Nolatiliol synthesis-related enzymes and nolatiliol synthesis method

By identifying enzymes like oxidoreductase DgmA, C-glucosidase complex DgmBC, and hydratase DgmG, the synthesis of noratiliol from mangiferin is enabled, addressing its scarcity and facilitating its industrial production for pharmaceutical applications.

JP2026055036APending Publication Date: 2026-03-30DAICEL CORP
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-09-17
Publication Date
2026-03-30

AI Technical Summary

Technical Problem

The scarcity of noratiliol in nature and the lack of identified enzymes for its synthesis from mangiferin hinder its industrial application, particularly for its potential as an antidiabetic and anticancer agent.

Method used

Identification of enzymes such as oxidoreductase DgmA, C-glucosidase complex DgmBC, and hydratase DgmG, which facilitate the conversion of mangiferin to noratiliol through specific biochemical pathways, including the production of intermediates and cofactors.

Benefits of technology

Enables the industrial production of noratiliol, leveraging the identified enzymes to enhance its availability and efficacy as a pharmaceutical agent.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026055036000005
    Figure 2026055036000005
  • Figure 2026055036000006
    Figure 2026055036000006
  • Figure 2026055036000007
    Figure 2026055036000007
Patent Text Reader

Abstract

This disclosure aims to provide a group of enzymes involved in the synthesis of nolatiliol from mangiferin. [Solution] The enzyme group of this disclosure includes: oxidoreductase DgmA and oxidoreductase DgmF which produce an intermediate (3-oxo-mangiferin) using mangiferin as a substrate; C-glucosidase complex DgmBC which produces nolatiliol using the intermediate (3-oxo-mangiferin) as a substrate; and hydratase DgmG which produces a cofactor (3-oxo-D-glucose) of oxidoreductase DgmA using a byproduct (1,5-anhydro-D-erythro-hexa-1-ene-3-urose) from the C-glucosidase complex DgmBC as a substrate.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] This invention relates to a noratiliolu synthesis-related enzyme involved in the synthesis pathway of noratiliolu from mangiferin, and to a method for synthesizing noratiliolu. [Background technology]

[0002] Mangiferin is a C-glycoside of xanthones found in plants belonging to families such as Anacardiaceae, Gentianaceae, Iridaceae, and Liliaceae. Mangiferin has been reported to possess physiological activities such as anti-inflammatory, anti-obesity, and angiogenic effects.

[0003] According to Non-Patent Literature 1, it has been reported that noratiliolule, the aglycone of mangiferin, has different physiological activity properties from mangiferin. Specifically, it has been reported that noratiliolule has higher efficacy than mangiferin as an antidiabetic and anticancer agent (for breast cancer, colon cancer, and lung cancer), and that noratiliolule has antidiabetic effects, antihyperuricemia effects, and effects that counteract hepatic lipid metabolism disorders. [Prior art documents] [Non-patent literature]

[0004] [Non-Patent Document 1] Bioscience, Biotechnology, and Biochemistry, 2021, Vol. 85, No. 4, 989-997 [Overview of the project] [Problems that the invention aims to solve]

[0005] While mangiferin is readily available in nature, noratiliol is highly rare. Therefore, a technology for efficiently converting mangiferin to noratiliol is desired. Currently, the only methods for producing noratiliol from mangiferin are organic synthesis or the use of specific microorganisms capable of producing noratiliol. The enzymes involved in the synthesis of noratiliol from mangiferin remain unknown, hindering its application to industrial production.

[0006] Therefore, this disclosure aims to provide a group of enzymes involved in the synthesis of nolatiliol from mangiferin. [Means for solving the problem]

[0007] As a result of diligent research, the inventors have identified the following enzymes involved in the synthesis of nolatiliol from mangiferin: oxidoreductase DgmA and oxidoreductase DgmF, which use mangiferin as a substrate to produce an intermediate (3-oxo-mangiferin); C-glucosidase complex DgmBC, which uses the intermediate (3-oxo-mangiferin) as a substrate to produce nolatiliol; and hydratase DgmG, which uses a by-product (1,5-anhydro-D-erythro-hexa-1-ene-3-urose) from C-glucosidase complex DgmBC as a substrate to produce a cofactor (3-oxo-D-glucose) for oxidoreductase DgmA. This disclosure is the result of further research based on this finding. That is, this disclosure provides the invention in the following embodiments.

[0008] Item 1. Oxidoreductase DgmA having the following properties (A1): (A1) Using 3-oxo-D-glucose as a cofactor, 3-oxo-mangiferin is produced from mangiferin. Item 2. The oxidoreductase DgmA described in Item 1 further possesses the properties of (A2) to (A6) below: (A2) It acts at pH 5.0 to 9.0; (A3) It works at temperatures between 15°C and 55°C; (A4) The optimal pH is 7.0 to 8.5; (A5) The optimal temperature is 25°C to 50°C: (A6) The molecular weight measured by SDS-PAGE is between 37,000 and 45,000. Item 3. Oxidoreductase DgmA according to item 1 or 2, comprising a polypeptide shown in any of (AI) to (A-III) below: (AI) A polypeptide consisting of the amino acid sequence shown in Sequence ID No. 1, (A-II) A polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, added, inserted, or deleted in the amino acid sequence shown in Sequence ID No. 1, (A-III) A polypeptide consisting of an amino acid sequence with 80% or more sequence identity to the amino acid sequence shown in Sequence ID No. 1.

[0009] Section 4. C-glucosidase complex DgmBC having the following properties (BC1): (BC1)3-oxo-mangiferin is used to produce nolatiliol. Item 5. The C-glucosidase complex DgmBC described in Item 4, further possessing the properties of (BC6) below: (BC6) A combination of molecular weights measured by SDS-PAGE between 13,000 and 16,000 and 35,000 and 42,000. Item 6. The C-glucosidase complex DgmBC described in Item 4 or 5, comprising subunit B consisting of a polypeptide shown in any of (BI) to (B-III) below, and subunit C consisting of a polypeptide shown in any of (CI) to (C-III) below: (BI) A polypeptide consisting of the amino acid sequence shown in Sequence ID No. 2, (B-II) A polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, added, inserted, or deleted in the amino acid sequence shown in Sequence ID No. 2, (B-III) Polypeptides consisting of amino acid sequences with 80% or more sequence identity to the amino acid sequence shown in Sequence ID No. 2, (CI) A polypeptide consisting of the amino acid sequence shown in Sequence ID No. 3, (C-II) A polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, added, inserted, or deleted in the amino acid sequence shown in Sequence ID No. 3, (C-III) A polypeptide consisting of an amino acid sequence with 80% or more sequence identity to the amino acid sequence shown in Sequence ID No. 3.

[0010] Section 7. Oxidoreductase DgmF having the following properties (F1): (F1) Dihydroxyacetone phosphate acts as a cofactor and has the activity to catalyze the reaction from mangiferin to 3-oxo-mangiferin. Item 8. Oxidoreductase DgmF described in Item 7, further possessing the properties of (F2) to (F6) below: (F2) Acts at pH 5.0-9.0; (F3) Acts at temperatures between 15°C and 50°C; (F4) The optimal pH is 6.0 to 8.0; (F5) The optimal temperature is 30°C to 42°C; (F6) The molecular weight measured by SDS-PAGE is between 37,000 and 45,000. Item 9. Oxidoreductase DgmF according to item 7 or 8, comprising a polypeptide shown in any of (FI) to (F-III) below: (FI) A polypeptide consisting of the amino acid sequence shown in Sequence ID No. 4, (F-II) A polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, added, inserted, or deleted in the amino acid sequence shown in Sequence ID No. 4, (F-III) A polypeptide consisting of an amino acid sequence with 80% or more sequence identity to the amino acid sequence shown in Sequence ID No. 4.

[0011] Item 10. Hydratase DgmG having the following properties (G1): (G1) 3-oxo-D-glucose is produced from 1,5-anhydro-D-erythro-hexa-1-ene-3-urouse. Item 11. Hydratase DgmG described in Item 10, further having the property of (G6) below: (G6) The molecular weight measured by SDS-PAGE is between 34,000 and 41,000. Item 12. Hydratase DgmG as described in item 10 or 11, comprising a polypeptide shown in any of the following (GI) to (G-III): (GI) A polypeptide consisting of the amino acid sequence shown in Sequence ID No. 5, (G-II) A polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, added, inserted, or deleted in the amino acid sequence shown in Sequence ID No. 5, (G-III) A polypeptide consisting of an amino acid sequence with 80% or more sequence identity to the amino acid sequence shown in Sequence ID No. 5.

[0012] Item 13. A polynucleotide encoding the oxidoreductase DgmA described in Item 3. Item 14. A polynucleotide encoding the C-glucosidase complex DgmBC as described in Item 6. Item 15. A polynucleotide encoding the oxidoreductase DgmF described in Item 9. Item 16. A polynucleotide encoding the hydratase DgmG described in Item 12.

[0013] Item 17. An expression cassette or recombinant vector comprising the polynucleotides described in Item 13. Furthermore, the expression cassette or recombinant vector described in item 17 may further contain at least one of the polynucleotides described in item 14, item 15, and item 16. Item 18. The expression cassette or recombinant vector according to Item 17, further comprising the polynucleotides described in Item 14. Item 19. The expression cassette or recombinant vector according to Item 17, further comprising the polynucleotides described in Item 16. Item 20. The expression cassette or recombinant vector according to item 17, further comprising the polynucleotides described in item 14 and the polynucleotides described in item 16.

[0014] Item 21. A transformant that is expressibly retaining the polynucleotide described in Item 13, or expressibly retaining the expression cassette or recombinant vector described in Item 17. Furthermore, the transformant of item 21 may also retain at least one of the polynucleotides described in item 13, the polynucleotide described in item 14, the polynucleotide described in item 15, and the polynucleotide described in item 16. Item 22. The transformant according to Item 21, further containing the polynucleotide described in Item 14, or the expression cassette or recombinant vector described in Item 18. Item 23. The transformant according to Item 21, further containing the polynucleotide described in Item 16, or the expression cassette or recombinant vector described in Item 19. Item 24. The transformant according to Item 21, further retaining the polynucleotides described in Item 14 and the polynucleotides described in Item 16, or retaining the expression cassette or recombinant vector described in Item 20.

[0015] Item 25. A method for producing oxidoreductase DgmA, comprising the step of culturing the transformant described in Item 21.

[0016] Item 26. An expression cassette or recombinant vector comprising the polynucleotides described in Item 14. Furthermore, the expression cassette or recombinant vector described in item 26 may further contain at least one of the polynucleotides described in item 13, item 15, and item 16. Item 27. A transformant that is expressibly retaining the polynucleotide described in Item 14, or expressibly retaining the expression cassette or recombinant vector described in Item 26. The transformant of item 27 may further retain at least one of the polynucleotides described in item 13, item 15, and item 16. Item 28. A method for producing C-glucosidase complex DgmBC, comprising the step of culturing the transformant described in Item 27.

[0017] Item 29. An expression cassette or recombinant vector comprising the polynucleotides described in Item 15. Furthermore, the expression cassette or recombinant vector described in item 29 may further contain at least one of the polynucleotides described in item 13, item 14, and item 16. Item 30. A transformant that is expressibly retaining the polynucleotide described in Item 15, or expressibly retaining the expression cassette or recombinant vector described in Item 29. Furthermore, the transformant of item 30 may also retain at least one of the polynucleotides described in item 13, item 14, and item 16. Item 31. A method for producing oxidoreductase DgmF, comprising the step of culturing the transformant described in Item 30.

[0018] Item 32. An expression cassette or recombinant vector containing the polynucleotides described in Item 16. Furthermore, the expression cassette or recombinant vector described in item 32 may also contain at least one of the polynucleotides described in item 13, item 14, and item 15. Item 33. The expression cassette or recombinant vector according to item 32, further comprising the polynucleotides described in item 14.

[0019] Item 34. A transformant that is expressibly retaining the polynucleotide described in Item 16, or expressibly retaining the expression cassette or recombinant vector described in Item 32. Furthermore, the transformant of item 34 may also retain at least one of the polynucleotides described in item 13, item 14, and item 15. Item 35. The transformant according to Item 34, which further retains the polynucleotide according to Item 14.

[0020] Item 36. A method for producing hydratase DgmG, which includes the step of culturing the transformant according to Item 34.

