Reusable initiators for nucleic acid synthesis

Abstract

The present invention provides a method and apparatus for synthesizing polynucleotides having a desired sequence without the need for a template. [Solution] The present invention provides an improved method for synthesizing polynucleotides, such as DNA and RNA, using a renewable initiator coupled to a solid support. Using the method of the present invention, specific sequences of polynucleotides can be synthesized de novo, base by base, in an aqueous environment without the use of nucleic acid templates.

Description

Technical Field

[0001] Related Applications This application claims the benefit and priority of U.S. Application No. 16 / 841,214, filed on April 6, 2020, the content of which is incorporated herein by reference. Field of the Invention The present invention relates to methods and apparatuses for synthesizing polynucleotides having a desired sequence without the need for a template.

Background Art

[0002] Background Most de novo nucleic acid sequencing is performed using well-established solid-phase phosphoramidite techniques. The phosphoramidite technique involves the sequential deprotection and synthesis of sequences constructed from phosphoramidite reagents corresponding to natural (or unnatural) nucleobases. However, phosphoramidite nucleic acid synthesis is limited in length in that nucleic acids longer than 200 base pairs (bp) experience a high rate of breakage and side reactions. In addition, phosphoramidite synthesis produces toxic by-products, and the disposal of this waste limits the availability of nucleic acid synthesizers and increases the cost of contract oligonucleotide production (the annual demand for oligonucleotide synthesis is estimated to be responsible for more than 300,000 gallons of hazardous chemical waste, including acetonitrile, trichloroacetic acid, toluene, tetrahydrofuran, and pyridine. See LeProust et al., Nucleic Acids Res., vol. 38(8), p.2522-2540, (2010), which is incorporated herein by reference in its entirety). Therefore, there is a need for a more efficient and cost-effective method for oligonucleotide synthesis.

Prior Art Documents

Non-Patent Documents

[0003]

Non-Patent Document 1

[0004] overview The present invention provides an improved method for nucleic acid synthesis. The method of the present invention provides faster and longer de novo synthesis of polynucleotides. Thus, the present invention dramatically reduces the overall cost of custom nucleic acid synthesis. The method of the present invention addresses template-independent synthesis of polynucleotides by using a nucleotidyltransferase enzyme to incorporate a nucleotide analog coupled to an inhibitor by a cleavable linker. Due to the inhibitor, synthesis stops with the addition of each new base, and the linker is cleaved, the inhibitor is separated, and a polynucleotide that is essentially identical to a naturally occurring nucleotide remains (i.e., recognized by the enzyme as a substrate for further nucleotide incorporation).

[0005] In particular, the present invention provides a renewable substrate for template-independent nucleic acid synthesis. De novo synthesis is initiated by a nucleic acid initiator bound to a solid support. In the presence of a suitable enzyme, e.g., polymerase, e.g., terminal deoxynucleotidyltransferase (TdT), a nucleotide analog is added to the nucleic acid initiator to produce an oligonucleotide. After the addition of one nucleotide to the nucleotide analog... It is preferable to include a removable termination group that causes enzymatic addition to terminate at a certain point. The removable termination group may be linked to the base portion of the nucleic acid and / or the 3' hydroxyl group of the nucleic acid. Deblocking of the termination group and / or 3' blocking group creates a new active site that is a substrate for the enzyme. Subsequent addition of the new nucleotide or nucleotide analog extends the oligonucleotide.

[0006] In some cases, the nucleic acid initiator contains a 3' portion that is a substrate for the enzyme. A release agent is used to cleave the 3' portion, thereby releasing the oligonucleotide. The 3' portion, nucleic acid initiator, and solid support are reusable after the release of the nascent oligonucleotide.

[0007] The present invention further includes apparatus for utilizing the method of the present invention for the production of custom polynucleotides. The apparatus of the present invention includes one or more bioreactors providing aqueous conditions and multiple sources of nucleotide analogs. The bioreactor may be, for example, a reservoir, a flow cell, or a multiwell plate. The bioreactor may include a nucleic acid initiator and a solid support having a cleavable 3' portion. Starting from the solid support, the polynucleotide is grown in the reactor by sequential nucleotide addition by the innate activity of a nucleotidyltransferase, such as terminal deoxynucleotidyltransferase (TdT) or any other enzyme that extends a DNA or RNA chain without template guidance. Upon cleavage of the linker, the innate polynucleotide is released from the solid support. Once the sequence is complete, the support is cleaved or the 3' portion comes into contact with a release agent, leaving a polynucleotide essentially equivalent to that found in nature. In some embodiments, the apparatus is designed to recycle the nucleotide analog solution by recovering the solution after nucleotide addition and reusing the solution for subsequent nucleotide addition. Therefore, less waste is generated, and the total cost per base is reduced compared to state-of-the-art methods. In certain embodiments, the bioreactor may include a microfluidic device and / or use inkjet printing technology.

[0008] The terminal group may include, for example, a charged moiety or a steric inhibitor. Generally, large polymers that prevent the nucleotidyltransferase enzyme from achieving a functional conformation are usefully used to inhibit oligonucleotide synthesis. Such polymers include polymers, polypeptides, polypeptoids, and nanoparticles. The polymer must be large enough to physically block the nucleotidyltransferase from accessing the active site, but not large enough to negatively alter the reaction kinetics. The polymer is linked to the nucleotide analog using one of the various linkers described below.

[0009] In embodiments using 3'-O-blocked nucleotide analogs, the 3'-O-blocking group is typically small and easily removed, thus allowing use with engineered enzymes having a modified active site. For example, the 3'-O-blocking group may include an azidomethyl, amino, or allyl group.

[0010] In some embodiments, oligonucleotide synthesis may involve introducing a 3' exonuclease into one or more synthesized oligonucleotides after the addition of each nucleotide analog, but before cleaving the terminal group. The terminal group blocks the 3' exonuclease from acting on any oligonucleotide to which the nucleotide analog has been added, but oligonucleotides to which the terminator-containing analog was not successfully added are removed by the 3' exonuclease. In this form, the present invention may enable quality control during the process and eliminate the need for post-synthesis purification.

[0011] Other aspects of the present invention will become apparent to those skilled in the art by consideration of the following figures and detailed description. [Brief explanation of the drawing]

[0012] [Figure 1]Figure 1A shows the genus of deoxycytidine triphosphate (dCTP) analogs having a cleavable terminator linked at the N-4 position. Figure 1B shows the cleavage of the cleavable terminator from the dCTP analog in Figure 1A to obtain “natural” dCTP and cyclic elimination molecules. [Figure 2] Figure 2A shows a genus of deoxyadenosine triphosphate (dATP) analogs having a cleavable terminator linked at the N-6 position. Figure 2B shows the cleavage of the cleavable terminator from the dATP analog in Figure 2A to obtain “natural” dATP and cyclic elimination molecules. [Figure 3] Figure 3A shows the genus of deoxyguanosine triphosphate (dGTP) analogs having a cleavable terminator linked at the N-2 position. Figure 3B shows the cleavage of the cleavable terminator from the dGTP analogs of Figure 3A to obtain “natural” dGTP and cyclic elimination molecules. [Figure 4] Figure 4A shows the genus of deoxythymidine triphosphate (dTTP) analogs having a cleavable terminator linked at the N-3 position. Figure 4B shows the cleavage of the cleavable terminator from the dTTP analog in Figure 4A to obtain “natural” dTTP and cyclic elimination molecules. [Figure 5] Figure 5A shows the genus of deoxyuridine triphosphate (dUTP) analogs having a cleavable terminator linked at the N-3 position. Figure 5B shows the cleavage of the cleavable terminator from the dUTP analog in Figure 5A to obtain dUTP and the cyclic elimination molecule. [Figure 6] Figure 6 shows an exemplary deoxycytidine triphosphate (dCTP) analog having a Staudinger linker that connects a blocking Asp-Asp molecule to the N-4 position of deoxycytidine, as well as the subsequent cleavage of the Staudinger linker under aqueous conditions to obtain dCTP and the leaving group. [Figure 7]Figure 7A shows the genus of cytidine triphosphate (rCTP) analogs having a cleavable terminator linked at the N-4 position. Figure 7B shows the cleavage of the cleavable terminator from the rCTP analogs of Figure 7A to obtain “natural” rCTP and cyclic elimination molecules. [Figure 8] Figure 8A shows a genus of adenosine triphosphate (rATP) analogs having a cleavable terminator linked at the N-6 position. Figure 8B shows the cleavage of the cleavable terminator from the rATP analog in Figure 8A to obtain “natural” rATP and cyclic elimination molecules. [Figure 9] Figure 9A shows a genus of guanosine triphosphate (rGTP) analogs having a cleavable terminator linked at the N-2 position. Figure 9B shows the cleavage of the cleavable terminator from the rGTP analogs in Figure 9A to obtain “natural” rGTP and cyclic elimination molecules. [Figure 10] Figure 10A shows the genus of thymidine triphosphate (rTTP) analogs having a cleavable terminator linked at the N-3 position. Figure 10B shows the cleavage of the cleavable terminator from the rTTP analog of Figure 10A to obtain “natural” rTTP and cyclic elimination molecules. [Figure 11] Figure 11A shows the genus of uridine triphosphate (rUTP) analogs having a cleavable terminator linked at the N-3 position. Figure 11B shows the cleavage of the cleavable terminator from the rUTP analog in Figure 11A to obtain rUTP and cyclic elimination molecules. [Figure 12] Figure 12 shows an exemplary cytidine triphosphate (rCTP) analog having a Staudinger linker that connects a blocking Asp-Asp molecule to the N-4 position of cytidine, as well as the subsequent cleavage of the Staudinger linker under aqueous conditions to obtain rCTP and the leaving group. [Figure 13]Figure 13 shows an exemplary terminal deoxynucleotidyl transferase (TdT)-mediated polynucleotide synthesis cycle that includes (a) incorporation of a cleavable terminator, a nucleotide triphosphate analog containing dN*TP-OH, and (b) removal of a terminal blocking group (indicated by *), which thus enables incorporation of the next dN*TP-OH; where N = A, G, C, or T. [Figure 14] Figure 14 shows an exemplary nucleotide analog having a cleavable linker that includes a variable number of methylene bridges. [Figure 15] Figure 15 shows an exemplary nucleotide analog having a cleavable linker that includes a cysteine residue. [Figure 16] Figure 16A shows an exemplary nucleotide analog having an anionic inhibitor that includes a single phosphate group. Figure 16B shows an exemplary nucleotide analog having an anionic inhibitor that includes two phosphate groups. Figure 16C shows an exemplary nucleotide analog having an anionic inhibitor that includes three phosphate groups. [Figure 17] Figure 17 shows an exemplary microfluidic polynucleotide synthesis device. [Figure 18] Figure 18 shows an exemplary polypeptoid inhibitor suitable for use in the present invention.In the present invention, it is suitable for use [Figure 19] Figure 19 shows a flowchart describing the use of a 3'-exonuclease to digest oligonucleotides that did not terminate properly between oligonucleotide synthesis cycles. [Figure 20] Figure 20 illustrates the synthesis of de novo oligonucleotides using nucleotide triphosphate analogs having 3'-O-blocking groups. [Figure 21] Figure 21 shows four exemplary 3'-O-blocked nucleotide analogs that can be used for the synthesis of de novo oligonucleotides in conjugation with a suitable template-independent polymerase. [Figure 22]Figure 22 illustrates the incorporation of a reusable 3' moiety into nucleic acids coupled to a solid support, the growth of nucleic acids using modified TdT, and the release of de novo oligonucleotides. [Figure 23] Figure 23 shows the enzymatic placement of the 3'-polyU tract by TdT, followed by USER digestion of the tract. [Figure 24] Figure 24 shows the results of USER digestion of the internal poly-U tract to produce a 5'-monodisperse cleavage product. [Figure 25] Figure 25 illustrates the results of solid-phase dephosphorylation and TdT elongation. [Figure 26] Figure 26 shows an exemplary resin regeneration cycle. [Figure 27] Figure 27 shows an exemplary index chain regeneration process. [Modes for carrying out the invention]

