Genetically engineered Bacillus subtilis strains that produce tagatose and method for preparing tagatose

Abstract

This invention provides genetically engineered Bacillus subtilis strains that produce tagatose, and a method for preparing tagatose. [Solution] The genetically engineered bacteria include the construction of bacteria expressing or co-expressing, respectively, heat-stable α-glucan phosphorylase, heat-stable phosphoglucumutase, heat-stable phosphoglucose isomerase, heat-stable tagatose 6-phosphate epimerase, and heat-stable tagatose 6-phosphate phosphatase. Starch can be effectively converted to tagatose using the genetically engineered bacteria. Compared to conventional methods of producing tagatose, this method has advantages such as being suitable for whole-cell recycling, being highly safe, having a high yield, a simple production process, being low-cost, and being easy to mass-produce.

Description

[Technical Field]

[0001] The present invention relates to the field of biotechnology, and more particularly to a genetically engineered bacterium that produces tagatose and a method for preparing that tagatose. [Background technology]

[0002] Tagatose is a rare, naturally occurring monosaccharide, a ketose form of galactose and an epimer of fructose. Tagatose has a sweetness similar to sucrose, but with about one-third the calories, making it a low-calorie sweetener. Natural tagatose is mainly found in dairy products such as fermented milk and powdered milk. Tagatose offers a very fresh and pure sweetness and has a taste characteristic similar to fructose. Research has revealed that tagatose possesses important physiological properties such as low calorie content, low carbohydrate index, anti-carcinogenicity, antioxidant properties, prebiotics, improved gut function, immunomodulation, and drug precursor properties, making it widely applicable in fields such as food, beverages, medicine, and health maintenance, and thus having enormous economic value (Oh DK: Tagatose: properties, applications, and biotechnological processes. App. Microbiol. Biotechnol. 2007, 76:1-8).

[0003] In 2001, the U.S. Food and Drug Administration (FDA) confirmed the safety of tagatose and approved it as a GRAS (Generally Regarded As Safe) product. The FDA approved tagatose as a tooth-friendly ingredient in December 2002, and as a food additive for use in the food and beverage and pharmaceutical industries as a sweetener in October 2003. In 2001, the Joint Expert Committee on Food Additives (JECFA), a joint committee of the Food and Agriculture Organization of the United Nations and the World Health Organization, recommended tagatose as a new low-calorie sweetener for use as a food additive. At its 63rd meeting in 2004, it was declared that there was no need to restrict the acceptable daily intake (ADI) of tagatose, and it was assigned an ADI of "not designated" as the safest food ingredient available to JECFA. South Korea, Australia (Australia and New Zealand), and the EU approved the launch of tagatose within their respective regions in 2003, 2004, and 2005, respectively. In December 2005, tagatose was officially approved in the EU as a new food ingredient with no restrictions on use. In China, tagatose was also approved as a new food ingredient in May 2014. Currently, tagatose is approved by the WHO / FAO and the International Food Standards Committee in more than 30 countries worldwide, and there are no restrictions on acceptable daily intake or use.

[0004] There are two main methods for producing tagatose: chemical synthesis and bioinversion. Generally, galactose is used as the raw material and produced through isomerization reactions using chemical methods or bioinversion. Chemical synthesis uses a soluble alkali metal salt or alkaline earth metal salt as a catalyst to produce tagatose from galactose under alkaline conditions, promotes the formation of a metal hydroxide-tagatose complex, and then neutralizes with acid to obtain tagatose. Chemical methods are energy-intensive, produce complex products, are difficult to purify, have many side reactions, and generate chemical contamination. Bioinversion uses galactitol or galactose and converts the corresponding substrate into tagatose through the catalytic action of enzymes or microorganisms. Galactitol is expensive and difficult to obtain, making it unsuitable as a raw material for industrial production. Currently, the mainstream method for producing tagatose involves steps such as isomerization of galactose, desalting, decolorization, separation, concentration, and crystallization to produce pure tagatose.However, this method also has drawbacks: it cannot completely convert galactose to tagatose, the final product is a mixture of galactose and tagatose, the tagatose separation process is complex, the conversion rate is low, the separation cost is high, and the price of the raw material galactose is not cheap, ultimately resulting in a high production cost for tagatose (Rhimi M, Aghajari N, Juy M, Chouayekh H, Maguin E, Haser R, Bejar S: Rational design of Bacillus stearothermophilus US100l-arabinose isomerase: Potential applications for d-tagatose production. Biochim. 2009, 91:650-653. Oh HJ, Kim HJ, Oh DK: Increase in d-tagatose production rate by site-directed mutagenesis of l-arabinose isomerase from Geobacillus thermodenitrificans. Biotechnol. Lett. 2006). 28:145-149. Bosshart A, Hee CS, Bechtold M, Schirmer T, Panke S: Directed divergent evolution of a thermostable D-tagatose epimerase towards improved activity for two hexose substrates. ChemBioChem 2015,16:592-601.).

[0005] Korean company CJ has invented a technology to catalyze the conversion of fructose to tagatose using multiple enzymes including fructose kinase, aldolase, and phytase (Oh DK, HONG SH, Lee SH: Aldolase, aldolase mutants and tagatose using the same production methods and compositions for production. WO 2015016544A1). However, producing fructose-6-phosphate from fructose requires ATP to perform substrate phosphorylation of fructose, and adding expensive ATP increases the production cost of tagatose, making it not industrially viable (TW107111500, US20160186162A1). Korean company CJ discovered and modified hexuronate 4-epimerase to convert fructose into tagatose (CN105431541B, CN109415715A), but the modified hexuronate 4-epimerase has extremely low enzyme activity and no industrial application value. Korean company CJ also discovered a novel tagatose-6-phosphate phosphatase and used it to produce tagatose by converting starch, maltodextrin, and sucrose into substrates (WO2018004310A1, CN 109790524A), but this tagatose-6-phosphate phosphatase also has extremely low enzyme activity and currently has no industrial application value.

[0006] The Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences, has developed a novel pathway for the extracellular synthesis of tagatose using inexpensive cornstarch, maltodextrin, and sucrose, fundamentally changing the existing tagatose production process (CN106399427A). Building on this, the Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences, has also developed a whole-cell catalytic method for preparing tagatose using inexpensive cornstarch, cellulose, maltodextrin, and sucrose (CN107988286A). This process reduces the number of steps in the multi-enzyme purification process, lowers production costs, reduces environmental pollution, and increases the yield of tagatose. However, the fermentation host for the key enzyme in this method is E. coli BL21(DE3), which is unsuitable for industrial production as an enzyme-producing strain related to the production of food preparations. Furthermore, the extracorporeal enzyme isolation and purification steps are complicated, the enzyme recovery and utilization rate is low, recycling is difficult, production costs cannot be further reduced, and it is not possible to industrially mass-produce and apply high-concentration products.

[0007] Therefore, there is an urgent need to develop a new method that allows for the recycling of all cells, is highly safe, has a high yield, a simple production process, is low-cost, is suitable for producing tagatose in high yield by introducing substrates at high concentrations, and facilitates the large-scale preparation of tagatose. [Overview of the Initiative]

[0008] The main objective is to provide a method for preparing and producing high-concentration tagatose from high-concentration starch preparation using the catalytic action of all cells of Bacillus subtilis, in order to address the problems of conventional methods for producing tagatose using multi-enzyme catalytic action, such as the unfavorability of E. coli for the industrial production of food preparations, as well as the complexities of the purification process, the low recovery and utilization rate of enzymes, the difficulty of recycling, and the input of low-concentration substrate starch.

[0009] The present invention first provides a genetically engineered strain of Bacillus subtilis that produces tagatose, which is a mixture of genetically engineered strains of Bacillus subtilis that co-express the α-glucan phosphorylase gene, the phosphoglucomutase gene, the phosphoglucose isomerase gene, the tagatose-6-phosphate epimerase gene, and the tagatose-6-phosphate phosphatase gene, or genetically engineered strains of Bacillus subtilis that express the α-glucan phosphorylase gene, the phosphoglucomutase gene, the phosphoglucose isomerase gene, the tagatose-6-phosphate epimerase gene, and the tagatose-6-phosphate phosphatase gene, respectively.

[0010] The principle of the above proposed technology is to fully utilize the relevant catalytic pathways to express them at the cellular level in living organisms and realize effective catalytic reactions. This involves converting the substrate starch to the intermediate glucose-1-phosphate (G1P) in the presence of inorganic phosphorus by α-glucan phosphorylase, moving the intermediate glucose-1-phosphate (G1P) to another intermediate glucose-6-phosphate (G6P) by phosphoglucomutase, and then using phosphoglucose isomerase to... The process includes moving a glucose-6-phosphate (G6P) to another intermediate, fructose-6-phosphate (F6P); isomerizing the intermediate fructose-6-phosphate (F6P) using tagatose-6-phosphate epimerase to another intermediate, tagatose-6-phosphate (T6P); and removing the phosphate group from the intermediate tagatose-6-phosphate (T6P) using tagatose-6-phosphate phosphatase to obtain the product, tagatose.

[0011] For example, various Bacillus subtilis strains known in this field, such as Bacillus subtilis 168, DB104, WB800, WB600, SCK6, 1A751, ATCC6051a, and ATCC6051, are all useful as starting strains for the present invention. Preferably, the Bacillus subtilis starting strain is a Bacillus subtilis strain of knockout protease, such as WB800, WB600, SCK6, or 1A751. More preferably, the Bacillus subtilis starting strain is SCK6.

[0012] In a particular embodiment, the genetically engineered Bacillus subtilis strain is a mixture of genetically engineered bacteria containing an expression vector that co-expresses α-glucan phosphorylase, phosphoglucumutase, phosphoglucose isomerase, tagatose 6-phosphate epimerase, and tagatose 6-phosphate phosphatase, or a genetically engineered bacteria containing an expression vector for α-glucan phosphorylase, a genetically engineered bacteria containing an expression vector for phosphoglucumutase, a genetically engineered bacteria containing an expression vector for phosphoglucose isomerase, a genetically engineered bacteria containing an expression vector for tagatose 6-phosphate epimerase, and a genetically engineered bacteria containing an expression vector for tagatose 6-phosphate phosphatase.

