Oil yeast that selectively elongates omega-3 fatty acids and a method for producing omega-3 fatty acids using the same

By transforming oil yeast with a promoter to enhance LsElo2 expression and co-expressing desaturases, the method addresses the challenge of selectively producing omega-3 fatty acids, achieving efficient and controlled omega-3 fatty acid production in oil yeast.

JP2026050014APending Publication Date: 2026-03-19MIYOSHI OIL & FAT +1
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-09-09
Publication Date
2026-03-19

AI Technical Summary

Technical Problem

Conventional methods for producing omega-3 fatty acids using oil yeasts face challenges in selectively producing omega-3 fatty acids while suppressing the production of omega-6 fatty acids, and existing technologies are not practical for commercialization due to low lipid production and inefficiencies.

Method used

The method involves transforming oil yeast with a promoter that enhances the expression of LsElo2, an enzyme that selectively elongates alpha-linolenic acid to eicosatrienoic acid, and co-expressing desaturase enzymes to promote the desaturation of linoleic acid to alpha-linolenic acid, thereby increasing omega-3 fatty acid production while minimizing omega-6 fatty acid production.

Benefits of technology

This approach effectively enhances the production of omega-3 fatty acids in oil yeast, achieving a controlled omega-3/omega-6 ratio and enabling mass production suitable for commercial applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026050014000023
    Figure 2026050014000023
  • Figure 2026050014000024
    Figure 2026050014000024
  • Figure 2026050014000025
    Figure 2026050014000025
Patent Text Reader

Abstract

This invention provides a mutant strain of oil yeast in which the production of omega-3 fatty acids is improved, and a method for producing omega-3 fatty acids using the mutant strain. [Solution] A lipid yeast into which a promoter that promotes the expression of LsElo2 has been introduced, increasing the production of omega-3 fatty acids.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] This invention relates to the selective production of omega-3 fatty acids in oil yeast. [Background technology]

[0002] A group of yeasts known as oil yeasts can accumulate large amounts of oil (more than 20% of their body weight) within their cells, and have recently attracted attention as an alternative source of oils and fats to plants and animals. Products produced by oil yeasts include triacylglycerols (TAGs), i.e., fatty acids, and fatty acid production using oil yeasts has the potential to become a promising business in the future.

[0003] On the other hand, many of the omega-3 (ω3) fatty acids synthesized from alpha-linolenic acid as a starting material play important roles as physiologically active substances, and are also essential fatty acids that cannot be synthesized in the human body. Therefore, the mass production of omega-3 fatty acids using oil yeast could become an extremely important technology in the future. Traditionally, highly unsaturated fatty acids have been derived from fish and algae, but due to restrictions on fish catches as part of the trend towards biodiversity conservation, rising prices, and the unique odor of algae, alternative technologies that enable the mass production of omega-3 fatty acids are being sought.

[0004] Regarding the production of fatty acids using yeast, Patent Document 1 proposes a method for producing oils and fats, which includes recovering oils and fats from a culture of oily yeast, wherein the oily yeast is an oily yeast containing an isolated polynucleotide that includes the coding sequence of Δ12 fatty acid desaturase derived from the yeast Pseudozyma antarctica. However, in the technique described in Patent Document 1, linoleic acid, an omega-6 (ω6) fatty acid, is also elongated at the same time.

[0005] Non-patent document 1 identifies and clarifies the characteristics of two genes, LsELO1 and LsELO2, that encode fatty acid elongases in the oil yeast Lipomyces starkeyi. He states that when these genes were heterologously expressed in the budding yeast Saccharomyces cerevisiae, it was revealed that LsElo1 is involved in the production of saturated long-chain fatty acids with 24 carbon atoms (C24:0), and LsElo2 is involved in the conversion of C16 fatty acids to C18 fatty acids. Furthermore, it was found that both LsElo1 and LsElo2 elongated polyunsaturated fatty acids, LsElo1 elongated linoleic acid (C18:2) to eicosadienoic acid (C20:2), and LsElo2 elongated α-linolenic acid (C18:3) to eicosatrienoic acid (C20:3). It has been reported that overexpression of LsELO2 in starkeyi leads to a decrease in C16 fatty acids, such as palmitic acid and palmitoleic acid, while C18 fatty acids such as oleic acid and linoleic acid accumulate. However, this only shows that the production of eicosatrienoic acid (ETrA), an omega-3 fatty acid, increased when a specific culture medium containing an excess of α-linolenic acid was used, and it cannot be said to be a practical method. Furthermore, Non-Patent Document 1 shows results using budding yeast with low lipid production, and therefore cannot be considered practical for commercialization. [Prior art documents] [Patent Documents]

[0006] [Patent Document 1] Patent No. 7144004 [Non-patent literature]

[0007] [Non-Patent Document 1] “Identification and characterization of two fatty acid elongases in Lipomyces starkeyi”, Applied Microbiology and Biotechnology, Vol.104, p.2537-2544, 2020 [Overview of the Initiative] [Problems that the invention aims to solve]

[0008] As a fundamental technology for realizing the mass production of omega-3 fatty acids using oil yeast, it is necessary to obtain an oil yeast strain that can easily and abundantly produce omega-3 fatty acids. However, conventional technologies have had the aforementioned problems in producing omega-3 fatty acids.

[0009] This invention has been made in view of the above circumstances, and aims to provide a mutant strain of oil yeast in which the production of omega-3 fatty acids is improved, and a method for producing omega-3 fatty acids using the mutant strain. [Means for solving the problem]

[0010] To solve the above problems, the inventors conducted diligent research and, as a result, unexpectedly discovered that by highly expressing the enzyme LsElo2, which is conventionally known to contribute to the elongation reaction from palmitic acid to stearic acid, in oily yeast, the elongation reaction from α-linolenic acid (C18:3) to eicosatrienoic acid (C20:3) in cells is actively promoted, leading to the completion of the present invention. Furthermore, the inventors have discovered that the production of omega-3 fatty acids can be enhanced by transforming cells to express desaturase, an enzyme that promotes the desaturation of linoleic acid (C18:2) to α-linolenic acid (C18:3).

[0011] In other words, this disclosure provides the following inventions. [1] A lipid yeast into which a promoter that promotes LsElo2 expression has been introduced, resulting in increased production of omega-3 fatty acids. [2] The aforementioned LsElo2, The oily yeast according to [1], which is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 6, or a polypeptide having 90% or more identity with the amino acid sequence shown in SEQ ID NO: 6 and having LsElo2 activity. [3] The aforementioned promoter, The 70486 promoter, the oil yeast described in [1]. [4] The promoter region of the aforementioned 70486 promoter is It is either the promoter region of the 70486 promoter consisting of the nucleotide sequence shown in Sequence ID No. 1, or The oily yeast described in [3], wherein the promoter region consists of a nucleotide sequence having 90% or more identity with the promoter region of the 70486 promoter consisting of the nucleotide sequence shown in Sequence ID No. 1, and the promoter region has the promoter activity of the 70486 promoter. [5] The terminator region of the aforementioned 70486 promoter is It is either the terminator region of the 70486 promoter consisting of the nucleotide sequence shown in Sequence ID No. 2, or The oily yeast described in [3], wherein the terminator region consists of a nucleotide sequence having 90% or more identity with the terminator region of the 70486 promoter consisting of the nucleotide sequence shown in Sequence ID No. 2, and is a terminator region having the terminator activity of the 70486 promoter. [6] The aforementioned 70486 promoter, The oily yeast described in [3], wherein the promoter consists of the nucleotide sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2. [7] Furthermore, the oily yeast described in any one of [1] to [6] is transformed to highly express desaturase, an enzyme that promotes the desaturation of linoleic acid (C18:2) to α-linolenic acid (C18:3). [8] The oil yeast described in [7], wherein the desaturase is MgD15D, FvD15D, or LsFad3, and the enzyme incorporates TDH3 as a promoter. [9] The aforementioned MgD15D, A polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 10, or An enzyme having more than 90% identity with the amino acid sequence shown in Sequence ID No. 10, possessing MgD15D activity, and incorporating TDH3 as a promoter. The aforementioned FvD15D is A polypeptide consisting of the amino acid sequence shown in Sequence ID No. 12, or An enzyme having more than 90% identity with the amino acid sequence shown in Sequence ID No. 12, possessing FvD15D activity, and incorporating TDH3 as a promoter. The aforementioned LsFad3, A polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 14, or The oil yeast described in [8] is a polypeptide having more than 90% identity with the amino acid sequence shown in Sequence ID No. 14, and possessing LsFad3 activity, and an enzyme in which TDH3 is incorporated as a promoter.

[10] The aforementioned MgD15D, It is a polypeptide consisting of the amino acid sequence shown in Sequence ID No. 10, and an enzyme in which TDH3 is incorporated as a promoter. The aforementioned FvD15D is It is a polypeptide consisting of the amino acid sequence shown in Sequence ID No. 12, and is an enzyme in which TDH3 is incorporated as a promoter. The aforementioned LsFad3, The oil yeast described in [9] is LsFad3, which consists of the amino acid sequence shown in Sequence ID No. 14, and is an enzyme in which TDH3 is incorporated as a promoter.