[0013] Detailed explanation The present invention provides an improved method for synthesizing polynucleotides, such as DNA and RNA, using enzymes and nucleic acid analogs. Using the disclosed method, a specific sequence of polynucleotides can be synthesized in an aqueous environment, without the use of a nucleic acid template, one base at a time. It can be synthesized using novo.

[0014] The nucleotide analog may have an unmodified 3'-hydroxyl group, or a 3'-O-blocking group, or a blocker releasedly attached to the phosphate. In any case, the blocking group is designed to leave no substantial additional molecules, i.e., a "scarless" nucleotide that is recognized by enzymes as a "natural" nucleotide. Thus, upon completion of synthesis, upon removal of the final blocking group, the synthesized polynucleotide is chemically and structurally equivalent to a naturally occurring polynucleotide having the same sequence. Therefore, the synthetic polynucleotide can be incorporated into biological systems without concern that the synthesized polynucleotide may interfere with biochemical pathways or metabolism.

[0015] The processes and analogs of the present invention are used for the non-template-mediated enzymatic synthesis of oligonucleotides and oligodeoxynucleotides, particularly long oligonucleotides (<5000 nt). The products may be single-stranded or partially double-stranded, depending on the initiator used. The synthesis of long oligonucleotides requires highly efficient incorporation and highly efficient reversible terminator removal. The initiator, bound to a solid support, consists of a short single-stranded DNA sequence, which is either a user-defined short piece of sequence or a general-purpose initiator from which a user-defined single-stranded product is removed.

[0016] In one embodiment, the disclosed method synthesizes polynucleotides from a nucleotide analog in a step-by-step manner using a commercially available nucleotidyltransferase enzyme, such as terminal deoxynucleotidyltransferase (TdT). The nucleotide analog is: NTP-linker-inhibitor In this form, NTP is a nucleotide triphosphate (i.e., dNTP or rNTP), the linker is a cleavable linker between the pyridine or pyrimidine bases, and the inhibitor is a group that prevents the enzyme from incorporating subsequent nucleotides. In each step, a new nucleotide analog is incorporated into the growing polynucleotide chain, and the enzyme is blocked from adding further nucleotides by the inhibitor group. Once the enzyme has stopped, any excess nucleotide analog is removed from the growing chain, the inhibitor can be cleaved from the NTP, and a new nucleotide analog can be introduced to add the next nucleotide to the chain. By sequentially repeating this step, it is possible to rapidly construct nucleotide sequences of desired length and sequence. Advantages of using nucleotidyltransferase for polynucleotide synthesis include: 1) 3'-extension activity using single-stranded (ss) initiation primers in template-independent polymerization, 2) the ability to extend primers in a highly efficient manner, resulting in the addition of thousands of nucleotides, and 3) tolerance of a wide variety of modified and substituted NTPs as efficient substrates.

[0017] In addition, the present invention can utilize an initiator sequence that is a substrate for nucleotidyltransferase. The initiator is attached to a solid support and serves as a recognition site for the enzyme. The initiator is preferably a general-purpose initiator for the enzyme, such as a homopolymer sequence, which is recyclable on the solid support, and the formed oligonucleotide can be cleaved from the initiator.

[0018] The method of the present invention is highly suitable for various applications currently using synthetic nucleic acids, such as phosphoramidite-synthesized DNA oligonucleotides. For example, polynucleotides synthesized using the method of the present invention are used as primers for nucleic acid amplification, hybridization probes for the detection of specific markers, and for integration into plasmids for genetic engineering. However, since the disclosed method produces nucleotides of longer synthetic chains at a faster rate and in an aqueous environment, the disclosed method itself is also useful for high-throughput applications, such as screening for the expression of genetic mutations in cell assays and in synthetic biology. Furthermore, the method of the present invention will also provide the functionality necessary for next-generation applications, such as using DNA as a synthetic read / write memory or creating macroscopic materials that are entirely (or partially) synthesized from DNA.

[0019] The present invention and the systems described herein provide the synthesis of polynucleotides, including deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). While synthetic pathways for “natural” nucleotides such as DNA and RNA are described in the context of common nucleic acid bases, e.g., adenine (A), guanine (G), cytosine (C), thymine (T), and uracil (U), the methods of the present invention synthesize nucleotides incorporating common bases, e.g., 3-nitropyrrole 2'-deoxynucleoside and 5-nitroindole 2'-deoxynucleoside, alpha-phosphorothiolate It should be understood that this can be applied to so-called "unnatural" nucleotides, including phosphorothioate nucleotide triphosphates, or other desired properties, such as fluorescent purines or pyrimidine conjugates. Other examples of purines and pyrimidine bases include pyrazolo[3,4-d]pyrimidine, 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine, 5-uracil (pseudolacil), 4-thiouracil, 8-halo (e.g., 8-bromo), 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl Other 8-substituted adenines and guanines, 5-halos, in particular 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, deazaguanine, 7-deazaguanine, 3-deazaguanine, deazaadenine, 7-deazaadenine, 3-deazaadenine, pyrazolo[3,4-d]pyrimidine, imidazo[1,5-a]1,3,5-triazinon, 9-deazapurine, imidazo[4,5-d]pyrazine, thiazolo[4,5-d]pyrimidine, pyrazine-2-one, 1,2,4-triazine, pyridazine, and 1,3,5-triazine. In some cases, it may be useful to generate nucleotide sequences that are non-reactive but have roughly equivalent bases, i.e., bases that do not react with other proteins, i.e., transcriptionases, and thus allow the influence of sequence information to be decoupled from the structural effects of the bases.

[0020] analog The present invention provides a nucleotide analog having the formula NTP-linker-inhibitor for the synthesis of polynucleotides in an aqueous environment. With respect to the analog in the form of an NTP-linker-inhibitor, NTP may be any nucleotide triphosphate, for example, adenosine triphosphate (ATP), guanosine triphosphate (GTP), cytidine triphosphate (CTP), thymidine triphosphate (TTP), uridine triphosphate (UTP), nucleotide triphosphate, deoxyadenosine triphosphate (dATP), deoxyguanosine triphosphate (dGTP), deoxycytidine triphosphate (dCTP), deoxythymidine triphosphate (dTTP), or deoxyuridine triphosphate (dUTP).

[0021] The linker can be any molecular portion that can link the inhibitor to the NTP and cleave it. For example, the linker can be cleaved by adjusting the pH of the surrounding environment. The linker may also be cleaved by an enzyme that is activated at a given temperature but inactivated at another temperature. In some embodiments, the linker includes a disulfide bond.

[0022] The linker may include, for example, a photocleavable, nucleophilic or electrophilic cleavage site. Examples of photocleavable linkers whose cleavage is activated by light of a specific wavelength include benzoin, nitroveratril, phenacyl, pivaloyl, silyl, and 2-hydroxy Possible linkers include those based on c-cinnamyl, coumarin-4-yl-methyl, or 2-nitrobenzyl.

[0023] Examples of nucleophilic cleavage sites include silicon-oxygen bonds that can be cleaved by fluoride ions, or esters that can be cleaved in a basic solution. Examples of electrophilically cleavable linkers include acid-induced cleavage sites that may include trityl, tert-butyloxycarbonyl groups, acetal groups, and p-alkoxybenzyl esters and amides. In certain embodiments, the cleavable linkers may include cysteine ​​residues, as shown in Figure 15.

[0024] Since attachment at carbon leads to the presence of a trace remaining after the removal of the polymerase-inhibiting group, linkers can be attached, for example, at N4 of cytosine, N3 or O4 of thymine, N2 or N3 of guanine, and N6 of adenine, or N3 or O4 of uracil. Linkers are typically on the order of at least about 10 angstroms in length, e.g., at least about 20 angstroms, e.g., at least about 25 angstroms, thus allowing sufficient detachment of the inhibitor from pyridine or pyrimidine, enabling the enzyme to bind NTPs to the polynucleotide chain via the attached sugar backbone. In some embodiments, the cleavable linker autocyclizes, forming a cyclic molecule that is particularly unreactive to the growing nucleotide chain.