[0021] Item 37. A method for producing 3-oxo-mangiferin, which includes the step of treating mangiferin with at least one of the following <1

[0021] , BC > to <3 A / F >: <1 A / F > The oxidoreductase DgmA according to any one of Items 1 to 3, and / or the oxidoreductase DgmF according to any one of Items 7 to 9, <2 A / F > The transformant according to Item 21 and / or the transformant according to Item 30, <3 A / F > A processed product selected from the group consisting of resting cells, processed products with improved cell membrane permeability, cell disruption processed products, and cell-free extracts of the transformant of the above <2 A / F >. Item 38. A method for producing norathyriol, which includes the step of treating 3-oxo-mangiferin with at least one of the following <1 BC > to <3 BC >: <1 BC > The C-glucosidase complex DgmBC according to any one of Items 4 to 6, <2 BC > The transformant according to Item 27, <3 BC > A processed product selected from the group consisting of resting cells, processed products with improved cell membrane permeability, cell disruption processed products, and cell-free extracts of the transformant of the above <2 BC >. Item 39. A method for producing 3-oxo-D-glucose, which includes the step of treating 1,5-anhydro-D-erythro-hex-1-en-3-ulose with at least one of the following <1 G > to <3 G >: [[ID=​​​ <2 G >Transformed organism as described in item 34, <3 G >The above <2 G >A processed product selected from the group consisting of resting cells, cell membrane permeability-enhanced products, cell disruption products, and cell-free extracts of the transformed organism.

[0022] Item 40. Mangiferin, see below <1 A / F , BC >~<3 A / F , BC A method for producing noraciliol, comprising the step of processing in at least one of the following: <1 A / F , BC >A combination of oxidoreductase DgmA described in any of items 1-3, and / or oxidoreductase DgmF described in any of items 7-9, and C-glucosidase complex DgmBC described in any of items 4-6, <2 A / F , BC >A combination of the transformant described in item 21 and / or the transformant described in item 30 and the transformant described in item 27; or the transformant described in item 22, <3 A / F , BC >The above <2 A / F , BC >A processed product selected from the group consisting of resting cells, cell membrane permeability-enhanced products, cell disruption products, and cell-free extracts of the transformed organism. Item 41. 3-Oxo-mangiferin, as shown below <1 BC , G >~<3 BC , G A method for producing noraciliol, comprising the step of processing in at least one of the following: <1 BC , G >A combination of the C-glucosidase complex DgmBC described in any of items 4-6 and the hydratase DgmG described in any of items 10-12, <2 BC , G>A combination of the transformant described in item 27 and the transformant described in item 34; or the transformant described in item 35, <3 BC , G >The above <2 BC , G A processed product selected from the group consisting of resting cells, cell membrane permeability-enhanced products, cell disruption products, and cell-free extracts of the transformed product described above. Item 42. Mangiferin, see below <1 A / F , BC , G >~<3 A / F , BC , G A method for producing noraciliol, comprising the step of processing in at least one of the following: <1 A / F , BC , G >A combination of oxidoreductase DgmA described in any of items 1-3, and / or oxidoreductase DgmF described in any of items 7-9, C-glucosidase complex DgmBC described in any of items 4-6, and hydratase DgmG described in any of items 10-12. <2 A / F , BC , G >A combination of the transformant described in item 21 and / or the transformant described in item 30, the transformant described in item 27, and the transformant described in item 34; a combination of the transformant described in item 23 and the transformant described in item 27; a combination of the transformant described in item 21 and the transformant described in item 35; a combination of the transformant described in item 22 and the transformant described in item 34; or the transformant described in item 24, <3 A / F , BC , G >The above <2 A / F , BC , G >A processed product selected from the group consisting of resting cells, cell membrane permeability-enhanced products, cell disruption products, and cell-free extracts of the transformed organism. [Effects of the Invention]

[0023] According to this disclosure, by identifying a group of enzymes involved in the synthesis of nolatiliol from mangiferin, it becomes possible to provide a synthesis technology that contributes to the industrial production of nolatiliol. [Brief explanation of the drawing]

[0024] [Figure 1] This disclosure illustrates the xanthone C-glycoside metabolic mechanism by the noratiliolus synthesis-related enzymes. [Figure 2] The results of SDS-PAGE analysis of the noraciliol synthesis-related enzymes (DgmA, DgmBC, DgmF, DgmG) described herein are shown (Test Example 3). [Figure 3] The results of the synthesis of 3-oxo-mangiferin from mangiferin using DgmA are shown (Test Example 4-1). [Figure 4] The results of the synthesis of 3-oxo-mangiferin from mangiferin using DgmA and DgmG are shown (Test Example 4-2). [Figure 5] The results of the synthesis of noratiriol from 3-oxo-mangiferin using DgmBC are shown (Test Example 4-3). [Figure 6] The results of the synthesis of noratiriol from 3-oxo-mangiferin using DgmBC and DgmG are shown (Test Example 4-4). [Figure 7] The results of the synthesis of nolatiriol from mangiferin using DgmA and DgmBC are shown (Test Example 4-5). [Figure 8] The results of the synthesis of nolatiriol from mangiferin using DgmA, DgmBC, and DgmG are shown (Test Examples 4-6). [Figure 9] The results of synthesizing noratiriol from mangiferin in the presence of cofactors DgmA, DgmBC, and DgmG are shown (Experimental Examples 4-7). [Figure 10] The results of synthesizing noratiriol from mangiferin in the presence of cofactors DgmF and DgmBC are shown (Experimental Example 4-8). [Figure 11]The results of synthesizing noratiriol from mangiferin in the presence of cofactors DgmF, DgmBC, and dgmG are shown (Experimental Examples 4-9). [Figure 12] The results of synthesizing noraciliol from mangiferin using cell-free extracts of bacterial lysates containing all of the transformants expressing DgmA, DgmBC, DgmF, and DgmG are shown (Test Example 5). [Figure 13] The pH characteristics of DgmA are shown (Test Example 6-1). [Figure 14] The pH characteristics of DgmF are shown (Test Example 6-2). [Figure 15] The temperature characteristics of DgmA are shown (Test Example 7-1). [Figure 16] The temperature characteristics of DgmF are shown (Test Example 7-2). [Modes for carrying out the invention]

[0025] [1] Nolatiliol synthesis-related enzymes The noratiliolu synthesis-related enzymes of this disclosure refer to enzymes involved in the synthesis pathway of noratiliolu from mangiferin, and include enzymes that use mangiferin as a substrate, enzymes that produce noratiliolu, and enzymes that produce cofactors. Figure 1 shows the synthesis pathway of noratiliolu from mangiferin, the compounds (cofactors, byproducts) involved in the synthesis pathway, and the enzymes involved in each reaction. The noratiliolules synthesis-related enzymes of this disclosure include, as a group of enzymes involved in the synthesis of noratiliolules from mangiferin, oxidoreductases DgmA and DgmF that produce an intermediate (3-oxo-mangiferin) using mangiferin as a substrate; C-glucosidase complex DgmBC that produces noratiliolules using the intermediate (3-oxo-mangiferin) as a substrate; and hydratase DgmG that produces a cofactor (3-oxo-D-glucose) for oxidoreductase DgmA using a byproduct (1,5-anhydro-D-erythro-hexa-1-ene-3-urose) from C-glucosidase complex DgmBC as a substrate.

[0026] The noratiliolus synthesis-related enzymes of this disclosure are preferably derived from microorganisms belonging to the genus Hungatella, and among these, those derived from microorganisms belonging to Hungatella hathewayi are more preferably.

[0027] In the noratiliolus synthesis-related enzyme of this disclosure, the optimal pH is the pH at which the enzyme exhibits 90% or more activity when the maximum activity at the operating pH is set to 100%, and the optimal temperature is the temperature at which the enzyme exhibits 90% or more activity when the maximum activity at the operating temperature is set to 100%.

[0028] [1-1] Oxidoreductase DgmA Oxidoreductase DgmA has the following properties (A1), and preferably also has the following properties (A2) to (A6).

[0029] (A1) Using 3-oxo-D-glucose as a cofactor, mangiferin is converted to 3-oxo-mangiferin. In other words, oxidoreductase DgmA oxidizes the 3-position of the glucose moiety of mangiferin in the presence of 3-oxo-D-glucose. (A2) It works at pH 5.0 to 9.0. (A3) It works at temperatures between 15°C and 55°C. (A4) The optimal pH is 7.0 to 8.5, preferably 7.3 to 8.2. (A5) The optimal temperature is 25°C to 50°C, preferably 35°C to 47°C, and more preferably 38°C to 47°C. (A6) The molecular weight measured by SDS-PAGE is 37,000 to 45,000, preferably 39,000 to 43,000, and more preferably 41,000.

[0030] The optimal pH of oxidoreductase DgmA is determined by reacting it in a reaction solution containing mangiferin in a buffer at the working pH at 37°C for 5 minutes, and measuring the activity based on the amount of 3-oxo-mangiferin produced. The optimal temperature of oxidoreductase DgmA is determined by reacting it in a reaction solution containing mangiferin in a buffer (pH 7.4) at the working temperature for 5 minutes, and measuring the activity based on the amount of 3-oxo-mangiferin produced.

[0031] Oxidoreductase DgmA preferably consists of a polypeptide shown in any of the following (AI) to (A-III).

[0032] (AI) A polypeptide consisting of the amino acid sequence shown in Sequence ID No. 1, (A-II) A polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, added, inserted, or deleted in the amino acid sequence shown in Sequence ID No. 1, (A-III) A polypeptide consisting of an amino acid sequence with 80% or more sequence identity to the amino acid sequence shown in Sequence ID No. 1.

[0033] [Table 1]

[0034] Of the polypeptides listed above, polypeptides (A-II) and (A-III) are sequence-similar polypeptides that use the amino acid sequence of polypeptide (AI) as their basic backbone.

[0035] The amino acid modifications introduced into the polypeptide (A-II) above may include only one type of modification (e.g., substitution) from among substitution, addition, insertion, and deletion, or they may include two or more types of modifications (e.g., substitution and insertion). In the polypeptide (A-II), the number of amino acids that are substituted, added, inserted, or deleted may be one, more than one, or several, for example, 1 to 73, preferably 1 to 55, more preferably 1 to 36, 1 to 18, even more preferably 1 to 11, even more preferably 1 to 7, and particularly preferably 1 to 5, 1 to 4, 1 to 3, 1 to 2, or 1.

[0036] In the polypeptides (A-III) described above, sequence identity should be 80% or more, but preferably 85% or more, more preferably 90% or more, 95% or more, even more preferably 97% or more, even more preferably 98% or more, and particularly preferably 99% or more, and 99.5% or more.

[0037] Here, in the polypeptides (A-III) above, the sequence identity with respect to the amino acid sequence shown in SEQ ID NO: 1 refers to the sequence identity calculated by comparing it with the amino acid sequence shown in SEQ ID NO: 1. Furthermore, "sequence identity" refers to the value of amino acid sequence identity obtained by the bl2seq program (Tatiana A. Tatsusova, Thomas L. Madden, FEMS Microbiol. Lett., Vol. 174, p247-250, 1999) from BLAST PACKAGE [sgi32 bit edition, Version 2.0.12; available from National Center for Biotechnology Information (NCBI)]. The parameters should be set to Gap insertion Cost value: 11 and Gap extension Cost value: 1.

[0038] When amino acid substitutions are introduced into the polypeptides of (A-II) and (A-III) above, one type of amino acid substitution is a conservative substitution. A conservative substitution refers to the substitution between Phe, Trp, and Tyr if the substitution site is an aromatic amino acid; between Leu, Ile, and Val if the substitution site is a hydrophobic amino acid; between Gln and Asn if the substitution site is a polar amino acid; between Lys, Arg, and His if the substitution site is a basic amino acid; between Asp and Glu if the substitution site is an acidic amino acid; and between Ser and Thr if the amino acid has a hydroxyl group. Conservative substitutions include, specifically, substitutions of Ala to Ser or Thr; substitutions of Arg to Gln, His or Lys; substitutions of Asn to Glu, Gln, Lys, His or Asp; substitutions of Asp to Asn, Glu or Gln; substitutions of Cys to Ser or Ala; substitutions of Gln to Asn, Glu, Lys, His, Asp or Arg; substitutions of Glu to Gly, Asn, Gln, Lys or Asp; substitutions of Gly to Pro; substitutions of Hisn, Lys, Gln, Arg or Tyr; and substitutions of Ile to L Examples of substitutions include: substitution of eu, Met, Val, or Phe; substitution of Leu to Ile, Met, Val, or Phe; substitution of Lys to Asn, Glu, Gln, His, or Arg; substitution of Met to Ile, Leu, Val, or Phe; substitution of Phe to Trp, Tyr, Met, Ile, or Leu; substitution of Ser to Thr or Ala; substitution of Thr to Ser or Ala; substitution of Trp to Phe or Tyr; substitution of Tyr to His, Phe, or Trp; and substitution of Val to Met, Ile, or Leu.