[11] A method for producing omega-3 fatty acids, comprising recovering oils containing omega-3 fatty acids from the cell bodies and / or culture medium of the oily yeast described in [1]. [Effects of the Invention]

[0012] According to the present invention, it is possible to effectively produce target omega-3 fatty acids in oil yeast while suppressing the production of unwanted omega-6 fatty acids. [Brief explanation of the drawing]

[0013] [Figure 1] The graphs show cell concentration, residual glucose levels, and lipid synthesis levels for the following strains: Δlslig4, Δlslig4 / LsELO2HE, Δlslig4 / LsELO2HE / PaD12DHE, Δlslig4 / LsELO2HE / PaD12DHE / MgD15DHE, Δlslig4 / LsELO2HE / PaD12DHE / FvD15DHE, and Δlslig4 / LsELO2HE / PaD12DHE / LsFAD3HE. The horizontal axis of each graph represents the elapsed time since the start of culture. Each graph shows the average of three independent measurements, and the error bars indicate the standard error. [Figure 2] This shows the fatty acid synthesis pathway. [Figure 3] This graph shows the expression levels of genes involved in the fatty acid synthesis pathway in the Δlslig4, Δlslig4 / LsELO2HE, Δlslig4 / LsELO2HE / PaD12DHE, Δlslig4 / LsELO2HE / PaD12DHE / MgD15DHE, Δlslig4 / LsELO2HE / PaD12DHE / FvD15DHE, and Δlslig4 / LsELO2HE / PaD12DHE / LsFAD3HE strains. Each graph shows the average of three independent measurements, and the error bars indicate the standard error. [Modes for carrying out the invention]

[0014] The following describes specific embodiments for carrying out the present invention. The enzyme LsElo2, inherently present in the oil yeast Lipomyces starkeyi, is generally known to contribute to the elongation of C16 fatty acids (palmitic acid) to C18 fatty acids. However, when oil yeast was transformed using an expression unit sequence containing a specific set of promoter and terminator sequences (hereinafter, unless otherwise specified, such a set may simply be referred to as the "promoter" or "promoter sequence") and the LsELO2 gene sequence, and LsELO2 was highly expressed, it was revealed that it selectively elongates α-linolenic acid to eicosatrienoic acid within the cell. To promote this reaction, it is not necessary to intentionally add large amounts of α-linolenic acid to the yeast.

[0015] Furthermore, LsElo2 does not participate in the production of linoleic acid, an omega-6 fatty acid, but selectively elongates alpha-linolenic acid, an omega-3 fatty acid. This selectivity enables the control of the ω3 / ω6 ratio, allowing for the effective production of desired omega-3 fatty acids while suppressing the production of unwanted omega-6 fatty acids.

[0016] Furthermore, it was revealed that transforming LsElo2-highly expressing strains to highly express an enzyme (desaturase) that promotes the desaturation of linoleic acid (C18:2) to α-linolenic acid (C18:3) further promotes the production of eicosatrienoic acid (C20:3), an omega-3 fatty acid.

[0017] These results will lead to a technology for mass-producing omega-3 fatty acids using oil yeast.

[0018] The oily yeast of the present invention has a promoter that promotes the expression of LsElo2, resulting in increased production of omega-3 fatty acids. Here, increased production of omega-3 fatty acids means an increase compared to when the expression unit is not introduced, and in particular, an increase in the production of a series of omega-3 fatty acids synthesized from alpha-linolenic acid as a starting material. An increase in the production of alpha-linolenic acid (C18:3) is also intended.

[0019] <oleaginous yeast> The oil-based yeast used in this invention is not particularly limited as long as it is a yeast capable of accumulating a large amount of oil. Representative oil yeasts that can be used include those of the genera Lipomyces, Rhodosporidium, Yarrowia, Cryptococcus, and Trichosporon. Examples of Lipomyces yeasts that can be used include Lipomyces starkeyi. Examples of Rhodosporidium genus yeasts that can be used include Rhodosporidium truloides and Rhodotorula glutinis. Examples of Yarrowia genus yeasts used include Yarrowia lipolytica. Examples of Cryptococcus yeasts used include Cryptococcus albidus. Examples of yeasts belonging to the genus Trichosporon include Trichosporon οleaginοsus. Among these, Lipomyces starkeyi is preferred from the viewpoint of oil and fat production volume.

[0020] The oily yeasts exemplified above may also be mutant strains. For example, the Δlslig4 strain of Lipomyces starkeyi is a known mutant strain. The oily yeasts may have mutations introduced in the fatty acid synthesis pathway. Specifically, for example, mutations may be introduced in the fatty acid synthesis pathway by introducing exogenous genes, modifying endogenous genes or their promoters, etc., in the C16 / C18 fatty acid elongase, Δ9 desaturase, Δ9 elongase, Δ8 desaturase, Δ5 desaturase, Δ15 desaturase, Δ17 desaturase, etc. This makes it possible to further increase, for example, the polyunsaturated fatty acid content, preferably the omega-3 fatty acid content.

[0021] For oily yeast, yeast with high oil accumulation capacity is preferred. Oily yeast may have an oil content of, for example, 20% (w / w) or more, 30% (w / w) or more, 40% (w / w) or more, 50% (w / w) or more, 60% (w / w) or more, or 65% or more.

[0022] <Enzyme> In this invention, the target oily yeast is produced by transforming oily yeast to highly express LsElo2, an enzyme conventionally known as elongase 2 that controls the elongation reaction from palmitic acid (C16:0) to stearic acid (C18:0), particularly derived from Lipomyces starkeyi.

[0023] In this invention, LsElo2 is the endogenous LsElo2 of Lipomyces starkeyi, as specified in Non-Patent Document 1 and other documents mentioned above. Furthermore, all mutants of LsElo2 (including amino acid substitution mutants, deletion mutants, etc.) that do not lose their elongase activity are also included.

[0024] As an example, the aforementioned LsElo2 is LsElo2 (i.e., polypeptide) consisting of the amino acid sequence shown in Sequence ID No. 6, or This polypeptide has more than 90% identity with the amino acid sequence shown in Sequence ID No. 6 and possesses LsElo2 activity.

[0025] LsElo2 is identified as a polypeptide having the amino acid sequence shown in Sequence ID No. 6. Furthermore, the cDNA sequence of LsElo2 included in the expression unit sequence used in the examples of this application is identified as Sequence ID No. 5.

[0026] In the present invention, the LsElo2 cDNA is a cDNA in which the polypeptide encoded therein is any variant (including amino acid-substituted variants, deletion variants, etc.) within the range that does not cause LsElo2 to lose its activity.

[0027] As an example, the cDNA is The DNA sequence shown in Sequence ID No. 5, or This is a cDNA sequence that has more than 90% identity with the DNA sequence shown in Sequence ID No. 5, and the polypeptide encoded therein has LsElo2 activity.

[0028] Furthermore, in this invention, mutant strains are created that highly express an enzyme that controls the desaturation of linoleic acid (C18:2) to α-linolenic acid (C18:3). Various such enzymes are known for each species, and various enzymes can be applied insofar as the objective is achieved. Candidate enzymes to be co-expressed with the aforementioned elongase 2 include MgD15D from the rice blast fungus Magnaporthe grisea, FvD15D from the corn rot fungus Fusarium verticilliodes (Fusarium moniliforme), or LsFad3 from Lipomyces starkeyi.

[0029] In other words, in the present invention, mutant strains transformed to express desaturase, an enzyme that promotes the desaturation of linoleic acid (C18:2) to α-linolenic acid (C18:3), are preferably used.

[0030] The term "desaturase" as used herein includes MgD15D, FvD15D, and LsFad3. Furthermore, it also includes all mutants of MgD15D, FvD15D, or LsFad3 (including amino acid substitution mutants, deletion mutants, etc.) that do not lose their desaturase activity.

[0031] As an example, the aforementioned MgD15D is A polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 10, or The polypeptide has more than 90% identity with the amino acid sequence shown in Sequence ID No. 10 and possesses MgD15D activity. Preferably, it is an enzyme further incorporating TDH3 as a promoter.

[0032] As an example, the aforementioned FvD15D is A polypeptide consisting of the amino acid sequence shown in Sequence ID No. 12, or This polypeptide has more than 90% identity with the amino acid sequence shown in Sequence ID No. 12 and possesses FvD15D activity. Preferably, it is an enzyme further incorporating TDH3 as a promoter.

[0033] As an example, the aforementioned LsFad3 is A polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 14, or The polypeptide has more than 90% identity with the amino acid sequence shown in SEQ ID NO: 14 and possesses LsFad3 activity. Preferably, it is an enzyme further incorporating TDH3 as a promoter.

[0034] Furthermore, MgD15D is identified as a polypeptide having the amino acid sequence shown in SEQ ID NO: 10, FvD15D as SEQ ID NO: 12, and LsFad3 as a polypeptide having the amino acid sequence shown in SEQ ID NO: 14. In addition, the cDNA sequences of MgD15D, FvD15D, and LsFAD3 included in the expression unit sequences used in the examples of this application are identified as SEQ ID NOs: 9, 11, and 13, respectively.

[0035] In the present invention, the cDNA of MgD15D, FvD15D, or LsFAD3 is a cDNA in which the polypeptide encoded therein is a variant of MgD15D, FvD15D, or LsFAD3, and is any variant (including amino acid substitution variants, deletion variants, etc.) within the range that does not lose the activity of MgD15D, FvD15D, or LsFAD3.

[0036] For example, the cDNA of MgD15D is The DNA sequence is the one shown in Sequence ID No. 9, or a cDNA sequence that has 90% or more identity with the DNA sequence shown in Sequence ID No. 9, and whose encoded polypeptide has MgD15D activity.

[0037] For example, the cDNA of FvD15D is: The DNA sequence is the DNA sequence shown in Sequence ID No. 11, or a cDNA sequence that has 90% or more identity with the DNA sequence shown in Sequence ID No. 11, and whose encoded polypeptide has FvD15D activity.

[0038] As an example, the cDNA of LsFAD3 is, The DNA sequence is the one shown in Sequence ID No. 13, or a cDNA sequence that has 90% or more identity with the DNA sequence shown in Sequence ID No. 13, and whose encoded polypeptide has LsFad3 activity.

[0039] The oily yeast of the present invention preferably expresses an enzyme that promotes the desaturation of stearic acid (C18:0) to oleic acid (C18:1). Such an enzyme is not particularly limited, but for example, OLE1 is included. OLE1 encodes a Δ9 fatty acid desaturase (see Reference 1 below).

