Compositions and methods comprising clostridium butyricum for the treatment of cancer
Combining Clostridium butyricum with anti-cancer agents like nivolumab and ipilimumab modulates gut microbiota, addressing the limitations of current mRCC treatments by enhancing immunotherapy efficacy and patient outcomes.
Patent Information
- Application Number
- JP2025174464
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2020-04-21
- Filing Date
- 2025-10-16
- Publication Date
- 2026-02-25
AI Technical Summary
Current treatments for metastatic renal cell carcinoma (mRCC) using immunotherapy combinations like nivolumab and ipilimumab show limited efficacy, with approximately 20% of patients developing progressive disease, necessitating the need for novel approaches to enhance clinical outcomes.
Administering a combination treatment of an anti-cancer agent with Clostridium butyricum, specifically in the form of Clostridium butyricum MIYAIRI 588 (CBM588 LBP), to modulate the gut microbiota and enhance the immune response against cancer.
The combination treatment with Clostridium butyricum improves patient response rates and survival outcomes by restoring beneficial gut bacteria and enhancing the effectiveness of immunotherapy, demonstrating improved response and progression-free survival.
Smart Images

Figure 2026031928000001_ABST
Abstract
Description
[Technical Field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 63 / 013,141, filed April 21, 2020, the entire contents of which are incorporated herein by reference for all purposes. Reference to an appendix listing a "Sequence Listing," a table, or a computer program submitted as an ASCII file
[0002] The sequence listing set forth in file 048440-758001 WO_SequenceListing_ST 25.txt, machine format IBM-PC, MS Windows Operating System, created on April 20, 2021, 4,096 bytes, is incorporated herein by reference. [Background technology]
[0003] More than 65,000 patients were diagnosed with renal cell carcinoma in the United States in 2018. 1 At initial presentation, one-third of cases are metastatic, and the remainder progress at various rates to metastatic disease. The current treatment algorithm involves surgery followed by a series of FDA-approved agents. Over the past decade, multiple agents have been approved for the treatment of metastatic renal cell carcinoma (mRCC), including targeted therapies (sunitinib, sorafenib, axitinib, pazopanib, everolimus, axitinib, cabozantinib) or immunotherapy with either nivolumab monotherapy or a combination of nivolumab and ipilimumab. 2 Nivolumab and ipilimumab are fully human monoclonal antibodies that target the programmed cell death protein 1 (PD-1) and cytotoxic T-lymphocyte antigen 4 (CTLA-4) pathways, respectively. Inhibition of the PD-1 and CTLA-4 immune checkpoint pathways overcomes the immune evasion mechanisms of tumor cells and enhances antitumor activity.
[0004] CheckMate 214 3compared the combination of nivolumab and ipilimumab with sunitinib, which was considered the standard of care for patients with mRCC. 4 Overall survival and objective response rates were significantly improved with the immunotherapy combination compared with sunitinib (18-month overall survival 75% vs. 60%, and objective response rate 42% vs. 27%, respectively). While these response rates are impressive, it is important to note that they reflect a small number of patients with mRCC. Furthermore, approximately 20% of patients receiving the nivolumab / ipilimumab combination in the frontline setting develop progressive disease. Therefore, significant efforts are currently underway to build on this regimen and identify novel approaches to improve the clinical efficacy of the nivolumab / ipilimumab combination. 3 Provided herein, among other things, are solutions to these and other problems in the art. Summary of the Invention
[0005] In an aspect, a method of treating cancer in a subject in need thereof is provided, comprising administering to the subject therapeutically effective amounts of an anti-cancer agent and Clostridium butyricum.
[0006] In one aspect, a method of treating cancer in a subject in need thereof is provided, comprising administering to the subject an effective amount of an anti-cancer agent and a live biological preparation of Clostridium butyricum MIYAIRI 588 (CBM588 LBP).
[0007] In another aspect, a pharmaceutical composition is provided that includes an anticancer agent in a first dosage form and Clostridium butyricum in a second dosage form.
[0008] In another aspect, a pharmaceutical composition is provided comprising an anticancer agent and Clostridium butyricum MIYAIRI 588 (CBM588 LBP).
[0009] In another aspect, a kit is provided that includes: (a) a first pharmaceutical composition comprising an anticancer drug and a pharmaceutically acceptable excipient in a first dosage form in a suitable container or in suitable packaging; and (b) a second pharmaceutical composition comprising Clostridium butyricum in a second dosage form in a suitable container or in suitable packaging.
[0010] In an aspect, a kit is provided that includes: (a) a first pharmaceutical composition comprising an anticancer drug and a pharmaceutically acceptable excipient in a first dosage form in a suitable container or in suitable packaging; and (b) a second pharmaceutical composition comprising a Clostridium butyricum MIYAIRI 588 (CBM588 LBP) preparation in a second dosage form in a suitable container or in suitable packaging. [Brief explanation of the drawings]
[0011] [Figure 1A] Figures 1A and 1B are principal coordinate analysis (PCoA) plots showing the microbiota of patients responding to sunitinib (Figure 1A) and nivolumab (Figure 1B). "P" indicates tumor progression, and "R" indicates response to treatment. [Figure 1B] Figures 1A and 1B are principal coordinate analysis (PCoA) plots showing the microbiota of patients responding to sunitinib (Figure 1A) and nivolumab (Figure 1B). "P" indicates tumor progression, and "R" indicates response to treatment. [Figure 2] Responses are shown for patients treated with nivolumab / ipilimumab, nivolumab / ipilimumab + CBM588 LBP, or no treatment (control group). The nivolumab / ipilimumab + CBM588 LBP treatment group is marked with a dotted arrow, the nivolumab / ipilimumab treatment group is marked with a solid arrow, and the untreated group is marked with no arrow. [Figure 3] 1 is a bar graph showing the response of patients receiving nivolumab / ipilimumab (Group 2) or nivolumab / ipilimumab plus CBM588 LBP (Group 1). Patient response was measured according to RECIST and is shown as the change from baseline in the percentage of target lesions in the bottom panel. [Figure 4]1 is a graph showing tumor response as measured by RECIST for patients receiving nivolumab / ipilimumab treatment (Group 2) or nivolumab / ipilimumab plus CBM588 LBP treatment (Group 1). [Figure 5] Graph showing the proportion of patients with progression-free survival by week. Patients were treated with nivolumab / ipilimumab or nivolumab / ipilimumab plus CBM588 LBP. [Figure 6] 1 shows overall survival for patients treated with nivolumab / ipilimumab or nivolumab / ipilimumab plus CBM588 LBP. Overall survival was measured in weeks. [Figure 7] Graph showing changes in target lesions in patients treated with nivolumab / ipilimumab or nivolumab / ipilimumab plus CBM588 LBP. [Figure 8] To demonstrate response and disease progression in patients treated with nivolumab / ipilimumab or nivolumab / ipilimumab + CBM588 LBP. [Figure 9A] Figures 9A and 9B are graphs showing the relative abundance of the bacterial species Bacillus pumilus (Figure 9A) and Bacillus berezensis (Figure 9B) in patients who were responsive (R) to CBM588 treatment compared to patients who were non-responsive (NR) to CBM588 treatment at Time 1 and Time 2. [Figure 9B] Figures 9A and 9B are graphs showing the relative abundance of the bacterial species Bacillus pumilus (Figure 9A) and Bacillus berezensis (Figure 9B) in patients who were responsive (R) to CBM588 treatment compared to patients who were non-responsive (NR) to CBM588 treatment at Time 1 and Time 2. [Figure 10A]Figures 10A-10F are graphs showing the relative abundance of Butyricimonas faecalis (Figure 10A), Finegoldia magna (Figure 10B), Clostridioides difficile (Figure 10C), Ruminococcus albus (Figure 10D), Treponema species RCC2812 (Figure 10E), and Thermoanaerobacter kivui (Figure 10F) in patients who were responsive (R) to CBM588 treatment compared to patients who were non-responsive (NR) to CBM588 treatment at Time 1 and Time 2. [Figure 10B] Figures 10A-10F are graphs showing the relative abundance of Butyricimonas faecalis (Figure 10A), Finegoldia magna (Figure 10B), Clostridioides difficile (Figure 10C), Ruminococcus albus (Figure 10D), Treponema species RCC2812 (Figure 10E), and Thermoanaerobacter kivui (Figure 10F) in patients who were responsive (R) to CBM588 treatment compared to patients who were non-responsive (NR) to CBM588 treatment at Time 1 and Time 2. [Figure 10C] Figures 10A-10F are graphs showing the relative abundance of Butyricimonas faecalis (Figure 10A), Finegoldia magna (Figure 10B), Clostridioides difficile (Figure 10C), Ruminococcus albus (Figure 10D), Treponema species RCC2812 (Figure 10E), and Thermoanaerobacter kivui (Figure 10F) in patients who were responsive (R) to CBM588 treatment compared to patients who were non-responsive (NR) to CBM588 treatment at Time 1 and Time 2. [Figure 10D]Figures 10A-10F are graphs showing the relative abundance of Butyricimonas faecalis (Figure 10A), Finegoldia magna (Figure 10B), Clostridioides difficile (Figure 10C), Ruminococcus albus (Figure 10D), Treponema species RCC2812 (Figure 10E), and Thermoanaerobacter kivui (Figure 10F) in patients who were responsive (R) to CBM588 treatment compared to patients who were non-responsive (NR) to CBM588 treatment at Time 1 and Time 2. [Figure 10E] Figures 10A-10F are graphs showing the relative abundance of Butyricimonas faecalis (Figure 10A), Finegoldia magna (Figure 10B), Clostridioides difficile (Figure 10C), Ruminococcus albus (Figure 10D), Treponema species RCC2812 (Figure 10E), and Thermoanaerobacter kivui (Figure 10F) in patients who were responsive (R) to CBM588 treatment compared to patients who were non-responsive (NR) to CBM588 treatment at Time 1 and Time 2. [Figure 10F] Figures 10A-10F are graphs showing the relative abundance of Butyricimonas faecalis (Figure 10A), Finegoldia magna (Figure 10B), Clostridioides difficile (Figure 10C), Ruminococcus albus (Figure 10D), Treponema species RCC2812 (Figure 10E), and Thermoanaerobacter kivui (Figure 10F) in patients who were responsive (R) to CBM588 treatment compared to patients who were non-responsive (NR) to CBM588 treatment at Time 1 and Time 2. [Figure 11A] Figures 11A-11C are graphs showing a comparative analysis of the relative abundance of Clostridiaceae species, including Clostridium kluyveri (Figure 11A), Clostridium pasteurianum (Figure 11B), and Clostridium species BNL1100 (Figure 11C), in patients who responded to CBM588 treatment (R) compared to patients who did not respond to CBM588 treatment (NR) at Time 1 and Time 2. [Figure 11B]Figures 11A-11C are graphs showing a comparative analysis of the relative abundance of Clostridiaceae species, including Clostridium kluyveri (Figure 11A), Clostridium pasteurianum (Figure 11B), and Clostridium species BNL1100 (Figure 11C), in patients who responded to CBM588 treatment (R) compared to patients who did not respond to CBM588 treatment (NR) at Time 1 and Time 2. [Figure 11C] Figures 11A-11C are graphs showing a comparative analysis of the relative abundance of Clostridiaceae species, including Clostridium kluyveri (Figure 11A), Clostridium pasteurianum (Figure 11B), and Clostridium species BNL1100 (Figure 11C), in patients who responded to CBM588 treatment (R) compared to patients who did not respond to CBM588 treatment (NR) at Time 1 and Time 2. [Figure 12A] Figures 12A-12C are graphs showing the relative abundance of bacterial species, including Aminopila species CBA3637 (Figure 12A), Bacteroides thetaiotaomicron (Figure 12B), and Bifidobacterium breve (Figure 12C), in patients who were responsive (R) to CBM588 treatment compared to patients who were non-responsive (NR) to CBM588 treatment at Time 1 and Time 2. [Figure 12B] Figures 12A-12C are graphs showing the relative abundance of bacterial species, including Aminopila species CBA3637 (Figure 12A), Bacteroides thetaiotaomicron (Figure 12B), and Bifidobacterium breve (Figure 12C), in patients who were responsive (R) to CBM588 treatment compared to patients who were non-responsive (NR) to CBM588 treatment at Time 1 and Time 2. [Figure 12C]Figures 12A-12C are graphs showing the relative abundance of bacterial species, including Aminopila species CBA3637 (Figure 12A), Bacteroides thetaiotaomicron (Figure 12B), and Bifidobacterium breve (Figure 12C), in patients who were responsive (R) to CBM588 treatment compared to patients who were non-responsive (NR) to CBM588 treatment at Time 1 and Time 2. [Figure 13A] Figures 13A-13E are graphs showing an analysis of the relative abundance of the phylum Actinobacteria (Figure 13E), class Actinomycetia (Figure 13D), order Bifidobacteriales (Figure 13C), family Bifidobacteriaceae (Figure 13B), and genus Bifidobacterium (Figure 13A) in patients who were responsive (R) to CBM588 treatment compared to patients who were non-responsive (NR) to CBM588 treatment at Time 1 and Time 2. [Figure 13B] Figures 13A-13E are graphs showing an analysis of the relative abundance of the phylum Actinobacteria (Figure 13E), class Actinomycetia (Figure 13D), order Bifidobacteriales (Figure 13C), family Bifidobacteriaceae (Figure 13B), and genus Bifidobacterium (Figure 13A) in patients who were responsive (R) to CBM588 treatment compared to patients who were non-responsive (NR) to CBM588 treatment at Time 1 and Time 2. [Figure 13C] Figures 13A-13E are graphs showing an analysis of the relative abundance of the phylum Actinobacteria (Figure 13E), class Actinomycetia (Figure 13D), order Bifidobacteriales (Figure 13C), family Bifidobacteriaceae (Figure 13B), and genus Bifidobacterium (Figure 13A) in patients who were responsive (R) to CBM588 treatment compared to patients who were non-responsive (NR) to CBM588 treatment at Time 1 and Time 2. [Figure 13D]Figures 13A-13E are graphs showing an analysis of the relative abundance of the phylum Actinobacteria (Figure 13E), class Actinomycetia (Figure 13D), order Bifidobacteriales (Figure 13C), family Bifidobacteriaceae (Figure 13B), and genus Bifidobacterium (Figure 13A) in patients who were responsive (R) to CBM588 treatment compared to patients who were non-responsive (NR) to CBM588 treatment at Time 1 and Time 2. [Figure 13E] Figures 13A-13E are graphs showing an analysis of the relative abundance of the phylum Actinobacteria (Figure 13E), class Actinomycetia (Figure 13D), order Bifidobacteriales (Figure 13C), family Bifidobacteriaceae (Figure 13B), and genus Bifidobacterium (Figure 13A) in patients who were responsive (R) to CBM588 treatment compared to patients who were non-responsive (NR) to CBM588 treatment at Time 1 and Time 2. DETAILED DESCRIPTION OF THE INVENTION
[0012] Studies described herein demonstrate that the presence of several types of gut bacteria (e.g., Bifidobacterium) in patients receiving immunotherapy (e.g., checkpoint inhibitors) for the treatment of cancer (e.g., metastatic cancer, microsatellite instability-high cancer, etc.) may indicate a predisposition to immunotherapy response. For example, butyric acid bacteria (e.g., Clostridium butyricum MIYAIRI 588) have immunomodulatory and anti-inflammatory effects on the intestinal epithelium and can restore bacterial species, including Bifidobacterium and Lactobacillus species, in the intestine. Described herein are compositions and methods that involve administering a combination treatment (e.g., an anti-cancer therapeutic agent and Clostridium butyricum) to a subject in need thereof. Applicants have identified the biological effects of Clostridium butyricum in combination with an anti-cancer agent (e.g., a checkpoint inhibitor (e.g., nivolumab, ipilimumab, etc.)) and demonstrated the efficacy of the combination treatment in cancer treatment.
[0013] While various embodiments and aspects of the present invention have been shown and described herein, it will be apparent to those skilled in the art that such embodiments and aspects are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It will be understood that various alternatives to the embodiments of the invention described herein may be used in practicing the invention.
[0014] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents or portions of documents cited in this application, including but not limited to patents, patent applications, articles, books, manuals, and treatises, are expressly incorporated herein by reference in their entirety for any purpose.
[0015] Unless otherwise defined, technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. See, for example, Singleton et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY 2nd ed., J. Wiley & Sons (New York, NY 1994); Sambrook et al., MOLECULAR CLONING, A LABORATORY MANUAL, Cold Springs Harbor Press (Cold Springs Harbor, NY 1989). Any methods, devices, and materials similar or equivalent to those described herein can be used in the practice of the present invention. The following definitions are provided to facilitate understanding of certain terms frequently used herein and are not intended to limit the scope of the present disclosure. definition
[0016] An amino acid residue of a protein "corresponds to" a given residue if it occupies the same essential structural position within the protein as the given residue.
[0017] The term "amino acid" refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those that are later modified, such as hydroxyproline, γ-carboxyglutamate, and O-phosphoserine. Amino acid analogs refer to compounds that have the same basic chemical structure as a naturally occurring amino acid (i.e., an α-carbon bonded to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methylsulfonium). Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid. Amino acid mimetics refer to chemical compounds that have a structure different from the general chemical structure of an amino acid but function in a manner similar to a naturally occurring amino acid. The terms "non-naturally occurring amino acid" and "unnatural amino acid" refer to amino acid analogs, synthetic amino acids, and amino acid mimetics that are not found in nature.
[0018] Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes.
[0019] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues, which, in embodiments, may be conjugated to a moiety that is not composed of amino acids. The term applies to amino acid polymers in which one or more amino acid residues are artificial chemical mimetics of corresponding naturally occurring amino acids, as well as to naturally occurring and non-naturally occurring amino acid polymers. A "fusion protein" refers to a chimeric protein encoding two or more separate protein sequences that are recombinantly expressed as a single moiety.
[0020] With respect to amino acid sequences, those skilled in the art will recognize that individual substitutions, deletions, or additions to a nucleic acid, peptide, polypeptide, or protein sequence that alter, add, or delete a single amino acid or a small percentage of amino acids in the encoded sequence are "conservatively modified variants," in that the changes result in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables that result in functionally similar amino acids are well known in the art. Such conservatively modified variants are in addition to, and do not exclude, polymorphic variants, interspecies homologs, and alleles of the present disclosure.
[0021] "Percent sequence identity" is determined by comparing two optimally aligned sequences over a comparison window, where the portion of the polynucleotide or polypeptide sequence in the comparison window may contain additions or deletions (i.e., gaps) compared to a reference sequence (which does not contain additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions where the identical nucleic acid base or amino acid residue occurs in both sequences to obtain the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percent sequence identity.
[0022] The term "identical" or "percent identity," in the context of two or more nucleic acid or polypeptide sequences, refers to two or more sequences or subsequences that contain the same or a specified percentage of identical amino acid residues or nucleotides (i.e., about 60% identity, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region when compared and aligned for closest correspondence over a comparison window or designated region), as determined using the BLAST or BLAST 2.0 sequence comparison algorithm with default parameters described below, or by manual alignment and visual inspection (see, e.g., the NCBI website http: / / www.ncbi.nlm.nih.gov / BLAST / ). Such sequences are then said to be "substantially identical." This definition also refers to or can be applied to the complement of a test sequence. This definition also includes sequences that have deletions and / or additions, as well as sequences that have substitutions. As explained below, preferred algorithms can account for gaps, etc. Preferably, identity exists over a region that is at least about 25 amino acids or nucleotides in length, or more preferably over a region that is 50-100 amino acids or nucleotides in length.
[0023] The "position" of an amino acid or nucleotide base is indicated by a number sequentially identifying each amino acid (or nucleotide base) in the reference sequence based on its position relative to the N-terminus (or 5'-terminus). Due to deletions, insertions, truncations, fusions, etc., which must be considered when determining optimal alignment, the number of amino acid residues in a test sequence, determined by simple counting from the N-terminus, is generally not necessarily the same as the number at that corresponding position in the reference sequence. For example, if a variant has a deletion relative to the aligned reference sequence, there will be no mutant amino acid corresponding to the reference sequence position at the deletion site. If an insertion is present in the aligned reference sequence, the insertion will not correspond to a numbered amino acid position in the reference sequence. In the case of a truncation or fusion, there may be stretches of amino acids in the reference or aligned sequence that do not correspond to any amino acids in the corresponding sequence.
[0024] The terms "numbered with reference to" or "corresponding to," when used in the context of the numbering of a given amino acid or polynucleotide sequence, refer to the numbering of the residues of a particular reference sequence when comparing the given amino acid or polynucleotide sequence to the reference sequence.
[0025] The term "amino acid side chain" refers to a functional substituent found on an amino acid. For example, the amino acid side chain can be the side chain of a naturally occurring amino acid. Naturally occurring amino acids are those encoded by the genetic code (e.g., alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, or valine), as well as amino acids that are later modified, such as hydroxyproline, γ-carboxyglutamate, and O-phosphoserine. In embodiments, the amino acid side chain can be a non-natural amino acid side chain. In some embodiments, the amino acid side chain can be H, [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] or [ka] is.
[0026] The term "antibody" refers to a polypeptide encoded by immunoglobulin genes or functional fragments thereof that specifically binds and recognizes an antigen. Recognized immunoglobulin genes include the kappa, lambda, alpha, gamma, delta, epsilon, and mu constant region genes, as well as the myriad immunoglobulin variable region genes. Light chains can be classified as either kappa or lambda. Heavy chains may be classified as gamma, mu, alpha, delta, or epsilon, which in turn define the immunoglobulin classes: IgG, IgM, IgA, IgD, and IgE, respectively.
[0027] When referring to a protein or peptide, the phrases "specifically (or selectively) bind" or "specifically (or selectively) immunoreactive" with an antibody frequently refer to a binding reaction that allows the determination of the presence of the protein in a heterogeneous population of proteins and other biologics. Thus, under specified immunoassay conditions, a specified antibody binds to a particular protein at least twice as much as background, more typically more than 10-100 times as much as background. Specific binding to an antibody under such conditions requires the antibody to be selected for its specificity for a particular protein. For example, polyclonal antibodies can be selected to obtain only a subset of antibodies that are specifically immunoreactive with a selected antigen and not with other proteins. This selection can be achieved by subtracting out antibodies that cross-react with other molecules. A variety of immunoassay formats can be used to select antibodies specifically immunoreactive with a particular protein. For example, solid-phase ELISA immunoassays are routinely used to select antibodies specifically immunoreactive with proteins (see, e.g., Harlow & Lane, Using Antibodies, A Laboratory Manual (1998) for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity).
[0028] An exemplary immunoglobulin (antibody) structural unit comprises a tetramer. Each tetramer is composed of two identical pairs of polypeptide chains, each pair having one "light" chain (about 25 kDa) and one "heavy" chain (about 50-70 kDa). The N-terminus of each chain defines a variable region of about 100-110 or more amino acids primarily responsible for antigen recognition. The "variable heavy chain," "V" H The term "variable light chain" or "VH" refers to the variable region of an immunoglobulin heavy chain, including Fv, scFv, dsFv, or Fab. L The term "VL" or "VL" refers to the variable region of an immunoglobulin light chain, including an Fv, scFv, dsFv or Fab.
[0029] Examples of functional antibody fragments include, but are not limited to, complete antibody molecules, antibody fragments such as Fv, single-chain Fv (scFv), complementarity-determining regions (CDRs), VL (light chain variable region), VH (heavy chain variable region), Fab, F(ab)2', and any combination thereof, or any other functional portion of an immunoglobulin peptide capable of binding to a target antigen (see, for example, Fundamental Immunology (Paul ed., 4th ed. 2001)). As will be recognized by those skilled in the art, various antibody fragments can be obtained by various methods, for example, digestion of intact antibodies with enzymes such as pepsin, or de novo synthesis. Antibody fragments are often synthesized de novo, either chemically or by using recombinant DNA methodology. Thus, the term antibody, as used herein, includes antibody fragments either produced by the modification of whole antibodies or synthesized de novo using recombinant DNA methodologies (e.g., single-chain Fvs) or identified using phage display libraries (see, e.g., McCafferty et al., (1990) Nature 348:552). The term "antibody" also includes bivalent or bispecific molecules, diabodies, triabodies, and tetrabodies. Bivalent and bispecific molecules have been described, for example, in Kostelny et al. (1992) J. Immunol. 148:1547, Pack and Pluckthun (1992) Biochemistry 31:1579, Hollinger et al. (1993) PNAS.USA 90:6444, Gruber et al. (1994) J. Immunol. 152:5368, Zhu et al. (1997) Protein Sci. 6:781, Hu et al. (1996) Cancer Res. 56:3055, Adams et al. (1993) Cancer Res. 53:4026, and McCartney, et al. (1995) Protein Eng. 8:301.
