Compounds and methods for reducing APP expression
Modified oligonucleotides targeting APP RNA and protein provide a treatment approach for neurodegenerative diseases like Alzheimer's and cerebral amyloid angiopathy, effectively reducing disease symptoms by addressing the underlying APP accumulation.
Patent Information
- Application Number
- JP2026083727
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2021-02-11
- Filing Date
- 2026-05-19
- Publication Date
- 2026-08-25
AI Technical Summary
There is a lack of effective treatments for neurodegenerative diseases such as Alzheimer's disease, Alzheimer's disease in Down syndrome, and cerebral amyloid angiopathy, which are characterized by the abnormal accumulation of beta-amyloid plaques originating from amyloid precursor protein (APP).
Development of compounds, particularly modified oligonucleotides, that reduce the amount or activity of APP RNA and protein, thereby targeting the root cause of these diseases.
These compounds effectively decrease the symptoms associated with these diseases, including cognitive impairment, behavioral and psychological symptoms, and abnormal amyloid deposition, by reducing APP expression.
Smart Images

Figure 2026136192000001 
Figure 2026136192000002 
Figure 2026136192000003
Abstract
Description
[Technical Field]
[0001] Sequence List This application is filed electronically along with a sequence listing. The sequence listing is provided as a file named BIOL0384WOSEQ_ST25.txt, 1007KB in size, created on July 7, 2021. The electronic information of this sequence listing is incorporated herein by reference in its entirety.
[0002] The present invention provides compounds, methods, and pharmaceutical compositions for reducing the amount or activity of APP RNA in cells or animals, and, in some cases, the amount of APP protein in cells or animals. Certain such compounds, methods, and pharmaceutical compositions are useful for improving at least one symptom or feature of a neurodegenerative disease or disorder. Such symptoms and features include cognitive impairment, including impaired memory and language abilities, behavioral and psychological symptoms such as apathy and lack of motivation, gait disturbances and seizures, progressive dementia, and abnormal amyloid deposition. Such neurodegenerative diseases and disorders include sporadic Alzheimer's disease, hereditary / familial Alzheimer's disease, Alzheimer's disease in patients with Down syndrome, and cerebral amyloid angiopathy. [Background technology]
[0003] Alzheimer's disease (AD), including sporadic Alzheimer's disease and hereditary / familial Alzheimer's disease, is the most common cause of age-related dementia, affecting an estimated 5.7 million Americans annually (Alzheimer's Association. 2018 Alzheimer's Disease Facts and Figures. Alzheimer's Dement. 2018;14(3):367-429). AD is characterized by the accumulation of beta-amyloid plaques in the brain before overt clinical symptoms appear. These overt clinical symptoms include cognitive impairment, including impaired memory and language abilities, behavioral and psychological symptoms such as apathy and lack of motivation, gait disturbances and seizures, and progressive dementia.
[0004] Individuals with Down syndrome (DS) are at risk of experiencing early-onset Alzheimer's disease (AD in DS). Many DS patients develop amyloid plaques by age 40, and more than 50% of individuals with Down syndrome develop Alzheimer's disease by age 50.
[0005] Cerebral amyloid angiopathy (CAA) is a related disorder characterized by the deposition of beta-amyloid in the blood vessels of the central nervous system (CNS). CAA is often observed in AD patients at autopsy, but it is also associated with aging even in the absence of clinical signs of AD.
[0006] AD, AD in DS, and CAA are all characterized by the abnormal accumulation of β-amyloid plaques. β-amyloid (Aβ) originates from amyloid precursor protein (APP) when APP is processed by α-, β-, and γ-secretases. In addition to the 42-amino acid fragment Aβ, various other fragments of APP are also formed, some of which are thought to contribute to the development of dementia in AD (reviewed in Nhan, et al., “The multifaceted nature of amyloid precursor protein and its proteolytic fragments: friends and foes”, Acta Neuropath., 2015, 129(1):1-19). The increased incidence in AD in DS patients is thought to be directly related to the increase in the copy number of the APP gene located on chromosome 21.