[0040] The oily yeast of the present invention preferably expresses an enzyme that promotes the desaturation of oleic acid (C18:1) to linoleic acid (C18:2). Δ12 fatty acid desaturates and Δ15 fatty acid desaturates are necessary to synthesize high-value unsaturated fatty acids such as linoleic acid and α-linolenic acid from oleic acid. Such enzymes are not particularly limited, but examples include LsFad2, PaD12D, LsFad3, FvD15D, and MgD15D. Lipomyces starkeyi contains a Δ12 fatty acid desaturate (LsFad2) that converts oleic acid to linoleic acid, and a Δ12 / Δ15 bifunctional fatty acid desaturate (LsFad3) that converts oleic acid to linoleic acid, and further converts linoleic acid to α-linolenic acid. These enzymes are responsible for the production of polyunsaturated fatty acids in Lipomyces starkeyi. A mutant strain transformed with the enzyme PaD12D derived from Pseudozyma antarctica (see Patent Document 1) may also be used.

[0041] In addition to fatty acid desaturases, fatty acid elongases are also important for changing the quality of lipids produced by oleopropyl yeast. In Lipomyces starkeyi, the functions of two fatty acid elongases (LsElo1 and LsElo2) have been analyzed. LsElo1 is involved in the synthesis of long-chain saturated fatty acids (C24), while LsElo2 elongates C16 fatty acids to C18 fatty acids.

[0042] The oily yeast of the present invention preferably expresses an enzyme that promotes the elongation reaction from palmitic acid (C16:0) to stearic acid (C18:0). Such enzymes are not particularly limited, but examples include LsElo2. A mutant strain may also be used, which has been transformed by introducing YlELO1 or YlELO2 derived from Yarrowia lipolytica into which the 70486 promoter or the like has been incorporated as an exogenous gene.

[0043] The oily yeast of the present invention expresses an enzyme that promotes the elongation reaction from α-linolenic acid (C18:3) to eicosatrienoic acid (C20:3). In particular, in the present invention, a mutant strain is used in which a gene encoding LsElo2, into which the 70486 promoter etc. has been incorporated, has been transformed into the enzyme.

[0044] In this specification, an enzyme is considered to be (i) a protein (polypeptide) consisting of its amino acid sequence, or (ii) a protein consisting of an amino acid sequence having 90% or more identity with the amino acid sequence, preferably 95% or more, more preferably 97% or more, even more preferably 98% or more, and particularly preferably 99% or more, and which, when expressed, has activity specific to the enzyme. The protein in (ii) above is, for example, a protein consisting of an amino acid sequence in which one or more amino acids have been mutated (e.g., substituted, deleted, added, inserted, etc.) from its amino acid sequence. The enzyme may be chemically modified insofar as it has the desired activity. Furthermore, "yeast-derived" in the context of an enzyme is not particularly limited, as long as it is originally possessed by yeast (i.e., encoded in the wild-type genome) or its amino acid sequence has been modified based on that. The degree of modification is not particularly limited as long as it does not significantly impair the activity, for example, having 95% or more of the original activity. The original activity refers to, for example, the activity of LsElo2 consisting of the amino acid sequence shown in SEQ ID NO: 6 in the case of LsElo2, the activity of MgD15D consisting of the amino acid sequence shown in SEQ ID NO: 10 in the case of MgD15D, the activity of FvD15D consisting of the amino acid sequence shown in SEQ ID NO: 12 in the case of FvD15D, and the activity of LsFad3 consisting of the amino acid sequence shown in SEQ ID NO: 14 in the case of LsFad3.

[0045] In this specification, "identity" of amino acid sequences refers to the degree of agreement between two or more comparable amino acid sequences. Therefore, the higher the agreement between two amino acid sequences, the higher their identity or similarity. The level of amino acid sequence identity can be determined, for example, using the sequence analysis tool FASTA with default parameters. Alternatively, it can be determined using the BLAST algorithm by Karlin and Altschul (Karlin S, Altschul SF. "Methods for assessing the statistical significance of molecular sequence features by using general scoring schemes" Proc Natl Acad Sci USA. 87:2264-2268 (1990), Karlin S, Altschul SF. "Applications and statistics for multiple high-scoring segments in molecular sequences." Proc Natl Acad Sci USA. 90:5873-7 (1993)). A program called BLASTX has been developed based on this BLAST algorithm. The specific methods for these analyses are publicly known and can be found on the National Center of Biotechnology Information (NCBI) website (http: / / www.ncbi.nlm.nih.gov / ). Furthermore, the "identity" of the base sequence is defined in accordance with the above.

[0046] Specifically, the elongase LsElo2 includes polypeptides consisting of the amino acid sequence shown in SEQ ID NO: 6, or polypeptides consisting of an amino acid sequence having 90% or more identity with the amino acid sequence shown in SEQ ID NO: 6, preferably 95% or more, more preferably 97% or more, even more preferably 98% or more, and particularly preferably 99% or more identity, and which have LsElo2 activity.

[0047] The desaturase MgD15D includes a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 10, or a polypeptide consisting of an amino acid sequence having 90% or more identity with the amino acid sequence shown in SEQ ID NO: 10, preferably 95% or more, more preferably 97% or more, even more preferably 98% or more, and particularly preferably 99% or more identity, and which has the activity of MgD15D.

[0048] The desaturase FvD15D includes a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 12, or a polypeptide consisting of an amino acid sequence having 90% or more identity with the amino acid sequence shown in SEQ ID NO: 12, preferably 95% or more, more preferably 97% or more, even more preferably 98% or more, and particularly preferably 99% or more identity, and which has the activity of FvD15D.

[0049] The desaturase LsFad3 includes a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 14, or a polypeptide consisting of an amino acid sequence having 90% or more identity with the amino acid sequence shown in SEQ ID NO: 14, preferably 95% or more, more preferably 97% or more, even more preferably 98% or more, and particularly preferably 99% or more identity, and which has LsFad3 activity.

[0050] <expression promoter> In expressing each of the enzymes described above, it is preferable to obtain a mutant strain by introducing an expression unit sequence, which is a combination of a promoter that promotes high-level expression of the target gene and the DNA sequence encoding each of the enzymes described above, into the target host strain and performing transformation. When introducing the expression unit sequence, transformation methods generally known in the art can be applied. For example, it is preferable to produce the target mutant strain by creating plasmid DNA, introducing it into the cell body, and performing transformation.

[0051] On the other hand, with respect to the same enzyme originally present in the host strain, it is acceptable to use a mutant strain in which its expression has been inhibited beforehand (for example, in which the gene for the enzyme is missing), or, if there are no particular problems, to co-express the endogenous gene without removing it.

[0052] As promoters, constitutive expression promoters such as the 70486 promoter for LsELO2, MgD15D, FvD15D, and the TDH3 promoter for LsFAD3 can be used.

[0053] (70486 promoter) In the present invention, the 70486 promoter has the activity to express the LsELO2 gene, which is functionally linked to the promoter and transcribed under the control of the promoter, and includes any polynucleotide (e.g., mutants that have been substituted, deleted, added, inserted, etc.) as long as it does not lose its activity. The degree of modification is not particularly limited as long as it does not significantly impair the activity, for example, having 95% or more of the activity of the promoter consisting of the base sequences shown in SEQ ID NOs: 1 and SEQ ID NOs: 2.

[0054] For example, the 70486 promoter has a promoter region that is It is either the promoter region of the 70486 promoter consisting of the nucleotide sequence shown in Sequence ID No. 1, or This promoter region has promoter activity of the 70486 promoter, consisting of a nucleotide sequence that is 90% or more, preferably 95% or more, more preferably 97% or more, even more preferably 98% or more, and particularly preferably 99% or more identical to the promoter region of the 70486 promoter consisting of the nucleotide sequence shown in Sequence ID No. 1, and promotes the expression of LsElo2 in oily yeast. This 70486 promoter is an isolated polynucleotide.

[0055] For example, the 70486 promoter has a terminator region that is It is either the terminator region of the 70486 promoter consisting of the nucleotide sequence shown in Sequence ID No. 2, or This terminator region of the 70486 promoter has a nucleotide sequence that is 90% or more, preferably 95% or more, more preferably 97% or more, even more preferably 98% or more, and particularly preferably 99% or more identical to the nucleotide sequence shown in Sequence ID No. 2, and has the terminator activity of the 70486 promoter that promotes LsElo2 expression in oily yeast. This 70486 promoter is an isolated polynucleotide.

[0056] As an example, the 70486 promoter is a promoter consisting of the nucleotide sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2.

[0057] (TDH3 promoter) In the present invention, the TDH3 promoter has the activity to express the MgD15D, FvD15D, and / or LsFad3 genes that are functionally linked to the promoter and transcribed under the control of the promoter, and includes any polynucleotide (e.g., mutants that have been substituted, deleted, added, inserted, etc.) as long as the activity is not lost. The degree of modification is not particularly limited as long as it does not significantly impair the activity, for example, having 95% or more of the activity of the promoter consisting of the base sequences shown in SEQ ID NOs: 3 and SEQ ID NOs: 4.

[0058] For example, the TDH3 promoter has a promoter region that is The promoter region of the TDH3 promoter consisting of the nucleotide sequence shown in Sequence ID No. 3, or This promoter region consists of a nucleotide sequence that has 90% or more identity, preferably 95% or more, more preferably 97% or more, even more preferably 98% or more, and particularly preferably 99% or more, with the promoter region of the TDH3 promoter consisting of the nucleotide sequence shown in Sequence ID No. 3, and has promoter activity of the TDH3 promoter that promotes the expression of MgD15D, FvD15D, and / or LsFad3 in oily yeast. This TDH3 promoter is an isolated polynucleotide.

