymorphisms, antibody detection methods, direct sequencing, or any combination thereof. [Section 14] The copy number of the bacterial 16S rRNA gene is determined using the following formula: TIFF2026027396000021.tif15103A method according to any one of items 1 to 13, wherein X is the amount of the amplification product and N is the nucleotide length of the target nucleic acid. [Section 15] 15. The method according to any one of items 1 to 14, wherein the sample is a biological sample such as sputum, blood, cerebrospinal fluid or urine taken from a subject. [Section 16] Item 16. The method according to item 15, wherein the subject has an infection caused by the bacterium. [Section 17] A method for determining the prognosis of a bacterial infection in a subject, comprising a step of quantifying the bacteria in a biological sample from the subject by the method described in any one of items 1 to 16, thereby assessing the prognosis of the infection in the subject. [Section 18] 1. A method of treating a bacterial infection in a subject, comprising: 17. A method comprising the steps of quantifying the bacteria in a biological sample from the subject by the method according to any one of items 1 to 16, and initiating, continuing, changing or discontinuing treatment for the infection based on the quantification. [Section 19] 1. A method for assessing the effectiveness of a treatment for a bacterial infection in a subject, comprising: Quantifying the bacteria in a biological sample from the subject by the method according to any one of items 1 to 16 above; and determining whether the treatment is effective based on whether the amount of the bacteria in the subject's biological sample is reduced or absent. [Section 20] 20. The method according to any one of paragraphs 16 to 19, wherein the subject has sepsis. [Section 21] 21. A kit or assay for quantifying bacteria in a sample or biological sample, comprising one or more reagents and instructions for use to carry out the method of any one of paragraphs 1 to 20 above. References throughout this specification to "one embodiment" or "an embodiment" mean that a particular feature, structure, or characteristic described in connection with that embodiment is included in at least one embodiment of the present invention. Thus, appearances of the phrases "in one embodiment" or "in an embodiment" in various places throughout this specification are not necessarily all referring to the same embodiment. Furthermore, particular features, structures, or characteristics may be combined in any suitable manner in one or more combinations.
[0262] In accordance with the statute, the invention has been described in terms more or less specific to structural or methodological features. It is to be understood that the invention is not limited to the specific features shown or described, as the means described herein comprise preferred modes of carrying out the invention. The invention is therefore claimed in any of its forms or modified forms within the proper scope of the appended claims, if any, as appropriately interpreted by those skilled in the art.
[0263] All computer programs, algorithms, patents, accession numbers, and scientific literature referred to herein are hereby incorporated by reference in their entirety.
[0264] In order that the present invention may be readily understood and put into practice, certain preferred embodiments will be described by way of the following non-limiting examples. [Example]
[0265] Example 1 The method (InfectID®) uses the core principles of real-time PCR (qPCR) and high-resolution melting (HRM) to accurately quantify and identify pathogens in a given patient sample. The process involves drawing blood directly from the patient, extracting pathogen DNA, amplifying it, and measuring the HRM curve to differentiate species. Like other molecular identification systems, the InfectID® process amplifies DNA to detectable levels. However, a key difference is that DNA is amplified alongside a sample of control DNA, which is present in known amounts. These amounts form a gradient, allowing a line of best fit to be drawn correlating DNA (ng) with volume (μl). An example is shown in Figure 1.
[0266] It is only after the amount of DNA is measured during amplification that it is separated for HRM curve analysis and speciation. Once the amount of DNA is measured in nanograms (ng), the number of bacterial cells or genome copies can be calculated using the genome copy number formula:
[0267] Gene copy number is the number of copies of a gene in a given pathogen genotype. InfectID® identifies and amplifies a region of the 16S gene, and because bacteria only have one chromosome, measuring the number of 16S molecules in a sample directly correlates with the number of bacterial cells. Different pathogens have different numbers of 16S genes in their chromosomes; for example, Staphylococcus aureus has five copies of the 16S gene, while Klebsiella pneumoniae has eight copies. Taking this variation into account, the total number of bacteria can be calculated using known values, for example, using the algorithm below, by dividing the total number of gene copies by the number of 16S copies in the genome.