[0030] A "chimeric antibody" is (a) an antibody molecule in which the constant region or a portion thereof has been altered, substituted, or exchanged so that the antigen-binding site (variable region) is linked to a constant region of a different or altered class, effector function, and / or species, or to an entirely different molecule, such as an enzyme, toxin, hormone, growth factor, drug, etc., that confers new properties to the chimeric antibody, or (b) an antibody molecule in which the variable region or a portion thereof has been altered, substituted, or exchanged with a variable region having a different or altered antigen specificity. Preferred antibodies of the invention and for use in accordance with the invention include humanized and / or chimeric monoclonal antibodies.
[0031] The term "isolated," when applied to a nucleic acid or protein, indicates that the nucleic acid or protein is essentially free from other cellular components with which it is naturally associated. It can be, for example, in a homogeneous state, either a dry solution or an aqueous solution. Purity and homogeneity are typically determined using analytical chemistry techniques such as polyacrylamide gel electrophoresis or high performance liquid chromatography. A protein that is the predominant species present in a preparation is substantially purified.
[0032] "Percent sequence identity" is determined by comparing two optimally aligned sequences over a comparison window, where the portion of the polynucleotide or polypeptide sequence in the comparison window may contain additions or deletions (i.e., gaps) compared to a reference sequence (which does not contain additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions where the identical nucleic acid base or amino acid residue occurs in both sequences to obtain the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percent sequence identity.
[0033] The term "identical" or "percent identity," in the context of two or more nucleic acid or polypeptide sequences, refers to two or more sequences or subsequences that contain the same or a specified percentage of identical amino acid residues or nucleotides (i.e., about 60% identity, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region when compared and aligned for closest correspondence over a comparison window or designated region), as determined using the BLAST or BLAST 2.0 sequence comparison algorithm with default parameters described below, or by manual alignment and visual inspection (see, e.g., the NCBI website http: / / www.ncbi.nlm.nih.gov / BLAST / ). Such sequences are then said to be "substantially identical." This definition also refers to or can be applied to the complement of a test sequence. This definition also includes sequences that have deletions and / or additions, as well as sequences that have substitutions. As explained below, preferred algorithms can account for gaps, etc. Preferably, identity exists over a region that is at least about 25 amino acids or nucleotides in length, or more preferably over a region that is 50-100 amino acids or nucleotides in length.
[0034] For particular proteins described herein, the named protein includes any naturally occurring form, variant, or homolog of the protein that maintains protein transcription factor activity (e.g., within the range of at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% activity compared to the native protein). In some embodiments, the variant or homolog has at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a portion of 50, 100, 150, or 200 contiguous amino acids) compared to the naturally occurring form. In other embodiments, the protein is a protein identified by its NCBI sequence reference. In other embodiments, the protein is a protein identified by its NCBI sequence reference, a homolog, or a functional fragment thereof.
[0035] The term "CTLA-4" or "CTLA-4 protein" as provided herein includes either recombinant or naturally occurring forms of cytotoxic T-lymphocyte-associated protein 4 (CTLA-4) or variants or homologs thereof that maintain the activity of the CTLA-4 protein (e.g., activity comprised at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% compared to CTLA-4). In some aspects, the variant or homolog has at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a portion of 50, 100, 150, or 200 contiguous amino acids) compared to a naturally occurring CTLA-4 polypeptide. In embodiments, the CTLA-4 is the protein identified by UniProt reference number P16410, a homolog, or a functional fragment thereof.
[0036] As referred to herein, "PD-1 protein" or "PD-1" includes either recombinant or naturally occurring forms of programmed cell death protein 1 (PD-1), also known as cluster of differentiation 279 (CD279), or variants or homologs thereof that maintain the activity of the PD-1 protein (e.g., in the range of at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% compared to the PD-1 protein). In some embodiments, the variant or homolog has at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a portion of 50, 100, 150, or 200 contiguous amino acids) compared to a naturally occurring form of the PD-1 protein. In embodiments, the PD-1 protein is substantially identical to the protein identified by UniProt reference number Q15116, or a variant or homolog having substantial identity thereto. In an embodiment, the PD-1 protein is substantially identical to the protein identified by UniProt reference number Q02242 or a variant or homolog having substantial identity thereto.
[0037] "PD-L1" or "PD-L1 protein" as referred to herein includes either recombinant or naturally occurring forms of programmed death-ligand 1 (PD-L1), also known as cluster of differentiation 274 (CD274), or variants or homologs thereof that maintain PD-L1 activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the activity of PD-L1). In some aspects, the variant or homolog has at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., a portion of 50, 100, 150 or 200 contiguous amino acids) compared to a naturally occurring form of the PD-L1 protein. In embodiments, the PD-L1 protein is substantially identical to the protein identified by UniProt Reference Number Q9NZQ7, or a variant or homolog having substantial identity thereto.
[0038] The term "disease" or "condition" refers to a state or condition of a patient or subject that can be treated with the compounds or methods provided herein. The disease can be cancer. The disease can be an autoimmune disease. The disease can be an inflammatory disease. The disease can be an infectious disease. In some further examples, "cancer" refers to human cancers and carcinomas, sarcomas, adenocarcinomas, lymphomas, leukemias, etc., including solid and lymphoid cancers, kidney, breast, lung, bladder, colon, ovary, prostate, pancreas, stomach, brain, head and neck, skin, uterus, testes, glioma, esophagus, and cancer of the liver, e.g., hepatocellular carcinoma, lymphomas, e.g., B-acute lymphoblastic lymphoma, non-Hodgkin's lymphoma (e.g., Burkitt's small cell lymphoma and large cell lymphoma), Hodgkin's lymphoma, leukemia (including AML, ALL, and CML), or multiple myeloma.
[0039] As used herein, the term "cancer" refers to all types of cancer, neoplasm, or malignant tumors found in mammals (e.g., humans), including leukemia, lymphoma, carcinoma, and sarcoma. Exemplary cancers that can be treated with the compositions, compounds, or methods provided herein include metastatic renal cell carcinoma (mRCC), non-small cell lung cancer, melanoma, sarcoma, lymphoma, breast cancer, bladder cancer, cervical cancer, colon cancer, head and neck cancer, liver cancer, gastric cancer, or rectal cancer. The cancer may be a microsatellite instability-high cancer. Further examples include cervical, uterine, gastric, thyroid cancer, carcinoma of the bile duct, pancreatic adenocarcinoma, cutaneous melanoma, colon adenocarcinoma, rectal adenocarcinoma, gastric adenocarcinoma, esophageal cancer, head and neck squamous cell carcinoma, invasive breast cancer, lung adenocarcinoma, lung squamous cell carcinoma, non-small cell lung cancer, mesothelioma, multiple myeloma, medulloblastoma, neuroblastoma, glioma, glioblastoma multiforme, ovarian cancer, rhabdomyosarcoma, primary thrombocytosis, primary macroglobulinemia, primary brain tumor, neuroblastoma, malignant pancreatic ipilimumab, cancer, including insulanoma, malignant carcinoid, bladder cancer, premalignant skin lesions, testicular cancer, thyroid cancer, Hodgkin's disease, non-Hodgkin's lymphoma, esophageal cancer, genitourinary tract cancer, malignant hypercalcemia, endometrial cancer, adrenocortical carcinoma, endocrine or exocrine malignant neoplasm of the pancreas, medullary thyroid carcinoma, melanoma, colorectal cancer, papillary thyroid carcinoma, hepatocellular carcinoma, or prostate cancer.
[0040] As used herein, the terms "metastasis" and "metastatic" can be used interchangeably and refer to the spread of a proliferative disease or disorder, such as cancer, from one organ or another non-adjacent organ or part of the body. "Metastatic cancer" is sometimes referred to as "stage IV cancer." Cancer originates in a primary site, such as the kidney, which is called the primary tumor, e.g., primary kidney cancer. Some cancer cells from the primary tumor or site of origin acquire the ability to penetrate and infiltrate the surrounding normal tissues of the local area and / or penetrate the walls of the lymphatic or vascular system and circulate to other sites and tissues in the body. A second, clinically detectable tumor formed from cancer cells of the primary tumor is called a metastatic or secondary tumor. When cancer cells metastasize, the metastatic tumor and its cells are presumed to be similar to those of the original tumor. Thus, the term metastatic cancer can refer to a disease in which a subject has or previously had a primary tumor, or one or more secondary tumors. The phrases non-metastatic cancer or a subject with non-metastatic cancer can refer to a disease in which the subject has a primary tumor but does not have one or more secondary tumors.
[0041] As used herein, the term "chemoresistant cancer" or "chemoresistant" refers to the lack of cancer's intended response to chemotherapy. Chemoresistant can refer to the decreased sensitivity of cancer to chemotherapy compared with its previous sensitivity to chemotherapy. Thus, chemotherapy resistance can occur even though cancer previously responded to chemotherapy. Chemoresistant can refer to the ability of cancer cells to survive and grow despite chemotherapy treatment.
[0042] The term "treat" or "treatment" refers to any indication of success in treating or ameliorating an injury, disease, pathology, or condition, including any objective or subjective parameter, such as relief, remission, diminishing symptoms, or making the injury, pathology, or condition more tolerable to the patient, slowing the rate of degeneration or decline, making the end point of degeneration less debilitating, or improving the patient's physical or mental health. The treatment or amelioration of symptoms can be based on objective or subjective parameters, including the results of a physical examination, neuropsychiatric examination, and / or psychiatric evaluation. The term "treatment" and its conjugations can include prevention of an injury, condition, state, or disease. In embodiments, treating is preventing. In embodiments, treating does not include preventing.
[0043] As used herein (and as well understood in the art), "treating" or "treatment" also broadly includes any approach to obtaining beneficial or desired results in a subject's condition, including clinical results. Beneficial or desired clinical results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, reduction in the extent of the disease, stabilization of the disease state (i.e., not worsening), prevention of disease spread or metastasis, delay or slowing of disease progression, improvement or palliation of the disease state, reduction in disease recurrence, and partial or total, detectable or undetectable remission. In other words, "treatment" as used herein includes any cure, amelioration, or prevention of disease. Treatment can prevent the onset of disease, inhibit disease metastasis, alleviate symptoms of disease, completely or partially eliminate the underlying cause of disease, shorten the duration of disease, or a combination thereof.
[0044] As used herein, "treating" and "treatment" include prophylactic treatment. A therapeutic method involves administering a therapeutically effective amount of an active agent to a subject. The administration step may consist of a single administration or may include a series of administrations. The length of the treatment period depends on various factors, such as the severity of the condition, the age of the patient, the concentration of the active agent, the activity of the composition used for treatment, or a combination thereof. It will also be understood that the effective dosage of an agent used for treatment or prevention may increase or decrease over the course of a particular treatment or prevention regimen. Changes in dosage may occur and be evident by standard diagnostic assays known in the art. In some cases, long-term administration may be required. For example, a composition is administered to a subject in an amount and for a period sufficient to treat the patient. In an embodiment, the treating or treatment is not prophylactic treatment.
[0045] The term "preventing" refers to a reduction in the occurrence of disease symptoms in a patient. As noted above, prevention may be complete (no detectable symptoms) or partial, such that fewer symptoms are observed than would occur in the absence of treatment.
[0046] A "patient" or "subject in need thereof" refers to an organism suffering from or prone to a disease (e.g., cancer) or condition that can be treated by administration of the pharmaceutical compositions provided herein. Non-limiting examples include humans, other mammals, bovines, rats, mice, dogs, monkeys, goats, sheep, cows, deer, and other non-mammalian animals. In some embodiments, the patient is a human.
[0047] An "effective amount" is an amount of a compound sufficient to achieve a stated purpose relative to the absence of the compound (e.g., achieve the effect for which it is administered, treat a disease, reduce enzyme activity, increase enzyme activity, reduce a signal transduction pathway, or reduce one or more symptoms of a disease or condition). An example of an "effective amount" is an amount sufficient to contribute to the treatment, prevention, or alleviation of one or more symptoms of a disease (e.g., cancer), which may also be referred to as a "therapeutically effective amount." A "reduction" of one or more symptoms (and grammatical equivalents of this phrase) refers to a decrease in the severity or frequency of one or more symptoms, or the elimination of one or more symptoms. A "prophylactically effective amount" of a drug is an amount of drug that, when administered to a subject, achieves the intended prophylactic effect, e.g., prevents or delays the onset (or recurrence) of an injury, disease, pathology, or condition, or reduces the likelihood of the onset (or recurrence) of an injury, disease, pathology, or condition, or its symptoms. A complete prophylactic effect does not necessarily occur with the administration of a single dose, but may occur only after the administration of a series of doses. Thus, a prophylactically effective amount can be administered in one or more administrations. As used herein, an "activity-reducing amount" refers to the amount of antagonist required to reduce the activity of an enzyme compared to the absence of the antagonist. As used herein, a "function-disrupting amount" refers to the amount of antagonist required to disrupt the function of an enzyme or protein relative to the absence of the antagonist. The exact amount depends on the purpose of treatment and can be ascertained by those skilled in the art using known techniques (e.g., Lieberman, Pharmaceutical Dosage Forms (vols. 1-3, 1992); Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (1999); Pickar, Dosage Calculations (1999); and Remington: The Science and Practice of Pharmacy, 20th Edition, 2003, Gennaro, Ed., Lippincott, Williams & Wilkins).
[0048] As used herein, "therapeutically effective dose or amount" refers to a dose that produces the intended effect (e.g., treatment or prevention of disease) for which it is administered. The exact dose and formulation depend on the purpose of treatment and can be ascertained by those skilled in the art using known techniques (see, for example, Lieberman, Pharmaceutical Dosage Forms (vols. 1-3, 1992); Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (1999); Remington: The Science and Practice of Pharmacy, 20th Edition, Gennaro, Editor (2003), and Pickar, Dosage Calculations (1999)). For example, for a given parameter, a therapeutically effective amount represents at least 5%, 10%, 15%, 20%, 25%, 40%, 50%, 60%, 75%, 80%, 90%, or at least 100% increase or decrease. The therapeutic effectiveness can also be expressed as a "-fold" increase or decrease. For example, a therapeutically effective amount can be at least 1.2-fold, 1.5-fold, 2-fold, 5-fold, or more effective than a standard control. A therapeutically effective dose or amount can improve one or more symptoms of a disease. A therapeutically effective dose or amount can prevent or delay the onset of a disease or one or more symptoms of a disease when the effect for which it is administered is to treat a person at risk of developing a disease.
[0049] For any compound described herein, the therapeutically effective amount can be initially determined from cell culture assays. The target concentration is the concentration of active compound that can be achieved using the methods described herein or known in the art.
[0050] As is well known in the art, the therapeutically effective amount for human use can also be determined from animal models.For example, the dosage for human can be formulated to achieve the concentration found to be effective in animals.As described above, the dosage for human can be adjusted by monitoring the effectiveness of compound and adjusting the dosage upward or downward.Based on the above method and other methods, it is well within the ability of those skilled in the art to adjust dosage to achieve maximum effectiveness in human.
[0051] Dosage can vary depending on the requirements of the patient and the compound used. In the context of the present disclosure, the dose administered to a patient should be sufficient to affect a beneficial therapeutic response in the patient over time. The size of the dose will also be determined by the existence, nature, and extent of any adverse side effects. Determining the appropriate dosage for a particular situation is within the skill of the practitioner. Generally, treatment is initiated at a low dose that is less than the optimal dose of the compound. Thereafter, the dosage is increased by small increments until the optimal effect under the circumstances is reached. Dosage and administration interval can be individually adjusted to provide an effective level of the administered compound for the specific clinical indication being treated. This allows for a treatment regimen that is commensurate with the severity of the individual's disease state.
[0052] As used herein, the term "administering" refers to oral administration, administration as a suppository, topical contact, intravenous, parenteral, intraperitoneal, intramuscular, intralesional, intrathecal, intranasal, or subcutaneous administration to a subject, or implantation of a sustained-release device, such as a mini-osmotic pump. Administration is by any route, including parenteral and transmucosal (e.g., buccal, sublingual, palatal, gingival, nasal, vaginal, rectal, or transdermal). Parenteral administration includes, for example, intravenous, intramuscular, intraarteriolar, intradermal, subcutaneous, intraperitoneal, intraventricular, and intracranial. Other delivery modes include, but are not limited to, the use of liposomal formulations, intravenous infusion, transdermal patches, and the like. In embodiments, administering does not include administration of any active agent other than the listed active agents.
[0053] "Co-administration" means that the compositions described herein are administered simultaneously with, immediately before, or immediately after the administration of one or more additional treatments. The compounds provided herein can be administered alone or simultaneously to a patient. Co-administration includes the simultaneous or sequential administration of compounds individually or in combination (more than one compound). Thus, the preparation can also be combined with other active substances (e.g., to reduce metabolic degradation) as needed. The compositions of the present disclosure can be delivered transdermally, topically, or formulated as applicator sticks, solutions, suspensions, emulsions, gels, creams, ointments, pastes, jellies, paints, powders, and aerosols.
[0054] As used herein, "sequential administration" includes administration of two agents (e.g., compounds or compositions described herein) separately on the same day or not on the same day (e.g., occurring on consecutive days).
[0055] As used herein, "concurrent administration" includes at least partial overlap in duration. For example, when two agents (e.g., any agent or class of agents described herein having biological activity) are administered concurrently, their administration occurs within a specific desired time period. Administration of the agents can begin and end on the same day. Administration of one agent can also occur one or more days prior to administration of the second agent, as long as both agents are taken at least once on the same day. Similarly, administration of one agent can extend beyond administration of the second agent, as long as both agents are taken at least once on the same day. Bioactive agents / agents do not need to be taken at the same time every day to be considered concurrent administration.
[0056] As used herein, "intermittent administration" includes administration of a drug for a period of time (which may be considered a "first administration period"), followed by a period during which the drug is not taken or is taken at a lower maintenance dose (which may be considered a "drug holiday period"), followed by a period during which the drug is again administered (which may be considered a "second administration period"). Generally, during the second administration period, the drug dosage level will correspond to that administered during the first administration period, but may be increased or decreased depending on medical needs.
[0057] "Control" or "control experiment" is used according to its simple and ordinary meaning and refers to an experiment in which the experimental subject or reagent is treated like a parallel experiment, except for the omission of an experimental procedure, reagent, or variable. In some cases, a control is used as a standard of comparison in evaluating the effect of an experiment. In some embodiments, a control is a measurement of protein activity in the absence of a compound described herein (including embodiments and examples).
[0058] As used herein, a cancer model organism is an organism that exhibits a phenotype that indicates cancer in an organism or the activity of cancer-causing factors.The term cancer is defined above.A wide variety of organisms can serve as cancer model organisms, including cancer cells and mammalian organisms such as rodents (e.g., mice or rats) and primates (e.g., humans).Cancer cell lines are generally understood by those skilled in the art as cells that exhibit a phenotype or genotype similar to in vivo cancer.As used herein, cancer cell lines include cell lines derived from animals (e.g., mice) and humans.
[0059] As used herein, "anticancer agent" refers to a molecule (e.g., a compound, peptide, protein, nucleic acid) used to treat cancer by destroying or inhibiting cancer cells or tissues. Anticancer agents may be selective for a particular cancer or a particular tissue. In embodiments, the anticancer agent is a checkpoint inhibitor. For example, the anticancer agent may be a PD-1 inhibitor.
[0060] "Anticancer agent" is used according to its plain and ordinary meaning and refers to a composition (e.g., a compound, drug, antagonist, inhibitor, modulator) that has anti-neoplastic properties or the ability to inhibit cell growth or proliferation. In embodiments, an anticancer agent is a chemotherapeutic agent. In embodiments, an anticancer agent is an agent identified herein that has utility in methods of treating cancer. In embodiments, an anticancer agent is an agent approved by the FDA or similar regulatory authority in a country other than the United States to treat cancer.
[0061] "Selective" or "selectivity" of a compound, etc., refers to the ability of the compound to distinguish between molecular targets.
[0062] "Specific," "specifically," "specificity," and the like, with respect to a compound, refer to the ability of the compound to cause a particular effect, such as inhibition of a particular molecular target, with minimal or no effect on other proteins of the cell.
[0063] As used herein, "cell" refers to a cell that performs metabolic or other functions sufficient to preserve or replicate its genomic DNA. Cells can be identified by methods well known in the art, including, for example, the presence of an intact membrane, staining with a particular dye, the ability to produce progeny, or, in the case of gametes, the ability to combine with a second gamete to produce viable progeny. Cells can include prokaryotic and eukaryotic cells. Prokaryotic cells include, but are not limited to, bacteria. Eukaryotic cells include, but are not limited to, yeast cells and cells of plant and animal origin, such as mammalian, insect (e.g., Spodoptera), and human cells. Cells can be useful if they are naturally non-adherent or have been treated to prevent them from adhering to surfaces, for example, by trypsinization.
[0064] "Biological sample" or "sample" refers to a material obtained from or derived from a subject or patient. Biological samples can also include sections of tissue, such as biopsy and autopsy samples, as well as frozen sections taken for histological purposes. Such samples include body fluids, such as blood and blood fractions or products (e.g., serum, plasma, platelets, red blood cells, etc.), sputum, tissues, cultured cells (e.g., primary cultures, explants, and transformed cells), stool, urine, synovial fluid, articular tissue, synovial tissue, synoviocytes, fibroblast-like synoviocytes, macrophage-like synoviocytes, immune cells, hematopoietic cells, fibroblasts, macrophages, T cells, and the like. Biological samples are typically obtained from eukaryotic organisms, such as mammals, e.g., primates, e.g., chimpanzees or humans, cattle, dogs, cats, rodents, e.g., guinea pigs, rats, mice, rabbits, or birds, reptiles, or fish.
[0065] Terms such as "immune response" refer, in their normal and customary sense, to a response by an organism that protects against disease. The response can be initiated by the innate or adaptive immune system, as is well known in the art.
[0066] Terms such as "modulating an immune response" refer to a change in a subject's immune response as a result of administering an agent, e.g., a compound or composition disclosed herein, including embodiments thereof. Thus, the immune response can be activated or inactivated as a result of administering an agent, e.g., a compound or composition disclosed herein, including embodiments thereof.
[0067] "B cells" or "B lymphocytes" refer to their standard usage in the art. B cells are lymphocytes, a type of white blood cell (leukocyte), that develop into antibody-producing plasma cells ("mature B cells"). "Immature B cells" are cells that can develop into mature B cells. Generally, pro-B cells undergo immunoglobulin heavy chain rearrangement to become pro-B pre-B cells, which then undergo immunoglobulin light chain rearrangement to become immature B cells. Immature B cells include T1 and T2 B cells.
[0068] As used herein, "T cells" or "T lymphocytes" are a type of lymphocyte (a subtype of white blood cell) that plays a central role in cell-mediated immunity. They can be distinguished from other lymphocytes, such as B cells and natural killer cells, by the presence of T cell receptors on their cell surface. T cells include, for example, natural killer T (NKT) cells, cytotoxic T lymphocytes (CTLs), regulatory T (Treg) cells, and T helper cells. Different types of T cells can be distinguished by the use of T cell detection agents.
[0069] "Memory T cells" are T cells that have previously encountered and responded to their cognate antigen during a previous infection, cancer encounter, or vaccination. Upon a second encounter with their cognate antigen, the T cells can regenerate (divide) to mount a faster and stronger immune response than when the immune system first responded to the pathogen.