[0059] For example, the TDH3 promoter has a terminator region that It is either the terminator region of the TDH3 promoter consisting of the nucleotide sequence shown in Sequence ID No. 4, or This is a terminator region of the TDH3 promoter having 90% or more, preferably 95% or more, more preferably 97% or more, even more preferably 98% or more, and particularly preferably 99% or more identity with the terminator region of the TDH3 promoter consisting of the nucleotide sequence shown in Sequence ID No. 4, and having TDH3 promoter terminator activity that promotes the expression of MgD15D, FvD15D, and / or LsFad3 in oily yeast. This TDH3 promoter is an isolated polynucleotide.

[0060] For example, the TDH3 promoter is a promoter consisting of the nucleotide sequences shown in SEQ ID NO: 3 and SEQ ID NO: 4.

[0061] In this specification, polynucleotides may be subjected to known chemical modifications. The base sequence of a polynucleotide may be a base sequence in which one or more bases have been mutated (e.g., substitution, deletion, addition, insertion, etc.) from the given base sequence. Furthermore, "isolated" means, for example, not the genomic DNA itself. Polynucleotides can be easily prepared according to known genetic engineering techniques. For example, they can be obtained by chemical synthesis or DNA amplification methods such as PCR.

[0062] The oily yeast of the present invention has been modified with a promoter gene that promotes the expression of LsELO2, resulting in increased production of omega-3 fatty acids. Examples of omega-3 fatty acids include C18:3 (α-linolenic acid), C20:3 (eicosatrienoic acid), C20:4 (eicosatetraenoic acid), and C20:5 (eicosapentaenoic acid). In particular, there is a noticeable increase in the production of C20:3 (eicosatrienoic acid) in addition to C18:3 (α-linolenic acid). C20:4 (eicosatetraenoic acid) can be produced from C20:3 (eicosatrienoic acid) by Δ8 desaturase. C20:5 (eicosapentaenoic acid) can be produced from the above-mentioned C20:4 (eicosatetraenoic acid) by Δ5 desaturase.

[0063] <Polynucleotides> The polynucleotide of the present invention is an isolated polynucleotide comprising a base sequence that is 90% or more, preferably 95% or more, more preferably 97% or more, even more preferably 98% or more, and particularly preferably 99% or more identical to the base sequence shown in SEQ ID NO: 1, and having promoter activity of the 70486 promoter that promotes the expression of LsElo2 in oily yeast.

[0064] Furthermore, the polynucleotide of the present invention is an isolated polynucleotide comprising a base sequence having 90% or more, preferably 95% or more, more preferably 97% or more, even more preferably 98% or more, and particularly preferably 99% or more identity with the base sequence shown in Sequence ID No. 2, and possessing 70486 promoter terminator activity that promotes LsElo2 expression in oily yeast.

[0065] The polynucleotides of the present invention can be obtained, for example, by chemical synthesis or DNA amplification methods such as PCR.

[0066] The polynucleotide of the present invention may be obtained by obtaining the entire length of the polynucleotide in one go, or by obtaining a polynucleotide consisting of a partial sequence of the polynucleotide and then concatenating the two. The above description of the method for obtaining the polynucleotide of the present invention is not limited to obtaining the entire sequence in one go, but can also be applied mutatis mutandis to obtaining a partial sequence.

[0067] <Vector> The vector of the present invention comprises a polynucleotide (A) having the corresponding promoter activity or terminator activity, which consists of one of the above-described base sequences as the promoter region or terminator region of an expression promoter, and a polynucleotide (B) encoding a target protein whose expression is promoted by the polynucleotide.

[0068] In this specification, “vector” means a DNA product comprising a polynucleotide sequence encoding a target protein operably ligated to a fitted regulatory sequence so as to express the target protein in a fitted host.

[0069] In the present invention, the regulatory sequence may include the polynucleotide (A).

[0070] The regulatory sequence may include a promoter that initiates transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA-ribosome binding site, a sequence for detoxification (e.g., a sequence encoding an antibiotic resistance gene), and sequences that regulate the termination of transcription and detoxification. The vector, after being transformed into a suitable host cell, can replicate or function independently of the host genome, or it can be integrated into the genome itself.

[0071] The target protein encoded by the polynucleotide (B) may be a polypeptide having elongase or desaturase activity related to lipid metabolism.

[0072] The vector of the present invention can be obtained, for example, by inserting the polynucleotide at an appropriate position in the vector. The vector is not particularly limited as long as it can stably exist and replicate in the host to be transformed. Examples of vectors include pET plasmid vectors, pUC plasmid vectors, and pTrc plasmid vectors. The vector of the present invention may be equipped with a selection marker such as an antibiotic resistance gene.

[0073] In this disclosure, host transformation using polynucleotides can be carried out, for example, by methods commonly used by those skilled in the art. For example, oily yeast can be selected as the host and transformed using the competent cell method, heat shock method, electroporation method, etc. After transformation, the oily yeast that is the transformed host of the present invention can be obtained by screening the host containing polynucleotides using an appropriate method.

[0074] <Method for producing omega-3 fatty acids> The present invention provides a method for producing omega-3 fatty acids, which includes recovering oils and fats from the culture of the oily yeast described above. Culturing can be carried out by conventionally known methods using a culture medium containing a carbon source. The carbon source is not particularly limited, but sugars, sugar alcohols, acidic sugars, or biomass containing these can be used. The amount of carbon source in the culture medium is not particularly limited, but is usually around 3-15% (w / w). In addition to the carbon source, the culture medium may also contain a nitrogen source, inorganic substances, and other nutrients.

[0075] Culturing should be carried out under aerobic conditions, such as shaking culture or deep stirring culture. The culture temperature is generally preferably 20-35°C, but other temperature conditions are acceptable as long as the bacteria can grow at that temperature. The pH of the culture medium during cultivation is usually 4.0-7.2. The cultivation period is not particularly limited, for example, 2-10 days.

[0076] The obtained culture and the cells within the culture contain lipids. The lipids from the culture can be recovered according to or in accordance with known methods. For example, lipids accumulated in cells can be recovered by obtaining an extract containing lipids from cells obtained by removing the liquid fraction from the culture as needed, using a known method, and then recovering the lipids from the extract according to a known method. The removal of the liquid fraction can be performed by operations such as centrifugation or natural sedimentation, or by using equipment such as separators, decanters, or filters. In the case of lipids secreted outside the cells, they can be recovered, for example, by adding a solvent to the culture or the liquid fraction obtained by removing cells from the culture and dissolving the lipids in the solvent. [Examples]

[0077] The present invention will be described in detail below with reference to examples, but the present invention is not limited to these examples. <oleaginous yeast> In this embodiment, all oil yeasts used for oil production are Lipomyces starkeyi. Furthermore, the nucleotide sequences encoding the elongase LsElo2, and the desaturases PaD12D, MgD15D, FvD15D, and LsFad3 used in the following examples are as described in SEQ ID NOs. 5, 7, 9, 11, and 13, respectively. The amino acid sequences expressed from each of the above nucleotide sequences are as described in SEQ ID NOs. 6, 8, 10, 12, and 14, respectively.

[0078] <Creation of ω3 high-fat production strains> The fatty acids in the oils produced by the oil yeast L. starkeyi are mainly palmitic acid and oleic acid. To improve the omega-3 fatty acid content of the oils produced by L. starkeyi, strains were created in which the fatty acid synthesis system was modified by overexpressing elongation enzymes and desaturates genes involved in fatty acid synthesis in L. starkeyi, as well as exogenous desaturates genes. The strains created and their genotypes are shown in Table 1.

[0079]

Table 1

[0080] Each strain shown in Table 1 was prepared as follows.

[0081] Example 1: Preparation of the Δlslig4 / LsELO2(70486)HE strain 1-1.pBluescript II KS (+) / 5'-UTR (LsELO2) / P 70486 -LsELO2-T 70486 / P ACT1 -Kan R -T ACT1 Fabrication of / 3'-UTR (LsELO2) For the genetic manipulations described hereinafter, the description of the following Reference 1 is followed. Reference 1 H. Takaku et al., App.l Microbiol. Biotechnol. Vol.107, p.1269-1284 (2023).

[0082] <Amplification of the <pBluescript II KS(+) fragment> The following PCR reaction solution was prepared, and the <pBluescript II KS(+) fragment> was amplified under the following PCR reaction conditions (initial denaturation at 98°C for 2 minutes; subsequently, 30 cycles of 10 seconds at 98°C, 5 seconds at 62°C, and 15 seconds at 68°C; and final extension at 68°C for 30 seconds).

[0083]

Table 2

[0084] <Amplification of the <5'-UTR (LsELO2) fragment> The following PCR reaction solution was prepared, and the <5'-UTR (LsELO2) fragment> was amplified under the following PCR reaction conditions (initial denaturation at 98°C for 2 minutes; subsequently, 30 cycles of 10 seconds at 98°C, 5 seconds at 62°C, and 15 seconds at 68°C; and final extension at 68°C for 30 seconds).

[0085]

Table 3

[0086] <P 70486 -LsELO2-T 70486 Fragment amplification> Prepare the following PCR reaction solution and perform the following PCR reaction conditions (initial denaturation at 98°C for 2 minutes; subsequently, 30 cycles of 10 seconds at 98°C, 5 seconds at 62°C, and 30 seconds at 68°C; and final extension at 68°C for 1 minute) to P 70486 -LsELO2-T 70486 amplify the fragment.

