Enhanced oligonucleotides for regulating FUBP1 expression

Abstract

The present invention relates to enhanced antisense oligonucleotides that are complementary to Far Upstream Element-Binding Protein 1 (FUBP1) and can reduce FUBP1 target nucleic acids such as FUBP1 mRNA. [Solution] The present invention relates to enhanced antisense oligonucleotides targeting FUBP1 or its conjugates for use in the treatment and / or prevention of hepatitis B virus (HBV) infection, particularly chronic HBV infection. The present invention relates in particular to the use of enhanced antisense oligonucleotides targeting FUBP1 or its conjugates for destabilizing cccDNA such as HBV cccDNA. The present invention further relates to enhanced antisense oligonucleotides targeting FUBP1 or its conjugates for use in the treatment of cancer. Pharmaceutical compositions and their use in the treatment and / or prevention of HBV infection, or their use in the treatment of cancer, are also included in the present invention.

Description

[Technical Field]

[0001] The present invention relates to enhanced antisense oligonucleotides that are complementary to Far Upstream Element-Binding Protein 1 (FUBP1) and capable of reducing FUBP1-targeted nucleic acids such as FUBP1 mRNA. The present invention relates to enhanced antisense oligonucleotides targeting FUBP1 or its conjugates for use in the treatment and / or prevention of hepatitis B virus (HBV) infection, particularly chronic HBV infection. The present invention relates in particular to the use of enhanced antisense oligonucleotides targeting FUBP1 or its conjugates for destabilizing cccDNA such as HBV cccDNA. The present invention further relates to enhanced antisense oligonucleotides targeting FUBP1 or its conjugates for use in the treatment of cancer. Pharmaceutical compositions and their use in the treatment and / or prevention of HBV infection, or their use in the treatment of cancer, are also included in the present invention. [Background technology]

[0002] Far Upstream Element-Binding Protein 1 (FUBP1 or FBP1) is a single-strand DNA-binding protein that binds to multiple DNA elements. This protein is also thought to bind to RNA and possesses 3'-5' helicase activity that exhibits in vitro activity against both DNA-DNA and RNA-RNA double helixes. FUBP1 is known to activate the transcription of the proto-oncogene c-myc by binding to the far upstream element (FUSE) located upstream of c-myc in undifferentiated cells. The protein is primarily located in the cell nucleus. Upregulation of FUBP1 has been observed in many types of cancer. Furthermore, FUBP1 can bind to and mediate the replication of RNA derived from hepatitis C virus and enterovirus (Zhang and Chen 2013 Oncogene vol 32 p.2907-2916).

[0003] FUBP1 has also been identified in hepatocellular carcinoma (HCC) and is suggested to be involved in HCC tumorigenesis (Ramdzan et al 2008 Proteomics Vol 8 p.5086-5096). Furthermore, FUBP1 is suggested to be necessary for HCC tumor growth, as exemplified by the use of lentiviral shRNAs that target FUBP1 (Rabenhorst et al 2009 Hepatology vol 50 p 1121-1129).

[0004] Knockdown of FUBP1 using lentiviral shRNA has been shown to enhance the treatment response in ovarian cancer (Zhang et al 2017 Oncology Letters Vol 14 p.5819-5824).

[0005] International Publication No. 2004 / 027061 discloses a screening method that includes a step of analyzing whether a test substance inhibits FBP (FBP is now called FUBP) and a pharmaceutical composition for treating proliferative disorders that contains a substance that inhibits FBP as an active ingredient.

[0006] Poly(U)-binding splicing factor 60 (PUF 60) is a potential regulator of both transcriptional and post-transcriptional processes in HBV pregenomic expression. PUF 60 is known to form a complex with FUBP1 in connection with c-myc repression. However, FUBP1 is not involved in PUF 60-dependent regulation of HBV pregenomic expression (Sun et al 2017 Scientific Reports 7:12874).

[0007] HBV infection remains a major global health problem affecting an estimated 350 million chronic carriers. Approximately 25% of carriers eventually die from chronic hepatitis, cirrhosis, or liver cancer. Hepatitis B virus is the second most important carcinogen after tobacco and causes 60-80% of all primary liver cancers. HBV is 100 times more infectious than HIV.

[0008] Hepatitis B virus (HBV) is a partially double-stranded DNA virus with an envelope. The compact 3.2kb HBV genome consists of four overlapping open reading frames (ORFs), each encoding the core, polymerase (Pol), envelope, and X protein. The Pol ORF is the longest, with the envelope ORF located within it, while the X and core ORFs overlap with the Pol ORF. The HBV genome replication cycle has two main events: 1) the generation of closed circular DNA (cccDNA) from relaxed circular DNA (RC DNA), and 2) the generation of RC DNA by reverse transcription of pregenomic RNA (pgRNA). RC DNA can originate from the infecting viral particle or arise as an intracellular replication intermediate.

[0009] HBsAg quantification is an important biomarker for prognosis and treatment response in chronic hepatitis B, where loss of circulating HBsAg is seen as a crucial event in achieving cure in chronically infected patients. However, HBsAg loss and achievement of seroconversion (functional cure) are rarely observed in chronically infected patients. Hepatitis B e antigen (also called HBV envelope antigen or HBeAg) is a viral protein secreted by hepatitis B-infected cells. HBeAg is associated with chronic hepatitis B infection and is used as a marker of active viral disease and the degree of infection in patients.

[0010] Therefore, reducing HBeAg secretion in addition to HBsAg secretion may result in improved inhibition of the development of chronic HBV infection compared to inhibiting HBsAg secretion alone.

[0011] Current therapies, such as nucleoside(tide) analogs, are molecules that inhibit HBV DNA synthesis but do not aim to reduce HBsAg levels. Most therapies currently under development aim to achieve functional cure, defined as persistent HBsAg loss with or without anti-HBs seroconversion, using undetectable serum DNA and transcriptionally inactive cccDNA, but do not address cccDNA persistence. In contrast, complete cure of HBV infection is defined as cccDNA loss combined with persistent HBV DNA and HBsAg loss. The persistence of cccDNA in infected hepatocytes is a major barrier to eradicating the virus in patients with chronic hepatitis B virus (CHB), highlighting the urgent need to develop new therapies for complete HBV cure that eliminate cccDNA.

[0012] International Publication No. 2019 / 193165 demonstrated that inhibition of FUBP1 function using small molecules, siRNA, or LNA antisense oligonucleotides resulted in a reduction of HBV cccDNA. In the examples section of International Publication No. 2019 / 193165, single-stranded LNA gapmer oligonucleotides were analyzed, and these were able to inhibit FUBP1 expression.

[0013] There is a need for therapeutic agents that can specifically inhibit FUBP1. The inventors screened over 2000 antisense oligonucleotides targeting human FUBP1 and identified sequences and compounds that are particularly potent and effective in specifically targeting human FUBP1. Specifically, nine alternating flank gapmers were identified, resulting in strong downregulation of human FUBP1 in vitro. Eight of the compounds target a region within exon 14 of human FUBP1, and one compound targets a region within exon 20 (CMP number 18_1).

[0014] Purpose of the invention This invention provides antisense oligonucleotides and their conjugates that regulate FUBP1 expression. The inventors have identified specific target sequences located in exon 14 or exon 20 of human FUBP1 premRNA that can be targeted by antisense oligonucleotides or their conjugates to result in effective FUBP1 inhibition. In particular, targeting positions 16184-16205 of SEQ ID NO: 1 is advantageous from the viewpoint of reducing FUBP1.

[0015] Furthermore, the inventors identified a specific target sequence located in exon 20 of human FUBP1 premRNA that can be targeted by antisense oligonucleotides or their conjugates to effectively inhibit FUBP1. In particular, targeting positions 30536-30553 of SEQ ID NO: 1 is advantageous from the viewpoint of reducing FUBP1 levels.

[0016] Therefore, an object of the present invention is to provide an enhanced antisense oligonucleotide or its conjugate that targets FUBP1, which can inhibit FUBP1 expression in vitro and in vivo, thereby reducing cccDNA in HBV-infected cells. The enhanced antisense oligonucleotide 1 or its conjugate that targets FUBP can be used for the treatment and / or prevention of HBV infection or for the treatment of cancer. [Overview of the Initiative]

[0017] The present invention relates to antisense oligonucleotides or their conjugates that target FUBP1 (Far upstream element-binding protein 1) nucleic acid, such as mammalian FUBP1 nucleic acid, and can inhibit the expression of said nucleic acid in cells expressing said nucleic acid, and to the use of such antisense oligonucleotides in pharmaceuticals. The antisense oligonucleotides are complementary to mammalian FUBP1 nucleic acid, such as human FUBP1.

[0018] The present invention provides an antisense oligonucleotide containing a sequence of nucleotides that is complementary, for example, completely complementary, to the nucleotide region 16184-16205 of human FUBP1 premRNA (shown in SEQ ID NO: 1).

[0019] Furthermore, the present invention provides an antisense oligonucleotide containing a continuous nucleotide sequence that is complementary, for example, completely complementary, to the nucleotide region 30536-30553 of human FUBP1 premRNA (shown in SEQ ID NO: 1).

[0020] In some embodiments, the antisense oligonucleotide or sequential nucleotide sequence is complementary, for example, perfectly complementary, to the region of nucleotides 16184-16200 of SEQ ID NO: 1.

[0021] In some embodiments, the antisense oligonucleotide or sequential nucleotide sequence is complementary, for example, perfectly complementary, to the region of nucleotides 16186-16203 of SEQ ID NO: 1.

[0022] In some embodiments, the antisense oligonucleotide or sequential nucleotide sequence is complementary, for example, perfectly complementary, to the region of nucleotides 30536-30553 of SEQ ID NO: 1.

[0023] In some embodiments, the antisense oligonucleotide or sequence of nucleotides is complementary to the region of nucleotides 16188-16205 of SEQ ID NO: 1, for example, perfectly complementary. In some embodiments, the antisense oligonucleotide or sequence of nucleotides is complementary to the region of nucleotides 16189-16205 of SEQ ID NO: 1, for example, perfectly complementary.

[0024] The antisense oligonucleotides of the present invention are typically 12 to 30 nucleotides long, for example 12 to 22, for example 16 to 20 nucleotides, and include a sequence of at least 12 nucleotides, for example 13, 14, 15, 16, 17, or 18 nucleotides that is complementary, for example perfectly complementary, to a region of human FUBP1 premRNA (shown in SEQ ID NO: 1) selected from regions derived from nucleotides 16184 to 16205, 16184 to 16200, 16186 to 16203, 16188 to 16205, 16189 to 16205, and 30536 to 30553 of SEQ ID NO: 1.

[0025] The present invention provides an antisense oligonucleotide having a length of 12 to 22 nucleotides, comprising a continuous nucleotide sequence of 12 to 22 nucleotides, wherein the continuous nucleotide sequence is complementary, for example, perfectly complementary, to SEQ ID NO: 10.

[0026] The present invention provides an antisense oligonucleotide having a length of 12 to 20 nucleotides (e.g., 15, 16, 17, or 18 nucleotides), comprising a continuous nucleotide sequence of 12 to 18 nucleotides (e.g., 15, 16, 17, or 18 nucleotides), wherein the continuous nucleotide sequence is complementary, for example, perfectly complementary, to SEQ ID NO: 11.

[0027] The present invention provides an antisense oligonucleotide having a length of 12 to 20 nucleotides (e.g., 15, 16, 17, or 18 nucleotides), comprising a continuous nucleotide sequence of 12 to 18 nucleotides (e.g., 15, 16, 17, or 18 nucleotides), wherein the continuous nucleotide sequence is complementary, for example, perfectly complementary, to SEQ ID NO: 19.

[0028] The present invention provides an antisense oligonucleotide having a length of 10 to 30 nucleotides, comprising a sequence of nucleotides having a length of 10 to 30 nucleotides, wherein the sequence of nucleotides is selected from the group consisting of SEQ ID NOs: 6, 7, 8, 9, and 18; or is 100% identical to at least 14 of the sequence of nucleotides.

[0029] The present invention provides an antisense oligonucleotide having a length of 10 to 30 nucleotides, comprising a continuous nucleotide sequence of 10 to 30 nucleotides, wherein the continuous nucleotide sequence is a sequence selected from the group consisting of SEQ ID NOs: 6, 7, 8, 9, and 18, or is 100% identical to at least 15 of those continuous nucleotides.

[0030] The present invention provides an antisense oligonucleotide having a length of 10 to 30 nucleotides, comprising a continuous nucleotide sequence of 10 to 30 nucleotides, wherein the continuous nucleotide sequence is a sequence selected from the group consisting of SEQ ID NOs: 6, 7, 8, 9, and 18, or is 100% identical to at least 16 of those continuous nucleotides.

[0031] The present invention provides an antisense oligonucleotide comprising a sequence selected from the group consisting of SEQ ID NOs: 6, 7, 8, 9, and 18, or a sequence of nucleotides that is 100% identical to 14, 15, 16, or 17 consecutive nucleotides thereof.

[0032] The present invention provides an antisense oligonucleotide comprising (or consisting of) a continuous nucleotide sequence selected from the group consisting of SEQ ID NOs: 6, 7, 8, 9, and 18.

[0033] The present invention provides an antisense oligonucleotide containing a sequence of nucleotides that is 100% identical to sequence number 6 (CTTATGCTTTTTATGGT), or its 14, 15, or 16 consecutive nucleotides.

[0034] The present invention provides an antisense oligonucleotide containing a sequence of nucleotides that is 100% identical to sequence number 7 (CTTATGCTTTTTATGGTT), or its 14, 15, 16, or 17 consecutive nucleotides.

[0035] The present invention provides an antisense oligonucleotide containing a sequence of nucleotides that is 100% identical to sequence number 8 (GCTTTTTATGGTTTCAC), or its 14, 15, or 16 consecutive nucleotides.

[0036] The present invention provides an antisense oligonucleotide containing a sequence of nucleotides that is 100% identical to sequence number 9 (TATGCTTTTTATGGTTTC), or its 14th, 15th, 16th, or 17th consecutive nucleotides.

[0037] The present invention provides an antisense oligonucleotide containing a sequence of nucleotides that is 100% identical to sequence number 18 (ACCAATTTTCATTTCTAC), or its 14th, 15th, 16th, or 17th consecutive nucleotides.

[0038] The present invention is as follows: CTTatGctttttatgGT (SEQ ID NO: 6, Compound ID: 6_1) CTTaTgctttttatgGT (SEQ ID NO: 6, Compound No. 6_2), CTtATgctttttatgGTT (Sequence ID 7, Compound No. 7_1), CTtAtgctttttatgGTT (Sequence ID 7, Compound No. 7_2), CTtAtgctttttatGgTT (Sequence ID 7, Compound No. 7_3), CTtAtgctttttatGGTT (Sequence ID 7, Compound No. 7_4), GcttTttatggtTtCAC (Sequence ID 8, Compound No. 8_1) TATgcTttttatggtTTC (SEQ ID NO: 9, Compound No. 9_1), and AcCAAttttcatttCtAC (Sequence ID 18, Compound No. 18_1) An antisense oligonucleotide selected from, The present invention provides antisense oligonucleotides in which uppercase letters represent β-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA Cs are LNA5-methylcytosine, and all nucleoside bonds are phosphorothioate nucleoside bonds.

[0039] The present invention also provides pharmaceutically acceptable salts of the antisense oligonucleotides of the present invention.

[0040] The present invention provides antisense oligonucleotides or pharmaceutically acceptable salts thereof selected from the group listed in Table 1. [Table 1] Helm annotation key: [LR](G) is a β-D-oxy-LNA guanine nucleoside, [LR](T) is a β-D-oxy-LNA thymine nucleoside, [LR](A) is a β-D-oxy-LNA adenine nucleoside, [LR]([5meC] is β-D-oxy-LNA 5-methylcytosine nucleoside, [dR](G) is a DNA guanine nucleoside, [dR](T) is a DNA thymine nucleoside, [dR](A) is a DNA adenine nucleoside, [dR]([C] is a DNA cytosine nucleoside, [sP] is a phosphorothioate nucleoside bond, P is a phosphodiester nucleoside bond.

[0041] Accordingly, the present invention provides antisense oligonucleotides selected from the group consisting of compound numbers 6_1, 6_2, 7_1, 7_2, 7_3, 7_4; 8_1 and 9_1.

[0042] The present invention further provides an antisense oligonucleotide having compound number 18_1.

[0043] In one embodiment, the antisense oligonucleotide is not antisense oligonucleotide compound number 53_1 or 54_1 as disclosed in International Publication No. 2019 / 193165 (see also Table 7 in the Examples section).

[0044] In one embodiment, the antisense oligonucleotide is not antisense oligonucleotide compound numbers 78_1 and 79_1 as disclosed in International Publication No. 2019 / 193165 (see also Table 7 in the Examples section).

[0045] The present invention further provides a conjugate comprising an antisense oligonucleotide and at least one conjugate moiety covalently bonded to the antisense oligonucleotide.

[0046] In some embodiments, the conjugate moiety can bind to an asialoglycoprotein receptor, such as the human asialoglycoprotein receptor. For example, the conjugate moiety may include at least one asialoglycoprotein receptor-targeting moiety selected from the group consisting of galactose, galactosamine, N-formyl-galactosamine, N-acetylgalactosamine, N-propionyl-galactosamine, Nn-butanoyl-galactosamine, and N-isobutanoylgalaxamine.

[0047] In some embodiments, the asialoglycoprotein receptor targeting moiety is N-acetylgalactosamine (GalNAc). Therefore, the antisense oligonucleotide of the present invention can be conjugated to at least one conjugate moiety containing at least one N-acetylgalactosamine (GalNAc) moiety, for example, at least one conjugate moiety containing at least one N-acetylgalactosamine (GalNAc) moiety as described below. According to one aspect of the present invention, the conjugate moiety is a GalNAc residue R as described below herein.

[0048] In some embodiments, the conjugate moiety is at least trivalent, for example, divalent, trivalent, or tetravalent GalNAc residue R. Preferably, the conjugate moiety is a trivalent GalNAc residue R. As used herein, the term “trivalent GalNAc residue” refers to a residue comprising three N-acetylgalactosamine moieties, i.e., preferably three moieties of the following formula: [ka]

[0049] The conjugate moiety or GalNAc residue R and the antisense oligonucleotide may be linked together via a linker L, such as a biocleavable linker L. Therefore, the conjugate compound may contain linkers L positioned between the antisense oligonucleotide and the conjugate moiety or GalNAc residue R, respectively.

[0050] In some embodiments, linker L comprises 1 to 10 linked nucleosides, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 linked nucleosides, e.g., 2 to 6 linked nucleosides, e.g., 2 to 5 linked nucleosides, e.g., 2 to 4 linked nucleosides. In some embodiments, the linker comprises two linked nucleotides. Thus, the nucleosides can be DNA nucleosides. Typically, the nucleosides are linked via phosphodiester nucleoside bonds. Furthermore, linker L may be linked to an antisense compound via phosphodiester nucleoside bonds.

[0051] Exemplary conjugates are provided in Table 2 (HELM annotation format) and in Figures 1-8, 8.1, and 10.

[0052] The present invention provides a conjugate selected from the group of conjugates listed in Table 2, or a pharmaceutically acceptable salt thereof. [Table 2]

[0053] In the table above, [5gn2c6] is a GalNAc residue R with the following formula: [ka]

[0054] It should be understood that R, as shown in the figure above and used in the table above, is a mixture of the two stereoisomers shown in Figures 9D1 and 9D2.

[0055] According to a further aspect of the present invention, R shown in the above figures and used in the above table is the stereoisomer shown in Figure 9D1.

[0056] According to a further aspect of the present invention, R as shown in the above figures and used in the above table is the stereoisomer shown in Figure 9D1. The structures of the conjugates provided in Table 2 are shown in Figures 1 to 8 and Figure 8.1.

[0057] The present invention provides the conjugate shown in Figure 1 or a pharmaceutically acceptable salt thereof.

[0058] The present invention provides an antisense oligonucleotide of compound number 6_1 or a pharmaceutically acceptable salt thereof.

[0059] The present invention provides the conjugate shown in Figure 2 or a pharmaceutically acceptable salt thereof.

[0060] The present invention provides an antisense oligonucleotide of compound number 6_2 or a pharmaceutically acceptable salt thereof.

[0061] The present invention provides the conjugate shown in Figure 3 or a pharmaceutically acceptable salt thereof.

[0062] The present invention provides an antisense oligonucleotide of compound number 7_1 or a pharmaceutically acceptable salt thereof.

[0063] The present invention provides the conjugate shown in Figure 4 or a pharmaceutically acceptable salt thereof.

[0064] The present invention provides an antisense oligonucleotide of compound number 7_2 or a pharmaceutically acceptable salt thereof.

[0065] The present invention provides the conjugate shown in Figure 5 or a pharmaceutically acceptable salt thereof.

[0066] The present invention provides an antisense oligonucleotide of compound number 7_3 or a pharmaceutically acceptable salt thereof.

[0067] The present invention provides the conjugate shown in Figure 6 or a pharmaceutically acceptable salt thereof.

[0068] The present invention provides an antisense oligonucleotide of compound number 7_4 or a pharmaceutically acceptable salt thereof.

[0069] The present invention provides the conjugate shown in Figure 7 or a pharmaceutically acceptable salt thereof.

[0070] The present invention provides an antisense oligonucleotide of compound number 8_1 or a pharmaceutically acceptable salt thereof.

[0071] The present invention provides the conjugate shown in Figure 8 or a pharmaceutically acceptable salt thereof.

[0072] The present invention provides an antisense oligonucleotide of compound number 9_1 or a pharmaceutically acceptable salt thereof.

[0073] The present invention provides an antisense oligonucleotide of compound number 18_1 or a pharmaceutically acceptable salt thereof.

[0074] The present invention provides the conjugate shown in Figure 8.1 or a pharmaceutically acceptable salt thereof.

[0075] Compound of formula (I) The present invention also provides compounds of the following formula (I). [ka] During the ceremony, n is either 0 or 1. p is either 0 or 1. However, if n is 1, then p is preferably 1. Furthermore, when n is 0 and p is 0, R is preferably H. L is a linker, preferably L is a linker containing or consisting of 2 to 10 nucleosides, for example, 2 to 5 nucleosides. R is a GalNAc residue, preferably a trivalent GalNAc residue. A is an antisense oligonucleotide residue according to the present invention.

[0076] The term "antisense oligonucleotide residue" is derived from its 5' end -(L) n -(OP(=O)(-OH)-) p This refers to antisense oligonucleotides according to the present invention that are bound to residue R via -, for example, the antisense oligonucleotides shown in Table 6. Preferred antisense oligonucleotide residues are shown in Figures 1A, 2A, 3A, 4A, 5A, 6A, 7A, and 8A. Even more preferred antisense oligonucleotide residues are shown in Figure 8.1A.