[0070] "Regulatory T cells" or "suppressor T cells" are lymphocytes that regulate the immune system, maintain tolerance to self-antigens, and prevent autoimmune diseases.
[0071] As used herein, the terms "immune checkpoint molecule," "immune checkpoint protein," or "checkpoint protein" may be used interchangeably and refer to molecules that can regulate the duration and amplitude of physiological immune responses. Immune checkpoint molecules can inhibit (reduce) immune responses. Examples of inhibitory checkpoint molecules include, but are not limited to, PD-1, PD-L1, CTLA-4, adenosine A2A receptor (A2AR), B7-H3, B7-H4, BTLA, indoleamine 2,3-dioxygenase (IDO), killer immunoglobulin-like receptor (KIR), LAG3, PD-1, TIM-3, and V-domain immunoglobulin suppressor of T-cell activation (VISTA) protein. Alternatively, immune checkpoint molecules can stimulate (increase) immune responses. Examples of stimulatory checkpoint molecules include, but are not limited to, members of the tumor necrosis factor (TNF) receptor superfamily (e.g., CD27, CD40, OX40, glucocorticoid-inducible TNFR family-related gene (GITR), and CD137), members of the B7-CD28 superfamily (e.g., CD28 itself and inducible T cell costimulator (ICOS)).
[0072] Similarly, an "immune checkpoint inhibitor" or "checkpoint inhibitor" as provided herein refers to a substance (e.g., an antibody or fragment thereof, a small molecule) that can inhibit or adversely affect (e.g., reduce) the activity or function of a checkpoint protein (e.g., reduce expression or reduce activity of a checkpoint protein) compared to the activity or function of the checkpoint protein in the absence of the inhibitor. A checkpoint inhibitor may at least partially, partially, or fully block a stimulus, reduce, prevent, or delay activation, or inactivate, desensitize, or downregulate signaling or enzymatic activity or the amount of a checkpoint protein. A "checkpoint inhibitor" may inhibit a checkpoint protein, for example, by binding, partially or fully blocking, reducing, preventing, delaying, inactivating, desensitizing, or downregulating the activity of the checkpoint protein. In embodiments, the checkpoint inhibitor is a small molecule. In embodiments, the checkpoint inhibitor is an antibody. In embodiments, the checkpoint inhibitor is an antibody fragment. In embodiments, the checkpoint inhibitor is an antibody variant. Thus, a PD-1 inhibitor is a molecule that adversely affects (e.g., decreases) the activity or function of PD-1. In embodiments, the PD-1 inhibitor is pembrolizumab, nivolumab, or cemiplimab. A PD-L1 inhibitor is a molecule that adversely affects (e.g., decreases) the activity or function of PD-L1. In embodiments, the PD-L1 inhibitor is atezolizumab, avelumab, or durvalumab. A CTLA-4 inhibitor is a molecule that adversely affects (e.g., decreases) the activity or function of CTLA-4. In embodiments, the CTLA-4 inhibitor is ipilimumab or tremelimumab.
[0073] The term "pharmaceutically acceptable salts" is intended to include salts of active compounds prepared with relatively non-toxic acids or bases, depending on the specific substituents found in the compounds described herein.When a compound of the present disclosure contains a relatively acidic functional group, a base addition salt can be obtained by contacting the neutral form of such a compound with a sufficient amount of the desired base, either neat or in a suitable inert solvent.Examples of pharmaceutically acceptable base addition salts include sodium, potassium, calcium, ammonium, organic amino, or magnesium salts, or similar salts.When a compound of the present disclosure contains a relatively basic functional group, an acid addition salt can be obtained by contacting the neutral form of such a compound with a sufficient amount of the desired acid, either neat or in a suitable inert solvent. Examples of pharmaceutically acceptable acid addition salts include those derived from inorganic acids such as hydrochloric acid, hydrobromic acid, nitric acid, carbonic acid, monohydrogencarbonic acid, phosphoric acid, monohydrogenphosphate, dihydrogenphosphate, sulfuric acid, monohydrogensulfuric acid, hydroiodic acid, or phosphorous acid, as well as salts derived from relatively non-toxic organic acids such as acetic acid, propionic acid, isobutyric acid, maleic acid, malonic acid, benzoic acid, succinic acid, suberic acid, fumaric acid, lactic acid, mandelic acid, phthalic acid, benzenesulfonic acid, p-tolylsulfonic acid, citric acid, tartaric acid, oxalic acid, and methanesulfonic acid. Also included are salts of amino acids such as alginate, and salts of organic acids such as glucuronic acid or galacturonic acid (see, e.g., Berge et al., "Pharmaceutical Salts," Journal of Pharmaceutical Science, 1977, 66, 1-19). Certain specific compounds of the present disclosure contain both basic and acidic functionalities that allow the compounds to be converted into either base or acid addition salts.
[0074] In addition to salt forms, the present disclosure provides compounds in the form of prodrugs.Prodrugs of the compounds described herein are compounds that easily undergo chemical changes under physiological conditions to provide the compounds of the present disclosure.Prodrugs of the compounds described herein can be converted in vivo after administration.Furthermore, prodrugs can be converted to the compounds of the present disclosure by chemical or biochemical methods in an ex vivo environment, for example, when contacted with a suitable enzyme or chemical reagent.
[0075] Certain compounds of the present disclosure can exist in non-solvated form and solvated form, including hydrated form.In general, solvated form is equivalent to non-solvated form and is included in the scope of the present disclosure.Certain compounds of the present disclosure can exist in multiple crystalline forms or amorphous forms.In general, all physical forms are equivalent to the use contemplated by the present disclosure and are intended to be within the scope of the present disclosure.
[0076] "Pharmaceutically acceptable excipient" and "pharmaceutically acceptable carrier" refer to substances that aid in the administration and absorption of an active agent by a subject and can be included in the compositions of the present disclosure without causing significant adverse toxicological effects to the patient. Non-limiting examples of pharmaceutically acceptable excipients include water, NaCl, normal saline, lactated Ringer's solution, normal sucrose, normal glucose, binders, fillers, disintegrants, lubricants, coatings, sweeteners, flavoring agents, salt solutions (such as Ringer's solution), alcohols, oils, gelatin, carbohydrates such as lactose, amylose, or starch, fatty acid esters, hydroxymethylcellulose, polyvinylpyrrolidine, and coloring agents. Such preparations are sterilized and, if necessary, can be mixed with auxiliary substances such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring agents, and / or aromatic substances that do not adversely react with the compounds of the present disclosure. Those skilled in the art will recognize that other pharmaceutical excipients are useful in the present disclosure.
[0077] The term "preparation" is intended to include formulation of the active compound with or without a carrier.
[0078] The terms "dose" and "dosage" are used interchangeably herein. Dose refers to the amount of active ingredient given to an individual at each administration. Dosage varies depending on several factors, including the usual dosage range for a given treatment, the frequency of administration, the size and tolerance of the individual, the severity of the condition, the risk of side effects, and the route of administration. One skilled in the art will recognize that dosage may be modified depending on the above factors or based on the progress of treatment. The term "dosage form" refers to the specific format of a drug or pharmaceutical composition and depends on the route of administration. For example, dosage forms may be in the form of a liquid for nebulization, e.g., a tablet or liquid inhalant, e.g., for oral delivery, or saline, e.g., for injection. Dosage forms may include sachets, capsules, chewable gels, granules, powders, tablets, wafers, etc.
[0079] As used herein, the term "about" refers to a range of values that includes the specified value and that one of ordinary skill in the art would consider reasonably similar to the specified value. In embodiments, about means within a standard deviation using generally accepted measurements in the art. In embodiments, about means a range that extends to + / - 10% of the specified value. In embodiments, about includes the specified value.
[0080] Clostridium butyricum is an anaerobic, endospore-forming, Gram-positive, butyrate-producing bacterium. It can be found in the gastrointestinal tract of humans and animals. Clostridium butyricum MIYAIRI 588, also known as CBM or CBM588, is a strain of the bacterium Clostridium butyricum. Clostridium butyricum MIYAIRI 588 may have immunomodulatory, anti-inflammatory, and antineoplastic properties. Clostridium butyricum MIYAIRI 588 can restore the intestinal microbiota and thus normalize the intestinal immune response.
[0081] Bifidobacterium is a genus of Gram-positive anaerobic bacteria. Bifidobacterium can be present in the digestive tract, vagina, and mouth (B. dentium) of mammals, including humans. Bifidobacterium is one of the main genera of bacteria that make up the mammalian gastrointestinal microflora. In embodiments, Bifidobacterium strains can be included in live biological preparations. In embodiments, Bifidobacterium can normalize intestinal immune response when used alone or in combination with other bacteria as live biological preparations.
[0082] Dorea is a gram-positive, non-spore-forming bacterial genus from the Lachnospiraceae family, and can be found in the intestines of mammals and in human feces. High levels of Dorea can be found in individuals with autoimmune conditions. When used alone or in combination with other bacteria as a live biological preparation, Dorea can normalize intestinal immune responses.
[0083] Blautia is a genus of intestinal microorganisms commonly found in the intestines of mammals. Blautia produces butyrate, which is used in cellular processes throughout the body. Butyrate can be used as a treatment for irritable bowel syndrome (IBS). Therefore, Blautia can be a target for treating IBS. Blautia can have anti-inflammatory properties and reduce the intolerance of the intestinal environment to pathogenic bacteria. In embodiments, Blautia can normalize intestinal immune responses when used alone or in combination with other bacteria as a live biological preparation.
[0084] Akkermansia muciniphila is a type of human intestinal mucin-degrading bacterium. Akkermansia muciniphila may be a target for the treatment of obesity, diabetes, and inflammation. In embodiments, Akkermansia muciniphila may be used alone or in combination with other bacteria as a live biological agent.
[0085] As used herein, "live biological product" or "LBP" refers to a biological product that contains a live organism and can be used to prevent, treat, or cure a disease. For example, a live biological product may contain a microorganism, including live bacteria or yeast. The microorganism may be naturally occurring, recombinant, or clonally selected. A live biological product can be dried and remain viable for extended periods of time (e.g., 1-2 years). In an embodiment, the live biological product is a bacterium. In an embodiment, the live biological product is Clostridium butyricum Miyairi 588 (CBM588). In an embodiment, the live biological product is CBM588 in combination with another bacterial species, including, but not limited to, another strain of Clostridium butyricum, a Bifidobacterium strain, a Dorea strain, a Blautia strain, or an Akkermansia muciniphila strain. In embodiments, the live biological product is CBM588 in combination with multiple other bacterial species, including, but not limited to, one or more other strains of Clostridium butyricum, one or more strains of Bifidobacterium, one or more strains of Dorea, one or more strains of Blautia, or Akkermansia muciniphila.
[0086] As used herein, "recombinant live biological product" or "recombinant LBP" refers to a live biological product comprising a microorganism that has been genetically modified by the deliberate addition, deletion, or modification of genetic material.
[0087] As used herein, the term "live biological preparation of Clostridium butyricum MIYAIRI 588" or "CBM588 LBP" refers to Clostridium butyricum MIYAIRI 588 when used to prevent, treat, or cure disease. CBM588 is described in further detail in Patent Application No. 1142081 (Production of Clostridium butyricum), published February 16, 1999, which is incorporated herein by reference in its entirety for all purposes. CBM588 was deposited with the Bureau of International Trade and Industry of the Institute of Scientific and Industrial Research under Accession No. FERM BP-2789 (FERM BP-2789). In embodiments, CBM588 LBP can be an anticancer agent when administered with other anticancer agents (e.g., immune checkpoint inhibitors). In embodiments, CBM388 LBP is administered in combination with another bacterial species, including, but not limited to, another strain of Clostridium butyricum, a strain of Bifidobacterium, a strain of Dorea, a strain of Blautia, or Akkermansia muciniphila. In embodiments, CBM388 LBP is administered in combination with multiple other bacterial species, including, but not limited to, one or more other strains of Clostridium butyricum, one or more strains of Bifidobacterium, one or more strains of Dorea, one or more strains of Blautia, and / or Akkermansia muciniphila. method
[0088] Described herein are methods for treating cancer, comprising administering Clostridium butyricum and an anticancer agent to a subject in need thereof. Without wishing to be bound by scientific theory, it is believed that Clostridium butyricum (e.g., a live biological preparation of Clostridium butyricum MIYAIRI 588 (CBM588 LBP)) regulates the levels of specific types of bacteria (e.g., Bifidobacterium) in the gastrointestinal microbiome. In embodiments, an increase or decrease in the levels of specific types of bacteria enhances the therapeutic effect of an anticancer agent (e.g., an immune checkpoint inhibitor). Therefore, it is contemplated that the Clostridium butyricum (e.g., CBM588 LBP) provided herein, including its embodiments, enhances the therapeutic effect of an anticancer agent.
[0089] Thus, in one embodiment, there is provided a method for treating cancer in a subject in need thereof, comprising administering to the subject therapeutically effective amounts of an anticancer agent and Clostridium butyricum. In one embodiment, the Clostridium butyricum is a live biological preparation. In one embodiment, the live Clostridium butyricum biological preparation is a live Clostridium butyricum MIYAIRI 588 biological preparation (CBM588 LBP).
[0090] In the methods provided herein, in embodiments, the anti-cancer agent is a checkpoint inhibitor. In embodiments, the checkpoint inhibitor is a PD-1, PD-L1, or CTLA-4 inhibitor. In embodiments, the checkpoint inhibitor is a PD-1 inhibitor. In embodiments, the checkpoint inhibitor is a PD-L1 inhibitor. In embodiments, the checkpoint inhibitor is a CTLA-4 inhibitor. In embodiments, the checkpoint inhibitor is nivolumab, ipilimumab, pembrolizumab, cemiplimab, durvalumab, daclizumab, avelumab, or atezolizumab. In embodiments, the checkpoint inhibitor is pembrolizumab. In embodiments, the checkpoint inhibitor is cemiplimab. In embodiments, the checkpoint inhibitor is durvalumab. In embodiments, the checkpoint inhibitor is daclizumab. In embodiments, the checkpoint inhibitor is avelumab. In embodiments, the checkpoint inhibitor is atezolizumab. In an embodiment, the checkpoint inhibitor is nivolumab. In an embodiment, the checkpoint inhibitor is ipilimumab. In an embodiment, the checkpoint inhibitor is nivolumab or ipilimumab.
[0091] For the methods provided herein, in embodiments, the method further comprises administering a second anti-cancer agent. In embodiments, the second anti-cancer agent is different from the first anti-cancer agent. In embodiments, the second anti-cancer agent is a second checkpoint inhibitor. In embodiments, the second checkpoint inhibitor is a PD-1, PD-L1, or CTLA-4 inhibitor. In embodiments, the second checkpoint inhibitor is a PD-1 inhibitor. In embodiments, the second checkpoint inhibitor is a PD-L1 inhibitor. In embodiments, the second checkpoint inhibitor is a CTLA-4 inhibitor. In embodiments, the second checkpoint inhibitor is nivolumab, ipilimumab, pembrolizumab, cemiplimab, durvalumab, daclizumab, avelumab, or atezolizumab. In embodiments, the second checkpoint inhibitor is pembrolizumab. In embodiments, the second checkpoint inhibitor is cemiplimab. In an embodiment, the second checkpoint inhibitor is durvalumab. In an embodiment, the second checkpoint inhibitor is daclizumab. In an embodiment, the second checkpoint inhibitor is avelumab. In an embodiment, the second checkpoint inhibitor is atezolizumab. In an embodiment, the second checkpoint inhibitor is nivolumab. In an embodiment, the second checkpoint inhibitor is ipilimumab. In an embodiment, the second checkpoint inhibitor is nivolumab or ipilimumab.
[0092] In embodiments, the method includes the concurrent administration of an anticancer agent (e.g., a checkpoint inhibitor) and Clostridium butyricum, wherein the administration comprises separate dosage forms or a single dosage form. In embodiments, the method includes the concurrent administration using separate dosage forms. In embodiments, the method includes the concurrent administration using a single dosage form. In embodiments, the method includes sequential administration of therapeutically effective amounts of an anticancer agent (e.g., a checkpoint inhibitor) and Clostridium butyricum in either order, wherein there may be a period during which both (or all) active agents simultaneously exert their biological activity. Preparations and dosing schedules for such anticancer agents may be used according to manufacturer's instructions or may be empirically determined by a skilled practitioner. Thus, in the methods provided herein, in embodiments, the anticancer agent (e.g., a checkpoint inhibitor) and Clostridium butyricum are administered sequentially. In embodiments, the anticancer agent (e.g., a checkpoint inhibitor) and Clostridium butyricum are administered simultaneously.
[0093] In embodiments, the methods provided herein include administration of an anti-cancer agent (e.g., a checkpoint inhibitor) and Clostridium butyricum, and do not include administration of another active agent (e.g., another anti-cancer agent, a live biological, a microorganism, etc.). In embodiments, the methods provided herein include administration of a first anti-cancer agent (e.g., a first checkpoint inhibitor), a second anti-cancer agent (e.g., a second checkpoint inhibitor), and Clostridium butyricum, and do not include administration of another active agent (e.g., another anti-cancer agent, a live biological, a microorganism, etc.).
[0094] In another aspect, a method of treating cancer in a subject in need thereof is provided, comprising administering to the subject an effective amount of an anticancer agent and a live biological preparation of Clostridium butyricum MIYAIRI 588 (CBM588 LBP). In embodiments, CBM588 LBP is administered in combination with another strain of Clostridium butyricum, a strain of Bifidobacterium, a strain of Dorea, a strain of Blautia, or a strain of Akkermansia muciniphila. In embodiments, CBM588 LBP is administered with another strain of Clostridium butyricum. In embodiments, CBM588 LBP is administered with a strain from the genus Bifidobacterium. In embodiments, CBM588 LBP is administered with a strain from the genus Dorea. In embodiments, CBM588 LBP is administered with a strain from the genus Blautia. In embodiments, CBM588 LBP is administered with Akkermansia muciniphila. In embodiments, CBM388 LBP is administered in combination with one or more other bacterial species, including, but not limited to, one or more other strains of Clostridium butyricum, one or more strains of Bifidobacterium, one or more strains of Dorea, one or more strains of Blautia, and / or Akkermansia muciniphila.
[0095] The methods provided herein, including embodiments thereof, are believed to be effective in treating cancer in a subject in need thereof. In embodiments, the cancer is metastatic renal cell carcinoma (mRCC), non-small cell lung cancer, melanoma, sarcoma, lymphoma, breast cancer, bladder cancer, cervical cancer, colon cancer, head and neck cancer, liver cancer, gastric cancer, or rectal cancer. In embodiments, the cancer is metastatic renal cell carcinoma. In embodiments, the cancer is non-small cell lung cancer. In embodiments, the cancer is melanoma. In embodiments, the cancer is sarcoma. In embodiments, the cancer is lymphoma. In embodiments, the cancer is breast cancer. In embodiments, the cancer is bladder cancer. In embodiments, the cancer is cervical cancer. In embodiments, the cancer is colon cancer. In embodiments, the cancer is head and neck cancer. In embodiments, the cancer is liver cancer. In embodiments, the cancer is gastric cancer. In embodiments, the cancer is rectal cancer. In embodiments, the cancer is metastatic cancer. In embodiments, the cancer is chemotherapy-resistant cancer.
[0096] As used herein, the term "resistance" or "resistant" refers to the lack of sensitivity or intended response of cancer cells or cancer to a therapeutic agent, such as an anti-cancer agent. For example, resistance to an anti-cancer agent can refer to the loss of the anti-cancer effect of the agent (e.g., a decrease in tumor volume or an increase in tumor volume). In an embodiment, the resistance is resistance to a chemotherapeutic agent. Thus, a "chemoresistant cancer" is a cancer that lacks sensitivity or intended response to a chemotherapeutic agent.
[0097] In embodiments, the cancer is a recurrence of cancer. In embodiments, cancer recurrence refers to cancer that is detected after treatment and after a period in which the cancer was not detected. In embodiments, the recurrence of cancer is found in the same area where it began (e.g., local recurrence). In embodiments, the recurrence of cancer is found in a different area of the body from where it began (e.g., distant recurrence). In embodiments, the cancer is found in lymph nodes near where it began (e.g., regional recurrence).
[0098] In embodiments, the cancer includes any solid tumor that is unable to repair or lacks repair of DNA errors that occur during DNA replication. In embodiments, the cancer involves a mismatch repair deficient (MMR) gene. In embodiments, the cancer is a microsatellite instability-high (MSI-H) cancer. As used herein, the term "microsatellite instability-high cancer" or "MSI-H cancer" refers to a cancer with mutations in short repeat sequences of DNA called microsatellites. In embodiments, MSI-H cancer results from the malfunction of mismatch repair genes due to mutations in genes encoding mismatch repair proteins. Due to accumulation in DNA microsatellites, MSI-H tumors may express multiple neoantigens. Therefore, MSI-H tumors may be susceptible to immunotherapy. MSI-H cancers include colon cancer, gastric cancer, endometrial cancer, ovarian cancer, hepatobiliary cancer, urinary tract cancer, brain cancer, and skin cancer. In embodiments, the MSI-H cancer is endometrial cancer. In embodiments, the MSI-H cancer is colon cancer. In embodiments, the MSI-H cancer is gastric cancer. In embodiments, the MSI-H cancer is esophageal cancer. In embodiments, the MSI-H cancer is gastroesophageal junction cancer. In embodiments, the MSI-H cancer is ovarian cancer. In embodiments, the MSI-H cancer is urinary tract cancer. In embodiments, the MSI-H cancer is bladder cancer. In embodiments, the MSI-H cancer is renal cancer. In embodiments, the MSI-H cancer is hepatobiliary cancer. In embodiments, the MSI-H cancer is brain cancer. In embodiments, the MSI-H cancer is skin cancer. In embodiments, the MSI-H cancer is breast cancer. In embodiments, the MSI-H cancer is pancreatic cancer. In embodiments, the MSI-H cancer is prostate cancer. In embodiments, the MSI-H cancer is retroperitoneal adenocarcinoma. In embodiments, the MSI-H cancer is sarcoma. In embodiments, the MSI-H cancer is small cell lung cancer. In embodiments, the MSI-H cancer is small intestine cancer. In an embodiment, the MSI-H cancer is thyroid cancer.
[0099] The methods provided herein, including embodiments thereof, may result in a reduction in tumor volume or tumor volume increase, or other sign of cancer growth inhibition or reduction. In embodiments, the methods may reduce tumor volume or tumor volume increase, or other sign of cancer activity, by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more compared to a control in the absence of the method. In embodiments, the methods may reduce tumor volume or tumor volume increase, or other sign of cancer activity, by 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold or less compared to a control in the absence of the method. In embodiments, the method may reduce tumor volume or tumor volume growth or other signs of cancer activity by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more compared to treatment with an immune checkpoint inhibitor or Clostridium butyricum (e.g., CBM588 LBP). In embodiments, the method may reduce tumor volume or tumor volume growth or other signs of cancer activity by 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold or less compared to treatment with an anti-cancer agent (e.g., a checkpoint inhibitor) or Clostridium butyricum (e.g., CBM588 LBP).
[0100] Clostridium butyricum is believed to enhance the anti-cancer effect of an anti-cancer agent (e.g., a checkpoint inhibitor). In examples, the anti-cancer effect is an extension of a subject's survival time, a reduction in tumor volume, a reduction in the number of cancer cells, or other indications of inhibiting or reducing cancer growth. For example, the anti-cancer agent may reduce tumor volume or the number of cancer cells by about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 3.10, 3.11, 3.12, 3.13, 3.14, 3.15, 3.16, 3.17, 3.18, 3.19, 3.20, 3.21, 3.22, 3.23, 3.24, 3.25, 3.26, 3.27, 3.28, 3.29, 3.30, 3.31, 3.32, 3.33, 3.34, 3.35, 3.36, 3.37, 3.38, 3.39, 3.40, 3.41, 3.42, 3.43, 3.44, 3 .1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7. 8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.0, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10.0, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43 , 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or a reduction of 100% or more.For example, the anticancer drug may extend the subject's survival time by approximately 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.10, 4.11, 4.12, 4.13, 4.14, 4.15, 4.16, 4.17, 4.18, 4.19, 4.20, 4.21, 4.22, 4.23, 4.24, 4.25, 4.26, 4.27, 4.28, 4.29, 5.30, 5.31, 5.32, 5.33, 5.34, 5.35, 5.36, 5.37, 5.38, 5.39, 5.40, 5.41, 5.42, 5.43, 5.44, 5.45, 5.46, 5.47, 5.48, 5.49, 5.50, 5.51, 5.52, 5.53, 5.54, 5.55, 5.56, 5.57, 5.58 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7. 8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.0, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10.0, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42 , 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%.