[0087]

Table 4

[0088] *P 70486 fragment (promoter side) and T 70486The fragments (terminator side) were amplified using KOD-One® PCR Master Mix -Blue- (TOYOBO) with L. starkeyi CBS1807 genomic DNA as a template, using primer sets 70486P-ELO2 (AGATACATCGGGACTCGCTCTACTCTACTCTAGTCTAACTCTAGTTTAC (SEQ ID NO: 19) and TAGACGCCATTGTGAAAGTTGAATATAGATAGTAAGAGCTTTTTCG (SEQ ID NO: 21)) and ELO2-70486T (GGTCCAGTAAACGTCGTCTCGCTTCCTCTC (SEQ ID NO: 22) and GAGTAGAGCGAGTCCCGATGTATCTTACCGAAATAAGC (SEQ ID NO: 20)) under the following PCR conditions (initial denaturation at 98°C for 2 minutes; followed by 30 cycles of 10 seconds at 98°C, 5 seconds at 62°C, and 5 seconds at 68°C; and final extension at 68°C for 10 seconds). The ELO2 fragment (region containing LsELO2) was amplified using L. starkeyiCBS1807cDNA as a template with the following PCR conditions (initial denaturation at 98°C for 2 minutes; followed by 30 cycles of 10 seconds at 98°C, 5 seconds at 62°C, and 10 seconds at 68°C; and final extension at 68°C for 20 seconds). 70486 Fragment, T 70486 The fragments (ELO2 fragments) were joined together using the Gibson Assembly System (NEB).

[0089] <P ACT1 -Kan R- T ACT1 Fragment amplification > Prepare the following PCR reaction solution and perform the PCR reaction under the following conditions (initial denaturation at 98°C for 2 minutes; followed by 30 cycles of 10 seconds at 98°C, 5 seconds at 58°C, and 20 seconds at 68°C; and final extension at 68°C for 1 minute). ACT1 -Kan R-T ACT1 The fragments were amplified.

[0090] [Table 5]

[0091] *P ACT1 Fragments and T ACT1 The fragments were amplified using KOD-One® PCR Master Mix -Blue- (TOYOBO) with L. starkeyi CBS1807 genomic DNA as a template, under the following PCR conditions: initial denaturation at 98°C for 2 minutes; followed by 30 cycles of 10 seconds at 98°C, 5 seconds at 58°C, and 5 seconds at 68°C; and final extension at 68°C for 10 seconds. KanR fragments were amplified using pKS-kanR* as a template with the respective primer sets KanR (ATATTTCACAATGAGCCATATTCAACGGGAAAC (SEQ ID NO: 29) and CAACGTCCGCTTAGAAAAACTCATCGAGCATCAAATGAAAC (SEQ ID NO: 30)) using KOD-One® PCR Master Mix -Blue- (TOYOBO) under the following PCR conditions (initial denaturation at 98°C for 2 minutes; followed by 30 cycles of 10 seconds at 98°C, 5 seconds at 58°C, and 5 seconds at 68°C; and final extension at 68°C for 10 seconds). The above three DNA fragments (P ACT1 Fragment, T ACT1 Fragments (KanR fragments) were joined together using the Gibson Assembly System (NEB). *Y. Oguro, H. Yamazaki, S. Ara, Y. Shida, W. Ogasawara, M. Takagi & H. Takaku: Curr. Genet. 63, 751 (2017).

[0092] <Amplification of the 3'-UTR (LsELO2) fragment> The following PCR reaction solutions were prepared, and the 3'-UTR (LsELO2) fragment was amplified under the following PCR reaction conditions (initial denaturation at 98°C for 2 minutes; followed by 30 cycles of 10 seconds at 98°C, 5 seconds at 62°C, and 15 seconds at 68°C; and final extension at 68°C for 30 seconds).

[0093] [Table 6]

[0094] The five DNA fragments mentioned above (pBluescript II KS (+) fragment, 5'-UTR (LsELO2) fragment, P 70486 -LsELO2-T 70486 Fragment, P ACT1 -Kan R -T ACT1 The fragments (3'-UTR (LsELO2) fragment) were joined together using the Gibson Assembly System (NEB) and transformed into E. coli HST08. Plasmids were extracted from the transformed E. coli colonies and named pBluescript II KS (+) / 5'-UTR (LsELO2) / P 70486 -LsELO2-T 70486 / P ACT1 -Kan R -T ACT1 We obtained / 3'-UTR (LsELO2).

[0095] 1-2. Transformation The obtained plasmid pBluescript II KS (+) / 5'-UTR (LsELO2) / P 70486 -LsELO2-T 70486 / P ACT1 -Kan R -TACT1 / 3'-UTR (LsELO2) was digested with the restriction enzyme NotI, and the digested DNA fragment was introduced into the Δlslig4 strain by the electroporation method described in Reference 2 below to obtain the mutant strain Δlslig4 / LsELO2(70486)HE. Reference 2 H. Takaku et al., Jour. Microbiol. Methods. Vol.169, No.105816

[0096] The specific method is shown below.

[0097] <Yeast transformation by electroporation> 1. Inoculate 50 mL of YPD liquid medium with bacterial cells and culture at 160 rpm at 30°C for 2 days. Ta. 2. Dissolve the bacteria obtained from step 1 in 50 mL of YPD liquid medium. 660 The cells were inoculated to a ratio of 1.5 and incubated at 160 rpm, 30°C, and for 12 hours. 3. The cultured cells were placed on ice for 15 minutes. 4. The bacterial cells were transferred to a 50 mL tube, centrifuged at 4000 × g, 4°C for 5 minutes, and the supernatant was discarded. 5. The solution was suspended in 8 mL of sterile distilled water, 1 mL of TE and 1 mL of 2 M lithium acetate were added, and the mixture was shaken at 30°C for 45 minutes. 6. Add 100 μL of 1 M dithiothreitol (DTT) to the mixture from step 5 and shake at 30°C for 15 minutes. 7. The solution was made up to 50 mL using ice-cold sterile distilled water, centrifuged at 4000 × g at 4°C for 5 minutes, and the supernatant was discarded. 8. Add 50 mL of ice-cold sterile distilled water, suspend the mixture, and centrifuge at 4000 × g at 4°C for 5 minutes. Discard the supernatant. 9. Add 3 mL of ice-cold 0.5 M sucrose to suspend the mixture, centrifuge at 4000 × g at 4°C for 5 minutes, and discard the supernatant. 40 μL of cell suspension (from cell 9) and the DNA for introduction were placed in a 10.1.5 mL tube and mixed. 11. 10 was added to an ice-cooled 0.2 cm electroporation cuvette and applied under the conditions of capacitance 25 μF, voltage 7.5 kV / cm, and resistance 800 Ω. 12. The cuvette was taken out, 1 mL of ice-cooled 0.5 M sucrose was added, and they were mixed. 13. The whole amount of 12 was added to 5 mL of YPD + 0.5 M sucrose medium, and it was cultured with shaking at 30 °C for 10 hours or more. 14. It was centrifuged at 4000×g, 24 °C for 5 minutes, and the supernatant was discarded. 15. It was suspended with sterilized distilled water, plated on YPD solid medium containing antibiotics, and cultured statically at 30 °C.

[0098] Example 2: Preparation of the Δlslig4 / LsELO2(70486)HE / PaD12D(70486)HE strain 2-1.pBluescript II KS (+) / 5'-UTR (LsLIG4) / P ACT1 -sNAT1-T ACT1 / P 70486 -PaD12D-T 70486 Fabrication of / 3'-UTR (LsLIG4) <Amplification of pBluescript II KS(+) fragment> The following PCR reaction solution was prepared, and the pBluescript II KS(+) fragment was amplified under the following PCR reaction conditions (initial denaturation at 98 °C for 2 minutes; subsequently, 30 cycles of 98 °C for 10 seconds, 62 °C for 5 seconds, and 68 °C for 15 seconds; and final extension at 68 °C for 30 seconds).

[0099]

Table 7

[0100] <Amplification of 5'-UTR (LsLIG4) fragment> The following PCR reaction solution was prepared, and the 5'-UTR (LsLIG4) fragment was amplified under the following PCR reaction conditions (initial denaturation at 98 °C for 2 minutes; subsequently, 30 cycles of 98 °C for 10 seconds, 60 °C for 5 seconds, and 68 °C for 15 seconds; and final extension at 68 °C for 30 seconds).

[0101] [[ID=UC=43]]

Table 8

[0102] <P ACT1 -sNAT1-T ACT1 Fragment amplification > Prepare the following PCR reaction solution and perform the PCR reaction under the following conditions (initial denaturation at 98°C for 2 minutes; followed by 30 cycles of 10 seconds at 98°C, 5 seconds at 58°C, and 15 seconds at 68°C; and final extension at 68°C for 30 seconds). ACT1 -sNAT1-T ACT1 The fragments were amplified.

[0103] [Table 9]

[0104] *P ACT1 Fragments and T ACT1The fragments were amplified using KOD-One® PCR Master Mix -Blue- (TOYOBO) with L. starkeyi CBS1807 genomic DNA as a template, under the following PCR conditions: initial denaturation at 98°C for 2 minutes; followed by 30 cycles of 10 seconds at 98°C, 5 seconds at 58°C, and 5 seconds at 68°C; and final extension at 68°C for 10 seconds. The sNAT1 fragments were amplified using pKS-sNAT1* as a template with the respective primer sets NAT (ATAATATTTCACAATGGGTACCACTCTTGACGAC (SEQ ID NO: 41) and GAACAACGTCCGCTTAGGGGCAGGGCATGCTC (SEQ ID NO: 42)) using KOD-One® PCR Master Mix -Blue- (TOYOBO) under the following PCR conditions (initial denaturation at 98°C for 2 minutes; followed by 30 cycles of 10 seconds at 98°C, 5 seconds at 58°C, and 5 seconds at 68°C; and final extension at 68°C for 10 seconds). The above three DNA fragments (P ACT1 Fragment, T ACT1 The fragments (sNAT1 fragments) were joined together using the Gibson Assembly System (NEB). *Y. Oguro, H. Yamazaki, S. Ara, Y. Shida, W. Ogasawara, M. Takagi & H. Takaku: Curr. Genet. 63, 751 (2017).