[0025] In certain embodiments, the cleavable linker may include a variable number of methylene bridges, for example, one, two, three, or four methylene bridges, on the inhibitor side of the NTP or disulfide bond, as shown in Figures 14 and 16A-C. These methylene bridges may be used to increase the space between the NTP and the inhibitor. As described above, the length of the cleavable linker may be selected to prevent the inhibitor from interfering with the coupling of the NTP to the synthesized polynucleotide. In some embodiments of the present invention, the distance from the charged group to the NTP plays a crucial role in the effectiveness of inhibiting subsequent nucleotide incorporation.

[0026] For example, in some embodiments using a charged moiety as an inhibitor, the charged moiety may be about 5 to about 60 bindings away from the NTP. In some other embodiments, the charged moiety of the inhibitor may be about 10 to about 40 bindings away from the NTP. In some other embodiments, the charged moiety of the inhibitor can be about 10 to about 35 bindings away from the NTP. In some other embodiments, the charged moiety of the inhibitor may be about 10 to about 30 bindings away from the NTP. In some other embodiments, the charged moiety of the inhibitor is about 10 to about 20 bindings away from the NTP. The number of bindings between the charged moiety and the NTP may be increased by including further methylene bridges.

[0027] A nucleotide analog may include any moiety linked to an NTP that inhibits subsequent nucleotide coupling by the enzyme. The inhibitory group may be a charged group, e.g., a charged amino acid, or the inhibitory group may be a group that becomes charged depending on ambient conditions. In some embodiments, the inhibitor may include a moiety that is negatively charged or capable of becoming negatively charged. For example, the inhibitor may include a chain of phosphate groups (e.g., one, two, or three phosphates), as shown in Figures 16A-C, where the additional phosphates increase the overall anionic charge of the inhibitor. In other embodiments, the inhibitory group may be positively charged or capable of becoming positively charged. In some other embodiments, the inhibitor is an amino acid or an amino acid analog. The inhibitor may be a peptide of 2-20 units of an amino acid or analog, a peptide of 2-10 units of an amino acid or analog, a peptide of 3-7 units of an amino acid or analog, or a peptide of 3-5 units of an amino acid or analog. In some embodiments, the inhibitor comprises a group selected from the group consisting of Glu, Asp, Arg, His, and Lys, and combinations thereof (e.g., Arg, Arg-Arg, Asp, Asp-Asp, Asp, Glu, Glu-Glu, Asp-Glu-Asp, Asp-Asp-Glu, or AspAspAspAsp, etc.). The peptide or group may be a combination of the same or different amino acids or analogs. In certain embodiments, the peptide inhibitor may be acetylated to prevent the misbinding of a free amino group. The inhibitory group may also contain a group that reacts with a residue in the active site of the enzyme, thus preventing subsequent nucleotide coupling by the enzyme. The inhibitor may have a charged group selected from the group consisting of -COO, -NO2, -PO4, -PO3, -SO2, or -NR3 (wherein each R can be H or an alkyl group). In other embodiments, the inhibitory moiety does not contain a -PO4 group.

[0028] In certain embodiments, the terminator or inhibitor may include a steric inhibitory group. Such a steric inhibitory group may enable the integration of an NTP-linker-inhibitor (i.e., a nucleotide analog) at the unblocked 3'OH of an oligonucleotide, and such integration is catalyzed by a nucleotidyltransferase. The steric inhibitory group may physically block the integration of a nucleotide or further nucleotide analog at the unblocked 3'OH of the integrated nucleotide analog. The steric inhibitor may also block a 3'-endonuclease from acting on the nucleotide analog, and therefore on the oligonucleotide into which the uncleaved nucleotide analog is integrated.

[0029] Examples of steric inhibitors include chemical polymers, nanoparticles, poly-N-substituted glycines (peptoids), or proteins. The steric inhibitors of the present invention can be of various sizes, including, for example, greater than 20 Å, greater than 30 Å, greater than 40 Å, greater than 50 Å, greater than 60 Å, greater than 70 Å, greater than 80 Å, greater than 90 Å, greater than 100 Å, greater than 110 Å, greater than 120 Å, greater than 130 Å, greater than 140 Å, or greater than 150 Å. In preferred embodiments, the steric inhibitor may be monodisperse or substantially monodisperse. The steric inhibitor may be water-soluble and conformationally constrained (i.e., in a rigid or semi-rigid form). In certain embodiments, due to the size or conformation of the inhibitor, the steric inhibitor physically blocks access to the active site of the associated nucleotidyltransferase enzyme. In preferred embodiments, the steric inhibitor may include non-natural biomimetic (bio-inspired) polymers, such as polypeptoids or non-natural polypeptides.

[0030] In certain embodiments, self-assembling polypeptoid sequences may be used as steric inhibitors. Peptoid monomers are often based on an N-substituted glycine skeleton. Because the skeleton lacks hydrogen bond donors, polypeptoids are easily processed while still being able to form secondary structures, such as helices. They generally offer beneficial properties that allow for polarity and side chains similar to peptides, while also being chemically and thermally stable. Self-assembling polypeptoid steric inhibitors according to the present invention can self-assemble into a single peptoid helix to form microspheres with diameters in the micrometer range, including, among others, 0.3 μm, 0.4 μm, 0.5 μm, 0.6 μm, 0.7 μm, 0.8 μm, 0.9 μm, 1.0 μm, 1.5 μm, 2 μm, 2.5 μm, 3 μm, or 3.5 μm. In certain embodiments, the steric inhibitor may include a peptoid having a C-α-branched side chain, an N-aryl side chain, an N-1-naphthylethyl side chain, or other formations capable of forming a stable helical structure. An example is shown in Figure 18. Figure 18 illustrates branched poly-N-methoxyethylglycine that can be used as a steric inhibitor according to the present invention. In certain embodiments, the steric inhibitor may include a reactive group that readily joins to a linker group, such as a cleavable linking group as described herein.

[0031] In other embodiments, the steric inhibitor may include a polymer, such as a biocompatible polymer. The polymer may contain blocks of different polymers, which, when exposed to an aqueous environment, form a desired macroscopic structure, such as a sphere. For example, the copolymer may contain blocks of hydrophilic and hydrophobic blocks so that the polymer self-assembles into a micelle structure upon addition to water. In some embodiments, the hydrophobic block may be selected from polycaprolactone (PCL), polydimethylsiloxane (PDMS), polymethyl methacrylate (PMMA), or polylactide (PLA). The hydrophilic block may include polyethylene glycol (PEG) or other polyhydric alcohols.

[0032] In other embodiments, the inhibitor may include nanoparticles of sufficient size to block the activity of nucleotidyltransferase. Such nanoparticles may include, for example, gold, silver, silicon, cerium oxide, iron oxide, titanium dioxide, silicon nitride, silicon boride, or silica, such as mesoporous silica. In other embodiments, the nanoparticles may include higher-order molecular structures containing carbon or semiconductors, such as fullerenes, such as buckyballs and nanotubes.

[0033] Steric inhibitors may be neutral or positively or negatively charged to provide compatibility with the nucleotide to which they are linked and with the nucleotidyltransferase enzyme, and as a result, the inhibitor does not interfere with the integration reaction at the 5' end of the NTP analog. Steric inhibitors may incorporate various amino acid residues to provide the desired conformation, charge, or attachment site.

[0034] An example of an NTP-linker-inhibitor type nucleotide analog is shown in Figure 1A. The analog in Figure 1A provides an unblocked, unmodified 3'-OH group on the sugar ring, while the N of dCTP is linked by a disulfide (-SS-) bond. 4It contains an inhibitory (-Asp-Asp-) group linked at the position. All linker atoms (including the portion that inhibits the second incorporation) can be removed, thereby constructing a linker that allows the nascent DNA strand to be returned to its native nucleotides. As shown in Figure 1B, the -SS bond can be cleaved using an aqueous reducing agent, such as tris(2-carboxyethyl)phosphine (TCEP) or dithiothreitol (DTT), resulting in a loss of inhibitory function (deblocking). As shown in Figure 1B, an autocyclizing linker can be incorporated, producing a cyclic oxidized tetrahydrothiophene leaving group that is readily removed from the reagent solution upon completion of nucleotide synthesis.

[0035] Exemplary schemes for synthesizing the dCTP analog in Figure 1A are shown in Schemes 1A and 1B below. [ka] [ka]

[0036] In a manner similar to schemes 1A and 1B, NTP-linker-inhibitor type nucleotide analogs can also be formed by attaching the linker-inhibitor moiety to adenine N6 (Figure 2), guanine N2 (Figure 3), thymine N3 (Figure 4), or uracil N3 (Figure 5), thereby providing analogs of “naturally occurring” dNTPs and deoxyuracil nucleotides (dUTPs). While the potential for widespread use of dUTPs is low, their synthesis is straightforward on a chemical basis.

[0037] The present invention is not limited to the linking chemistry of schemes 1A and 1B, however, the carbamimate may be an amide or other self-eliminating linkage. It can also be used. For example, as shown in Scheme 2, nucleotides can also be prepared using a Staudinger linker. [ka]

[0038] Figure 6 shows a deoxycytidine triphosphate (dCTP) analog produced using a Staudinger linker (Scheme 2) to an Asp-Asp blocking group. As shown in Figure 6, the Staudinger dCTP analog is cleaved under aqueous conditions by the addition of azide and triphenylphosphine. As described above and illustrated in Figures 1-5, the Staudinger analog shown in Figure 6 is also suitable for nucleotide elongation using a nucleotidyl transferase, e.g., TdT. Although not clearly shown in the figure, those skilled in the art can use Scheme 2 in conjugation with suitable reactants to produce other nucleotide analogs having the Staudinger linker necessary for complete de novo nucleotide synthesis. In a manner similar to Figure 6, the nucleotide analog of Scheme 2 can be formed by attaching the Staudinger moiety to N6 of adenine, N2 of guanine, N3 of thymine, or N3 of uracil, thereby providing "naturally occurring" dNTPs and analogs of deoxyuracil nucleotide (dUTP).