[0007] Currently, there is a lack of acceptable options for treating neurodegenerative diseases and disorders such as AD, AD in DS, and CAA. Therefore, it is the object of this specification to provide compounds, methods, and pharmaceutical compositions for treating such diseases. [Overview of the Initiative]
[0008] The present invention provides compounds, methods, and pharmaceutical compositions for reducing the amount or activity of APP RNA, and in specific embodiments, for reducing the amount of APP protein in cells or animals. In specific embodiments, the animals suffer from neurodegenerative diseases and disorders. In specific embodiments, the animals suffer from Alzheimer's disease (AD). In specific embodiments, the animals suffer from Alzheimer's disease associated with Down syndrome (AD in DS). In specific embodiments, the animals suffer from cerebral amyloid angiopathy (CAA). In specific embodiments, the compounds useful for reducing APP RNA expression are oligomeric compounds. In specific embodiments, the compounds useful for reducing APP RNA expression are modified oligonucleotides.
[0009] Also provided are methods useful for improving at least one symptom or feature of a neurodegenerative disease and disorder. In certain embodiments, the neurodegenerative disease is Alzheimer's disease. In certain embodiments, the neurodegenerative disease is Alzheimer's disease in a patient with Down syndrome. In certain embodiments, the neurodegenerative disease is cerebral amyloid angiopathy (CAA). In certain embodiments, the symptoms or features include cognitive impairment, including behavioral and psychological symptoms such as impaired memory and language abilities, apathy and lack of motivation, gait disturbances and seizures, progressive dementia, or abnormal amyloid deposition. [Modes for carrying out the invention]
[0010] Please understand that the above summary and the following detailed explanation are illustrative and descriptive only, and not limiting. In this specification, the use of the singular includes the plural unless otherwise explicitly stated. Where used herein, the use of "or" means "and / or" unless otherwise explicitly stated. Furthermore, the use of the term "including," as well as other forms such as "including" and "included," is not limiting. Also, terms such as "element" or "component" include both elements and components containing one unit, and elements and components containing two or more subunits, unless otherwise explicitly stated.
[0011] The headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described herein. All documents or parts of documents cited herein, including but not limited to patents, patent applications, articles, books, and papers, are expressly incorporated herein by reference to the parts and in whole of the documents discussed herein.
[0012] definition Unless otherwise specified, the nomenclature, procedures, and techniques used in relation to analytical chemistry, synthetic organic chemistry, and medical and pharmaceutical chemistry described herein are well known and commonly used in the art. Where permitted, all patents, patent applications, patent application publications, and other publications and data referenced throughout this disclosure are incorporated herein by reference in their entirety.
[0013] Unless otherwise specified, the following terms have the meanings listed below.
[0014] definition As used herein, "2'-deoxynucleoside" means 2'-H(H)deoxynucleoside This refers to a nucleoside containing a xylibosyl sugar moiety. In certain embodiments, a 2'-deoxynucleoside is a 2'-β-D-deoxynucleoside containing a 2'-β-D-deoxyribosyl sugar moiety, which has a β-D configuration similar to that found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, a 2'-deoxynucleoside, or a nucleoside containing an unmodified 2'-deoxyribosyl sugar moiety, may contain a modified nucleic acid base or an RNA nucleic acid base (uracil).
[0015] As used herein, “2'-substituted nucleoside” means a nucleoside containing a 2'-substituted sugar moiety. As used herein, “2'-substituted” with respect to a sugar moiety means a sugar moiety containing at least one 2'-substituent other than H or OH.