[0101] In embodiments, the anti-cancer agent is therapeutically effective at a dosage that is less than the therapeutically effective amount when used in the absence of Clostridium butyricum to treat cancer. In some embodiments, the therapeutically effective amount of the anti-cancer agent is about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.10, 4.11, 4.12, 4.13, 4.14, 4.15, 4.16, 4.17, 4.18, 4.19, 4.20, 4.21, 4.22, 4.23, 4.24, 4.25, 4.26, 4.27, 4.28, 4.29, 5.30, 5.31, 5.32, 5.33, 5.34, 5.35, 5.36, 5.37, 5.38, 5.39, 5.40, 5.41, 5.42, 5.43, 5.44, 5.45, 5.46, 5.47, 5.48, 5.49, 5.50, 5.5 1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7 ,7.8,7.9,8.0,8.1,8.2,8.3,8.4,8.5,8.6,8.7,8.8,8.9,9.0,9.1,9.2,9.3,9.4,9.5,9.6,9.7,9.8,9.9,10.0,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41 It can be 1, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%.
[0102] In embodiments, the methods provided herein include administering therapeutically effective amounts of an anti-cancer agent (e.g., a checkpoint inhibitor) and Clostridium butyricum (e.g., CBM588 LBP) to a subject, as described above, wherein the combination has a synergistic effect. In embodiments, the methods provided herein include administering therapeutically effective amounts of a first anti-cancer agent (e.g., a first checkpoint inhibitor), a second anti-cancer agent (e.g., a second checkpoint inhibitor), and Clostridium butyricum to a subject, as described above, wherein the combination has a synergistic effect. In embodiments, the synergistic effect exceeds the combined effects of the individual administrations of the anti-cancer agents or Clostridium butyricum.
[0103] In an example, the synergistic effect is cancer cell death. Cancer cell death can be quantified, for example, by a reduction in tumor volume or a reduction in the number of cancer cells. In an embodiment, the synergistic effect between an anticancer drug (e.g., a checkpoint inhibitor) and Clostridium butyricum is a reduction in the number of cancer cells in a tumor. LBP) than the total reduction when used individually and in isolation, approximately 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8 , 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4 ,8.5,8.6,8.7,8.8,8.9,9.0,9.1,9.2,9.3,9.4,9.5,9.6,9.7,9.8,9.9,10.0,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68 The present invention may result in a reduction in tumor volume or number of cancer cells of 0, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% or more.
[0104] In embodiments, the synergistic effect of the anti-cancer agent (e.g., a checkpoint inhibitor) and Clostridium butyricum is greater than the sum of the inhibitions of the anti-cancer agent (e.g., a checkpoint inhibitor) and Clostridium butyricum (e.g., CBM588 LBP) when used individually and in isolation by about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.1, 8.1, 8.2, 8.3, 8.4, 8 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.0, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10.0, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58 , 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% significant inhibition of the activity of one or more immune checkpoint molecules (e.g., CTLA-4, PD-1, PD-L1, etc.).
[0105] In some cases, the synergistic effect is the inhibition of metastasis of cancer in a subject. In some embodiments, the synergistic effect of an anticancer agent (e.g., a checkpoint inhibitor) and Clostridium butyricum (e.g., CBM588 LBP) is 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.10, 4.11, 4.12, 4.13, 4.14, 4.15, 4.16, 4.17, 4.18, 4.19, 4.20, 4.21, 4.22, 4.23, 4.24, 4.25, 4.26, 4.27, 4.28, 4.29, 5.30, 5.31, 5.32, 5.33, 5.34, 5.35, 5.36, 5.37, 5.38, 5.39, 5.40, 5.41, 5.42, 5.43, 5.44, 5.45, 5.46, 5.47, 5.48, 5. .6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1 , 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.0, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10.0, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45 , 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% inhibition.
[0106] In some cases, the synergistic effect is an extension of survival time of a subject with cancer. In embodiments, the synergistic effect between an anti-cancer agent (e.g., a checkpoint inhibitor) and Clostridium butyricum (e.g., CBM588 LBP) results in an increased survival time of a subject with cancer. LBP) in comparison with the use of them individually and separately, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.0, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10.1, 8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3 ,8.4,8.5,8.6,8.7,8.8,8.9,9.0,9.1,9.2,9.3,9.4,9.5,9.6,9.7,9.8,9.9,10.0,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% may result in a significant increase in survival.
[0107] As used herein, a "synergistic amount" refers to the sum of a first amount (e.g., an amount of an anticancer agent) and a second amount (e.g., an amount of Clostridium butyricum) that results in a synergistic effect (i.e., an effect that is greater than additive). Thus, the terms "synergy," "synergism," "synergistic," "combined synergistic amount," and "synergistic therapeutic effect," used interchangeably herein, refer to a measured effect of compounds administered in combination, where the measured effect is greater than the sum of the individual effects of each of the compounds provided herein when administered alone as a single agent. More specifically, a "combined synergistic amount" is a combined amount of a first agent (e.g., an anticancer agent (e.g., a checkpoint inhibitor)) and a second agent (e.g., Clostridium butyricum) that is effective to produce a synergistic effect (e.g., for treating cancer, including embodiments described herein). In embodiments, the methods herein comprising administering an anti-cancer agent (e.g., a checkpoint inhibitor) and Clostridium butyricum comprise administering a combined synergistic amount of the anti-cancer agent (e.g., a checkpoint inhibitor) and Clostridium butyricum. In embodiments, the pharmaceutical compositions herein comprising an anti-cancer agent (e.g., a checkpoint inhibitor) and Clostridium butyricum comprise a combined synergistic amount of the anti-cancer agent (e.g., a checkpoint inhibitor) and Clostridium butyricum (e.g., CBM588 LBP).
[0108] In embodiments, a synergistic amount is about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.10, 3.11, 3.12, 3.13, 3.14, 3.15, 3.16, 3.17, 3.18, 3.19, 3.20, 3.21, 3.22, 3.23, 3.24, 3.25, 3.26, 3.27, 3.28, 3.29, 3.30, 3.31, 3.32, 3.33, 3.34, 3.35, 3.36, 3.37, 3.38, 3.39, 3.40, 3.41, 3.42, 3.43, 3.44, 3.45, 3.46, 3.47, 3.48, 3.49, 3.50, 3.51, 3.52, 3.53, 3.54, 3.55, 3.56, 3.57, 3.58, 3.59, 3.60, 3.61, 3.62, 3.63, 3.64, 3.65, 3.66, 3.67, 3 .0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.0, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10.0, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%. Pharmaceutical Composition
[0109] Applicants have surprisingly discovered that the compositions described herein, including embodiments thereof, are useful in the treatment of cancer. The Clostridium butyricum described herein can enhance the therapeutic effect of an anti-cancer agent (e.g., a first checkpoint inhibitor, a second checkpoint inhibitor) when administered in combination with or simultaneously with the anti-cancer agent.
[0110] Thus, in one aspect, there is provided a pharmaceutical composition comprising an anticancer drug in a first dosage form and Clostridium butyricum in a second dosage form. In one embodiment, the Clostridium butyricum is a live biological preparation. In one embodiment, the live Clostridium butyricum is a live Clostridium butyricum MIYAIRI 588 biological preparation (CBM588 LBP).
[0111] In the pharmaceutical compositions provided herein, in embodiments, the anti-cancer agent is an immune checkpoint inhibitor. Immune checkpoint proteins can inhibit or reduce immune responses, and checkpoint inhibitors can downregulate or inhibit the effects of checkpoint proteins. In embodiments, the checkpoint inhibitor is a PD-1, PD-L1, or CTLA-4 inhibitor. In embodiments, the checkpoint inhibitor is a PD-1 inhibitor. In embodiments, the checkpoint inhibitor is a PD-L1 inhibitor. In embodiments, the checkpoint inhibitor is a CTLA-4 inhibitor. In embodiments, the checkpoint inhibitor is nivolumab, ipilimumab, pembrolizumab, cemiplimab, durvalumab, daclizumab, avelumab, or atezolizumab. In embodiments, the checkpoint inhibitor is pembrolizumab. In embodiments, the checkpoint inhibitor is cemiplimab. In embodiments, the checkpoint inhibitor is durvalumab. In embodiments, the checkpoint inhibitor is daclizumab. In an embodiment, the checkpoint inhibitor is avelumab. In an embodiment, the checkpoint inhibitor is atezolizumab. In an embodiment, the checkpoint inhibitor is nivolumab or ipilimumab. In an embodiment, the checkpoint inhibitor is nivolumab. In an embodiment, the checkpoint inhibitor is ipilimumab.
[0112] In an embodiment, the pharmaceutical composition further comprises a second anti-cancer agent. In an embodiment, the second anti-cancer agent is different from the first anti-cancer agent. In an embodiment, the second anti-cancer agent is a second checkpoint inhibitor. In an embodiment, the second checkpoint inhibitor is a PD-1, PD-L1, or CTLA-4 inhibitor. In an embodiment, the second checkpoint inhibitor is a PD-1 inhibitor. In an embodiment, the second checkpoint inhibitor is a PD-L1 inhibitor. In an embodiment, the second checkpoint inhibitor is a CTLA-4 inhibitor. In an embodiment, the second checkpoint inhibitor is nivolumab, ipilimumab, pembrolizumab, cemiplimab, durvalumab, daclizumab, avelumab, or atezolizumab. In an embodiment, the second checkpoint inhibitor is pembrolizumab. In an embodiment, the second checkpoint inhibitor is cemiplimab. In an embodiment, the second checkpoint inhibitor is durvalumab. In an embodiment, the second checkpoint inhibitor is daclizumab. In an embodiment, the second checkpoint inhibitor is avelumab. In an embodiment, the second checkpoint inhibitor is atezolizumab. In an embodiment, the second checkpoint inhibitor is nivolumab or ipilimumab. In an embodiment, the second checkpoint inhibitor is nivolumab. In an embodiment, the second checkpoint inhibitor is ipilimumab.
[0113] In embodiments, the pharmaceutical compositions provided herein comprise an anti-cancer agent (e.g., a checkpoint inhibitor) and Clostridium butyricum, and do not include another active agent (e.g., another anti-cancer agent, a live biological agent, a microorganism, etc.). In embodiments, the pharmaceutical compositions provided herein comprise a first anti-cancer agent (e.g., a first checkpoint inhibitor), a second anti-cancer agent (e.g., a second checkpoint inhibitor), and Clostridium butyricum, and do not include another active agent (e.g., another anti-cancer agent, a live biological agent, a microorganism, etc.).
[0114] In another aspect, a pharmaceutical composition is provided comprising an anticancer drug in a first dosage form and a live biological preparation of Clostridium butyricum MIYAIRI 588 (CBM588 LBP) in a second dosage form. In an embodiment, the pharmaceutical composition comprises another strain of Clostridium butyricum, a strain of Bifidobacterium, a strain of Dorea, a strain of Blautia, or Akkermansia muciniphila. In an embodiment, the pharmaceutical composition comprises another strain of Clostridium butyricum. In an embodiment, the pharmaceutical composition comprises a strain of Bifidobacterium. In an embodiment, the pharmaceutical composition comprises a strain from the Dorea genus. In an embodiment, the pharmaceutical composition comprises a strain from the Blautia genus. In an embodiment, the pharmaceutical composition comprises Akkermansia muciniphila. In embodiments, the pharmaceutical composition comprises one or more CBM388 of another bacterial species, including, but not limited to, one or more other strains of Clostridium butyricum, one or more strains of Bifidobacterium, one or more strains of Dorea, one or more strains of Blautia, and / or one or more strains of Akkermansia muciniphila.
[0115] In an embodiment, the Clostridium butyricum is about 0.1 x 10 9 Colony forming units (CFU) / dose ~10 x 10 9 In an embodiment, Clostridium butyricum is administered at a potency of about 0.5 x 10 CFU / dose. 9 CFU / dose ~ approx. 10 x 10 9 In an embodiment, Clostridium butyricum is administered at a potency of about 1.0 x 10 CFU / dose. 9 CFU / dose ~ approx. 10 x 10 9 In an embodiment, Clostridium butyricum is administered at a potency of about 1.5 x 10 CFU / dose. 9 CFU / dose ~ approx. 10 x 10 9 In an embodiment, Clostridium butyricum is administered at a potency of about 2.0 x 10 CFU / dose. 9 CFU / dose ~ approx. 10 x 10 9 In an embodiment, Clostridium butyricum is administered at a potency of about 2.5 x 10 CFU / dose. 9 CFU / dose ~ approx. 10 x 109 In an embodiment, Clostridium butyricum is administered at a potency of about 3.0 x 10 CFU / dose. 9 CFU / dose ~ approx. 10 x 10 9 In an embodiment, Clostridium butyricum is administered at a potency of about 3.5 x 10 CFU / dose. 9 CFU / dose ~ approx. 10 x 10 9 In an embodiment, Clostridium butyricum is administered at a potency of about 4.0 x 10 CFU / dose. 9 CFU / dose ~ approx. 10 x 10 9 In an embodiment, Clostridium butyricum is administered at a potency of about 4.5 x 10 CFU / dose. 9 CFU / dose ~ approx. 10 x 10 9 In an embodiment, Clostridium butyricum is administered at a potency of about 5.0 x 10 CFU / dose. 9 CFU / dose ~ approx. 10 x 10 9 In an embodiment, Clostridium butyricum is administered at a potency of about 5.5 x 10 CFU / dose. 9 CFU / dose ~ approx. 10 x 10 9 In an embodiment, Clostridium butyricum is administered at a potency of about 6.0 x 10 CFU / dose. 9 CFU / dose ~ approx. 10 x 10 9 In an embodiment, Clostridium butyricum is administered at a potency of about 6.5 x 10 CFU / dose. 9 CFU / dose ~ approx. 10 x 10 9 In an embodiment, Clostridium butyricum is administered at a potency of about 7.0 x 10 CFU / dose. 9 CFU / dose ~ approx. 10 x 10 9 In an embodiment, Clostridium butyricum is administered at a potency of about 7.5 x 10 CFU / dose. 9 CFU / dose ~ approx. 10 x 10 9 In an embodiment, Clostridium butyricum is administered at a potency of about 8.0 x 10 CFU / dose. 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose. In an embodiment, Clostridium butyricum is administered at a potency of about 8.5 x 109 CFU / dose ~ approx. 10 x 10 9 In an embodiment, Clostridium butyricum is administered at a potency of about 9.0 x 10 CFU / dose. 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose. In an embodiment, Clostridium butyricum is administered at a potency of about 9.5 x 10 9 CFU / dose ~ approx. 10 x 10 9 It is administered in potency of CFU / dose.
[0116] In an embodiment, the Clostridium butyricum is about 0.1 x 10 9 CFU / dose ~ approx. 9.5×10 9 In an embodiment, Clostridium butyricum is administered at a potency of about 0.1 x 10 CFU / dose. 9 CFU / dose ~ approx. 9.0×10 9 In an embodiment, Clostridium butyricum is administered at a potency of about 0.1 x 10 CFU / dose. 9 CFU / dose~about 8.5×10 9 In an embodiment, Clostridium butyricum is administered at a potency of about 0.1 x 10 CFU / dose. 9 CFU / dose~about 8.0×10 9 In an embodiment, Clostridium butyricum is administered at a potency of about 0.1 x 10 CFU / dose. 9 CFU / dose~approx. 7.5×10 9 In an embodiment, Clostridium butyricum is administered at a potency of about 0.1 x 10 CFU / dose. 9 CFU / dose~approx. 7.0×10 9 In an embodiment, Clostridium butyricum is administered at a potency of about 0.1 x 10 CFU / dose. 9 CFU / dose~about 6.5×10 9 In an embodiment, Clostridium butyricum is administered at a potency of about 0.1 x 10 CFU / dose. 9 CFU / dose~about 6.0×10 9 In an embodiment, Clostridium butyricum is administered at a potency of about 0.1 x 10 CFU / dose. 9CFU / dose~approx. 5.5×10 9 In an embodiment, Clostridium butyricum is administered at a potency of about 0.1 x 10 CFU / dose. 9 CFU / dose~approx. 5.0×10 9 In an embodiment, Clostridium butyricum is administered at a potency of about 0.1 x 10 CFU / dose. 9 CFU / dose~about 4.5×10 9 In an embodiment, Clostridium butyricum is administered at a potency of about 0.1 x 10 CFU / dose. 9 CFU / dose ~ approx. 4.0×10 9 In an embodiment, Clostridium butyricum is administered at a potency of about 0.1 x 10 CFU / dose. 9 CFU / dose ~ approx. 3.5×10 9 In an embodiment, Clostridium butyricum is administered at a potency of about 0.1 x 10 CFU / dose. 9 CFU / dose ~ approx. 3.0×10 9 In an embodiment, Clostridium butyricum is administered at a potency of about 0.1 x 10 CFU / dose. 9 CFU / dose ~ approx. 2.5×10 9 In an embodiment, Clostridium butyricum is administered at a potency of about 0.1 x 10 CFU / dose. 9 CFU / dose ~ approx. 2.0×10 9 In an embodiment, Clostridium butyricum is administered at a potency of about 0.1 x 10 CFU / dose. 9 CFU / dose~approx. 1.5×10 9 In an embodiment, Clostridium butyricum is administered at a potency of about 0.1 x 10 CFU / dose. 9 CFU / dose~approx. 1.0×10 9 In an embodiment, Clostridium butyricum is administered at a potency of about 0.1 x 10 CFU / dose. 9 CFU / dose ~ approx. 0.5×10 9 It is administered in potency of CFU / dose.
[0117] In an embodiment, the Clostridium butyricum is about 0.1 x 10 9 CFU / dose, 0.5×109 CFU / dose, 1.5×10 9 CFU / dose, 2.0×10 9 CFU / dose, approximately 2.5 x 10 9 CFU / dose, 3.0×10 9 CFU / dose, 3.5×10 9 CFU / dose, 4.0×10 9 CFU / dose, 4.5×10 9 CFU / dose, 5.0×10 9 CFU / dose, 5.5×10 9 CFU / dose, approximately 6.0×10 9 CFU / dose, 6.5×10 9 CFU / dose, 7.0×10 9 CFU / dose, 7.5×10 9 CFU / dose, 8.0×10 9 CFU / dose, 8.5×10 9 CFU / dose, 9.0×10 9 CFU / dose, 9.5×10 9 CFU / dose, or 10 x 10 9 In an embodiment, Clostridium butyricum is administered at a potency of about 2.5 x 10 CFU / dose. 9 In one embodiment, Clostridium butyricum is administered at a potency of 2.5 x 10 CFU / dose. 9 In an embodiment, Clostridium butyricum is administered at a potency of about 5.0 x 10 CFU / dose. 9 CFU / dose. In an embodiment, Clostridium butyricum is administered at a potency of 5.0 x 10 9 The C. butyricum potency may be any value or subrange of the listed range that includes the endpoint, or any range between any of the listed values.
[0118] Regarding the dosages of Clostridium butyricum provided herein, in embodiments, the dosage may be divided for administration. In embodiments, the dosage may be divided by about 1 / 2, about 1 / 3, about 1 / 4, about 1 / 5, or about 1 / 6 for administration. In embodiments, the dosage may be divided by about 1 / 2. In embodiments, the dosage may be divided by about 1 / 3. In embodiments, the dosage may be divided by about 1 / 4. In embodiments, the dosage may be divided by about 1 / 5. In embodiments, the dosage may be divided by about 1 / 6.
[0119] In embodiments, each dose contains about 20 mg to about 1020 mg of active pharmaceutical ingredient (API). In embodiments, each dose contains about 120 mg to about 1020 mg of API. In embodiments, each dose contains about 220 mg to about 1020 mg of API. In embodiments, each dose contains about 320 mg to about 1020 mg of API. In embodiments, each dose contains about 420 mg to about 1020 mg of API. In embodiments, each dose contains about 520 mg to about 1020 mg of API. In embodiments, each dose contains about 620 mg to about 1020 mg of API. In embodiments, each dose contains about 720 mg to about 1020 mg of API. In embodiments, each dose contains about 820 mg to about 1020 mg of API. In embodiments, each dose contains about 920 mg to about 1020 mg of API.
[0120] In embodiments, each dose contains about 20 mg to about 920 mg of active pharmaceutical ingredient (API). In embodiments, each dose contains about 20 mg to about 820 mg of API. In embodiments, each dose contains about 20 mg to about 720 mg of API. In embodiments, each dose contains about 20 mg to about 620 mg of API. In embodiments, each dose contains about 20 mg to about 520 mg of API. In embodiments, each dose contains about 20 mg to about 420 mg of API. In embodiments, each dose contains about 20 mg to about 320 mg of API. In embodiments, each dose contains about 20 mg to about 220 mg of API. In embodiments, each dose contains about 20 mg to about 120 mg of API.
[0121] In embodiments, each dose contains about 20 mg of API, 120 mg of API, 220 mg of API, 320 mg of API, 420 mg of API, 520 mg of API, 620 mg of API, 720 mg of API, 820 mg of API, 920 mg of API, or 1020 mg of API. In embodiments, each dose contains about 320 mg of API. In embodiments, each dose contains 320 mg of API. The API can be any value or subrange of the recited range that includes the endpoint, or any range between any of the recited values.
[0122] With regard to the dosages of Clostridium butyricum provided herein, in embodiments, Clostridium butyricum may be administered for about 1 week to about 100 weeks. In embodiments, Clostridium butyricum may be administered for about 10 weeks to about 100 weeks. In embodiments, Clostridium butyricum may be administered for about 20 weeks to about 100 weeks. In embodiments, Clostridium butyricum may be administered for about 30 weeks to about 100 weeks. In embodiments, Clostridium butyricum may be administered for about 40 weeks to about 100 weeks. In embodiments, Clostridium butyricum may be administered for about 50 weeks to about 100 weeks. In embodiments, Clostridium butyricum may be administered for about 60 weeks to about 100 weeks. In embodiments, Clostridium butyricum may be administered for about 70 weeks to about 100 weeks. In embodiments, Clostridium butyricum may be administered for about 80 weeks to about 100 weeks. In embodiments, Clostridium butyricum may be administered for about 90 weeks to about 100 weeks.
[0123] In embodiments, Clostridium butyricum may be administered for about 1 week to about 90 weeks. In embodiments, Clostridium butyricum may be administered for about 1 week to about 80 weeks. In embodiments, Clostridium butyricum may be administered for about 1 week to about 70 weeks. In embodiments, Clostridium butyricum may be administered for about 1 week to about 60 weeks. In embodiments, Clostridium butyricum may be administered for about 1 week to about 50 weeks. In embodiments, Clostridium butyricum may be administered for about 1 week to about 40 weeks. In embodiments, Clostridium butyricum may be administered for about 1 week to about 30 weeks. In embodiments, Clostridium butyricum may be administered for about 1 week to about 20 weeks. In embodiments, Clostridium butyricum may be administered for about 1 week to about 10 weeks.
[0124] In embodiments, Clostridium butyricum can be administered for about 1 week, 10 weeks, 20 weeks, 30 weeks, 40 weeks, 50 weeks, 60 weeks, 70 weeks, 80 weeks, 90 weeks, or 100 weeks. The range of times for administration of Clostridium butyricum can be any value or subrange of the recited ranges that include the endpoint, or any range between any of the recited values.