[0039] For example, as shown in Figures 7-10, the corresponding ribonucleotide analog can be generated using the methodology of Scheme 1A by starting with a suitable ribonucleotide reactant. As shown in Figure 12, ribonucleotide analogs containing the Staudinger linker can also be produced using Scheme 2 to form the desired ribonucleotide analog, for example, the CTP analog. Furthermore, all ribonucleotide analogs, namely C, A, T, G, and U, can be formed using reactions similar to those in Scheme 2.

[0040] In other embodiments, a 3'-O-blocked nucleotide analog can be used in conjunction with a modified enzyme capable of incorporating the 3'-O-blocked nucleotide analog into an oligonucleotide. Such a modified enzyme allows the 3'-O-blocked dNTP analog to be used in a step-by-step manner for extending a starting nucleic acid to a user-defined sequence (see Figure 20). Furthermore, after each nucleotide extension step, the reaction product can be recovered and recycled from the solid support and returned to the original reagent reservoir. Once the steps are complete, the 3'-O-blocking group is removed, and a new cycle can be started. Upon completion of n cycles of extension-recovery-deblocking-wash, the full-length single-stranded polydeoxynucleotide is cleaved from the solid support and isolated for subsequent use. Various 3'-O-blocked deoxynucleotides can be used, but the selection of a particular 3'-O-blocking group is determined by 1) the minimum possible bulk to maximize substrate utilization by TdT, and 2) the removal of the blocking group in the shortest time, in the mildest manner, and preferably under aqueous conditions.

[0041] Various 3'-O-modified dNTPs and NTPs can be used with the disclosed proteins for de novo synthesis. In some embodiments, preferred removable 3'-O-blocking groups are 3'-O-amino, 3'-O-allyl, or 3'-O-azidomethyl. In other embodiments, the removable 3'-O-blocking moiety is selected from the group consisting of O-phenoxyacetyl, O-methoxyacetyl, O-acetyl, O-(p-toluene)-sulfonate, O-phosphate, O-nitrate, O-[4-methoxy]-tetrahydrothiopyranyl, O-tetrahydrothiopyranyl, O-[5-methyl]-tetrahydrofuranyl, O-[2-methyl,4-methoxy]-tetrahydropyranyl, O-[5-methyl]-tetrahydropyranyl, and O-tetrahydrothiofuranyl (see U.S. Patent No. 8,133,669). In other embodiments, the removable blocking portion is selected from the group consisting of esters, ethers, carbonitriles, phosphates, carbonates, carbamates, hydroxylamines, borates, nitrates, sugars, phosphoramides, phosphoramidates, phenylsulfenates, sulfates, sulfones, and amino acids (Metzker ML et al. Nuc Acids Res. 1994;22(20):4259-67; U.S. Patent No. 6,232,465, U.S. Patent No. 7,414,116, and See U.S. Patent No. 7,279,563, all of which are incorporated by reference.

[0042] Figure 21 shows four exemplary 3'-O-blocked dNTP analogs, namely 3'-O-azidomethyl-dATP, 3'-O-azidomethyl-dCTP, 3'-O-azidomethyl-dGTP, and 3'-O-azidomethyl-dTTP. 3'-O-blocked dNTP analogs can be purchased from specialized suppliers, such as Azco Biotech, Oceanside, CA. Corresponding 3'-O-blocked ribonucleotides are also commercially available, thus enabling the creation of custom RNA oligonucleotides.

[0043] In various embodiments, the nucleotide analog of the present invention has the following structure: [ka] It may have.

[0044] BG represents a 3'-O-blocking group, such as those discussed above. In certain embodiments, the 3'-O-blocking group may be 3'-ONO2, 3'-OCH2CH2CN, 3'-OCH2N3, 3'-OPO3, 3'-OCH2SSCH3, and 3'-ONHC(O)H. The nucleotide-R group may be any of the nucleotide groups discussed above, including various linker and blocking groups or other modifications. In certain embodiments, R may be H, an amide, a carbamate, or urea. Any of these R groups may be further linked to methyl, ethyl, propyl, isopropyl, isobutyl, pivaloyl, cyclohexyl, cyclopropyl, phenyl, naphthyl, anthracenyl, phenantrenyl, pyrenyl, crisenyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, quinolinyl, isoquinolinyl, furanyl, thiophenyl, morpholinyl, piperidinyl, dioxanyl, tetrahydrofuranyl, or biotin.

[0045] A complete nucleotide-R group may include deoxyadenosine, deoxycytidine, deoxythymidine, deoxyguanosine, N6-modified deoxyadenosine, N4-modified deoxycytidine, N1-modified deoxythymidine, O6-modified deoxyguanosine, N1-modified deoxyguanosine, or N2-modified deoxyguanosine.

[0046] In various embodiments, the nucleotide analog may be solely N4-modified deoxycytidine or O6, N1, or N2-modified deoxyguanosine, each further comprising a 3'-O-blocking group. In some embodiments, the nucleotide analog may be solely N4-modified deoxycytidine or N1-modified deoxythymidine, each further comprising a 3'-O-blocking group.

[0047] In some embodiments, the nucleotide analog may be solely N4-modified deoxycytidine or N6-modified deoxyadenosine, each further comprising a 3'-O-blocking group.

[0048] In some embodiments, the nucleotide analogs may be O6, N1, or N2-modified deoxyguanosine, and N6-modified deoxyadenosine or N1-modified deoxythymidine, each further comprising a 3'-O-blocking group.

[0049] enzyme The method of the present invention involves assembling nucleotide analogs into polynucleotides using nucleotidyltransferases. Nucleotidyltransferases include several families of related transferase and polymerase enzymes. Some nucleotidyltransferases polymerize deoxyribonucleotides more efficiently than ribonucleotides, some nucleotidyltransferases polymerize ribonucleotides more efficiently than deoxyribonucleotides, and some nucleotidyltransferases polymerize ribonucleotides and deoxyribonucleotides at approximately the same rate.

[0050] Of particular importance to the present invention is that a transferase having polymerase activity, such as terminal deoxyribonucleotide (TdT), can catalyze the addition of a deoxyribonucleotide to the 3' end of a nucleotide chain, thereby increasing the chain length of the DNA nucleotide. TdT catalyzes the addition of only one or two ribonucleotides to the end of a growing DNA chain, which may be useful in the construction of site-directed DNA-RNA chimeric polynucleotides. In particular, calf thymus TdT supplied from engineered E. coli is suitable for use in the present invention and is available from commercial sources, e.g., Thermo Scientific (Pittsburgh, PA). The amino acid sequence corresponding to calf TdT is listed in Table 1 as Sequence ID No. 1. [Table 1]

[0051] The nucleotide sequences corresponding to calf TdT are listed in Table 2 as Sequence ID No. 2. [Table 2-1] [Table 2-2]

[0052] Commercially available TdT is suitable for use in the method of the present invention, but modified TdT having, for example, an amino acid sequence at least 95% common with SEQ ID NO: 1, for example, an amino acid sequence at least 98% common with SEQ ID NO: 1, for example, an amino acid sequence at least 99% common with SEQ ID NO: 1 may also be used in the method of the present invention. Organisms expressing a suitable nucleotidyltransferase may contain nucleic acid sequences at least 95% common with SEQ ID NO: 2, for example, at least 98% common with SEQ ID NO: 2, for example, at least 99% common with SEQ ID NO: 2. In some examples, modified TdT results in more efficient production of polynucleotides or allows for better control of chain length. Other modifications to TdT may alter the enzyme's release properties, thereby reducing the need for aqueous reducing agents, such as TCEP or DTT.

[0053] For the synthesis of RNA polynucleotides, a nucleotidyl transferase such as E.Coli poly(A) polymerase can be used to catalyze the addition of a ribonucleotide to the 3' end of a ribonucleotide initiator. In other embodiments, E.Coli poly(U) polymerase may be more suitable for use in the method of the present invention. Both E.Coli poly(A) polymerase and E.Coli poly(U) polymerase are available from New England Biolabs (Ipswich, MA). These enzymes may be used together with 3'-unblocked reversible terminator ribonucleotide (ribonuclotide) triphosphate (rNTP) to synthesize RNA. In certain embodiments, RNA may be synthesized using 3'-blocked, 2'-blocked, or 2'-3'-blocked rNTPs and poly(U) polymerase or poly(A) polymerase. The amino acid and nucleotide sequences for E.Coli poly(A) polymerase and E.Coli poly(U) polymerase are reproduced below. Modified E.Coli poly(A) polymerase or E.Coli poly(U) polymerase may be suitable for use in the methods of the present invention. For example, enzymes having an amino acid sequence that is at least 95% common with SEQ ID NO: 3, for example, an amino acid sequence that is at least 98% common with SEQ ID NO: 3, for example, an amino acid sequence that is at least 99% common with SEQ ID NO: 3 may be used in the methods of the present invention. Organisms expressing suitable enzymes may contain nucleic acid sequences that are at least 95% common with SEQ ID NO: 4, for example, at least 98% common with SEQ ID NO: 4, for example, at least 99% common with SEQ ID NO: 4. Alternatively, an enzyme having an amino acid sequence that is at least 95% common with SEQ ID NO: 5, for example, an amino acid sequence that is at least 98% common with SEQ ID NO: 5, for example, an amino acid sequence that is at least 99% common with SEQ ID NO: 5, may be used in the method of the present invention. An organism expressing a suitable enzyme may contain a nucleic acid sequence that is at least 95% common with SEQ ID NO: 6, for example, an amino acid sequence that is at least 98% common with SEQ ID NO: 6, for example, an amino acid sequence that is at least 99% common with SEQ ID NO: 6. [Table 3]

[0054] The nucleotide sequences corresponding to E. coli poly(A) polymerase are listed in Table 4 as Sequence ID No. 4. [Table 4-1] [Table 4-2] [Table 5]

[0055] The nucleotide sequences corresponding to E. coli poly(U) polymerase are listed in Table 6 as Sequence ID No. 6. [Table 6]

[0056] As discussed above, inhibitors coupled to nucleotide analogs prevent the transferase, e.g., TdT, from releasing from the polynucleotide or from incorporating other analogs into the growing chain. While charged moieties yield better inhibition, studies suggest that the specific chemical properties of the inhibitor are not particularly important. For example, both phosphates and acidic peptides can be used to inhibit enzyme activity. (e.g., Bowers et al., Nature Methods, vol. 6, (2009)) See pp. 593-595 and U.S. Patent No. 8,071,755, both of which are incorporated herein by reference in their entirety. In some embodiments, the inhibitor comprises a single amino acid or a dipeptide such as -(Asp)2, however, the size and charge of the portion can be adjusted as needed based on the experimentally determined rate of incorporation of the first and second nucleotides. That is, other embodiments may use more or different charged amino acids or other biocompatible charged molecules.