[0077] GalNAc residue R R is a GalNAc residue, preferably a trivalent GalNAc residue. As used herein, the term "GalNAc residue" refers to a residue containing at least one N-acetylgalactosamine (GalNAc) moiety, i.e., at least one part of the following formula: [ka]

[0078] As used herein, the term “trivalent GalNAc residue” refers to a residue comprising three N-acetylgalactosamine (GalNAc) moieties, preferably three moieties of the following formula: [ka]

[0079] Preferably, the GalNAc residue consists of at least one, preferably three, GalNAc constituent units having the following structure ( La ) including, [ka] During the ceremony, the linker ais selected from an alkyl group, an alkyl-oxy-alkyl group, an alkyl group containing at least one phosphodiester bond, an alkyl group containing at least one amide bond, an alkyl-oxy-alkyl group containing at least one phosphodiester bond, and an alkyl-oxy-alkyl group containing at least one amide bond.

[0080] The term "alkyl" refers to a substituted or unsubstituted linear or branched alkyl group, such as a C1-C20 alkyl group, preferably a C2-C8, for example a C2, C3, C4, C5, C6, C7 or C8 alkyl group. Preferably, the alkyl group is unsubstituted, more preferably a linear and unsubstituted alkyl group.

[0081] The term "alkyloxyalkyl" group refers to at least two alkyl groups bonded via oxygen, preferably an ethyl-oxy-ethyl group, for example -(CH2-O) x - group, and the integer x is preferably in the range of 2-20, more preferably in the range of 2-6, for example 2, 3, 4, 5 or 6, and more preferably x is 3 or 5.

[0082] According to one aspect of the present invention, the GalNAc building block (L a ) is selected from the group of the following structures (L a ).

[0083] When more than one residue (L a ), such as three residues in a trivalent GalNAc residue, is present in the GalNAc residue, it is preferred that all residues are the same.

[0084] Most preferably, L a has the following structure.

Chemical formula

[0085] When the conjugate moiety R contains a plurality, for example preferably three GalNAc moieties, R is a GalNAc building block (L aIn addition to a ), preferably the structural unit (L n -(O-P(=O)(-OH)-) p - is bonded to the antisense oligonucleotide residue A via a polyvalent, preferably tetravalent, structural unit (L b ).

[0086] L b is preferably selected from one of the following structures.

Chemical formula

[0087] More preferably, L b has the following structure.

Chemical formula

[0088] L b is understood to have either the structure L b * or the structure L b **, or a mixture thereof. According to a preferred embodiment, L b is a mixture of L b * and L b **.

Chemical formula

[0089] Therefore, the conjugate moiety R preferably contains the structure (L a )3-L b -, more preferably R contains one of the following structures,

Chemical formula

Chemical formula

[0090] (L a )3-L b If the following applies, [ka]

[0091] L a The more more preferably, is selected from the group consisting of the following: [ka]

[0092] (L a )3-L b If the following applies, [ka] or [ka] Preferably, [ka] And L a Preferably, the following: [ka]

[0093] Optionally, the conjugate moiety R further comprises a linker L c and thus R preferably has the structure (L a )3-L b -(L c ) c -, where the integer c is 1 or 0.

[0094] Such linker compounds are known to those skilled in the art and are appropriately selected to attach (L n )3-L p to the remainder of the compound, the antisense oligonucleotide residue, i.e., via -(L) a )3-L b -(O-P(=O)(-OH)-).

[0095] L b Depending on the structure of L c , L c is selected from the group consisting of alkyl, alkyl-oxy-alkyl, amino-alkyl (-NH-alkyl-), amino-alkyl-oxy-alkyl, non-natural amino acid residues, and natural amino acid residues. According to one aspect of the invention, L

[0096] According to one aspect of the invention, R is (L a )3-L b -(L c ) c , c = 1, (La)3-Lb-(Lc)c, and (L a )3-L b is as follows.

Chemical formula

[0097] L c is preferably an amino-alkyl group or an amino acid such as a substituted or unsubstituted lysine group. In particular, L C is selected from the group consisting of, for example, [ka] The amino group is L b It binds to the carbonyl group, thereby forming an amide bond. Preferred residues R in this embodiment are shown in Figures 9A1, 9A2; 9C1, 9C2, 9D1, and 9D2. Accordingly, according to one embodiment of the present invention, R is selected from the group consisting of residues shown in Figures 9A1, 9A2; 9C1, 9C2, 9D1, and 9D2.

[0098] According to a further aspect of the present invention, R is structure (L a )3-L b -(L c ) c It has, c is 0, (L a )3-L b The following applies: [ka]

[0099] Preferred residues R according to this embodiment of the present invention are shown in Figures 9B1 and 9B2.

[0100] According to a further aspect of the present invention, R is structure (L a )3-L b -(L c ) c (L a )3-L b The following is: [ka] Z is O. In this case, c is preferably 1 and L c The residue R is preferably an alkyl group, more preferably a C3-C6 alkyl group, more preferably a propyl group, and most preferably an n-propyl group. The preferred residue R in this embodiment is shown in Figures 9E1, 9F1, 9G1, and 9H1. Therefore, according to one embodiment of the present invention, R is selected from the group consisting of the residues shown in Figures 9E1, 9F1, 9G1, and 9H1.

[0101] According to a further aspect of the present invention, R has the structure (L a )3-L b -(L c ) c where (L a )3-L b is as follows,

Chemical formula

Chemical formula

[0102] In particular, in this case, L c is as follows.

Chemical formula

[0103] Preferred residue R according to this aspect of the present invention is shown in FIG. 9J1.

[0104] According to a further aspect of the present invention, R has the structure (L a )3-L b -(L c ) c where (L a )3-L b is as follows,

Chemical formula

[0105] According to one aspect of the present invention, R is (L a )3-L b -(L c ) c where c = 0, and is (La)3-Lb-(Lc)c, and (L a )3-L b is as follows. [ka]

[0106] Preferred residues R according to this embodiment of the present invention are shown in Figures 9L1 and 9L2.

[0107] Therefore, R is preferably selected from the residues shown in Figures 9A1, 9A2; 9C1, 9C2, 9D1, 9D2, 9E1, 9F1, 9G1, 9H1, 9I1, 9J1, 9L1, 9L2 and mixtures thereof, for example, a mixture of stereoisomers of 9A1 and 9A2; 9C1 and 9C2 or 9D1 and 9D2; more preferably R is selected from the residues shown in 9D1 and 9D2 and mixtures thereof; more preferably R is a mixture of the residues shown in 9D1 and 9D2, having a molar ratio of 9D1 to 9D2 in the range of, for example, 10:90 to 90:10, for example, 30:70 to 70:30, or for example, 45:55 to 55:45.

[0108] Therefore, compound (I) is preferably selected from the compounds shown in Figures 10A1, 10A2; 10C1, 10C2, 10D1, 10D2, 10E1, 10F1, 10G1, 10H1, 10I1, 10J1, 10L1, 10L2 and mixtures thereof, for example, a mixture of stereoisomers of 10A1 and 10A2; 10C1 and 10C2 or 10D1 and 10D2 shown in 10D1 and 10D2, and more preferably, compound (I) is a mixture of the compounds shown in 10D1 and 10D2, such as a mixture having a molar ratio of 10D1 to 10D2 in the range of 10:90 to 90:10, for example, in the range of 30:70 to 70:30, for example, in the range of 45:55 to 55:45.

[0109] Linker L In the above formula, L is a linker as defined herein, preferably L is a linker comprising or consisting of 2 to 10 nucleosides, for example 2 to 5 nucleosides, for example 2 nucleosides, and optionally the nucleosides are phosphodiester-linked nucleosides.

[0110] Linker L comprises 1 to 10 linked nucleosides, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 linked nucleosides, for example, 2 to 6 linked nucleosides, for example, 2 to 5 linked nucleosides, for example, 2 to 4 linked nucleosides. In some embodiments, the linker comprises two linked nucleotides. Thus, the nucleosides can be DNA nucleosides. Typically, the nucleosides are linked via phosphodiester nucleoside bonds. Furthermore, linker L may be linked to an antisense compound via phosphodiester nucleoside bonds. Furthermore, linker L is bonded to conjugate moiety R via a suitable functional group, for example, via an amide, amine, ether, ester, phosphodiester (-OP(=O)(-OH)-O-) or thiophosphodiester (-OP(=S)(-OH)-O-) bond. It should be understood that L may optionally further contain an alkyl group or alkyl-oxy-alkyl group between the functional group linking L to R and the nucleoside. In this case, the nucleoside is preferably linked to an alkyl group or alkyl-oxy-alkyl group via a phosphodiester bond, which is then linked to R via a suitable functional group, such as via an amide, amine, ether, ester, phosphodiester (-OP(=O)(-OH)-O-) or thiophosphodiester (-OP(=S)(-OH)-O-) bond. According to a preferred embodiment, L is as follows: [ka]

[0111] Antisense (A) oligonucleotide residues A connects to R via its 5' end -(L) n -(OP(=O)(-OH)-) pThe antisense oligonucleotide residue according to the present invention, such as the antisense oligonucleotides shown in Table 6, is bound via the . Preferably, A is an antisense oligonucleotide residue shown in Figures 1A, 2A, 3A, 4A, 5A, 6A, 7A and 8A, or selected from the residues shown in Figures 1A, 2A, 3A, 4A, 5A, 6A, 7A, 8A and 8.1A.

[0112] According to a further aspect of the present invention, A is an antisense oligonucleotide residue shown in Figure 8.1A.

[0113] Therefore, compound (I) is preferably selected from the compounds shown in Figures 10A1, 10A2; 10C1, 10C2, 10D1, 10D2, 10E1, 10F1, 10G1, 10H1, 10I1, 10J1, 10L1, 10L2, and mixtures thereof, for example, a mixture of stereoisomers of 10A1 and 10A2; 10C1 and 10C2 or 10D1 and 10D2; more preferably compound (I) is selected from the compounds shown in 10D1 and 10D2 and mixtures thereof; more preferably compound (I) is a mixture of compounds 10D1 and 10D2; preferably A is selected from the antisense oligonucleotides shown in Table 6; preferably A is shown in Figures 1A, 2A L is an antisense oligonucleotide residue selected from the residues shown in 3A, 4A, 5A, 6A, 7A, and 8A, where L is a linker containing or consisting of 2 to 10 nucleosides, e.g., 2 to 5 nucleosides, e.g., 2 nucleosides, and optionally, the nucleosides are phosphodiester-linked nucleosides.

[0114] More preferably, L is as follows: [ka]

[0115] In a further embodiment, R is a residue having structure (I), [ka]

[0116] L is a linker as defined herein, preferably L is a linker comprising or consisting of 2 to 10 nucleosides, for example 2 to 5 nucleosides, for example 2 nucleosides, optionally the nucleosides are phosphodiester-linked nucleosides, and more preferably L is as follows: [ka] and A is an antisense oligonucleotide according to the present invention, for example, the antisense oligonucleotides shown in Table 6.

[0117] According to one aspect of the present invention, A is an antisense nucleotide residue selected from the residues shown in Figures 1A, 2A, 3A, 4A, 5A, 6A, 7A, and 8A, or from the residues shown in Figures 1A, 2A, 3A, 4A, 5A, 6A, 7A, 8A, and 8.1A.

[0118] According to a further aspect of the present invention, A is an antisense oligonucleotide residue shown in Figure 8.1A.

[0119] The present invention provides a pharmaceutical composition comprising the antisense oligonucleotide or conjugate of the present invention and a pharmaceutically acceptable diluent, carrier, salt, and / or adjuvant.

[0120] The present invention provides pharmaceutically acceptable salts of antisense oligonucleotides or their conjugates. In some embodiments, the pharmaceutically acceptable salts are selected from the group consisting of sodium salts, potassium salts, and ammonium salts.

[0121] The present invention provides a pharmaceutical solution of the antisense oligonucleotide or its conjugate, comprising the antisense oligonucleotide or its conjugate and a pharmaceutically acceptable solvent such as phosphate-buffered saline. Alternatively, the solvent may be water or a sodium chloride solution.

[0122] The present invention provides antisense oligonucleotides or their conjugates in solid powder form, such as in the form of freeze-dried powder.

[0123] The present invention provides pharmaceutically acceptable salts of the antisense oligonucleotide or its conjugate.

[0124] The present invention provides a pharmaceutically acceptable salt of an antisense oligonucleotide according to the present invention or a conjugate of the present invention, wherein the pharmaceutically acceptable salt is a sodium salt, or the salt is a potassium salt.

[0125] The present invention provides a pharmaceutical composition comprising an antisense oligonucleotide of the present invention, a conjugate of the present invention, or a salt of the present invention, and a pharmaceutically acceptable diluent, solvent, carrier, salt, and / or adjuvant.

[0126] The present invention provides a method for inhibiting FUBP1 expression in target cells expressing FUBP1, comprising administering an effective amount of the antisense oligonucleotide of the present invention, or the conjugate of the present invention, or the salt of the present invention, or the composition of the present invention to said cells. The method may be in vivo or in vitro.

[0127] The present invention provides a method for treating and / or preventing HBV infection in a subject such as a human, comprising administering a therapeutically effective amount or a preventively effective amount of the antisense oligonucleotide of the present invention, or a conjugate of the present invention, or a salt of the present invention, or a composition of the present invention, to treat and / or prevent HBV infection, such as chronic HBV infection, and proliferative disorders, such as cancer, particularly hepatocellular carcinoma.

[0128] In some embodiments, the antisense oligonucleotides of the present invention, or the conjugates of the present invention, or the salts of the present invention, or the pharmaceutical compositions of the present invention are intended for use in the treatment and / or prevention of HBV infection, such as chronic HBV infection.

[0129] The present invention provides an antisense oligonucleotide, a conjugate, a pharmaceutical composition, or a salt of the present invention for use in pharmaceuticals. In a further embodiment, the present invention provides a method for inhibiting FUBP1 expression in target cells expressing FUBP1 by administering an effective amount of the antisense oligonucleotide or conjugate to cells. In a further embodiment, the present invention provides a method for an in vivo or in vitro method for inhibiting FUBP1 expression in target cells expressing FUBP1 by administering an effective amount of the antisense oligonucleotide or conjugate to cells. The cells may be human cells, for example, liver cells, for example, hepatocytes. In one embodiment, the cells are hepatocellular carcinoma cells.

[0130] In a further embodiment, the present invention provides a method for reducing cccDNA in HBV-infected cells by administering an effective amount of the antisense oligonucleotide or conjugate of the present invention to cells.

[0131] In a further embodiment, the present invention provides a method for an in vivo or in vitro method for reducing cccDNA in HBV-infected cells by administering an effective amount of the antisense oligonucleotide or conjugate of the present invention to cells.

[0132] In a further embodiment, the present invention provides a method for treating and / or preventing diseases selected from the group consisting of HBV infection, such as chronic HBV infection, and proliferative disorders, such as cancer, particularly hepatocellular carcinoma.

[0133] In a further embodiment, the present invention provides antisense oligonucleotides or conjugates of the present invention, or pharmaceutical compositions of the present invention, for use in the manufacture of pharmaceuticals for treating and / or preventing diseases selected from the group consisting of HBV infection, such as chronic HBV infection, and proliferative disorders, such as cancer, particularly hepatocellular carcinoma.

[0134] In a further embodiment, the present invention provides an antisense oligonucleotide or conjugate of the present invention, or a pharmaceutical composition of the present invention, for use in the manufacture of an antiviral drug.

[0135] In a further embodiment, the present invention provides an antisense oligonucleotide or conjugate of the present invention, or a pharmaceutical composition of the present invention, for use in the manufacture of an antitumor drug.

[0136] The present invention provides antisense oligonucleotides, conjugates, or pharmaceutical compositions of the present invention for use in the treatment and / or prevention of diseases selected from the group consisting of HBV infection, such as chronic HBV infection, and proliferative disorders, such as cancer, particularly hepatocellular carcinoma.

[0137] Sequence List The sequence listing submitted with this application is incorporated herein by reference. In the event of any discrepancy between the sequence listing and the specification or drawings, the information disclosed in the specification (including the drawings) shall be deemed correct. [Brief explanation of the drawing]

[0138] [Figure 1] Compound 6_1 (SEQ ID NO: 6) conjugated to the GalNAc moiety via a phosphodiester-linked DNA dinucleotide. [Figure 1A] Residue A of compound 6_1 (SEQ ID NO: 6) [Figure 2] Compound 6_2 (SEQ ID NO: 6) conjugated to the GalNAc moiety via a phosphodiester-linked DNA dinucleotide. [Figure 2A] Residue A of compound 6_2 (SEQ ID NO: 6) [Figure 3] Compound 7_1 (SEQ ID NO: 7) conjugated to the GalNAc moiety via a phosphodiester-linked DNA dinucleotide. [Figure 3A] Residue A of compound 7_1 (SEQ ID NO: 7) [Figure 4] Compound 7_2 (SEQ ID NO: 7) conjugated to the GalNAc moiety via a phosphodiester-linked DNA dinucleotide. [Figure 4A] Residue A of compound 7_2 (SEQ ID NO: 7) [Figure 5] Compound 7_3 (SEQ ID NO: 7) conjugated to the GalNAc moiety via a phosphodiester-linked DNA dinucleotide. [Figure 5A] Residue of compound 7_3 (SEQ ID NO: 7) [Figure 6] Compound 7_4 (SEQ ID NO: 7) conjugated to the GalNAc moiety via a phosphodiester-linked DNA dinucleotide. [Figure 6A] Residue A of compound 7_4 (SEQ ID NO: 7) [Figure 7] Compound 8_1 (SEQ ID NO: 8) conjugated to the GalNAc moiety via a phosphodiester-linked DNA dinucleotide. [Figure 7A] Residue A of compound 8_1 (SEQ ID NO: 8) [Figure 8] Compound 9_1 (SEQ ID NO: 9) conjugated to the GalNAc moiety via a phosphodiester-linked DNA dinucleotide. [Figure 8A]Residue A of compound 9_1 (SEQ ID NO: 9) [Figure 8.1] Compound 18_1 (SEQ ID NO: 18) conjugated to the GalNAc moiety via a phosphodiester-linked DNA dinucleotide. [Figure 8.1A] Residue A of compound 18_1 (SEQ ID NO: 18) [Figure 9] Figure 9 shows an exemplary GalNAc moiety. Compound K in Figure 9L consists of monomeric GalNAc phosphoramidite added to oligonucleotide while still on a solid support as part of the synthesis, where X is S or O, Y is S or O, and n=1 to 3 (see International Publication No. 2017 / 178656). Figures 9B and 9D, also referred to herein as GalNAc2 or GN2, represent the absence and presence of a C6 linker, respectively. [Figure 10] Figure 10 shows exemplary antisense oligonucleotide conjugates. The compounds in Figures 10A-D include a dyridine brancher molecule, a PEG3 spacer, and three terminal GalNAc carbohydrate moieties. In the compounds in Figures 10A and 10B, the oligonucleotide is preferably directly bound to the asialocrypoprotein receptor targeting conjugate moiety without a linker. In the compounds in Figures 10C and 10D, the oligonucleotide is bound to the asialocrypoprotein receptor targeting conjugate moiety via a C6 linker. The compounds in Figures 10E-J include commercially available trebler brancher molecules and spacers of various lengths and structures, as well as three terminal GalNAc carbohydrate moieties. Compound K in Figure 10L consists of monomeric GalNAc phosphoramidite added to the oligonucleotide while it is still on a solid support as part of the synthesis, where X=S or O, Y is S or O, and n=1-3 (see International Publication No. 2017 / 178656). [Figure 11] Figure 11 shows the results of the in vitro efficacy analysis of anti-FUBP1 compounds in HeLa cells. FUBP1 mRNA levels are normalized and shown as a percentage of the control. [Figure 12]Target binding: FUBP1 mRNA. As described in Example 3, four antisense oligonucleotide compounds were tested in HBV-infected PHH cells. Each compound was delivered to cells at a concentration of 10 μM once a week for 3 weeks. One week after the last treatment, FUBP1 mRNA target KD was evaluated. Total RNA was extracted from cells using the MagNA Pure robot and the MagNA Pure 96 Cellular RNA Large Volume Kit according to the manufacturer's protocol, and FUBP1 mRNA was quantified by TaqMan qPCR. This figure shows the residual expression of target mRNA compared to a negative control (NDC=1) using oligos tested at 10 μM. Data are normalized to the human GUS B reference gene, and the mean + SD from two biological replicas is reported for each oligo tested. 50% and 20% FCs are highlighted on the graph. CMP number 7_3 represents the best FUBP1 mRNA KD, with 80% reduced mRNA expression at 10 μM. CMP number 18_1 exhibits the strongest effect in reducing FUBP1 mRNA, comparable to oligonucleotides with CMP number 7_3, compared to prior art oligonucleotides (CMP numbers 35_1 and 50_1). Both reduce target mRNA expression by approximately 80% at 10 μM compared to NDC (see Example 3 for more details). [Figure 13] The in vivo liver PK / PD correlation of oligonucleotides having CMP numbers 7_3 and 18_1 conjugated to the GalNAc portion via phosphodiester-linked DNA dinucleotides was evaluated in a single-dose mouse study (Conj. = conjugate; see Example 4 for further details).

[0139] definition HBV infection The term "hepatitis B virus infection" or "HBV infection" is commonly known in the field to refer to an infectious disease caused by the hepatitis B virus (HBV) that affects the liver. HBV infection can be acute or chronic. Chronic hepatitis B virus (CHB) infection is a global disease burden affecting 248 million people worldwide. Approximately 686,000 deaths per year are attributable to HBV-related end-stage liver disease and hepatocellular carcinoma (HCC) (GBD, 2013; Schweitzer et al., 2015). The WHO predicted that without further intervention, the number of CHB infections would remain at current high levels for the next 40-50 years, with a cumulative 20 million deaths between 2015 and 2030 (WHO, 2016). CHB infection is not a homogeneous disease that presents with specific clinical symptoms. Infected individuals progress through several stages of CHB-related liver disease throughout their lives. These disease stages also form the basis for standard of care (SOC) treatment. Current guidelines recommend treating only specific individuals infected with CHB based on three criteria: serum ALT levels, HBV DNA levels, and severity of liver disease (EASL, 2017). This recommendation stems from the fact that SOC, namely nucleoside analogs (NA) and pegylated interferon-alpha (PEG-IFN), are not curative and must be administered for extended periods, thereby increasing safety risks. NA effectively suppresses HBV DNA replication. However, it has very limited or no effect on other viral markers. Two characteristics of HBV infection, hepatitis B surface antigen (HBsAg) and covalent closed circular DNA (cccDNA), are the main targets of new drugs aimed at curing HBV. In the plasma of CHB patients, HBsAg subviruses (hollow particles) are 10³ to 10⁵ times more numerous than HBV virions (Ganem & Prince, 2014). This excess is thought to contribute to the immunopathogenesis of the disease, including individuals who cannot express neutralizing anti-HBs antibodies, a serological marker observed after the resolution of acute HBV infection.