[0016] As used herein, "2'-MOE" means a 2'-OCH2CH2OCH3 group instead of the 2'-OH group of the ribosyl sugar moiety. A "2'-MOE sugar moiety" is a sugar moiety having a 2'-OCH2CH2OCH3 group instead of the 2'-OH group of the ribosyl sugar moiety. Unless otherwise indicated, the 2'-MOE sugar moiety is in the β-D configuration. "MOE" means O-methoxyethyl.
[0017] As used herein, "2'-MOE nucleoside" means a nucleoside containing a 2'-MOE sugar moiety.
[0018] As used herein, "2'-OMe" or "2'-O-methyl sugar moiety" means a 2'-OCH3 group in place of the 2'-OH group in the ribosyl sugar moiety. Unless otherwise specified, 2'-OMe has a β-D stereochemical configuration.
[0019] As used herein, "2'-OMe nucleoside" means a nucleoside containing a 2'-OMe sugar moiety.
[0020] As used herein, “3' target site” refers to the 3'-most nucleotide of the target nucleic acid that is complementary to the antisense oligonucleotide when the antisense oligonucleotide is hybridized to the target nucleic acid.
[0021] As used herein, “5' target site” refers to the 5'-side nucleotide of the target nucleic acid that is complementary to the antisense oligonucleotide when the antisense oligonucleotide is hybridized to the target nucleic acid.
[0022] As used herein, "5-methylcytosine" refers to cytosine modified with a methyl group attached to the 5-position. 5-methylcytosine is a modified nucleic acid base.
[0023] As used herein, “desaccharified sugar moiety” means the sugar portion of a nucleoside that is not bound to the nucleoside. Such debasicated sugar moieties are sometimes referred to in the art as “desaccharified nucleoside.”
[0024] As used herein, “administer” or “to administer” means to provide a drug or composition to an animal.
[0025] As used herein, “animal” means human or non-human animal.
[0026] As used herein, “antisense activity” means any detectable and / or measurable change resulting from the hybridization of an antisense compound with its target nucleic acid. In certain embodiments, antisense activity is defined as the absence of the antisense compound. This is a decrease in the amount or expression of the target nucleic acid or the protein encoded by such target nucleic acid, compared to the target nucleic acid level or target protein level at a given time.
[0027] As used herein, “antisense compound” means an oligomeric compound capable of achieving at least one antisense activity.
[0028] As used herein, “antisense oligonucleotide” means an oligonucleotide comprising an oligonucleotide portion of an oligomeric compound that is complementary to a target nucleic acid and capable of achieving at least one antisense activity. Antisense oligonucleotides include, but are not limited to, antisense RNaseH oligonucleotides.
[0029] As used herein, “improvement” in relation to treatment means improvement in at least one symptom compared to the same symptom without treatment. In certain embodiments, improvement is a decrease in the severity or frequency of a symptom, or a delay in the onset or progression of a symptom in terms of severity or frequency. In certain embodiments, the symptom or feature is cognitive impairment, including behavioral and psychological symptoms such as impaired memory and language abilities, apathy and lack of motivation, gait disturbances and seizures, progressive dementia, or abnormal amyloid deposition.
[0030] As used herein, “bicyclic nucleoside” or “BNA” means a nucleoside containing a bicyclic sugar moiety.
[0031] As used herein, “bicyclic sugar” or “bicyclic sugar moiety” means a modified sugar moiety comprising two rings, the second ring being formed via a bridge connecting two atoms in the first ring, thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the bicyclic sugar moiety does not contain a furanosyl moiety.
[0032] As used herein, “cleavable portion” means a bond or group of atoms that is cleaved under physiological conditions, for example, within a cell, animal, or human.