[0057] De novo oligonucleotides may be constructed in a template-independent manner using nucleotidyltransferase or a modified nucleotidyltransferase, using other methods of nucleotide synthesis. In one embodiment, polymerase / transferase enzymes can be modified so that they terminate nucleotide addition when they encounter modification to the phosphate of the 3' unmodified dNTP analog. This scheme requires a deblocking reagent / reaction to modify the phosphate end of the nucleotide analog, which frees the nascent chain for subsequent nucleotide incorporation. A preferred embodiment of this method uses nucleotide analogs modified only at the phosphate (alpha, beta, or gamma), but allowing modification of the purine / pyrimidine base of the nucleotide.

[0058] In some embodiments, it may be advantageous to remove oligonucleotides that did not properly terminate with the inhibitor using a 3' exonuclease before subsequent nucleotide analog addition. In particular, inhibitors of the nucleotide analog can be selected to inhibit the activity of the nucleotidyltransferase and 3' exonuclease so that only properly terminated oligonucleotides are constructed. Using this quality control technique, the purity of the resulting oligonucleotide sequence will be improved. In some embodiments, the use of such quality control measures may negate the need for post-synthesis purification. This technique is schematically represented in Figure 19, where the 3' exonuclease is introduced after a washing step to remove excess nucleotide analogs and before linker cleavage. As shown in Figure 19, such a purification step will reduce the number of oligonucleotides that are of undesirable length and / or sequence.

[0059] Another embodiment for using a template-independent polymerase / transferase enzyme would involve modifying the enzyme using protein engineering or protein evolution to ensure it binds firmly to the nascent chain after each single nucleotide incorporation and remains inactive to the nascent chain, thus preventing any subsequent incorporation until the polymerase / transferase is released from the chain by the use of a release reagent / condition. Such modifications would be chosen to allow the use of a naturally occurring, unmodified dNTP instead of a reversible terminator dNTP. Release reagents could be high-salt buffers, denaturants, etc. Release conditions could be high temperature, agitation, etc. For example, mutations in the loop 1 and SD1 regions of TdT have been shown to dramatically alter the activity from template-independent to higher template-dependent activity. Target-specific mutations include, but are not limited to, Δ3384 / 391 / 392, del loop 1 (386→398), L398A, D339A, F401A, and Q402K403C404→E402R403S404. Other means of achieving the goal of a TdT enzyme that binds firmly after integration (i.e., single turnover) include, but are not limited to, mutations in residues that cause binding to three phosphates in the initiator chain, including K261, R432, and R454.

[0060] Another embodiment for using non-template-dependent polymerase / transferase enzymes involves modifying the enzyme using protein engineering or protein evolution to efficiently accommodate 3'-blocked reversible terminators. Naturally occurring polymerase / transferase enzymes do not incorporate 3'-blocked reversible terminators due to steric constraints at the enzyme's active site. By modifying one or more amino acids at the enzyme's active site, it may be possible to enable highly efficient incorporation of 3'-blocked reversible terminators into a support-bound initiator in a process entirely similar to the process described above. After incorporation, the 3'-reversible terminator is removed with a deblocking reagent / condition, thus generating a completely native (trace-free) single-chain molecule ready for a subsequent controlled extension reaction. The enzyme contains amino acids close to the 3'-OH of the incoming dNTP, which explains the TdT's tendency to incorporate ribonucleotide triphosphates as readily as deoxyribonucleotide triphosphates, and, though not limited to, amino acids between β1 and β2, in particular R334, loop 1, and between α13 and α14, in particular R454, are likely targets for mutagenesis, accommodating the 3'-reversible terminator group and enabling their efficient incorporation. In certain embodiments, further amino acid changes may be required to counteract the changes made to accommodate the 3'-reversible terminator. Another embodiment for using template-dependent polymerase is to use a 3'-blocked or 3'-unblocked dNTP analog with multiple primer-template pairs attached to a solid support, where the template is a nucleic acid analog supporting polymerase-mediated primer extension of any of four bases specified by the user.

[0061] In some embodiments, a modified TdT is used to achieve stepwise synthesis using 3'-O-blocked nucleotide analogs. The active site of the TdT protein can be modeled using AutoDock (Molecular Graphics Laboratory, Scripps Research Institute, La Jolla, CA). Based on this calculation, it is predicted that modified TdT with changes at Arg336 and Arg454 may have enzymatic activity against 3'-O-blocked nucleotide analogs. Gly452 and Ser453 are present in a cis-peptide bond conformation (see Delarue et al, EMBO J., 2002; 21(3):427-39, the whole of which is incorporated herein by reference), and the guanidinium group of Arg336 appears to contribute to the stabilization of this conformation. The stability provided by Arg336 may help explain why substitution at this position negatively affects the reactivity of the modified TdT protein. In some examples, the instability created by modifying position 336 can be overcome by using proline to stabilize the cis-peptide bond conformation. However, if Arg336 is substituted with, for example, alanine or glycine, the entire TGSR motif (positions 451, 452, 435, and 454) may also need to be modified to counteract this change. For example, the TGSR motif may be modified to TPSR or TGPR. In another embodiment, a substitution at Arg454 to accommodate the steric bulk of the 3'-O-blocking group may require further modification to the α14 region to counteract the glycine or alanine substitution at Arg454. In yet another embodiment, substitutions of other amino acids in the α11 region may be required, instead of or in addition to the modification of the GSR motif, to counteract the substitution to Arg336.

[0062] Modifications to Arg336 and Arg454 may alter the binding interaction of 3'-O-modified dNTPs, but it may also be necessary to explore substitutions that would result in improved steric interactions between 3'-O-modified dNTPs and TdT. Such steric modifications can also be explored computationally. Residues Gly332, Gly333, Gly452, Thr451, and Ser453 are also potential targets for substitutions that allow for additional steric bulk of 3'-blocking groups such as 3'-O-azidomethyl or 3'-O-allyl. Residues within 1.2 nm of a 3'-OH group, such as Glu457, Ala510, Asp509, Arg508, Lysl99, Serl96, Metl92, or Leul61, may also potentially hinder substrate utilization of 3'-O-blocked dNTPs and are therefore targets for substitution in addition to, or in combination with, Arg336 and Arg454. In addition to amino acid substitutions at positions 508, 509, and 510, it may be necessary to delete amino acids to eliminate interference with 3'-O-blocking groups. Since these amino acids are located near the C-terminus of the protein and in a relatively unorganized region, they may be deleted alone or together, instead of or in combination with the modifications described above.

[0063] Another embodiment for using a non-template-dependent polymerase / transferase enzyme is that protein engineering or protein evolution can be used to modify the enzyme to optimize the use of each of the four different nucleotides or even more different modified nucleotide analogs in an analog-specific manner. Nucleotide-specific or nucleotide analog-specific enzyme variants would further reduce the cost of synthesizing the desired polynucleotide. m It can be manipulated to have desired biochemical attributes, such as a reduction in or an increase in the rate of addition.

[0064] Solid-state synthesis The method of the present invention can be carried out under various reaction conditions; however, the sequential construction and recovery of desired polynucleotides almost always requires a solid support capable of extending the polynucleotides. When used in combination with the NTPs, linkers, and inhibitor analogs discussed above, it is possible to construct specific polynucleotide sequences of DNA and RNA, for example, by using TdT or poly(A) polymerase in an aqueous environment. As shown in Figure 13, stepwise construction of custom polynucleotides can be achieved by extending the polynucleotide sequence in a stepwise manner using TdT. As previously discussed, the inhibitor group of each NTP analog causes the enzyme to stop the addition of nucleotides. After each nucleotide extension step, the reactants are washed away from the solid support before the inhibitor is removed by cleaving the linker, and then new reactants can be added to start a new cycle.

[0065] In certain embodiments, an additional quality control step may be incorporated in which the oligonucleotide or polynucleotide is exposed to a 3' exonuclease after the nucleotidyltransferase-mediated nucleotide analog extension step and before inhibitor cleavage. The 3' exonuclease degrades oligonucleotide or polynucleotide chains that have an unblocked 3'OH group. An uncleaved inhibitor (e.g., a steric inhibitor) may physically block the 3' exonuclease from degrading chains into which the uncleaved nucleotide analog has been successfully incorporated. Such a quality control step degrades only the oligonucleotide or polynucleotide into which the desired nucleotide analog was unsuccessfully incorporated in the preceding addition step, thereby eliminating any errors in the completed synthetic sequence. After 3' exonuclease exposure, the enzyme may be washed away before the inhibitor cleavage step is performed.

[0066] 3' exonucleases act by shortening or completely degrading strands to which the desired nucleotide analog was not successfully added. Strands that fail to enzymatically extend in a given cycle lack terminal polymer-dNMP conjugates before the linker cleavage step. When 3' exonucleases are introduced at this stage, the "failed" strands are shortened or potentially completely degraded to mononucleotide phosphates, while the full-length strands may be protected from degradation. The yield of long (>500 bases) synthetic DNA depends on highly efficient reactions occurring in each and all cycles, and both the enzymatic extension and deblocking / self-exclusion steps must occur near quantitative yield. If the extension efficiency is low (i.e., there are strands that are not extended and therefore have native unmodified terminal nucleotides), introducing 3' exonucleases after the enzymatic extension step but before the polymer terminator cleavage step has a positive effect on the purity of the nascent strands.