[0268]
number
[0269] result A summary of the sensitivity of InfectID® is shown below in Table 9. These cell values were quantified from DNA data from Rotorgene, which was then used in the genome copy formula above.
[0270] [Table 9]
[0271] A major obstacle for InfectID® is disrupting current nomenclature, helping clinicians and pathologists understand what the susceptible genome copy number is and how this relates to CFU and total cells. To do this, the inventors performed multiple experiments to quantify the number of pathogenic cells in a given sample. Colonies of several species of interest were grown for 12-16 hours, depending on the species, and then a single colony of known pathogenic cell concentration was spiked into the sample. As an example, growth of E. coli over a 12-hour period yielded 10 7 ~10 8 This results in colonies of cells. Because E. coli is the fastest growing bacterium, all other colonies will have fewer cells in the first place, further demonstrating the strength of InfectID® sensitivity. Blood and spiking were performed on single colonies diluted 10-fold in serial dilutions as shown in Figure 2.
[0272] When performing experiments with the InfectID system, PBS and blood were spiked with the pathogen of interest to test sensitivity and specificity. During this time, samples of the spiked components were plated onto a conventional culture plate assay. The resulting CFU counts were compared to the InfectID results, as illustrated in Table 10 below.
[0273] [Table 10]
[0274] Flow cytometry is the direct counting of individual molecules based on size and fluorescence. In this context, bacterial cells are stained with a fluorescent dye and individual bacteria are counted as they are scanned one cell at a time through a laser.
[0275] The results of the quantification experiment are shown in Figure 3. Due to the limited ability to count individual colonies at lower dilutions, results were recorded only at the higher dilutions for plate counts. The total number of cells shown below relates to the volume of sample used in the InfectID®, which was 350 μL. Table 11 shows the data illustrated in Figure 3 and is provided below.
[0276] [Table 11]
[0277] Example 2 background The methods of the present invention can help reduce the impact of sepsis, a global public health threat that claims millions of lives and costs billions each year.
[0278] Sepsis is a potentially life-threatening response to infection. Identifying the pathogen causing the infection and the subsequent most effective course of treatment can take many hours, even days. Meanwhile, clinicians can only guess as to which antibiotics are needed to contain this fast-moving and frequently fatal condition. As a result, while awaiting test results, physicians commonly administer broad-spectrum antibiotics, which are often inappropriate and therefore ineffective.
[0279] InfectID® detects sepsis-causing pathogens directly from blood (no culture required). InfectID® is based on testing a small number of SNPs to separate and identify multiple pathogens of interest. To do this, InfectID® uses real-time PCR followed by high-resolution melting curve analysis (MCA) to pinpoint the pathogen species directly in the blood.
[0280] The extremely low levels of bacteria (1–100 cells / mL) found in the blood of septic patients increase the challenge of rapid diagnosis (Reimer et al., 1997). Two further studies have also shown that when patients begin to show clinical symptoms of sepsis, the concentration of bacteria present in the blood is very low (1–100 CFU / mL in adults (Yagupsky et al., 1990) and <10 CFU / mL in neonates (Reier-Nilsen et al., 2009)). The current gold standard for diagnosing bloodstream infections and sepsis is blood culture, and the severe limitation of the gold standard is that the concentration of bacteria in a suspension must typically rise to 10 CFU / mL before it can be detected (Smith et al., 2008).
[0281] In a series of 20 adults with bacteremia and septic shock, Hall and Gold (1955) found that all 6 patients with >100 CFU / mL blood died, while only 41% of patients with less bacteremia died. The number of microorganisms in the blood correlated moderately with the occurrence and severity of septic shock, although some patients with bacterial counts as high as 300 CFU / mL blood did not suffer from shock. In another study, Weil and Spink (1958) found a correlation between the severity of bacteremia and fatal outcome in patients with gram-negative sepsis. Mortality in 8 patients with 5 CFU isolated from the patient's blood increased the mortality rate to 84%.
[0282] InfectID® has been demonstrated to be a highly specific and sensitive direct-from-blood diagnostic test that identifies the top 20 bacterial and 5 yeast pathogens most commonly associated with bloodstream infections and sepsis. The utility of InfectID® as a tool for determining the severity of bloodstream infections and sepsis may have a significant impact on patient antibiotic treatment.