[0039] The polypeptides described in (A-II) and (A-III) above include not only polypeptides obtained by artificial mutations such as mutagenesis and genetic recombination, but also mutant or variant polypeptides resulting from naturally occurring mutations based on individual differences or species differences in the organism from which the polypeptide originates.

[0040] [1-2] C-glucosidase complex DgmBC The C-glucosidase complex DgmBC has the following properties (BC1), and preferably also has the following properties (BC6). (BC1)3-oxo-mangiferin is used to produce nolatiliol. (BC6) A combination of subunit B with a molecular weight of 13,000 to 16,000, preferably 14,000 to 15,000, more preferably 15,000, and subunit C with a molecular weight of 35,000 to 42,000, preferably 37,000 to 40,000, more preferably 38,000, as measured by SDS-PAGE.

[0041] In other words, the C-glucosidase complex DgmBC cleaves the C-glucosidic bond of 3-oxo-mangiferin. The cleavage of the C-glucosidic bond is thought to occur when the hydrogen at position 2 of the sugar portion of 3-oxo-mangiferin is abstracted, generating an enolate ion. The phenolic hydroxyl group of the aglycone undergoes keto-enol tautomerization, causing the aglycone to become a leaving group. This elimination reaction is thought to produce noratiriol and 1,5-anhydro-D-erythro-hexa-1-ene-3-uros.

[0042] The C-glucosidase complex DgmBC consists of two subunits. Preferably, the C-glucosidase complex DgmBC consists of subunit B, which is made up of a polypeptide shown in any of (BI) to (B-III) below, and subunit C, which is made up of a polypeptide shown in any of (CI) to (C-III) below.

[0043] (BI) A polypeptide consisting of the amino acid sequence shown in Sequence ID No. 2, (B-II) A polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, added, inserted, or deleted in the amino acid sequence shown in Sequence ID No. 2, (B-III) Polypeptides consisting of amino acid sequences with 80% or more sequence identity to the amino acid sequence shown in Sequence ID No. 2, (CI) A polypeptide consisting of the amino acid sequence shown in Sequence ID No. 3, (C-II) A polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, added, inserted, or deleted in the amino acid sequence shown in Sequence ID No. 3, (C-III) A polypeptide consisting of an amino acid sequence with 80% or more sequence identity to the amino acid sequence shown in Sequence ID No. 3.

[0044] [Table 2]

[0045] Of the polypeptides listed above, those with branch numbers "-II" and "-III" are polypeptides with a similar sequence to the polypeptide with branch number "-I," using its amino acid sequence as the basic backbone.

[0046] The amino acid modifications introduced into the polypeptides designated with the branch number "-II" above may include only one type of modification (e.g., substitution) from among substitution, addition, insertion, and deletion, or they may include two or more types of modifications (e.g., substitution and insertion). In the polypeptide of (B-II), the amino acids that are substituted, added, inserted, or deleted may be one, more than one, or several, for example, 1 to 26, preferably 1 to 19, more preferably 1 to 13, 1 to 10, even more preferably 1 to 6, even more preferably 1 to 5, and particularly preferably 1 to 4, 1 to 3, 1 to 2, or 1. In the (C-II) polypeptide, the amino acids that are substituted, added, inserted, or deleted may be one, more than one, or several, for example, 1 to 66, preferably 1 to 50, more preferably 1 to 33, 1 to 16, even more preferably 1 to 10, even more preferably 1 to 6, and particularly preferably 1 to 5, 1 to 4, 1 to 3, 1 to 2, or 1.

[0047] In the polypeptides designated with the branch number "-III" above, sequence identity should be 80% or more, but preferably 85% or more, more preferably 90% or more, 95% or more, even more preferably 97% or more, even more preferably 98% or more, and especially preferably 99% or more, 99.5% or more.

[0048] Here, in polypeptides with the branch number "-III" mentioned above, the sequence identity with respect to the amino acid sequences shown in SEQ ID NOs. 2 and 3, respectively, is the sequence identity calculated by comparing them with the amino acid sequences shown in SEQ ID NOs. Furthermore, "sequence identity" is as described in "1-1. Oxidoreductase DgmA" above.

[0049] When amino acid substitutions are introduced into polypeptides designated with the branch numbers "-II" and "-III" above, one type of amino acid substitution is a conservative substitution. Conservative substitutions are as described in "1-1. Oxidoreductase DgmA" above.

[0050] The polypeptides designated with the sub-numbers "-II" and "-III" above include not only polypeptides obtained through artificial mutations such as mutagenesis and genetic recombination, but also mutant or variant polypeptides resulting from naturally occurring mutations based on individual differences or species differences in the organisms from which the polypeptides originate.

[0051] [1-3] Oxidoreductase DgmF Oxidoreductase DgmF has the following properties (F1), and preferably also has the following properties (F2) and (F3), (F4) and (F5), and / or (F6).

[0052] (F1) Dihydroxyacetone phosphate acts as a cofactor and has the activity to catalyze the reaction of mangiferin to 3-oxo-mangiferin. In other words, oxidoreductase DgmF oxidizes the 3-position of the glucose moiety of mangiferin in the presence of dihydroxyacetone phosphate. (F2) It works at pH 5.0 to 9.0. (F3) Acts at temperatures between 15°C and 50°C. (F4) The optimal pH is 6.0 to 8.0, preferably 6.2 to 7.5, and more preferably 6.2 to 7.0. (F5) The optimal temperature is 30°C to 42°C, preferably 35°C to 42°C. (F6) Molecular weight measured by SDS-PAGE is 37,000 to 45,000, preferably 39,000 to 43,000, more preferably 41,000.

[0053] The optimal pH of oxidoreductase DgmF is determined by reacting it in a reaction solution containing mangiferin in a buffer at the working pH at 37°C for 5 minutes, and measuring the activity based on the amount of 3-oxo-mangiferin produced. The optimal temperature of oxidoreductase DgmF is determined by reacting it in a reaction solution containing mangiferin in a buffer (pH 7.4) at the working temperature for 5 minutes, and measuring the activity based on the amount of 3-oxo-mangiferin produced.

[0054] Oxidoreductase DgmF preferably consists of a polypeptide shown in any of the following (FI) to (F-III).

[0055] (FI) A polypeptide consisting of the amino acid sequence shown in Sequence ID No. 4, (F-II) A polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, added, inserted, or deleted in the amino acid sequence shown in Sequence ID No. 4, (F-III) A polypeptide consisting of an amino acid sequence with 80% or more sequence identity to the amino acid sequence shown in Sequence ID No. 4.

[0056] [Table 3]

[0057] Of the polypeptides listed above, polypeptides (F-II) and (F-III) are sequence-similar polypeptides that use the amino acid sequence of polypeptide (FI) as their basic backbone.

[0058] The amino acid modifications introduced into the polypeptide (F-II) above may include only one type of modification (e.g., substitution) from among substitution, addition, insertion, and deletion, or they may include two or more types of modifications (e.g., substitution and insertion). In the polypeptide (F-II), the number of amino acids that are substituted, added, inserted, or deleted may be one, more than one, or several, for example, 1 to 71, preferably 1 to 53, more preferably 1 to 35, 1 to 17, even more preferably 1 to 10, even more preferably 1 to 7, particularly preferably 1 to 5, 1 to 4, 1 to 3, 1 to 2, or 1.

[0059] In the polypeptide (F-III) described above, sequence identity should be 80% or more, but preferably 85% or more, more preferably 90% or more, 95% or more, even more preferably 97% or more, even more preferably 98% or more, and especially preferably 99% or more, 99.5% or more.

[0060] Here, in the polypeptide (F-III) described above, the sequence identity with respect to the amino acid sequence shown in SEQ ID NO: 4 is the sequence identity calculated by comparing it with the amino acid sequence shown in SEQ ID NO: 1. Furthermore, "sequence identity" is as described above in "1-1. Oxidoreductase DgmA".

[0061] When amino acid substitutions are introduced into the polypeptides (F-II) and (F-III) described above, conservative substitutions are one type of amino acid substitution. Conservative substitutions are as described in "1-1. Oxidoreductase DgmA" above.

[0062] The polypeptides described in (F-II) and (F-III) above include not only polypeptides obtained by artificial mutations such as mutagenesis and genetic recombination, but also mutant or variant polypeptides resulting from naturally occurring mutations based on individual differences or species differences in the organism from which the polypeptide originates.

[0063] [1-4] Hydratase DgmG Hydratase DgmG has the following properties (G1), and preferably the following properties (G6). (G1) 3-oxo-D-glucose is produced from 1,5-anhydro-D-erythro-hexa-1-ene-3-urouse. (G6) Molecular weight measured by SDS-PAGE is 34,000 to 41,000, preferably 36,000 to 40,000, more preferably 38,000.

[0064] 1,5-anhydro-D-erythro-hexa-1-ene-3-urose is a byproduct produced when the C-glucosidase complex DgmBC deglycosides 3-oxo-mangiferin to produce noralithiol. Furthermore, 3-oxo-D-glucose is a cofactor used by oxidoreductase DgmA to produce 3-oxo-mangiferin from mangiferin. In other words, hydratase DgmG increases the productivity of noralithiol by adding H2O to 1,5-anhydro-D-erythro-hexa-1-ene-3-urose, a sugar byproduct of the reaction of the C-glucosidase complex DgmBC, thereby generating 3-oxo-D-glucose, a cofactor for oxidoreductase DgmA. This cycle of xanthone metabolism is then rotated, improving the productivity of noralithiol. Furthermore, the conversion of sugar byproducts by hydratase DgmG inhibits the reverse reaction of the C-glucosidic bond cleavage reaction by the C-glucosidase complex DgmBC (i.e., the reaction in which the sugar byproduct binds to nolarithiol and returns to 3-oxo-mangiferin), thereby improving the productivity of nolarithiol.

[0065] Hydratase DgmG preferably consists of a polypeptide shown in any of the following (GI) to (G-III). (GI) A polypeptide consisting of the amino acid sequence shown in Sequence ID No. 5, (G-II) A polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, added, inserted, or deleted in the amino acid sequence shown in Sequence ID No. 5, (G-III) A polypeptide consisting of an amino acid sequence with 80% or more sequence identity to the amino acid sequence shown in Sequence ID No. 5.

[0066] [Table 4]

[0067] Of the polypeptides listed above, polypeptides (G-II) and (G-III) are sequence-similar polypeptides that use the amino acid sequence of polypeptide (GI) as their basic backbone.

[0068] The amino acid modifications introduced into the polypeptide (G-II) above may include only one type of modification (e.g., substitution) from among substitution, addition, insertion, and deletion, or they may include two or more types of modifications (e.g., substitution and insertion). In the polypeptide (G-II), the number of amino acids that are substituted, added, inserted, or deleted may be one, more than one, or several, for example, 1 to 66, preferably 1 to 49, more preferably 1 to 33, 1 to 16, even more preferably 1 to 9, even more preferably 1 to 6, and particularly preferably 1 to 5, 1 to 4, 1 to 3, 1 to 2, or 1.

[0069] In the polypeptide (G-III) described above, sequence identity should be 80% or more, but preferably 85% or more, more preferably 90% or more, 95% or more, even more preferably 97% or more, even more preferably 98% or more, and especially preferably 99% or more, 99.5% or more.

[0070] Here, in the polypeptide (G-III) described above, the sequence identity with respect to the amino acid sequence shown in SEQ ID NO: 5 is the sequence identity calculated by comparing it with the amino acid sequence shown in SEQ ID NO: 1. Furthermore, "sequence identity" is as described above in "1-1. Oxidoreductase DgmA".

[0071] When amino acid substitutions are introduced into the polypeptides (G-II) and (G-III) described above, one type of amino acid substitution is a conservative substitution. Conservative substitutions are as described in "1-1. Oxidoreductase DgmA" above.