[0140] In some embodiments, the term "HBV infection" refers to "chronic HBV infection."

[0141] Furthermore, this term encompasses infection by any HBV genotype.

[0142] In some embodiments, the patient being treated is infected with HBV genotype A.

[0143] In some embodiments, the patient being treated is infected with HBV genotype B.

[0144] In some embodiments, the patient being treated is infected with HBV genotype C (this was tested in Example 3 of the Examples section).

[0145] In some embodiments, the patient being treated is infected with HBV genotype D.

[0146] In some embodiments, the patient being treated is infected with HBV genotype E.

[0147] In some embodiments, the patient being treated is infected with HBV genotype F.

[0148] In some embodiments, the patient being treated is infected with HBV genotype G.

[0149] In some embodiments, the patient being treated is infected with HBV genotype H.

[0150] In some embodiments, the patient being treated is infected with HBV genotype I.

[0151] In some embodiments, the patient being treated is infected with HBV genotype J. cccDNA (covalently closed circular DNA)

[0152] cccDNA is the genetic template of the virus present in the nucleus of infected hepatocytes, producing all the HBV RNA transcripts necessary for proliferative infection and contributing to viral persistence during the natural course of chronic HBV infection (Locarnini & Zoulim (2010) "Antivir Ther." Vol. 15 Supplement, No. 3, pp. 3-14, doi:10.3851 / IMP1619). cccDNA acts as a viral reservoir and is a source of viral rebound after discontinuation of treatment, requiring long-term, sometimes lifelong, treatment. Due to its various side effects, PEG-IFN can only be administered to a small subset of CHB patients.

[0153] Therefore, there is a strong need for novel therapies that can bring about a complete cure, defined by the degradation or removal of HBV cccDNA, in the majority of CHB patients.

[0154] compound In this specification, the term “compound” means any molecule capable of inhibiting the expression or activity of FUBP1. Certain compounds of the present invention are nucleic acid molecules, such as antisense oligonucleotides according to the present invention, or any conjugates comprising such nucleic acid molecules. For example, in this specification, a compound may be a nucleic acid molecule that targets FUBP1, particularly an antisense oligonucleotide.

[0155] Oligonucleotides As used herein, the term “oligonucleotide” is defined as is generally understood by those skilled in the art to be a molecule comprising two or more covalently bonded nucleosides. Such covalently bonded nucleosides may also be referred to as nucleic acid molecules or oligomers. Oligonucleotides are typically prepared in the laboratory by solid-phase chemical synthesis, followed by purification and isolation. When referring to the sequence of an oligonucleotide, the sequence or order of the nucleic acid base portions of the covalently bonded nucleotide or nucleoside, or their modifications, is referred to. The oligonucleotides of the present invention are artificial, chemically synthesized, and typically purified or isolated. The oligonucleotides of the present invention may contain one or more modified nucleosides, such as 2'-sugar modified nucleosides. The oligonucleotides of the present invention may contain one or more modified nucleoside bonds, such as one or more phosphorothioate nucleoside bonds.

[0156] Antisense oligonucleotides As used herein, the terms “antisense oligonucleotide” or “ASO” are defined as oligonucleotides capable of regulating the expression of a target gene by hybridizing to a target nucleic acid, particularly a continuous sequence on the target nucleic acid. Antisense oligonucleotides are not inherently double-stranded and are therefore not siRNA or shRNA. Preferably, the antisense oligonucleotides of the present invention are single-stranded. It is understood that single-stranded oligonucleotides of the present invention can form hairpin or intermolecular double-stranded structures (double helixes between two molecules of the same oligonucleotide) as long as the degree of intra- or inter-complementarity over the entire length of the oligonucleotide is less than 50%.

[0157] In some embodiments, the single-stranded antisense oligonucleotide of the present invention may not contain an RNA nucleoside.

[0158] Advantageously, the oligonucleotide of the present invention comprises one or more modified nucleosides or nucleotides, such as 2'-saccharide-modified nucleosides. Furthermore, it is advantageous that the unmodified nucleosides are DNA nucleosides.

[0159] Sequential nucleotide sequence The term “continuous nucleotide sequence” refers to a region of oligonucleotide complementary to the target nucleic acid. This term is used herein interchangeably with the terms “continuous nucleic acid base sequence” and “oligonucleotide motif sequence.” In some embodiments, all nucleosides of the oligonucleotide constitute a continuous nucleotide sequence. In some embodiments, the oligonucleotide includes a continuous nucleotide sequence, such as an FG-F' gapmer region, and optionally includes a nucleotide linker region that can be used to attach further nucleotides, e.g., functional groups (e.g., conjugate groups), to the continuous nucleotide sequence. The nucleotide linker region may or may not be complementary to the target nucleic acid. In some embodiments, the nucleic acid base sequence of the antisense oligonucleotide constitutes a continuous nucleotide sequence.

[0160] Nucleotides and nucleosides Nucleotides and nucleosides are the constituent units of oligonucleotides and polynucleotides, and for the purposes of this invention, include both naturally occurring and non-naturally occurring nucleotides and nucleosides. Nucleotides, such as DNA nucleotides and RNA nucleotides, naturally consist of a ribose sugar moiety, a nucleic acid base moiety, and one or more phosphate groups (which are not present in nucleosides). Nucleosides and nucleotides can also be interchangeably referred to as "units" or "monomers."

[0161] Modified nucleoside As used herein, the terms “modified nucleoside” or “nucleoside modification” refer to a nucleoside modified compared to an equivalent DNA or RNA nucleoside by introducing one or more modifications to the sugar moiety or (nucleic acid) base moiety. Advantageously, one or more modified nucleosides of the antisense oligonucleotides of the present invention include a modified sugar moiety. The term “modified nucleoside” may also be used interchangeably with the terms “nucleoside analog” or modified “unit” or modified “monomer.” A nucleoside having an unmodified DNA or RNA sugar moiety is referred to herein as a DNA or RNA nucleoside. A nucleoside having modifications to the base region of a DNA or RNA nucleoside is still generally referred to as DNA or RNA if they are Watson-Crick base-pairable.

[0162] Inter-modified nucleoside bonding The term "modified nucleoside bond" is defined as is generally understood by those skilled in the art to be a bond other than a phosphodiester (PO) bond that covalently bonds two nucleosides together. Accordingly, the oligonucleotides of the present invention may include one or more modified nucleoside bonds, such as nucleoside bonds of one or more phosphorothioates or nucleoside bonds of one or more phosphorodithioates.

[0163] In some embodiments, at least 50% of the internucleoside bonds of the oligonucleotide or its sequence of nucleotides are phosphorothioates, and at least 60%, for example, at least 70%, for example, at least 75%, for example, at least 80%, or for example, at least 90% of the internucleoside bonds of the oligonucleotide or its sequence of nucleotides are phosphorothioates. In some embodiments, all of the internucleoside bonds of the oligonucleotide or its sequence of nucleotides are phosphorothioates.

[0164] In some advantageous embodiments, all nucleoside-to-nucleoside bonds in the continuous nucleotide sequence of the oligonucleotide are phosphorothioates, or all nucleoside-to-nucleoside bonds in the oligonucleotide are phosphorothioate bonds.

[0165] Phosphothioate bonds can exist in various tautomerized forms, as shown below, for example. [ka]

[0166] As disclosed in European Patent No. 2742135, it is recognized that antisense oligonucleotides may include other nucleoside bonds (other than phosphodiesters, phosphorothioates, and phosphorodithioates), such as alkylphosphonate / methylphosphonate nucleoside bonds, which, according to European Patent No. 2742135, may be resistant, for example, within the gap region of another DNA phosphorothioate.

[0167] Nucleic acid bases The term "nucleic acid base" includes the purine (e.g., adenine and guanine) and pyrimidine (e.g., uracil, thymine, and cytosine) moieties present in nucleosides and nucleotides, which form hydrogen bonds in nucleic acid hybridization. In the context of this invention, the term "nucleic acid base" also includes modified nucleic acid bases that function during nucleic acid hybridization, although these may differ from naturally occurring nucleic acid bases. In this context, "nucleic acid base" refers to both naturally occurring nucleic acid bases such as adenine, guanine, cytosine, thymidine, uracil, xanthine, and hypoxanthine, and variants that do not exist naturally. Such variants are described, for example, in Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1.

[0168] In some embodiments, the nucleic acid base moiety is modified by replacing the purine or pyrimidine with a nucleobased base selected from modified purines or pyrimidines, such as substituted purines or pyrimidines, such as isocytosine, pseudoisocytosine, 5-methylcytosine, 5-thiazolocytosine, 5-propynylcytosine, 5-propynyluracil, 5-bromouracil, 5-thiazolouracil, 2-thiouracil, 2'thiothymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine, and 2-chloro-6-aminopurine.

[0169] The nucleic acid base portion may be represented by a letter code for each corresponding nucleic acid base, for example, A, T, G, C, or U, where each letter may optionally include a modified nucleic acid base with equivalent function. For example, in the illustrated oligonucleotide, the nucleic acid base portion is selected from A, T, G, C, and 5-methylcytosine. Optionally, 5-methylcytosine LNA nucleoside may be used for the LNA gapmer.

[0170] Modified oligonucleotides The term "modified oligonucleotide" refers to an oligonucleotide containing one or more sugar-modified nucleosides and / or intermodified nucleoside bonds. The term "chimeric oligonucleotide" is a term used in the literature to describe oligonucleotides containing sugar-modified nucleosides and DNA nucleosides. The antisense oligonucleotides of the present invention are advantageously chimeric oligonucleotides.

[0171] Complementarity The term "complementarity" describes the Watson-Crick base pairing ability of nucleosides / nucleotides. Watson-Crick base pairs are guanine (G)-cytosine (C) and adenine (A)-thymine (T) / uracil (U). Oligonucleotides may also contain nucleosides with modified nucleic acid bases; for example, 5-methylcytosine is often used in place of cytosine. Therefore, the term complementarity should be understood to encompass Watson-Crick base pairing between unmodified and modified nucleic acid bases (see, e.g., Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1).

[0172] The term "% complementary," as used herein, refers to the percentage of nucleotides in a sequence of nucleic acid molecules (e.g., oligonucleotides) that are complementary to a reference sequence (e.g., a target sequence or sequence motif) across the sequence. Therefore, the percentage of complementarity is calculated by counting the number of complementary (from Watson-Crick base pairs) nucleic acid bases between two sequences (when the oligonucleotide sequence is aligned from the target sequence 5'-3' and 3'-5'), dividing that number by the total number of nucleotides in the oligonucleotide, and multiplying by 100. In such a comparison, nucleic acid bases / nucleotides that do not align (form base pairs) are referred to as mismatches. Insertions and deletions are not permitted in the calculation of the % complementarity of a sequence of nucleotides. It will be understood that, in determining complementarity, chemical modifications of nucleic acid bases are ignored as long as the nucleic acid base retains its functional ability to form Watson-Crick base pairs (e.g., 5-methylcytosine is considered identical to cytosine for the purposes of calculating % identity).

[0173] The term "perfectly complementary" refers to 100% complementarity.

[0174] identity As used herein, the term "identity" refers to the percentage of nucleotides in a sequence of nucleic acid molecules (e.g., oligonucleotides) that are identical to a reference sequence (e.g., a sequence motif) across the sequence. Therefore, the percentage of identity is calculated by counting the number of identical (matching) aligned nucleic acid bases between two sequences (in the sequence of the compound of the present invention and the reference sequence), dividing that number by the total number of nucleotides in the oligonucleotide, and multiplying by 100. Thus, the percentage of identity = (number of matches × 100) / length of the aligned region (e.g., sequence of nucleotides). Insertions and deletions are not permitted in the calculation of the percentage of identity of a sequence of nucleotides. It will be understood that, in determining identity, chemical modifications of nucleic acid bases are ignored as long as the nucleic acid base retains its functional ability to form Watson-Crick base pairs (e.g., 5-methylcytosine is considered identical to cytosine for the purposes of calculating the percentage of identity).

[0175] Hybridization As used herein, the terms “hybridization,” “hybridizing,” or “hybridizing” should be understood as the formation of a double helix by two nucleic acid strands (e.g., an oligonucleotide and a target nucleic acid) forming hydrogen bonds between base pairs on opposing strands. The affinity of the bond between the two nucleic acid strands is the strength of the hybridization. This is defined as the melting temperature (T), which is the temperature at which half of the oligonucleotide forms a double helix with the target nucleic acid. m It is often explained by ). Under physiological conditions, T m This is not strictly proportional to affinity (Mergny and Lacroix, 2003, Oligonucleotides 13:515-537). The Gibbs free energy ΔG° at standard conditions more accurately represents binding affinity, where ΔG° = -RTln(K d The dissociation constant (K) of the reaction is determined by the reaction.dΔG° is associated with the reaction between oligonucleotides and target nucleic acids, where R is the gas constant and T is the absolute temperature. Therefore, a very low ΔG° for the reaction between oligonucleotides and target nucleic acids reflects strong hybridization between the oligonucleotides and target nucleic acids. ΔG° is the energy associated with the reaction at an aqueous concentration of 1 M, pH 7, and temperature of 37°C. Hybridization of oligonucleotides with target nucleic acids is a spontaneous reaction, and in the case of a spontaneous reaction, ΔG° is less than zero. ΔG° can be measured experimentally, for example, by using isothermal titration calorimetry (ITC) methods, as described, for example, in Hansen et al., 1965, Chem. Comm. 36-38 and Holdgate et al., 2005, Drug Discov Today. Those skilled in the art will know that commercially available instruments are available for ΔG° measurement. ΔG° can be numerically estimated using the nearest neighbor model described in Santa Lucia, 1998, Proc Natl Acad Sci USA. 95:1460-1465, and appropriately obtained thermodynamic parameters described in Sugimoto et al., 1995, Biochemistry 34:11211-11216 and McTigue et al., 2004, Biochemistry 43:5388-5405. To ensure the possibility of modulating the intended nucleic acid target by hybridization, the oligonucleotides of the present invention hybridize to target nucleic acids with an approximate ΔG° value of less than -10 kcal for oligonucleotides of 10 to 30 nucleotides in length. In some embodiments, the degree or intensity of hybridization is measured by the Gibbs free energy ΔG° at standard conditions. Oligonucleotides can hybridize to target nucleic acids with approximate ΔG° values ​​of less than -10 kcal for oligonucleotides of 8 to 30 nucleotides in length, e.g., less than -15 kcal, e.g., less than -20 kcal, and e.g., less than -25 kcal.In some embodiments, the oligonucleotide hybridizes to the target nucleic acid with an estimated ΔG° value of -10 to -60 kcal, e.g., -12 to -40, e.g., -15 to -30 kcal, or -16 to -27 kcal, e.g., -18 to -25 kcal.

[0176] target As used herein, the term “target” refers to the mammalian protein “Far Upstream Element-Binding Protein 1,” also known as “FUBP1,” “FBP,” or “FUBP” or “hDH V.” The Homo sapiens FUBP1 gene is located on chromosome 1, 77944055..77979435, in the complement (NC_000001.11, gene number 1462). The FUBP1 gene encodes an ssDNA-binding protein that activates the far upstream element of c-myc and stimulates c-myc expression in undifferentiated cells. Regulation of FUSE by FUBP occurs by single-strand binding of FUBP to the non-coding strand. The FUBP1 protein has ATP-dependent DNA helicase activity. The amino acid sequence of human FUBP1 is publicly known in the art and can be evaluated by UniProt; see, for example, UniProt entry Q96AE4 for human FUBP1 (incorporated herein by reference).

[0177] target nucleic acid According to the present invention, the target nucleic acid is a nucleic acid that encodes mammalian FUBP1, and may be, for example, a gene, RNA, mRNA, and premRNA, mature mRNA, or cDNA sequence. Therefore, the target can be referred to as a FUBP1 target nucleic acid.

[0178] Appropriately, the target nucleic acid encodes a mammalian FUBP1 protein, particularly a human FUBP1 gene encoding a premRNA or mRNA sequence provided herein as Sequence ID No. 1, 2, and / or 3. Sequence ID No. 1 is the sequence of human FUBP1 premRNA. Sequence ID Nos. 2 and 3 are the sequences of human FUBP1 mRNA. Table 3 lists the predicted exons and intron regions of sequence number 1. [Table 3]

[0179] In some embodiments, the target nucleic acid may be FUBP1 nucleic acid from cynomolgus monkeys, such as mRNA or premRNA.

[0180] In some embodiments, the target nucleic acid may be mouse FUBP1 nucleic acid, such as mRNA or premRNA.

[0181] Table 4 provides an overview of the FUBP1 genome sequences in humans, cynomolgus monkeys, and mice. Table 5 provides an overview of the premRNA sequences of FUBP1 in humans, monkeys, and mice, as well as the mature mRNA of human FUBP1.

[0182] In some embodiments, the target nucleic acid is selected from the group consisting of SEQ ID NOs: 1, 2, 3, 4, and / or 5, or their naturally occurring variants (e.g., sequences encoding mammalian FUBP1).

[0183] In some embodiments, the target nucleic acid is selected from the group consisting of SEQ ID NOs: 1, 2, and / or 3, or their naturally occurring variants (e.g., sequences encoding mammalian FUBP1).

[0184] In some embodiments, the target nucleic acid is selected from the group consisting of sequence numbers 1, 4, and 5, or their naturally occurring variants (e.g., sequences encoding mammalian FUBP1). [Table 4]

[0185] When the antisense oligonucleotide of the present invention is used for research or diagnostic purposes, the target nucleic acid may be cDNA or a synthetic nucleic acid derived from DNA or RNA.

[0186] For in vivo or in vitro application, the therapeutic antisense oligonucleotides of the present invention can typically inhibit the expression of FUBP1 target nucleic acid in cells expressing the FUBP1 target nucleic acid. The sequence of nucleic acid bases of the antisense oligonucleotides of the present invention is typically complementary to the conserved region of the FUBP1 target nucleic acid, measured over the length of the antisense oligonucleotide, except optionally one or two mismatches, and optionally a nucleotide-based linker region capable of conjugating the antisense oligonucleotide to any functional group such as a conjugate, or other non-complementary terminal nucleotides.

[0187] The target nucleic acid may be a mammalian FUBP1 protein such as human FUBP1, a human FUBP1 premRNA sequence such as the one disclosed as SEQ ID NO: 1, a cynomolgus monkey FUBP1 premRNA sequence such as the one disclosed as SEQ ID NO: 4, a mouse FUBP1 premRNA sequence such as the one disclosed as SEQ ID NO: 5, or a messenger RNA such as a premRNA encoding mature FUBP1 mRNA, such as the human mature mRNA disclosed as SEQ ID NOs: 2 and 3. SEQ ID NOs: 1-5, 10, 11, 15 and 19 are DNA sequences. It will be understood that the target RNA sequence has uracil (U) bases instead of thymidine bases (T).

[0188] Further information regarding exemplary target nucleic acids is provided in Table 5. [Table 5]

[0189] In some embodiments, the target nucleic acid is SEQ ID NO: 1.

[0190] In some embodiments, the target nucleic acid is SEQ ID NO: 2.

[0191] In some embodiments, the target nucleic acid is SEQ ID NO: 3.

[0192] In some embodiments, the target nucleic acid is SEQ ID NO: 4.

[0193] In some embodiments, the target nucleic acid is SEQ ID NO: 5.

[0194] In some embodiments, the target nucleic acid is SEQ ID NOs: 1, 2, and / or 3.

[0195] In some embodiments, the target nucleic acid is SEQ ID NO: 1 and / or 4. Thus, the antisense oligonucleotide can target FUBP1 in both humans and cynomolgus monkeys.

[0196] In some embodiments, the target nucleic acid is SEQ ID NO: 1 and / or 5. Thus, the antisense oligonucleotide targets FUBP1 in both human and mouse.

[0197] In some embodiments, the target nucleic acid is SEQ ID NOs: 1, 4, and / or 5. Thus, the antisense oligonucleotide can target human, cynomolgus monkey, and mouse FUBP1.

[0198] target sequence As used herein, the term “target sequence” refers to a sequence of nucleotides present in a target nucleic acid, comprising a nucleic acid base sequence complementary to the oligonucleotide or nucleic acid molecule of the present invention. In some embodiments, the target sequence consists of a region on the target nucleic acid having a nucleic acid base sequence complementary to a continuous nucleotide sequence (i.e., a partial sequence) of the antisense oligonucleotide of the present invention. This region of the target nucleic acid may interchangeably be referred to as the target nucleotide sequence, target sequence, or target region. In some embodiments, the target sequence may be longer than the complementary sequence of a single antisense oligonucleotide and may represent, for example, a preferred region of the target nucleic acid that can be targeted by some antisense oligonucleotides of the present invention.

[0199] In one embodiment, the target sequence is a region within exon 14 of human FUBP1 mRNA (see Table 3 above).

[0200] In another embodiment, the target sequence is a region within exon 20 of human FUBP1 mRNA (see Table 3 above).

[0201] The antisense oligonucleotides of the present invention include a sequence of nucleotides that is complementary to or hybridizes a region on a target nucleic acid, for example, a target sequence as described herein.

[0202] Target sequences, defined by a region of human FUBP1 premRNA (using SEQ ID NO: 1 as a reference), which can be targeted by the oligonucleotides of the present invention, are provided herein.

[0203] The oligonucleotides of the present invention include a sequence of nucleotides that is complementary to or hybridizes with a target nucleic acid, such as a subsequence of the target nucleic acid, such as the target sequence described herein.

[0204] An oligonucleotide contains a sequence of nucleotides complementary to the target sequence present in the target nucleic acid molecule. The sequence of nucleotides (and therefore the target sequence) contains at least 12 nucleotides, e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 nucleotides, e.g., 14-20 nucleotides, e.g., 14-18 nucleotides.

[0205] Target sequence region The inventors have identified particularly effective sequences of FUBP1 target nucleic acids that can be targeted by the oligonucleotides of the present invention.

[0206] In some embodiments, the target sequence is sequence number 10.

[0207] In some embodiments, the target sequence is sequence number 11.

[0208] In some embodiments, the target sequence is sequence number 15.

[0209] In some embodiments, the target sequence is sequence number 19.

[0210] Sequence ID 10: GTGAAACCATAAAAAGCATAAG Sequence ID 11: AACCATAAAAAGCATAAG Sequence ID 15: GTGAAACCATAAAAAGCATA Sequence ID 19: GTAGAAATGAAAATTGGT Sequence IDs 10, 11, 15, and 19 are DNA sequences. It should be understood that the target RNA sequence has uracil (U) bases instead of thymidine (T) bases.