[0067] Conversely, if the deblocking / exclusion step is below a quantitative level, the 3'-exonuclease step will have no effect on the quality of the synthesis, because those chains are still protected by the polymer terminator and fail to elongate during the next elongation step. Therefore, the actual improvement in the quality of the synthesis by adding the 3'-exonuclease step can only be determined experimentally, and consequently, the evaluation is made if it is worth the additional cost and cycle time.

[0068] Enzymes possessing 3'-5'-exonuclease activity include the 3'-exonucleases discussed above and polymerases containing 3'-exonuclease. Exemplary enzymes possessing 3'-5'-exonuclease activity include ExoI, thermally unstable ExoI, and ExoT, Exo I, Exo T, thermally unstable Exo I, Exo II, Exo III, Exo IV, Exo V, Exo VII, Exo IX, Exo IX, TREX1, TREX2 RNase T, Pol d, Pol e, Pol g, POL3, POL2, MIP1, WRN, p53, MRE11, hRADl, RAD1, hRAD9, and Rad9.

[0069] Upon completion of the n-cycle extension-removal-deblocking-washing process, the completed full-length single-stranded polynucleotide is complete and can be cleaved from the solid support and recovered for subsequent use in applications such as DNA sequencing or PCR. Alternatively, the completed full-length single-stranded polynucleotide can be left attached to the solid support for subsequent use in applications such as hybridization analysis, protein or DNA affinity capture. In other embodiments, partially double-stranded DNA can be used as an initiator to result in the synthesis of double-stranded polynucleotides.

[0070] In certain embodiments, the nucleotide analog addition cycle may include the step of exposing an oligonucleotide attached to a solid support to the nucleotide analog under conditions sufficient for the incorporation of the analog into the oligonucleotide, in the presence of a nucleotidyltransferase enzyme and in the absence of a nucleic acid template. The nucleotide analog may contain a 3'-O-blocking group, which prevents the nucleotidyltransferase from catalyzing the addition of either the native nucleotide or the nucleotide analog to the oligonucleotide until the blocking group is removed. After the incorporation of each nucleotide analog, the oligonucleotide may be exposed to a second nucleotide analog that does not confer resistance to exonuclease activity. The oligonucleotide may then be exposed to an enzyme having 3'-5'-exonuclease activity before the removal of the 3'-blocking group. Strands that did not incorporate the desired 3'-O-blocked nucleotide analog instead have the incorporated second nucleotide analog or nothing (with an unmodified 3'-OH group remaining that is sensitive to exonuclease activity). Therefore, treatment with an exonuclease prior to the removal of the 3'-O-blocking group results in the digestion of an error strand in which the desired nucleotide analog was not incorporated. The second nucleotide analog is selected from the group consisting of 2',3'-dideoxynucleotides and 2',3'-dehydronucleotides.

[0071] Exonuclease treatment may occur after each nucleotide analog integration cycle, or it may be deferred and performed only after the integration of two or more nucleotide analogs, or after the final nucleotide analog has been integrated and the desired oligonucleotide sequence is complete (but before the removal of the final blocking group). In the case of the second nucleotide analog that terminates the sequence, error strands in which the desired 3'-O-blocked nucleotide analog was not successfully integrated are blocked from further extension by the second nucleotide that terminates the chain and therefore do not have any further integrated 3'-O-blocked nucleotide analogs. Thus, even if exonuclease treatment is deferred for the final integration step, any error strands that occur along the way remain susceptible to exonuclease activity.

[0072] 11. The method according to claim 9, wherein the addition cycle comprises steps a), b), and c), followed by a step of removing a 3'-blocking group, and the method further comprises a step of repeating the addition cycle two or more times. In certain embodiments, the final integration step may include adding a nucleotide analog having a 3'-O-blocking group and a biotin modification.

[0073] In some embodiments, the nucleic acid initiator includes a 3' portion that releases the synthesized oligonucleotide in the presence of a release agent. This feature is generally illustrated in Figure 22, where the nucleic acid initiator (5'-initiator-) is shown coupled to a solid support (white circle) and a releaseable 3' portion (white star). In some embodiments, the initiator is a single-stranded oligonucleotide, e.g., a dimer, trimer, tetramer, pentamer, hexamer, heptamer, or octamer. The 3' portion attached to the initiator is a substrate for an enzyme, e.g., TdT, e.g., modified TdT, so that the enzyme can add further nucleotides or nucleotide analogs in a stepwise manner. Each addition increases the length of the synthesized oligonucleotide. Once oligonucleotide synthesis is complete, a release agent can be introduced to cleave the 3' portion from the nucleic acid initiator. In some embodiments, the 3' portion is a ribonucleotide, e.g., A, C, G, or U ribonucleotide. In other embodiments, the 3' portion is debased deoxyribose. In other embodiments, the 3' portion is debased ribose. In other embodiments, the 3' portion is non-nucleoside 5'-monophosphate. The release agent may contain a basic solution or metal ions. For example, the release agent may be a concentrated NH4OH solution having a pH greater than 8, i.e., a pH greater than 8.5, i.e., a pH greater than 9.0, i.e., a pH greater than 9.5. In some embodiments, the release agent is an enzyme, for example, a type II restriction nuclease. In some embodiments, the enzyme uniquely interacts with the nucleic acid sequence of the initiator, dissolving the oligonucleotide synthesized from the initiator and leaving the initiator behind.

[0074] In some embodiments, the initiator is a nucleic acid hexamer, and the 3' portion is a ribonucleotide, such as adenosine. Using, for example, a nucleotide containing a cleavable terminator linked at the N-4 position or a nucleotide having a 3'-O-blocked position, once oligonucleotide synthesis is complete, the oligonucleotide can be released by exposing the bound oligonucleotide to an ammonium hydroxide solution at approximately pH 8. The basic solution containing the synthesized oligonucleotide can then be separated from the solid substrate containing the hexamer initiator. The solid substrate is then washed and / or neutralized to prepare the initiator and 3' portion for the production of new oligonucleotides. In some embodiments, the terminal ribonucleotide is regenerated before oligonucleotide synthesis by using the 3' phosphatase activity of a phosphatase or T4 polynucleotide kinase.

[0075] In some embodiments, the solid support and the nucleic acid initiator including the 3' portion are reusable, thereby allowing the initiator coupled to the solid support to be used multiple times for rapid synthesis of oligonucleotides. Suitable solid supports for use in the method of the present invention may include glass and silica supports, including beads, slides, pegs, or wells. In some embodiments, the support may be anchored to another structure, such as a polymer well plate or pipette tip. In some embodiments, the solid support may have additional magnetic properties, thus allowing the support to be manipulated or removed from a position using a magnet. In other embodiments, the solid support may be a silica-coated polymer, thereby allowing the formation of various structural shapes that are useful for automated processing.

[0076] The choice of substrate material and the covalent linking chemistry between the initiator and the substrate is limited only by the ability of the construct to withstand synthesis conditions without initiator loss. Preferred embodiments utilize a substrate and linker that are more chemically stable than the initiator so that the stability of the entire construct is that of the attached oligonucleotide and independent of the substrate. In some embodiments, the initiator can be synthesized in the 5' to 3' direction from a material that presents surface hydroxyl groups, in preferred embodiments where the initiator is instead grafted onto the substrate so that density and initiator quality can be precisely controlled.

[0077] The covalent bond between the initiator and the substrate can be any bond that does not impair the stability of the construct. Preferred embodiments may utilize coupling between an oligonucleotide containing any of the 5'-amine, 5'-hydroxyl, 5'-phosphate, 5'-sulfhydryl, or 5'-benzaldehyde groups and a surface or resin on the substrate containing formyl, chloromethyl, epoxide, amine, thiol, alkene, or terminal CF bond.

[0078] In some embodiments, the initiator may contain elements for sequence-specific cleavage strategies, such as restriction enzymes, uracil-specific cleavage reagents (USER), or any variety of sequence-specific nucleases. In other embodiments, these elements may instead be enzymatically synthesized or added to the initiator after coupling with the resin. Such a scenario may be preferred, for example, when the initiator is composed solely of thymidine to minimize potential side reactions with surface functional groups during the coupling process.

[0079] Figure 23 shows an example of a solution phase in which a short polyuracil (U) tract is added to the 3'-end of an initiator using TdT. The resulting initiator can then be used for further extension reactions as described to produce the desired sequence. Upon completion of the synthesis, the newly generated sequence can be cleaved at the internal poly-U tract to separate the new sequence from the original initiator. The 30-nucleotide initiator used is of the sequence 5'-TTATTATTATTATTAAAAAAGGCCAAAAAA. The gel shown in Figure 23 contains the initiator flowed in lane 1, while the initiator after the addition of one or more dUTPs (i.e., polyuracil tracts) was flowed in lane 2. The resulting sequences were then subjected to USER digestion for 10, 30, and 60 minutes, flowing in lanes 3, 4, and 5, respectively.

[0080] Figure 24 shows that cleavage of a sequence containing an internal polyU tract produces a homogeneous-length single product with a 5'-phosphate. The cleavage process leaves a 3'-phosphate on the resin-bound initiator, which can be removed by treatment with T4 polynucleotide kinase, alkaline phosphatase, or other dephosphorylation processes (see Figure 25). In the example shown in Figure 24, the cleaved internal polyU tract sequence was the sequence 5'-TTAATTAATUUUUGTGAGCTTAATGTCCTTATGT, which, after USER digestion, yielded a product of the sequence 5'-phos-GTGAGCTTAATGTCCTTATGT. The resulting product was run in lanes 1, 2, 3, and 4 after 0, 10, 30, and 60 minutes of USER digestion, as shown in Figure 24, demonstrating successful cleavage and homogeneous product length. In lane 5, a control oligonucleotide of the sequence GTGAGCTTAATGTCCTTATGT was run.

[0081] Figure 25 illustrates an exemplary solid-phase dephosphorylation and TdT elongation process. The chart represents the absorbance of the TdT reaction mixture during solid-phase elongation. When dNTPs are added to initiators bound to the resin, they are depleted from the solution, reducing the absorbance of the supernatant. Trace A shows a negligible percentage of dNTP incorporation on resin where the 3'-ends of the initiators are blocked with terminal phosphate. Trace B shows the percentage of incorporation after such initiators have been treated with ebi alkaline phosphatase for 15 minutes. Trace C shows the percentage of dNTP incorporation under the same conditions using unblocked initiators.