[0105] <P 70486 -PaD12D-T 70486 Fragment amplification > Prepare the following PCR reaction solution and perform the PCR reaction under the following conditions (initial denaturation at 98°C for 2 minutes; followed by 30 cycles of 10 seconds at 98°C, 5 seconds at 58°C, and 15 seconds at 68°C; and final extension at 68°C for 30 seconds). 70486 -PaD12D-T 70486 The fragments were amplified.

[0106] [Table 10]

[0107] *P 70486 Fragments and T 70486 The fragments were amplified using KOD-One® PCR Master Mix -Blue- (TOYOBO) with L. starkeyi CBS1807 genomic DNA as a template, under the following PCR conditions: initial denaturation at 98°C for 2 minutes; followed by 30 cycles of 10 seconds at 98°C, 5 seconds at 58°C, and 5 seconds at 68°C; and final extension at 68°C for 10 seconds. The PaD12D fragments were amplified using Pseudozyma antarctica cDNA as a template with the following PCR conditions (initial denaturation at 98°C for 2 minutes; followed by 30 cycles of 10 seconds at 98°C, 5 seconds at 58°C, and 5 seconds at 68°C; and final extension at 68°C for 10 seconds). 70486 , PaD12D, T 70486The fragments were joined together using the Gibson Assembly System (NEB).

[0108] <Amplification of the 3'-UTR (LsLIG4) fragment> The following PCR reaction solutions were prepared, and the 3'-UTR (LsLIG4) fragment was amplified under the following PCR reaction conditions (initial denaturation at 98°C for 2 minutes; followed by 30 cycles of 10 seconds at 98°C, 5 seconds at 60°C, and 15 seconds at 68°C; and final extension at 68°C for 30 seconds).

[0109] [Table 11]

[0110] The five DNA fragments mentioned above (pBluescript II KS (+) fragment, 5'-UTR (LsLIG4) fragment, P ACT1 -sNAT1-T ACT1 Fragment, P 70486 -PaD12D-T 70486 The fragments (3'-UTR (LsLIG4) fragment) were joined together using the Gibson Assembly System (NEB) and transformed into E. coli HST08. Plasmids were extracted from the transformed E. coli colonies and named pBluescript II KS (+) / 5'-UTR (LsLIG4) / P ACT1 -sNAT1-T ACT1 / P 70486 -PaD12D-T 70486 / 3'-UTR (LsLIG4) was obtained.

[0111] 2-2. Transformation For Δlslig4 / LsELO2(70486)HE obtained in 1-2 above, the pBluescript II KS (+) / 5'-UTR (LsLIG4) / P obtained in 2-1 above is used. ACT1 -sNAT1-T ACT1 / P 70486 -PaD12D-T 70486The Δlslig4 / LsELO2(70486)HE / PaD12D(70486)HE was obtained by digesting the 5'-UTR (LsLIG4) with NotI and introducing the digested DNA fragment. The specific method is in accordance with 1-2 above, so it is omitted.

[0112] Example 3: Preparation of the Δlslig4 / LsELO2(70486)HE / PaD12D(70486)HE / MgD15D(TDH3)HE strain

[0113] 3-1.pBluescript II KS (+) / 5'-UTR (LsLIG4) / P ACT1 -hph-T ACT1 / P TDH3 -MgD15D-T TDH3 / 3'-UTR (P 70486 Fabrication of -PaD12D-T70486-LsLIG4) <Amplification of the pBluescript II KS (+) / 5'-UTR (LsLIG4) fragment><PThe following PCR reaction solution was prepared, and the pBluescript II KS (+) / 5'-UTR (LsLIG4) fragment was amplified under the following PCR reaction conditions (initial denaturation at 98°C for 2 minutes; subsequently, 30 cycles of 10 seconds at 98°C, 5 seconds at 58°C, and 30 seconds at 68°C; and final extension at 68°C for 1 minute).

[0114] [Table 12] <00xxx733>

[0115] <P ACT1 -hph-T ACT1 <Amplification of the fragment> The following PCR reaction solution was prepared, and the P ACT1 -hph-T ACT1 fragment was amplified under the following PCR reaction conditions (initial denaturation at 98°C for 2 minutes; subsequently, 30 cycles of 10 seconds at 98°C, 5 seconds at 58°C, and 20 seconds at 68°C; and final extension at 68°C for 1 minute).

[0116] [Table 13]

[0117] *P ACT1 Fragments and T ACT1 The fragments were amplified using KOD-One® PCR Master Mix -Blue- (TOYOBO) with L. starkeyi CBS1807 genomic DNA as a template, under the following PCR conditions: initial denaturation at 98°C for 2 minutes; followed by 30 cycles of 10 seconds at 98°C, 5 seconds at 58°C, and 5 seconds at 68°C; and final extension at 68°C for 10 seconds. The hph fragments were amplified using pKS-hph* as a template with the respective primer sets hph (ATAATATTTCACAATGAAAAAGCCTGAACTCACCG (SEQ ID NO: 57) and GAACAACGTCCGCGGTCGGCATCTACTCTATTCC (SEQ ID NO: 58)) using KOD-One® PCR Master Mix -Blue- (TOYOBO) under the following PCR conditions (initial denaturation at 98°C for 2 minutes; followed by 30 cycles of 10 seconds at 98°C, 5 seconds at 62°C, and 5 seconds at 68°C; and final extension at 68°C for 10 seconds). The above three DNA fragments (P ACT1 Fragment, T ACT1 The fragments (hph fragments) were joined together using the Gibson Assembly System (NEB). *Y. Oguro, H. Yamazaki, S. Ara, Y. Shida, W. Ogasawara, M. Takagi & H. Takaku: Curr. Genet. 63, 751 (2017). <P TDH3 -MgD15D-T TDH3 Fragment amplification > The following PCR reaction solution was prepared and the following PCR reaction conditions (initial denaturation at 98°C for 2 minutes; subsequently, 30 cycles of 10 seconds at 98°C, 5 seconds at 58°C, and 15 seconds at 68°C; and final extension at 68°C for 30 seconds) were used to amplify the P TDH3 -MgD15D-T TDH3 fragment.

[0118]

Table 14

[0119] *P TDH3 fragment and T TDH3 fragment were amplified using KOD-One (registered trademark) PCR Master Mix -Blue- (TOYOBO) with the primer sets TDH3P-MgD15D (CTATACTCCTTTAATTTGCTGAAGCGGTTTG (SEQ ID NO: 59) and GGTGGTGGACATTGCGAATGTGGATTAGAGTAAGATAGATAAC (SEQ ID NO: 61)), primer set MgD15D-TDH3T (TGGGCCGATTGAGTGTGCGGTTGATGGTCTTC (SEQ ID NO: 62) and GTAGAGCGAGATGTAGCGGGTGGTGATG (SEQ ID NO: 60)), respectively, with L. starkeyi CBS1807 genomic DNA as a template under the following PCR conditions (initial denaturation at 98°C for 2 minutes; subsequently, 30 cycles of 10 seconds at 98°C, 5 seconds at 58°C, and 5 seconds at 68°C; and final extension at 68°C for 10 seconds). The MgD15D fragment was amplified using KOD-One (registered trademark) PCR Master Mix -Blue- (TOYOBO) with the primer set MgD15D (ATCCACATTCGCAATGTCCACCACCGTCACTC (SEQ ID NO: 63) and ATCAACCGCACACTCAATCGGCCCACCTCATG (SEQ ID NO: 64)) with Magnaporthe grisea cDNA as a template under the following PCR conditions (initial denaturation at 98°C for 2 minutes; subsequently, 30 cycles of 10 seconds at 98°C, 5 seconds at 58°C, and 10 seconds at 68°C; and final extension at 68°C for 20 seconds). The above three DNA fragments (P TDH3 fragment, T TDH3The fragments (pBluescript II KS (+) / 5'-UTR (LsLIG4) fragment, P <3'-UTR (P 70486 -PaD12D-T70486-LsLIG4) fragment amplification> The following PCR reaction solution was prepared and the 3'-UTR (P 70486 -PaD12D-T70486-LsLIG4) fragment was amplified under the following PCR reaction conditions (initial denaturation at 98°C for 2 minutes; subsequently, 30 cycles of 98°C for 10 seconds, 58°C for 5 seconds, and 68°C for 15 seconds; and final extension at 68°C for 30 seconds).

[0120]

Table 15

[0121] The above four DNA fragments (pBluescript II KS (+) / 5'-UTR (LsLIG4) fragment, P ACT1 -hph-T ACT1 fragment, P TDH3 -MgD15D-T TDH3 fragment, 3'-UTR (P 70486 -PaD12D-T70486-LsLIG4) fragment) were ligated using the Gibson assembly system (NEB) and transformed into Escherichia coli HST08. Plasmids were extracted from the colonies of transformed Escherichia coli to obtain pBluescript II KS (+) / 5'-UTR (LsLIG4) / P ACT1 -hph-T ACT1 / P TDH3 -MgD15D-T TDH3 / 3'-UTR (P 70486 -PaD12D-T70486-LsLIG4).

[0122] 3-2. Transformation For the Δlslig4 / LsELO2(70486)HE obtained in 1-2 above, the pBluescript II KS (+) / 5'-UTR (LsLIG4) / P ACT1 -hph-T ACT1 / PTDH3 -MgD15D-T TDH3 / 3'-UTR (P 70486 -PaD12D-T70486-LsLIG4) was digested with NotI, and the digested DNA fragment was introduced to obtain Δlslig4 / LsELO2(70486)HE / PaD12D(70486)HE / MgD15D(TDH3)HE. The specific method shall conform to the above 1-2.

[0123] Example 4 · Preparation of HE using Δlslig4 / LsELO2(70486)HE / PaD12D(70486)HE / FvD15D(TDH3)

[0124] 4-1.pBluescript II KS (+) / 5'-UTR (LsLIG4) / P ACT1 -hph-T ACT1 / P TDH3 -FvD15D-T TDH3 / 3'-UTR (P 70486 Fabrication of -PaD12D-T70486-LsLIG4) <Amplification of FvD15D fragment> The following PCR reaction solution was prepared, and the FvD15D fragment was amplified under the following PCR reaction conditions (initial denaturation at 98°C for 2 minutes; subsequently, 30 cycles of 10 seconds at 98°C, 5 seconds at 58°C, and 15 seconds at 68°C; and final extension at 68°C for 30 seconds).