[0072] The polypeptides described in (G-II) and (G-III) above include not only polypeptides obtained by artificial mutations such as mutagenesis and genetic recombination, but also mutant or variant polypeptides resulting from naturally occurring mutations based on individual differences or species differences in the organism from which the polypeptide originates.

[0073] [2] Polynucleotides The polynucleotides of this disclosure are polynucleotides that encode the amino acid sequences of each noratiliolu synthesis-related enzyme shown in "[1] Noratiliolu synthesis-related enzymes" above. Those skilled in the art can appropriately design and prepare the sequences of the polynucleotides of this disclosure according to the amino acid sequences of each noratiliolu synthesis-related enzyme shown in "[1] Noratiliolu synthesis-related enzymes".

[0074] [2-1] Base sequence The polynucleotides of this disclosure include a variety of polynucleotides derived from codon degeneracy. Furthermore, the base sequences of the polynucleotides of this disclosure are preferably optimized for the host in terms of codon utilization frequency.

[0075] Examples of polynucleotides of this disclosure include the DNA shown in (ai) or (a-ii) below, the DNA shown in (bi) or (b-ii) below, the DNA shown in (ci) or (c-ii) below, the DNA shown in (fi) or (f-ii) below, or the DNA shown in (gi) or (g-ii) below.

[0076] (ai) DNA consisting of the base sequence shown in Sequence ID No. 6 or 7, (a-ii) DNA that hybridizes under stringent conditions with DNA consisting of the base sequence shown in SEQ ID NO: 6 or 7 and encodes a polypeptide having the properties of (A1) above, (bi) DNA consisting of the base sequence shown in Sequence ID No. 8 or 9, (b-ii) DNA encoding a polypeptide that hybridizes under stringent conditions with DNA consisting of the base sequence shown in SEQ ID NO: 8 or 9, and forms a complex having the properties of (BC1) with a polypeptide shown in any of (CI) to (C-III) above. (ci) DNA consisting of the base sequence shown in Sequence ID No. 10 or 11, (c-ii) DNA encoding a polypeptide that hybridizes under stringent conditions with DNA consisting of the base sequence shown in SEQ ID NO: 10 or 11, and forms a complex having the properties of (BC1) with a polypeptide shown in any of (BI) to (B-III) above. (fi) DNA consisting of the base sequence shown in Sequence ID No. 12 or 13, (f-ii) DNA that hybridizes under stringent conditions with DNA consisting of the base sequence shown in Sequence ID No. 12 or 13 and encodes a polypeptide having the properties of (F1) above, (gi) DNA consisting of the base sequence shown in SEQ ID NO: 14 or 15, (g-ii) DNA that hybridizes under stringent conditions with DNA consisting of the base sequence shown in SEQ ID NO: 14 or 15, and encodes a polypeptide having the properties of (G1) above.

[0077] The nucleotide sequences shown in SEQ ID NOs: 6, 8, 10, 12, and 14 encode the amino acid sequences shown in SEQ ID NOs: 1, 2, 3, 4, and 5, respectively, while the nucleotide sequences shown in SEQ ID NOs: 7, 9, 11, 13, and 15 are the nucleotide sequences shown in SEQ ID NOs: 6, 8, 10, 12, and 14, respectively, with the codon usage frequencies optimized for Escherichia coli.

[0078] In the case of the polynucleotides listed above, the "stringent conditions" for DNA with the branch number "-ii" refer to the conditions under which the DNA is incubated at 50°C to 65°C for 4 hours to overnight in 6×SSC (1×SSC is 0.15M NaCl, 0.015M sodium citrate, pH 7.0) containing 0.5% SDS, 5×Denhartz's [Denhartz's, 0.1% bovine serum albumin (BSA), 0.1% polyvinylpyrrolidone, 0.1% Ficol 400] and 100 μg / ml salmon sperm DNA.

[0079] Hybridization under stringent conditions is specifically performed by the following method: A nylon membrane immobilizing a DNA library or cDNA library is prepared, and the nylon membrane is blocked at 65°C in a pre-hybridization solution containing 6×SSC, 0.5% SDS, 5×Denharts, and 100 μg / ml salmon sperm DNA. Then, 32 Each probe labeled with P is added and incubated overnight at 65°C. After washing this nylon membrane in 6×SSC for 10 minutes at room temperature, in 2×SSC containing 0.1% SDS for 10 minutes at room temperature, and in 0.2×SSC containing 0.1% SDS for 30 minutes at 45°C, autoradiography can be performed to detect DNA that specifically hybridizes with the probe.

[0080] [2-2] Preparation of polynucleotides A method for preparing the polynucleotides of this disclosure is the hybridization-based method described below.

[0081] First, DNA obtained from a suitable gene source is linked to plasmids or phage vectors according to standard procedures to create a DNA library. This library is introduced into a suitable host, and the resulting transformants are cultured on a plate. The grown colonies or plaques are transferred to a nitrocellulose or nylon membrane, and after denaturation treatment, the DNA is immobilized on the membrane. This membrane is then prepared in advance. 32 Hybridization is performed in a solution of the above composition containing a probe labeled with P, etc., while maintaining the temperature under the above stringent conditions.

[0082] After hybridization is complete, nonspecifically adsorbed probes are washed away, and clones that have formed hybrids with the probes are identified by autoradiography or other methods. This procedure is repeated until hybrid-forming clones can be isolated. Finally, from the obtained clones, the gene encoding the polypeptide with the desired enzyme activity is selected. Gene isolation can be performed by known polynucleotide extraction methods such as the alkaline method.

[0083] The polynucleotides of this disclosure can also be isolated from microorganisms belonging to the genus Hungatella, preferably from microorganisms belonging to Hungatella hathewayi. For example, the target DNA can be isolated from the genome of the microorganism by PCR or hybridization using the genomic DNA of the microorganism as a template and primers or probes designed based on amino acid sequence information considering gene degeneracy, or primers or probes designed based on base sequence information.

[0084] The polynucleotides of this disclosure include a variety of polynucleotides derived from codon degeneracy. It is readily possible to artificially create a variety of polynucleotides encoding the same amino acid sequence using known genetic engineering techniques. For example, in the production of a genetically engineered protein, if the codons used in the original gene encoding the target protein are infrequently used in the host, the protein expression level may be low. In such cases, high expression of the target protein can be achieved by optimizing the codon utilization frequency for the host without altering the encoded amino acid sequence.

[0085] Methods for introducing mutations into genes and artificially modifying amino acid sequences include known techniques such as the Kunkel method and the Gapped duplex method, as well as mutation introduction kits utilizing site-directed mutagenesis, such as the QuikChange™ Site-Directed Mutagenesis Kit (Stratagene), GeneArt™ Site-Directed Mutagenesis PLUS System (Invitrogen), and the TaKaRa Site-Directed Mutagenesis System (Mutan-K, Mutan-Super Express Km, PrimeSTAR Mutagenesis Basal Kit, etc.: Takara Bio).

[0086] The base sequence of polynucleotides can be confirmed by sequencing using conventional methods. For example, it can be done by dideoxynucleotide chain termination (Sanger et al. (1977) Proc. Natl. Acad. Sci. USA 74:5463). Alternatively, the sequence can be analyzed using a suitable sequencer.

[0087] To confirm whether the obtained polynucleotide encodes the target noraciliol synthesis-related enzyme, the determined base sequence can be compared with the DNA base sequences of (ai), (a-ii), (bi), (b-ii), (ci), (c-ii), (fi), (f-ii), (gi), and (g-ii) listed above. Alternatively, the amino acid sequence predicted from the determined base sequence can be compared with the amino acid sequences of (AI)~(A-III), (BI)~(B-III), (CI)~(C-III), (FI)~(F-III), and (GI)~(G-III) listed above.

[0088] [3] Expression cassette or recombinant vector The expression cassette or recombinant vector of this disclosure comprises the polynucleotide of this disclosure as shown in "[2] Polynucleotide" above.

[0089] Furthermore, the expression cassette or recombinant vector of the present disclosure may contain one of the polynucleotides of the present disclosure shown in "[2] Polynucleotide" above, or it may contain two or more in combination. Accordingly, the expression cassette or recombinant vector of the present disclosure may contain one or more polynucleotides encoding any of the polypeptides of (AI)~(A-III), (BI)~(B-III), (CI)~(C-III), (FI)~(F-III), and (GI)~(G-III) above, or it may contain two or more in combination. For example, examples of the expression cassette or recombinant vector of the present disclosure include one containing one polynucleotide encoding any of the polypeptides of (AI)~(A-III), (FI)~(F-III), and (GI)~(G-III) above, and one containing a combination of a polynucleotide encoding any of the polypeptides of (BI)~(B-III) and a polynucleotide encoding any of the polypeptides of (CI)~(C-III) above.

[0090] The expression cassette or recombinant vector of the present disclosure can be obtained by ligating a promoter and a terminator to the polynucleotide of the present disclosure, or by inserting the expression cassette or polynucleotide of the present disclosure into an expression vector.

[0091] The expression cassette or recombinant vector of the present disclosure may include, as options, a promoter and a terminator, as well as a transcription element such as an enhancer, a CCAAT box, a TATA box, or an SPI site. These regulatory factors only need to be operably ligated to the polynucleotide of the present disclosure. Operable ligation means that the polynucleotide of the present disclosure is ligated to the various regulatory factors that regulate the polynucleotide of the present disclosure in a manner that allows it to function in a host cell.

[0092] Preferred expression vectors are those constructed for genetic recombination from phages, plasmids, or viruses that can autonomously proliferate within a host. Such expression vectors are well known, and those skilled in the art can appropriately select and use suitable combinations with host cells.

[0093] [4] Transformed The transformants of this disclosure are expressible and retain the polynucleotides of this disclosure as shown in "[2] Polynucleotides" above, or expressible and retain the expression cassette or recombinant vector of this disclosure as shown in "[3] Expression Cassette or Recombinant Vector" above.

[0094] The transformant of this disclosure may be configured to express any one of the oxidoreductase DgmA, C-glucosidase complex DgmBC, oxidoreductase DgmF, and hydratase DgmG shown in "[1] Noraciliol synthesis-related enzymes" above, or it may be configured to co-express two or more enzymes. Furthermore, when the transformant of this disclosure is configured to express the C-glucosidase complex DgmBC, its subunits B and C may be configured to express each individually, or the two subunits B and C may be configured to co-express. In other words, the transformant of this disclosure may be configured to express any polypeptide of (AI)~(A-III), (BI)~(B-III), (CI)~(C-III), (FI)~(F-III), or (GI)~(G-III) individually, or it may be configured to co-express two or more polypeptides.

[0095] Accordingly, the transformant of the present disclosure may hold one of the polynucleotides of the present disclosure shown in "[2] Polynucleotides" above, individually, or in combination of two or more. Furthermore, the transformant of the present disclosure may hold one of the expression cassettes or recombinant vectors of the present disclosure shown in "[3] Expression Cassette or Recombinant Vector" above, individually, or in combination of two or more. If the transformant of the present disclosure holding an expression cassette or recombinant vector holds two or more of the above polynucleotides in combination, the two or more polynucleotides in that combination may be incorporated into different expression cassettes or recombinant vectors, or they may all be incorporated into the same expression cassette or recombinant vector.

[0096] Examples of transformants of this disclosure are given below. Transformed A : Transformants expressing oxidoreductase DgmA Transformed F : Transformants expressing oxidoreductase DgmF Transformed BC : Transformants expressing the C-glucosidase complex DgmBC Transformed G : Transformants expressing hydratase DgmG Transformed A / F Transformants co-expressing oxidoreductase DgmA and / or oxidoreductase DgmF Transformed A,BC : Transformants that co-express oxidoreductase DgmA and C-glucosidase complex DgmBC Transformed A / F,BC : Transformants co-expressing oxidoreductase DgmA and / or oxidoreductase DgmF and C-glucosidase complex DgmBC Transformed A,G : Transformants that co-express oxidoreductase DgmA and hydratase DgmG Transformed A / F,G: Transformants co-expressing oxidoreductase DgmA and / or oxidoreductase DgmF and hydratase DgmG Transformed BC,G Transformants that co-express the C-glucosidase complex DgmBC and hydratase DgmG. Transformed A,BC,G : A transformant that co-expresses oxidoreductase DgmA, C-glucosidase complex DgmBC, and hydratase DgmG. Transformed A / F,BC,G Transformants co-expressing oxidoreductase DgmA and / or oxidoreductase DgmF, C-glucosidase complex DgmBC, and hydratase DgmG.