[0283] The aim of this example was to determine the limits of detecting sepsis-causing bacterial species in spiked EDTA blood using InfectID®. method 1. In total, 20 of the most prevalent bacterial species were tested in this study. 2. Twenty American Type Culture Collection (ATCC) bacterial species were cultured on brain heart infusion agar overnight at 37°C. A single bacterial colony from each bacterial species was used to spike 3.1 mL of EDTA blood, which was then serially diluted 1:9 to generate a dilution series of spiked blood. 4. DNA was extracted from the spiked blood samples using the Roche MagNApure system. 5. Additionally, 1 mL of EDTA blood obtained from patients admitted to the Royal Brisbane & Women's Hospital was also subjected to DNA extraction using the Roche Magnapure system. 6. InfectID® SNP primers (Integrated DNA Technologies, Australia) were designed to amplify regions encompassing highly discriminatory SNPs. PCR product sizes ranged from 79 bp to 96 bp. 7. Quantitative real-time PCR (qPCR) was used to determine the concentrations of 20 bacterial species in the contaminating blood and patient blood. The qPCR process was as follows: 1 microliter of extracted DNA (1–3 ng) was added to a 19-μl reaction mastermix containing 10 μl of 2× Type-it-HRM Mastermix (Qiagen, Australia) and 8 pmol of each primer. The temperature cycle for these reactions was as follows: 50°C for 2 minutes, 95°C for 2 minutes, followed by 40 cycles of 95°C for 15 seconds, 52°C for 20 seconds, and 72°C for 35 seconds, followed by a 72°C hold for 2 minutes, followed by a 50°C hold for 20 seconds (RotorGeneQ, Qiagen, Australia). 8. RotorGeneQ (Qiagen, Australia) software allows users to visualize HRM data in multiple ways: normalized raw melting curves, which represent decreasing fluorescence versus increasing temperature, and difference curves, which show a user-defined curve as the baseline (i.e., x-axis) and represent other normalized curves relative to that baseline.
[0284] result The limits of detection for the various bacterial species tested are shown in Table 13, and a melting curve analysis of this data is shown in Figure 6.
[0285] Data regarding testing and bacterial quantification of patient samples are illustrated in Table 14.
[0286] [Table 12]
[0287] [Table 13]
[0288] conclusion This study demonstrates the ability of InfectID® to detect very low genome copy numbers of the top 20 bacterial species known to cause bloodstream infections and sepsis, in both spiked and patient blood samples.
[0289] Example 3 380 patient whole blood samples obtained from hospitalized patients at the Royal Brisbane and Women's Hospital and Mackay Base Hospital were investigated. Blood culture (BacTAlert) results were obtained from Pathology Queensland. Additionally, the same samples were run on InfectID®, which included identifying the bacteria present in the sample and quantifying the bacterial cells present in 350 μL of blood using the method of the present invention (accomplished simultaneously within the same study). Finally, all patient clinical metadata was evaluated and classified to rank patients as high, medium, or low risk based on clinical assessment criteria. The results are provided in Table 17 below.
[0290] Blood culture process: Blood cultures are used to test for the presence of systemic bloodstream infections. Two or more blood samples are drawn from separate sites (typically from veins in the patient's arm). Collection of multiple samples can increase the chances of detecting an infection. After collection, the blood is transferred to blood culture bottles, such as BacT / ALERT® media. These bottles are sent to a routine diagnostic laboratory, where they are placed in an incubation system, such as a BacT / ALERT® machine. If bacteria or yeast are present in the patient's blood, these microorganisms grow in the blood culture bottle, producing CO2. The machine periodically measures the amount of CO2; once a threshold amount is produced, the blood culture bottle is labeled, and a laboratory technician removes the bottle from the machine and processes the patient sample for microbial identification using standard microbial culture techniques.