[0013] Preferably, the enzymes mentioned above are heat-stable, namely, thermo-resistant α-glucan phosphorylase, thermo-stable phosphoglucumutase, thermo-stable phosphoglucose isomerase, thermo-stable tagatose 6-phosphate epimerase, and thermo-stable tagatose 6-phosphate phosphatase. Compared to non-heat-stable, room-temperature enzymes, heat-stable enzymes are preferable in inactivating the strain; that is, the latter can inactivate the strain by heat treatment after fermentation is complete, and the enzymes related to tagatose synthesis maintain their activity, thereby allowing tagatose to be produced by mixing inactivated strains, which is more suitable for industrial applications. If room-temperature enzymes are used, in order to obtain the enzymes necessary for tagatose production, it is necessary to obtain pure enzymes by cell disruption and enzyme purification after fermentation and production are complete.

[0014] Specifically, the heat-resistant α-glucan phosphorylase refers to an enzyme that has the function of phosphorylating starch to glucose-1-phosphate (G1P) at temperatures of 40°C or higher, 45°C or higher, 50°C or higher, 55°C or higher, 60°C or higher, 65°C or higher, 70°C or higher, 75°C or higher, or 80°C or higher. More preferably, the heat-resistant α-glucan phosphorylase is a thermophilic microorganism, such as Geobacillus kaustophilus, Geobacillus stearothermophilus, Thermoga maritima, Pseudothermotoga thermarum, Thermoccoccus kodakarensis, Archaeoglobus fulgidus, Thermoanaerobacter indiensis, Dictyoglomus thermophilum, Caldicellulosiruptor kronotskyensis, Clostridium thermocellum, Caldilinea aerophila, Pyrococcus furiosus, Thermoccoccus thermophilus, Methanothermobacter marburgensis, Archaeoglobus The thermostable α-glucan phosphorylase is derived from *Profundus* or the like, or the amino acid sequence of the thermostable α-glucan phosphorylase is at least 70%, preferably at least 80%, more preferably at least 90%, and most preferably at least 95% identical to the thermostable α-glucan phosphorylase derived from the thermophilic microorganism. More preferably, the thermostable α-glucan phosphorylase is derived from *Thermococcus kodakarensis*.

[0015] Specifically, a heat-stable phosphoglucomutase refers to an enzyme that has the function of transferring glucose-1-phosphate (G1P) to glucose-6-phosphate (G6P) at temperatures of 40°C or higher, 45°C or higher, 50°C or higher, 55°C or higher, 60°C or higher, 65°C or higher, 70°C or higher, 75°C or higher, or 80°C or lower. More preferably, the heat-resistant phosphoglucomutase is derived from a thermophilic microorganism, such as Geobacillus kaustophilus, Geobacillus stearothermophilus, Thermotoga maritima, Pseudothermotoga thermarum, Thermolococcus kodakarensis, Archaeoglobus fulgidus, Thermoanaerobacter indiensis, Dictyoglomus thermophilum, Caldicellulosiruptor kronotskyensis, Clostridium thermocellum, Caldilinea aerophila, Pyrococcus furiosus, Thermolococcus thermophilus, Methanothermobacter marburgensis, Archaeoglobus profundus, etc., or the amino acid sequence of the heat-resistant phosphoglucomutase has at least 70%, preferably at least 80%, more preferably at least 90%, and most preferably at least 95% identity with the heat-resistant phosphoglucomutase derived from the thermophilic microorganism. More preferably, the heat-resistant phosphoglucomutase is derived from Thermococcus kodakarensis.

[0016] Specifically, a heat-stable phosphoglucose isomerase refers to an enzyme that has the function of transferring glucose-6-phosphate (G6P) to fructose-6-phosphate (F6P) at temperatures of 40°C or higher, 45°C or higher, 50°C or higher, 55°C or higher, 60°C or higher, 65°C or higher, 70°C or higher, 75°C or higher, or 80°C or higher. More preferably, the heat-stable phosphoglucose isomerase is derived from thermophilic microorganisms such as Geobacillus kaustophilus, Geobacillus stearothermophilus, Thermotoga maritima, Pseudothermotoga thermarum, Thermolococcus kodakarensis, Archaeoglobus fulgidus, Thermoanaerobacter indiensis, Dictyoglomus thermophilum, Caldicellulosiruptor kronotskyensis, Clostridium thermocellum, Caldilinea aerophila, Pyrococcus furiosus, Thermolococcus thermophilus, Methanothermobacter marburgensis, Archaeoglobus profundus, etc., or the amino acid sequence of the heat-stable phosphoglucose isomerase is at least 70%, preferably at least 80%, more preferably at least 90%, and most preferably at least 95% identical to that of the heat-stable phosphoglucose isomerase derived from the thermophilic microorganisms. More preferably, the heat-stable phosphoglucose isomerase is derived from Thermus thermophilus.

[0017] Specifically, heat-resistant tagatose 6-phosphate epimerase refers to an enzyme that has the function of isomerizing fructose-6-phosphate (F6P) to tagatose-6-phosphate (T6P) at temperatures of 40°C or higher, 45°C or higher, 50°C or higher, 55°C or higher, 60°C or higher, 65°C or higher, 70°C or higher, 75°C or higher, or 80°C or higher. More preferably, the heat-resistant tagatose 6-phosphate epimerase is found in thermophilic microorganisms such as Geobacillus kaustophilus, Geobacillus stearothermophilus, Thermotoga maritima, Pseudothermotoga thermarum, Thermolococcus kodakarensis, Archaeoglobus fulgidus, Thermoanaerobacter indiensis, Dictyoglomus thermophilum, Caldicellulosiruptor kronotskyensis, Clostridium thermocellum, Caldilinea aerophila, Pyrococcus furiosus, Thermolococcus thermophilus, Methanothermobacter marburgensis, and Archaeoglobus. The thermostable tagatose 6-phosphate epimerase is derived from *Profundus* or the like, or the amino acid sequence of the thermostable tagatose 6-phosphate epimerase is at least 70%, preferably at least 80%, more preferably at least 90%, and most preferably at least 95% identical to the thermostable tagatose 6-phosphate epimerase derived from the thermophilic microorganism. More preferably, the thermostable tagatose 6-phosphate epimerase is derived from *Thermoanaerobacter indiensis*.

[0018] Specifically, the tagatose 6-phosphate phosphatase refers to an enzyme that has the function of removing the phosphate group from tagatose-6-phosphate (T6P) to produce the product tagatose at temperatures of 40°C or higher, 45°C or higher, 50°C or higher, 55°C or higher, 60°C or higher, 65°C or higher, 70°C or higher, 75°C or higher, or 80°C or higher. More preferably, the tagatose 6-phosphate phosphatase is a thermophilic microorganism, such as Geobacillus kaustophilus, Geobacillus stearothermophilus, Thermotoga maritima, Pseudothermotoga thermarum, Thermolococcus kodakarensis, Archaeoglobus fulgidus, Thermoanaerobacter indiensis, Dictyoglomus thermophilum, Caldicellulosiruptor kronotskyensis, Clostridium thermocellum, Caldilinea aerophila, Pyrococcus furiosus, Thermolococcus thermophilus, Methanothermobacter marburgensis, Archaeoglobus The tagatose 6-phosphate phosphatase is derived from *Profundus* or the like, or the amino acid sequence of the tagatose 6-phosphate phosphatase is at least 70%, preferably at least 80%, more preferably at least 90%, and most preferably at least 95% identical to the tagatose 6-phosphate phosphatase derived from the thermophilic microorganism. More preferably, the tagatose 6-phosphate phosphatase is derived from *Archaeoglobus fulgidus*.

[0019] The present invention also provides an expression vector for the above-mentioned genetically engineered bacteria, comprising the genes for α-glucan phosphorylase, phosphoglucumutase, phosphoglucose isomerase, tagatose 6-phosphate epimerase, and tagatose 6-phosphate phosphatase, and capable of co-expressing these genes.

[0020] As those skilled in the art will understand, the vectors and genetically engineered bacteria according to the present invention may be prepared by general methods known in the art, for example, by constructing and obtaining α-glucan phosphorylase genes, phosphoglucomutase genes, phosphoglucose isomerase genes, tagatose 6-phosphate epimerase genes, and tagatose 6-phosphate phosphatase genes by recombinant DNA technology, constructing recombinant expression vectors, and then transduction into Bacillus subtilis by known methods to obtain genetically engineered bacteria.

[0021] More preferably, the vector comprises a promoter, a thermostable α-glucan phosphorylase gene, a thermostable phosphoglucomutase gene, a thermostable phosphoglucose isomerase gene, a thermostable tagatose 6-phosphate epimerase gene, a thermostable tagatose 6-phosphate phosphatase gene, and a terminator. Each of the vectors expressing a thermostable α-glucan phosphorylase comprises a promoter, a thermostable α-glucan phosphorylase gene, and a terminator; each of the vectors expressing a thermostable phosphoglucumutase comprises a promoter, a thermostable phosphoglucumutase gene, and a terminator; each of the vectors expressing a thermostable tagatose 6-phosphate epimerase comprises a promoter, a thermostable tagatose 6-phosphate epimerase gene, and a terminator; each of the vectors expressing a thermostable tagatose 6-phosphate epimerase comprises a promoter, a thermostable tagatose 6-phosphate epimerase gene, and a terminator; and each of the vectors expressing a thermostable tagatose 6-phosphate phosphatase comprises a promoter, a thermostable tagatose 6-phosphate phosphatase gene, and a terminator.