[0211] In some embodiments, the target sequence is the region from nucleotides 16184 to 16200 of SEQ ID NO: 1.

[0212] In some embodiments, the target sequence is the region from nucleotides 16186 to 16203 of SEQ ID NO: 1.

[0213] In some embodiments, the target sequence is the region from nucleotides 16188 to 16205 of SEQ ID NO: 1.

[0214] In some embodiments, the target sequence is the region from nucleotides 16189 to 16205 of SEQ ID NO: 1.

[0215] In some embodiments, the target sequence is the region from nucleotides 30536 to 30553 of SEQ ID NO: 1.

[0216] target cell As used herein, the term "target cell" refers to a cell expressing a target nucleic acid. In some embodiments, the target cell may be in vivo or in vitro. In some embodiments, the target cell may be a mammalian cell, e.g., a rodent cell, e.g., a mouse cell or a rat cell, or a primate cell, e.g., a monkey cell or a human cell.

[0217] Typically, target cells express FUBP1 mRNA, such as FUBP1 pre-mRNA or FUBP1 mature mRNA. For example, target cells express human FUBP1 pre-mRNA, e.g., SEQ ID NO: 1, or human FUBP1 mature mRNA containing exon 14 (or exon 20), e.g., SEQ ID NO: 2 or 3). For experimental evaluation, target cells expressing nucleic acids containing the target sequence may be used. The poly(A) tail of FUBP1 mRNA is typically not considered in antisense oligonucleotide targeting.

[0218] The antisense oligonucleotides of the present invention can typically inhibit the expression of FUBP1 target nucleic acids in target cells expressing FUBP1 target nucleic acids, for example, either in vivo or in vitro.

[0219] Furthermore, the target cells may be hepatocytes. In one embodiment, the target cells are primary human hepatocytes infected with HBV, and are either derived from an HBV-infected individual or from an HBV-infected mouse (PhoenixBio, PXB mouse) that has a humanized liver.

[0220] In one embodiment, target cells may be infected with HBV. Furthermore, target cells may contain HBV cccDNA. Therefore, it is preferable that target cells contain FUBP1 mRNA, such as FUBP1 premRNA or FUBP1 mature mRNA, and HBV cccDNA.

[0221] Furthermore, the target cells may also be cancer cells, such as hepatocellular carcinoma cells.

[0222] Naturally occurring variants The term "naturally occurring variant" refers to variants of the FUBP1 gene or transcript, and allele variants, that originate from the same locus as the target nucleic acid but may differ due to, for example, degeneracy of the genetic code resulting in multiple codons encoding the same amino acid, or due to alternative splicing of premRNA, or the presence of polymorphisms, such as single nucleotide polymorphisms (SNPs). Based on the presence of sufficiently complementary sequences to the oligonucleotide, the oligonucleotides of the present invention can therefore target the target nucleic acid and its naturally occurring variants.

[0223] In some embodiments, naturally occurring variants have at least 95%, for example, at least 98%, or at least 99% homology to mammalian FUBP1 target nucleic acids, such as those selected from the group consisting of SEQ ID NOs: 1, 2, 3, 4, or 5. In some embodiments, naturally occurring variants have at least 99% homology to the human FUBP1 target nucleic acid of SEQ ID NO: 1.

[0224] Inhibition of expression As used herein, the term “inhibition of expression” should be understood as a general term for the ability of an oligonucleotide to inhibit the amount or activity of FUBP1 in target cells. Inhibition of activity can be determined by measuring the level of FUBP1 premRNA or FUBP1 mRNA, or by measuring the level of FUBP1 or FUBP1 activity in cells. Therefore, inhibition of expression can be determined in vitro or in vivo.

[0225] Typically, inhibition of expression is determined by comparing the inhibition of activity by administering an effective amount of antisense oligonucleotide to target cells and comparing the level to a reference level (control experiment) or a known reference level (e.g., the expression level before administration of an effective amount of antisense oligonucleotide, or a predetermined or other known expression level) obtained from target cells without administration of the antisense oligonucleotide.

[0226] For example, the control experiment may involve animals or humans, or target cells treated with a saline composition or reference oligonucleotide (often a scrambled control).

[0227] The terms "inhibition" or "to inhibit" can also be used to describe downregulating, reducing, suppressing, decreasing, or lowering FUBP1 expression.

[0228] Inhibition of expression can occur, for example, by degradation of premRNA or mRNA (e.g., using RNase H mobilizing oligonucleotides, e.g., gapmers).

[0229] High affinity modified nucleoside High affinity modified nucleosides are modified nucleotides that, when incorporated into oligonucleotides, enhance the affinity of the oligonucleotide to its complementary target, for example, by its melting temperature (Tm). The high affinity modified nucleosides of the present invention preferably result in an increase in melting temperature of +0.5 to +12°C, more preferably +1.5 to +10°C, and most preferably +3 to +8°C per modified nucleoside. Numerous high affinity modified nucleosides are known in the art, including, for example, many 2'-substituted nucleosides and locked nucleic acids (LNAs) (see, e.g., Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213).

[0230] sugar modification The oligomer of the present invention may contain one or more nucleosides in which the sugar moiety is modified, i.e., compared to the ribose sugar moiety found in DNA and RNA. Numerous nucleosides with ribose sugar moieties have been created primarily to improve certain properties of oligonucleotides, such as affinity and / or nuclease resistance.

[0231] Such modifications include, for example, those in which the ribose ring structure is modified by replacing it with a hexose ring (HNA), or typically a bicyclic ring (LNA) having a biradicle bridge between the C2 and C4 carbons on the ribose ring, or typically an unbonded ribose ring lacking a bond between the C2 and C3 carbons (e.g., UNA). Other sugar-modified nucleosides include, for example, bicyclohexose nucleic acids (International Publication No. 2011 / 017521) or tricyclic nucleic acids (International Publication No. 2013 / 154798). Modified nucleosides also include those in which the sugar moiety is replaced with a non-sugar moiety, for example, peptide nucleic acid (PNA) or morpholino nucleic acid.

[0232] Sugar modifications also include modifications made by changing substituents on the ribose ring to groups other than hydrogen, or to 2'-OH groups that are naturally present in DNA and RNA nucleosides. Substituents can be introduced, for example, at the 2', 3', 4', or 5' positions.

[0233] 2' sugar-modified nucleoside 2'-sugar-modified nucleosides are nucleosides having substituents other than H or -OH at the 2' position (2'-substituted nucleosides), or nucleosides containing a 2'-bonded biradical that can form a bridge between the 2' carbon and the second carbon of the ribose ring, such as LNA (2'-4' biradical bridged) nucleosides.

[0234] In fact, the development of 2'-sugar-substituted nucleosides has attracted considerable attention, and numerous 2'-substituted nucleosides have been found to possess beneficial properties when incorporated into oligonucleotides. For example, 2'-modified sugars can impart enhanced binding affinity and / or increased nuclease resistance to oligonucleotides. Examples of 2'-substituted nucleosides include 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA, and 2'-F-ANA nucleosides. For further examples, see Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443, Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213, and Deleavey and Damha, Chemistry and Biology 2012, 19, 937. The following are some examples of 2' substitution-modified nucleosides. [ka]

[0235] In relation to the present invention, the 2'-substituted sugar-modified nucleoside does not contain a 2'-crosslinked nucleoside such as LNA.

[0236] Locked nucleic acid nucleosides (LNA nucleosides) "LNA nucleosides" are 2'-modified nucleosides containing a biradical (also called a "2'-4' bridge") that links the C2' and C4' of the ribose sugar ring of the above nucleoside, thereby restricting or fixing the conformation of the ribose ring. These nucleosides are also referred to in the literature as cross-linked nucleic acids or bicyclic nucleic acids (BNAs). Fixation of the ribose conformation is related to improved hybridization affinity (double helix stabilization) when LNAs are incorporated into oligonucleotides of complementary RNA or DNA molecules. This can be routinely determined by measuring the melting temperature of the oligonucleotide / complementary double helix.

[0237] Non-restrictive and exemplary LNA nucleosides are described in International Publications 99 / 014226, 00 / 66604, 98 / 039352, 2004 / 046160, 00 / 047599, 2007 / 134181, 2010 / 077578, 2010 / 036698, 2007 / 090071, 2009 / 006478, 2011 / 156202, 2008 / 154401, 2009 / 067647, 2008 / 150729, Morita et al. These are disclosed in al., Bioorganic & Med. Chem. Lett. 12, 73-76, Seth et al. J. Org. Chem. 2010, Vol 75(5) pp. 1569-81, Mitsuoka et al., Nucleic Acids Research 2009, 37(4), 1225-1238, and Wan and Seth, J. Medical Chemistry 2016, 59, 9645-9667. Furthermore, non-limiting exemplary LNA nucleosides are disclosed in Scheme 1. Scheme 1: [ka]

[0238] Certain LNA nucleosides are β-D-oxy-LNA, 6'-methyl-β-D-oxy-LNA, e.g., (S)-6'-methyl-β-D-oxy-LNA(ScET) and ENA. A particularly favorable LNA is β-D-oxy-LNA.

[0239] Nuclease-mediated degradation Nuclease-mediated degradation refers to oligonucleotides that can mediate the degradation of complementary nucleotide sequences when they form a double helix with such sequences.

[0240] In some embodiments, oligonucleotides can function via nuclease-mediated degradation of target nucleic acids, and the oligonucleotides of the present invention can recruit nucleases, particularly endonucleases, preferably endoribonucleases (RNases) such as RNase H. An example of an oligonucleotide design that acts via a nuclease-mediated mechanism is an oligonucleotide that typically comprises a region of at least five or six consecutive DNA nucleosides, with affinity-enhancing nucleosides, such as gapmers, flanked on one or both sides.

[0241] Activation and recruitment of RNase H The RNase H activity of an antisense oligonucleotide refers to its ability to recruit RNase H when in a double helix with a complementary RNA molecule. International Publication No. 01 / 23613 provides an in vitro method for determining RNase H activity that can be used to determine the ability to recruit RNase H. Typically, an oligonucleotide is considered capable of recruiting RNase H if it has an initial rate measured at at least 5% of the initial rate determined using the methodology provided in Examples 91-95 of International Publication No. 01 / 23613 (incorporated herein by reference), e.g., at least 10% or more than 20% of the initial rate measured at pmol / l / min. For use in determining RHase H activity, recombinant human RNase H1 is available from Creative Biomart® (recombinant human RNase H1 fused with a His tag expressed in E. coli).

[0242] Gapmar The antisense oligonucleotide or its sequence of nucleotides according to the present invention may also be a gapmer, and may also be referred to as a gapmer oligonucleotide or gapmer design. Antisense gapmers are typically used for inhibiting target nucleic acids via RNase H-mediated degradation. A gapmer oligonucleotide comprises at least three distinct structural regions, a 5'-flank, a gap, and a 3'-flank, FG-F' in the 5'→3' direction. The "gap" region (G) contains a stretch of sequence of DNA nucleotides that allows the oligonucleotide to recruit RNase H. The gap region is flanked by a 5'-flanking region (F) containing one or more glycosylated nucleosides, preferably high-affinity glycosylated nucleosides, and a 3'-flanking region (F') containing one or more glycosylated nucleosides, preferably high-affinity glycosylated nucleosides. One or more glycosylated nucleosides in regions F and F' enhance the affinity of the oligonucleotide to the target nucleic acid (i.e., they are affinity-enhancing glycosylated nucleosides). In some embodiments, one or more glycosylated nucleosides in regions F and F' are 2' glycosylated nucleosides, such as high-affinity 2' glycosylation nucleosides, which are independently selected from, for example, LNA and 2'-MOE.

[0243] In gapmer designs, the outermost 5' and 3' nucleosides of the gap region are DNA nucleosides, located adjacent to the sugar-modified nucleosides of the 5'(F) or 3'(F') region, respectively. A flank may be further defined by having at least one sugar-modified nucleoside at the end furthest from the gap region, i.e., the 5' end of a 5' flank and the 3' end of a 3' flank.

[0244] Region FG-F' forms a continuous nucleotide sequence. The antisense oligonucleotide of the present invention or its continuous nucleotide sequence may include a gapmer region of formula FG-F'. In some embodiments, all internucleoside bonds between nucleosides in the gapmer region of formula FG-F' are phosphorothioate internucleoside bonds.

[0245] The full length of the gapmer design F-G-F' can be, for example, 12 to 32 nucleosides, such as 13 to 24, such as 14 to 22 nucleosides, such as 15 to 20, such as 16 to 18 nucleosides. In some embodiments, the full length is 17 nucleosides. In some embodiments, the full length is 17 nucleosides.

[0246] As an example, the gapmer oligonucleotide of the present invention can be represented by the following formula: F 1-8 -G 5-16 -F' 1-8 , for example F 1-8 -G 7-16 -F' 2-8、 or F 4-8 -G 7-12 -F' 2-8 , or F 4-6 -G 7-11 -F' 2-6 However, the full length of the gapmer region F-G-F' is at least 12, for example at least 14 nucleotides long.

[0247] In one embodiment, the gapmer oligonucleotide of the present invention can be represented by the following formula: F 4-6 -G 7-11 -F' 2-6 Preferably, the full length of the gapmer region F-G-F' is at least 16 nucleotides, such as 17 or 18 nucleotides.

[0248] In one aspect of the present invention, an antisense oligonucleotide or a sequence of nucleotides thereof consists of or comprises a gapmer of formula 5'-FG-F'-3', wherein regions F and F' independently comprise 1 to 8 nucleosides, of which 1 to 4 are 2'-sugar modified, defining the 5' and 3' ends of the F and F' regions, and G is a region of 6 to 16 nucleosides capable of recruiting RNaseH, for example, a region of 7 to 12 nucleosides. In some embodiments, all modified nucleosides in regions F and F' are β-D-oxy LNA nucleosides. Furthermore, region F or F', or F and F', optionally contain DNA nucleosides. Optionally, flanking region F or F', or both flanking regions F and F', may contain one or more DNA nucleosides (alternating flanks; see definition of alternating flanks for more details).

[0249] Regions F, G, and F' are further defined below and can be incorporated into the FG-F' formula.

[0250] Gapmar-region G The gapmer region G (gap region) is a region of nucleosides, typically DNA nucleosides, that allows the oligonucleotide to recruit RNaseH, such as human RNaseH1. RNaseH is a cellular enzyme that recognizes the double helix between DNA and RNA and enzymatically cleaves RNA molecules. Preferably, the gapmer may have a gap region (G) of at least 5 or 6 consecutive DNA nucleosides, e.g., 5-16 consecutive DNA nucleosides, e.g., 6-15 consecutive DNA nucleosides, e.g., 7-14 consecutive DNA nucleosides, e.g., 8-12 consecutive DNA nucleotides, e.g., 8-12 consecutive DNA nucleotides. In some embodiments, the gap region G may consist of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive DNA nucleosides.

[0251] In some embodiments, the gap region G may consist of 12 or fewer consecutive DNA nucleosides, such as 7. 8. 9, 10, or 11 consecutive DNA nucleosides, e.g., 9, 10, or 11 consecutive DNA nucleosides.

[0252] One or more cytosine (C)DNA molecules within a gap region can be methylated in some cases (for example, when DNA c is followed by DNA g). Any such residue is 5-methylcytosine ( me This is annotated as C). In some embodiments, the gap region G may consist of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive phosphorothioate-binding DNA nucleosides.

[0253] In some embodiments, all nucleoside-to-nucleoside bonds within the gap are phosphorothioate bonds.

[0254] Gapmar-Franking region, F and F' Region F is located immediately adjacent to the 5' DNA nucleoside of region G. The furthest 3' nucleoside in region F is a glycosylated nucleoside, such as a high-affinity glycosylated nucleoside, such as a 2'-substituted nucleoside, such as a MOE nucleoside, or an LNA nucleoside.

[0255] Region F' is located immediately adjacent to the 3' DNA nucleoside of region G. The furthest 5' nucleoside in region F is a glycosylated nucleoside, such as a high-affinity glycosylated nucleoside, such as a 2'-substituted nucleoside, such as a MOE nucleoside, or an LNA nucleoside.

[0256] Region F has a length of 1 to 8 consecutive nucleotides, for example, 2 to 6, or for example, 4 to 6 consecutive nucleotides. In some embodiments, the length of region F is 4 consecutive nucleotides. In some embodiments, the length of region F is 5 consecutive nucleotides. In some embodiments, the length of region F is 6 consecutive nucleotides.

[0257] Advantageously, the outermost 5' nucleoside of region F is a sugar-modified nucleoside. In some embodiments, the two outermost 5' nucleosides of region F are sugar-modified nucleosides. In some embodiments, the outermost 5' nucleoside of region F is an LNA nucleoside. In some embodiments, the two outermost 5' nucleosides of region F are LNA nucleosides.

[0258] Region F' has a length of 1 to 8 consecutive nucleotides, for example, 2 to 6, or for example, 2 to 5 consecutive nucleotides. In some embodiments, the length of region F' is 2 consecutive nucleotides. In some embodiments, the length of region F' is 3 consecutive nucleotides. In some embodiments, the length of region F' is 4 consecutive nucleotides. In some embodiments, the length of region F' is 5 consecutive nucleotides.

[0259] Advantageously, the most 3' nucleoside in region F' is a sugar-modified nucleoside. In some embodiments, the two most 3' nucleosides in region F' are sugar-modified nucleosides. In some embodiments, the two most 3' nucleosides in region F' are LNA nucleosides. In some embodiments, the most 3' nucleoside in region F' is an LNA nucleoside.

[0260] It should be noted that if the length of region F is 1, it is favorably an LNA nucleoside. Furthermore, if the length of region F and / or F' is 2, it should be noted that the nucleosides of both regions F and / or F' are favorably LNA nucleosides.

[0261] In some embodiments, the sugar-modified nucleosides in regions F and F' consist of only one type of sugar-modified nucleoside, such as MOE only, or β-D-oxy LNA only, or ScET only. Such designs are also referred to as uniform flank or uniform gapmer designs.

[0262] In some embodiments, all nucleosides in region F or F', or in both F and F', are LNA nucleosides, such as β-D-oxy LNA nucleosides. In alternative embodiments, all sugar-modified nucleosides in regions F and F' are LNA nucleosides, such as β-D-oxy LNA nucleosides, and region F or F', or both F and F', may contain DNA nucleosides (alternating flanks; see definitions for details).

[0263] In some embodiments, the 5' and 3' nucleosides in regions F and F' are LNA nucleosides, such as β-D-oxy LNA nucleosides.

[0264] In some embodiments, the nucleoside bonds between region F and region G and / or between region F' and region G are phosphorothioate nucleoside bonds. In some embodiments, the nucleoside bonds between the nucleosides of region F or F', F and F' are phosphorothioate nucleoside bonds.

[0265] LNA gapmer An LNA gapmer is a gapmer containing or consisting of an LNA nucleoside in one or both of regions F and F'. A β-D-oxy gapmer is a gapmer containing or consisting of a β-D-oxy LNA nucleoside in one or both of regions F and F'.

[0266] In some embodiments, the LNA gapmer is given by the formula: [LNA] 1-5 -[Area G]-[LNA] 1-5 In the formula, region G is a region of a continuous DNA nucleoside capable of recruiting RNase H, or includes such region.

[0267] MOE Gap Marker A MOE gapmer is a gapmer in which regions F and F' consist of MOE nucleosides. In some embodiments, the MOE gapmer is designed [MOE]1-8 -[Area G] 5-16 -[MOE] 1-8 For example, [MOE] 2-7 -[Area G] 6-14 -[MOE] 2-7 For example, [MOE] 3-6 -[Area G] 8-12 -[MOE] 3-6 Here, region G is as defined in the definition of a gapmer. MOE gapmers with a 5-10-5 design (MOE-DNA-MOE) are widely used in the art.

[0268] Mixed wing gap mar A mixed wing gapmer is an LNA gapmer in which one or both of regions F and F' contain a 2'-substituted nucleoside, such as a MOE nucleoside, independently selected from 2'-substituted nucleosides, such as 2'-O-alkyl-RNA units, 2'-O-methyl-RNA, 2'-amino-DNA units, 2'-fluoro-DNA units, 2'-alkoxy-RNA, MOE units, arabino nucleic acid (ANA) units, and 2'-fluoro-ANA units. In some embodiments in which at least one of regions F and F', or both regions F and F', contain at least one LNA nucleoside, the remaining nucleosides in regions F and F' are independently selected from the group consisting of MOE and LNA. In some embodiments in which at least one of regions F and F', or both regions F and F', contain at least two LNA nucleosides, the remaining nucleosides in regions F and F' are independently selected from the group consisting of MOE and LNA. In some mixed wing embodiments, one or both of regions F and F' may further contain one or more DNA nucleosides.

[0269] Alternating Frank Gap Marker The flanking regions may contain both LNA and DNA nucleosides, and are called “alternating flanks” because they contain an alternating motif of LNA-DNA-LNA nucleosides. Gapmers containing at least one alternating flank are referred to as “alternating flank gapmers.” Thus, an “alternating flank gapmer” is an LNA gapmer oligonucleotide in which at least one of the flanks (F or F') contains one or more DNA nucleotides in addition to the LNA nucleoside. In some embodiments, at least one of regions F or F', or both regions F and F', contain both LNA nucleosides and DNA nucleosides. In such embodiments, the flanking regions F or F', or both F and F', contain at least three nucleosides, and the furthest 5' and 3' nucleosides in regions F and / or F' are LNA nucleosides. Alternating flank LNA gapmers are disclosed in International Publication WO2016 / 127002.

[0270] The alternating flank region may contain up to three consecutive DNA nucleosides, for example, one to two, or one, two, or three consecutive DNA nucleosides.

[0271] The alternating flank region is a sequence of integers representing the number of LNA nucleosides (L) followed by the number of DNA nucleosides (D), e.g., [L] 1-3 -[D] 1-3 -[L] 1-3 or [L] 1-2 -[D] 1-2 -[L] 1-2 -[D] 1-2 -[L] 1-2として注釈を付けることができる。In oligonucleotide design, these are often represented as numbers such that 2-2-1 represents 5'[L]2-[D]2-[L]3' and 1-1-1-1-1 represents 5'[L]-[D]-[L]-[D]-[L]3'. The lengths of the flanks (regions F and F') in oligonucleotides with alternating flanks can be, for example, 4-8, e.g., 5-6 nucleosides, e.g., 4, 5, 6, or 7 modified nucleosides, as described herein for these regions. To confer additional exonuclease resistance, it may be advantageous to have at least two LNA nucleosides at the 3' end of the 3' flank (F').