[0125]

Table 16

[0126] <T TDH3 -3'UTR - pBluescript II KS (+) / 5'-UTR (LsLIG4) / P ACT1 -hph-T ACT1 / P TDH3 <Amplification of fragment> The following PCR reaction solution was prepared, and the following PCR reaction conditions (initial denaturation at 98°C for 2 minutes; subsequently, 30 cycles of 10 seconds at 98°C, 5 seconds at 58°C, and 2 minutes 10 seconds at 68°C; and final extension at 68°C for 4 minutes 20 seconds) were used for T TDH3 -3'UTR - pBluescript II KS (+) / 5'-UTR (LsLIG4) / PACT1 -hph-T ACT1 / P TDH3 The fragments were amplified.

[0127] [Table 17]

[0128] The two DNA fragments mentioned above (FvD15D fragment, T TDH3 -3'UTR- pBluescript II KS (+) / 5'-UTR (LsLIG4) / P ACT1 -hph-T ACT1 / P TDH3 The fragments were joined together using the Gibson Assembly System (NEB) and transformed into E. coli HST08. Plasmids were extracted from the transformed E. coli colonies and identified as pBluescript II KS (+) / 5'-UTR (LsLIG4) / P ACT1 -hph-T ACT1 / P TDH3 -FvD15D-T TDH3 / 3'-UTR (P 70486 -PaD12D-T70486-LsLIG4) was obtained.

[0129] 4-2. Transformation For Δlslig4 / LsELO2(70486)HE obtained in 1-2 above, the pBluescript II KS (+) / 5'-UTR (LsLIG4) / P obtained in 4-1 is used. ACT1 -hph-T ACT1 / P TDH3 -FvD15D-T TDH3 / 3'-UTR (P 70486 By digesting -PaD12D-T70486-LsLIG4) with NotI and introducing the digested DNA fragment, Δlslig4 / LsELO2(70486)HE / PaD12D(70486)HE / FvD15D(TDH3)HE was obtained. The specific method is the same as described in 1-2 above.

[0130] Example 5: Preparation of the Δlslig4 / LsELO2(70486)HE / PaD12D(70486)HE / LsFAD3(TDH3)HE strain

[0131] 5-1.pBluescript II KS (+) / 5'-UTR (LsLIG4) / P ACT1 -hph-T ACT1 / P TDH3 -LsFAD3-T TDH3 / 3'-UTR (P 70486 Fabrication of -PaD12D-T70486-LsLIG4) <Amplification of the LsFAD3 fragment> The following PCR reaction solution was prepared, and the LsFAD3 fragment was amplified under the following PCR reaction conditions (initial denaturation at 98°C for 2 minutes; subsequently, 30 cycles of 10 seconds at 98°C, 5 seconds at 58°C, and 10 seconds at 68°C; and final extension at 68°C for 20 seconds).

[0132]

Table 18

[0133] <T TDH3 -3'UTR - pBluescript II KS (+) / 5'-UTR (LsLIG4) / P ACT1 -hph-T ACT1 / P TDH3 <Amplification of the fragment> The following PCR reaction solution was prepared, and the following PCR reaction conditions (initial denaturation at 98°C for 2 minutes; subsequently, 30 cycles of 10 seconds at 98°C, 5 seconds at 58°C, and 2 minutes 10 seconds at 68°C; and final extension at 68°C for 4 minutes 20 seconds) were used to amplify T TDH3 -3'UTR - pBluescript II KS (+) / 5'-UTR (LsLIG4) / P ACT1 -hph-T ACT1 / P TDH3 <fragment.>

[0134]

Table 19

[0135] The above two DNA fragments (LsFAD3 fragment, T TDH3-3'UTR- pBluescript II KS (+) / 5'-UTR (LsLIG4) / P ACT1 -hph-T ACT1 / P TDH3 The fragments were joined together using the Gibson Assembly System (NEB) and transformed into E. coli HST08. Plasmids were extracted from the transformed E. coli colonies and identified as pBluescript II KS (+) / 5'-UTR (LsLIG4) / P ACT1 -hph-T ACT1 / P TDH3 -LsFAD3-T TDH3 / 3'-UTR (P 70486 -PaD12D-T70486-LsLIG4) was obtained.

[0136] 5-2. Transformation For Δlslig4 / LsELO2(70486)HE obtained in 1-2 above, the pBluescript II KS (+) / 5'-UTR (LsLIG4) / P obtained in 5-1 ACT1 -hph-T ACT1 / P TDH3 -LsFAD3-T TDH3 / 3'-UTR (P 70486 By digesting -PaD12D-T70486-LsLIG4) with NotI and introducing the digested DNA fragment, we obtained Δlslig4 / LsELO2(70486)HE / PaD12D(70486)HE / LsFAD3(TDH3)HE. The specific method is the same as described in 1-2 above.

[0137] Table 20 summarizes the enzymes expressed and promoters acting in the fatty acid synthesis systems of each strain in Comparative Example 1 and Examples 1-5. See also Figure 2 for the synthesis pathway.

[0138] [Table 20]

[0139] *The promoter acting on the gene is inside the parentheses. Those without parentheses indicate that the endogenous gene is expressed.

[0140] <Promoter Search for Gene Expression by RNAseq Analysis> The Δlslig4 strain was cultured in YPD medium for 3 days, and cells were collected a total of 3 times at intervals of 1 day to extract RNA. RNAseq analysis was performed on the extracted RNA, and read counts were carried out. The read counts mapped to each gene were multiplied by 1 million with respect to the value obtained by dividing by the total mapped read counts, and normalization by CPM (Counts per million mapped reads) was performed.

[0141] The CPM values of the endogenous genes expressed under the control of each promoter inherent in the Δlslig4 strain genome are compared. Specifically, the CPM values of the mRNA transcribed based on the DNA sequence downstream of the promoter are compared a total of 3 times from day 1 to day 3, and the strength of the activity of each promoter is evaluated. A promoter with a large mRNA transcription amount and a constant transcription amount regardless of the passage of time is a desirable promoter.

[0142] <Method for Measuring Oil Content> The oil content in the cultured yeast was measured according to the method described in Non-Patent Document 1 above. The outline is as follows. Cells were collected from the culture solution, and after confirming the cell amount, glass beads with a diameter of 0.5 mm were added to the cell suspension and homogenized to disrupt the cells. The amount of TAG and glycerol in the disrupted solution was quantified using a commercially available kit (TG E-test, Fujifilm Wako Pure Chemical Corporation). Furthermore, for the fatty acids in TAG, after methylation using a commercially available methylation kit (Nacalai Tesque, Inc.), quantification was performed by gas chromatography and a hydrogen flame ionization detector (GC-FID).

[0143] <Results> 1. Differences in expression levels depending on the promoter The CPM values under the control of each promoter are shown below.

[0144]

Table 21

[0145] First, the top 10 CPM values on the first day of culture were extracted. Among the genes expressed by the 70486 promoter, the RNA amount was the second among all promoters on the first, second, and third days of culture. It was shown that the 70486 promoter is a promoter that expresses the target gene most continuously and at a high level. Thereafter, this 70486 promoter was used as the promoter for highly expressing LsELO2.

[0146] Compared with the 70486 promoter, other promoters did not stably and highly express the genes under their control. As described above, when highly expressing desaturase PaD12D (an enzyme responsible for the unsaturation from C18:1 to C18:2), MgD15D, FvD15D, and LsFAD3, the TDH3 promoter is used.

[0147] The DNA sequences of the promoter region and terminator region of 70486 used this time are separately attached as SEQ ID NO: 1 and 2. On the other hand, the promoter region and terminator region of TDH3 are attached as SEQ ID NO: 3 and 4, respectively, but they are DNA sequences known from the above-mentioned Non-Patent Document 1, etc.

[0148] 2. Amount of oil production in oil yeast mutant strains The growth and oil production of the control strain Δlslig4 (Comparative Example 1) and a series of mutant strains in which each enzyme was highly expressed were examined. The results are shown in Fig. 1.

[0149] Compared to Comparative Example 1 (Δlslig4), there were no significant differences in cell concentration, glucose assimilation, or lipid synthesis in the LsELO2 high-expression strain (Δlslig4 / LsELO2(70486)HE, Example 1). On the other hand, there were no significant differences in LsELO2 and PaD12D high-expression strains (Δlslig4 / LsELO2(70486)HE / PaD12D(70486)HE, Example 2), LsELO2, PaD12D, and MgD15D high-expression strains (Δlslig4 / LsELO2(70486)HE / PaD12D(70486)HE / MgD15D(TDH3)HE, Example 3), and LsELO2, PaD12D, and FvD15D high-expression strains (Δlslig4 / LsELO2(70486)HE / PaD12D(70486)HE / MgD15D(TDH3)HE, Example 3). In the four strains—g4 / LsELO2(70486)HE / PaD12D(70486)HE / FvD15D(TDH3)HE (Example 4), and the LsELO2, PaD12D, and LsFAD3 high-expression strain (Δlslig4 / LsELO2(70486)HE / PaD12D(70486)HE / LsFAD3(TDH3)HE (Example 5)—a decrease in cell concentration, a slight decrease in glucose assimilation rate, and a decrease in lipid content were observed.

[0150] Next, the fatty acid composition (relative amount) of the accumulated oils and fats was analyzed for the six strains examined in Figure 1 (Table 22). Figure 2 shows the fatty acid synthesis pathway.