[0033] As used herein, “complementary” with respect to an oligonucleotide means that at least 70% of the nucleic acid bases or one or more regions of the oligonucleotide and at least 70% of the nucleic acid bases or one or more regions of another nucleic acid can hydrogen bond with each other when the nucleic acid base sequences of the oligonucleotide and the other nucleic acid are aligned in opposite directions. Complementary nucleic acid bases mean nucleic acid bases that can form hydrogen bonds with each other. Examples of complementary nucleic acid base pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (mC) and guanine (G). Certain modified nucleic acid bases that pair with natural nucleic acid bases or other modified nucleic acid bases are known in the art. For example, inosine can pair with adenosine, cytosine, or uracil. Complementary oligonucleotides and / or nucleic acids do not require nucleic acid base complementarity at each nucleoside; rather, some mismatches are acceptable. As used herein, “fully complementary” or “100% complementary” with respect to an oligonucleotide means that the oligonucleotide is complementary to another oligonucleotide or nucleic acid at each nucleoside of the oligonucleotide.
[0034] As used herein, “conjugate group” means an atomic group that is directly bonded to an oligonucleotide. A conjugate group includes a conjugate moiety and a conjugate linker that bonds the conjugate moiety to an oligonucleotide.
[0035] As used herein, “conjugate linker” means a group of atoms containing at least one bond that connects a single bond or conjugate portion to an oligonucleotide.
[0036] As used herein, “conjugated portion” means a group of atoms bonded to an oligonucleotide via a conjugate linker.
[0037] As used herein, “consecutive” in the context of oligonucleotides refers to nucleosides, nucleic acid bases, sugar moieties, or internucleoside bonds that are directly adjacent to each other. For example, “consecutive nucleic acid bases” means nucleic acid bases that are directly adjacent to each other in a sequence.
[0038] As used herein, “restricted ethyl,” “cEt,” or “cEt-modified sugar moiety” means a β-D-ribosyl bicyclic sugar moiety in which the second ring of the bicyclic sugar is formed by a crosslink connecting the 4'-carbon and 2'-carbon of the β-D-ribosyl sugar moiety, and this crosslink has the formula: 4'-CH(CH3)-O-2', with the methyl group of the crosslink in the S configuration.
[0039] As used herein, "cEt nucleoside" means a nucleoside containing a cEt-modified sugar moiety.
[0040] As used herein, “chiral-enriched population” means a group of molecules of the same molecular formula in which the number or proportion of molecules having a particular stereochemical configuration at a particular chiral center is greater than the number or proportion of molecules in the population that would be expected to have the same particular stereochemical configuration at the same particular chiral center if that particular chiral center were stereorandom. A chiral-enriched population of molecules having multiple chiral centers in each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecule is a modified oligonucleotide. In certain embodiments, the molecule is an oligomeric compound containing a modified oligonucleotide.
[0041] As used herein, “double-stranded” means a double helix formed by complementary strands of nucleic acids (including, but not limited to, oligonucleotides) that are hybridized with each other. In certain embodiments, the two strands of a double-stranded region are separate molecules. In certain embodiments, the two strands are regions of the same molecule folded on top of itself (e.g., a hairpin structure).
[0042] As used herein, “double helix” or “double helix region” means a structure formed by two oligonucleotides or portions thereof that hybridize with one another.
[0043] As used herein, “gapmer” means a modified oligonucleotide comprising an internal region having multiple nucleosides supporting RNase H cleavage positioned between external regions having one or more nucleosides, wherein at least one of the nucleosides comprising the internal region is chemically distinct from at least one nucleoside of each external region. Specifically, the nucleosides defining the boundary between the internal region and each external region must be chemically distinct. The internal region may be referred to as a “gap,” and the external region may be referred to as a “wing.” Unless otherwise indicated, “gapmer” refers to a sugar motif. In certain embodiments, the sugar moiety of each nucleoside in the gap is a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the gap comprises one 2'-substituted nucleoside at position 1, 2, 3, 4, or 5 of the gap, and the remainder of the nucleosides in the gap are 2'-β-D-deoxynucleosides. Unless otherwise indicated, a gapmer is one or more modified nucleosides The molecule may contain rheoside bonds and / or modified nucleic acid bases, and such modifications do not necessarily follow the gapmer pattern of sugar modifications.