[0082] After the cleavage of the synthesized sequence, the resin can then be used in another cycle of setting the cleavage site, synthesis, product removal, and regeneration. Figure 26 provides an overview of an exemplary regeneration cycle.

[0083] In other embodiments, the placement of cleavage sites can be used to ensure homogeneous enzymatic access to the initiator oligonucleotides. Each enzyme used during the enzymatic synthesis cycle has its own steric footprint with potentially distinct optimal loading and spacing from the surface. This can lead to unexpected behavior regarding the dynamics of stepwise addition and yield from the enzymatic cleavage process. In some embodiments, the iterative cycle of cleavage site placement, cleavage, and regeneration may be performed prior to oligonucleotide synthesis so that the cleavage enzyme and template-independent polymerase access the same population of surface oligonucleotides.

[0084] In some embodiments, multiple distinct cleavage sites may be established across the entire chain during synthesis. During digestion, a complex library of chains located between the cleavage sites may be released from the resin. Such sequences can then be further amplified and used by those skilled in the art for enzymatic assembly processes. This technique may be particularly suitable for parallel synthesis schemes to produce greater diversity of sequence fragments at relatively few distinct locations on the surface, or to avoid the synthesis of adjacent chains that would be at risk of secondary structure formation during synthesis.

[0085] In other embodiments, the placement of cleavage sites may be used immediately after each cycle of enzymatic extension to assist in the removal of unreacted initiator sequences, similar to acetylation used in phosphoramidite-based oligonucleotide synthesis. Chains that have not been extended between addition cycles act as substrates for polyU tracts, but extended initiators with chain terminators do not. At the end of the synthesis cycle, single-USER digestion is performed, resulting in the release of the oligonucleotide from the support, and sequences containing failed additions are simultaneously digested to a length shorter than the full-size product. Failed sequences are also similar in that they are phosphorylated here at their 3'-ends, making them inactive for further enzymatic extension. The full-length sequence is then extended, and any elements may be added to enable selective capture, isolation, or enrichment. Such elements may be either additional homopolymer tracts, e.g., further polyU tracts (which can be isolated by hybridization-based methods and subsequently digested), or biotinylated elements for non-covalent capture. This method compensates for the lack of suitable chromatographic techniques, making it suitable for long (150 nt + oligonucleotides), small sample volumes, or complex mixtures of sequences of variable length.

[0086] Further embodiments may utilize the placement of cleavage sites to assist in the recycling of highly indexed DNA-based data recording media. An example is shown in Figure 27. In such cases, the 5'-surface-fixed sequence is terminated with a short poly-A tract. Extension to generate a sufficiently long terminal 3'-poly-U site allows for hairpin folding under appropriate conditions, and as a result, elements of the initiator preceding the poly-A stretch can be replicated using a template-dependent polymerase. The sequence is then extended with a new homopolymer tract, leaving a free 3'-end that can be used in subsequent data writing operations. Upon completion of the writing step, the hairpin linker can then be digested with USER enzyme to release the data strand, but leaving a template initiator that is regenerated by a 3'-dephosphorylation step, poly-U addition, and re-copying of the template strand. The use of homopolymer tracts in DNA-based data recording is described in U.S. Patent Application No. 15 / 994,335, co-owned, incorporated herein by reference.

[0087] Synthesizer To fully utilize the efficiency of the disclosed method, an aqueous DNA synthesizer can be constructed to produce a substantial amount of the desired polynucleotide. In one embodiment, the synthesizer contains four wells of the described NTP analog reagents, namely dCTP, dATP, dGTP, and dTTP, as well as TdT at a concentration sufficient to yield polynucleotide growth. Multiple start sequences can be attached to a solid support designed to be repeatedly immersed in each of the four wells, for example, using a laboratory robot. The robot may be further programmed to rinse the solid support with a washing buffer between nucleotide additions, cleave the linking groups by exposing the support to a deblocking agent, and perform a second wash on the solid support before moving it to the well of the next desired nucleotide. With simple programming, it is possible to produce a useful amount of the desired nucleotide sequence in a few hours, with a substantial reduction in hazardous waste. Synthesis proceeding under carefully controlled conditions allows for the synthesis of polynucleotides having lengths of several thousand base pairs. Upon completion, the extension products are released from the solid support and can be used as the completed nucleotide sequence.

[0088] A highly parallelized embodiment may consist of a series of initiator-solid supports on pegs in either 96 or 384-well form, which can be individually retracted or lowered, so that the pegs can be indexed to come into contact with the liquid in the wells in a controlled manner. Thus, the synthesizer may consist of randomly addressable peg devices, four enzyme-dNTP analog reservoirs of the same form as the peg devices (96 or 384 spacing), additional reagent reservoirs of the same form as the peg devices (96 or 384 spacing) (for washing, deblocking, etc.), and a transport mechanism (e.g., a laboratory robot) that allows the user to programmable, controlled, but randomly access the peg devices from one reservoir to another. Since the contents are reused throughout the synthesis process to reduce the cost of each polynucleotide synthesis, care must be taken to avoid contamination of each of the four enzyme-dNTP reservoirs.

[0089] In alternative embodiments, reagents (e.g., nucleotide analogs, enzymes, buffers) are moved between solid supports, allowing for reagent recycling. For example, a reservoir and pump system can move four different nucleotide analog solutions, washing buffers, and / or reducing agent solutions between one or more reactors where oligonucleotides are formed. The reactors and pumps may be conventional, or the devices may be constructed using microfluidics. Due to the non-anhydrous (aqueous) nature of the process, special care is not required in the design of the hardware used to eliminate exposure to water. The synthesis process can be carried out with only precautions to control losses in evaporation. Highly parallel embodiments may consist of a series of monolithic initiator-solid supports on pegs in either 96 or 384-well form, which can be interconnected into a series of wells in the same matching form. Each well would in fact be a reaction chamber supplied by four enzyme-dNTP analog reservoirs with appropriate valves, and additional reagent reservoirs (washing, deblocking, etc.). Since the enzyme-dNTP reaction product is reused throughout the synthesis process to reduce the cost of each polynucleotide synthesis, by the logic of fluidics, preparations will be made to recover the enzyme-dNTP reaction product in the initial manner after each extension reaction. In other embodiments, reagents can be added and removed using a pipetting tip system.

[0090] In certain embodiments, polynucleotides may be synthesized using microfluidic devices and / or inkjet printing techniques. An exemplary microfluidic polynucleotide synthesis device is shown in Figure 17 for illustrative purposes, but not at a constant scaling ratio. A microfluidic channel 255 containing a regulator 257 connects a reservoir 253 to a reaction chamber 251, and an outlet channel 259 containing a regulator 257 can discharge waste from the reaction chamber 251. A microfluidic device for polynucleotide synthesis may include, for example, channel 255, reservoir 253, and / or regulator 257. Polynucleotide synthesis may occur in a microfluidic reaction chamber 251, which may contain several tethered synthesized nucleotide initiators, which may contain beads or other substrates (which can release NTP analogs or polynucleotide initiators) tethered or bound to the inner surface of the reaction chamber. The reaction chamber 251 may include at least one intake and one outlet channel 259, thereby allowing reagents to be added to and removed from the reaction chamber 251. The microfluidic device may include reservoirs 253 for each individual NTP analog. Each of these NTP analog reservoirs 253 may also contain an appropriate amount of TdT, or any other enzyme that extends a DNA or RNA strand without template indication. Additional reservoirs 253 may contain reagents for linker / inhibitor cleavage and washing. These reservoirs 253 can be connected to the reaction chamber 251 via separate channels 255, and the flow of reagents through each channel 255 to the reaction chamber 251 may be individually regulated by the use of gates, valves, pressure regulators, or other means. The flow from the reaction chamber 251 through the outlet channel 259 may be regulated similarly.

[0091] In certain examples, reagents, in particular NTP analog-enzyme reagents, may be recycled. The reagents may be drawn back from the reaction chamber 251 to their individual reservoirs 253 via the same channel 255 into which they enter, by inducing backflow using a gate, valve, pressure regulator or other means. Alternatively, the reagents may be returned from the reaction chamber 251 to their individual reservoirs 253 via an independent return channel. The microfluidic device may include a controller capable of operating the gate, valve, pressure or other regulator 257 described above.

[0092] An exemplary microfluidic polynucleotide synthesis reaction may include the steps of: flowing a desired enzyme-NTP analog reagent into reaction chamber 251; removing the enzyme-NTP analog reagent from reaction chamber 251 via an outlet channel 259 or a return channel after a set time; flowing a washing reagent into reaction chamber 251; removing the washing reagent from reaction chamber 251 via an outlet channel 259; flowing a deblocking or cleaving reagent into reaction chamber 251; removing the deblocking or cleaving reagent from reaction chamber 251 via an outlet channel 259 or a return channel; flowing a washing reagent into reaction chamber 251; removing the washing reagent from reaction chamber 251 via an outlet channel 259; flowing an enzyme-NTP analog reagent containing the next NTP in the desired sequence to be synthesized into reaction chamber 251; and repeating until the desired polynucleotide is synthesized. After the desired polynucleotide is synthesized, it may be released from the reaction chamber anchor or substrate and collected via an outlet channel 259 or other means.

[0093] In certain embodiments, reagents and compounds, including NTP analogs, TdT, and / or other enzymes, as well as reagents for linker / inhibitor cleavage and / or washing, may be deposited in the reaction chamber using inkjet printing technology or piezoelectric drop-on-demand (DOD) inkjet printing technology. Using inkjet printing technology, droplets can be formed and deposited in the reaction chamber by air. Reagent droplets may have volumes on a picoliter to nanoliter scale. Droplets may be introduced using inkjet printing technology at various frequencies, including 1 Hz, 10 Hz, 100 Hz, 1 kHz, 2 kHz, and 2.5 kHz. Different reagents may be stored in separate reservoirs within the inkjet printing device, and the inkjet printing device may deliver droplets of different reagents to various separate locations, for example, including different reaction chambers or wells within a chip. In certain embodiments, inkjet and microfluidic technologies may be combined, where certain reagents and compounds are delivered to the reaction chamber via inkjet printing technology, while others are delivered via microfluidic channels or tubes. The inkjet printing device may be controlled by a computing device which includes at least non-transient tangible memory coupled to a processor. The computing device may receive input from an input device, such as a touchscreen, mouse, or keyboard, and may be able to operate the inkjet printing device to control the time and place of deposition of reagent droplets, the reagent used for deposition, and / or the amount of reagent deposited.