[0272] In one embodiment, the gapmer oligonucleotide of the present invention can be represented by the following formula: F 4-6 -G 7-11 -F' 2-6、 In the formula, F is [L] 1-3 -[D] 1-3 -[L] 1-3 It has a design, and F' is [L] 1-2 -[D] 1-2 -[L] 2-4、 or [L] 2-6 It has a design.

[0273] However, the total length of the gapmer region FG-F' is required to be at least 16 nucleotides, for example, 17 or 18 nucleotides.

[0274] Therefore, the gapmer oligonucleotides of the present invention may contain at least one alternating flank. Typically, at least the F region is an alternating flank. In some embodiments, both the F and F' regions are alternating flanks. In some embodiments, the F region is an alternating flank and the F' region is a homogeneous flank (i.e., F' consists of only one type of sugar-modified nucleoside, such as β-D-oxy LNA only).

[0275] In some embodiments, the design of region F is selected from the following designs: 3-2-1 (i.e., LLLDDL), 3-1-1 (i.e., LLLDL), 2-1-2 (LLDLL), 2-1-1 (LLDL), and 1-3-1 (i.e., LDDDL).

[0276] In some embodiments, the design of region F' is 1-1-3 (i.e., LDLLL) or 1-1-2 (i.e., LDLL). In some embodiments, the design of region F is LL, LLL, or LLLL.

[0277] Region D' or D'' within the oligonucleotide In some embodiments, the oligonucleotides of the present invention may comprise, or consist of, a continuous nucleotide sequence of oligonucleotides complementary to the target nucleic acid, e.g., a gapmer region FG-F', and further 5' and / or 3' nucleosides. The further 5' and / or 3' nucleosides may be fully complementary to the target nucleic acid or not. Such further 5' and / or 3' nucleosides may be referred to herein as regions D' and D''.

[0278] The addition of region D' or D'' may be used to link a continuous nucleotide sequence, such as a gapmer, to a conjugate moiety or another functional group. When used for linking, the continuous nucleotide sequence having the conjugate moiety can act as a bio-cleavable linker. Alternatively, it may be used to provide exonuclease protection or to facilitate synthesis or manufacture.

[0279] Regions D' and D'' can be bonded to the 5' end of region F or the 3' end of region F', respectively, to generate the following designs of formula D'-FG-F', FG-F'-D'', or D'-FG-F'-D''. In this case, FG-F' is the gapmer portion of the oligonucleotide, and regions D' or D'' constitute separate portions of the oligonucleotide.

[0280] Region D' or D'' independently contains or consists of 1, 2, 3, 4, or 5 additional nucleotides, which may or may not be complementary to the target nucleic acid. The nucleotides adjacent to the F or F' region are not sugar-modified nucleotides such as DNA or RNA, nor are they base-modified versions thereof. Region D' or D' can function as a nuclease-sensitive biocleavable linker (see definition of linker). In some embodiments, the additional 5' and / or 3' terminal nucleotides are linked by phosphodiester bonds and are DNA or RNA. Nucleotide-based biocleavable linkers suitable for use as region D' or D'' are disclosed in International Publication 2014 / 076195, which includes, as an example, phosphodiester-linked DNA dinucleotides. The use of biocleavable linkers in polyoligonucleotide constructs is disclosed in International Publication WO2015 / 113922, where they are used to link multiple antisense constructs (e.g., gapmer regions) within a single oligonucleotide.

[0281] In one embodiment, the oligonucleotide of the present invention includes regions D' and / or D'' in addition to the continuous nucleotide sequence constituting the gapmer.

[0282] In some embodiments, the oligonucleotides of the present invention can be represented by the following formula: FG-F'; especially 1-8 -G 5-16 -F' 2-8 For example, F 4-6 -G 7-11 -F' 2-6 D'-FG-F', especially D' 1-3 -F 1-8 -G 5-16 -F' 2-8 For example, D' 1-3 -F 4-6 -G 7-11 -F' 2-6 FG-F'-D'', especially F 1-8 -G 5-16 -F'2-8 -D'' 1-3 D'-FG-F'-D'', especially D' 1-3 -F 1-8 -G 5-16 -F' 2-8 -D'' 1-3 . In some embodiments, the internucleoside bond located between region D' and region F is a phosphodiester bond. In some embodiments, the internucleoside bond located between region F' and region D'' is a phosphodiester bond.

[0283] Conjugate As used herein, the term "conjugate" refers to an oligonucleotide covalently bonded to a non-nucleotide portion (the conjugate portion or region C or a third region). The conjugate portion may optionally be covalently bonded to the antisense oligonucleotide via a linker group such as region D' or D''.

[0284] Oligonucleotide conjugates and their synthesis have also been reported in comprehensive reviews: Manoharan in Antisense Drug Technology, Principles, Strategies, and Applications, STCrooke, ed., Ch.16, Marcel Dekker, Inc., 2001 and Manoharan, Antisense and Nucleic Acid Drug Development, 2002, 12, 103.

[0285] In some embodiments, the non-nucleotide portion (conjugate portion) is selected from the group consisting of carbohydrates (e.g., GalNAc), cell surface receptor ligands, active pharmaceutical ingredients, hormones, lipophilic substances, polymers, proteins, peptides, toxins (e.g., bacterial toxins), vitamins, viral proteins (e.g., capsids), or combinations thereof.

[0286] Exemplary conjugate moieties include those capable of binding to the asialoglycoprotein receptor (ASGPR). In particular, the conjugate moiety of trivalent N-acetylgalactosamine is suitable for binding to ASGPR; see, for example, International Publications 2014 / 076196, 2014 / 207232, and 2014 / 179620. Such conjugates help enhance the uptake of oligonucleotides into the liver.

[0287] In some embodiments, the conjugate is an antibody or antibody fragment having specific affinity for the transferrin receptor, such as disclosed in International Publication No. 2012 / 143379, which is incorporated herein by reference. In some embodiments, the non-nucleotide portion is an antibody or antibody fragment, such as an antibody or antibody fragment that facilitates delivery across the blood-brain barrier, in particular an antibody or antibody fragment that targets the transferrin receptor.

[0288] Linker A linker or conjugate is a connection between two atoms that links one chemical group or segment of interest to another chemical group or segment of interest via one or more covalent bonds. The conjugate portion can be conjugated to an oligonucleotide directly or via a linking portion (e.g., a linker or tether). The linker plays the role of covalently bonding a third region, e.g., the conjugate portion (region C), to a first region, e.g., an oligonucleotide or sequence of nucleotides complementary to the target nucleic acid (region A).

[0289] In some embodiments of the present invention, the conjugate or oligonucleotide conjugate of the present invention may optionally include a linker region (second region or region B and / or region Y) located between an oligonucleotide or sequential nucleotide sequence complementary to the target nucleic acid (region A or first region) and the conjugate portion (region C or third region).

[0290] A biocleavable linker (region B) contains or consists of a physiologically unstable bond that can be cleaved under conditions normally encountered or similar to those encountered in the mammalian body. Conditions under which the physiologically unstable linker undergoes chemical transformation (e.g., cleavage) include chemical conditions such as pH, temperature, oxidation or reduction conditions, or drugs, as well as salt concentrations similar to those found in or encountered in mammalian cells. Mammalian intracellular conditions also include the presence of enzyme activity normally present in mammalian cells, such as proteolytic enzymes, hydrolytic enzymes, or nucleases. In one embodiment, the biocleavable linker is susceptible to S1 nuclease cleavage. In some embodiments, the physiologically unstable linker (biologically cleavable) comprises 1 to 10 linked nucleosides, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 linked nucleosides, for example, 2 to 6 linked nucleosides, for example, 2 to 5 linked nucleosides, for example, 2 to 4 linked nucleosides, where at least two consecutive links are biologically cleavable, for example, phosphodiester links, for example, at least 3, 4, or 5 consecutive phosphodiester links. Preferably, the nucleosides are DNA or RNA.

[0291] In one embodiment, the linker between the oligonucleotide and the conjugate moiety is a physiologically unstable linker composed of 2 to 5 consecutive phosphodiester nucleosides, each containing at least two consecutive phosphodiester bonds at the 5' or 3' end of the consecutive nucleotide sequence of the antisense oligonucleotide.

[0292] In some embodiments, the physiologically unstable linker comprises or consists of a DNA dinucleotide having a sequence selected from the group consisting of AA, AT, AC, AG, TA, TT, TC, TG, CA, CT, CC, CG, GA, GT, GC, or GG, wherein a phosphodiester bond exists between the two DNA nucleosides, and at least one further phosphodiester is present at the 5' or 3' end of the dinucleotide that links the oligonucleotide of the nucleic acid molecule to the dinucleotide or links the conjugate portion to the dinucleotide. For example, the linker may be a CA dinucleotide. In some embodiments, the physiologically unstable linker comprises or consists of the sequence AAA, AAT, AAC, AAG, ATA, ATT, ATC, ATG, ACA, ACT, ACC, ACG, AGA, AGT, AGC, AGG, TAA, TAT, TAC, TAG, TTA, TTT, TTC, TAG, TCA, TCT, TCC, TCG, TGA, TGT, TGC, TGG, CAA, CAT, CAC, CAG, CTA, CTG, CTC, CTT, CCA, CCT, CCC, CCG, CGA, CGT, CGC, CGG, GAA, GAT, GAC, CAG, GTA, GTT, GTC, GTG, GCA, GCT, GCC, GCG, GGA, GGT, GGC, or GGG, with phosphodiester bonds present between DNA nucleosides and potentially further phosphodiesters at the 5' or 3' ends of the trinucleotides. Biocleavable linkers containing phosphodiesters are described in more detail in WO2014 / 076195 (incorporated herein by reference). In conjugate compounds having biocleavable linkers, compared to a standard, at least about 50% of the conjugate moiety is cleaved from the oligonucleotide, for example, at least about 60%, for example, at least about 70%, for example, at least about 80%, for example, at least about 85%, for example, at least about 90%, for example, at least about 95% of the conjugate moiety is cleaved from the oligonucleotide.

[0293] Region Y refers to a linker that is not necessarily biocleavable but primarily serves to covalently bond the conjugate portion (region C or third region) to an oligonucleotide (region A or first region). The region Y linker may contain a chain structure or oligomer of repeating units such as ethylene glycol, amino acid units, or aminoalkyl groups.

[0294] The oligonucleotide conjugate of the present invention can be constructed from the following region elements AC, ABC, ABYC, AYBC, or AYC. In some embodiments, the linker (region Y) is an aminoalkyl, such as a C2-C36 aminoalkyl group including a C6-C12 aminoalkyl group. In some embodiments, the linker (region Y) is a C6 aminoalkyl group.

[0295] Pharmaceutically acceptable salts The term "pharmaceutically acceptable salt" refers to a salt that retains the biological efficacy and properties of a free base or free acid, and is not biologically or otherwise undesirable. Salts are formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, and phosphoric acid, particularly hydrochloric acid, as well as organic acids such as acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid, and N-acetylcysteine. In addition, these salts can be prepared by adding an inorganic base or organic base to a free acid. Salts derived from inorganic bases include, but are not limited to, salts of sodium, potassium, lithium, ammonium, calcium, and magnesium. Salts derived from organic bases include, but are not limited to, primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines, and salts of basic ion exchange resins, such as isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, lysine, arginine, N-ethylpiperidine, piperidine, and polyamine resins. The compounds of the present invention may also exist in zwitterionic form. Particularly preferred are pharmaceutically acceptable salts of the compound of formula (I) of hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, and methanesulfonic acid.

[0296] treatment As used herein, terms such as “treatment,” “to treat,” and “to treat” generally mean obtaining a desired pharmacological and / or physiological effect. This effect is therapeutic in that it partially or completely cures the disease and / or adverse effects caused by the disease. As used herein, the term “treatment” encompasses any treatment of a disease in a subject and includes: (a) inhibiting the disease; or (b) improving (i.e., alleviating) the disease, i.e., causing disease regression. Compounds that improve and / or inhibit HBV infection are compounds that treat HBV infection. Preferably, as used herein, the term “treatment” relates to a medical intervention for an already manifested disorder, such as the treatment of an already defined and manifested HBV infection or cancer.

[0297] prevention In this specification, the terms “prevention,” “prevention,” or “to prevent” relate to preventive measures, i.e., measurements or means whose purpose is to prevent a disease rather than to cure it. Prevention means that a desired pharmacological and / or physiological effect is obtained preventively, in terms of completely or partially preventing the disease or its symptoms. Accordingly, “HBV infection prevention” in this specification includes preventing the occurrence of HBV infection in a subject and preventing the occurrence of symptoms of HBV infection. In particular, the present invention aims to prevent HBV infection in children from HBV-infected mothers. It also aims to prevent acute HBV infection from progressing to chronic HBV infection.

[0298] patient For the purposes of this invention, the "subject" or "patient" may be a vertebrate. In relation to this invention, the term "subject" includes both humans and other animals, particularly mammals, and other living organisms. Accordingly, the means and methods provided herein are applicable to both human therapeutic and veterinary uses. Accordingly, herein, the subject may be an animal such as a mouse, rat, hamster, rabbit, guinea pig, ferret, cat, dog, chicken, sheep, cattle, horse, camel, or primate. Preferably, the subject is a mammal. More preferably, the subject is a human. In some embodiments, the patient suffers from a disease referred to herein, such as HBV infection or cancer. In some embodiments, the patient is susceptible to said disease. [Modes for carrying out the invention]

[0299] One aspect of the present invention is an enhanced antisense oligonucleotide or conjugate targeting FUBP1 for use in the treatment and / or prevention of diseases selected from the group consisting of HBV infection, e.g., chronic HBV infection, and proliferative disorders, e.g., cancer, particularly hepatocellular carcinoma.

[0300] One embodiment of the present invention is an antisense oligonucleotide or its conjugate that can reduce HBV DNA such as cccDNA and HBV RNA transcripts such as pgRNA in infected cells such as HBV-infected cells.

[0301] In further embodiments, the antisense oligonucleotides or their conjugates of the present invention can reduce HBsAg and / or HBeAg in vivo in HBV-infected individuals.

[0302] Another aspect of the present invention is the use of the antisense oligonucleotide or its conjugate in the treatment and / or prevention of hepatitis B virus (HBV) infection, particularly chronic HBV infection, or in the treatment of cancers in which FUBP1 is overexpressed.

[0303] The present invention's antisense oligonucleotide The enhanced antisense oligonucleotides or their conjugates of the present invention are potentially excellent FUBP1 inhibitors because they can target FUBP1 transcripts and promote their degradation via RNase H cleavage.

[0304] One aspect of the present invention is an enhanced antisense oligonucleotide or conjugate thereof for use in the treatment and / or prevention of HBV infection or in the treatment of cancer.

[0305] This section describes enhanced antisense oligonucleotides or their conjugates suitable for use in the treatment and / or prevention of HBV infection or in the treatment of cancer.

[0306] The antisense oligonucleotides or their conjugates of the present invention can inhibit FUBP1 expression in vitro and in vivo. Inhibition is achieved by hybridizing the antisense oligonucleotide to a target nucleic acid that encodes FUBP1 or is involved in the regulation of FUBP1. The target nucleic acid may be a mammalian FUBP1 sequence, such as a sequence selected from the group consisting of SEQ ID NOs: 1, 2, 3, 4, and / or 5.

[0307] Therefore, the oligonucleotide of the present invention is an antisense oligonucleotide that targets FUBP1.

[0308] In some embodiments, the antisense oligonucleotides or their conjugates of the present invention can be modulated by inhibiting or downregulating the expression of a target. Preferably, such modification results in inhibition of at least 20%, more preferably at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% compared to the normal expression level of the target. In some embodiments, the antisense oligonucleotides or their conjugates of the present invention can inhibit the expression level of FUBP1 mRNA by at least 50% or 60% in vitro using 25 μM in PXB-PHH cells. In some embodiments, the antisense oligonucleotides or their conjugates of the present invention can inhibit the expression level of FUBP1 protein by at least 50% in vitro using 25 μM in PXB-PHH cells, and this range of target reduction is advantageous in selecting antisense oligonucleotides that correlate well with cccDNA reduction. Appropriately, the examples provide assays that can be used to measure FUBP1 RNA inhibition (e.g., Example 1 or 2). Targeted inhibition is caused by hybridization between the sequence of nucleotides in the antisense oligonucleotide and the target nucleic acid. In some embodiments, the antisense oligonucleotide of the present invention includes a mismatch between the antisense oligonucleotide and the target nucleic acid. Despite the mismatch, hybridization to the target nucleic acid may still be sufficient to exhibit the desired inhibition of FUBP1 expression. The decrease in binding affinity resulting from the mismatch can be favorably compensated by increasing the number of nucleotides in the oligonucleotide and / or the number of modified nucleosides that can increase binding affinity to the target, such as an increase in the number of 2' sugar-modified nucleosides containing LNA present in the antisense oligonucleotide sequence.

[0309] One aspect of the present invention relates to enhanced antisense oligonucleotides of 12 to 30, for example 12 to 22, for example 16 to 20 nucleotide lengths, comprising a target sequence from nucleotides 16184 to 16205, such as a target sequence selected from 16184 to 16200, 16186 to 16203, 16188 to 16205 and 16189 to 16205 of SEQ ID NO: 1, and a continuous nucleotide sequence of at least 12 nucleotide lengths, for example 14, 15, 16, or 17 nucleotide lengths, having at least 90% complementarity, for example 100%. In particular, antisense oligonucleotides that can inhibit FUBP1 expression, i.e., reduce FUBP1 nucleic acids such as FUBP1 mRNA, are considered part of the present invention.

[0310] In some embodiments, the antisense oligonucleotide of the present invention comprises a sequence of 12 to 22 nucleotides, for example, 15 to 20 nucleotides, having at least 90% complementarity, for example, complete complementarity, to the target nucleic acid of SEQ ID NO: 10.

[0311] In some embodiments, the antisense oligonucleotide comprises a sequence of 15-18 nucleotides, e.g., 17-18 nucleotides, having at least 90% complementarity, e.g., complete complementarity, to the target nucleic acid of SEQ ID NO: 11.

[0312] In some embodiments, the antisense oligonucleotide comprises a sequence of 15-18 nucleotides, e.g., 17-18 nucleotides, having at least 90% complementarity, e.g., complete complementarity, to the target nucleic acid of SEQ ID NO: 18.

[0313] In some embodiments, the antisense oligonucleotide comprises a sequence of 15-22 nucleotides, e.g., 15-18 nucleotides, e.g., 17 or 18 nucleotides, having at least 90% complementarity, e.g., complete complementarity, to a target nucleic acid selected from the following regions of SEQ ID NO: 16184-16205, 16184-16200, 16186-16203, 16188-16205 and 16189-16205 of SEQ ID NO: 1. Furthermore, it comprises a sequence of 15-22 nucleotides, e.g., 15-18 nucleotides, e.g., 17 or 18 nucleotides, having at least 90% complementarity, e.g., complete complementarity, to a target nucleic acid selected from the following regions of SEQ ID NO: 30536-30553.

[0314] In some embodiments, the antisense oligonucleotide comprises a continuous sequence of 12 to 30 nucleotides in length, which is at least 90% complementary to the region of the target nucleic acid or target sequence, for example, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or 100% complementary.

[0315] The antisense oligonucleotide or its sequence of nucleotides according to the present invention is advantageous when it is perfectly complementary (100% complementary) to the region of the target nucleic acid, or, in some embodiments, when it may contain one or two mismatches between the oligonucleotide and the target nucleic acid.

[0316] In some embodiments, the antisense oligonucleotide sequence is 100% complementary to the corresponding target nucleic acid region of SEQ ID NO: 1.

[0317] In some embodiments, the antisense oligonucleotide or sequential nucleotide sequence of the present invention is at least 95% complementary, for example, perfectly (or 100%) complementary, to the target nucleic acids of SEQ ID NO: 1 and SEQ ID NO: 4.

[0318] In some embodiments, the antisense oligonucleotide comprises a sequence of 15 to 22 nucleotides in length that is at least 90% complementary to the corresponding target sequence present in SEQ ID NO: 1, for example, having 100% complementarity, and the target sequence is selected from nucleotides 16184 to 16205, 16184 to 16200, 16186 to 16203, 16188 to 16205, 16189 to 16205, and 30536 to 30553 of SEQ ID NO: 1.

[0319] In some embodiments, the sequence of antisense oligonucleotides is at least 90% complementary, and preferably 100% complementary, to the target site sequence of SEQ ID NO: 10.

[0320] In some embodiments, the sequence of antisense oligonucleotides is at least 90% complementary, and preferably 100% complementary, to the target site sequence of SEQ ID NO: 11.

[0321] In some embodiments, the sequence of antisense oligonucleotides is at least 90% complementary, and preferably 100% complementary, to the target site sequence of SEQ ID NO: 15.

[0322] In some embodiments, the sequence of nucleotides of the antisense oligonucleotide is at least 90% complementary, and preferably 100% complementary, to the target site sequence of SEQ ID NO: 19.

[0323] In some embodiments, the continuous nucleotide sequence is a sequence of nucleic acid bases selected from the group consisting of SEQ ID NOs: 6, 7, 8, 9, and 18, or comprises at least 14 of those continuous nucleotides, for example, 17 or 18 of those continuous nucleotides.

[0324] In some embodiments, the antisense oligonucleotide of the present invention, or the sequence of nucleotides thereof, comprises or consists of a sequence of 10 to 30 nucleotides in length, for example, 12 to 25, for example, 11 to 22, for example, 12 to 20, for example, 14 to 18 or 16 to 18 nucleotides.

[0325] In some embodiments, an antisense oligonucleotide or its sequence of nucleotides contains or consists of 22 or fewer nucleotides, for example, 20 or fewer, or 18 or fewer nucleotides. For example, an antisense oligonucleotide or its sequence of nucleotides may contain 14, 15, 16, or 17 nucleotides. It should be understood that any range provided herein includes the endpoint of the range. Therefore, when an oligonucleotide is described as containing 10 to 30 nucleotides, it includes both 10 and 30 nucleotides.

[0326] The present invention provides antisense oligonucleotides according to the present invention, such as antisense oligonucleotides having a length of 12 to 24 nucleotides, for example, 12 to 18 nucleotides, the antisense oligonucleotides comprising a sequence of nucleotides comprising at least 12, for example at least 13, for example at least 14, for example at least 15, or at least 16 consecutive nucleotides, as present in SEQ ID NO: 6.

[0327] The present invention provides antisense oligonucleotides according to the present invention, such as antisense oligonucleotides having a length of 12 to 24 nucleotides, for example, 12 to 18 nucleotides, the antisense oligonucleotides comprising a sequence of nucleotides containing at least 12, for example, at least 13, for example, at least 14, for example, at least 15, or at least 16 consecutive nucleotides, as present in SEQ ID NO: 7.