[0291] InfectID® Process In absolute quantification using the standard curve method, unknowns are quantified based on known amounts. First, a standard curve is generated using 10-fold serially diluted reference DNA of known concentration, which is used as the input sample for the InfectID® test. These reactions are run alongside the unknown samples, and the unknowns are then compared to the standard curve, from which values are extrapolated, which are the cycle times (C) from real-time PCR amplification. t ) based on
[0292] C T An example of a typical standard curve for log copy number is illustrated in Figure 14A (Yun JJ, Heisler L, Hwang IIL, Wilkins O. 2006. Genomic DNA functions as a universal external standard in quantitative real-time PCR. Nucleic Acids Research, 34(12): e85). Points containing the line are labeled with copy number. Figure 14B shows the C standard curve obtained from the amplification plot. T The values shown represent the change in normalized signal (expressed as copy number) of the five standards between 20 and 40 cycles of PCR. t is the cycle at which the fluorescence crosses the threshold.
[0293] The InfectID® process was carried out similarly to that in Example 2. Briefly: 1. A reference sample of known concentration (see Table 15) was diluted 10 times to provide a reference sample. The patient blood sample described above was also used. 2. DNA was extracted from reference and patient blood samples using the Roche MagNApure system. 3. Quantitative real-time PCR (qPCR) under the same conditions was performed on the reference sample and the patient blood sample. This determined whether the bacterial species was present in the patient blood sample. If so, the qPCR data was analyzed as outlined above to determine the concentration of bacteria present. The qPCR process was as follows: 1 microliter of extracted DNA (1-3 ng) was added to a 19 μl reaction mastermix containing 10 μl of 2× Type-it-HRM® Mastermix (Qiagen, Australia) and 8 pmol of each primer (primers designed to amplify regions encompassing highly discriminatory SNPs in 16S rRNA (see SEQ ID NOS: 16-37 and 48-51)). The temperature cycle for these reactions was as follows: 50°C for 2 min, 95°C for 2 min, followed by 40 cycles of 95°C for 15 s, 52°C for 20 s, and 72°C for 35 s, a 2-min hold at 72°C, and a 20-s hold at 50°C (RotorGeneQ, Qiagen, Australia). The size of the PCR products ranged from 79 bp to 96 bp. 4. RotorGeneQ (Qiagen, Australia) software allows users to visualize HRM data in multiple ways: normalized raw melting curves, which represent decreasing fluorescence versus increasing temperature, and difference curves, which show a user-defined curve as the baseline (i.e., x-axis) and other normalized curves relative to that baseline. 5. Using the above formula, the concentration of bacteria present was determined.
[0294] [Table 14-1] [Table 14-2]
[0295] Clinical evaluation criteria Patient metadata was assessed and classified by the Emergency Department Adult Sepsis Pathway for Tertiary and Secondary Facilities, Queensland, to rank patients as high, medium, or low based on clinical assessment criteria (provided in Table 16).
[0296] [Table 15]
[0297] [Table 16-1] [Table 16-2]
[0298] reference 1. Reimer LG, Wilson ML, Weinstein MP. Update on detection of bacteremia and fungemia. Clin Microbiol Rev. 1997; 10:444-65. 2. Yagupsky P., Nolte F. 1990. Quantitative aspects of septicemia. Clin. Microbiol. Rev. 3:269-279. 3. Reier-Nilsen T., Farstad T., Nakstad B., Lauvrak V., Steinbakk M. 2009. Comparison of broad range 16S rDNA PCR and conventional blood culture for diagnosis of sepsis in the newborn: a case control study. BMC Pediatr. 9:5. 4. Smith, J., Y. Serebrennikova, D. Huffman, G. Leparc, and L. Garcia Rubio. 2008. A new method for the detection of microorganisms in blood cultures: Part I. Theoretical analysis and simulation of blood culture processes. Can. J. Chem. Eng. 86:947-959. 5. Hall, W. H., and D. Gold. 1955. Shock associated with bacteremia. Arch. Intern. Med. 96:403-412. 6. Weil, M. H., and W. W. Spink. 1958. The shock syndrome associated with bacteremia due to gram-negative bacilli. Arch. Intern. Med. 101:184-193. 7. Yun JJ, Heisler L, Hwang IIL, Wilkins O. 2006. Genomic DNA functions as a universal external standard in quantitative real-time PCR. Nucleic Acids Research, 34(12): e85.