[0125] Regarding the dosages of Clostridium butyricum provided herein, in embodiments, Clostridium butyricum may be administered once daily for about 1 week to about 100 weeks. In embodiments, Clostridium butyricum may be administered once daily for about 10 weeks to about 100 weeks. In embodiments, Clostridium butyricum may be administered once daily for about 20 weeks to about 100 weeks. In embodiments, Clostridium butyricum may be administered once daily for about 30 weeks to about 100 weeks. In embodiments, Clostridium butyricum may be administered once daily for about 40 weeks to about 100 weeks. In embodiments, Clostridium butyricum may be administered once daily for about 50 weeks to about 100 weeks. In embodiments, Clostridium butyricum may be administered once daily for about 60 weeks to about 100 weeks. In embodiments, Clostridium butyricum may be administered once daily for about 70 weeks to about 100 weeks. In embodiments, Clostridium butyricum may be administered once daily for about 80 weeks to about 100 weeks.
[0126] In embodiments, Clostridium butyricum may be administered once daily for about 1 week to about 90 weeks. In embodiments, Clostridium butyricum may be administered once daily for about 1 week to about 80 weeks. In embodiments, Clostridium butyricum may be administered once daily for about 1 week to about 70 weeks. In embodiments, Clostridium butyricum may be administered once daily for about 1 week to about 60 weeks. In embodiments, Clostridium butyricum may be administered once daily for about 1 week to about 50 weeks. In embodiments, Clostridium butyricum may be administered once daily for about 1 week to about 40 weeks. In embodiments, Clostridium butyricum may be administered once daily for about 1 week to about 30 weeks. In embodiments, Clostridium butyricum may be administered once daily for about 1 week to about 20 weeks.
[0127] In embodiments, Clostridium butyricum can be administered once daily for about 1 week, about 10 weeks, about 20 weeks, about 30 weeks, about 40 weeks, about 50 weeks, about 60 weeks, about 70 weeks, about 80 weeks, about 90 weeks, or about 100 weeks. The time of administration of Clostridium butyricum can be any value or subrange of the recited range that includes the endpoint, or any range between any of the recited values.
[0128] Regarding the dosages of Clostridium butyricum provided herein, in embodiments, Clostridium butyricum may be administered twice daily for about 1 week to about 100 weeks. In embodiments, Clostridium butyricum may be administered twice daily for about 10 weeks to about 100 weeks. In embodiments, Clostridium butyricum may be administered twice daily for about 20 weeks to about 100 weeks. In embodiments, Clostridium butyricum may be administered twice daily for about 30 weeks to about 100 weeks. In embodiments, Clostridium butyricum may be administered twice daily for about 40 weeks to about 100 weeks. In embodiments, Clostridium butyricum may be administered twice daily for about 50 weeks to about 100 weeks. In embodiments, Clostridium butyricum may be administered twice daily for about 60 weeks to about 100 weeks. In embodiments, Clostridium butyricum may be administered twice daily for about 70 weeks to about 100 weeks. In embodiments, Clostridium butyricum may be administered twice daily for about 80 weeks to about 100 weeks.
[0129] In embodiments, Clostridium butyricum may be administered twice daily for about 1 week to about 90 weeks. In embodiments, Clostridium butyricum may be administered twice daily for about 1 week to about 80 weeks. In embodiments, Clostridium butyricum may be administered twice daily for about 1 week to about 70 weeks. In embodiments, Clostridium butyricum may be administered twice daily for about 1 week to about 60 weeks. In embodiments, Clostridium butyricum may be administered twice daily for about 1 week to about 50 weeks. In embodiments, Clostridium butyricum may be administered twice daily for about 1 week to about 40 weeks. In embodiments, Clostridium butyricum may be administered twice daily for about 1 week to about 30 weeks. In embodiments, Clostridium butyricum may be administered twice daily for about 1 week to about 20 weeks.
[0130] In embodiments, Clostridium butyricum can be administered twice daily for about 1 week, about 10 weeks, about 20 weeks, about 30 weeks, about 40 weeks, about 50 weeks, about 60 weeks, about 70 weeks, about 80 weeks, about 90 weeks, or about 100 weeks. The time of administration of Clostridium butyricum can be any value or subrange of the recited range that includes the endpoint, or any range between any of the recited values.
[0131] Regarding the dosages of Clostridium butyricum provided herein, in embodiments, Clostridium butyricum may be administered three times a day for about 1 week to about 100 weeks. In embodiments, Clostridium butyricum may be administered three times a day for about 10 weeks to about 100 weeks. In embodiments, Clostridium butyricum may be administered three times a day for about 20 weeks to about 100 weeks. In embodiments, Clostridium butyricum may be administered three times a day for about 30 weeks to about 100 weeks. In embodiments, Clostridium butyricum may be administered three times a day for about 40 weeks to about 100 weeks. In embodiments, Clostridium butyricum may be administered three times a day for about 50 weeks to about 100 weeks. In embodiments, Clostridium butyricum may be administered three times a day for about 60 weeks to about 100 weeks. In embodiments, Clostridium butyricum may be administered three times daily for about 70 weeks to about 100 weeks. In embodiments, Clostridium butyricum may be administered three times daily for about 80 weeks to about 100 weeks.
[0132] In embodiments, Clostridium butyricum may be administered three times a day for about 1 week to about 90 weeks. In embodiments, Clostridium butyricum may be administered three times a day for about 1 week to about 80 weeks. In embodiments, Clostridium butyricum may be administered three times a day for about 1 week to about 70 weeks. In embodiments, Clostridium butyricum may be administered three times a day for about 1 week to about 60 weeks. In embodiments, Clostridium butyricum may be administered three times a day for about 1 week to about 50 weeks. In embodiments, Clostridium butyricum may be administered three times a day for about 1 week to about 40 weeks. In embodiments, Clostridium butyricum may be administered three times a day for about 1 week to about 30 weeks. In embodiments, Clostridium butyricum may be administered three times a day for about 1 week to about 20 weeks.
[0133] In embodiments, Clostridium butyricum can be administered three times daily for about 1 week, about 10 weeks, about 20 weeks, about 30 weeks, about 40 weeks, about 50 weeks, about 60 weeks, about 70 weeks, about 80 weeks, about 90 weeks, or about 100 weeks. The time of administration of Clostridium butyricum can be any value or subrange of the recited range that includes the endpoint, or any range between any of the recited values.
[0134] In an embodiment, the Clostridium butyricum is about 0.1 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose once daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.5 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose once daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 1.0 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose once daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 1.5 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose once daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 2.0 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose once daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 2.5 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose once daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 3.0 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose once daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 3.5 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose once daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 4.0 x 10 9 CFU / dose ~ approx. 10 x 109 CFU / dose once daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 4.5 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose once daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 5.0 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose once daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 5.5 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose once daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 6.0 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose once daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 6.5 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose once daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 7.0 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose once daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 7.5 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose once daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 8.0 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose once daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 8.5 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose once daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 9.0 x 10 9 CFU / dose ~ approx. 10 x 10 9 It is administered once daily at a potency of CFU / dose.
[0135] In an embodiment, the Clostridium butyricum is about 0.1 x 10 9CFU / dose ~ approx. 9.5×10 9 CFU / dose once daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose ~ approx. 9.0×10 9 CFU / dose once daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose~about 8.5×10 9 CFU / dose once daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose~about 8.0×10 9 CFU / dose once daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose~approx. 7.5×10 9 CFU / dose once daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose~approx. 7.0×10 9 CFU / dose once daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose~about 6.5×10 9 CFU / dose once daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose~about 6.0×10 9 CFU / dose once daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose~approx. 5.5×10 9 CFU / dose once daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose~approx. 5.0×10 9 CFU / dose once daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose~about 4.5×10 9 CFU / dose once daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9CFU / dose ~ approx. 4.0×10 9 CFU / dose once daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose ~ approx. 3.5×10 9 CFU / dose once daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose ~ approx. 3.0×10 9 CFU / dose once daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose ~ approx. 2.5×10 9 CFU / dose once daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose ~ approx. 2.0×10 9 CFU / dose once daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose~approx. 1.5×10 9 CFU / dose once daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose~approx. 1.0×10 9 It is administered once daily at a potency of CFU / dose.
[0136] In an embodiment, the Clostridium butyricum is about 0.1 x 10 9 CFU / dose, 0.5×10 9 CFU / dose, 1.5×10 9 CFU / dose, 2.0×10 9 CFU / dose, 2.5×10 9 CFU / dose, 3.0×10 9 CFU / dose, 3.5×10 9 CFU / dose, 4.0×10 9 CFU / dose, 4.5×10 9 CFU / dose, 5.0×10 9 CFU / dose, 5.5×10 9 CFU / dose, 6.0×10 9 CFU / dose, 6.5×10 9 CFU / dose, 7.0×109 CFU / dose, 7.5×10 9 CFU / dose, 8.0×10 9 CFU / dose, 8.5×10 9 CFU / dose, 9.0×10 9 CFU / dose, 9.5×10 9 CFU / dose, or 10 x 10 9 CFU / dose once daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 2.5 x 10 9 CFU / dose once daily. In one embodiment, Clostridium butyricum is administered at a dose of 2.5 x 10 9 CFU / dose once daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 5.0 x 10 9 CFU / dose once daily. In an embodiment, Clostridium butyricum is administered at a dose of 5.0 x 10 9 It is administered once daily at a potency of CFU / dose. The potency of CBM588 LBP can be any value or subrange of the recited range that includes the endpoint, or within any range between any of the recited values.
[0137] In an embodiment, the Clostridium butyricum is about 0.1 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose twice daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.5 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose twice daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 1.0 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose twice daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 1.5 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose twice daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 2.0 x 10 9 CFU / dose ~ approx. 10 x 10 9CFU / dose twice daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 2.5 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose twice daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 3.0 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose twice daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 3.5 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose twice daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 4.0 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose twice daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 4.5 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose twice daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 5.0 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose twice daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 5.5 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose twice daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 6.0 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose twice daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 6.5 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose twice daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 7.0 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose twice daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 7.5 x 10 9 CFU / dose ~ approx. 10 x 10 9CFU / dose twice daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 8.0 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose twice daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 8.5 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose twice daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 9.0 x 10 9 CFU / dose ~ approx. 10 x 10 9 It is administered twice daily at a potency of CFU / dose.
[0138] In an embodiment, the Clostridium butyricum is about 0.1 x 10 9 CFU / dose ~ approx. 9.5×10 9 CFU / dose twice daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose ~ approx. 9.0×10 9 CFU / dose twice daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose~about 8.5×10 9 CFU / dose twice daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose~about 8.0×10 9 CFU / dose twice daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose~approx. 7.5×10 9 CFU / dose twice daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose~approx. 7.0×10 9 CFU / dose twice daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose~about 6.5×10 9 CFU / dose twice daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9CFU / dose~about 6.0×10 9 CFU / dose twice daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose~approx. 5.5×10 9 CFU / dose twice daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose~approx. 5.0×10 9 CFU / dose twice daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose~about 4.5×10 9 CFU / dose twice daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose ~ approx. 4.0×10 9 CFU / dose twice daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose ~ approx. 3.5×10 9 CFU / dose twice daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose ~ approx. 3.0×10 9 CFU / dose twice daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose ~ approx. 2.5×10 9 CFU / dose twice daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose ~ approx. 2.0×10 9 CFU / dose twice daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose~approx. 1.5×10 9 CFU / dose twice daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose~approx. 1.0×10 9 It is administered twice daily at a potency of CFU / dose.
[0139] In an embodiment, the Clostridium butyricum is about 0.1 x 10 9 CFU / dose, 0.5×10 9 CFU / dose, 1.5×10 9 CFU / dose, 2.0×10 9 CFU / dose, 2.5×10 9 CFU / dose, 3.0×10 9 CFU / dose, 3.5×10 9 CFU / dose, 4.0×10 9 CFU / dose, 4.5×10 9 CFU / dose, 5.0×10 9 CFU / dose, 5.5×10 9 CFU / dose, 6.0×10 9 CFU / dose, 6.5×10 9 CFU / dose, 7.0×10 9 CFU / dose, 7.5×10 9 CFU / dose, 8.0×10 9 CFU / dose, 8.5×10 9 CFU / dose, 9.0×10 9 CFU / dose, 9.5×10 9 CFU / dose, or approximately 10 x 10 9 CFU / dose twice daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 2.5 x 10 9 CFU / dose twice daily. In one embodiment, Clostridium butyricum is administered at a dose of 2.5 x 10 9 CFU / dose twice daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 5.0 x 10 9 CFU / dose twice daily. In one embodiment, Clostridium butyricum is administered at a dose of 5.0 x 10 9 It is administered twice daily at a potency of CFU / dose. The potency of Clostridium butyricum can be any value or subrange of the listed range that includes the endpoint, or any range between any of the listed values.
[0140] In an embodiment, the Clostridium butyricum is about 0.1 x 10 9 CFU / dose ~ approx. 10 x 10 9CFU / dose administered three times daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.5 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose administered three times daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 1.0 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose administered three times daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 1.5 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose administered three times daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 2.0 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose administered three times daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 2.5 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose three times daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 3.0 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose three times daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 3.5 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose administered three times daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 4.0 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose administered three times daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 4.5 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose three times daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 5.0 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose administered three times daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 5.5 x 10 9 CFU / dose ~ approx. 10 x 10 9CFU / dose three times daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 6.0 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose administered three times daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 6.5 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose administered three times daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 7.0 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose administered three times daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 7.5 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose administered three times daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 8.0 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose administered three times daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 8.5 x 10 9 CFU / dose ~ approx. 10 x 10 9 CFU / dose three times daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 9.0 x 10 9 CFU / dose ~ approx. 10 x 10 9 It is administered three times daily at a potency of CFU / dose.
[0141] In an embodiment, the Clostridium butyricum is about 0.1 x 10 9 CFU / dose ~ approx. 9.5×10 9 CFU / dose administered three times daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose ~ approx. 9.0×10 9 CFU / dose administered three times daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose~about 8.5×10 9 CFU / dose administered three times daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9CFU / dose~about 8.0×10 9 CFU / dose administered three times daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose~approx. 7.5×10 9 CFU / dose administered three times daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose~approx. 7.0×10 9 CFU / dose administered three times daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose~about 6.5×10 9 CFU / dose administered three times daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose~about 6.0×10 9 CFU / dose administered three times daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose~approx. 5.5×10 9 CFU / dose administered three times daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose~approx. 5.0×10 9 CFU / dose administered three times daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose~about 4.5×10 9 CFU / dose administered three times daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose ~ approx. 4.0×10 9 CFU / dose administered three times daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose ~ approx. 3.5×10 9 CFU / dose administered three times daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose ~ approx. 3.0×10 9 CFU / dose administered three times daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9CFU / dose ~ approx. 2.5×10 9 CFU / dose administered three times daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose ~ approx. 2.0×10 9 CFU / dose administered three times daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose~approx. 1.5×10 9 CFU / dose administered three times daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 0.1 x 10 9 CFU / dose~approx. 1.0×10 9 It is administered three times daily at a potency of CFU / dose.
[0142] In an embodiment, the Clostridium butyricum is about 0.1 x 10 9 CFU / dose, 0.5×10 9 CFU / dose, 1.5×10 9 CFU / dose, 2.0×10 9 CFU / dose, 2.5×10 9 CFU / dose, 3.0×10 9 CFU / dose, 3.5×10 9 CFU / dose, 4.0×10 9 CFU / dose, 4.5×10 9 CFU / dose, 5.0×10 9 CFU / dose, 5.5×10 9 CFU / dose, 6.0×10 9 CFU / dose, 6.5×10 9 CFU / dose, 7.0×10 9 CFU / dose, 7.5×10 9 CFU / dose, 8.0×10 9 CFU / dose, 8.5×10 9 CFU / dose, 9.0×10 9 CFU / dose, 9.5×10 9 CFU / dose, or approximately 10 x 10 9 CFU / dose administered three times daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 2.5 x 10 9CFU / dose three times daily. In one embodiment, Clostridium butyricum is administered at a dose of 2.5 x 10 9 CFU / dose three times daily. In an embodiment, Clostridium butyricum is administered at a concentration of about 5.0 x 10 9 CFU / dose administered three times daily. In one embodiment, Clostridium butyricum is administered at a dose of 5.0 x 10 9 CFU / dose three times daily. The potency of CBM588 LBP can be any value or subrange of the recited range that includes the endpoint, or within any range between any of the recited values.
[0143] In an embodiment, the Clostridium butyricum is about 5 x 10 9 In an embodiment, Clostridium butyricum may be administered at a concentration of 5 x 10 CFU / dose. 9 CFU / dose. In embodiments, 5 x 10 9 CFU / dose of CBM588 LBP can be administered twice daily.
[0144] In embodiments, ipilimumab may be administered at a dose of about 0.25 mg / kg to about 5 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 0.5 mg / kg to about 5 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 0.75 mg / kg to about 5 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 1 mg / kg to about 5 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 1.25 mg / kg to about 5 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 1.5 mg / kg to about 5 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 1.75 mg / kg to about 5 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 2 mg / kg to about 5 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 2.25 mg / kg to about 5 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 2.5 mg / kg to about 5 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 2.75 mg / kg to about 5 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 3.0 mg / kg to about 5 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 3.25 mg / kg to about 5 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 3.75 mg / kg to about 5 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 4 mg / kg to about 5 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 4.25 mg / kg to about 5 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 4.5 mg / kg to about 5 mg / kg.
[0145] In embodiments, ipilimumab may be administered at a dose of about 0.25 mg / kg to about 4.5 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 0.25 mg / kg to about 4.25 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 0.25 mg / kg to about 4 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 0.25 mg / kg to about 3.75 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 0.25 mg / kg to about 3.25 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 0.25 mg / kg to about 3 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 0.25 mg / kg to about 2.75 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 0.25 mg / kg to about 2.5 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 0.25 mg / kg to about 2.25 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 0.25 mg / kg to about 2 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 0.25 mg / kg to about 1.75 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 0.25 mg / kg to about 1.5 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 0.25 mg / kg to about 1.25 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 0.25 mg / kg to about 1 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 0.25 mg / kg to about 0.75 mg / kg.
[0146] In embodiments, ipilimumab may be administered at a dose of 0.25 mg / kg, 0.5 mg / kg, 0.75 mg / kg, 1 mg / kg, 1.25 mg / kg, 1.5 mg / kg, 1.75 mg / kg, 2 mg / kg, 2.25 mg / kg, 2.5 mg / kg, 2.75 mg / kg, 3 mg / kg, 4.25 mg / kg, 4.5 mg / kg, 4.75 mg / kg, or 5 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 1 mg / kg. In embodiments, ipilimumab may be administered at a dose of 1 mg / kg. The dose of ipilimumab may be any value or subrange of the recited ranges that include the endpoint, or any range between any of the recited values.
[0147] In embodiments, nivolumab may be administered at a dose of about 0.5 mg / kg to about 6 mg / kg. In embodiments, nivolumab may be administered at a dose of about 1 mg / kg to about 6 mg / kg. In embodiments, nivolumab may be administered at a dose of about 1.5 mg / kg to about 6 mg / kg. In embodiments, nivolumab may be administered at a dose of about 2 mg / kg to about 6 mg / kg. In embodiments, nivolumab may be administered at a dose of about 2.5 mg / kg to about 6 mg / kg. In embodiments, nivolumab may be administered at a dose of about 3 mg / kg to about 6 mg / kg. In embodiments, nivolumab may be administered at a dose of about 3.5 mg / kg to about 6 mg / kg. In embodiments, nivolumab may be administered at a dose of about 4 mg / kg to about 6 mg / kg. In embodiments, nivolumab may be administered at a dose of about 4.5 mg / kg to about 6 mg / kg. In embodiments, nivolumab may be administered at a dose of about 5 mg / kg to about 6 mg / kg.
[0148] In embodiments, nivolumab may be administered at a dose of about 0.5 mg / kg to about 5.5 mg / kg. In embodiments, nivolumab may be administered at a dose of about 0.5 mg / kg to about 4.5 mg / kg. In embodiments, nivolumab may be administered at a dose of about 0.5 mg / kg to about 4 mg / kg. In embodiments, nivolumab may be administered at a dose of about 0.5 mg / kg to about 3.5 mg / kg. In embodiments, nivolumab may be administered at a dose of about 0.5 mg / kg to about 3 mg / kg. In embodiments, nivolumab may be administered at a dose of about 0.5 mg / kg to about 2.5 mg / kg. In embodiments, nivolumab may be administered at a dose of about 0.5 mg / kg to about 2 mg / kg. In embodiments, nivolumab may be administered at a dose of about 0.5 mg / kg to about 1.5 mg / kg.
[0149] In embodiments, nivolumab may be administered at a dose of about 0.5 mg / kg, about 1 mg / kg, about 1.5 mg / kg, about 2 mg / kg, about 2.5 mg / kg, about 3 mg / kg, about 3.5 mg / kg, about 4 mg / kg, about 4.5 mg / kg, about 5 mg / kg, about 5.5 mg / kg, or about 6 mg / kg. In embodiments, nivolumab may be administered at a dose of about 3 mg / kg. The dosage of nivolumab may be any value or subrange of the recited ranges that include the endpoint, or any range between any of the recited values.
[0150] In embodiments, nivolumab may be administered once every three weeks, where each three week period is referred to as a "cycle." Nivolumab may be administered for about one to about ten cycles. Nivolumab may be administered for about one, about two, about three, about four, about five, about six, about seven, about eight, about nine, or about ten cycles.
[0151] In embodiments, ipilimumab may be administered once every three weeks, where each three-week period is referred to as a "cycle." Ipilimumab may be administered for about one to about ten cycles. Ipilimumab may be administered for about one, two, three, four, five, six, seven, eight, nine, or ten cycles.
[0152] For the pharmaceutical compositions provided herein, including embodiments thereof, the anti-cancer agent may be used in an amount that is normally considered subtherapeutic but is a therapeutically effective amount when used in combination with Clostridium butyricum. In embodiments, the anti-cancer agent is one or more checkpoint inhibitors. Thus, in embodiments, the checkpoint inhibitor may be used in an amount that is normally considered subtherapeutic but is a therapeutically effective amount when used in combination with Clostridium butyricum. In embodiments, the checkpoint inhibitor is nivolumab, ipilimumab, pembrolizumab, cemiplimab, durvalumab, daclizumab, avelumab, or atezolizumab. In embodiments, the checkpoint inhibitor is pembrolizumab. In embodiments, the checkpoint inhibitor is cemiplimab. In embodiments, the checkpoint inhibitor is durvalumab. In embodiments, the checkpoint inhibitor is daclizumab. In embodiments, the checkpoint inhibitor is avelumab. In embodiments, the checkpoint inhibitor is atezolizumab. In embodiments, the checkpoint inhibitor is nivolumab or ipilimumab. In embodiments, the checkpoint inhibitor is nivolumab. In embodiments, the checkpoint inhibitor is ipilimumab. In embodiments, the checkpoint inhibitor is a combination of one or more of nivolumab, ipilimumab, pembrolizumab, talimogen laherparepvec, durvalumab, daclizumab, avelumab, or atezolizumab.
[0153] In embodiments, ipilimumab may be used in an amount that is normally considered subtherapeutic but is a therapeutically effective amount when used in combination with Clostridium butyricum. In embodiments, nivolumab may be used in an amount that is normally considered subtherapeutic but is a therapeutically effective amount when used in combination with Clostridium butyricum. In embodiments, nivolumab and ipilimumab may be used in amounts that are normally considered subtherapeutic but are a therapeutically effective amount when used in combination with CBM588 LBP. In embodiments, nivolumab is therapeutically effective in amounts that are typically considered subtherapeutic when used in combination with Clostridium butyricum. In embodiments, ipilimumab is therapeutically effective in amounts that are typically considered subtherapeutic when used in combination with Clostridium butyricum. In embodiments, nivolumab and ipilimumab are therapeutically effective in amounts that are typically considered subtherapeutic when used in combination with Clostridium butyricum.