[0022] As can be understood by those skilled in the art, all kinds of promoters known in this field can be used as the promoter of the present invention, including but not limited to the P43 promoter, Pylb promoter, PamyL promoter, Plaps promoter, PhpaII promoter, PamyE promoter, Pgrac promoter, PsacB promoter, PsigX promoter, PaprE promoter, PgroES promoter, etc. Preferably, as the promoter of the present invention, the PhpaII promoter and the Pylb promoter are selected and connected in series. Various terminators known in this field are also useful as the terminator of the present invention.

[0023] In a preferred embodiment, the endogenous uracil phosphoribosyltransferase gene, and / or α-amylase gene, and / or sporulation RNA polymerase σ F factor gene, and / or surfactin synthase subunit 3 gene in the genetically engineered bacterium is inactivated or knocked out. Most preferably, the endogenous uracil phosphoribosyltransferase gene, α-amylase gene, sporulation RNA polymerase σ F factor gene, and surfactin synthase subunit 3 gene in the genetically engineered bacterium are all inactivated or knocked out. Here, the inactivation or knockout of the above genes can further enhance the efficiency of producing tagatose from the genetically engineered bacterium, and the specific reasons are as follows. The inactivation or knockout of the uracil phosphoribosyltransferase gene constructs a trace-free gene manipulation system, making subsequent gene manipulation (i.e., gene knockout) a trace-free operation without the need to introduce foreign genes such as resistance genes. The inactivation or knockout of the α-amylase gene cuts off the pathway by which the strain utilizes exogenous starch, avoiding the metabolism and utilization of starch, which is the substrate for producing tagatose, as a carbon source by the strain. The sporulation RNA polymerase σ FInactivation or knockout of the factor gene enables the use of the bacterial species to metabolize and synthesize and express heterologous proteins related to tagatose synthesis, and also enables control of the fermentation of the strain so as not to generate spores. Inactivation or knockout of the surfactin synthase subunit 3 gene facilitates control in the fermentative production of the bacterial cells and can reduce the formation of foam. Therefore, inactivation or knockout of the above four genes is a preferred embodiment because it is more advantageous for the production of tagatose by the genetically engineered bacterium.

[0024] Inactivation or knockout of the endogenous gene can be carried out by methods known in the art, preferably by gene editing methods.

[0025] The present invention also provides a method for preparing and producing tagatose from starch by the catalytic action of whole cells of the above genetically engineered bacterium, comprising: Step (1) of fermenting the engineered bacterium of Bacillus subtilis to obtain whole cells; Step (2) of subjecting the whole cells of Bacillus subtilis obtained in step (1) to cell membrane permeability treatment to obtain permeable whole cells; Step (3) of preparing tagatose from starch by the catalytic action of the permeable whole cells obtained in step (2), and in the case of a co-expression type engineered bacterium of Bacillus subtilis, directly using the permeable whole cells for catalytic action, and in the case of an engineered bacterium of Bacillus subtilis expressing various enzymes respectively, mixing them and using them for catalytic action.

[0026] Preferably, the method further comprises a step of subjecting the permeable whole cells of Bacillus subtilis obtained in step (2) to immobilization treatment to obtain immobilized whole cells or an immobilized whole cell mixture, and using them for catalytic action.

[0027] In a specific embodiment, the whole cells in step (1) are prepared by methods known in the art. For fermentation, any medium can be used, including but not limited to LB medium, SR medium, TB medium, etc., which are suitable for the expression of foreign proteins.

[0028] In a preferred embodiment, step (2) may employ known methods for cell membrane permeability treatment, including but not limited to heat treatment, the addition of organic solvents and / or surfactants. Here, the organic solvents include, but are not limited to, acetone and acetonitrile. The surfactants include, but are not limited to, cetyl trimethyl ammonium bromide (CTAB) and Tween-80. Preferably, the cell membrane permeability treatment is heat treatment. The purpose of permeability treatment of the cell membrane is to allow extracellular starch to enter the cell through the cell membrane.

[0029] Preferably, the heat treatment temperature is 45 to 100°C, more preferably 70 to 80°C. Preferably, the heat treatment time is 10 to 100 min, more preferably 50 to 70 min. Preferably, the cell concentration during heat treatment is OD 600 =10~300, more preferably, OD 600 The temperature range is 30 to 150. The heat treatment may be carried out in a buffer-free system or a buffer system, but preferably, the heat treatment is carried out in a buffer system, and the buffer system may be HEPES buffer, phosphate buffer, Tris buffer, acetate buffer, etc. Phosphate buffers include sodium phosphate buffer and potassium phosphate buffer, for example.

[0030] In certain embodiments, the concentration of the substrate starch in the catalytic reaction system is 50 to 300 g / L, more preferably 100 to 200 g / L. Preferably, the reaction conditions are pH 5.0 to 8.0, 40 to 80°C for 0.5 to 96 hours, more preferably pH 6.5 to 7.5, 45 to 75°C for 12 to 60 hours, and most preferably pH 7.5, 60 to 70°C for 12 to 96 hours. The catalyst may be used in a buffer-free system or a buffer system, but preferably in a buffer system, and the buffer may be HEPES buffer, phosphate buffer, Tris buffer, acetate buffer, etc. Phosphate buffers include, for example, sodium phosphate buffer and potassium phosphate buffer.

[0031] Preferably, for permeable whole cells of Bacillus subtilis engineered bacteria expressing various enzymes individually, the ratio of permeable whole cells expressing heat-stable α-glucan phosphorylase, permeable whole cells expressing heat-stable phosphoglucomutase, permeable whole cells expressing heat-stable phosphoglucose isomerase, permeable whole cells expressing heat-stable tagatose 6-phosphate epimerase, and permeable whole cells expressing heat-stable tagatose 6-phosphate phosphatase in these mixtures is (0.1~10):(0.1~10):(0.1~10):(0.1~10):(0.1~10), more preferably (0.5~5):(0.5~5):(0.5~5):(0.5~5):(0.5~5), and most preferably 1:1:1:1:1.

[0032] In a specific embodiment, the method for immobilizing permeable whole cells involves resuspending permeable whole cells co-expressing thermostable α-glucan phosphorylase, thermostable phosphoglucumutase, thermostable phosphoglucose isomerase, thermostable tagatose 6-phosphate epimerase, and thermostable tagatose 6-phosphate phosphatase in sodium phosphate or potassium phosphate buffer, adding an appropriate amount of inorganic soil, and stirring uniformly. An aqueous polyethyleneimine solution is added and agglomerated under room temperature conditions, and then a crosslinking agent is added to crosslink. Subsequently, a filtration cake layer is obtained by suction filtration, the filtration cake is washed with deionized water and then extruded to prepare particles, which are dried to obtain immobilized whole cells.

[0033] In the method for processing the mixture of immobilized permeable whole cells described above, permeable whole cells expressing thermostable α-glucan phosphorylase, permeable whole cells expressing thermostable phosphoglucumutase, permeable whole cells expressing thermostable phosphoglucose isomerase, permeable whole cells expressing thermostable tagatose 6-phosphate epimerase, and permeable whole cells expressing thermostable tagatose 6-phosphate phosphatase are resuspended using sodium phosphate or potassium phosphate buffer, an appropriate amount of inorganic soil is added, and the mixture is mixed uniformly. Polyethyleneimine aqueous solution is added and agglomerated under room temperature conditions, and then a crosslinking agent is added to crosslink the mixture. After that, a filtration cake layer is obtained by suction filtration, the filtration cake is washed with deionized water and then extruded to prepare particles, which are dried to obtain immobilized whole cells.

[0034] Here, the inorganic soil includes, but is not limited to, montmorillonite, diatomaceous earth, kaolin, and bentonite, and preferably the inorganic soil is diatomaceous earth, and the crosslinking agent includes, but is not limited to, glutaraldehyde, trihydroxymethylphosphine, N,N-methylenebisacrylamide, epichlorohydrin, and genipin, and preferably the crosslinking agent is glutaraldehyde. [Effects of the Invention]

[0035] Compared to conventional technology, the present invention has the following beneficial effects.

[0036] (1) The present invention is the first to utilize the catalytic activity of whole cells expressing heat-stable α-glucan phosphorylase, heat-stable phosphoglucumutase, heat-stable phosphoglucose isomerase, heat-stable tagatose 6-phosphate epimerase, and heat-stable tagatose 6-phosphate phosphatase to produce tagatose from starch, thereby developing a new method for preparing tagatose that is simple and easy to scale up.

[0037] (2) Bacillus subtilis is a food-grade microorganism that is generally recognized as safe (GRAS: Generally Recognized As Safe) and does not produce endotoxins. Furthermore, knockout of the α-amylase coding gene is advantageous for subsequent substrate starch catalysis and spore-forming RNA polymerase σ F Knockout of factor-coding genes is advantageous for the application of genetically engineered strains to fermentation production in subsequent substrate-to-tagatose conversion production, and knockout of surface-active peptide synthase subunit 3-coding genes is advantageous for the application of genetically engineered strains to fermentation production in subsequent substrate-to-tagatose conversion production.

[0038] (3) In preferred embodiments, by using various heat-resistant enzymes, the preparation of tagatose can be carried out at high temperatures, thereby increasing the solubility of the substrate starch. Compared to the prior art, the present invention allows for the preparation of tagatose at high substrate concentrations, which is advantageous for improving production efficiency and further reducing production costs.