Claims
1. 1. A method for determining the amount or concentration of bacteria in a sample, comprising: (a) amplifying said bacterial target nucleic acid from genetic material obtained from said sample to form an amplification product, said target nucleic acid comprising at least a portion of a bacterial 16S rRNA gene; (b) measuring the amount or concentration of the amplification product; (c) calculating the amount or concentration of the target nucleic acid in the sample by comparing the amount or concentration of the amplification product with its reference level; and (d) determining the copy number of the bacterial 16S rRNA gene in the sample from the amount or concentration of the target nucleic acid in the sample, wherein the copy number is a function of or correlates with the amount of the bacterium in the sample. A method comprising:
2. 2. The method of claim 1, wherein the target nucleic acid comprises one or more single nucleotide polymorphisms (SNPs) in the bacterial 16S rRNA gene.
3. 3. The method of claim 2, wherein the one or more SNPs correspond to at least one of positions 273, 378, 408, 412, 440, 488, 647, 653, 737, 755, 762, and 776 of the 16S rRNA gene as set forth in SEQ ID NO:
1.
4. 10. The method of any one of the preceding claims, further comprising generating said reference level from one or more control samples.
5. 5. The method of claim 4, wherein generating the reference level comprises amplifying the target nucleic acid from the one or more control samples, the control samples comprising a known amount or concentration of genetic material.
6. 6. The method of claim 5, wherein amplifying the target nucleic acid from the one or more control samples is carried out substantially simultaneously or in parallel with step (a).
7. 7. The method of claim 4, wherein the one or more control samples further comprise genetic material from one or more additional bacteria.
8. 8. The method of any one of claims 1 to 7, wherein amplifying the target nucleic acid from the genetic material of the sample and / or the one or more control samples is carried out with a pair of primers comprising at least one of SEQ ID NOs: 16 to 37 and 48 to 51.
9. 9. The method of any one of claims 1 to 8, wherein amplifying the target nucleic acid from the genetic material of the sample and / or the one or more control samples comprises the use of quantitative PCR, semi-quantitative PCR, digital PCR, end-point PCR, ligase chain reaction (LCR), Sanger sequencing, next generation sequencing, or any combination thereof.
10. 10. The method of claim 1, further comprising identifying the bacteria in the sample.
11. 11. The method of claim 10, wherein the step of identifying the bacterium comprises analyzing the amplification product for the presence or absence of at least one SNP.
12. 12. The method of claim 11, wherein the at least one SNP is at a position corresponding to at least one of positions 273, 378, 408, 412, 440, 488, 647, 653, 737, 755, 762, and 776 of the 16S rRNA gene as set forth in SEQ ID NO:
1.
13. 13. The method of claim 11 or 12, wherein analyzing the amplification products for the presence or absence of the at least one SNP comprises the use of high-resolution melting analysis, 5' nuclease digestion, molecular beacons, oligonucleotide ligation, microarrays, restriction fragment length polymorphisms, antibody detection methods, direct sequencing, or any combination thereof.
14. The copy number of the bacterial 16S rRNA gene is determined using the following formula: [Equation 1] 14. The method of claim 1, wherein X is the amount of the amplification product and N is the length in nucleotides of the target nucleic acid.
15. 15. The method of any one of claims 1 to 14, wherein the sample is a biological sample such as sputum, blood, cerebrospinal fluid or urine taken from a subject.
16. 16. The method of claim 15, wherein the subject has an infection with the bacteria.
17. A method for determining the prognosis of a bacterial infection in a subject, comprising a step of quantifying the bacteria in a biological sample from the subject by a method described in any one of claims 1 to 16, thereby assessing the prognosis of the infection in the subject.
18. 1. A method of treating a bacterial infection in a subject, comprising:
17. A method comprising the steps of quantifying the bacteria in a biological sample from the subject by the method of any one of claims 1 to 16, and initiating, continuing, modifying or discontinuing treatment for the infection based on the quantification.
19. 1. A method for assessing the effectiveness of a treatment for a bacterial infection in a subject, comprising: Quantifying the bacteria in a biological sample from the subject by the method of any one of claims 1 to 16; and determining whether the treatment is effective based on whether the amount of the bacteria in the subject's biological sample is reduced or absent.
20. 20. The method of any one of claims 16 to 19, wherein the subject has sepsis.
21. 21. A kit or assay for quantifying bacteria in a sample or biological sample, comprising one or more reagents and instructions for carrying out the method of any one of claims 1 to 20.