[0328] The present invention provides antisense oligonucleotides according to the present invention, such as antisense oligonucleotides having a length of 12 to 24 nucleotides, for example, 12 to 18 nucleotides, the antisense oligonucleotides comprising a sequence of nucleotides containing at least 12, for example at least 13, for example at least 14, for example at least 15, or at least 16 consecutive nucleotides, as present in SEQ ID NO: 8.

[0329] The present invention provides antisense oligonucleotides according to the present invention, such as antisense oligonucleotides having a length of 12 to 24 nucleotides, for example, 12 to 18 nucleotides, the antisense oligonucleotides comprising a sequence of nucleotides containing at least 12, for example at least 13, for example at least 14, for example at least 15, or at least 16 consecutive nucleotides, as present in SEQ ID NO: 9.

[0330] The present invention provides antisense oligonucleotides according to the present invention, such as antisense oligonucleotides having a length of 12 to 24 nucleotides, for example, 12 to 18 nucleotides, the antisense oligonucleotides comprising a sequence of nucleotides containing at least 12, for example, at least 13, for example, at least 14, for example, at least 15, for example, at least 16, at least 17 or 18 consecutive nucleotides, as present in SEQ ID NO: 18.

[0331] In some embodiments, the continuous nucleotide sequence has a continuous nucleotide length of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22, for example, containing or consisting of 16, 17, or 18 continuous nucleotides.

[0332] In some embodiments, the antisense oligonucleotide or the sequence thereof comprises or consists of a sequence selected from SEQ ID NOs: 6, 7, 8, 9, and 18.

[0333] In a favorable embodiment, the antisense oligonucleotide comprises one or more glycosylated nucleosides, for example, one or more 2'-glycosylated nucleosides, for example, one or more 2'-glycosylated nucleosides independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabino nucleic acid (ANA), 2'-fluoro-ANA, and LNA nucleosides. It is advantageous if one or more of the modified nucleosides are locked nucleic acid (LNA).

[0334] In some embodiments, the continuous nucleotide sequence includes LNA nucleosides.

[0335] In some embodiments, the continuous nucleotide sequence includes LNA nucleosides and DNA nucleosides.

[0336] In some embodiments, the continuous nucleotide sequence comprises a 2'-O-methoxyethyl (2'MOE) nucleoside.

[0337] In some embodiments, the continuous nucleotide sequence comprises a 2'-O-methoxyethyl (2'MOE) nucleoside and a DNA nucleoside.

[0338] Advantageously, the antisense oligonucleotide, or the 3'-most nucleoside of its sequence of nucleotides, is a 2'-sugar-modified nucleoside.

[0339] Advantageously, the oligonucleotide comprises at least one modified internucleoside bond, such as a phosphorothioate or phosphorodithioate.

[0340] In some embodiments, at least one nucleoside-nucleoside bond in a sequence of nucleotides is a phosphorothioate nucleoside bond.

[0341] In some embodiments, at least one nucleoside bond in a sequence of nucleotides is a phosphorodithioate nucleoside bond.

[0342] In some embodiments, at least one nucleoside bond in a sequence of nucleotides is a phosphodiester nucleoside bond.

[0343] In some embodiments, all nucleoside-to-nucleoside bonds within a continuous nucleotide sequence are phosphorothioate nucleoside bonds.

[0344] In some embodiments, at least 75% of the nucleoside bonds in the antisense oligonucleotide, or in its sequential nucleotide sequence, are phosphorothioate nucleoside bonds.

[0345] In some embodiments, all nucleoside-to-nucleoside bonds within the antisense oligonucleotide, or within its sequence of nucleotides, are phosphorothioate nucleoside-to-nucleoside bonds.

[0346] In advantageous embodiments of the present invention, the antisense oligonucleotide of the present invention can recruit RNase H, for example, RNase H1. In some embodiments, the antisense oligonucleotide of the present invention or the sequence of nucleotides thereof is a gapmer.

[0347] In some embodiments, the antisense oligonucleotide, or the sequence thereof, consists of or includes a gapmer of formula 5'-FG-F'-3'.

[0348] In some embodiments, region G consists of 6 to 16 DNA nucleosides, for example, 7 to 12 DNA nucleosides. In some embodiments, region F contains 4 to 6 nucleosides, and / or region F' contains 2 to 6 nucleosides.

[0349] In some embodiments, regions F and F' each contain at least one LNA nucleoside.

[0350] In some embodiments of the oligonucleotides of the present invention, all LNA nucleosides are β-D-oxy LNA nucleosides.

[0351] In some embodiments, the oligonucleotide of the present invention is an LNA gapmer having a uniform flank.

[0352] In some embodiments of the present invention, the LNA gapmer is an alternating flank LNA gapmer. In some embodiments, the alternating flank LNA gapmer includes at least one alternating flank (e.g., flank F). In some embodiments, the alternating flank LNA gapmer includes one alternating flank (e.g., flank F) and one uniform flank (e.g., flank F'). In some embodiments, the alternating flank LNA gapmer includes two alternating flanks. For example, the LNA gapmer may have a design selected from the following designs: 3-2-1-9-2, 3-1-1-10-2, 2-1-2-10-3, 2-1-1-11-3, 2-1-1-10-1-1-2, 2-1-1-10-4, 1-3-1-7-1-1-3, and 3-2-1-9-3. Alternatively, the LNA gapmer may have the following design: 1-1-3-9-1-1-2.

[0353] Table 6 lists preferred designs for each motif arrangement.

[0354] The present invention provides the following oligonucleotide compounds (Table 6): [Table 6]

[0355] The heading "Oligonide Compound" in the table represents a specific design of the motif sequence. Uppercase letters represent β-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA Cs are 5-methylcytosine, and all nucleoside bonds are phosphorothioate nucleoside bonds. The heading "Design" refers to gapmer designs, FG-F'. In gapmers of alternating flank designs, the oligonucleotide flanks are annotated as a series of integers, representing the number of β-D-oxy LNA nucleosides (L) followed by the number of DNA nucleosides (D). For example, a flank with a 2-2-1 motif represents LLDDL. Both flanks have β-D-oxy LNA nucleosides at their 5' and 3' ends. The gap region (G) consists of several DNA nucleosides located between the flanks.

[0356] In some embodiments of the present invention, the oligonucleotide is selected from the group consisting of oligonucleotide compounds having CMP numbers 6_1, 6_2, 7_1, 7_2, 7_3, 7_4; 8_1 and 9_1 (see Table 6). For example, the compound may be a compound having CMP number 7_3.

[0357] In alternative embodiments, the oligonucleotide is an oligonucleotide of a compound having CMP number 18_1 (see Table 6).

[0358] In all cases, the FG-F' design may further include regions D' and / or D'' as described in the "Definition" section of "Region D' or D'' in Oligonucleotides". In some embodiments, the oligonucleotides of the present invention have one, two, or three phosphodiester-linked nucleoside units, e.g., DNA units, at the 5' or 3' end of the gapmer region, e.g., the 5' end. In some embodiments, the oligonucleotides of the present invention consist of two 5' phosphodiester-linked DNA nucleosides followed by the FG-F' gapmer region as defined above. Oligonucleotides containing phosphodiester-linked DNA units at the 5' or 3' end are suitable for conjugation and may further include conjugated moieties as described herein. For delivery to the liver, the ASGPR-targeting moiety is particularly advantageous as a conjugated moiety. See Conjugated Moieties for further details.

[0359] Conjugate Since HBV infection primarily affects hepatocytes in the liver, it is advantageous to conjugate the enhanced antisense oligonucleotide of the present invention to a conjugate portion that increases the delivery of the antisense oligonucleotide to the liver compared to a non-conjugated antisense oligonucleotide. In one embodiment, the liver-targeting portion is selected from a portion containing cholesterol or other lipids, or a conjugate portion capable of binding to the asialoglycoprotein receptor (ASGPR).

[0360] In some embodiments, the present invention provides a conjugate comprising an antisense oligonucleotide of the present invention covalently bonded to the conjugate portion.

[0361] The asialoglycoprotein receptor (ASGPR) conjugate moiety comprises one or more carbohydrate moieties capable of binding to the asialoglycoprotein receptor (ASPGR targeting moiety) with affinity equal to or greater than that of galactose. The affinities of numerous galactose derivatives to the asialoglycoprotein receptor have been studied (see, e.g., Jobst, ST and Drickamer, K.JB.C. 1996, 271, 6686) or can be readily determined using methods typical in the art.

[0362] In one embodiment, the conjugate moiety comprises at least one asialoglycoprotein receptor targeting moiety selected from the group consisting of galactose, galactosamine, N-formyl-galactosamine, N-acetylgalactosamine, N-propionyl-galactosamine, Nn-butanoyl-galactosamine, and N-isobutanoylgalactosamine. Advantageously, the asialoglycoprotein receptor targeting moiety is N-acetylgalactosamine (GalNAc).

[0363] To generate an ASGPR conjugate moiety, an ASPGR-targeting moiety (preferably GalNAc) can be attached to a conjugate scaffold. Generally, the ASPGR-targeting moiety may be located at the same end of the scaffold. In one embodiment, the conjugate moiety consists of 2 to 4 terminal GalNAc moieties bound to a spacer that binds each GalNAc moiety to a burracher molecule that can be bound to an antisense oligonucleotide.

[0364] In further embodiments, the conjugate moiety is monovalent, divalent, trivalent, or tetravalent with respect to the asialoclycoprotein receptor targeting moiety. Advantageously, the asialoclycoprotein receptor targeting moiety includes an N-acetylgalactosamine (GalNAc) moiety.

[0365] Examples of GalNAc conjugate moieties include those described in International Publication Nos. 2014 / 179620 and 2016 / 055601 and International Application No. PCT / EP2017 / 059080 (incorporated herein by reference), as well as small peptides to which GalNAc moieties are attached, such as Tyr-Glu-Glu-(aminohexylGalNAc)3(YEE(ahGalNAc)3); glycotripeptides that bind to asialocrypoprotein receptors on hepatocytes, e.g., Duff, et al., Methods Enzymol, 2000, 313, 297; lysine-based galactose clusters (e.g., L3G4; Biessen, et al., Cardovasc. Med., 1999, 214); and corane-based galactose clusters (e.g., carbohydrate recognition motifs for asialocrypoprotein receptors).

[0366] The ASGPR conjugate moiety, particularly the trivalent GalNAc conjugate moiety, can be conjugated to the 3' or 5' end of an oligonucleotide using methods known in the art. In one embodiment, the ASGPR conjugate moiety is conjugated to the 5' end of the oligonucleotide.

[0367] In one embodiment, the conjugated portion is trivalent N-acetylgalactosamine (GalNAc), such as those shown in Figures 9A1, 9A2; 9C1, 9C2, 9D1, 9D2, 9E1, 9F1, 9G1, 9H1, 9I1, 9J1, 9L1, and 9L2, or the conjugated portion is a mixture of 9A1 and 9A2; a mixture of 9C1 and 9C2 or a mixture of 9D1 and 9D2, in particular trivalent N-acetylgalactosamine (GalNAc) or a mixture thereof, as shown in Figure 9D1 or 9D2.

[0368] In some embodiments, the conjugate is selected from the group consisting of the following: 5'-GN2-C6 o c o a o m C s T s T s as t s G s c s t s t s t s t s t s a s t s g s G s T、 5’-GN2-C6 o c o a o m C s T s T s a s T s g s c s t s t s t s t s t s a s t s g s G s T、 5’-GN2-C6 o c o a o m C s T s t s A s T s g s c s t s t s t s t s t s a s t s g s G s T s T、 5’-GN2-C6 o c o a o m C s T s t s A s t s g s c s t s t st s t s t s a s t s g s G s T s T、 5’-GN2-C6 o c o a o m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s g s T s T、 5’-GN2-C6 o c o a o m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s G s T s T、 5’-GN2-C6 o c o a o G s c s t s t s T s t s t s a s t s g s g s t s T s ts m C s A s m C, and 5’-GN2-C6 o c o a o T s A s T s g s c s T s t s t s t s t s a s t s g s g s t s T s T s m C, 5’-GN2-C6 o c o a o A S c S m C S A S A S t S t S t S t S c S a S t S t S t S m C S tA S m C Uppercase letters represent β-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, each LNA cytosine is 5-methylcytosine, the subscript s represents a phosphorothioate nucleoside bond, the subscript o represents a phosphodiester nucleoside bond, and GN2-C6 is trivalent N-acetylgalactosamine (GalNAc) as shown in Figure 9D, for example, trivalent N-acetylgalactosamine (GalNAc) as shown in Figure 9D-1 or Figure 9D2, or a mixture of both, preferably linked via a phosphodiester bond at the 5' end of the oligonucleotide. Chemical diagrams representing some molecules are shown in Figures 1 to 8 and Figure 8.1.

[0369] In some embodiments, the conjugate is the conjugate shown in Figure 1.

[0370] In some embodiments, the conjugate is the conjugate shown in Figure 2.

[0371] In some embodiments, the conjugate is the conjugate shown in Figure 3.

[0372] In some embodiments, the conjugate is the conjugate shown in Figure 4.

[0373] In some embodiments, the conjugate is the conjugate shown in Figure 5.

[0374] In some embodiments, the conjugate is the conjugate shown in Figure 6.

[0375] In some embodiments, the conjugate is the conjugate shown in Figure 7.

[0376] In some embodiments, the conjugate is the conjugate shown in Figure 8.

[0377] In some embodiments, the conjugate is the conjugate shown in Figure 8.1.

[0378] The compounds illustrated in Figures 1-8 and 8.1 are shown in protonated form, meaning the sulfur atom on the phosphorothioate bond is protonated. It will be understood that the presence of the proton depends on the acidity of the molecular environment and the presence of alternative cations (e.g., when the oligonucleotide is in salt form). Protonated phosphorothioates exist in tautomerized forms.

[0379] Pharmaceutically acceptable salts The compounds according to the present invention may exist in the form of their pharmaceutically acceptable salts. The term "pharmaceutically acceptable salt" refers to conventional acid-addition salts or base-addition salts formed from suitable non-toxic organic or inorganic acids or organic or inorganic bases that retain the biological efficacy and properties of the compounds of the present invention. Acid-addition salts include, for example, those derived from inorganic acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, sulfamic acid, phosphoric acid, and nitric acid, as well as those derived from organic acids such as p-toluenesulfonic acid, salicylic acid, methanesulfonic acid, oxalic acid, succinic acid, citric acid, malic acid, lactic acid, and fumaric acid. Base-addition salts include those derived from ammonium, potassium, sodium, and quaternary ammonium hydroxides, such as tetramethylammonium hydroxide. Chemical modification of medicinal compounds into salts is a well-known technique among medicinal chemists to improve the physical and chemical stability, hygroscopicity, fluidity, and solubility of the compounds. This is described, for example, in Bastin, Organic Process Research & Development 2000, 4, 427-435 or in Ansel, In: Pharmaceutical Dosage Forms and Drug Delivery Systems, 6th ed. (1995), pp. 196 and 1456-1457. For example, a pharmaceutically acceptable salt of a compound provided herein may be a sodium salt.

[0380] In a further embodiment, the present invention provides pharmaceutically acceptable salts of antisense oligonucleotides or their conjugates, such as pharmaceutically acceptable sodium salts, ammonium salts, or potassium salts.

[0381] Manufacturing method In further embodiments, the present invention provides a method for producing oligonucleotides of the present invention, comprising reacting nucleotide units to form a covalently linked sequence of oligonucleotides. Preferably, this method utilizes phosphoramidite chemistry (see, for example, Caruthers et al. (1987) "Methods in Enzymology" Vol. 154, pp. 287-313). In further embodiments, this method further comprises reacting a sequence of nucleotides with a conjugate moiety (ligand) to covalently bond the conjugate moiety to an oligonucleotide. In further embodiments, a method for producing a composition of the present invention is provided, comprising mixing the oligonucleotide or conjugated oligonucleotide of the present invention with a pharmaceutically acceptable diluent, solvent, carrier, salt, and / or adjuvant.

[0382] Pharmaceutical composition In further embodiments, the present invention provides pharmaceutical compositions comprising any of the aforementioned oligonucleotides and / or oligonucleotide conjugates or salts thereof, and a pharmaceutically acceptable diluent, carrier, salt, and / or adjuvant. The pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS), and the pharmaceutically acceptable salt includes, but is not limited to, sodium salts, ammonium salts, and potassium salts. In some embodiments, the pharmaceutically acceptable diluent is sterile phosphate-buffered saline. Alternatively, the diluent may be water or a sodium chloride solution. In some embodiments, the oligonucleotide is used in a concentration of 50 to 300 μM in the pharmaceutically acceptable diluent.

[0383] Formulations suitable for use in the present invention can be found in Remington's Pharmaceutical Sciences, Mack Publishing Company, Philadelphia, Pa., 17th ed., 1985. For a brief review of drug delivery methods, see, for example, Langer (Science 249:1527-1533, 1990). International Publication No. 2007 / 031091 provides further suitable and preferred examples of pharmaceutically acceptable diluents, carriers, and adjuvants (incorporated herein by reference). Suitable doses, formulations, routes of administration, compositions, dosage forms, combinations with other therapeutic agents, and prodrug formulations are also provided in International Publication No. 2007 / 031091.

[0384] In some embodiments, the antisense oligonucleotides of the present invention, their conjugates, or pharmaceutically acceptable salts thereof are in solid form, such as powder, such as freeze-dried powder.

[0385] In some embodiments, the antisense oligonucleotides or their conjugates of the present invention may be mixed with pharmaceutically acceptable active or inactive substances for the preparation of pharmaceutical compositions or formulations. The compositions and methods for the preparation of pharmaceutical compositions depend on many criteria, including the route of administration, the severity of the disease, or the dose administered, but are not limited to these.

[0386] These compositions may be sterilized by conventional sterilization techniques or subjected to a sterile filter. The resulting aqueous solution can be packaged for immediate use or freeze-dried, and the freeze-dried preparation is combined with a sterile aqueous carrier before administration. The pH of the preparation will typically be 3 to 11, more preferably 5 to 9 or 6 to 8, most preferably 7 to 8, for example, 7 to 7.5. The resulting solid-form compositions can be packaged in multiple single-dose units, each containing a fixed amount of the above-mentioned drug or group of drugs, such as in sealed tablet or capsule packages. The solid-form compositions can also be packaged in flexible-volume containers, such as squeeze-out tubes designed for topically applicable creams or ointments.

[0387] In some embodiments, the antisense oligonucleotide or its conjugate of the present invention is a prodrug. In particular, with respect to antisense oligonucleotide conjugates, when the prodrug is delivered to the site of action, for example, a target cell, the conjugate portion is cleaved from the oligonucleotide.

[0388] Purpose The enhanced antisense oligonucleotides of the present invention can be used, for example, as research reagents for diagnostic, therapeutic, and prophylactic methods.

[0389] In research, such antisense oligonucleotides can be used to specifically regulate the synthesis of the FUBP1 protein in cells (e.g., in vitro cell cultures) and experimental animals, thereby facilitating the functional analysis of the target or the evaluation of its usefulness as a target for therapeutic intervention. Typically, target regulation is achieved by degrading or inhibiting the mRNA that produces the protein, thereby preventing protein formation, or by degrading or inhibiting the protein-producing gene or mRNA modulator.

[0390] When the antisense oligonucleotide of the present invention is used for research or diagnostic purposes, the target nucleic acid may be cDNA or a synthetic nucleic acid derived from DNA or RNA.

[0391] The present invention also includes an in vivo or in vitro method for modulating FUBP1 expression in target cells expressing FUBP1, comprising administering an effective amount of the antisense oligonucleotide, its conjugate, or pharmaceutical composition of the present invention to said cells.

[0392] In some embodiments, the target cells are mammalian cells, particularly human cells. The target cells may be in vitro cell cultures or in vivo cells that form part of a mammalian tissue. In preferred embodiments, the target cells are located in the liver. The target cells may be hepatocytes.

[0393] One aspect of the present invention relates to an antisense oligonucleotide, its conjugate, or a pharmaceutical composition used as a pharmaceutical.

[0394] In one aspect of the present invention, the antisense oligonucleotide, its conjugate, or pharmaceutical composition of the present invention can reduce cccDNA levels in infected cells and thus inhibit HBV infection. In particular, the antisense oligonucleotide or its conjugate can affect one or more of the following parameters in infected cells: (i) a decrease in cccDNA and / or (ii) a decrease in pgRNA and / or (iii) a decrease in HBV DNA and / or (iv) a decrease in HBV viral antigen.

[0395] For example, antisense oligonucleotides or their conjugates that inhibit HBV infection can (i) reduce cccDNA levels in infected cells by at least 40%, e.g., 50%, 60%, 70%, 80%, or 90%, compared to a control, or (ii) reduce pgRNA levels by at least 40%, e.g., 50%, 60%, 70%, 80%, or 90%, compared to a control. The control may be untreated cells or animals, or cells or animals treated with an appropriate control.

[0396] Inhibition of HBV infection can be measured in vitro using primary human hepatocytes infected with HBV, or in vivo using a humanized hepatocyte PXB mouse model (available from PhoenixBio; see also Kakuni et al. (2014) "Int.J.Mol.Sci." Vol. 15, pp. 58-74). Inhibition of HBsAg and / or HBeAg secretion can be measured by ELISA, for example, using the CLIA ELISA kit (Autobio Diagnostic), according to the manufacturer's instructions. Reduction of intracellular cccDNA or HBV mRNA and pgRNA can be measured by qPCR, for example, as described in the Materials and Methods section. Further methods for evaluating whether the test compound inhibits HBV infection are to measure HBV DNA secretion by qPCR, for example, as described in International Publication No. 2015 / 173208, or by Northern blotting, in situ hybridization, or immunofluorescence.

[0397] By reducing FUBP1 levels, the antisense oligonucleotides, their conjugates, or pharmaceutical compositions of the present invention can be used to inhibit or treat the onset of HBV infection. In particular, the destabilization and reduction of cccDNA, antisense oligonucleotides, their conjugates, or pharmaceutical compositions of the present invention more efficiently inhibit or treat the onset of chronic HBV infection compared to compounds that only reduce HBsAg secretion.

[0398] Accordingly, one aspect of the present invention relates to the use of the antisense oligonucleotide, its conjugate, or pharmaceutical composition of the present invention for reducing cccDNA and / or pgRNA in HBV-infected individuals.

[0399] Further aspects of the present invention relate to the use of the antisense oligonucleotides, their conjugates, or pharmaceutical compositions of the present invention for inhibiting or treating the development of chronic HBV infection.

[0400] Further aspects of the present invention relate to the use of the antisense oligonucleotides, their conjugates, or pharmaceutical compositions of the present invention to reduce the infectivity of HBV-infected individuals. In certain aspects of the present invention, the antisense oligonucleotides, their conjugates, or pharmaceutical compositions of the present invention inhibit the development of chronic HBV infection.