[0039] (4) In the method of the present invention, the conversion reaction of tagatose may be carried out without a buffer or in a buffer system, and does not require a culture medium containing a carbon source, a nitrogen source, an inorganic salt and an antibiotic, which is advantageous in reducing production costs and is also advantageous in separating and purifying the tagatose product. [Brief explanation of the drawing]

[0040] [Figure 1] This is a schematic diagram of the production of tagatose from starch by whole-cell catalytic action according to the present invention. [Figure 2] This is a map of the recombinant expression vector pMA5-Pylb-aGP. [Figure 3] This is a map of the recombinant expression vector pMA5-Pylb-PGM. [Figure 4] This is a map of the recombinant expression vector pMA5-Pylb-PGI. [Figure 5] This is a map of the recombinant expression vector pMA5-Pylb-TPE. [Figure 6] This is a map of the recombinant expression vector pMA5-Pylb-TPP. [Figure 7] This is a map of the recombinant expression vector pMA5-Pylb-aGP-PGM-PGI-TPE-TPP. [Figure 8] This is a curve diagram showing the change in tagatose yield with respect to reaction time. [Figure 9] This is a yield trend diagram for producing Tagatose by fixing co-expressing recombinant strains. [Figure 10] This is a trend diagram of yield when producing Tagatose by fixing individually expressed recombinant bacterial strains. [Modes for carrying out the invention]

[0041] To further illustrate the technical means used in the present invention and their effects, the technical proposal of the present invention will be further described below by specific embodiments. However, the embodiments described above are merely illustrative and preferred embodiments, but do not limit the scope of the present invention in any way. As will be apparent to those skilled in the art, modifications or substitutions can be made to the details and forms of the technical proposal of the present invention without departing from the spirit and scope of the present invention, and all such modifications or substitutions are included within the patentable scope of the present invention.

[0042] Example 1: Construction of recombinant Bacillus subtilis strain SCK8 (1) Construction of the recombinant embedded vector pSS-upp-FR Based on the uracilphosphoribosyltransferase encoding gene upp gene sequence (NCBI-ProteinID: NP_391570) derived from Bacillus subtilis 168 in the KEGG database, primers were designed, amplified by PCR, and homologous fragments of the upstream 500 bp and downstream of the upp gene were obtained. These were then constructed into the recombinant embedded vector pSS using a simple cloning method (You, C., Zhang, XZ, & Zhang, YH (2012). Simple cloning via direct transformation of PCR product (DNA Multimer) to Escherichia coli and Bacillus subtilis. Appl. Environ. Microbiol., 78(5), 1593-1595. doi:10.1128 / AEM.07105-11), obtaining the recombinant embedded vector pSS-upp-FR.

[0043] (2) Construction of recombinant Bacillus subtilis strain SCK8 Supercompetent cells of Bacillus subtilis strain SCK6 (200 μl) (Zhang, XZ, & Zhang, YHP (2011). Simple, fast and high-efficiency transformation system for directed evolution of cellulase in Bacillus subtilis. Microb. Biotechnol., 4(1), 98-105.) A recombinant vector pSS-upp-FR (1 μg) was prepared, and the recombinant embedded vector pSS-upp-FR (1 μg) was homogeneously mixed with Bacillus subtilis strain SCK6 supercompetent cells (200 μl). Subsequently, the mixture was shaken at 37°C for 90 minutes, and the bacterial suspension was spread onto solid LB medium containing chloramphenicol (5 μg / mL) (yeast extract 5 g / L, peptone 10 g / L, sodium chloride 10 g / L), and incubated in a 37°C incubator for 14-16 hours.

[0044] Positive single-exchange transformant colonies grown on chloramphenicol-resistant plates are selected and PCR validation of the colonies is performed. PCR amplification results in two bands, one with a 1000 bp DNA fragment and the other with a 2000 bp DNA fragment (the size of the 1000 bp DNA fragment is the size of the upstream and downstream homology arms of the upp coding gene in the vector pSS-upp-FR, and the size of the 2000 bp DNA fragment is the size of the fragment in the genome that includes the upstream homology arm of the upp coding gene, the upp coding gene, and the downstream homology arm of the upp coding gene), and these are considered positive clones.

[0045] Positive clones were selected and transferred to LB medium without antibiotics for 8-12 hours of incubation. Subsequently, 200 μl of the bacterial suspension was centrifuged to remove the supernatant, and then resuspended in sterile water. This was then spread onto a solid plate of 5-fluorouracil (5-FU) basal salt medium (40% glucose 20.0 ml / L, 4% glutamine 50.0 mL / L, 0.5% tryptophan 10.0 mL / L, 1% vitamin B1 1.0 mL / L, 20 mM 5-fluorouracil 500 μL / L, 10× basal salt 100.0 mL / L, 1000× trace elements 1.0 mL / L), and incubated in a 37°C incubator for 24 hours. The purpose of this step is to promote intramolecular homologous recombination of positive transformants by culturing in LB medium without antibiotics, and to obtain target transformants that have undergone upp knockout by screening culture on 5-FU basal salt medium.

[0046] Multiple colonies were selected from a 5-FU basal salt medium solid plate, and further PCR validation of the colonies revealed that transformants possessing only a 1000 bp DNA fragment were positive clones. PCR sequencing of the transformants confirmed the existence of a correct strain, namely a Bacillus subtilis engineered strain with the upp gene knockout, i.e., a recombinant Bacillus subtilis engineered strain lacking uracilphosphoribosyltransferase enzyme activity, which was preserved and named SCK8.

[0047] Example 2: Construction of recombinant Bacillus subtilis strain SCK8-ST1 (1) Construction of the recombinant embedded vector pSS-amyE-FR Based on the amyG gene sequence (NCBI-ProteinID: NP_388186) of the α-amylase encoding gene derived from Bacillus subtilis 168 in the KEGG database, primers were designed, amplified by PCR, and obtained a 500 bp homologous fragment upstream and downstream of the amyG gene. These were then constructed into the recombinant embedded vector pSS using a simple cloning method (You, C., Zhang, XZ, & Zhang, YH (2012). Simple cloning via direct transformation of PCR product (DNA Multimer) to Escherichia coli and Bacillus subtilis. Appl. Environ. Microbiol., 78(5), 1593-1595. doi:10.1128 / AEM.07105-11), obtaining the recombinant embedded vector pSS-amyE-FR.

[0048] (2) Construction of recombinant Bacillus subtilis strain SCK8-ST1 Bacillus subtilis strain SCK8 supercompetent cells (200 μl) were prepared, and the recombinant embedded vector pSS-amyE-FR (1 μg) was homogeneously mixed with the Bacillus subtilis strain SCK8 supercompetent cells (200 μl). Subsequently, the mixture was incubated in a 37°C shaker for 90 minutes, and the bacterial suspension was spread onto solid LB medium containing chloramphenicol (5 μg / mL) (yeast extract 5 g / L, peptone 10 g / L, sodium chloride 10 g / L), and incubated in a 37°C incubator for 14-16 hours.

[0049] Positive single-exchange transformant colonies grown on chloramphenicol-resistant plates were selected and PCR validation was performed on the colonies. PCR amplification results obtained bands of 1000 bp DNA fragments and two 2000 bp DNA fragments (the size of the 1000 bp DNA fragment is the size of the upstream and downstream homology arms of the amyE coding gene in the vector pSS-amyE-FR, and the size of the 2000 bp DNA fragment is the size of the fragment containing the upstream homology arm of the amyE coding gene, the amyE coding gene, and the downstream homology arm of the amyE coding gene in the genome), and these were identified as positive clones.

[0050] Positive clones were selected and transferred to LB medium without antibiotics for 8-12 hours of incubation. Subsequently, 200 μl of the bacterial suspension was centrifuged to remove the supernatant, and then resuspended in sterile water. This was then spread onto a 5-FU basal salt plate (40% glucose 20.0 ml / L, 4% glutamine 50.0 mL / L, 0.5% tryptophan 10.0 mL / L, 1% vitamin B1 1.0 mL / L, 20 mM 5-fluorouracil 500 μL / L, 10× basal salt 100.0 mL / L, 1000× trace elements 1.0 mL / L) and incubated in a 37°C incubator for 24 hours. The purpose of this step is to promote intramolecular homologous recombination of positive transformants by culturing in LB medium without antibiotics, and to obtain target transformants that have undergone myE knockout by screening culture in 5-FU basal salt medium.

[0051] Multiple colonies were selected from a 5-FU basal salt medium solid plate, and further PCR validation of the colonies revealed that transformants possessing only a 1000 bp DNA fragment were positive clones. PCR sequencing of the transformants confirmed the existence of a correct strain, namely an amyG gene knockout Bacillus subtilis engineered strain, i.e., a recombinant Bacillus subtilis engineered strain lacking α-amylase enzyme activity, which was preserved and named SCK8-ST1.

[0052] Example 3: Construction of recombinant Bacillus subtilis strain SCK8-ST2 (1) Construction of the recombinant embedded vector pSS-spoIIAC-FR Spore-forming RNA polymerase σ from Bacillus subtilis 168 in the KEGG database F Primers were designed according to the sequence of the factor-coding gene spoIIAC (NCBI-ProteinID: NP_390226), amplified by PCR, and homologous fragments of the spore-forming spoIIAC gene (500 bp upstream and 500 bp downstream) were obtained. These were then constructed into the embedding vector pSS using a simple cloning method (You, C., Zhang, XZ, & Zhang, YH (2012). Simple cloning via direct transformation of PCR product (DNA Multimer) to Escherichia coli and Bacillus subtilis. Appl. Environ. Microbiol., 78(5), 1593-1595. doi:10.1128 / AEM.07105-11), obtaining the recombinant embedding vector pSS-spoIIAC-FR.

[0053] (2) Construction of recombinant Bacillus subtilis strain SCK8-ST2 Super-competent Bacillus subtilis strain SCK8-ST1 cells (200 μl) were prepared, and the recombinant embedded vector pSS-spoIIAC-FR (1 μg) was homogeneously mixed with the Bacillus subtilis strain SCK8-ST1 super-competent cells (200 μl). Subsequently, the mixture was incubated in a 37°C shaker for 90 minutes, and the bacterial suspension was spread onto solid LB medium containing chloramphenicol (5 μg / mL) (yeast extract 5 g / L, peptone 10 g / L, sodium chloride 10 g / L). The mixture was then incubated in a 37°C incubator for 14-16 hours.