[0094] In a particular example, a desired polynucleotide sequence may be input to a computing device through an input device, which can be operated to carry out the reactions necessary to generate the desired polynucleotide sequence by sequentially depositing the appropriate NTP analog, enzyme, cleavage reagent, and washing reagent in the appropriate order, as described above.

[0095] After synthesis, the released extension product can be analyzed by high-resolution PAGE to determine whether the initiator has been extended to the expected number of bases compared to a control. A portion of the recovered synthetic DNA can also be sequenced to determine whether the synthesized polynucleotide has the expected sequence.

[0096] Because the synthesizer is relatively simple and does not require the toxic components necessary for phosphoramidite synthesis, the synthesizer of the present invention is widely accessible to research institutions, biotechnology companies, and hospitals. In addition, the ability to reuse / recycle reagents helps reduce the amount of waste generated and lower the cost of consumables. The inventors anticipate that this method and system will be useful in numerous applications, such as DNA sequencing, PCR, and synthetic biology.

[0097] Built-in by reference Throughout this disclosure, references and citations have been made to other documents, such as patents, patent applications, patent publications, journals, books, articles, and web content. All such documents, in their entirety, are incorporated herein by reference for all purposes.

[0098] Equal parts In addition to those shown and described herein, various modifications of the invention and many further embodiments will be apparent to those skilled in the art from the entirety of this document, including references to the scientific and patent documents cited herein. The subject matter of this specification includes important information, examples, and guidance that may be applicable to the implementation of the invention in its various embodiments and equivalents. The present invention provides, for example, the following items: (Item 1) A method for synthesizing oligonucleotides, wherein the method is A step of exposing an oligonucleotide attached to a solid support to a nucleotide analog under conditions sufficient for incorporation of the analog into the oligonucleotide, in the presence of a nucleotidyltransferase enzyme and in the absence of a nucleic acid template, wherein the nucleotide analog contains a 3'-O-blocking group, and the 3'-O-blocking group prevents the nucleotidyltransferase from catalyzing the addition of either a native nucleotide or the nucleotide analog to the oligonucleotide until the blocking group is removed; The step of exposing the oligonucleotide to an enzyme having 3'-5'-exonuclease activity before removing the 3'-O-blocking group. Methods that include... (Item 2) The structure of the nucleotide analog is [ka] Including, in the formula, BG is a 3'-O-blocking group selected from the group consisting of 3'-ONO2, 3'-OCH2CH2CN, 3'-OCH2N3, 3'-OPO3, 3'-OCH2SSCH3, and 3'-ONHC(O)H. R is selected from the group consisting of H, amides, carbamates, and ureas, and in each case, it is optionally linked to a member selected from the group consisting of methyl, ethyl, propyl, isopropyl, isobutyl, pivaloyl, cyclohexyl, cyclopropyl, phenyl, naphthyl, anthracenyl, phenantrenyl, pyrenyl, crisenyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, quinolinyl, isoquinolinyl, furanyl, thiophenyl, morpholinyl, piperidinyl, dioxanyl, tetrahydrofuranyl, and biotin. The method described in item 1. (Item 3) The nucleotide analog has the following structure: [ka] Including, in the formula, BG is a 3'-O-blocking group selected from the group consisting of 3'-ONO2, 3'-OCH2CH2CN, 3'-OCH2N3, 3'-OPO3, 3'-OCH2SSCH3, and 3'-ONHC(O)H. Nucleotide-R is selected from the group consisting of deoxyadenosine, deoxycytidine, deoxythymidine, deoxyguanosine, N6-modified deoxyadenosine, N4-modified deoxycytidine, N1-modified deoxythymidine, O6-modified deoxyguanosine, N1-modified deoxyguanosine, and N2-modified deoxyguanosine. The method described in item 1. (Item 4) The enzyme having the aforementioned 3'-5'-exonuclease activity is ExoI, thermally unstable ExoI, and ExoT, Exo I, Exo T, thermally unstable Exo I, Exo II, Exo III, Exo IV, Exo V, Exo VII, Exo IX, Exo The method described in item 1, selected from the group consisting of IX, TREX1, TREX2 RNase T, Pol d, Pol e, Pol g, POL3, POL2, MIP1, WRN, p53, MRE11, hRADl, RAD1, hRAD9, and Rad9. (Item 5) The method according to item 3, wherein nucleotide-R is selected from the group consisting of N4-modified deoxycytidine, O6-modified deoxyguanosine, Nl-modified deoxyguanosine, and N2-modified deoxyguanosine. (Item 6) The method according to item 3, wherein nucleotide-R is selected from the group consisting of N4-modified deoxycytidine and N1-modified deoxythymidine. (Item 7) The method according to item 3, wherein nucleotide-R is selected from the group consisting of N4-modified deoxycytidine and N6-modified deoxyadenosine. (Item 8) The method according to item 3, wherein nucleotide-R is selected from the group consisting of O6-modified deoxyguanosine, Nl-modified deoxyguanosine, N2-modified deoxyguanosine, N6-modified deoxyadenosine, and N1-modified deoxythymidine. (Item 9) A method for synthesizing oligonucleotides, wherein the method is a) Exposing an oligonucleotide attached to a solid support to a nucleotide analog under conditions sufficient for incorporation of the analog into the oligonucleotide, in the presence of a nucleotidyltransferase enzyme and in the absence of a nucleic acid template, wherein the nucleotide analog contains a 3'-O-blocking group, and the 3'-O-blocking group prevents the nucleotidyltransferase from catalyzing the addition of either a native nucleotide or the nucleotide analog to the oligonucleotide until the blocking group is removed. b) Before removing the 3'-blocking group, the oligonucleotide is exposed to a second nucleotide analog that does not confer resistance to exonuclease activity, and c) Before removing the 3'-blocking group, the oligonucleotide is exposed to an enzyme having 3'-5'-exonuclease activity. Methods that include... (Item 10) The method according to item 9, wherein the second nucleotide analog is selected from the group consisting of 2',3'-dideoxynucleotides and 2',3'-dehydronucleotides. (Item 11) The method according to item 9, wherein the addition cycle comprises steps a), b), and c), followed by the step of removing the 3'-blocking group, and the method further comprises the step of repeating the addition cycle two or more times. (Item 12) The addition cycle comprises steps a) and b), followed by the step of removing the 3'-blocking group, and the method is The step of repeating the aforementioned additional cycle two or more times, After the last iteration of the aforementioned additional cycle, the final cycle is performed, including steps a), b), and c). The method described in item 9, further including the method described in item 9. (Item 13) The method according to item 11, further comprising the step of exposing the oligonucleotide to a third nucleotide analog comprising the 3'-O-blocking group and biotin modification after the last iteration of the addition cycle. (Item 14) The structure of the nucleotide analog is [ka] Including, in the formula, BG is a 3'-O-blocking group selected from the group consisting of 3'-ONO2, 3'-OCH2CH2CN, 3'-OCH2N3, 3'-OPO3, 3'-OCH2SSCH3, and 3'-ONHC(O)H. R is selected from the group consisting of H, amides, carbamates, and ureas, and in each case, it is optionally linked to a member selected from the group consisting of methyl, ethyl, propyl, isopropyl, isobutyl, pivaloyl, cyclohexyl, cyclopropyl, phenyl, naphthyl, anthracenyl, phenantrenyl, pyrenyl, crisenyl, pyridinyl, pyrimidinyl, pyrazinyl, indolyl, quinolinyl, isoquinolinyl, furanyl, thiophenyl, morpholinyl, piperidinyl, dioxanyl, tetrahydrofuranyl, and biotin. The method described in item 9. (Item 15) The nucleotide analog has the following structure: [ka] Including, in the formula, BG is a 3'-O-blocking group selected from the group consisting of 3'-ONO2, 3'-OCH2CH2CN, 3'-OCH2N3, 3'-OPO3, 3'-OCH2SSCH3, and 3'-ONHC(O)H. Nucleotide-R is selected from the group consisting of deoxyadenosine, deoxycytidine, deoxythymidine, deoxyguanosine, N6-modified deoxyadenosine, N4-modified deoxycytidine, N1-modified deoxythymidine, O6-modified deoxyguanosine, N1-modified deoxyguanosine, and N2-modified deoxyguanosine. The method described in item 9. (Item 16) The enzyme having the aforementioned 3'-5'-exonuclease activity is ExoI, thermally unstable ExoI, and ExoT, Exo I, Exo T, thermally unstable Exo I, Exo II, Exo III, Exo IV, Exo V, Exo VII, Exo IX, Exo The method described in item 9, selected from the group consisting of IX, TREX1, TREX2 RNase T, Pol d, Pol e, Pol g, POL3, POL2, MIP1, WRN, p53, MRE11, hRADl, RAD1, hRAD9, and Rad9. (Item 17) The method according to item 15, wherein nucleotide-R is selected from the group consisting of N4-modified deoxycytidine, O6-modified deoxyguanosine, Nl-modified deoxyguanosine, and N2-modified deoxyguanosine. (Item 18) The method according to item 15, wherein nucleotide-R is selected from the group consisting of N4-modified deoxycytidine and N1-modified deoxythymidine. (Item 19) The method according to item 15, wherein nucleotide-R is selected from the group consisting of N4-modified deoxycytidine and N6-modified deoxyadenosine. (Item 20) The method according to item 15, wherein nucleotide-R is selected from the group consisting of O6-modified deoxyguanosine, Nl-modified deoxyguanosine, N2-modified deoxyguanosine, N6-modified deoxyadenosine, and N1-modified deoxythymidine.

Claims

[Claim 1] The invention described herein.

Images