[0154] In embodiments, pembrolizumab may be used in an amount that is normally considered subtherapeutic, but is a therapeutically effective amount when used in combination with Clostridium butyricum. In embodiments, when used in combination with Clostridium butyricum, pembrolizumab is therapeutically effective at an amount that is typically considered subtherapeutic. In embodiments, cemiplimab may be used in an amount that is normally considered subtherapeutic, but is a therapeutically effective amount when used in combination with Clostridium butyricum. In embodiments, cemiplimab is therapeutically effective at an amount that is typically considered subtherapeutic when used in combination with Clostridium butyricum. In embodiments, durvalumab may be used in an amount that is normally considered subtherapeutic, but is a therapeutically effective amount when used in combination with Clostridium butyricum. In embodiments, when used in combination with Clostridium butyricum, durvalumab is therapeutically effective at an amount that is typically considered subtherapeutic. In embodiments, daclizumab may be used in amounts that are normally considered subtherapeutic but are therapeutically effective amounts when used in combination with Clostridium butyricum. In embodiments, when used in combination with Clostridium butyricum, daclizumab is therapeutically effective at amounts that are typically considered subtherapeutic. In embodiments, avelumab may be used in amounts that are normally considered subtherapeutic but are therapeutically effective amounts when used in combination with Clostridium butyricum. In embodiments, avelumab is therapeutically effective at amounts that are typically considered subtherapeutic when used in combination with Clostridium butyricum. In embodiments, atezolizumab may be used in amounts that are normally considered subtherapeutic but are therapeutically effective amounts when used in combination with Clostridium butyricum. In embodiments, when used in combination with Clostridium butyricum, atezolizumab is therapeutically effective at amounts that are typically considered subtherapeutic.
[0155] In embodiments, ipilimumab may be used in amounts that are normally considered subtherapeutic, but are therapeutically effective amounts when used in combination with Clostridium butyricum. In embodiments, when used separately from Clostridium butyricum, the amount may be about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.10, 4.11, 4.12, 4.13, 4.14, 4.15, 4.16, 4.17, 4.18, 4.19, 4.20, 4.21, 4.22, 4.23, 4.24, 4.25, 4.26, 4.27, 4.28, 4.29, 5.30, 5.31, 5.32, 5.33, 5.34, 5.35, 5.36, 5.37, 5.38, 5.39, 5.40, 5.41, 5.42, 5.43, 5.44, 5.45, 5.46, 5.47, 5.48, 5.49, 5.50, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8. 0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.0, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10.0, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43 , 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%. In embodiments, the therapeutically effective amount of ipilimumab can be from about 0.1 mg / kg to about 2.2 mg / kg.
[0156] Thus, in embodiments, ipilimumab may be administered at a dose of about 0.1 mg / kg to about 2.2 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 0.4 mg / kg to about 2.2 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 0.7 mg / kg to about 2.2 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 1 mg / kg to about 2.2 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 1.3 mg / kg to about 2.2 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 1.6 mg / kg to about 2.2 mg / kg.
[0157] In embodiments, ipilimumab may be administered at a dose of about 0.1 mg / kg to about 1.9 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 0.1 mg / kg to about 1.6 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 0.1 mg / kg to about 1.3 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 0.1 mg / kg to about 1 mg / kg. In embodiments, ipilimumab may be administered at a dose of about 0.1 mg / kg to about 0.7 mg / kg.
[0158] In embodiments, ipilimumab may be administered at a dose of about 0.1 mg / kg, 0.4 mg / kg, 0.7 mg / kg, 1 mg / kg, 1.3 mg / kg, 1.6 mg / kg, 1.9 mg / kg, or 2.2 mg / kg. The dose of ipilimumab may be any value or subrange of the recited range that includes the endpoint, or any range between any of the recited values.
[0159] In embodiments, nivolumab may be used in amounts that are normally considered subtherapeutic, but are therapeutically effective amounts when used in combination with Clostridium butyricum. In embodiments, when used separately from Clostridium butyricum, the amount may be about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.10, 4.11, 4.12, 4.13, 4.14, 4.15, 4.16, 4.17, 4.18, 4.19, 4.20, 4.21, 4.22, 4.23, 4.24, 4.25, 4.26, 4.27, 4.28, 4.29, 5.30, 5.31, 5.32, 5.33, 5.34, 5.35, 5.36, 5.37, 5.38, 5.39, 5.40, 5.41, 5.42, 5.43, 5.44, 5.45, 5.46, 5.47, 5.48, 5.49, 5.50, .5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8. 0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.0, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10.0, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43 , 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%. Thus, a therapeutically effective amount of nivolumab can be from about 0.2 mg / kg to about 2 mg / kg.
[0160] Thus, in embodiments, nivolumab may be administered at a dose of about 0.2 mg / kg to about 2 mg / kg. In embodiments, nivolumab may be administered at a dose of about 0.4 mg / kg to about 2 mg / kg. In embodiments, nivolumab may be administered at a dose of about 0.6 mg / kg to about 2 mg / kg. In embodiments, nivolumab may be administered at a dose of about 0.8 mg / kg to about 2 mg / kg. In embodiments, nivolumab may be administered at a dose of about 1 mg / kg to about 2 mg / kg. In embodiments, nivolumab may be administered at a dose of about 1.2 mg / kg to about 2 mg / kg. In embodiments, nivolumab may be administered at a dose of about 1.4 mg / kg to about 2 mg / kg. In embodiments, nivolumab may be administered at a dose of about 1.6 mg / kg to about 2 mg / kg.
[0161] In embodiments, nivolumab may be administered at a dose of about 0.2 mg / kg to about 1.8 mg / kg. In embodiments, nivolumab may be administered at a dose of about 0.2 mg / kg to about 1.6 mg / kg. In embodiments, nivolumab may be administered at a dose of about 0.2 mg / kg to about 1.4 mg / kg. In embodiments, nivolumab may be administered at a dose of about 0.2 mg / kg to about 1.2 mg / kg. In embodiments, nivolumab may be administered at a dose of about 0.2 mg / kg to about 1 mg / kg. In embodiments, nivolumab may be administered at a dose of about 0.2 mg / kg to about 0.8 mg / kg. In embodiments, nivolumab may be administered at a dose of about 0.2 mg / kg to about 0.6 mg / kg.
[0162] In embodiments, nivolumab may be administered at a dose of about 0.2 mg / kg, 0.4 mg / kg, 0.8 mg / kg, 1 mg / kg, 1.2 mg / kg, 1.4 mg / kg, 1.6 mg / kg, 1.8 mg / kg, or 2 mg / kg. The dose of nivolumab may be any value or subrange of the recited range that includes the endpoint, or any range between any of the recited values. kit
[0163] The pharmaceutical compositions provided herein, including embodiments thereof, may be packaged into kits for treating cancer. Thus, in some embodiments, a kit is provided that includes: (a) a first pharmaceutical composition comprising a first dosage form of an anticancer agent and a pharmaceutically acceptable excipient in a suitable container or suitable packaging; and (b) a second pharmaceutical composition comprising a second dosage form of Clostridium butyricum in a suitable container or suitable packaging. In some embodiments, the Clostridium butyricum is a live biological preparation. In some embodiments, the live Clostridium butyricum biological preparation is a live Clostridium butyricum MIYAIRI 588 biological preparation (CBM588 LBP). As used herein, the term "dosage form" refers to a formulation containing a predetermined dose of an agent (e.g., an anticancer agent, Clostridium butyricum). The agent (e.g., an anticancer agent, Clostridium butyricum) in the dosage form is present in an amount effective to treat the disease for which it is prescribed. In some embodiments, the kit includes instructions for use. In embodiments, the kit comprises (a) a first dosage form and a second dosage form, and (b) instructions for use in treating, preventing, slowing the progression of, or delaying the onset and / or development of cancer, or recurrence of cancer.
[0164] In embodiments, the anti-cancer agent is a checkpoint inhibitor. In embodiments, the checkpoint inhibitor is a PD-1, PD-L1, or CTLA-4 inhibitor. In embodiments, the checkpoint inhibitor is a PD-1 inhibitor. In embodiments, the checkpoint inhibitor is a PD-L1 inhibitor. In embodiments, the checkpoint inhibitor is a CTLA-4 inhibitor. In embodiments, the checkpoint inhibitor is nivolumab, ipilimumab, pembrolizumab, cemiplimab, durvalumab, daclizumab, avelumab, or atezolizumab. In embodiments, the checkpoint inhibitor is pembrolizumab. In embodiments, the checkpoint inhibitor is cemiplimab. In embodiments, the checkpoint inhibitor is durvalumab. In embodiments, the checkpoint inhibitor is daclizumab. In embodiments, the checkpoint inhibitor is avelumab. In embodiments, the checkpoint inhibitor is atezolizumab. In embodiments, the checkpoint inhibitor is nivolumab. In embodiments, the checkpoint inhibitor is ipilimumab. In embodiments, the checkpoint inhibitor is nivolumab or ipilimumab.
[0165] In embodiments, the kit further comprises (c) a third pharmaceutical composition comprising a second anti-cancer agent and a pharmaceutically acceptable excipient in a suitable container or suitable packaging. In embodiments, the second anti-cancer agent is a second checkpoint inhibitor. In embodiments, the second checkpoint inhibitor is a PD-1, PD-L1, or CTLA-4 inhibitor. In embodiments, the second checkpoint inhibitor is a PD-1 inhibitor. In embodiments, the second checkpoint inhibitor is a PD-L1 inhibitor. In embodiments, the second checkpoint inhibitor is a CTLA-4 inhibitor. In embodiments, the second checkpoint inhibitor is nivolumab, ipilimumab, pembrolizumab, cemiplimab, durvalumab, daclizumab, avelumab, or atezolizumab. In embodiments, the second checkpoint inhibitor is pembrolizumab. In embodiments, the second checkpoint inhibitor is cemiplimab. In an embodiment, the second checkpoint inhibitor is durvalumab. In an embodiment, the second checkpoint inhibitor is daclizumab. In an embodiment, the second checkpoint inhibitor is avelumab. In an embodiment, the second checkpoint inhibitor is atezolizumab. In an embodiment, the second checkpoint inhibitor is nivolumab or ipilimumab. In an embodiment, the second checkpoint inhibitor is nivolumab. In an embodiment, the second checkpoint inhibitor is ipilimumab.
[0166] Thus, in an aspect, a kit is provided that includes: (a) a first pharmaceutical composition comprising an anticancer agent and a pharmaceutically acceptable excipient in a first dosage form in a suitable container or suitable packaging; and (b) a second pharmaceutical composition comprising a live biological preparation of Clostridium butyricum MIYAIRI 588 (CBM588 LBP) in a second dosage form in a suitable container or suitable packaging. In an embodiment, the CBM588 LBP is CBM588 in combination with another strain of Clostridium butyricum, a Bifidobacterium strain, a Dorea strain, a Blautia strain, or an Akkermansia muciniphila strain. In an embodiment, the CBM588 LBP is CBM588 with another strain of Clostridium butyricum. In an embodiment, the CBM588 LBP is CBM588 with a Bifidobacterium strain. In embodiments, the CBM588 LBP is CBM588 comprising a strain of the genus Dorea. In embodiments, the CBM588 LBP is CBM588 comprising a strain of the genus Blautia. In embodiments, the CBM588 LBP is CBM588 comprising Akkermansia muciniphila. In embodiments, the CBM388 LBP is a combination of CBM388 with one or more other bacterial species, including, but not limited to, one or more other strains of Clostridium butyricum, one or more strains of the genus Bifidobacterium, one or more strains of the genus Dorea, one or more strains of the genus Blautia, and / or Akkermansia muciniphila. P embodiment
[0167] P Embodiment 1. A method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of an anti-cancer agent and a live biological preparation of Clostridium butyricum MIYAIRI 588 (CBM588 LBP).
[0168] P Embodiment 2. The method of P embodiment 1, wherein the anticancer agent is a checkpoint inhibitor.
[0169] P Embodiment 3. The method of P embodiment 2, wherein the checkpoint inhibitor is a PD-1, PDL-1, or CTLA-4 inhibitor.
[0170] P Embodiment 4. The method of P embodiment 2 or 3, wherein the checkpoint inhibitor is nivolumab, ipilimumab, pembrolizumab, cemiplimab, durvalumab, daclizumab, avelumab, or atezolizumab.
[0171] P Embodiment 5. The method of any one of P embodiments 2-4, wherein the checkpoint inhibitor is nivolumab.
[0172] P Embodiment 6. The method of any one of P embodiments 2-4, wherein the checkpoint inhibitor is ipilimumab.
[0173] P Embodiment 7. The method of any one of P embodiments 1-6, further comprising a second anticancer agent.
[0174] P Embodiment 8. The method of P embodiment 7, wherein the second anticancer agent is a second checkpoint inhibitor.
[0175] P Embodiment 9. The method of P embodiment 8, wherein the second checkpoint inhibitor is nivolumab, ipilimumab, pembrolizumab, cemiplimab, durvalumab, daclizumab, avelumab, or atezolizumab.
[0176] P embodiment 10. The method of P embodiment 8 or 9, wherein the second checkpoint inhibitor is nivolumab.
[0177] P Embodiment 11. The method of P embodiment 8 or 9, wherein the second checkpoint inhibitor is ipilimumab.
[0178] P embodiment 12. The method of any one of P embodiments 1 to 11, wherein the cancer is a microsatellite instability-high (MSI-H) cancer.
[0179] P embodiment 13. The method of any one of P embodiments 1 to 12, wherein the cancer is metastatic renal cell carcinoma (mRCC), non-small cell lung cancer, melanoma, sarcoma, lymphoma, breast cancer, bladder cancer, cervical cancer, colon cancer, head and neck cancer, liver cancer, gastric cancer, or rectal cancer.
[0180] P embodiment 14. The method of P embodiment 13, wherein the cancer is mRCC.
[0181] P Embodiment 15. The method of any one of P embodiments 1 to 14, wherein the cancer is a recurrence of cancer.
[0182] P embodiment 16. The method of any one of P embodiments 1 to 15, wherein the cancer is a chemotherapy-resistant cancer.
[0183] P embodiment 17. The method of any one of P embodiments 1 to 16, wherein the cancer is a metastatic cancer.
[0184] P Embodiment 18. A pharmaceutical composition comprising an anticancer drug in a first dosage form and CBM588 LBP in a second dosage form.
[0185] P embodiment 19. The pharmaceutical composition of P embodiment 18, wherein the anticancer agent is at a sub-therapeutically effective dose when used in the absence of CBM588 LBP for the treatment of cancer.
[0186] P embodiment 20. The pharmaceutical composition of P embodiment 18 or 19, wherein the anticancer agent is a checkpoint inhibitor.
[0187] P embodiment 21. The pharmaceutical composition of P embodiment 20, wherein the checkpoint inhibitor is a PD-1, PDL-1 or CTLA-4 inhibitor.
[0188] P embodiment 22. The pharmaceutical composition of P embodiment 20 or 21, wherein the checkpoint inhibitor is nivolumab, ipilimumab, pembrolizumab, cemiplimab, durvalumab, daclizumab, avelumab, or atezolizumab.
[0189] P Embodiment 23. The pharmaceutical composition of any one of P embodiments 20 to 22, wherein the checkpoint inhibitor is nivolumab.
[0190] P Embodiment 24. The pharmaceutical composition of any one of P embodiments 20-22, wherein the checkpoint inhibitor is ipilimumab.
[0191] P Embodiment 25. A pharmaceutical composition according to any one of P embodiments 18 to 24, further comprising a second anticancer agent.
[0192] P embodiment 26. The pharmaceutical composition of P embodiment 25, wherein the second anticancer agent is a second checkpoint inhibitor.
[0193] P embodiment 27. The pharmaceutical composition of P embodiment 26, wherein the second checkpoint inhibitor is nivolumab, ipilimumab, pembrolizumab, cemiplimab, durvalumab, daclizumab, avelumab, or atezolizumab.
[0194] P embodiment 28. The pharmaceutical composition of P embodiment 26 or 27, wherein the second checkpoint inhibitor is nivolumab.
[0195] P embodiment 29. The pharmaceutical composition of P embodiment 26 or 27, wherein the second checkpoint inhibitor is ipilimumab.
[0196] P Embodiment 30. A kit comprising: (a) a first pharmaceutical composition comprising an anticancer drug in a first dosage form and a pharmaceutically acceptable excipient in a suitable container or in suitable packaging; and (b) a second pharmaceutical composition comprising a CBM588 LBP preparation in a second dosage form in a suitable container or in suitable packaging.
[0197] P embodiment 31. The kit of P embodiment 30, wherein the anticancer agent is a checkpoint inhibitor.
[0198] P embodiment 32. The kit of P embodiment 31, wherein the checkpoint inhibitor is a PD-1 inhibitor, a PDL-1 inhibitor, or a CTLA-4 inhibitor.
[0199] P embodiment 33. The kit of P embodiment 31 or 32, wherein the checkpoint inhibitor is nivolumab, ipilimumab, pembrolizumab, cemiplimab, durvalumab, daclizumab, avelumab, or atezolizumab.
[0200] P Embodiment 34. A kit described in any one of P embodiments 31 to 33, wherein the checkpoint inhibitor is nivolumab.
[0201] P embodiment 35. The kit of P embodiments 31 to 33, wherein the checkpoint inhibitor is ipilimumab.
[0202] P embodiment 36. A kit described in any one of P embodiments 30 to 35, further comprising (c) a third pharmaceutical composition comprising a second anticancer drug and a pharmaceutically acceptable excipient in a suitable container or in suitable packaging.
[0203] P embodiment 37. The kit of P embodiment 36, wherein the second anticancer agent is a second checkpoint inhibitor.
[0204] P embodiment 38. The kit of P embodiment 37, wherein the second checkpoint inhibitor is nivolumab, ipilimumab, pembrolizumab, cemiplimab, durvalumab, daclizumab, avelumab, or atezolizumab.
[0205] P Embodiment 39. The kit of P embodiment 37 or 38, wherein the second checkpoint inhibitor is nivolumab.
[0206] P embodiment 40. The kit of P embodiment 37 or 38, wherein the second checkpoint inhibitor is ipilimumab. Embodiment
[0207] Embodiment 1. A method of treating cancer in a subject in need thereof, said method comprising administering to said subject a therapeutically effective amount of an anti-cancer agent and Clostridium butyricum.
[0208] Embodiment 2. The method of embodiment 1, wherein the Clostridium butyricum is a live biological agent.
[0209] Embodiment 3. The method of embodiment 2, wherein the live biological preparation of Clostridium butyricum is a live biological preparation of Clostridium butyricum MIYAIRI 588 (CBM588 LBP).
[0210] Embodiment 4. The method of any one of embodiments 1-3, wherein the anticancer agent is a checkpoint inhibitor.
[0211] Embodiment 5. The method of embodiment 4, wherein the checkpoint inhibitor is a PD-1, PD-L1, or CTLA-4 inhibitor.
[0212] Embodiment 6. The method of embodiment 4 or 5, wherein the checkpoint inhibitor is nivolumab, ipilimumab, pembrolizumab, cemiplimab, durvalumab, daclizumab, avelumab, or atezolizumab.
[0213] Embodiment 7. The method of any one of embodiments 4-6, wherein the checkpoint inhibitor is nivolumab.
[0214] Embodiment 8. The method of any one of embodiments 4 to 6, wherein the checkpoint inhibitor is ipilimumab.
[0215] Embodiment 9. The method of any one of embodiments 1-8, further comprising administering a second anti-cancer agent.
[0216] Embodiment 10. The method of embodiment 9, wherein the second anticancer agent is a second checkpoint inhibitor.
[0217] Embodiment 11. The method of embodiment 10, wherein the second checkpoint inhibitor is nivolumab, ipilimumab, pembrolizumab, cemiplimab, durvalumab, daclizumab, avelumab, or atezolizumab.
[0218] Embodiment 12. The method of embodiment 10 or 11, wherein the second checkpoint inhibitor is nivolumab.
[0219] Embodiment 13 The method of embodiment 10 or 11, wherein the second checkpoint inhibitor is ipilimumab.
[0220] Embodiment 14. The method of any one of embodiments 1 to 13, wherein the cancer is a microsatellite instability-high (MSI-H) cancer.
[0221] Embodiment 15. The method of any one of embodiments 1-14, wherein the cancer is metastatic renal cell carcinoma (mRCC), non-small cell lung cancer, melanoma, sarcoma, lymphoma, breast cancer, bladder cancer, cervical cancer, colon cancer, head and neck cancer, liver cancer, gastric cancer, or rectal cancer.
[0222] Embodiment 16. The method of embodiment 15, wherein the cancer is mRCC.
[0223] Embodiment 17. The method of any one of embodiments 1 to 16, wherein the cancer is a recurrence of cancer.
[0224] Embodiment 18. The method of any one of embodiments 1 to 17, wherein the cancer is a chemotherapy-resistant cancer.
[0225] Embodiment 19. The method of any one of embodiments 1 to 18, wherein the cancer is a metastatic cancer.
[0226] Embodiment 20. A pharmaceutical composition comprising an anticancer drug in a first dosage form and Clostridium butyricum in a second dosage form.
[0227] Embodiment 21. The pharmaceutical composition of embodiment 20, wherein the Clostridium butyricum is a live biological product.
[0228] Embodiment 22. The pharmaceutical composition of embodiment 21, wherein the live biological preparation of Clostridium butyricum is a live biological preparation of Clostridium butyricum MIYAIRI 588 (CBM588 LBP).
[0229] Embodiment 23. The pharmaceutical composition of any one of embodiments 20 to 22, wherein the anticancer agent is administered at a dose that is less than its therapeutically effective amount when used in the absence of CBM588 LBP to treat cancer.
[0230] Embodiment 24. The pharmaceutical composition of any one of embodiments 20 to 23, wherein the anticancer agent is a checkpoint inhibitor.
[0231] Embodiment 25. The pharmaceutical composition of embodiment 24, wherein the checkpoint inhibitor is a PD-1, PD-L1, or CTLA-4 inhibitor.
[0232] Embodiment 26. The pharmaceutical composition of embodiment 24 or 23, wherein the checkpoint inhibitor is nivolumab, ipilimumab, pembrolizumab, cemiplimab, durvalumab, daclizumab, avelumab, or atezolizumab.
[0233] Embodiment 27. The pharmaceutical composition of any one of embodiments 24 to 26, wherein the checkpoint inhibitor is nivolumab.
[0234] Embodiment 28. The pharmaceutical composition of any one of embodiments 24 to 26, wherein the checkpoint inhibitor is ipilimumab.
[0235] Embodiment 29. The pharmaceutical composition of any one of embodiments 20 to 28, further comprising a second anticancer agent.
[0236] Embodiment 30. The pharmaceutical composition of embodiment 29, wherein the second anticancer agent is a second checkpoint inhibitor.
[0237] Embodiment 31. The pharmaceutical composition of embodiment 30, wherein the second checkpoint inhibitor is nivolumab, ipilimumab, pembrolizumab, cemiplimab, durvalumab, daclizumab, avelumab, or atezolizumab.
[0238] Embodiment 32. The pharmaceutical composition of embodiment 30 or 31, wherein the second checkpoint inhibitor is nivolumab.
[0239] Embodiment 33. The pharmaceutical composition of embodiment 30 or 31, wherein the second checkpoint inhibitor is ipilimumab.
[0240] Embodiment 34. A kit comprising: (a) a first pharmaceutical composition comprising an anticancer drug in a first dosage form and a pharmaceutically acceptable excipient in a suitable container or suitable packaging; and (b) a second pharmaceutical composition comprising Clostridium butyricum in a second dosage form in a suitable container or suitable packaging.
[0241] Embodiment 35. The kit of embodiment 34, wherein the Clostridium butyricum is a live biological product.
[0242] Embodiment 36. The kit of embodiment 35, wherein the live biological preparation of Clostridium butyricum is a live biological preparation of Clostridium butyricum MIYAIRI 588 (CBM588 LBP).
[0243] Embodiment 37. The kit of any one of embodiments 34 to 36, wherein the anticancer agent is a checkpoint inhibitor.