[0097] The transformants of this disclosure can be obtained by transforming a host using the expression cassette or recombinant vector of this disclosure as described in "[3] Expression Cassette or Recombinant Vector" above.

[0098] The host used for the production of the transformant is not particularly limited as long as it can be used for gene introduction, autonomously reproduce, and express the traits of the polynucleotide gene in this disclosure. Examples include microorganisms such as Escherichia coli, insects, plants, and animals.

[0099] The host used in the production of the transformant may be the microorganism from which the noraciliol synthesis-related enzyme of this disclosure originates.

[0100] In the preparation of the transformant of the present invention, the expression cassette or recombinant vector of the present disclosure is introduced into a host. The site on which the polynucleotide of the present disclosure is introduced is not particularly limited as long as the target gene can be expressed, and may be on a plasmid or on the genome. Specific methods for introducing the expression cassette or recombinant vector of the present disclosure include, for example, recombinant vector methods and genome editing methods. The conditions for introducing the expression cassette or recombinant vector of the present disclosure into a host may be appropriately set depending on the type of host, etc.

[0101] [5] Method for producing noraciliol synthesis-related enzymes The method for producing the noraciliol synthesis-related enzyme of this disclosure includes a step of culturing the transformant of this disclosure shown in "[4] Transformant" above (culturing step).

[0102] [5-1]Culture process The transformants used for culture are appropriately selected according to the type of noraciliol synthesis-related enzyme to be produced. The culture conditions can be set appropriately considering the nutritional and physiological properties of the host, but liquid culture is preferred, and shaking culture is more preferred.

[0103] Furthermore, regarding the atmospheric conditions for culture, aerobic or anaerobic conditions may be used before protein expression induction, and aerobic or anaerobic conditions may also be used after protein expression induction. Regarding the temperature conditions for culture, they may remain unchanged before and after protein expression induction, or the culture temperature may be lowered after protein expression induction compared to before induction.

[0104] [5-2] Other processes The method for producing the noraciliol synthesis-related enzyme described herein may include other steps as needed.

[0105] Other processes include a cell recovery process, a cell membrane permeability improvement process, a cell disruption process, a cell-free extract recovery process, a purification process, a concentration process, and / or a drying process.

[0106] In the bacterial cell recovery process, for example, the culture obtained by cultivation is subjected to a solid-liquid separation method such as centrifugation. This allows for the recovery of dormant bacterial cells.

[0107] In the cell membrane permeability improvement process, for example, the recovered dormant cells are treated with a surfactant such as sodium dodecyl sulfate or an organic solvent such as toluene to improve the permeability of the cell membrane and make the intracellular components easily leak out. This results in a cell membrane permeability improved treatment product.

[0108] In the cell disruption process, for example, the dormant cells recovered in the cell recovery process, or the cell membrane permeability-enhanced material, are subjected to mechanical treatment such as ultrasound, French press, or bead crushing; or enzymatic treatment with lysozyme or other lytic enzymes. The cell disruption process may be carried out under aerobic or anaerobic conditions. This yields the cell disruption-treated material.

[0109] In the cell-free extract recovery process, the cell membrane permeability-enhanced product or the cell disruption product is subjected to a solid-liquid separation method such as centrifugation, and the liquid fraction can be obtained as a cell-free extract (fraction containing enzymes related to noratiriol synthesis).

[0110] In the purification process, the purity of the noraciliol synthesis-related enzymes is increased by removing at least some of the components other than the noraciliol synthesis-related enzymes. Specifically, in the purification process, the cell-free extract can be subjected to gel filtration, hydrophobic chromatography, ion exchange chromatography, affinity chromatography, salting out, fractional precipitation, etc. The purification process may be carried out under aerobic or anaerobic conditions. This results in a purified product with a higher degree of purity of the noraciliol synthesis-related enzymes.

[0111] In the concentration process, for example, the cell-free extract or the purified product can be subjected to vacuum concentration, membrane concentration, or the like to obtain a concentrate with an increased concentration of noraciliol synthesis-related enzymes.

[0112] In the drying process, for example, the above product or concentrate can be subjected to a drying treatment such as freeze-drying, vacuum drying, or spray drying to obtain a dried product (powder) of the noraciliol synthesis-related enzyme. Excipients such as lactose, dextrin, and corn starch can also be added during the drying treatment.

[0113] [6] Enzyme preparations The enzyme preparation of this disclosure is an enzyme composition containing the noraciliol synthesis-related enzyme shown in "[1] Noraciliol synthesis-related enzyme" above as an active ingredient.

[0114] The noraciliol synthesis-related enzymes contained in the enzyme preparations of this disclosure may consist of one type alone or a combination of two or more types.

[0115] The content of the noraciliol synthesis-related enzyme in the enzyme preparation of this disclosure is not particularly limited and can be appropriately set within a range in which the predetermined activity of the enzyme (the properties of (A1), (BC1), (F1), or (G1) above) is exhibited.

[0116] The enzyme preparation described herein may contain, or may not contain, other components in addition to the noratiliolu synthesis-related enzyme, as long as the enzyme exhibits the desired activity. Examples of other components include additives and culture residues generated by the manufacturing method described in "[5] Method for producing noratiliolu synthesis-related enzyme".

[0117] The additives can be appropriately determined depending on the formulation form of the enzyme preparation, the stability of the noraciliol synthesis-related enzymes, etc., but examples include excipients, buffers, suspending agents, stabilizers, preservatives, antimicrobials, and water. Examples of excipients include starch, dextrin, maltose, trehalose, lactose, D-glucose, sorbitol, D-mannitol, sucrose, and glycerol. Examples of buffers include phosphates, citrates, and acetates. Examples of stabilizers include propylene glycol and ascorbic acid. Examples of preservatives include benzoates (alkali metal salts such as potassium salts and sodium salts), sorbates (alkali metal salts such as potassium salts and sodium salts), phenol, benzalkonium chloride, benzyl alcohol, chlorobutanol, and methylparaben. Examples of antimicrobials include ethanol, benzalkonium chloride, para-hydroxybenzoic acid, and chlorobutanol. These additives may be included individually or in combination.

[0118] Culture residues include components derived from the culture medium, contaminating proteins, bacterial components, and cellular components.

[0119] The formulation form of the enzyme preparation described herein is not particularly limited and examples include liquid, solid (powder, granules, etc.). These formulations of enzyme preparations can be prepared by generally known methods.

[0120] [7] Method for producing noraciliol synthesis-related compounds In the method for producing noratiliolu synthesis-related compounds of this disclosure, compounds related to the noratiliolu synthesis pathway are synthesized using the noratiliolu synthesis-related enzyme indicated in "[1] Noratiliolu synthesis-related enzyme" above. Examples of the synthesized compounds in the method for producing noratiliolu synthesis-related compounds of this disclosure include at least one of 3-oxo-mangiferin, noratiliolu, and 3-oxo-D-glucose. Furthermore, in the method for producing noratiliolu synthesis-related compounds of this disclosure, the material compound can be selected from mangiferin, 3-oxo-mangiferin, or 1,5-anhydro-D-erythro-hexa-1-ene-3-urose. These target compounds and material compounds can be set according to the properties of the enzyme that acts on the reaction system in the method for producing noratiliolu synthesis-related compounds of this disclosure. Furthermore, the enzyme used in the reaction system in the method for producing noratiliolu synthesis-related compounds of this disclosure may be one of the noratiliolu synthesis-related enzymes shown in "[1] Noratiliolu synthesis-related enzymes" above, or a combination of two or more. Accordingly, the method for producing noratiliolu synthesis-related compounds of this disclosure may involve any one step of the reaction pathway shown in Figure 1, or it may involve two or more consecutive steps.

[0121] [7-1] Enzyme treatment process The method for producing noraciliol synthesis-related compounds disclosed herein involves using the following materials: <1> ~ <3> This includes a step of bringing at least one of the following into contact (enzyme treatment step). <1> Nolatiliol synthesis-related enzymes, <2> The aforementioned <1> A transformant expressing the noratiliolu synthesis-related enzyme, <3> The aforementioned <2> A processed product selected from the group consisting of resting cells, cell membrane permeability-enhanced products, cell disruption products, and cell-free extracts of the transformed organism.

[0122] the above <1> Further details are provided in "[1] Noraciliol synthesis-related enzymes" above. Furthermore, the noraciliol synthesis-related enzymes may be used in the form of enzyme preparations as shown in "[6] Enzyme preparations" above, or in a form immobilized on an insoluble carrier (immobilized enzyme form). the above <2> Further details are provided in "[4] Transformants" above. the above <3> Further details are as described in "[5-2] Other Processes" above.

[0123] the above <1> ~ <3> A more detailed example is given below.

[0124] [7-1-1] In an example where the method for producing noracioliol synthesis-related compounds of this disclosure is a method for producing 3-oxo-mangiferin (material compound: mangiferin, target compound: 3-oxo-mangiferin), in the enzymatic treatment step, mangiferin is treated as follows <1 A / F >~<3 A / F >It can be processed using at least one of these methods. <1 A / F >Oxidoreductase DgmA as described in "[1-1] Oxidoreductase DgmA" above, and / or oxidoreductase DgmF as described in "[1-3] Oxidoreductase DgmF" above, <2 A / F >Transformed organism, the transformed organism described in "[4] Transformed organism" above A and / or transformants F , <3 A / F >The above <2 A / F >A processed product selected from the group consisting of resting cells, cell membrane permeability-enhanced products, cell disruption products, and cell-free extracts of the transformed organism.

[0125] [7-1-2] In the example where the method for producing a compound related to norathyriol synthesis of the present disclosure is a method for producing norathyriol (starting material compound: 3-oxo-mangiferin, target compound: norathyriol), in the enzyme treatment step, 3-oxo-mangiferin can be treated with at least one of the following <1 BC > to <3 BC >. <1 BC > The C-glucosidase complex DgmBC described in the above "[1-2] C-glucosidase complex DgmBC", <2 BC > A transformant as described in the above "[4] Transformant" BC , <3 BC > A processed product selected from the group consisting of resting cells, a processed product with improved cell membrane permeability, a cell disruption processed product, and a cell-free extract of the transformant of <2 BC .

[0126] [7-1-3] In the example where the method for producing a compound related to norathyriol synthesis of the present disclosure is a method for producing 3-oxo-D-glucose (starting material compound: 1,5-anhydro-D-erythro-hex-1-en-3-ulose, target compound: 3-oxo-D-glucose), in the enzyme treatment step, 1,5-anhydro-D-erythro-hex-1-en-3-ulose can be treated with at least one of the following <1 G > to <3 G . <1 G > The oxidoreductase DgmG described in the above "[1-4] Hydratase DgmG", <2 G > A transformant as described in the above "[4] Transformant"<00,00094>, , <3 G > A processed product selected from the group consisting of resting cells, a processed product with improved cell membrane permeability, a cell disruption processed product, and a cell-free extract of the transformant of <2 G .

[0127] [7-1-4] In another example where the method for producing a compound related to norathyriol synthesis of the present disclosure is a method for producing norathyriol (starting material compound: mangiferin, target compound: norathyriol), in the enzymatic treatment step, mangiferin is treated with at least one of the following <1 A / F , BC > to <3 A / F , BC . <1 A / F , BC > The oxidoreductase DgmA described in the above "[1-1] Oxidoreductase DgmA" and / or the oxidoreductase DgmF described in the above "[1-3] Oxidoreductase DgmF", in combination with the C-glucosidase complex DgmBC described in the above "[1-2] C-Glucosidase complex DgmBC", <2 A / F , BC > A transformant, the transformant described in the above "[4] Transformant" A And / or a transformant F And, a combination with a transformant BC ; Or, a transformant A / F,BC , <3 A / F , BC > The <2 A / F , BC > A processed product selected from the group consisting of resting cells, a processed product with improved cell membrane permeability, a processed product of cell disruption, and a cell-free extract of the transformant.

[0128] [7-1-5] In yet another example where the method for producing a compound related to norathyriol synthesis of the present disclosure is a method for producing norathyriol (starting material compound: 3-oxo-mangiferin, target compound: norathyriol), in the enzymatic treatment step, 3-oxo-mangiferin is treated with at least one of the following <1 BC , G > to <3 BC , G . <1 BC , G>A combination of the C-glucosidase complex DgmBC described in "[1-2] C-glucosidase complex DgmBC" above and the hydratase DgmG described in "[1-4] hydratase DgmG" above. <2 BC , G > Transformed BC and transformant G A combination with; or a transformed body BC,G , <3 BC , G >The above <2 BC , G A processed product selected from the group consisting of resting cells, cell membrane permeability-enhanced products, cell disruption products, and cell-free extracts of the transformed product described above.