[0054] Positive single-exchange transformant colonies grown on chloramphenicol-resistant plates were selected and PCR validation was performed on the colonies. PCR amplification results obtained two bands, one with a 1000 bp DNA fragment and the other with a 2000 bp DNA fragment (the size of the 1000 bp DNA fragment is the size of the upstream and downstream homology arms of the spoIIAC coding gene in the vector pSS-spoIIAC-FR, and the size of the 2000 bp DNA fragment is the size of the fragment in the genome that includes the upstream homology arm of the spoIIAC coding gene, the spoIIAC coding gene, and the downstream homology arm of the spoIIAC coding gene), and these were identified as positive clones.

[0055] Positive clones were selected and transferred to LB medium without antibiotics for 8-12 hours of incubation. Subsequently, 200 μl of the bacterial suspension was centrifuged to remove the supernatant, and then resuspended in sterile water. This was then spread onto a 5-FU basal salt plate (40% glucose 20.0 ml / L, 4% glutamine 50.0 mL / L, 0.5% tryptophan 10.0 mL / L, 1% vitamin B1 1.0 mL / L, 20 mM 5-fluorouracil 500 μL / L, 10× basal salt 100.0 mL / L, 1000× trace elements 1.0 mL / L) and incubated in a 37°C incubator for 24 hours. The purpose of this step is to promote intramolecular homologous recombination of positive transformants by culturing in LB medium without antibiotics, and to obtain target transformants that have undergone spoIIAC knockout by screening culture on 5-FU basal salt medium.

[0056] Multiple colonies were selected from a 5-FU basal salt medium solid plate, and further PCR validation of the colonies was performed. PCR amplification revealed that transformants containing only a 1000 bp DNA fragment were positive clones. PCR sequencing of the transformants confirmed the presence of the correct strain, namely, a recombinant engineered strain of Bacillus subtilis with the spore-forming spoIIAC gene knockout, i.e., a strain with spore-forming RNA polymerase σ F We preserved a recombinant Bacillus subtilis strain lacking factor activity and named it SCK8-ST2.

[0057] Example 4: Construction of recombinant Bacillus subtilis strain SCK8-ST3 (1) Construction of the recombinant embedded vector pSS-srfAC-FR Based on the srfAC gene sequence (NCBI-ProteinID: NP_388233) derived from Bacillus subtilis 168 in the KEGG database, primers were designed, amplified by PCR, and homologous fragments of the upstream 500 bp and downstream 500 bp of the srfAC gene were obtained. These were then constructed into the recombinant embedded vector pSS using a simple cloning method (You, C., Zhang, XZ, & Zhang, YH (2012). Simple cloning via direct transformation of PCR product (DNA Multimer) to Escherichia coli and Bacillus subtilis. Appl. Environ. Microbiol., 78(5), 1593-1595. doi:10.1128 / AEM.07105-11), obtaining the recombinant embedded vector pSS-srfAC-FR.

[0058] (2) Construction of recombinant Bacillus subtilis strain SCK8-ST3 Super-competent cells of Bacillus subtilis strain SCK8-ST2 (200 μl) were prepared, and the recombinant embedded vector pSS-srfAC-FR (1 μg) was homogeneously mixed with the Bacillus subtilis strain SCK8-ST2 super-competent cells (200 μl). Subsequently, the mixture was incubated in a 37°C shaker for 90 minutes, and the bacterial suspension was spread onto solid LB medium containing chloramphenicol (5 μg / mL) (yeast extract 5 g / L, peptone 10 g / L, sodium chloride 10 g / L). The mixture was then incubated in a 37°C incubator for 14-16 hours.

[0059] Positive single-exchange transformant colonies grown on chloramphenicol-resistant plates were selected and PCR validation was performed on the colonies. PCR amplification results obtained two bands, one with a 1000 bp DNA fragment and the other with a 2000 bp DNA fragment (the size of the 1000 bp DNA fragment is the size of the upstream and downstream homology arms of the srfAC coding gene in the vector pSS-srfAC-FR, and the size of the 2000 bp DNA fragment is the size of the fragment in the genome that includes the upstream homology arm of the srfAC coding gene, the srfAC coding gene, and the downstream homology arm of the srfAC coding gene), and these were identified as positive clones.

[0060] Positive clones were selected and transferred to LB medium without antibiotics for 8-12 hours of incubation. Subsequently, 200 μl of the bacterial suspension was centrifuged to remove the supernatant, and then resuspended in sterile water. This was then spread onto a 5-FU basal salt plate (40% glucose 20.0 ml / L, 4% glutamine 50.0 mL / L, 0.5% tryptophan 10.0 mL / L, 1% vitamin B1 1.0 mL / L, 20 mM 5-fluorouracil 500 μL / L, 10× basal salt 100.0 mL / L, 1000× trace elements 1.0 mL / L) and incubated in a 37°C incubator for 24 hours. The purpose of this step is to promote intramolecular homologous recombination of positive transformants by culturing in LB medium without antibiotics, and to obtain target transformants that have undergone srfAC knockout by screening culture in 5-FU basal salt medium.

[0061] Multiple colonies were selected from a 5-FU basal salt medium solid plate, and further PCR validation of the colonies revealed that transformants possessing only a 1000 bp DNA fragment were positive clones. PCR sequencing of the transformants confirmed the existence of a correct strain, namely a Bacillus subtilis recombinant engineered strain with srfAC gene knockout, i.e., a Bacillus subtilis recombinant engineered strain lacking surface-active peptide synthase subunit 3 enzyme activity, which was preserved and named SCK8-ST3.

[0062] Example 5: Construction of a recombinant vector (1) Construction of pMA5-Pylb-aGP In this example, the thermostable α-glucan phosphorylase is derived from Thermococcus kodakarensis. The thermostable α-glucan phosphorylase encoding gene agp sequence (NCBI-ProteinID: BAD85595) was synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. and ligated to a conventional plasmid. The thermostable α-glucan phosphorylase encoding gene agp was obtained by PCR using a pair of primers. Primers 299-F:5´-AGAAACAACAAAGGGGGAGATTTGTatggtgaacgtttccaatgccgttg-3´ and 300-R:5´-gcttgagctcgactctagaggatcctcagtcaagtcccttccacttgacca-3´ were used, and the pMA5-Pylb linear skeleton was obtained by PCR using a pair of primers. Primers 301-F:5´-tggtcaagtggaagggacttgactgaggatcctctagagtcgagctcaagc-3´ and 302-R:5´-caacggcattggaaacgttcaccatACAAATCTCCCCCTTTGTTGTTTCT-3´ were used. All primers were synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. The PCR conditions for the genes were denatured at 94°C for 5 minutes, followed by denaturation at 94°C for 15 seconds, annealing at 58°C for 15 seconds, extension at 72°C for 1 minute, and finally extension at 72°C for 10 minutes, for a total of 30 cycles. Each product obtained from the PCR reaction was analyzed by 0.8% agarose gel electrophoresis. After confirming the correct fragment size using a gel imaging system, the target fragment was recovered using a DNA purification and recovery kit (Tiangen Biochemical Technology Co., Ltd., China) and used to construct a recombinant expression vector.

[0063] Subsequently, the thermostable α-glucan phosphorylase gene fragment and the pMA5-Pylb vector framework were assembled using POE-PCR. The POE-PCR system was as follows: Purified pMA5-Pylb linear framework, 200 ng; Purified thermostable α-glucan phosphorylase gene fragment, 131 ng; 2×PrimeSTAR MAX DNA Polymerase (Dalian Baobiotics, China), 25 μL, with water remaining up to 50 μL. The POE-PCR conditions consisted of 30 cycles following parameters such as denaturation at 98°C for 2 min, denaturation at 98°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 3.5 min, and finally extension at 72°C for 5 min. The ligated product was transformed into competent E. coli Top10 using the calcium chloride method. Transformants were selected and identified by colony PCR and dual enzyme digestion. Two to three positive transformants were selected and further sequenced for verification. The sequencing results yielded a pMA5-Pylb-aGP recombinant co-expression vector, and the plasmid map is shown in Figure 2.

[0064] (2) Construction of pMA5-Pylb-PGM In this example, the thermostable phosphoglucomutase is derived from Thermococcus kodakarensis. The thermostable phosphoglucomutase coding gene pgm sequence (NCBI-ProteinID: BAD85297) was synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. and ligated to a conventional plasmid. The thermostable phosphoglucomutase coding gene pgm was obtained from genomic DNA by PCR using a pair of primers. Primers 327-F:5´-AGAAACAACAAAGGGGGAGATTTGTatgggcaaactgtttggtaccttcg-3´ and 328-R:5´-agcttgagctcgactctagaggatccTTAacctttcagtgcttcttccagc-3´ were used, and the pMA5-Pylb linear skeleton was obtained by PCR using a pair of primers. Primers 329-F:5'-gctggaagaagcactgaaaggtTAAggatcctctagagtcgagctcaagct-3' and 330-R:5'-cgaaggtaccaaacagtttgcccatACAAATCTCCCCCTTTGTTGTTTCT-3' were used. All primers were synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. The PCR conditions for the genes were denatured at 94°C for 5 minutes, followed by denaturation at 94°C for 15 seconds, annealing at 58°C for 15 seconds, extension at 72°C for 1 minute, and finally extension at 72°C for 10 minutes, for a total of 30 cycles. Each product obtained from the PCR reaction was analyzed by 0.8% agarose gel electrophoresis. After confirming the correct fragment size using a gel imaging system, the target fragment was recovered using a DNA purification and recovery kit (Tiangen Biochemical Technology Co., Ltd., China) and used to construct a recombinant expression vector.