[0244] Embodiment 38. The kit of embodiment 37, wherein the checkpoint inhibitor is a PD-1, PD-L1, or CTLA-4 inhibitor.
[0245] Embodiment 39. The kit of embodiment 37 or 38, wherein the checkpoint inhibitor is nivolumab, ipilimumab, pembrolizumab, cemiplimab, durvalumab, daclizumab, avelumab, or atezolizumab.
[0246] Embodiment 40. The kit of any one of embodiments 37 to 39, wherein the checkpoint inhibitor is nivolumab.
[0247] Embodiment 41. The kit of any one of embodiments 37 to 39, wherein the checkpoint inhibitor is ipilimumab.
[0248] Embodiment 42. (c) The kit of any one of embodiments 34 to 41, further comprising a third pharmaceutical composition comprising a second anticancer drug and a pharmaceutically acceptable excipient in a suitable container or in suitable packaging.
[0249] Embodiment 43. The kit of embodiment 42, wherein the second anticancer agent is a second checkpoint inhibitor.
[0250] Embodiment 44. The kit of embodiment 43, wherein the second checkpoint inhibitor is nivolumab, ipilimumab, pembrolizumab, cemiplimab, durvalumab, daclizumab, avelumab, or atezolizumab.
[0251] Embodiment 45. The kit of embodiment 43 or 44, wherein the second checkpoint inhibitor is nivolumab. [Example]
[0252] Example 1: Evaluation of the biological efficacy of a live biologic of Clostridium butyricum MIYAIRI 588 (CBM588 LBP) in combination with nivolumab / ipilimumab in patients with metastatic renal cell carcinoma (mRCC) Background to the studies described herein
[0253] The treatment landscape for mRCC has changed dramatically over the past decade. Most recently, nivolumab / ipilimumab has been introduced in the frontline setting based on data from the CheckMate 214 trial, which demonstrated an overall survival benefit compared with sunitinib. While the data are encouraging for this strategy of dual checkpoint inhibition, the majority of patients are not cured of their disease. Only a minority of patients (46%) respond to immunotherapy, and approximately 20% of patients progress through treatment.
[0254] Recent studies suggest that the gut microbiota may play an important role in modulating responses to immunotherapy. In a mouse model, Vetizou et al. reported that the activity of cytotoxic T-lymphocyte-associated protein 4 (CTLA4) blockade therapy was dependent on the presence of Bacteroides species. 5 In relation to PD-1, Sivan et al. showed that the clinical activity of anti-PD-1 agents is associated with Bifidobacterium species. 6 Gopalakrishnan et al. reported a correlation between microbiota composition and response to anti-PD1 agents in 43 patients with metastatic melanoma. 7 Routy et al. showed that the relative abundance of Akkermansia muciniphila was closely related to the response. 8
[0255] Therefore, applicants proposed to evaluate a live biological product of Clostridium butyricum MIYAIRI 588 (CBM588 LBP) in combination with the checkpoint inhibitors nivolumab / ipilimumab to determine its anti-cancer efficacy. Microbiota in mRCC
[0256] Applicants first investigated the role of the microbiota in patients with mRCC receiving nivolumab and TKIs. Patients receiving sunitinib or nivolumab were enrolled via two separate IRB-approved protocols (COH IRB 16088 and COH IRB 16323, respectively). In these studies, applicants utilized fecal samples for DNA extraction and analysis.
[0257] The first protocol randomized patients receiving sunitinib to a diet excluding yogurt or any bacterially enriched foods, or required patients to consume a standard 4 ounce yogurt supplement (Activia™) twice daily for the 12-week study period. The second protocol required the elimination of yogurt or any bacterially enriched foods for the 12-week study period.
[0258] At the end of the 12-week study period, responses were characterized using RECIST 1.1 criteria. For the purposes of the study, responders were defined as patients achieving a complete response (CR), partial response (PR), or stable disease (SD) after 3 months of treatment, and non-responders were defined as patients with progressive disease (PD) as their best response.
[0259] Fecal samples were processed using protocols established by the Earth Microbiome Project (EMP). Briefly, DNA was extracted from 250 mg of fecal material for each sample using the DNeasy PowerSoil kit (MoBio Laboratories, a Qiagen Company, Carlsbad, CA). The manufacturer's protocol was followed, with the exception of a 10-minute incubation at 65°C after adding solution C1 according to the EMP protocol. 16S amplicon libraries with barcoded adapters compatible with Illumina chemistry were prepared from the extracted DNA using the previously described method. Each library was quantified by qPCR (Kapa Biosystems; Wilmington, MA). Quantified libraries were pooled at equimolar concentrations. The pool was quantified and run on an Illumina MiSeq using version 3 chemistry (Illumina Inc., San Diego, CA).
[0260] As described in the MiSeq SOPs, sequence reads were processed using Mothur software, assembled into OUTs, taxonomically annotated to the genus level, and used to construct a Bray-Curtis dissimilarity matrix. Sample similarities were visualized using PCoA and further confirmed by ANOSIM tests, and differentially abundant taxa were determined using METASTATS software.
[0261] Treated fecal DNA was subjected to PCR using universal primers. PCR amplicons were sequenced, diluted to 10,000 sequences per sample, and poor-quality sequences were trimmed. Chimeric sequences were removed and assembled into 7,097 operational taxonomic units (OTUs), which were taxonomically annotated at the genus level. OTU sizes ranged from 1 sequence for the median and smallest size, 37 for the average size, and 30,878 for the largest size. OTUs were used to assess the structure, membership, and dynamics of the gut microbial community. OTU abundances were normalized and used to calculate distances between samples using Bray-Curtis dissimilarity, which was visualized by PCoA plot. Sample distribution confirmed that gut microbiota structure was patient-specific (ANOSIM, p=0.001) and that treatment response was one of the significant factors affecting sample segregation (ANOSIM, p=0.01).
[0262] As shown in Figures 1A and 1B, the microbial community structure between patients responding to nivolumab and sunitinib treatment and patients with progressive tumors was compared using eight samples collected before treatment initiation (time point 1 [T1]). The Gini-Simpson index suggested that the complexity of the gut microbiota was not significantly different between the responder groups (Wilcoxon rank-sum test, p = 0.25). At the same time, a trend was observed suggesting that the microbiota of patients responding to treatment had higher complexity. The gut microbiota structure was decomposed to the phylum and genus levels. METASTATS identified that the phylum Bacteroidetes, the genus Barnesiella, and the genus Bacteroides were elevated in responders (p < 0.05 for each). The phylum Proteobacteria was elevated in non-responders, but METASTATS analysis suggested that this difference was not significant (p = 0.29).
[0263] Collectively, the data suggest that specific bacterial species (e.g., Bifidobacterium, Clostridium, etc.) are associated with clinical efficacy associated with immunotherapy in mRCC. Therefore, we propose the combination of nivolumab / ipilimumab and CBM588 LBP in patients with mRCC as a novel approach to enhance bacterial subpopulations, such as Bifidobacterium. CBM588 LBP
[0264] CBM588 is a strain of Clostridium butyricum that is commercially available in Japan as a live biological product for humans and as an animal feed additive. CBM588 was approved by the European Union in 2014 as a novel food ingredient and as a feed additive for turkeys, chickens, and a few related bird species. 9 In a pediatric study involving 110 children with upper respiratory tract infections or gastroenteritis, CBM588 administered as an LBP was safe and well tolerated. Furthermore, the incidence of antibiotic-associated diarrhea was significantly reduced in patients receiving CBM588 LBP (59% vs. 5%). 10 In the ulcerative colitis trial, CBM588 LBP was administered orally at a dose of 60 mg three times daily. 11、12
[0265] There are no data demonstrating the safety, tolerability, and efficacy of combining CBM588 LBP with immunotherapy in patients with advanced cancer. Therefore, we evaluated CBM588 LBP as an adjunct to nivolumab / ipilimumab in patients with mRCC in a phase I protocol. OBED represents the dose that resulted in the greatest increase in Bifidobacterium levels from baseline to week 6 of treatment. Bifidobacterium was chosen among other bacteria thought to be associated with response to immunotherapy because CBM588 LBP could specifically increase levels of this genus. Eligibility Criteria
[0266] Inclusion Criteria:
[0267] To be eligible for study inclusion, participants must meet all of the following criteria on screening: histologic confirmation of RCC with a clear cell component, advanced (ineligible for curative surgery or radiation therapy) or metastatic (AJCC stage IV) RCC, no prior systemic therapy for RCC, with the following exceptions: one prior adjuvant or neoadjuvant therapy for completely resectable RCC if therapy did not include an agent targeting PD-1 or PD-L1 and if recurrence occurred at least 6 months after the last dose of adjuvant or neoadjuvant therapy, ECOG performance status less than 2, and measurable disease by RECIST 1.1.
[0268] Key exclusion criteria:
[0269] Presence of untreated brain metastases. Patients with treated brain metastases must be stable for 4 weeks after completing treatment, with pre-study imaging demonstrating stability. Patients must have clinical symptoms from brain metastases and must not be on systemic corticosteroids equivalent to >10 mg / day prednisone or its equivalent for at least 2 weeks prior to the first dose of study drug. Patients with known leptomeningeal metastases, even if treated, are excluded.
[0270] Prior treatment with anti-PD-1, anti-PD-L1, anti-PD-L2, anti-CD137, or anti-CTLA-4 antibodies, or any other antibodies or drugs that specifically target T-cell costimulatory or checkpoint pathways.
[0271] Current or recent history of known or suspected autoimmune disease, or recent history of symptoms that required systemic corticosteroids (>10 mg prednisone equivalent daily) or immunosuppressants, excluding symptoms not expected to recur in the absence of an external trigger. Subjects with vitiligo or residual hypothyroidism due to type 1 diabetes or autoimmune thyroiditis requiring hormone replacement alone will be permitted to enroll.
[0272] Current use of probiotics, yogurt, or bacteria-fortified foods or intended use during treatment.
[0273] Any condition requiring systemic treatment with corticosteroids (>10 mg prednisone equivalent daily) or other immunosuppressants within 14 days prior to the first dose of study drug. Inhaled steroids and adrenal replacement steroid doses greater than 10 mg prednisone equivalent daily are permitted in the absence of active autoimmune disease.
[0274] Uncontrolled adrenal insufficiency.
[0275] Any known medical condition that, in the opinion of the investigator, increases the risks associated with study participation or administration of the study drug or interferes with the interpretation of safety results (e.g., conditions associated with diarrhea or acute diverticulitis).
[0276] Grade 1 (NCI CTCAE v4) or baseline before administration of study medication.
[0277] Any of the following laboratory findings: WBC < 2,000 / mm 3 , neutrophils <1,500 / mm 3 , platelets <100,000 / mm 3 , AST or ALT > 3 × ULN (> 5 × ULN if liver metastases are present), total bilirubin > 1.5 × ULN (excluding subjects with Gilbert syndrome who may have total bilirubin 3.0 mg / dL), serum creatinine > 1.5 × upper limit of normal (ULN). Treatment Program Overview
[0278] Table 1. Treatment arms were randomized (2:1) to nivolumab / ipilimumab with CBM588 LBP or nivolumab / ipilimumab alone. [Table 1]
[0279] The primary objectives of this study were (1) to determine the effect of CBM588 LBP (in combination with nivolumab / ipilimumab) on modulating the gut microbiota in patients with mRCC. Secondary objectives were (1) to evaluate the effect of CBM588 LBP on the clinical efficacy of the nivolumab / ipilimumab combination, and (2) to determine the effect of CBM588 LBP on systemic immunomodulation of the nivolumab / ipilimumab combination in patients with mRCC.
[0280] The evaluation criteria and evaluation items were as follows and are shown in Tables 2 and 3. The primary endpoint was (1) the change in fecal composition of Bifidobacterium from baseline to week 12 of treatment for CBM588 LBP plus nivolumab / ipilimumab versus nivolumab / ipilimumab alone. Secondary endpoints included: (1) comparison of the Shannon index (a measure of microbial diversity) from baseline to week 12 of treatment for CBM588 LBP plus nivolumab / ipilimumab versus nivolumab / ipilimumab alone; (2a) best overall response by RECIST for nivolumab / ipilimumab alone versus nivolumab / ipilimumab with CBM588 LBP; (2b) progression-free survival (PFS), assessed as the time from enrollment to progression, for nivolumab / ipilimumab alone versus nivolumab / ipilimumab with CBM588 LBP; (3a) comparison of the proportion of circulating Tregs at baseline compared to the level of circulating Tregs for nivolumab / ipilimumab alone versus nivolumab / ipilimumab with CBM588 LBP; and (3b) comparison of the proportion of circulating Tregs at baseline compared to the level of circulating Tregs for nivolumab / ipilimumab alone versus nivolumab / ipilimumab with CBM588 LBP. Comparison of the percentage of circulating MDSCs in nivolumab / ipilimumab combined with LBP, and (3c) comparison of IL-6, IL-8, and other cytokines / chemokines in nivolumab / ipilimumab alone versus nivolumab / ipilimumab combined with CBM588 LBP. Table 2. Main purpose [Table 2] Table 3. Secondary Objectives [Table 3]
[0281] One cycle of treatment consisted of a 3-weekly regimen of nivolumab and ipilimumab for the first 12 weeks. Thereafter, nivolumab was administered on a monthly schedule, so a cycle was considered to be 4 weeks. The treatment cycle is shown in Table 4.
[0282] CBM588 LBP: CBM588 LBP is to be administered orally daily at a dose of 80 mg twice daily in 100 ml of water (contents of two sachets) and should be given indefinitely while following the protocol.
[0283] Nivolumab: Nivolumab was administered intravenously at a dose of 3 mg / kg, followed by ipilimumab at 3 mg / kg monthly for the first four cycles.
[0284] Ipilimumab: After nivolumab administration, ipilimumab was administered intravenously at a dose of 1 mg / kg for the first four cycles only, after which administration was discontinued. Drug administration
[0285] CBM588:
[0286] CBM588 granules consist of Clostridium butyricum and are manufactured as an orally available live biological therapeutic packaged in 1g sachets. Each sachet contains 40mg of CBM588. CBM588 is administered orally at a dose of 80mg twice daily in 100ml of water (contents of two sachets) and should be given indefinitely while following the protocol. Subjects may take CBM588 with or without food. CBM588 should be taken at home, not in a clinic. The defined dosing cycle is 21 days.
[0287] Nivolumab:
[0288] Nivolumab injection is a clear, opalescent, colorless to pale yellow, sterile, non-pyrogenic, single-use, isotonic aqueous solution formulated with sodium citrate, sodium chloride, mannitol, diethylenetriaminepentaacetic acid (pentetic acid), and polysorbate 80 (Tween® 80), pH 6.0. Each vial contains 100 mg (10 mg / mL) and is packaged in a 10 mL type I flint glass vial with a 0.7 mL overfill, equipped with a butyl rubber stopper and aluminum seal. Nivolumab injection vials should be stored at 2°C to 8°C (36°F to 46°F) and protected from light, freezing, and shaking. If any fluctuations in storage temperature are observed, immediately return nivolumab to 2°C to 8°C and quarantine the supply.
[0289] Nivolumab can be injected undiluted (10 mg / mL) or diluted with 0.9% Sodium Chloride Injection, USP, or 5% Dextrose, USP to a drug concentration of 0.35 mg / mL or greater. Nivolumab injection is administered as a 60-minute IV infusion through a 0.2-1.2 micron pore size, low-protein binding polyethersulfone membrane in-line filter. No compatibility has been observed between nivolumab and polyvinyl chloride (PVC), non-PVC DHEP (di(2-ethylhexyl) phthalate) IV components, or glass bottles.
[0290] Administration of undiluted and diluted nivolumab solutions should be completed within 24 hours of preparation. If not used immediately, the infusion solution can be stored in a refrigerator at 2°C to 8°C (36°F to 46°F) for up to 24 hours, with up to 4 hours of the total 24-hour period at room temperature (20°C to 25°C (68°F to 77°F)) and room light. The 4-hour period under room temperature and room light conditions includes the product administration period. Single-use dosage forms do not contain antimicrobial preservatives or bacteriostatic agents. Therefore, it is recommended that the product be discarded 8 hours after initial administration.
[0291] Ipilimumab:
[0292] Ipilimumab injection is supplied as 200 mg / 40 mL (5 mg / mL). It is formulated as a clear to slightly opalescent, colorless to pale yellow, sterile, nonpyrogenic, single-use, isotonic aqueous solution that may contain particles. Vials of ipilimumab injection should be stored at 2°C to 8°C (36°F to 46°F), frozen, and protected from light. If any fluctuations in storage temperature are observed, immediately return ipilimumab to 2°C to 8°C and quarantine the supply.
[0293] Ipilimumab is administered undiluted (10 mg / mL) or further diluted in 0.9% Sodium Chloride Injection, USP, or 5% Dextrose, USP at concentrations of 1 mg / mL to 4 mg / mL. Ipilimumab is stable in polyvinyl chloride (PVC), non-PVC DHEP (di(2-ethylhexyl) phthalate) IV bags or glass containers when refrigerated at 2°C to 8°C (36°F to 46°F) or room temperature with room light for up to 24 hours. The product may be infused using a volumetric pump with a non-pyrogenic, low-protein-binding filter (0.2 micrometer or 1.2 micrometer pore size) in protocol-specific dose(s). The prepared IV ipilimumab solution is stable for up to 24 hours when refrigerated at 2°C to 8°C (36°F to 46°F) or room temperature with room light. Each vial is a Type I flint glass vial with a gray butyl stopper and sealed with an aluminum seal. Partially used or empty vials of ipilimumab injection should be disposed of on-site according to proper drug disposal procedures.
[0294] Table 4. Regiment Description [Table 4]
[0295] Participants received protocol therapy until one of the following criteria was met: disease progression, completion of protocol therapy, participant deemed intolerant to protocol therapy due to toxicity despite dose modification / delay (if one agent was discontinued due to toxicity, the participant could continue receiving the other study agent), general or specific changes in the patient's condition that, in the judgment of the investigator, made the patient unamenable to further treatment, or withdrawal of consent for further protocol therapy.
[0296] Study participation ended when any of the following occurred: completion of study activities, withdrawal of consent, or participant loss to follow-up for safety, behavioral, study termination, or administrative reasons at the investigator's discretion. Patient response and study retention for each treatment group are shown in Figure 2. Correlation / Special Testing and Laboratory Processing and Analysis
[0297] Assessment of fecal microbiota
[0298] Samples were collected at predetermined time points: Fecal material was collected by the patient into 100 mL collection containers at two time points, before treatment began (baseline) and at the start of week 13.
[0299] Total genomic DNA was isolated from 0.25 g of feces using the PowerSoil DNA Isolation Kit (Mo Bio, USA). Purified DNA was separated on a 1% agarose gel and quantified by densitometry and spectrophotometry (NanoDrop 1000; Thermo Scientific, USA). Bacterial 16S rRNA genes were amplified from all samples using a PCR protocol as described by Stearns et al. The V4 and V5 regions were amplified using the following PCR primers, which contain the Illumina portion of the 12 adapter sequence: In the following sequences, M can be A or C.
[0300] SEQ ID NO: 1 V4-F:ACACTCTTTCCCTACACGACGCTCTTCCGATCTGTGCCAGCMGCCGCGGTAA.
[0301] SEQ ID NO:2 V4-R:ACACTCTTTCCCTACACGACGCTCTTCCGATCTGTGCCAGCMGCCGCGGTAA.
[0302] SEQ ID NO: 3 V5-F: ACACTCTTTCCCTACACGACGCTCTTCCGATCTGATTAGATACCCTGGTAG.
[0303] SEQ ID NO: 4 V5-R:GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCCGTCAATTCMTTTGAGTTT.
[0304] Complete Illumina adapters and barcodes were added by five additional cycles of PCR to generate Illumina libraries. QC was checked using a bioanalyzer and qPCR. Libraries were mixed equally. 2 × 100 bp paired-end sequencing was performed on an Illumina HiSeq 2000. Sequences were clustered at various identity percentages against a closed reference using the USEARCH algorithm. Classification was then assigned using the RDP2.4 classifier as described in Smith et al.
[0305] We used Illumina / Solexa high-throughput sequencing to sequence the 16S rRNA gene. Libraries were constructed for all samples by amplification of the V3 region of bacterial 16S rRNA. Barcodes were generated to uniquely index and label each sample for multiplexed Illumina sequencing with paired-end reads. Initially, multiple test runs were generated to ensure the effectiveness of 16S rRNA extraction and amplification from fecal samples, and standard QC was performed to check the quality of the multiplexed Illumina sequencing. Reads of poor quality were removed, and only reads that perfectly matched the assembly were retained for further downstream analysis.
[0306] Serum cytokine assessment
[0307] At weeks 7, 13, 17, and 25 (+ / - 1 week), one 10 mL CPT tube was collected within 7 days before the initiation of nivolumab and ipilimumab. A pretreatment sample could be collected the morning of treatment initiation, as long as the sample preceded the administration of ipilimumab / nivolumab. Efforts were made to collect samples at the time of routine blood sampling. Blood was collected into a 10 mL CPT vacuum tube, gently inverted approximately 8-10 times, and kept at room temperature.
[0308] The 10 mL CPT tube samples were processed quickly, ideally within 4-6 hours. The CPT tubes were centrifuged at 1800 x g (approximately 2800 rpm in a Sorvall RT6000 centrifuge) for 20 minutes at room temperature. After centrifugation, the plasma from the CPT tube was gently pipetted onto the gel plug to remove cells adhering to the top of the gel. The cell suspension was transferred to a 50 mL conical polypropylene tube. cRPMI was added to a total of 40 mL. A 10 mL aliquot of the cell suspension was removed for counting. The 50 mL tube was then centrifuged at 250 x g for 7 minutes at room temperature. Once centrifugation was complete, the supernatant was aspirated. PMBCs were either frozen or used fresh.
[0309] Isolation of relevant WBC subsets was performed using a previously reported technique. PBMCs were immersed in a mixture of PBS, 2% FCS, and 0.1% (wt / vol) sodium azide with FcIII / IIR-specific antibodies to block nonspecific binding. Cells were then stained with different combinations of fluorochrome-conjugated antibodies against CD11c, I-Ab (MHC class II), CD86, CD11b, Gr1, CD49b, CD3, CD25, or Lag-3, or with Annexin V (BD Biosciences). Fluorescence data were collected on a FACSCalibur (Beckton Dickinson) and analyzed using FlowJo software (Tree Star). This method was previously published by Chalmin et al. Efficacy endpoint measurement
[0310] Change in fecal composition of Bifidobacterium spp. from baseline to week 13 of treatment
[0311] Applicants assessed the proportion of Bifidobacterium species (relative to the cumulative assessment of microbial species) at baseline and compared this to the proportion observed after completing 12 weeks of treatment.
[0312] Best overall response by RECIST criteria
[0313] Response was a secondary endpoint in this study. For this purpose, patients were reassessed for response every 12 weeks. As shown in Figures 3 and 4, this study assessed response and progression using the new international criteria proposed by the revised Response Evaluation Criteria in Solid Tumors (RECIST) guidelines (version 1.1). 14Results show that the majority of patients treated with nivolumab / ipilimumab exhibited progressive disease, while patients treated with nivolumab / ipilimumab plus CBM588 LBP had either stable disease or a partial response to treatment. The published RECIST document is available at http: / / www.eortc.be / RECIST. The RECIST criteria used were the change in the longest diameter (unidimensional measurement) of the tumor lesion and the shortest diameter in the case of malignant lymph nodes.
[0314] Toxicity assessment. All patients were evaluable for toxicity from the time of first treatment with VV2003 alone or in combination with nivolumab and ipilimumab.
[0315] Assessment for Objective Response. Only patients with measurable disease present at baseline, who received at least one cycle of treatment, and whose disease was reassessed were considered evaluable for response. These patients had a response classified according to the definitions described below. (Note: Patients who demonstrated objective disease progression before the end of Cycle 1 were considered evaluable.)