[0129] Thus, 3-oxo-mangiferin is used as described above <1 BC , G >~<3 BC , G When processed using at least one of the above methods, the reaction system involves a combination of C-glucosidase complex DgmBC and hydratase DgmG. This combination of enzymes improves the efficiency of noratiriol production because hydratase DgmG converts the byproduct 1,5-anhydro-D-erythrohexa-1-ene-3-urose from the reaction of C-glucosidase complex DgmBC to 3-oxo-D-glucose, thereby inhibiting the reverse reaction of the C-glucosidic bond cleavage reaction by C-glucosidase complex DgmBC (i.e., the reaction in which the byproduct of the sugar binds to noratiriol and returns to 3-oxo-mangiferin).

[0130] [7-1-6] In yet another example where the method for producing norathiol synthesis-related compounds of this disclosure is a method for producing norathiol (material compound: mangiferin, target compound: norathiol), in the enzymatic treatment step, mangiferin is treated as follows <1 A / F , BC , G >~<3 A / F , BC , G>It can be processed using at least one of these methods. <1 A / F , BC , G >A combination of oxidoreductase DgmA described in "[1-1] Oxidoreductase DgmA" above, and / or oxidoreductase DgmF described in "[1-3] Oxidoreductase DgmF" above, C-glucosidase complex DgmBC described in "[1-2] C-glucosidase complex DgmBC" above, and hydratase DgmG described in "[1-4] Hydratase DgmG" above, <2 A / F , BC , G > Transformed A and / or transformants F and transformant BC and transformant G Combination with; transformant A / F,G and transformant BC Combination with; transformant A and / or transformants F and transformant BC,G Combination with; transformant A / F,BC and transformant G A combination with; or a transformant A / F,BC,G , <3 A / F , BC , G >The above <2 A / F , BC , G A processed product selected from the group consisting of resting cells, cell membrane permeability-enhanced products, cell disruption products, and cell-free extracts of the transformed product described above.

[0131] Thus, mangiferin is used as described above <1 A / F , BC , G >~<3 A / F , BC , GWhen processing is carried out using at least one of the above, the reaction system acts in combination with at least the C-glucosidase complex DgmBC and hydratase DgmG. Therefore, similar to "[7-1-5]" above, the production efficiency of nolatiliol can be improved by inhibiting the reverse reaction of the C-glucosidic bond cleavage reaction by the reaction of the C-glucosidase complex DgmBC.

[0132] [7-1-7] In yet another example where the method for producing norathiol synthesis-related compounds of this disclosure is a method for producing norathiol (material compound: mangiferin, target compound: norathiol), in the enzymatic treatment step, mangiferin is treated as follows <1 A , BC , G >~<3 A , BC , G >It can be processed using at least one of these methods. <1 A , BC , G >A combination of oxidoreductase DgmA described above in "[1-1] Oxidoreductase DgmA", C-glucosidase complex DgmBC described above in "[1-2] C-glucosidase complex DgmBC", and hydratase DgmG described above in "[1-4] Hydratase DgmG", <2 A , BC , G > Transformed A and transformant BC and transformant G Combination with; transformant A,G and transformant BC Combination with; transformant A and transformant BC,G Combination with; transformant A,BC and transformant G A combination with; or a transformant A,BC,G , <3 A , BC , G >The above <2 A , BC ,G A processed product selected from the group consisting of resting cells, cell membrane permeability-enhanced products, cell disruption products, and cell-free extracts of the transformed product described above.

[0133] Thus, mangiferin is used as described above <1 A , BC , G >~<3 A , BC , G When processed using at least one of the methods described above, the reaction system involves the combined action of oxidoreductase DgmA, C-glucosidase complex DgmBC, and hydratase DgmG. This combination of enzymes, since it includes at least C-glucosidase complex DgmBC and hydratase DgmG, can improve the efficiency of noratiliol production by inhibiting the reverse reaction of the C-glucosidic bond cleavage reaction by the reaction of C-glucosidase complex DgmBC, similar to the method described in "[7-1-5]" above. Furthermore, this combination of enzymes can also improve the efficiency of noratiliol production by reusing 3-oxo-D-glucose produced by hydratase DgmG as a cofactor for oxidoreductase DgmA, thereby rotating the catalytic cycle of the xanthone metabolic reaction.

[0134] Regarding the enzyme treatment conditions, <1> ~ <3> Conditions that allow the noratiliol synthesis-related enzyme activity to be exerted can be appropriately set. These conditions include the presence or absence of cofactors, pH, and temperature, and these conditions can be set taking into account the properties of the noratiliol synthesis-related enzyme to be acted upon (at least one of (A1) to (A5), (BC1), (F1) to (F5), and (G1) described in "[1] Noratiliol Synthesis-Related Enzymes" above).

[0135] [7-2] Other processes The method for producing noraciliol synthesis-related compounds described herein may include other steps as needed.

[0136] Other processes include quantitative analysis, enzyme deactivation, purification, concentration, and / or drying.

[0137] In quantitative engineering, the target compound can be quantified according to a conventional method that enables quantification. For example, a lower alcohol (such as methanol, ethanol, and / or butanol, etc.) to which an aqueous solution of an acid such as acetic acid is added as needed is added to the reaction mixture obtained in the enzyme treatment step for extraction, and the target compound can be quantified for the obtained extract using high-performance liquid chromatography.

[0138] In the enzyme inactivation step, the reaction mixture obtained in the enzyme treatment step is subjected to conditions that inactivate the norathyriol synthesis-related enzyme. For such conditions, conditions for heat inactivation can be selected. Specifically, at least either (A3) or (F3) described in the above “[1] Norathyriol synthesis-related enzyme” and the thermal properties of the target compound are taken into consideration and can be appropriately determined.

[0139] In the purification step, for example, the reaction mixture obtained in the enzyme treatment step or its enzyme-inactivated product can be subjected to sterilization by centrifugation, microfiltration (MF), ultrafiltration (UF), nanofiltration (NF), etc.; removal of solids and macromolecular substances; extraction and crystallization with an organic solvent or ionic liquid, etc.; chromatography such as adsorption using a hydrophobic adsorbent, ion exchange resin, activated carbon column, etc., and treatment such as decolorization.

[0140] In the concentration step, the reaction mixture obtained in the enzyme treatment step, its enzyme-inactivated product, or their purified products can be subjected to concentration by reduced-pressure concentration, membrane concentration, etc.

[0141] In the drying step, the reaction mixture obtained in the enzyme treatment step, its enzyme-inactivated product, their purified products, or their concentrates are subjected to a drying treatment such as freeze drying or spray drying to obtain a dried product (powder) of the target compound. In the drying treatment, excipients such as lactose, dextrin, and corn starch can also be added.

[0142] Each aspect disclosed in this specification can be combined with any other features disclosed in this specification. Each configuration and their combinations in each embodiment are examples, and within the scope not departing from the gist of the present invention, additions, omissions, substitutions, and other changes to the configuration can be made as appropriate. This disclosure is not limited by the embodiments, but only by the scope of the claims.

Example

[0143] Examples are shown below to more specifically explain this disclosure, but this disclosure is not limited to these examples.

[0144] [Test Example 1] Cloning of genes related to nolatiliol synthesis and construction of expression vectors Genomic DNA was prepared from Hungatella hathewayi (JCM 16063) according to a conventional method. Using the obtained genomic DNA as a template, a gene group related to norathyriol synthesis was amplified by PCR using the following primer sets. Primers for amplifying the dgmA gene: 5'- AAAGGATCCATGAAGAAAGTGAGAATCGG -3' (SEQ ID NO: 16) Bam HI site 5'- AAACTCGAGCTAATCAAAATAAATGGTTT -3' (SEQ ID NO: 17) Xho I site Primers for amplifying the dgmB and dgmC genes: (Two genes arranged continuously on the genome were simultaneously inserted into the expression vector.) 5'- AAAGGATCCATGAGCAGAATCAAGACGTG -3' (SEQ ID NO: 18) Bam HI site 5'- AAACTCGAGCTATGCAATCATCACAGTCC -3' (SEQ ID NO: 19) Xho I site Primers for amplifying the dgmF gene: 5'- AAAGGATCCATGAGCGATATCATTAATCT -3' (SEQ ID NO: 20) Bam HI site 5'- AAACTCGAGCTATTTTTCAAATGCAACTG -3'(Sequence ID 21)Xho I site Primers for amplifying the dgmG gene: 5'- AAAGAATTCATGAAAAAGAGACCAGTTAC -3'(Sequence ID 22)Eco RI site 5'- AAACTCGAGTCAGTCATTTTTCAACGCCG -3'(Sequence ID 23)Xho I site

[0145] The obtained polynucleotides, specifically the polynucleotide of dgmA (SEQ ID NO: 6), the polynucleotides of dgmB and dgmC (SEQ ID NO: 8 and 10), the polynucleotide of dgmF (SEQ ID NO: 12), and the polynucleotide of dgmG (SEQ ID NO: 14), were inserted into plasmid pET-21a(+).

[0146] Furthermore, the T7 tag was removed by PCR using the following primer set, and expression vectors for each enzyme were constructed. Primer for dgmA tag removal: 5'- TATACATATGAAGAAAGTGAGAATC(Sequence ID 24) 5'- TTCTTCATATGTATATCTCCTTCTTA(Sequence ID 25) Primers for removing dgmB and dgmC tags: 5'- TATACATATGAGCAGAATCAACG(Sequence ID 26) 5'- CTGCTCATATGTATATCTCCTTCTTA(Sequence ID 27) Primer for dgmF tag removal: 5'- TATACATATGAGCGATATCATTAAT(Sequence No. 28) 5'- TCGCTCATATGTATATCTCCTTCTTA(Sequence ID 29) Primer for removing dgmG tags: 5'- TATACATATGAAAAAGAGACCAGTT(Sequence ID 30) 5'- TTTTTCATATGTATATCTCCTTCTTA(Sequence ID 31)

[0147] [Test Example 2] Production of nolatiliol synthesis-related enzyme Escherichia coli BL21(DE3) strain was transformed with the expression vector constructed in Test Example 1 by the heat shock method. The resulting transformed strains were cultured in LB medium (1 mL) containing 100 μg / mL ampicillin at 37°C for 6 hours with shaking (pre-culture). The pre-culture solution was cultured in LB medium (150 mL) containing 100 μg / mL ampicillin at 37°C for 3 hours with shaking (main culture). IPTG was added to the main culture solution to a concentration of 0.4 mM, and the culture temperature was further reduced to room temperature and incubated overnight to induce protein expression. The resulting culture solution was centrifuged to prepare wet cells of the transformed organisms. The wet cells of the transformed organisms were suspended in 40 mL of potassium phosphate buffer, and the bacteria were disrupted by sonication.

[0148] Furthermore, the lysates were purified using ion-exchange and hydrophobic columns. This yielded purified products of oxidoreductase DgmA (SEQ ID NO: 1; hereafter, this enzyme will be abbreviated as "DgmA"), oxidoreductase DgmF (SEQ ID NO: 4; hereafter, this enzyme will be abbreviated as "DgmF"), C-glucosidase complex DgmBC (a complex of polypeptides from SEQ ID NOs: 2 and 3; hereafter, this enzyme will be abbreviated as "DgmBC"), and hydratase DgmG (SEQ ID NO: 5; hereafter, this enzyme will be abbreviated as "DgmG").

[0149] [Test Example 3] Expression analysis of nolatiliol synthesis-related enzymes Each purified enzyme obtained in Test Example 2 was analyzed by SDS-PAGE. The acrylamide concentration was set to 12.5% ​​by weight, and Protein Molecular Weight Marker (Broad) (Takara Bio Inc.) was used as the protein molecular weight marker. The results are shown in Figure 2.

[0150] As shown in Fig. 2, bands of norchiliol synthesis-related enzymes were observed, and their molecular weights were 40,603 for DgmA, 14,637 for DgmB, 38,474 for DgmC, 40,582 for DgmF, and 37,647 for DgmG, respectively. Note that molecular weight measurement by SDS-PAGE generally includes an error of about 10%.