[0401] The subjects treated with the antisense oligonucleotide, its conjugate, or pharmaceutical composition of the present invention (or those who prophylactically receive the antisense oligonucleotide, its conjugate, or pharmaceutical composition of the present invention) are preferably human, more preferably HBsAg-positive and / or HBeAg-positive human patients, and more preferably HBsAg-positive and HBeAg-positive human patients.

[0402] Accordingly, the present invention relates to a method for treating HBV infection, comprising administering an effective amount of the antisense oligonucleotide, its conjugate, or pharmaceutical composition of the present invention. The present invention further relates to a method for preventing cirrhosis and hepatocellular carcinoma resulting from chronic HBV infection.

[0403] The present invention also provides the use of the antisense oligonucleotides thereof, their conjugates, or pharmaceutical compositions for the manufacture of pharmaceuticals, particularly pharmaceuticals used for the treatment of HBV infection or chronic HBV infection, or for reducing the infectivity of HBV-infected individuals. In preferred embodiments, the pharmaceuticals are manufactured in dosage forms for subcutaneous administration.

[0404] The present invention also provides the use of the antisense oligonucleotide, its conjugate, and pharmaceutical composition for the manufacture of a pharmaceutical, wherein the pharmaceutical is in a dosage form for intravenous administration.

[0405] Combination therapy In some embodiments, the enhanced antisense oligonucleotides, their conjugates, or pharmaceutical compositions of the present invention are intended for use in combination with another therapeutic agent. The therapeutic agent may, for example, be a standard therapeutic agent for the aforementioned disease or disorder.

[0406] For example, antisense oligonucleotides, their conjugates, or pharmaceutical compositions can be used in combination with other activators such as oligonucleotide antiviral agents, e.g., sequence-specific oligonucleotide antiviral agents, which act via any of the following mechanisms: antisense (including other LNA oligomers), siRNA (such as ARC520), aptama, morpholino, or any other antiviral, nucleotide sequence-dependent mode of action.

[0407] As a further example, antisense oligonucleotides, their conjugates, or pharmaceutical compositions can be used in combination with other active substances such as interferons (e.g., pegylated interferon-α), TLR7 agonists (e.g., GS-9620), or immunostimulatory antiviral compounds such as therapeutic vaccines.

[0408] As a further example, antisense oligonucleotides, their conjugates, or pharmaceutical compositions can be used in combination with other active substances having antiviral activity, such as small molecules. These other active substances may be, for example, nucleoside / nucleotide inhibitors (e.g., entecavir or tenofovir disoproxil fumarate), inclusion inhibitors, or entry inhibitors (e.g., Myrcludex B).

[0409] In certain embodiments, additional therapeutic agents may be HBV drugs, hepatitis C virus (HCV) drugs, chemotherapeutic agents, antibiotics, analgesics, nonsteroidal anti-inflammatory drugs (NSAIDs), antifungal agents, antiparasitic agents, antiemetics, antidiarrheals, or immunosuppressants.

[0410] In particular, in the relevant embodiments, additional HBV agents may be interferon α-2b, interferon α-2a, and interferon alphacon-1 (pegylated and non-pegylated), ribavirin; HBV RNA replication inhibitors; second antisense oligomers; HBV therapeutic vaccines; HBV prophylactic vaccines; lamivudine (3TC); entecavir (ETV); tenofovir diisoproxil fumarate (TDF); terbivudine (LdT); adefovir; or HBV antibody therapy (monoclonal or polyclonal).

[0411] In other specific related embodiments, further HCV agents may include interferon α-2b, interferon α-2a, and interferon alphacon-1 (pegylated and unpegylated); ribavirin; pegasys; HCV RNA replication inhibitors (e.g., ViroPharma VP50406 series); HCV antisense agents; HCV therapeutic vaccines; HCV protease inhibitors; HCV helicase inhibitors; or HCV monoclonal antibody therapy or HCV polyclonal antibody therapy.

[0412] Administration The enhanced antisense oligonucleotides, their conjugates, or pharmaceutical compositions of the present invention are formulated, administered, and given in a manner consistent with excellent medical practice. Factors to be considered in this regard include the specific mammal being treated, the clinical symptoms of the individual patient, the site of drug delivery, the method of administration, the administration schedule, the patient's age and sex, and other factors known to the healthcare professional. Herein, “effective dose” (also known as “(therapeutably) effective dose”) means the amount of compound that elicits a biological or medical response in the subject as sought by the physician or other clinician. The “effective dose” of the oligonucleotides, conjugate compounds, or pharmaceutical compositions of the present invention is the minimum amount required to inhibit HBsAg and / or HBeAg, depending on such considerations. For example, such a dose may be less than the amount that is toxic to the recipient’s cells or the entire mammal.

[0413] In some embodiments, the antisense oligonucleotides, their conjugates, or pharmaceutical compositions of the present invention are administered in doses of 0.1 to 15 mg / kg, for example, 0.2 to 10 mg / kg, or for example, 0.25 to 5 mg / kg. Administration may be once a week, once every two weeks, once every three weeks, or once a month.

[0414] The antisense oligonucleotides, their conjugates, or pharmaceutical compositions of the present invention may be administered topically (e.g., through the skin, by inhalation, by the eyes or ears), enterally (e.g., orally or through the gastrointestinal tract), or parenterally (e.g., intravenously, subcutaneously, or intramuscularly).

[0415] In preferred embodiments, the antisense oligonucleotides, their conjugates, or pharmaceutical compositions of the present invention are administered by parenteral routes, including intravenous, intra-arterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion. In one embodiment, the active oligonucleotide or oligonucleotide conjugate is administered intravenously. For GalNAc conjugate compounds, subcutaneous administration may be advantageous to delay ASGP receptor saturation.

[0416] Embodiments of the present invention The following embodiments of the present invention can be used in combination with any other embodiments described herein. The definitions and descriptions provided above, in particular in the sections “Summary of the Invention,” “Definitions,” and “Detailed Description of the Invention,” will apply mutatis mutandis below.

[0417] 1. An antisense oligonucleotide comprising a continuous nucleotide sequence that is at least 90% complementary to the FUBP1 nucleic acid, for example, completely complementary, which can inhibit the expression of FUBP1 such as human FUBP1 in cells.

[0418] 2. An antisense oligonucleotide according to Embodiment 1, a) The continuous nucleotide sequence is at least 90% complementary to the region within exon 14 of human FUBP1 (see Table 3), for example, completely complementary, or b) Antisense oligonucleotides whose continuous nucleotide sequence is at least 90% complementary, e.g., fully complementary, to a region within exon 20 of human FUBP1 (see Table 3).

[0419] 3. Antisense oligonucleotides according to Embodiments 1 and 2, a) The sequence of nucleotides is perfectly complementary to the region of human FUBP1 premRNA shown in SEQ ID NO: 1, for example, a region selected from the regions of nucleotides 16184-16200, nucleotides 16186-16203, nucleotides 16188-16205 and nucleotides 16189-16205 of SEQ ID NO: 1, or b) An antisense oligonucleotide whose continuous nucleotide sequence is perfectly complementary to the region from nucleotides 30536–30553 of the human FUBP1 premRNA shown in SEQ ID NO: 1.

[0420] 4. An antisense oligonucleotide according to any one of Embodiments 1 to 3, wherein a) the sequence of nucleotides is fully complementary to SEQ ID NO: 10 and / or SEQ ID NO: 11, or b) the sequence of nucleotides is fully complementary to SEQ ID NO: 19.

[0421] 5. An antisense oligonucleotide according to any one of Embodiments 1 to 4, having a length of 12 to 30 nucleotides, for example, 12 to 22 nucleotides, or for example, 16 to 20 nucleotides.

[0422] 6. An antisense oligonucleotide according to any one of Embodiments 1 to 4, wherein the continuous nucleotide sequence is a continuous sequence of at least 12 nucleotides, for example, 14, 15, 16, 17, or 18 nucleotides.

[0423] 7. The antisense oligonucleotide according to Embodiment 6, wherein the continuous nucleotide sequence is a continuous sequence of 17 or 18 nucleotides.

[0424] 8. An antisense oligonucleotide according to any one of Embodiments 1 to 7, wherein the sequence of nucleotides is 100% identical to a sequence selected from the group consisting of SEQ ID NOs. 6, 7, 8, 9, and 18, or to at least 15 of those sequences of nucleotides.

[0425] 9. An antisense oligonucleotide according to any one of Embodiments 1 to 8, comprising one or more modified nucleosides in a continuous nucleotide sequence.

[0426] 10. An antisense oligonucleotide of Embodiment 9, wherein one or more modified nucleosides in a continuous nucleotide sequence are 2'-saccharide modified nucleosides.

[0427] 11. The antisense oligonucleotide according to Embodiment 10, wherein one or more 2'-saccharide-modified nucleosides are independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabino nucleic acid (ANA), 2'-fluoro-ANA, and LNA nucleosides.

[0428] 12. An antisense oligonucleotide according to any one of embodiments 9 to 11, wherein one or more modified nucleosides are LNA nucleosides such as oxy-LNA having the following 2'-4' crosslinked-O-CH2-.

[0429] 13. The antisense oligonucleotide according to Embodiment 12, wherein one or more modified nucleosides are β-D-oxy-LNA.

[0430] 14. An antisense oligonucleotide according to any one of embodiments 1 to 13, wherein at least one nucleoside bond in the continuous nucleotide sequence is a phosphorothioate nucleoside bond.

[0431] 15. An antisense oligonucleotide according to any one of Embodiments 1 to 14, wherein at least one nucleoside bond in the continuous nucleotide sequence is a phosphorodithioate nucleoside bond.

[0432] 16. An antisense oligonucleotide according to any one of embodiments 1 to 15, wherein at least one nucleoside bond in the continuous nucleotide sequence is a phosphodiester nucleoside bond.

[0433] 17. The antisense oligonucleotide according to Embodiment 16, wherein all nucleoside-to-nucleoside bonds in the continuous nucleotide sequence are phosphorothioate nucleoside-to-nucleoside bonds.

[0434] 18. The antisense oligonucleotide according to any one of Embodiments 1 to 17, wherein the antisense oligonucleotide is an antisense oligonucleotide capable of recruiting RNase H such as RNase H1.

[0435] 19. The antisense oligonucleotide according to Embodiment 18, wherein the antisense oligonucleotide, or the sequence of nucleotides thereof, consists of or includes a gapmer of formula 5'-FG-F'-3'.

[0436] 20. The antisense oligonucleotide according to Embodiment 19, wherein region G has a length of 6 to 16 DNA nucleosides, for example, 7 to 12 DNA nucleosides, for example, 7 to 11 DNA nucleosides.

[0437] 21. An antisense oligonucleotide according to any one of embodiments 18 to 20, wherein regions F and F' each contain at least one LNA nucleoside, for example, regions F and F' each contain at least one LNA nucleoside.

[0438] 22. An antisense oligonucleotide according to any one of embodiments 18 to 21, wherein region F has a length of 1 to 8 DNA nucleosides, for example, 4 to 6 DNA nucleosides.

[0439] 23. An antisense oligonucleotide according to any one of embodiments 18 to 22, wherein region F' has a length of 1 to 8 DNA nucleosides, for example, 2 to 6 DNA nucleosides.

[0440] 24. An antisense oligonucleotide or a sequence thereof is defined by formula F 4-6 -G 7-11 -F' 2-6 An antisense oligonucleotide according to any one of embodiments 18 to 23, comprising or including a gapmer, preferably the gapmer comprising at least one alternating flank.

[0441] 25. Below CTTatGctttttatgGT (Sequence ID 6), CTTaTgctttttatgGT (Sequence ID 6), CTtATgctttttatgGTT (Sequence ID 7), CTtAtgctttttatgGTT (Sequence ID 7), CTtAtgctttttatGgTT (Sequence ID 7), CTtAtgctttttatGGTT (Sequence ID 7), GcttTttatggtTtCAC (Sequence ID 8), TATgcTttttatggtTTC (SEQ ID NO: 9), and AcCAAttttcatttCtAC (Sequence ID 18) An antisense oligonucleotide according to any one of embodiments 1 to 24, selected from the group consisting of the following: Antisense oligonucleotides where uppercase letters represent β-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA Cs are 5-methylcytosine, and all nucleoside-to-nucleoside bonds are phosphorothioate nucleoside-to-nucleoside bonds.

[0442] 26. A conjugate comprising an antisense oligonucleotide according to any one of Embodiments 1 to 25 and at least one conjugate portion covalently bonded to the antisense oligonucleotide.

[0443] 27. The conjugate according to Embodiment 27, wherein the conjugate portion comprises at least one asialoglycoprotein receptor targeting moiety selected from the group consisting of galactose, galactosamine, N-formyl-galactosamine, N-acetylgalactosamine, N-propionyl-galactosamine, Nn-butanoyl-galactosamine, and N-isobutanoylgalaxamine.

[0444] 28. The conjugate compound according to Embodiment 27, wherein the asialoclycoprotein receptor targeting moiety is N-acetylgalactosamine (GalNAc).

[0445] 29. The conjugate compound of Embodiment 27 or 28, wherein the conjugate portion is monovalent, divalent, trivalent, or tetravalent with respect to the asialocrypoprotein receptor targeting portion.

[0446] 30. The conjugate compound according to Embodiment 29, wherein the conjugate portion comprises 2 to 4 terminal GalNAc moieties and spacers that attach each GalNAc moiety to a blancher molecule that can be conjugated to an antisense compound.

[0447] 31. The conjugate compound according to Embodiment 30, wherein the spacer is a PEG spacer.

[0448] 32. The conjugate compound according to any one of Embodiments 26 to 31, wherein the conjugate portion is a trivalent N-acetylgalactosamine (GalNAc) portion.

[0449] 33. The conjugate compound according to any one of embodiments 26 to 32, wherein the conjugate portion is selected from one of the trivalent GalNAc portions in Figures 9A1, 9A2; 9C1, 9C2, 9D1, 9D2, 9E1, 9F1, 9G1, 9H1, 9I1, 9J1, 9L1, and 9L2.

[0450] 34. The conjugate compound according to Embodiment 33, wherein the conjugate portion is the trivalent GalNAc portion shown in Figure 9D1 or 9D2, or a mixture thereof.

[0451] 35. A conjugate compound according to any one of embodiments 26 to 34, comprising a linker positioned between an antisense oligonucleotide and a conjugate moiety.

[0452] 36. The conjugate compound according to Embodiment 35, wherein the linker comprises or consists of 2 to 5 consecutive phosphodiester bonded nucleosides, for example, 2 consecutive phosphodiester bonded nucleosides, for example, phosphodiester bonded nucleosides.

[0453] 37. A conjugate according to any one of embodiments 26 to 36, selected from the group consisting of the following: 5'-GN2-C6 o c o a o m C s T s T s a s t s G s c s t s t s t s t s t s as t s g s G s T、 5’-GN2-C6 o c o a o m C s T s T s a s T s g s c s t s t s t s t s t s a s t s g s G s T、 5’-GN2-C6 o c o a o m C s T s t s A s T s g s c s t s t s t s t s t s a s t s g s G s T s T、 5’-GN2-C6 o c o a o m C s T s t s A s t s g s c s t s t s t s t s t s a s t s g s G s T s T、 5’-GN2-C6 o c o a o m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s g s T s T、 5’-GN2-C6 o c o a o m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s G s T s T、 5’-GN2-C6 o c o a o G s c s t s t s T s t s t s a s t s g s g s t s T s t s m C s A s m C、 5’-GN2-C6 o c o a o Ts A s T s g s c s T s t s t s t s t s a s t s g s g s t s T s T s m C, and 5'-GN2-C6 o c o a o A S c S m C S A S A S t S t S t S t S c S a S t S t S t S m C S tA S m C Preferably, uppercase letters represent β-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, and each LNA cytosine is 5-methylcytosine. m c is 5-methylcytosine DNA, the subscript s represents a phosphorothioate nucleoside bond, the subscript o represents a phosphodiester nucleoside bond, and GN2-C6 is trivalent N-acetylgalactosamine (GalNAc) as shown in Figure 9D, for example trivalent N-acetylgalactosamine (GalNAc) as shown in Figure 9D-1 or Figure 9D2, or a mixture of both, preferably linked via a phosphodiester bond at the 5' end of the oligonucleotide.

[0454] 38. The conjugate shown in Figure 1.

[0455] 39. The conjugate shown in Figure 2.

[0456] 40. The conjugate shown in Figure 3.

[0457] 41. The conjugate shown in Figure 4.

[0458] 42. The conjugate shown in Figure 5.

[0459] 43. The conjugate shown in Figure 6.

[0460] 44. The conjugate shown in Figure 7.

[0461] 45. The conjugate shown in Figure 8.

[0462] 46. ​​The conjugate shown in Figure 8.1.

[0463] 47. A pharmaceutically acceptable salt of any one oligonucleotide from Embodiments 1 to 25 or any one of the conjugates described in Embodiments 26 to 46.

[0464] 48. A pharmaceutical composition comprising an antisense oligonucleotide according to any one of Embodiments 1 to 25, a conjugate according to any one of Embodiments 26 to 46, or a pharmaceutically acceptable salt according to Embodiment 48, and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

[0465] 49. An in vivo or in vitro method for modulating FUBP1 expression in target cells expressing FUBP1, comprising administering to the cells in an effective amount of an antisense oligonucleotide according to any one of Embodiments 1 to 25, a conjugate according to any one of Embodiments 26 to 46, a pharmaceutically acceptable salt according to Embodiment 48, or a pharmaceutical composition according to Embodiment 48.

[0466] 50. A method for treating or preventing a disease, comprising administering to a subject who is afflicted with or susceptible to the disease a therapeutically effective amount or a preventively effective amount of an antisense oligonucleotide according to any one of Embodiments 1 to 25, a conjugate according to any one of Embodiments 26 to 46, a pharmaceutically acceptable salt according to Embodiment 47, or a pharmaceutical composition according to Embodiment 48, wherein the disease is hepatitis B virus (HBV) infection and / or cancer.

[0467] 51. An antisense oligonucleotide according to any one of Embodiments 1 to 25, a conjugate according to any one of Embodiments 26 to 46, a pharmaceutically acceptable salt according to Embodiment 47, or a pharmaceutical composition according to Embodiment 48, for use in a pharmaceutical.

[0468] 52. An antisense oligonucleotide according to any one of Embodiments 1 to 25, a conjugate according to any one of Embodiments 26 to 46, a pharmaceutically acceptable salt according to Embodiment 47, or a pharmaceutical composition according to Embodiment 48, for use in the treatment or prevention of hepatitis B virus (HBV) infection and / or cancer.

[0469] 53. Use of an antisense oligonucleotide according to any one of Embodiments 1 to 25, a conjugate according to any one of Embodiments 26 to 46, a pharmaceutically acceptable salt according to Embodiment 47, or a pharmaceutical composition according to Embodiment 48 for preparing a medicament for treating or preventing hepatitis B virus (HBV) infection and / or cancer.

[0470] 54. The method according to Embodiment 50, the antisense oligonucleotide, conjugate, pharmaceutical composition, or pharmaceutically acceptable salt for use as described in Embodiment 52, or the use as described in Embodiment 53, wherein the disease is hepatitis B virus (HBV) infection, for example, chronic HBV infection.

[0471] 55. The method according to Embodiment 50, the antisense oligonucleotide, conjugate, pharmaceutical composition, or pharmaceutically acceptable salt for use as described in Embodiment 52, or the use as described in Embodiment 53, for which the disease is cancer, e.g., hepatocellular carcinoma.

[0472] 56. An antisense oligonucleotide according to any one of Embodiments 1 to 25, wherein the antisense oligonucleotide is AcCAAttttcatttCtAC (SEQ ID NO: 18), a conjugate according to any one of claims 26 to 33 and 45, a pharmaceutically acceptable salt according to Embodiment 47, or a pharmaceutical composition according to Embodiment 48, a use according to claim 53, or the methods according to claims 54 and 54.

[0473] 57. An antisense oligonucleotide according to any one of Embodiments 1 to 25, wherein the antisense oligonucleotide is CTtAtgctttttatGgTT (SEQ ID NO: 7), a conjugate according to any one of claims 26 to 33 and 42, a pharmaceutically acceptable salt of Embodiment 47, or a pharmaceutical composition according to Embodiment 48, a use according to claim 53, or the methods of claims 54 and 54. [Examples]

[0474] Introduction Overexpression and mutations of FUBP1 have long been known to be associated with cancer. In particular, strong overexpression of FUBP1 in human hepatocellular carcinoma (HCC) supports tumor growth and correlates with poor patient prognosis.

[0475] In infected hepatocytes, HBV cccDNA is involved in persistent chronic infection and reactivation, serving as a template for all viral subgenomic transcripts and pregenomic RNA (pgRNA), ensuring both newly synthesized viral progeny and cccDNA pool replenishment via intracellular nucleocapsid recirculation.

[0476] International Publication No. 2019 / 193165 demonstrated that FUBP1 is associated with cccDNA stability. This knowledge opens up opportunities to destabilize cccDNA in HBV-infected subjects, potentially leading to a complete cure for chronically infected HBV patients.

[0477] In this study, we screened over 2000 antisense oligonucleotides targeting human FUBP1. This screening identified compounds that are particularly potent and effective in targeting human FUBP1. Specifically, we identified nine alternating flank gapmer LNA oligonucleotides that target a region within exon 14 of human FUBP1 and confer strong downregulation of human FUBP1 in vitro. Furthermore, we identified one alternating flank gapmer LNA oligonucleotide that targets a region within exon 20 of human FUBP1 and also confers strong downregulation of human FUBP1. A summary of the nine identified compounds is shown in Table 6 above.

[0478] The target sequences of the identified compounds overlap with the target sequences of CMP numbers 53_1 and 54_1 disclosed in International Publication No. 2019 / 193165. These two compounds inhibit FUBP1 in HeLa cells by approximately 70% at 5 μM. However, the nine identified compounds are clearly more effective, inhibiting FUBP1 in HeLa cells by approximately 25% to 35% at 3.3 μM, or by approximately 27% at 5 μM (CMP number 18_1). In addition, they are more efficient in targeting FUBP1 in HeLa cells than CMP number 50_1, the best compound in International Publication No. 2019 / 193165 (see Example 1).

[0479] Table 7 below provides summaries of prior art compounds 35_1, 50_1, 53_1, 54_1, 78_1, and 79_1 from International Publication No. 2019 / 193165. The compounds are gapmers with homogeneous flanks. CMP number 50_1 was the best compound in PHH cells, and CMP number 35_1 was the best compound in HeLa cells. CMP numbers 53_1 and 54_1 are the closest compounds to CMP numbers 6_1, 6_2, 7_1, 7_2, 7_3, 7_4; 8_1, and 9_1. CMP numbers 78_1 and 79_1 are the closest compounds to CMP number 18_1.