[0065] Subsequently, the thermostable phosphoglucomutase gene fragment and the pMA5-Pylb vector framework were assembled using POE-PCR. The POE-PCR system was as follows: Purified pMA5-Pylb linear framework, 200 ng; Purified thermostable phosphoglucomutase gene fragment, 131 ng; 2×PrimeSTAR MAX DNA Polymerase (Dalian Baobiotics, China), 25 μL; Water up to 50 μL. The POE-PCR conditions consisted of 30 cycles following parameters such as denaturation at 98°C for 2 min, denaturation at 98°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 3.5 min, and finally extension at 72°C for 5 min. The ligated product was transformed into competent E. coli Top10 using the calcium chloride method. Transformants were selected and identified by colony PCR and dual enzyme digestion. Two to three positive transformants were selected and further sequenced for verification. The sequencing results yielded a pMA5-Pylb-PGM recombinant co-expression vector, and the plasmid map is shown in Figure 3.

[0066] (3) Construction of pMA5-Pylb-PGI In this example, the thermostable phosphoglucose isomerase is derived from Thermus thermophilus. The thermostable phosphoglucose isomerase coding gene pgi sequence (NCBI-ProteinID: AAS82052) was synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. and ligated to a conventional plasmid. The thermostable phosphoglucose isomerase coding gene pgi was obtained from genomic DNA by PCR using a pair of primers. Primers 331-F:5´-AGAAACAACAAAGGGGGAGATTTGTATGCTGCGTCTGGATACTCGCTTTC-3´ and 332-R:5´-agcttgagctcgactctagaggatccTTAACCAGCCAGGCGTTTACGAGTC-3´ were used, and the pMA5-Pylb linear skeleton was obtained by PCR using a pair of primers. Primers 333-F:5'-GACTCGTAAACGCCTGGCTGGTTAAggatcctctagagtcgagctcaagct-3' and 334-R:5'-GAAAGCGAGTATCCAGACGCAGCATACAAATCTCCCCCTTTGTTGTTTCT-3' were used. All primers were synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. The PCR conditions for the genes were denatured at 94°C for 5 minutes, followed by denaturation at 94°C for 15 seconds, annealing at 58°C for 15 seconds, extension at 72°C for 1 minute, and finally extension at 72°C for 10 minutes, for a total of 30 cycles. Each product obtained from the PCR reaction was analyzed by 0.8% agarose gel electrophoresis. After confirming the correct fragment size using a gel imaging system, the target fragment was recovered using a DNA purification and recovery kit (Tiangen Biochemical Technology Co., Ltd., China) and used to construct a recombinant expression vector.

[0067] Subsequently, the thermostable phosphoglucose isomerase gene fragment and the pMA5-Pylb vector framework were assembled using POE-PCR. The POE-PCR system was as follows: Purified pMA5-Pylb linear framework, 200 ng; Purified thermostable phosphoglucose isomerase gene fragment, 131 ng; 2×PrimeSTAR MAX DNA Polymerase (Dalian Baobio, China), 25 μL; Water up to 50 μL. The POE-PCR conditions consisted of denaturation at 98°C for 2 min, denaturation at 98°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 3.5 min, and finally extension at 72°C for 5 min, followed by 30 cycles. The ligated product was transformed into competent E. coli Top10 using the calcium chloride method. Transformants were selected and identified by colony PCR and dual enzyme digestion. Two to three positive transformants were selected and further sequenced for verification. The sequencing results yielded a pMA5-Pylb-PGI recombinant co-expression vector, and the plasmid map is shown in Figure 4.

[0068] (4) Construction of pMA5-Pylb-TPE In this example, the thermostable tagatose 6-phosphate epimerase is derived from Thermoanaerobacter indiensis. The thermostable tagatose 6-phosphate epimerase coding gene tpe sequence (NCBI-ProteinID: B044_RS0101530) was synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. and ligated to a conventional plasmid. The thermostable tagatose 6-phosphate epimerase coding gene tpe was obtained from genomic DNA by PCR using a pair of primers. Primers 335-F:5´-AGAAACAACAAAGGGGGAGATTTGTatgaaagtttggctggttggtgcct-3´ and 324-R:5´-agcttgagctcgactctagaggatccTTAtttcaggttgctataccattct-3´ were used, and the pMA5-Pylb linear skeleton was obtained by PCR using a pair of primers. Primers 325-F:5´-agaatggtatagcaacctgaaaTAAggatcctctagagtcgagctcaagct-3´ and 326-R:5´-aggcaccaaccagccaaactttcatACAAATCTCCCCCTTTGTTGTTTCT-3´ were used. All primers were synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. The PCR conditions for the genes were denatured at 94°C for 5 minutes, followed by denaturation at 94°C for 15 seconds, annealing at 58°C for 15 seconds, extension at 72°C for 1 minute, and finally extension at 72°C for 10 minutes, for a total of 30 cycles. Each product obtained from the PCR reaction was analyzed by 0.8% agarose gel electrophoresis. After confirming the correct fragment size using a gel imaging system, the target fragment was recovered using a DNA purification and recovery kit (Tiangen Biochemical Technology Co., Ltd., China) and used to construct a recombinant expression vector.

[0069] Subsequently, the thermostable tagatose 6-phosphate epimerase gene fragment and the pMA5-Pylb vector skeleton were assembled using POE-PCR. The POE-PCR system was as follows: Purified pMA5-Pylb linear skeleton, 200 ng; Purified thermostable tagatose 6-phosphate epimerase gene fragment, 131 ng; 2×PrimeSTAR MAX DNA Polymerase (Dalian Baobio, China), 25 μL; Water up to 50 μL. The POE-PCR conditions consisted of 30 cycles following parameters such as denaturation at 98°C for 2 min, denaturation at 98°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 3.5 min, and finally extension at 72°C for 5 min. The ligated product was transformed into competent E. coli Top10 using the calcium chloride method. Transformants were selected and identified by colony PCR and dual enzyme digestion. Two to three positive transformants were selected and further sequenced for verification. The sequencing results yielded a pMA5-Pylb-TPE recombinant co-expression vector, and the plasmid map is shown in Figure 5.

[0070] (5) Construction of pMA5-Pylb-TPP In this example, the thermostable tagatose 6-phosphate phosphatase was derived from Archaeoglobus fulgidus. The thermostable tagatose 6-phosphate phosphatase coding gene tpp sequence (NCBI-ProteinID: AAB90791) was synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. and ligated to a conventional plasmid. The thermostable tagatose 6-phosphate phosphatase coding gene tpp was obtained from genomic DNA by PCR using a pair of primers. Primers 339-F:5´-AGAAACAACAAAGGGGGAGATTTGTATGTTCAAGCCGAAAGCGATCGCGG-3´ and 340-R:5´-agcttgagctcgactctagaggatccTTAACGCAGCAGGCCCAGAAACTG-3´ were used, and the pMA5-Pylb linear skeleton was obtained by PCR using a pair of primers. Primers 341-F:5'-CAGTTTCTGGGCCTGCTGCGTTAAggatcctctagagtcgagctcaagct-3' and 342-R:5'-CCGCGATCGCTTTCGGCTTGAACATACAAATCTCCCCCTTTGTTGTTTCT-3' were used.

[0071] All primers were synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. The PCR conditions for the genes were denatured at 94°C for 5 minutes, followed by denaturation at 94°C for 15 seconds, annealing at 58°C for 15 seconds, extension at 72°C for 1 minute, and finally extension at 72°C for 10 minutes, for a total of 30 cycles. Each product obtained from the PCR reaction was analyzed by 0.8% agarose gel electrophoresis. After confirming the correct fragment size using a gel imaging system, the target fragment was recovered using a DNA purification and recovery kit (Tiangen Biochemical Technology Co., Ltd., China) and used to construct a recombinant expression vector.

[0072] Subsequently, the thermostable tagatose 6-phosphate phosphatase gene fragment and the pMA5-Pylb vector framework were assembled using POE-PCR. The POE-PCR system was as follows: Purified pMA5-Pylb linear framework, 200 ng; Purified thermostable tagatose 6-phosphate phosphatase gene fragment, 131 ng; 2×PrimeSTAR MAX DNA Polymerase (Dalian Baobio, China), 25 μL; Water up to 50 μL. The POE-PCR conditions consisted of denaturation at 98°C for 2 min, denaturation at 98°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 3.5 min, and finally extension at 72°C for 5 min, followed by 30 cycles. The ligated product was transformed into competent E. coli Top10 using the calcium chloride method. Transformants were selected and identified by colony PCR and dual enzyme digestion. Two to three positive transformants were selected and further sequenced for verification. The sequencing results yielded a pMA5-Pylb-TPP recombinant co-expression vector, and the plasmid map is shown in Figure 6.