[0151] [Test Example 4] Synthesis of Nolaciriol Synthesis-Related Compounds - 1 Using each purified enzyme obtained in Test Example 2, norchiliol synthesis-related compounds were synthesized.

[0152] [Test Example 4-1] Synthesis of 3-oxo-mangiferin from mangiferin using DgmA Using the purified DgmA obtained in Test Example 2, a reaction was carried out at 37 °C for 30 minutes in a reaction solution containing mangiferin (initial concentration 0.5 mM) in water. 100 μL of the reaction solution was sampled, and 300 μL of methanol was added and mixed. After centrifuging the mixed solution, it was filtered, and the filtrate was analyzed by high performance liquid chromatography (HPLC). The conditions were as follows: HPLC Condition 1. <HPLC Condition 1> Column used: COSMOSIL 5C 18 -MS-II Eluent: 10 - 50% CH3CN + 0.05% TFA Flow rate: 1 mL / min Detection wavelength: 254 nm

[0153] The results are shown in Fig. 3. As shown in the HPLC chart of Fig. 3, a peak specific to the target compound, 3-oxo-mangiferin, was detected.

[0154] [Test Example 4-2] Synthesis of 3-oxo-mangiferin from mangiferin using DgmA and DgmG Using the purified DgmA and purified DgmG obtained in Test Example 2, the reaction was carried out at 37°C for 30 minutes in a reaction mixture containing mangiferin (initial concentration 0.5 mM) and 1,5-anhydro-D-erythrohexa-1-ene-3-urose (initial concentration 0.5 mg / mL) in water. 100 μL of the reaction mixture was sampled, and 300 μL of methanol was added and mixed. The mixed solution was centrifuged and filtered, and the filtrate was analyzed by high-performance liquid chromatography (HPLC). The conditions were as described in HPLC Condition 1 above.

[0155] The results are shown in Figure 4. As shown in the HPLC chart in Figure 4, a peak specific to the target compound, 3-oxo-mangiferin, was detected. Furthermore, as can be seen in the comparison with Figure 3 from Test Example 4-1 (without concomitant use of DgmG), the amount of the target compound, 3-oxo-mangiferin, produced in Figure 4 is improved. This is thought to be because the addition of DgmG converted 1,5-anhydro-D-erythrohexa-1-ene-3-uros into 3-oxo-D-glucose, which was then used as a cofactor for purified DgmA.

[0156] [Test Example 4-3] Synthesis of noratiriol from 3-oxo-mangiferin using DgmBC Using the purified dgmBC obtained in Test Example 2, the reaction was carried out at 37°C for 10 minutes in a reaction mixture containing 3-oxo-mangiferin (initial concentration 0.5 mM) in water. 100 μL of the reaction mixture was sampled, and 300 μL of methanol was added and mixed. The mixed solution was centrifuged and filtered, and the filtrate was analyzed by high-performance liquid chromatography (HPLC). The conditions were as described in HPLC Condition 1 above.

[0157] The results are shown in Figure 5. As shown in the HPLC chart in Figure 5, a peak specific to the target compound, noraciliol, was detected.

[0158] [Test Example 4-4] Synthesis of noratiriol from 3-oxo-mangiferin using DgmBC and DgmG Using the purified DgmBC and purified DgmG obtained in Test Example 2, the reaction was carried out at 37°C for 10 minutes in a reaction mixture containing 3-oxo-mangiferin (initial concentration 0.5 mM) in water. 100 μL of the reaction mixture was sampled, and 300 μL of methanol was added and mixed. The mixed solution was centrifuged and filtered, and the filtrate was analyzed by high-performance liquid chromatography (HPLC). The conditions were as described in HPLC Condition 1 above.

[0159] The results are shown in Figure 6. As shown in the HPLC chart in Figure 6, a peak specific to the target compound, noratiliolu, was detected. Furthermore, as can be seen in the comparison with Figure 5 from Test Example 4-3 (without the use of DgmG), the amount of noratiliolu, the target compound, produced is improved in Figure 6. This is thought to be because the addition of DgmG converted 1,5-anhydro-D-erythrohexa-1-ene-3-urose, a byproduct of the deglycerization reaction by DgmBC, to 3-oxo-D-glucose, thereby inhibiting the reverse reaction of the deglycerization reaction by DgmBC.

[0160] [Test Example 4-5] Synthesis of noratiriol from mangiferin using DgmA and DgmBC Using the purified DgmA and purified DgmBC obtained in Test Example 2, the reaction was carried out at 37°C for 16 hours in a reaction mixture containing mangiferin (initial concentration 0.5 mM) in water. 100 μL of the reaction mixture was sampled, 200 μL of butanol saturated with 0.01% aqueous acetic acid was added, and the mixture was centrifuged. The supernatant was collected and extracted again with butanol saturated with 0.01% aqueous acetic acid. The butanol extracts were combined, the solvent was removed by distillation, and 100 μL of methanol and 100 μL of pure water were added to the residue. The mixture was analyzed by high-performance liquid chromatography (HPLC). The conditions were the same as those for HPLC Condition 1 described above.

[0161] The results are shown in Figure 7. As shown in the HPLC chart in Figure 7, a peak specific to the target compound, noraciliol, was detected.

[0162] [Test Example 4-6] Synthesis of noratiriol from mangiferin using DgmA, DgmBC, and DgmG Using the purified DgmA, purified DgmBC, and purified DgmG obtained in Test Example 2, the reaction was carried out at 37°C for 16 hours in a reaction mixture containing mangiferin (initial concentration 0.5 mM) in water. 100 μL of the reaction mixture was sampled, 200 μL of butanol saturated with 0.01% aqueous acetic acid was added, and the mixture was centrifuged. The supernatant was collected and extracted again with butanol saturated with 0.01% aqueous acetic acid. The butanol extracts were combined, the solvent was removed by distillation, and 100 μL of methanol and 100 μL of pure water were added to the residue. The mixture was analyzed by high-performance liquid chromatography (HPLC). The conditions were the same as those for HPLC Condition 1 described above.

[0163] The results are shown in Figure 8. As shown in the HPLC chart in Figure 8, a peak specific to the target compound, noratiliolu, was detected. Furthermore, as can be seen in the comparison with Figure 7 from Test Example 4-5 (without the use of DgmG), the amount of noratiliolu, the target compound, produced is improved in Figure 8. This is thought to be because the addition of DgmG converts 1,5-anhydro-D-erythrohexa-1-ene-3-urose, a byproduct of the deglycation reaction by DgmBC, into 3-oxo-D-glucose, which is then utilized as a cofactor for DgmA, and the reverse reaction of the deglycation reaction by DgmBC is inhibited.

[0164] [Test Example 4-7] Synthesis of noratiriol from mangiferin in the presence of cofactors DgmA, DgmBC, and DgmG Using the purified DgmA, purified DgmBC, and purified DgmG obtained in Test Example 2, the reaction was carried out at 37°C for 1 hour in a reaction mixture containing mangiferin (initial concentration 0.5 mM) and the cofactor 3-oxo-D-glucose (1 mM) in water. 100 μL of the reaction mixture was sampled, 300 μL of methanol was added, and the mixture was centrifuged. The supernatant was analyzed by high-performance liquid chromatography (HPLC). The conditions were the same as those described in HPLC Condition 1 above.

[0165] The results are shown in Figure 9. As shown in the HPLC chart in Figure 9, a peak specific to the target compound, noratiliolu, was detected. Furthermore, as can be seen in the comparison with Figure 8 from Test Example 4-6 (without cofactor addition), the rate of noratiliolu production of the target compound is improved in Figure 9. This is thought to be because the addition of the cofactor (3-oxo-D-glucose) increased the amount of cofactor available for the DgmA reaction, thereby accelerating the DgmA reaction.

[0166] [Test Example 4-8] Synthesis of noratiriol from mangiferin in the presence of cofactors DgmF and DgmBC Using the purified DgmF and purified DgmBC obtained in Test Example 2, mangiferin (initial concentration 0.5 mM) and cofactor DHAP (initial concentration 5 mM) were reacted in water at 37°C for 60 minutes. 100 μL of the reaction solution was sampled, 300 μL of methanol was added, and the mixture was centrifuged. The supernatant was analyzed by high-performance liquid chromatography (HPLC). The conditions were as described in HPLC Condition 1 above.

[0167] The results are shown in Figure 10. As shown in the HPLC chart in Figure 10, a peak specific to the target compound, nolatiliol, was detected.

[0168] [Test Example 4-9] Synthesis of noratiriol from mangiferin in the presence of cofactors DgmF, DgmBC, and dgmG Using the purified DgmF, purified DgmBC, and purified dgmG obtained in Test Example 2, the reaction was carried out at 37°C for 60 minutes in a reaction mixture containing mangiferin (initial concentration 0.5 mM) and cofactor DHAP (initial concentration 5 mM) in water. 100 μL of the reaction mixture was sampled, 300 μL of methanol was added, and the mixture was centrifuged. The supernatant was analyzed by high-performance liquid chromatography (HPLC). The conditions were as described in HPLC Condition 1 above.

[0169] The results are shown in Figure 11. As shown in the HPLC chart in Figure 11, a peak specific to the target compound, noratiliolu, was detected. Furthermore, as can be seen in the comparison with Figure 10 from Test Example 4-8 (without the use of DgmG), the amount of noratiliolu, the target compound, produced in Figure 11 is increased. This is thought to be because the addition of DgmG converted 1,5-anhydro-D-erythrohexa-1-ene-3-urose, a byproduct of the deglycerization reaction by DgmBC, to 3-oxo-D-glucose, thereby inhibiting the reverse reaction of the deglycerization reaction by DgmBC.

[0170] [Test Example 5] Synthesis of Nolaciriol Synthesis-Related Compounds - 2 The enzyme solution (cell-free extract) obtained by purifying the lysates of Escherichia coli transformants (including all transformants expressing DgmA, DgmBC, DgmF, and DgmG) obtained in Test Example 2 using an ion-exchange column and a hydrophobic column was reacted with mangiferin (initial concentration 0.5 mM) and DHAP (initial concentration 1 mM) in water at 37°C for 60 minutes. 100 μL of the reaction solution was sampled, 300 μL of methanol was added, and the solution was filtered. The filtrate was analyzed by high-performance liquid chromatography (HPLC). The conditions were as described in HPLC Condition 1 above.

[0171] The results are shown in Figure 12. As shown in the HPLC chart in Figure 12, a peak specific to the target compound, noratiliolu, was detected. As can be seen in the comparison with Figure 11 from Test Example 4-9, the amount of noratiliolu produced in Figure 12 is improved. This is thought to be because the addition of DgmA causes 1,5-anhydro-D-erythrohexa-1-ene-3-urose, a byproduct of the deglycosylation reaction by DgmBC, to be converted to 3-oxo-D-glucose by dgmG. By rotating the catalytic cycle of the xanthone metabolic reaction as a cofactor of DgmA, two types of oxidoreductases, dgmA and dgmF, contribute to the conversion of mangiferin to 3-oxo-mangiferin, resulting in increased noratiliolu production.

[0172] [Test Example 6] pH characteristics of noratiriol synthesis-related enzymes The pH characteristics of each purified enzyme obtained in Test Example 2 were confirmed.

[0173] [Test Example 6-1] pH characteristics of DgmA In Test Example 4-1, the reaction solution containing mangiferin in water was replaced with a reaction solution containing mangiferin in each of the buffer solutions listed below, the reaction time was changed from 30 minutes to 5 minutes, and the procedure was otherwise the same as in Test Example 4-1.

[0174] pH 4.0, 5.0, 6.0: 50 mM sodium acetate buffer pH 6.0, 6.5, 7.0, 7.5, 8.0: 50 mM potassium phosphate buffer pH 8.0, 8.5, 9.0: 50 mM Tris-HCl buffer

[0175] The relative values ​​of the HPLC peak area of ​​3-oxo-mangiferin at each pH were derived, with the peak area at the pH where the HPLC peak area of ​​3-oxo-mangiferin was maximized (activity at the pH showing maximum activity) set to 100. The relationship between relative activity and pH is shown in Figure 13.

[0176] As shown in Figure 13, DgmA was effective at pH 5.0–9.0, with an optimal pH of around 7.5–8.0.

[0177] [Test Example 6-2] pH characteristics of DgmF The procedure was the same as in Test Example 6-1, except that the enzyme was changed from DgmA to DgmF. In the same manner as in Test Example 6-1, the relative activity at each pH was derived, with the activity at the pH where maximum activity was observed set to 100. The relationship between relative activity and pH is shown in Figure 14.