[0480] [Table 7] Regarding the compounds: Uppercase letters represent LNA nucleosides (using β-D-oxy LNA nucleosides), all LNA cytosines are 5-methylcytosine, and lowercase letters represent DNA nucleosides. All nucleoside bonds are phosphorothioate nucleoside bonds.

[0481] Example 1: In vitro efficacy testing of antisense oligonucleotides targeting human FUBP1 mRNA in HeLa cells. We tested the ability of antisense oligonucleotides targeting FUBP1 to reduce FUBP1 mRNA expression in human HeLa cells (catalog number 93021013) obtained from ECACC.

[0482] Hela cells were grown in cell culture medium (EMEM [Sigma, catalog no. M2279] supplemented with 10% fetal bovine serum [Sigma, catalog no. F7524], 2 mM glutamine [Sigma, G7513], 0.1 mM NEAA [Sigma, M7145], and 0.025 mg / ml gentamicin [Sigma, catalog no. G1397]). The cells were washed with phosphate-buffered salt solution (PBS) [Sigma cat. no. 14190-094], then incubated at 37°C for 2-3 minutes with 0.25% trypsin-EDTA solution (Sigma, T3924), and triedpsinized every 5 days by grinding before seeding.

[0483] For the experiment, 2500 cells per well were seeded in 190 μL of growth medium in a 96-well plate (Nunc catalog number 167008). Approximately 24 hours after seeding, when the cells reached their final custom concentration, ASO dissolved in PBS was added. The cells were incubated for 3 days without changing the medium.

[0484] After incubation, the culture medium was removed, followed by the collection of cells by adding 125 μL of RLT Lysis buffer (Qiagen 79216) and 125 μL of 70% ethanol. RNA was purified according to the manufacturer's instructions (Qiagen RNeasy 96 kit) and eluted with a final volume of 200 μL of DNase / RNase-free water (Gibco).

[0485] The RNA was subjected to a heat shock at 90°C for 40 seconds to thaw the RNA:LNA double helix, transferred directly to ice, and spun down before use. For a one-step qPCR reaction, a master mix was prepared by mixing a qPCR mix (qScript® XLE 1-step RT-qPCR TOUGHMIX® Low ROX (QauntaBio, catalog no. 95134-500)) with two IDT probes (final concentration 1X). The Taqman probe was obtained from IDT:FUBP1:Hs.PT.58.26883775 (primer-probe ratio 2, FAM) or ThermoFisher Scientific:GUSB:4326320E. Next, the master mix (6 μL) and RNA (4 μL, 1-2 ng / μL) were mixed in a quantitative PCR plate (MICROAMP® Optical 384 wells, 4309849). After sealing, the plate was rapidly rotated (1000g for 1 minute at room temperature) and transferred to a Viia® 7 system (Applied Biosystems, Thermo) using the following PCR conditions: 15 minutes at 50°C; 3 minutes at 95°C; and the following for 40 cycles: 5 seconds at 95°C, followed by a temperature decrease of 1.6°C / sec, followed by 45 seconds at 60°C. Data were analyzed using QuantStudio® Real-time PCR software.

[0486] qPCR data was captured, and the quality control of the raw data was performed using Quantstudio 7 software.

[0487] Next, the data was imported into an E-Workbook, and the data was captured and analyzed using a BioBook template. The data was analyzed using the following steps: 1. Calculate the quantity using the delta-delta-Ct method (Quantity = 2^(-Ct) * 1000000000) 2. Normalize the amount relative to the amount calculated for the housekeeping gene assay performed in the same well. Relative target amount = amount_target / amount_housekeeping 3. RNA knockdown was calculated for each well by dividing by the average of all PBS-treated wells on the same plate. Normalized target dose = (relative target dose / [average] relative target dose]_pbs_wells) * 100 4. The final data is presented as a percentage of untreated (PBS) wells.

[0488] 5. For concentration-response experiments, curves were fitted from RNA knockdown values ​​(steps 3-4) for each compound [either concentration 8 or 10, depending on the dilution model]. The curves were fitted using the Biobook 4-parameter sigmoid dose-response model.

[0489] Table 8 shows the relative FUBP1 mRNA expression levels as a percentage of the control group. That is, a smaller value indicates greater inhibition. Furthermore, the results are shown in Figure 11.

[0490] [Table 8]

[0491] Example 2: In vitro efficacy test of antisense oligonucleotides targeting human FUBP1 mRNA in primary human hepatocytes (PXB-PHH). Fresh primary human hepatocytes (PXB-PHH) isolated from humanized mice (uPA / SCID mice) (referred to as PHH herein) were obtained in 96-well format from PhoenixBio Co.,Ltd (Japan) and cultured in modified hepatocyte clonal growth medium (dHCGM). dHCGM is a DMEM medium containing 100 U / ml penicillin, 100 μg / ml streptomycin, 20 mM Hepes, 44 mM NaHCO3, 15 μg / ml L-proline, 0.25 μg / ml insulin, 50 nM dexamethasone, 5 ng / ml EGF, 0.1 mM Asc-2P, 2% DMSO, and 10% FBS (Ishida et al., 2015).

[0492] Cells were cultured at 37°C in a humidified atmosphere containing 5% CO2. The culture medium was changed twice a week until harvest.

[0493] Uninfected cells were treated once with 5 μM and harvested after 7 days. In all treatments, cells were administered the oligonucleotide compound in a final volume of 120 μI / well of dHCGM medium. Experiments for RNA measurement were performed biologically in double denominations.

[0494] Subsequently, real-time PCR of FUBP1 RNA was performed. Total mRNA was extracted from cells using the MagNA Pure robot and the MagNA Pure 96 Cellular RNA Large Volume Kit (Roche, No. 05467535001) according to the manufacturer's protocol. mRNA expression levels were technically quantified in a dual qPCR sequence using QuantStudio 12K Flex (Applied Biosystems), TaqMan RNA-to-CT 1-Step Kit (Applied Biosystems, #4392938), and human GusB endogenous control (Applied Biosystems, #Hs00939627_m1). mRNA expression was analyzed using a comparative cycle threshold 2-ΔΔCt method normalized to the reference gene GusB and untreated cells. The TaqMan primers used for quantification of GusB RNA and FUBP1 RNA are listed in the table below.

[0495] [Table 9]

[0496] Table 10 shows the relative FUBP1 mRNA expression levels of eight compounds (CMP numbers: 6_1, 6_2, 7_1, 7_2, 7_3, 7_4; 8_1 and 9_1; CMP numbers 78_1 and 79_1) in PXB-PHH cells as a percentage of the control. In other words, the lower the value, the greater the inhibition. The FUBP1 mRNA expression level of CMP number 18_1) in PXB-PHH cells is analyzed in Example 3.

[0497] [Table 10] Conclusions drawn from Examples 1 and 2 The data from Examples 1 and 2, as shown in Table 6, demonstrate that targeting FUBP1 with LNA ASO leads to efficient reduction of FUBP1.

[0498] Example 3: Further analysis of CMP numbers 7_1 and 18_1 The following describes additional experiments using two of the nine identified compounds, CMP numbers 7_3 and 18_1. In these experiments, the two compounds were compared to the two prior compounds that yielded the best results in International Publication No. 2019 / 193165.

[0499] Materials and methods Primary human hepatocytes (PXB-PHH) Fresh primary human hepatocytes (PXB-PHH) were cultured as described in Example 2, except that a 24-well format was used.

[0500] ASO sequence and compound Table 11 provides an overview of the compounds tested in Example 3.

[0501] [Table 11]

[0502] HBV infection and oligonucleotide treatment Upon arrival, PHH cells were infected with MOI 110 using a purified inoculum (genotype C) derived from chronic patients by incubation with HBV in 4% (v / v) PEG in PHH medium for 16 hours. The cells were then washed three times with PBS and cultured in fresh PHH medium under a humidified atmosphere of 5% CO2. Four days after infection, the cells were treated in dipets with 10 μM final concentration FUBP1 LNA (see Table 11) or with PBS as a drug-free control (NDC). On the day of treatment, the old medium was removed from the cells and replaced with 400 μl / well of fresh PHH medium. For each well, 100 μL of 50 μM FUBP1 LNA or PBS as NDC was added to 400 μL of PHH medium. The same procedure was repeated three times on days 4, 11, and 18 post-infection. The cell culture medium was replaced with fresh medium every three days on days 7, 14, and 21 post-infection.

[0503] Real-time PCR of intracellular HBV pgRNA and FUBP1 mRNA After determining cell viability, the cells were washed once with PBS. Total RNA was extracted from the cells using the MagNA Pure robot and the MagNA Pure 96 Cellular RNA Large Volume Kit (Roche, No. 05467535001) according to the manufacturer's protocol. FUBP1 mRNA and viral pgRNA expression levels were technically quantified in double-chain qPCR using QuantStudio 12K Flex (Applied Biosystems), TaqMan RNA-to-CT 1-step kit (Applied Biosystems, #4392938), and human GusB endogenous control (Applied Biosystems, #Hs00939627_m1). Relative expression of FUBP1 mRNA and viral pgRNA was analyzed using the 2-ΔΔCt method, normalized for the reference gene GusB and untreated cells. The TaqMan primers used for the quantification of GusB RNA, FUBP1 RNA, and HBV pgRNA are listed in Table 12.

[0504] [Table 12]

[0505] result The relative FUBP1 mRNA expression levels of the tested compounds are shown in Table 13 and Figure 12. As can be deduced from Table and Figure 13, both compounds of the present invention (CMP numbers 7_3 and 18_1) reduce target mRNA expression by approximately 80% compared to NDC. Their effect on FUBP1 mRNA levels is far stronger than that of the prior art compounds (CMP numbers 50_1 and 35_1).

[0506] [Table 13]

[0507] Table 14 shows pgRNA levels in HBV-infected PHH cells treated with different concentrations of antisense compounds. As can be deduced from the table, downregulation was associated with the concentration of the antisense compound. The lowest pgRNA levels were observed for CMP number 7_3 at a concentration of 10 μM. Furthermore, the highest pgRNA levels were observed for the prior art compound with CMP number 35_1. CMP number 18_1 downregulated HBV pgRNA in a similar manner to the prior art compound CMP number 50_1.

[0508] [Table 14]

[0509] Cells were also tested once a week for three weeks at a concentration of 2 μM. At 2 μM, CMP number 7_3 showed the best FUBP1 mRNA KD, resulting in a 50% reduction in mRNA expression. Therefore, the effect is concentration-dependent (an 80% reduction was observed at 2 μM). Furthermore, CMP number 18_1 showed a similar effect on target mRNA expression levels compared to prior art oligonucleotides (at 2 μM).

[0510] Example 4: In vivo PK / PD of FUBP1 ASO The in vivo liver PK / PD correlation of oligonucleotides with CMP numbers 7_3 and 18_1 conjugated to the GalNAc moiety via phosphodiester-linked DNA dinucleotides was evaluated in a single-dose mouse study using C57BL / 6 mice (see, for example, Figures 5 and 8.1 for conjugate structure). Mice were subcutaneously administered 3 mg / kg and terminated at different time points. Fubp1 mRNA knockdown, compound exposure, and PKPD were measured as follows.

[0511] Materials and methods Processing of tissue samples [Table 15]

[0512] Liver samples were frozen in 2 ml round-bottom Eppendorf tubes, and 5 mm homogenization beads were added. Homogenization was then performed in pure MagNa buffer (Roche) on TissueLyser II (Qiagen) for 2 × 1.5 minutes. After sample homogenization was complete, the homogenate was allowed to stand at room temperature (RT) for 30 minutes to complete tissue lysis. All steps of the homogenization process were carried out in a flow hood due to the buffered thiocyanate salt and mercaptoethanol content. After lysis, the homogenate was centrifuged at 17,000 g for 3 minutes.

[0513] To avoid overloading the MagNa pure instrument, the homogenate was diluted to approximately 20 mg per 400 μL of tissue. 350 μL of the homogenate was used for RNA extraction in the MagNA pure 96 instrument for subsequent qPCR analysis. The remaining aliquots of the homogenate were used for hELISA analysis.

[0514] Hybridization ELISA The following oligonucleotides and (total LNA phosphodiester) ELISA probes were used for hELISA analysis, all of which were designed, synthesized, and certified at the Roche Innovation Center Copenhagen A / S. [Table 16] [Table 17] [Table 18]

[0515] Prior to hELISA analysis, the homogenate was converted to RT and vortexed before use. The sample was diluted at least 10-fold with 5×SSCT buffer.

[0516] Sample matrices and dilution factors conforming to appropriate standards were performed on all plates and prepared in parallel with the samples using the relevant oligos (derived from quality and identity-checked formulations). Standards for each compound were spiked into a sample pool derived from unadministered samples. The spike-in concentration was kept within approximately 10 times the oligo content of the sample.

[0517] The sample and standard were added to the dilution plate at the desired settings to create a dilution series. 300 μL of sample / standard + capture detection solution was added to the first well, and 150 μL of capture detection solution was added to the remaining wells.

[0518] Standard and two-fold sample dilution series were prepared by sequentially transferring 150 μL of liquid. Two to four wells were retained for blanks (capture detection solution only). For optimal results, a two-fold sample dilution series of at least six wells is recommended.

[0519] The sample in the dilution plate was incubated at room temperature for 30 minutes. 100 μL of the liquid was transferred from the dilution plate to a streptavidin plate. The plate was incubated at room temperature for 1 hour with gentle agitation (plate shaker). The wells were aspirated and washed three times with 300 μL of 2×SSCT buffer.

[0520] 100 μL of anti-DIG-AP, diluted 1:4000 using PBST (prepared on the same day), was added to each well, and incubated at room temperature for 1 hour with gentle agitation. The wells were aspirated and washed three times with 300 μL of 2×SSCT buffer.

[0521] 100 μL of freshly prepared substrate (AP) solution was added to each well. After incubation for 30 minutes with gentle stirring, the color intensity was measured spectrophotometrically at 615 nm.

[0522] Raw data was exported from the reader (Gen5 2.0 software) to Excel format and further analyzed in Excel. Standard curves were generated using GraphPad Prism 8 software and a logistic 4PL regression model.

[0523] Data points were reported as the average value of technical replicas.

[0524] RNA purification All samples were purified using a MagNA Pure 96 Instrument (Roche) according to the manufacturer's protocol. [Table 19]

[0525] 350 μL of tissue homogenate was transferred to a MagNaPure 96 treated cartridge. The remaining lysate was saved for later oligonucleotide exposure analysis. RNA was purified using the protocol "RNA Tissue FF Standard LV 3.1" with MagNa Pure 96 equipped with the Cellular RNA Large Volume Kit. RNA was eluted with 50 μL of elution buffer (from the kit, 05467535001).

[0526] RNA concentrations and the A260 / 280 ratio (approximately 2.0 for all samples) were determined using an Eon Microplate spectrophotometer (BioTek Instruments). Based on these concentrations, the samples were normalized to 25 ng / μL by dilution in DNase / RNase-free water, and further diluted to a working concentration of 2.5 ng / μL.

[0527] Next, the sample was used as input for a one-step qPCR analysis. The details of the assay are shown below.

[0528] qPCR analysis qPCR was performed as a one-step qPCR format using the following materials. [Table 20]

[0529] RNA preparation for qPCR analysis To avoid undesirable RT enzyme activity, the reactants were kept cool throughout all steps of this protocol. The diluted RNA was then heat-shocked at 90°C for 40 seconds to dissociate the RNA:ASO double helix and placed on ice. Prior to analysis, the RNA samples were spun to the bottom of the wells.

[0530] Standard curves were run on each plate and used for quantification and amplification efficiency measurements. 4 μL of 10 ng / μL PBS sample was used as input in 10 μL of reaction. A 2-fold dilution series was prepared in RNase-free water to create a 7-point standard curve.

[0531] Two separate mouse Fubb1 assays and four control assays were performed in a double reaction using two technical replicas for each animal.

[0532] For qPCR, the following procedure was followed: For each qPCR well, a stock master mix was prepared containing 5 μL of XLT 1-step mix, 0.5 μL of Probe mix 1 (20x), and 0.5 μL of Probe mix 2 (20x). From the stock master mix, 6 μL was added to each well in a 384-well plate (MicroAmp Optical 384-well plate - Applied Biosystems 4309849).

[0533] From the RNA dilution plate, 4 μL of diluted RNA (2.5 ng / uL) was added to each well of the master mix. The plate was then sealed and vortexed. The plate was then centrifuged at high speed for 3 minutes. The qPCR reaction was kept at a low temperature until it was transferred to a qPCR instrument (Life Technology Viia7; software: QuantStudio v.1.3) configured to run the following program: 50°C for 15 minutes, then 95°C for 3 minutes, with a set temperature change rate of 1.9°C / sec. Subsequently, the temperature change rate was set to 1.6°C / sec, and 40 cycles of 5 seconds at 95°C and 45 seconds at 60°C were performed.

[0534] All samples were analyzed using the same run, which minimized technical variations.

[0535] qPCR data processing qPCR data were reviewed using QuantStudio software (Applied Biosystems). Potential outlier wells were identified and removed based on the irregularities in the amplification curves. Following this review for each plate, export files were generated for each qPCR assay with quantities calculated from the ct values ​​of each sample based on the standard curve, and these were analyzed using Excel.

[0536] In general, the standard curve demonstrated high quality and high performance assays with efficiencies between the recommended 95-105%.

[0537] Four different HK genes (Gusb, Rplp0, Rps29, and Tbp) were assayed, and their geometric means were used for normalization. HK gene stability was assessed pre-inclusion using the method published by Vandesompele et al. (Vandesompele et al., 2002). Using four HK genes ensured that pairwise HK gene mutations remained below the recommended threshold of 0.15 for all tissues.

[0538] "Remaining Fubp1 (%)" was calculated as follows: The amount from each Fubp1 qPCR assay was normalized to the geometric mean of the HK assay, and then divided by the mean of the untreated group to obtain the remaining mRNA (%). The average of the two remaining Fubp1 mRNA (%) results was used as the final readout.

[0539] Plotting and calculation of PKPD Liver tissue exposure values ​​were calculated as nmol of compound per tissue (g) (nmol / g). These were then converted to log10 and plotted against residual Fubp1 mRNA (%) (Figure 13). A nonlinear regression curve (4PL regression model, constrained at 100) was fitted using GraphPad Prism 8. The best-fitted PKPD IC50 was calculated using software (regression IC50: conjugate of CMP number 18_1: 0.092 nmol / g; conjugate of CMP number 7_3: 0.068 nmol / g).

[0540] Results: Both conjugates tested had good PK profiles. The CMP number 7_3 conjugate was slightly better than the CMP number 18_1 conjugate in terms of early target KD expression. Some aspects of the present invention are described below. 1. Below CTtAtgctttttatGgTT (Sequence ID 7), AcCAAttttcatttCtAC (Sequence ID 18), CTTatGctttttatgGT (Sequence ID 6), CTTaTgctttttatgGT (Sequence ID 6), CTtATgctttttatgGTT (Sequence ID 7), CTtAtgctttttatgGTT (Sequence ID 7), CTtAtgctttttatGGTT (Sequence ID 7), GcttTttatggtTtCAC (Sequence ID 8), and TATgcTttttatggtTTC (Sequence ID 9) An antisense oligonucleotide selected from the group consisting of, Antisense oligonucleotides where uppercase letters represent β-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA Cs are 5-methylcytosine, and all nucleoside-to-nucleoside bonds are phosphorothioate nucleoside-to-nucleoside bonds. 2. A conjugate comprising an antisense oligonucleotide as described in item 1 and at least one conjugate portion covalently bonded to the antisense oligonucleotide. 3. The conjugate according to item 2, wherein at least one conjugate portion is capable of binding to an asialoclycoprotein receptor. 4. The conjugate described in item 2 or 3, wherein the conjugate portion is selected from one of the trivalent GalNAc portions in Figure 9. 5. The conjugate according to item 4, wherein the conjugate portion is the trivalent GalNAc portion of Figure 9D1 or 9D2 or a mixture thereof. 6. A conjugate according to any one of items 1 to 5, comprising a linker located between the antisense oligonucleotide and the conjugate portion. 7. The conjugate according to item 6, wherein the linker comprises or consists of 2 to 5 consecutive phosphodiester bonded nucleosides. 8. A conjugate selected from the group of conjugates shown in Figures 1, 2, 3, 4, 5, 6, 7, 8, and 8.1. 9. A pharmaceutically acceptable salt of an oligonucleotide as described in item 1 or any of the conjugates described in items 2 to 8. 10. A pharmaceutical composition comprising an antisense oligonucleotide as described in item 1, a conjugate as described in any of items 2 to 8, or a pharmaceutically acceptable salt as described in item 9, and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant. 11. An in vivo or in vitro method for modulating FUBP1 expression in target cells expressing FUBP1, comprising administering an effective amount of an antisense oligonucleotide as described in item 1, a conjugate as described in any of items 2 to 8, a pharmaceutically acceptable salt as described in item 9, or a pharmaceutical composition as described in item 10 to the cells. 12. A method for treating or preventing a disease, comprising administering to a subject suffering from or susceptible to the disease a therapeutically effective amount or a preventively effective amount of an antisense oligonucleotide described in item 1, a conjugate described in any of items 2 to 8, a pharmaceutically acceptable salt described in item 9, or a pharmaceutical composition described in item 10, wherein the disease is hepatitis B virus (HBV) infection and / or cancer. 13. Antisense oligonucleotides as described in item 1, conjugates as described in any of items 2-8, pharmaceutically acceptable salts as described in item 9, or pharmaceutical compositions as described in item 10, for use in pharmaceuticals. 14. Antisense oligonucleotides as described in item 1, conjugates as described in any of items 2-8, pharmaceutically acceptable salts as described in item 9, or pharmaceutical compositions as described in item 10, for use in the treatment or prevention of hepatitis B virus (HBV) infection and / or cancer. 15. Use of an antisense oligonucleotide as described in item 1, a conjugate as described in any of items 2-8, a pharmaceutically acceptable salt as described in item 9, or a pharmaceutical composition as described in item 10, for the preparation of a medicament for treating or preventing hepatitis B virus (HBV) infection and / or cancer. 16. If the disease is hepatitis B virus (HBV) infection, for example chronic HBV infection, the method described in item 12, the antisense oligonucleotide, conjugate, pharmaceutical composition, or pharmaceutically acceptable salt for use as described in item 14, or the use as described in item 15. 17. If the disease is cancer, for example hepatocellular carcinoma, the method described in item 12, the antisense oligonucleotide, conjugate, pharmaceutical composition, or pharmaceutically acceptable salt for use as described in item 14, or the use as described in item 15.

Claims

[Claim 1] The invention described herein.

Images