[0316] Evaluable Non-Target Disease Response. Patients with baseline disease that was evaluable but did not meet the definition of measurable disease, received at least one cycle of treatment, and had their disease reassessed were considered evaluable for non-target disease. Response assessment was based on the presence, absence, or definite progression of disease.
[0317] Measurable disease. Measurable lesions were defined as those that could be accurately measured in at least one dimension (longest recorded diameter) by chest x-ray ≥20 mm or by clinical examination, CT scan, MRI, or caliper ≥10 mm. All tumor measurements were recorded in millimeters (or fractions of a centimeter).
[0318] Tumor lesions located in previously irradiated areas were considered measurable.
[0319] Malignant lymph nodes. To be considered pathologically enlarged and measurable, lymph nodes had to measure ≥15 mm in their short axis when assessed by CT scan (a CT scan slice thickness of ≤5 mm is recommended). At baseline and follow-up, only the short axis was measured and tracked.
[0320] Nonmeasurable disease. All other lesions (or sites of disease), including small lesions (pathologic lymph nodes with a longest diameter less than 10 mm or a short axis greater than or equal to 10 mm but less than 15 mm), were considered nonmeasurable. Bone lesions, leptomeningeal disease, ascites, pleural / pericardial effusion, cutaneous lymphangitis / pneumonia, inflammatory breast disease, and abdominal masses (not followed by CT or MRI) were considered nonmeasurable.
[0321] Target Lesions. All measurable lesions, up to two per organ and a total of five lesions representing all involved organs, were identified as target lesions and recorded and measured at baseline. Target lesions were selected based on their size (lesions with the longest diameter) to be representative of all involved organs but also conducive to reproducible repeated measurements. In some cases, the largest lesion may not be suitable for reproducible measurement; in that situation, the next largest lesion that can be reproducibly measured should be selected. The sum of the diameters of all target lesions (longest axis for non-nodal lesions and short axis for nodal lesions) was calculated and reported as the baseline total diameter. If lymph nodes were included in the total, only the short axis was added to the total. The baseline total diameter was used as a reference to further characterize any objective tumor regression in the measurable dimensions of disease.
[0322] Non-target lesions. All other lesions (or sites of disease), including any measurable lesions above and beyond the five target lesions, should be identified as non-target lesions and recorded at baseline. Measurement of these lesions is not required, but their presence, absence, or, in rare cases, definite progression should be noted throughout follow-up.
[0323] Measurable disease assessment methods
[0324] All measurements should be taken and recorded in metric notation using a ruler or calipers. All baseline assessments should be performed as close as possible to the start of treatment, but no more than 4 weeks before the start of treatment.
[0325] The same assessment methods and techniques should be used to characterize each lesion identified and reported at baseline and during follow-up. Imaging-based assessment is preferred over clinical assessment unless the lesion being followed cannot be imaged but can be assessed by clinical examination.
[0326] Clinical Lesions: Clinical lesions are considered measurable only if they are superficial (e.g., skin nodules and palpable lymph nodes) and ≥10 mm in diameter as assessed using calipers (e.g., skin nodules). For skin lesions, documentation by color photographs, including a ruler to estimate the size of the lesion, is recommended.
[0327] Chest X-ray: Lesions on chest X-ray are acceptable as measurable lesions if they are well-defined and surrounded by aerated lung; however, CT is preferred.
[0328] Conventional CT and MRI: This guideline defines the measurability of lesions on CT scans based on the assumption that the CT slice thickness is 5 mm or less. If the CT scan has a slice thickness greater than 5 mm, the minimum size for a measurable lesion should be twice the slice thickness. MRI is also acceptable in certain circumstances (e.g., for body scans).
[0329] The use of MRI remains a complex issue. MRI has excellent contrast, spatial, and temporal resolution. However, MRI involves many image acquisition variables that significantly affect image quality, lesion conspicuity, and measurement. Furthermore, MRI availability is generally variable. Similar to CT, when MRI is performed, the technical specifications of the scan sequence used should be optimized for the type and location of disease assessed. Furthermore, similar to CT, the modality used at follow-up should be the same as that used at baseline, and lesions should be measured / assessed with the same pulse sequence. It is beyond the scope of the RECIST guidelines to prescribe specific MRI pulse sequence parameters for every scanner, body part, and disease. Ideally, the same type of scanner should be used, and the image acquisition protocol should follow the previous scan as closely as possible. Body scans should be performed using breath-hold scanning techniques, if possible.
[0330] PET-CT: Currently, the low-dose or attenuation-corrected CT portion of a combined PET-CT is not necessarily of optimal diagnostic CT quality for use in RECIST-compliant measurements. However, if a site can demonstrate that the CT performed as part of the PET-CT is of the same diagnostic quality as the diagnostic CT (including IV and oral contrast), the CT portion of the PET-CT can be used in RECIST-compliant measurements and can be used interchangeably with conventional CT in accurately measuring cancer lesions over time. However, it should be noted that the PET portion of the CT introduces additional data that may bias the treating physician if not performed routinely or serially.
[0331] Ultrasound: Ultrasound is not useful for assessing lesion size and should not be used as a measurement method. Ultrasound examinations cannot be reproduced in their entirety for later independent review and are operator-dependent, so the same technique and measurements cannot be guaranteed from one evaluation to the next. If new lesions are identified by ultrasound during the course of the examination, confirmation by CT or MRI is recommended. MRI can be used instead of CT in selected cases if there are concerns about radiation exposure with CT.
[0332] Target Lesion Evaluation
[0333] Complete response (CR): Disappearance of all target lesions. All pathological lymph nodes (whether target or non-target) must have a short axis reduced to less than 10 mm. Partial response (PR): At least a 30% reduction in the sum of the diameters of the target lesions, based on the baseline sum diameter. Progressive disease (PD): At least a 20% increase in the sum of the diameters of the target lesions, taking the smallest sum on study as reference (this includes the baseline sum if it is the smallest on study). In addition to the 20% relative increase, the sum must also show an absolute increase of at least 5 mm. (Note: The appearance of one or more new lesions is also considered progression). Stable disease (SD): Neither sufficient shrinkage to qualify for PR nor sufficient increase to qualify for PD, taking the smallest sum diameter on study as reference.
[0334] Evaluation of non-target lesions
[0335] Complete Response (CR): Disappearance of all non-target lesions. All lymph nodes must be non-pathological in size (short axis <10 mm). Non-CR / Non-PD: Persistence of one or more non-target lesions and / or maintenance of tumor marker levels above normal limits. Progressive Disease (PD): Appearance of one or more new lesions and / or definite progression of existing non-target lesions. Indeterminate progression should usually not exceed the status of target lesions. It should represent a change in overall disease status, not an increase in a single lesion. Definite progression of only "non-target" lesions is exceptional, but in such circumstances the opinion of the treating physician should prevail, and the progression status should be confirmed later by a review panel (or principal investigator).
[0336] Best overall response rating
[0337] Best overall response is the best response recorded from treatment initiation until disease progression / recurrence (for progressive disease, the reference is the smallest measurement recorded after treatment initiation). Assignment of a patient's best response depends on achieving both measurement and confirmation criteria.
[0338] Time from registration to progression
[0339] PFS is defined as the time from the start of treatment to progression or death, whichever occurs first.
[0340] Comparison of the Shannon index (a measure of microbial diversity) from baseline to week 13 of treatment
[0341] Calculate the Shannon index at baseline and week 12 for comparison of microbial diversity at these two time points using the translational method described in section 9.1.
[0342] Comparison of the percentage of circulating Tregs at baseline versus the level of circulating Tregs upon treatment
[0343] Use the translational method described in section 9.2 to estimate the percentage of Tregs in the blood, which is assessed graphically across consecutive time points of blood collection to identify any trends (see study calendar).
[0344] Comparison of the percentage of circulating MDSCs at baseline versus the level of circulating MDSCs at the time of treatment
[0345] Use the translational method described in section 9.2 to estimate the percentage of MDSCs in the blood, which is assessed graphically over consecutive time points of blood collection to identify any trends (see study calendar).
[0346] Comparison of IL-6, IL-8, and other cytokines at baseline against levels of the same cytokines on treatment
[0347] Using a translational method, applicants estimate serum cytokine ratios in the blood, which are evaluated graphically over successive time points of blood draw to identify any trends (see study calendar).
[0348] Study Design
[0349] This paper describes a randomized trial of nivolumab / ipilimumab alone or in combination with CBM588. The objective is to define the biological effects of CBM588 when used in combination with nivolumab / ipilimumab. Applicant's preclinical data indicates that Bifidobacterium species are associated with response to immunotherapy, and therefore, CBM588 is believed to increase levels of Bifidobacterium species. Applicant compared the proportional increase in Bifidobacterium species with the addition of CBM588 to CBM588 and identified the cohort that achieved the greatest such increase compared to patients receiving nivolumab / ipilimumab alone.
[0350] Sample size and natural increase rate
[0351] Thirty patients will be randomized in a 1:2 fashion to receive nivolumab / ipilimumab alone (Group 1) or in combination with CBM588 (Group 2). Spontaneous accrual of 30 patients is expected over two years (approximately 1.5 patients / month), with an average follow-up of approximately 12 months (based on PFS estimates for nivolumab / ipilimumab). Given an expected 80% acceptance rate for this study based on existing trials in newly diagnosed mRCC patients, we would need to approach approximately two patients per month. This is feasible with the current rate of new patient volume at our institution.
[0352] Statistical analysis plan
[0353] Primary endpoint: Change in fecal composition of Bifidobacterium from baseline to week 12 of treatment. Comparison of Shannon index (a measure of microbial diversity) from baseline to week 12 of treatment. Analytical plan: Change in Bifidobacterium from baseline to week 12 will be assessed for both groups of patients. With 20 in the CBM588-containing group and 10 in the non-CBM588-containing group, Applicants will have 80% power to detect a difference of one standard deviation (the common standard deviation of the change in Bifidobacterium) between the mean changes detected in the two groups using a two-group t-test with a one-sided, type I error of 0.05.
[0354] Comparisons of the Shannon index (a measure of microbial diversity) from baseline to week 12 of treatment will be performed in a similar fashion. Because this is a secondary measure, any conclusions will be subject to the multiple comparison issues inherent in this second analysis.
[0355] Secondary endpoints: (1a) Best overall response by RECIST criteria for nivolumab / ipilimumab alone versus nivolumab / ipilimumab with CBM588. The association between treatment arm and overall response (response or no response) by RECIST criteria will be examined using Fisher's exact test. (1b) Progression-free survival (PFS), assessed as the time from enrollment to progression, for nivolumab / ipilimumab alone versus nivolumab / ipilimumab with CBM588. Analysis plan: The difference in progression-free survival across the two groups will be examined graphically using Kaplan-Meier survival plots. Median progression-free survival for each of the two groups will be reported, and a Cox proportional hazards model will be used to estimate the hazard ratio and its confidence interval.
[0356] The following exploratory analyses are performed without adjusting for the issue of multiple comparisons, but any conclusions drawn include a discussion of the limitations of any conclusions due to concerns about multiple comparisons. (2a) Comparison of the percentage of circulating Tregs to the level of circulating Tregs at baseline for nivolumab / ipilimumab alone versus nivolumab / ipilimumab with CBM588. (2b) Comparison of the percentage of circulating myeloid-derived suppressor cells (MDSCs) for nivolumab / ipilimumab alone versus nivolumab / ipilimumab with CBM588. (2c) Comparison of IL-6, IL-8, and other cytokines / chemokines for nivolumab / ipilimumab alone versus nivolumab / ipilimumab with CBM588.
[0357] Example 2: Analysis of the anti-cancer effects of CBM588 LBP in combination with nivolumab / ipilimumab in patients with metastatic renal cell carcinoma (mRCC)
[0358] Applicants further evaluated the anti-cancer efficacy of a combination treatment comprising nivolumab / ipilimumab and CBM588 LBP, as described in Example 1. The median follow-up period for patients undergoing the treatment trial was 89 weeks. The characteristics of patients enrolled in the trial are shown in Table 5.
[0359] Table 5. Patient characteristics [Table 5]
[0360] Among patients enrolled in the trial, a significantly greater number of patients receiving nivolumab / ipilimumab in combination with CBM588 experienced progression-free survival compared to patients receiving nivolumab / ipilimumab without CBM588 (Figure 5). Similarly, overall survival was increased in patients receiving checkpoint inhibitor combination therapy with CBM588 compared to patients receiving checkpoint inhibitors without CBM588 (Figure 6).
[0361] Table 6. Progression-free survival. [Table 6]
[0362] Table 7. Progression-free survival: Test of the equivalence of survival distributions for different levels of NI1NIC2. [Table 7]
[0363] Table 8. Overall survival. [Table 8]
[0364] Table 9. Overall survival: Test of equality of survival distributions for different levels of NI1NIC2. [Table 9]
[0365] Furthermore, more patients receiving the nivolumab / ipilimumab / CBM588 combination therapy demonstrated a response to treatment, as measured by changes in cancerous lesions (Figure 7 and Table 10). Similarly, overall responses were higher in patients receiving combination therapy including CBM588 compared to patients receiving checkpoint inhibitors alone (Table 11).
[0366] Table 10. Target lesion response in patients receiving Nivo / Ipi or Nivo / Ipi / CBM. [Table 10]
[0367] Table 11. Overall response in patients receiving Nivo / Ipi or Nivo / Ipi / CBM [Table 11]
[0368] The study results further demonstrate that more patients are able to continue treatment when receiving a combination therapy containing CBM588 compared to patients receiving checkpoint inhibitor treatment alone. Furthermore, more patients receiving the combination therapy experienced either stable disease or a partial response to treatment (Figure 8).
[0369] Example 3: Analysis of gastrointestinal regulation by CBM588
[0370] While not wishing to be bound by scientific theory, the applicant's rationale for the clinical trial described herein was that CBM588 could modify the GI microbiota to enhance host immune function against cancer. The exact bacterial populations in the GI tract that can enhance or attenuate host immune function are not fully understood. Therefore, a Wilcoxon signed-rank test was performed to compare the relative abundance at the species level between the Time 1 and Time 2 data of the CBM588 responder group only. Significant differences in the relative abundance of 44 species were detected, and their relative abundance in each group is shown as boxplots (without multiplicity adjustment) (Figures 9A-9B, 10A-10F, 11A-11C, 12A-12C, and 13A).
[0371] One possible group of bacteria in the GI tract associated with improved response to immune checkpoint therapy for cancer is the genus Bifidobacterium. Microbiome data indeed show a trend toward increased Bifidobacterium abundance in the GI tract from pre-CBM588 treatment (T1) to post-CBM588 treatment (T2). This effect was not observed in placebo subjects. Additionally, there are increases and decreases in other bacterial populations, particularly in CBM588-treated subjects, that may underlie the immune benefit against cancer (Figures 9A-9B, 10A-10F, 11A-11C, 12A-12C, and 13A). References
[0372] 1.Surveillance,Epidemiology,and End Results Program.SEER stat fact sheets:kidney and renal pelvis cancer.Bethesda,MD,National Cancer Institute
[0373] 2. Choueiri TK, Motzer RJ: Systemic Therapy for Metastatic Renal-Cell Carcinoma.N Engl J Med 376:354-366,2017
[0374] 3.Motzer RJ, Tannir NM, McDermott DF, et al:Nivolumab plus Ipilimumab versus Sunitinib in Advanced Renal-Cell Carcinoma.N Engl J Med 378:1277-1290,2018
[0375] 4.Motzer RJ, Tannir NM, McDermott DF, et al:Nivolumab plus Ipilimumab versus Sunitinib in Advanced Renal-Cell Carcinoma.New England Journal of Medicine 378:1277-1290,2018
[0376] 5.Vetizou M,Pitt JM,Daillere R,et al:Anticancer immunotherapy by CTLA-4 blockade relies on the gut microbiota.Science 350:1079-84,2015
[0377] 6.Sivan A,Corrales L,Hubert N,et al:Commensal Bifidobacterium promotes antitumor immunity and facilitates anti-PD-L1 efficacy.Science 350:1084-9,2015
[0378] 7.Gopalakrishnan V,Spencer CN,Nezi L,et al:Gut microbiome modulates response to anti-PD-1 immunotherapy in melanoma patients.Science 359:97-103,2018
[0379] 8.Derosa L,Hellmann MD,Spaziano M,et al:Negative association of antibiotics on clinical activity of immune checkpoint inhibitors in patients with advanced renal cell and non-small-cell lung cancer.Ann Oncol 29:1437-1444,2018
[0380] 9.Isa K,Oka K,Beauchamp N,et al:Safety assessment of the Clostridium butyricum MIYAIRI 588(R)probiotic strain including evaluation of antimicrobial sensitivity and presence of Clostridium toxin genes in vitro and teratogenicity in vivo.Hum Exp Toxicol 35:818-32,2016
[0381] 10.Seki H,Shiohara M,Matsumura T,et al:Prevention of antibiotic-associated diarrhea in children by Clostridium butyricum MIYAIRI.Pediatr Int 45:86-90,2003
[0382] 11.Yasueda A,Mizushima T,Nezu R,et al:The effect of Clostridium butyricum MIYAIRI on the prevention of pouchitis and alteration of the microbiota profile in patients with ulcerative colitis.Surg Today 46:939-49,2016
[0383] 12.Sato S,Nagai H,Igarashi Y:Effect of probiotics on serum bile acids in patients with ulcerative colitis.Hepatogastroenterology 59:1804-8,2012
[0384] 13.Chalmin F,Ladoire S,Mignot G,et al:Membrane-associated Hsp72 from tumor-derived exosomes mediates STAT3-dependent immunosuppressive function of mouse and human myeloid-derived suppressor cells.J Clin Invest 120:457-71,2010
[0385] 14.Eisenhauer EA,Therasse P,Bogaerts J,et al:New response evaluation criteria in solid tumours:revised RECIST guideline(version 1.1).Eur J Cancer 45:228-47,2009
[0386] 15.Oken MM,Creech RH,Tormey DC,et al:Toxicity and response criteria of the Eastern Cooperative Oncology Group.Am J Clin Oncol 5:649-55,1982
Claims
1. 1. A method of treating cancer in a subject in need thereof, said method comprising administering to said subject therapeutically effective amounts of an anti-cancer agent and Clostridium butyricum.
2. 10. The method of claim 1, wherein the Clostridium butyricum is a live biological agent.
3. 3. The method of claim 2, wherein the live biological preparation of Clostridium butyricum is a live biological preparation of Clostridium butyricum MIYAIRI 588 (CBM588 LBP).
4. 10. The method of claim 1, wherein the anti-cancer agent is a checkpoint inhibitor.
5. 5. The method of claim 4, wherein the checkpoint inhibitor is a PD-1, PD-L1, or CTLA-4 inhibitor.
6. 5. The method of claim 4, wherein the checkpoint inhibitor is nivolumab, ipilimumab, pembrolizumab, cemiplimab, durvalumab, daclizumab, avelumab, or atezolizumab.
7. 5. The method of claim 4, wherein the checkpoint inhibitor is nivolumab.
8. 5. The method of claim 4, wherein the checkpoint inhibitor is ipilimumab.
9. 10. The method of claim 1, further comprising administering a second anti-cancer agent.
10. 10. The method of claim 9, wherein the second anti-cancer agent is a second checkpoint inhibitor.
11. 11. The method of claim 10, wherein the second checkpoint inhibitor is nivolumab, ipilimumab, pembrolizumab, cemiplimab, durvalumab, daclizumab, avelumab, or atezolizumab.
12. 11. The method of claim 10, wherein the second checkpoint inhibitor is nivolumab.
13. 11. The method of claim 10, wherein the second checkpoint inhibitor is ipilimumab.
14. 10. The method of claim 1, wherein the cancer is a microsatellite instability-high (MSI-H) cancer.
15. 10. The method of claim 1, wherein the cancer is metastatic renal cell carcinoma (mRCC), non-small cell lung cancer, melanoma, sarcoma, lymphoma, breast cancer, bladder cancer, cervical cancer, colon cancer, head and neck cancer, liver cancer, gastric cancer, or rectal cancer.
16. 16. The method of claim 15, wherein the cancer is mRCC.
17. 10. The method of claim 1, wherein the cancer is a recurrence of cancer.
18. 10. The method of claim 1, wherein the cancer is a chemotherapy-resistant cancer.
19. 10. The method of claim 1, wherein the cancer is a metastatic cancer.
20. A pharmaceutical composition comprising an anti-cancer drug in a first dosage form and Clostridium butyricum in a second dosage form.
21. 21. The pharmaceutical composition of claim 20, wherein the Clostridium butyricum is a live biological product.
22. 22. The pharmaceutical composition of claim 21, wherein the live biological preparation of Clostridium butyricum is a live biological preparation of Clostridium butyricum MIYAIRI 588 (CBM588 LBP).
23. 21. The pharmaceutical composition of claim 20, wherein the anti-cancer agent is at a sub-therapeutically effective dose when used in the absence of CBM588 LBP to treat cancer.
24. 21. The pharmaceutical composition of claim 20, wherein the anti-cancer agent is a checkpoint inhibitor.
25. 25. The pharmaceutical composition of claim 24, wherein the checkpoint inhibitor is a PD-1, PD-L1, or CTLA-4 inhibitor.
26. 25. The pharmaceutical composition of claim 24, wherein the checkpoint inhibitor is nivolumab, ipilimumab, pembrolizumab, cemiplimab, durvalumab, daclizumab, avelumab, or atezolizumab.
27. 25. The pharmaceutical composition of claim 24, wherein the checkpoint inhibitor is nivolumab.
28. 25. The pharmaceutical composition of claim 24, wherein the checkpoint inhibitor is ipilimumab.
29. 21. The pharmaceutical composition of claim 20, further comprising a second anti-cancer agent.
30. 30. The pharmaceutical composition of claim 29, wherein the second anti-cancer agent is a second checkpoint inhibitor.
31. 31. The pharmaceutical composition of claim 30, wherein the second checkpoint inhibitor is nivolumab, ipilimumab, pembrolizumab, cemiplimab, durvalumab, daclizumab, avelumab, or atezolizumab.
32. 31. The pharmaceutical composition of claim 30, wherein the second checkpoint inhibitor is nivolumab.
33. 31. The pharmaceutical composition of claim 30, wherein the second checkpoint inhibitor is ipilimumab.
34. A kit comprising: (a) a first pharmaceutical composition comprising an anticancer drug in a first dosage form and a pharmaceutically acceptable excipient in a suitable container or in suitable packaging; and (b) a second pharmaceutical composition comprising Clostridium butyricum in a second dosage form in a suitable container or in suitable packaging.
35. 35. The kit of claim 34, wherein the Clostridium butyricum is a live biological product.
36. 36. The kit of claim 35, wherein the live biological preparation of Clostridium butyricum is a live biological preparation of Clostridium butyricum MIYAIRI 588 (CBM588 LBP).
37. 35. The kit of claim 34, wherein the anti-cancer agent is a checkpoint inhibitor.
38. 38. The kit of claim 37, wherein the checkpoint inhibitor is a PD-1, PD-L1, or CTLA-4 inhibitor.
39. 38. The kit of claim 37, wherein the checkpoint inhibitor is nivolumab, ipilimumab, pembrolizumab, cemiplimab, durvalumab, daclizumab, avelumab, or atezolizumab.
40. 38. The kit of claim 37, wherein the checkpoint inhibitor is nivolumab.
41. 38. The kit of claim 37, wherein the checkpoint inhibitor is ipilimumab.
42. 35. The kit of claim 34, further comprising: (c) a third pharmaceutical composition comprising a second anti-cancer agent and a pharmaceutically acceptable excipient in a suitable container or in suitable packaging.
43. 43. The kit of claim 42, wherein the second anti-cancer agent is a second checkpoint inhibitor.
44. 44. The kit of claim 43, wherein the second checkpoint inhibitor is nivolumab, ipilimumab, pembrolizumab, cemiplimab, durvalumab, daclizumab, avelumab, or atezolizumab.
45. 44. The kit of claim 43, wherein the second checkpoint inhibitor is nivolumab.
46. 44. The kit of claim 43, wherein the second checkpoint inhibitor is ipilimumab.