[0178] As shown in Figure 14, DgmF acted at pH 5.0–9.0, and showed an optimal pH around pH 6.5–7.0.

[0179] [Test Example 7] Temperature characteristics of nolatiliol synthesis-related enzymes The temperature characteristics of each purified enzyme obtained in Test Example 2 were confirmed.

[0180] [Test Example 7-1] Temperature Characteristics of DgmA In Test Example 4-1, the reaction solution containing mangiferin in water was changed to a reaction solution containing mangiferin in 50 mM potassium phosphate buffer (pH 7.4), the reaction temperature was changed from 37°C to 15, 20, 25, 30, 35, 40, 45, 50, 55, and 60°C, and the reaction time was changed from 30 minutes to 5 minutes. Otherwise, the procedure was the same as in Test Example 4-1.

[0181] The relative values ​​of the HPLC peak area of ​​3-oxo-mangiferin at each temperature (relative activity at each temperature) were derived, with the peak area at the temperature where the HPLC peak area of ​​3-oxo-mangiferin was maximized (activity at the temperature showing maximum activity) set to 100. The relationship between relative activity and temperature is shown in Figure 15.

[0182] As shown in Figure 15, DgmA was effective from 15°C to 55°C, with an optimal temperature of around 35°C to 45°C.

[0183] [Test Example 7-2] Temperature Characteristics of DgmF The procedure was the same as in Experiment 7-1, except that the enzyme was changed from DgmA to DgmF. In the same manner as in Experiment 7-1, the relative activity at each temperature was derived, with the activity at the temperature showing maximum activity set to 100. The relationship between relative activity and temperature is shown in Figure 16.

[0184] As shown in Figure 16, DgmF acted between 15°C and 50°C, with an optimal temperature of around 35°C to 40°C.

Claims

1. Oxidoreductase DgmA having the following properties (A1): (A1) Using 3-oxo-D-glucose as a cofactor, 3-oxo-mangiferin is produced from mangiferin.

2. The oxidoreductase DgmA according to claim 1 further possesses the following properties (A2) to (A6): (A2) It acts at pH 5.0 to 9.0; (A3) It acts between 15°C and 55°C; (A4) The optimal pH is 7.0 to 8.5; (A5) The optimal temperature is 25°C to 50°C: (A6) The molecular weight measured by SDS-PAGE is between 37,000 and 45,000.

3. Oxidoreductase DgmA according to claim 1, comprising a polypeptide shown in any of the following (A-I) to (A-III): (A-I) Polypeptide consisting of the amino acid sequence shown in Sequence ID No. 1, (A-II) A polypeptide comprising an amino acid sequence in which one or more amino acids are substituted, added, inserted, or deleted in the amino acid sequence shown in Sequence ID No. 1, (A-III) A polypeptide consisting of an amino acid sequence with 80% or more sequence identity to the amino acid sequence shown in Sequence ID No.

1.

4. C-glucosidase complex DgmBC having the following properties (BC1): (BC1)3-oxo-mangiferin is used to produce nolatiliol.

5. The C-glucosidase complex DgmBC according to claim 4 further has the following properties (BC6): (BC6) A combination of molecular weights measured by SDS-PAGE of 13,000 to 16,000 and 35,000 to 42,000.

6. The C-glucosidase complex DgmBC according to claim 4 comprises subunit B, which consists of a polypeptide shown in any of (B-I) to (B-III) below, and subunit C, which consists of a polypeptide shown in any of (C-I) to (C-III) below: (B-I) Polypeptide consisting of the amino acid sequence shown in Sequence ID No. 2, (B-II) A polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, added, inserted, or deleted in the amino acid sequence shown in Sequence ID No. 2, (B-III) Polypeptides consisting of amino acid sequences with 80% or more sequence identity to the amino acid sequence shown in Sequence ID No. 2, (C-I) Polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 3, (C-II) A polypeptide comprising an amino acid sequence in which one or more amino acids are substituted, added, inserted, or deleted in the amino acid sequence shown in Sequence ID No. 3, (C-III) A polypeptide consisting of an amino acid sequence with 80% or more sequence identity to the amino acid sequence shown in Sequence ID No.

3.

7. Oxidoreductase DgmF having the following properties (F1): (F1) Dihydroxyacetone phosphate acts as a cofactor and has the activity to catalyze the reaction from mangiferin to 3-oxo-mangiferin.

8. The oxidoreductase DgmF according to claim 7 further possesses the following properties (F2) to (F6): (F2) Acts at pH 5.0 to 9.0; (F3) Acts at temperatures between 15°C and 50°C; (F4) The optimal pH is 6.0 to 8.0; (F5) The optimal temperature is 30°C to 42°C; (F6) The molecular weight measured by SDS-PAGE is 37,000 to 45,000.

9. Oxidoreductase DgmF according to claim 7, comprising a polypeptide shown in any of the following (F-I) to (F-III): (F-I) Polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 4, (F-II) A polypeptide comprising an amino acid sequence in which one or more amino acids are substituted, added, inserted, or deleted in the amino acid sequence shown in Sequence ID No. 4, (F-III) A polypeptide consisting of an amino acid sequence with 80% or more sequence identity to the amino acid sequence shown in Sequence ID No.

4.

10. Hydratase DgmG having the following properties (G1): (G1) 3-oxo-D-glucose is produced from 1,5-anhydro-D-erythro-hexa-1-ene-3-urouse.

11. Hydratase DgmG according to claim 10, further having the property (G6) described below: (G6) The molecular weight measured by SDS-PAGE is between 34,000 and 41,000.

12. Hydratase DgmG according to claim 10, comprising a polypeptide shown in any of the following (G-I) to (G-III): (G-I) Polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5 (G-II) A polypeptide comprising an amino acid sequence in which one or more amino acids are substituted, added, inserted, or deleted in the amino acid sequence shown in Sequence ID No.

5. (G-III) A polypeptide consisting of an amino acid sequence with 80% or more sequence identity to the amino acid sequence shown in Sequence ID No.

5.

13. A polynucleotide encoding the oxidoreductase DgmA described in claim 3.

14. A polynucleotide encoding the C-glucosidase complex DgmBC as described in claim 6.

15. A polynucleotide encoding the oxidoreductase DgmF according to claim 9.

16. A polynucleotide encoding hydratase DgmG according to claim 12.

17. An expression cassette or recombinant vector comprising the polynucleotide described in claim 13.

18. Furthermore, the expression cassette or recombinant vector according to claim 17, comprising the polynucleotide described in claim 14.

19. Furthermore, the expression cassette or recombinant vector according to claim 17, comprising the polynucleotide according to claim 16.

20. Furthermore, the expression cassette or recombinant vector according to claim 17 comprises the polynucleotide according to claim 14 and the polynucleotide according to claim 16.

21. A transformant that can express the polynucleotide described in claim 13, or that can express the expression cassette or recombinant vector described in claim 17.

22. Furthermore, the transformant according to claim 21, which holds the polynucleotide described in claim 14, or the expression cassette or recombinant vector described in claim 18.

23. Furthermore, the transformant according to claim 21, which holds the polynucleotide described in claim 16, or the expression cassette or recombinant vector described in claim 19.

24. Furthermore, the transformant according to claim 21, which holds the polynucleotide according to claim 14 and the polynucleotide according to claim 16, or holds the expression cassette or recombinant vector according to claim 20.

25. A method for producing oxidoreductase DgmA, comprising the step of culturing the transformant described in claim 21.

26. An expression cassette or recombinant vector comprising the polynucleotide described in claim 14.

27. A transformant that can express the polynucleotide described in claim 14, or that can express the expression cassette or recombinant vector described in claim 26.

28. A method for producing C-glucosidase complex DgmBC, comprising the step of culturing the transformant described in claim 27.

29. An expression cassette or recombinant vector comprising the polynucleotide described in claim 15.

30. A transformant that can express the polynucleotide described in claim 15, or that can express the expression cassette or recombinant vector described in claim 29.

31. A method for producing oxidoreductase DgmF, comprising the step of culturing the transformant described in claim 30.

32. An expression cassette or recombinant vector comprising the polynucleotide described in claim 16.

33. Furthermore, the expression cassette or recombinant vector according to claim 32, comprising the polynucleotide described in claim 14.

34. A transformant that can express the polynucleotide described in claim 16, or that can express the expression cassette or recombinant vector described in claim 32.

35. Furthermore, the transformed product according to claim 34, which retains the polynucleotide described in claim 14.

36. A method for producing hydratase DgmG, comprising the step of culturing the transformant described in claim 34.

37. Mangiferin, see below <1 A / F >~<3 A / F A method for producing 3-oxo-mangiferin, comprising the step of processing in at least one of the following: <1 A / F >Oxidoreductase DgmA according to any one of claims 1 to 3, and / or oxidoreductase DgmF according to any one of claims 7 to 9, <2 A / F >The transformant according to claim 21 and / or the transformant according to claim 30, <3 A / F >The above<2 A / F >A processed product selected from the group consisting of resting cells, cell membrane permeability-enhanced products, cell disruption products, and cell-free extracts of the transformed organism.

38. 3-Oxo-mangiferin, see below <1 BC >~<3 BC A method for producing noraciliol, comprising the step of processing in at least one of the following: <1 BC >The C-glucosidase complex DgmBC according to any one of claims 4 to 6, <2 BC >Transformed body according to claim 27, <3 BC >The above<2 BC >A processed product selected from the group consisting of resting cells, cell membrane permeability-enhanced products, cell disruption products, and cell-free extracts of the transformed organism.

39. 1,5-Anhydro-D-erythrohexa-1-ene-3-urose is used as follows: <1 G >~<3 G A method for producing 3-oxo-D-glucose, comprising a step of processing in at least one of the following: <1 G >Hydratase DgmG according to any one of claims 10 to 12, <2 G >Transformed body according to claim 34, <3 G >The above<2 G >A processed product selected from the group consisting of resting cells, cell membrane permeability-enhanced products, cell disruption products, and cell-free extracts of the transformed organism.

40. Mangiferin, see below <1 A / F , BC >~<3 A / F , BC A method for producing noraciliol, comprising the step of processing in at least one of the following: <1 A / F , BC >A combination of oxidoreductase DgmA according to any one of claims 1 to 3, and / or oxidoreductase DgmF according to any one of claims 7 to 9, and C-glucosidase complex DgmBC according to any one of claims 4 to 6, <2 A / F , BC >A combination of the transformer according to claim 21 and / or the transformer according to claim 30 and the transformer according to claim 27; or the transformer according to claim 22, <3 A / F , BC >The above<2 A / F , BC >A processed product selected from the group consisting of resting cells, cell membrane permeability-enhanced products, cell disruption products, and cell-free extracts of the transformed organism.

41. 3-Oxo-mangiferin, see below <1 BC , G >~<3 BC , G A method for producing noraciliol, comprising the step of processing in at least one of the following: <1 BC , G >A combination of C-glucosidase complex DgmBC according to any one of claims 4 to 6 and hydratase DgmG according to any one of claims 10 to 12, <2 BC , G >A combination of the transformant according to claim 27 and the transformant according to claim 34; or the transformant according to claim 35, <3 BC , G >The above<2 BC , G A processed product selected from the group consisting of resting cells, cell membrane permeability-enhanced products, cell disruption products, and cell-free extracts of the transformed product described above.

42. Mangiferin, see below <1 A / F , BC , G >~<3 A / F , BC , G A method for producing noraciliol, comprising the step of processing in at least one of the following: <1 A / F , BC , G >A combination of oxidoreductase DgmA according to any one of claims 1 to 3, and / or oxidoreductase DgmF according to any one of claims 7 to 9, C-glucosidase complex DgmBC according to any one of claims 4 to 6, and hydratase DgmG according to any one of claims 10 to 12. <2 A / F , BC , G >A combination of the transformer according to claim 21 and / or the transformer according to claim 30, the transformer according to claim 27, and the transformer according to claim 34; a combination of the transformer according to claim 23 and the transformer according to claim 27; a combination of the transformer according to claim 21 and the transformer according to claim 35; a combination of the transformer according to claim 22 and the transformer according to claim 34; or the transformer according to claim 24, <3 A / F , BC , G >The above<2 A / F , BC , G A processed product selected from the group consisting of resting cells, cell membrane permeability-enhanced products, cell disruption products, and cell-free extracts of the transformed product described above.