[0073] (6) Construction of pMA5-Pylb-aGP-PGM-PGI-TPE-TPP In this example, the heat-stable α-glucan phosphorylase is derived from Thermococcus kodakarensis, the heat-stable phosphoglucumutase is derived from Thermococcus kodakarensis, the heat-stable phosphoglucose isomerase is derived from Thermus thermophilus, the heat-stable tagatose 6-phosphate epimerase is derived from Thermoanaerobacter indiensis, and the heat-stable tagatose 6-phosphate phosphatase is derived from Archaeoglobus fulgidus. The thermostable α-glucan phosphorylase encoding gene agp (NCBI-ProteinID: BAD85595) was obtained by PCR, using primers 350-F:5´-AGAAACAACAAAGGGGGAGATTTGTatggtgaacgtttccaatgccgttg-3´ and 351-R:5´-cgaaggtaccaaacagtttgcccatTTTGAATTCCTCCTTTtcagtcaagtcccttccacttgacc-3´. The thermostable phosphoglucocomutase encoding gene pgm (NCBI-ProteinID: BAD85297) was obtained by PCR, using primers 352-F:5´-ggtcaagtggaagggacttgactgaAAAGGAGGAATTCAAAatgggcaaactgtttggtaccttcg-3´ and 353-R:5´- GAAAGCGAGTATCCAGACGCAGCATTTTGAATTCCTCCTTTTTAacctttcagtgcttcttccagc-3' was used, the thermostable phosphoglucose isomerase encoding gene pgi (NCBI-ProteinID: AAS82052) was obtained by PCR, and primers 354-F:5'- gctggaagaagcactgaaaggtTAAAAAGGAGGAATTCAAAATGCTGCGTCTGGATACTCGCTTTC-3' and 355-R:5'- TTTTCAGCGGATGTTCGGTGTTCATTTTGAATTCCTCCTTTTCAACCAGCCAGGCGTTTACGAGTC-3' were used, and the thermostable tagatose 6-phosphate epimerase encoding gene tpe (NCBI-ProteinID:B044_RS0101530) was obtained by PCR, using primers 356-F:5´- GACTCGTAAACGCCTGGCTGGTTGAAAAGGAGGAATTCAAAATGAACACCGAACATCCGCTGAAAA-3´ and 357-R:5´- ACCGCGATCGCTTTCGGCTTGAACATTTTGAATTCCTCCTTTttaAATCAGTTTGAATTCACCGCTG-3´. The heat-stable tagatose 6-phosphate phosphatase coding gene tpp (NCBI-ProteinID: AAB90791) was obtained by PCR, using primers 358-F:5´- CAGCGGTGAATTCAAACTGATTtaaAAAGGAGGAATTCAAAATGTTCAAGCCGAAAGCGATCGCGGT-3´ and 359-R:5´- gcttgagctcgactctagaggatccTTAACGCAGCAGGCCCAGAAACTGCA-3' is used, the pMA5-Pylb linear skeleton is obtained by PCR, and primers 360-F:5'-TGCAGTTTCTGGGCCTGCTGCGTTAAggatcctctagagtcgagctcaagc-3' and 361-R:5'-caacggcattggaaacgttcaccatACAAATCTCCCCCTTTGTTGTTTCT-3' are used.

[0074] All primers were synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. The PCR conditions for the genes were denatured at 94°C for 5 minutes, followed by denaturation at 94°C for 15 seconds, annealing at 58°C for 15 seconds, extension at 72°C for 1 minute, and finally extension at 72°C for 10 minutes, for a total of 30 cycles. Each product obtained from the PCR reaction was analyzed by 0.8% agarose gel electrophoresis. After confirming the correct fragment size using a gel imaging system, the target fragment was recovered using a DNA purification and recovery kit (Tiangen Biochemical Technology Co., Ltd., China) and used to construct a recombinant expression vector.

[0075] Subsequently, thermostable α-glucan phosphorylase gene fragments, thermostable phosphoglucomutase gene fragments, thermostable tagatose 6-phosphate epimerase gene fragments, thermostable tagatose 6-phosphate phosphatase gene fragments, and the pMA5-Pylb vector skeleton were assembled using POE-PCR. The POE-PCR system was as follows: Purified pMA5-Pylb linear skeleton, 200 ng; Purified thermostable α-glucan phosphorylase gene fragment, 131 ng; thermostable phosphoglucose isomerase gene fragment, 131 ng; thermostable tagatose 6-phosphate epimerase gene fragment, 131 ng; thermostable tagatose 6-phosphate phosphatase gene fragment, 131 ng; 2×PrimeSTAR MAX DNA Polymerase (Dalian Baobiotics, China), 25 μL; water up to 50 μL. The POE-PCR conditions were denatured at 98°C for 2 minutes, followed by denaturation at 98°C for 15 seconds, annealing at 58°C for 15 seconds, extension at 72°C for 3.5 minutes, and finally extension at 72°C for 5 minutes, for a total of 30 cycles. The ligated product was transformed into competent E. coli Top10 by the calcium chloride method. Transformants were selected and identified by colony PCR and dual enzyme digestion. Two to three positive transformants were selected and further sequenced for verification. Sequencing yielded a pMA5-Pylb-aGP-PGM-PGI-TPE-TPP recombinant co-expression vector, and the plasmid map is shown in Figure 7.

[0076] Example 6: Construction of recombinant microorganisms The constructed recombinant expression vectors pMA5-Pylb-aGP, pMA5-Pylb-PGM, pMA5-Pylb-PGI, pMA5-Pylb-TPE, pMA5-Pylb-TPP, and pMA5-Pylb-aGP-PGM-PGI-TPE-TPP were each transformed into the Bacillus subtilis SCK8-ST3 strain, cultured overnight in LB test tubes, and plasmids were extracted using a plasmid extraction kit. The correct clones SCK8-ST3 / pMA5-Pylb-aGP, SCK8-ST3 / pMA5-Pylb-PGM, SCK8-ST3 / pMA5-Pylb-PGI, SCK8-ST3 / pMA5-Pylb-TPE, SCK8-ST3 / pMA5-Pylb-TPP, and SCK8-ST3 / pMA5-Pylb-aGP-PGM-PGI-TPE-TPP were then stored.

[0077] Example 7 Preparation of recombinant whole bacterial cells Recombinant strains SCK8-ST3 / pMA5-Pylb-aGP, SCK8-ST3 / pMA5-Pylb-PGM, SCK8-ST3 / pMA5-Pylb-PGI, SCK8-ST3 / pMA5-Pylb-TPE, SCK8-ST3 / pMA5-Pylb-TPP, and SCK8-ST3 / pMA5-Pylb-aGP-PGM-PGI-TPE-TPP were selected and inoculated into spectinomycin-containing LB medium, and incubated overnight at 37°C with shaking. The culture was inoculated at a 1% dose into new LB medium containing spectinomycin, cultured overnight at 37°C with shaking, centrifuged at 5500 rpm for 10 minutes, and the supernatant was discarded to obtain whole cells expressing thermostable α-glucan phosphorylase, whole cells expressing thermostable phosphoglucumutase, whole cells expressing thermostable phosphoglucose isomerase, whole cells expressing thermostable tagatose 6-phosphate epimerase, whole cells expressing thermostable tagatose 6-phosphate phosphatase, and whole cells co-expressing thermostable α-glucan phosphorylase, thermostable phosphoglucumutase, thermostable phosphoglucose isomerase, thermostable tagatose 6-phosphate epimerase, and thermostable tagatose 6-phosphate phosphatase.

[0078] Example 8 Preparation of Tagatose from Starch by Catalysis of Co-expressed Whole Cells The whole cells co-expressing thermostable α-glucan phosphorylase, thermostable phosphoglucomutase, thermostable glucose isomerase, thermostable tagatose 6-phosphate epimerase and thermostable tagatose 6-phosphate phosphatase prepared in Example 7 were washed once with 50 mM Tris-HCl buffer (pH 7.5), centrifuged at 5500 rpm for 10 min, the supernatant was discarded, 50 mM Tris-HCl (pH 7.5) buffer was added to the precipitate, and the cells were resuspended until OD 600 = approximately 300. The resuspended cells were heat-treated at 75 °C for 90 min.

[0079] In a 1 L reaction system, 100 g / L starch, 50 mM sodium phosphate buffer (pH 7.5) and heat-treated whole cells were added to a final concentration of OD 600 = approximately 20. The reaction was carried out in a water bath shaker at 70 °C for 46 h, and samples were taken for high performance liquid chromatography (HPLC) analysis. As HPLC detection conditions, chromatography column Bio-Rad HPX-87H; flow rate 0.6 mL / min; column temperature 60 °C; detector was a differential refractive index detector; injection volume was 20 μL.

[0080] A total of 3 parallel repeated experiments were carried out, and the curve of the change in the yield of tagatose with reaction time is shown in Fig. 8. After reacting in a water bath shaker at 70 °C for 46 h, the results of the test by HPLC showed that the yield of tagatose reached 50 g / L and the yield reached 50%.

[0081] Example 9 Preparation of Tagatose from Starch by Catalysis of Whole Cell Mixture The whole cells expressing thermostable α-glucan phosphorylase, thermostable phosphoglucomutase, thermostable phosphoglucose isomerase, thermostable tagatose 6-phosphate epimerase, and thermostable tagatose 6-phosphate phosphatase, prepared in Example 7, were each washed once with 50 mM Tris-HCl buffer (pH 7.5), centrifuged at 5500 rpm for 10 min, the supernatant was discarded, and 50 mM sodium phosphate buffer (pH 7.5) was added to the precipitate, and the bacterial cells were subjected to OD (Oxygen Dissociation). 600 The cells were resuspended to a concentration of approximately 300. The resuspended cells were heat-treated at 75°C for 90 minutes.

[0082] To a 1L reaction system, add 100g / L starch at a final concentration, 50mM sodium phosphate buffer (pH 7.5), and the four types of heat-treated whole cells mentioned above, and perform OD (Oxygen-Drug Reaction). 600 The ratio of cells expressing thermostable α-glucan phosphorylase, thermostable phosphoglucomutase, thermostable phosphoglucose isomerase, thermostable tagatose 6-phosphate epimerase, and thermostable tagatose 6-phosphate phosphatase was set to approximately 20, with a total addition ratio of 1:1:1:1:1. The mixture was reacted for 46 hours in a 70°C water bath shaker, and samples were taken for HPLC analysis. A total of three parallel duplicate experiments were performed, with the HPLC detection conditions being the same as in Example 8. After reacting for 46 hours in a 70°C water bath shaker, the HPLC test results showed that the yield of tagatose reached 73 g / L, and the yield reached 73%.

[0083] Example 10 Preparation of tagatose from starch by catalytic action of immobilized whole cells Permeable whole cells co-expressing thermostable α-glucan phosphorylase, thermostable phosphoglucumutase, thermostable phosphoglucose isomerase, thermostable tagatose 6-phosphate epimerase, and thermostable tagatose 6-phosphate phosphatase were resuspended in 1 L of sodium phosphate buffer (pH 7.0), and OD was performed. 600The mixture was diluted to approximately 400 ml, 1 g of montmorillonite was added, and the mixture was uniformly stirred. 40 ml of 5% (w / v) polyethyleneimine aqueous solution was added and agglomerated at room temperature, and 20 ml of 50% glutaraldehyde aqueous solution was added and crosslinked at room temperature for 3 hours. Subsequently, a filtration cake layer was obtained by suction filtration, the filtration cake was washed with deionized water and then extruded to prepare particles, which were dried to obtain immobilized whole cells.