[0151] [Table 22]

[0152] As a result, in Example 1, eicosadienoic acid (C20:2) and cis-11,14,17-eicosatrienoic acid (C20:3), which were not detected in Comparative Example 1 (Δlslig4), were detected. This indicates that the high expression of LsELO2 due to 70486 promoter activity contributed to the increase in the content of eicosadienoic acid and cis-11,14,17-eicosatrienoic acid. Furthermore, in Example 2, in which the PaD12D gene was further introduced, while the content of palmitic acid (C16:0) and oleic acid (C18:1) decreased, a further increase in the content of eicosadienoic acid and cis-11,14,17-eicosatrienoic acid was detected.

[0153] Furthermore, in Examples 3, 4, and 5, in which MgD15D, FvD15D, or LsFAD3 was introduced and highly expressed in the Δlslig4 / LsELO2(70486) / PaD12D(70486) HE strain, the fatty acid composition showed an increase in the content ratio of α-linolenic acid (C18:3) and cis-11,14,17-eicosatrienoic acid compared to Examples 1 and 2. In particular, in Example 3, where MgD15D was highly expressed, the content ratio of α-linolenic acid increased by about 29% and cis-11,14,17-eicosatrienoic acid increased by about 14% compared to Example 2, with ω3 fatty acid content accounting for about 66% of the total. Furthermore, since Examples 3, 4, and 5 are strains into which one of the following enzymes encoding Δ15 desaturases—MgD15D, FvD15D, or LsFAD3—was introduced and highly expressed, the high expression of the above-mentioned series of desaturases promoted the conversion of linoleic acid to α-linolenic acid, and simultaneously promoted the conversion of α-linolenic acid to cis-11,14,17-eicosatrienoic acid. This is thought to be because the fatty acid elongation enzyme LsELO2, which is also highly expressed at the same time, converted the abundant α-linolenic acid to cis-11,14,17-eicosatrienoic acid.

[0154] Next, to clarify the involvement of the highly expressed genes LsELO2, PaD12D, MgD15D, FvD15D, LsFAD3, and LsELO1, OLE1, and LsFAD2 in L. starkeyi in the fatty acid synthesis pathway, we performed fatty acid synthesis pathway-related gene expression analysis (Figure 3). Five types of LsELO2 high-expression strains were identified: Δlslig4 / LsELO2(70486) HE (Example 1), Δlslig4 / LsELO2(70486) / PaD12D(70486) HE (Example 2), Δlslig4 / LsELO2(70486) / PaD12D(70486) / MgD15D(TDH3) HE (Example 3), Δlslig4 / LsELO2(70486) / PaD12D(70486) / FvD15D(TDH3) HE (Example 4), and Δlslig4 / LsELO2(70486) / PaD12D(70486)HE / LsFAD3(TDH3). In HE Example 5), LsELO2 expression was approximately 30-100 times higher on day 1 and even on day 3 compared to the control Δlslig4 strain (comparative example), confirming continuous high expression. In addition, PaD12D in the four PaD12D high-expression strains (Examples 2-5) was confirmed to be continuously high-expressing not only on day 1 but also on day 3 (for example, it was expressed at a significantly higher level than endogenous LsFAD2, which controls the same reaction as PaD12D). In the MgD15D high-expression strain (Example 3), MgD15D expression was confirmed to be continuously high on day 1 and even on day 3 compared to other genes (for example, endogenous LsFAD3 expressed in Example 3). In the FvD15D high-expression strain (Example 4), FvD15D expression was confirmed to be continuously high on day 1 and even on day 3 compared to other genes (for example, endogenous LsFAD3 expressed in Example 4). The LsFAD3 expression level in the LsFAD3-high-expression strain (Example 5) was approximately 5-8 times higher than that of the control strain Δlslig4 (which expresses only endogenous LsFAD3), not only on day 1 but also on day 3, confirming that LsFAD3 is continuously expressed at a high level.On the other hand, on day 3, the expression level of OLE1 in strains that highly expressed LsELO2 and PaD12D (Examples 1-4) was lower compared to the control Δlslig4 strain.

[0155] The results shown in Figure 3 and Table 21 suggest that the fatty acid composition of the Δlslig4 / LsELO2(70486) / PaD12D(70486) HE strain (Example 1) was affected by the action of highly expressed LsELO2, resulting in a decrease in palmitic acid, an increase in stearic acid and oleic acid, and an increase in the production of eicosadienoic acid and cis-11,14,17-eicosatrienoic acid compared to the control Δlslig4 strain (Comparative Example). The fatty acid composition of the Δlslig4 / LsELO2(70486) / PaD12D(70486) HE strain (Example 2) was affected by the action of highly expressed LsELO2 and PaD12D, resulting in a decrease in palmitic acid and oleic acid, and an increase in the production of linoleic acid, α-linolenic acid, eicosadienoic acid, and cis-11,14,17-eicosatrienoic acid compared to the control Δlslig4 strain. The fatty acid composition of the Δlslig4 / LsELO2(70486) / PaD12D(70486) / MgD15D(TDH3) HE strain (Example 3) is thought to have been affected by the action of highly expressed LsELO2, PaD12D, and MgD15D, resulting in a decrease in palmitic acid and oleic acid, and an increase in the production of linoleic acid, α-linolenic acid, eicosadienoic acid, and cis-11,14,17-eicosatrienoic acid compared to the control Δlslig4 strain (Comparative Example). The fatty acid composition of the Δlslig4 / LsELO2(70486) / PaD12D(70486) / FvD15D(TDH3) HE strain (Example 4) is thought to have been affected by the action of highly expressed LsELO2, PaD12D, and FvD15D, resulting in a decrease in palmitic acid and oleic acid, and an increase in the production of linoleic acid, α-linolenic acid, eicosadienoic acid, and cis-11,14,17-eicosatrienoic acid compared to the control Δlslig4 strain (Comparative Example). The fatty acid composition of the Δlslig4 / LsELO2(70486) / PaD12D(70486)HE / LsFAD3(TDH3)HE strain (Example 5) is thought to have been affected by the action of highly expressed LsELO2, PaD12D, and LsFAD3, resulting in a decrease in palmitic acid and oleic acid, and an increase in the production of linoleic acid, α-linolenic acid, eicosadienoic acid, and cis-11,14,17-eicosatrienoic acid compared to the control Δlslig4 strain (Comparative Example).In particular, in Examples 3-5, where the Δ15 desaturase gene was highly expressed and α-linolenic acid production was enhanced, the high production of α-linolenic acid and the high expression of LsELO2 cooperate to promote the elongation reaction of cis-11,14,17-eicosatrienoic acid from α-linolenic acid.

Claims

1. A lipid yeast in which a promoter that promotes LsElo2 expression has been introduced, resulting in increased production of omega-3 fatty acids.

2. The aforementioned LsElo2 is The oily yeast according to claim 1, comprising a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 6, or a polypeptide having 90% or more identity with the amino acid sequence shown in SEQ ID NO: 6 and having LsElo2 activity.

3. The aforementioned promoter, The oil yeast according to claim 1, which is a 70486 promoter.

4. The promoter region of the 70486 promoter is It is either the promoter region of the 70486 promoter consisting of the nucleotide sequence shown in Sequence ID No. 1, or The oily yeast according to claim 3, wherein the promoter region consists of a nucleotide sequence having 90% or more identity with the promoter region of the 70486 promoter consisting of the nucleotide sequence shown in Sequence ID No. 1, and the promoter region has the promoter activity of the 70486 promoter.

5. The terminator region of the 70486 promoter is The terminator region of the 70486 promoter consisting of the nucleotide sequence shown in Sequence ID No. 2, or The oily yeast according to claim 3, wherein the terminator region consists of a base sequence having 90% or more identity with the terminator region of the 70486 promoter consisting of the base sequence shown in Sequence ID No. 2, and is a terminator region having the terminator activity of the 70486 promoter.

6. The aforementioned 70486 promoter, The oily yeast according to claim 3, wherein the promoter comprises the base sequences shown in SEQ ID NO: 1 and SEQ ID NO:

2.

7. Furthermore, the oily yeast according to any one of claims 1 to 6 is transformed to highly express desaturase, an enzyme that promotes the desaturation of linoleic acid (C18:2) to α-linolenic acid (C18:3).

8. The oil yeast according to claim 7, wherein the desaturase is MgD15D, FvD15D, or LsFad3, and is an enzyme in which TDH3 is incorporated as a promoter.

9. The aforementioned MgD15D is A polypeptide consisting of the amino acid sequence shown in Sequence ID No. 10, or An enzyme having more than 90% identity with the amino acid sequence shown in Sequence ID No. 10, possessing MgD15D activity, and incorporating TDH3 as a promoter. The aforementioned FvD15D is A polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 12, or An enzyme having more than 90% identity with the amino acid sequence shown in Sequence ID No. 12, possessing FvD15D activity, and incorporating TDH3 as a promoter. The aforementioned LsFad3 is A polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 14, or The oil yeast according to claim 8, which is a polypeptide having 90% or more identity with the amino acid sequence shown in Sequence ID No. 14, and having LsFad3 activity, and is an enzyme in which TDH3 is incorporated as a promoter.

10. The aforementioned MgD15D is It is a polypeptide consisting of the amino acid sequence shown in Sequence ID No. 10, and an enzyme in which TDH3 is incorporated as a promoter. The aforementioned FvD15D is It is a polypeptide consisting of the amino acid sequence shown in Sequence ID No. 12, and an enzyme in which TDH3 is incorporated as a promoter. The aforementioned LsFad3 is The oil yeast according to claim 9, which is an enzyme that is LsFad3 consisting of the amino acid sequence shown in Sequence ID No. 14 and incorporates TDH3 as a promoter.

11. A method for producing omega-3 fatty acids, comprising recovering oils containing omega-3 fatty acids from the cell bodies and / or culture medium of the oily yeast described in claim 1.

Citation Information

Patent Citations

  • Δ12 fatty acid desaturase

    JP7144004B2