[0084] To 1 L of the reaction system, add 100 g / L starch at a final concentration, 50 mM sodium phosphate buffer (pH 7.5), and immobilized whole cells, respectively, and then OD 600 The reaction was carried out in a 70°C water bath shaker with a concentration of approximately 20. After the reaction was complete, the reaction solution was centrifuged at 4°C, and the tagatose content was analyzed by high-performance liquid chromatography (HPLC). The immobilized particles were collected, washed with buffer, and the reaction was carried out for the next lot. The experimental results are shown in Figure 9. The results show that in the process of producing tagatose from starch by catalytic action of immobilized whole cells, the yield of the predetermined product reached a maximum of 50%, and as the number of lots of continuous catalytic reactions increased, the yield of the product gradually decreased, and even after 50 lots of continuous catalytic reactions, the yield of the product was maintained at approximately 36%.

[0085] Example 11 Preparation of tagatose from starch by catalytic action of immobilized whole cell mixture Using 1 L sodium phosphate buffer (pH 7.0), permeable whole cells expressing thermostable α-glucan phosphorylase, permeable whole cells expressing thermostable phosphoglucumutase, permeable whole cells expressing thermostable phosphoglucose isomerase, permeable whole cells expressing thermostable tagatose 6-phosphate epimerase, and permeable whole cells expressing thermostable tagatose 6-phosphate phosphatase were resuspended in a ratio of 1:1:1:1:1, and OD was performed. 600The mixture was diluted to approximately 300, and 0.8 g of montmorillonite was added and mixed uniformly. 35 ml of 5% (w / v) polyethyleneimine aqueous solution was added and agglomerated at room temperature, and 18 ml of 50% glutaraldehyde aqueous solution was added and crosslinked at room temperature for 3 hours. Subsequently, a filtration cake layer was obtained by suction filtration, the filtration cake was washed with deionized water and then extruded to prepare particles, which were dried to obtain an immobilized whole cell mixture.

[0086] To 1 L of the reaction system, add 100 g / L starch at a final concentration, 50 mM sodium phosphate buffer (pH 7.5), and immobilized whole cells, respectively, and then OD 600 The reaction was carried out in a 70°C water bath shaker with a concentration of approximately 20. After the reaction was complete, the reaction solution was centrifuged at 4°C, and the tagatose content was analyzed by high-performance liquid chromatography (HPLC). The immobilized particles were collected, washed with buffer, and the reaction was carried out for the next lot. The experimental results are shown in Figure 10. From the results, it was found that in the case of 60 lots of continuous catalyst, the product yield exceeded 50% in all cases, and reached a maximum of over 73%. The experimental results are shown in Figure 10. From the results, it was found that when an immobilized whole cell mixture was continuously catalyzed, the initial product yield reached a maximum of over 73%, and as the continuous catalytic reaction progressed, the product yield gradually decreased, and even after 60 lots of continuous catalyst, the product yield was maintained at 52%.

Claims

1. A genetically engineered strain of Bacillus subtilis that produces tagatose, The aforementioned genetically engineered bacteria include the α-glucan phosphorylase gene, the phosphoglucomutase gene, the phosphoglucose isomerase gene, the tagatose-6-phosphate epimerase gene, and the tagatose-6-phosphate phosphatase gene. The genetically engineered bacillus subtilis is characterized by being a bacillus subtilis genetically engineered bacillus subtilis co-expressing the phosphatase gene, or a mixture of bacillus subtilis genetically engineered bacillus subtilis expressing the α-glucan phosphorylase gene, phosphoglucum commutase gene, phosphoglucose isomerase gene, tagatose 6-phosphate epimerase gene, and tagatose 6-phosphate phosphatase gene, respectively.

2. The genetically engineered bacterium according to claim 1, characterized in that the starting strain of Bacillus subtilis is a Bacillus subtilis strain in which protease has been knocked out.

3. The genetically engineered bacteria are characterized by containing an expression vector that co-expresses α-glucan phosphorylase, phosphoglucumutase, phosphoglucose isomerase, tagatose 6-phosphate epimerase, and tagatose 6-phosphate phosphatase, or by being a mixture of genetically engineered bacteria containing an α-glucan phosphorylase expression vector, genetically engineered bacteria containing a phosphoglucum isomerase expression vector, genetically engineered bacteria containing a tagatose 6-phosphate epimerase expression vector, and genetically engineered bacteria containing a tagatose 6-phosphate phosphatase expression vector. The genetically engineered bacterium according to claim 1.

4. The α-glucan phosphorylase, phosphoglucumutase, phosphoglucose isomerase, tagatose 6-phosphate epimerase, and tagatose 6-phosphate phosphatase are characterized in that they are, respectively, heat-stable α-glucan phosphorylase, heat-stable phosphoglucumutase, heat-stable phosphoglucose isomerase, heat-stable tagatose 6-phosphate epimerase, and heat-stable tagatose 6-phosphate phosphatase. The genetically engineered bacterium according to claim 1.

5. The aforementioned heat resistance is characterized by having enzyme activity at temperatures of 40°C or higher. The genetically engineered bacterium according to claim 4.

6. The endogenous uracil phosphoribosyltransferase gene, α-amylase gene, and spore-forming RNA polymerase σ in the aforementioned genetically engineered bacteria. Ｆ A genetically engineered bacterium according to any one of claims 1 to 5, characterized in that all factor genes and the surfactant synthase subunit 3 gene are inactivated or knocked out.

7. An expression vector, The expression vector is characterized by containing genes for α-glucan phosphorylase, phosphoglucumutase, phosphoglucose isomerase, tagatose 6-phosphate epimerase, and tagatose 6-phosphate phosphatase, and being capable of co-expressing these genes.

8. A method for preparing and producing tagatose from starch by catalytic action of whole cells (whole cells) of a genetically engineered bacterium according to any one of claims 1 to 6, Step (1) involves fermenting the engineered strain of Bacillus subtilis to obtain whole cells, Step (2) involves treating all Bacillus subtilis cells obtained in step (1) to make the cell membrane permeable, thereby obtaining permeable whole cells. A method comprising step (3) preparing tagatose from starch by catalytic action of permeable whole cells obtained in step (2), using the co-expressing type of engineered Bacillus subtilis whole cells as is for catalytic action, and mixing the engineered Bacillus subtilis whole cells that express various enzymes individually for catalytic action.

9. The further step involves immobilizing the permeable whole cells of Bacillus subtilis obtained in step (2) to obtain immobilized whole cells or a mixture of immobilized whole cells, which are then used for catalytic action. The method according to claim 8.

10. The preparation of all cells in step (1) is characterized by being carried out by a fermentation method suitable for the expression of foreign proteins. The method according to claim 8.

11. The cell membrane permeability treatment in step (2) is characterized by being carried out by heat treatment, the addition of an organic solvent and / or a surfactant. The method according to claim 8.

12. The organic solvent is selected from acetone and acetonitrile, and the surfactant is selected from cetyltrimethylammonium bromide and Tween-80. The method according to claim 11.

13. The heat treatment temperature is 45 to 100°C, the heat treatment time is 10 to 100 min, and the cell concentration during treatment is OD ６００ The characteristic is that it is between 10 and 300. The method according to claim 11.

14. The heat treatment temperature is 70-80°C, the heat treatment time is 50-70 min, and the cell concentration during treatment is OD ６００ The characteristic is that it is between 30 and 150. The method according to claim 13.

15. The heat treatment is characterized by being carried out using a buffer selected from HEPES buffer, phosphate buffer, Tris buffer, and acetate buffer. The method according to claim 11.

16. In the catalytic reaction system of step (3) described above, the concentration of the substrate starch is 50 to 300 g / L, and the reaction conditions are characterized by a pH of 5.0 to 8.0, a temperature of 40 to 80°C, and a reaction period of 0.5 to 96 hours. The method according to claim 8.

17. In the catalytic reaction system of step (3) described above, the concentration of the substrate starch is 100 to 200 g / L, and the reaction conditions are characterized by a pH of 6.5 to 7.5 and a reaction carried out at 45 to 75°C for 12 to 60 hours. The method according to claim 16.

18. The catalytic reaction in step (3) is carried out using a buffer selected from HEPES buffer, phosphate buffer, Tris buffer, and acetate buffer. The method according to claim 8.

19. In the case of permeable whole cells of Bacillus subtilis expressing various enzymes, the mixture is characterized by being a mixture of permeable whole cells expressing α-glucan phosphorylase, permeable whole cells expressing phosphoglucum tase, permeable whole cells expressing phosphoglucose isomerase, permeable whole cells expressing tagatose 6-phosphate epimerase, and permeable whole cells expressing tagatose 6-phosphate phosphatase in the ratio of (0.1-10):(0.1-10):(0.1-10):(0.1-10):(0.1-10). The method according to claim 8.

20. The method for immobilizing permeable whole cells is characterized by resuspending the permeable whole cells in sodium phosphate or potassium phosphate buffer, adding inorganic soil and stirring uniformly, then adding polyethyleneimine aqueous solution to cause aggregation, then adding a crosslinking agent to crosslink, then suction filtration to obtain a filtration cake layer, washing the filtration cake with deionized water and extruding it to prepare particles, drying to obtain immobilized whole cells. The method according to claim 9.

21. The inorganic soil is selected from montmorillonite, diatomaceous earth, kaolin, and bentonite, and the crosslinking agent is selected from glutaraldehyde, trihydroxymethylphosphine, N,N-methylenebisacrylamide, epichlorohydrin, and genipin. The method according to claim 20.

Images