[0044] As used herein, “hotspot region” refers to a range of nucleic acid bases on a target nucleic acid that is prone to oligomer compound-mediated reduction in the amount or activity of the target nucleic acid.
[0045] As used herein, “hybridization” means the pairing or annealing of complementary oligonucleotides and / or nucleic acids. While not limited to any particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonds between complementary nucleic acid bases.
[0046] As used herein, “nucleoside bond” refers to a covalent bond between adjacent nucleosides in an oligonucleotide. As used herein, “modified nucleoside bond” refers to any nucleoside bond other than a phosphodiester nucleoside bond. “Phosphothioate nucleoside bond” is a modified nucleoside bond in which one of the non-bridged oxygen atoms of a phosphodiester nucleoside bond is replaced with a sulfur atom.
[0047] As used herein, “linker nucleoside” means a nucleoside that directly or indirectly binds an oligonucleotide to the conjugate moiety. Linker nucleosides are located within the conjugate linker of a compound. Linker nucleosides are not considered part of the oligonucleotide moiety of an oligomeric compound, even if they are contiguous with the oligonucleotide.
[0048] As used herein, “non-bicyclic modified sugar moiety” means a modified sugar moiety that includes modifications such as substituents that do not form a bridge between the two atoms of the sugar to form a second ring.
[0049] As used herein, “mismatch” or “non-complementary” means a nuclear base of the first nucleic acid sequence that is not complementary to the corresponding nucleic acid base of the second nucleic acid sequence or the target nucleic acid when the first and second nucleic acid sequences are aligned.
[0050] As used herein, “motif” means the pattern of unmodified and / or modified sugar moieties, nucleic acid bases, and / or nucleoside bonds in an oligonucleotide.
[0051] As used herein, “neurodegenerative disease” or “neurodegenerative disorder” means a condition characterized by a progressive loss of function or structure, including loss of nerve function and death of neurons. In certain embodiments, neurodegenerative disease is Alzheimer’s disease. In certain embodiments, neurodegenerative disease is sporadic Alzheimer’s disease. In certain embodiments, neurodegenerative disease is hereditary / familial Alzheimer’s disease. In certain embodiments, neurodegenerative disease is Alzheimer’s disease in patients with Down syndrome. In certain embodiments, neurodegenerative disease is cerebral amyloid angiopathy.
[0052] As used herein, “nucleic acid base” means either an unmodified or modified nucleic acid base. A nucleic acid base is a heterocyclic moiety. As used herein, “unmodified nucleic acid base” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, “modified nucleic acid base” is an atomic group other than unmodified A, T, C, U, or G that can form pairs with at least one other nucleic acid base. “5-methylcytosine” is a modified nucleic acid base. There are five types of universal bases. It is a nucleic acid base that can pair with any one of the unmodified nucleic acid bases.
[0053] As used herein, “nucleic acid sequence” means a sequence of consecutive nucleic acid bases unrelated to any sugar or nucleoside bond modifications.
[0054] As used herein, "nucleoside" means a compound or fragment of a compound comprising a nucleic acid base and a sugar moiety. The nucleic acid base and sugar moiety may be independent, unmodified, or modified.
[0055] As used herein, “modified nucleoside” means a nucleoside containing a modified nucleic acid base and / or a modified sugar moiety.
[0056] As used herein, “bound nucleoside” refers to nucleosides connected in a contiguous sequence (i.e., there are no additional nucleosides between the bound ones).
[0057] As used herein, “oligomer compound” means an oligonucleotide and, optionally, one or more additional features such as a conjugated group or terminal group. An oligomer compound may or may not be paired with a second oligomer compound complementary to a first oligomer compound. A “single-stranded oligomer compound” is an unpaired oligomer compound. The term “oligomer double-stranded” means a double-stranded structure formed by two oligomer compounds having complementary nucleic acid base sequences. Each oligomer compound in an oligomer double-stranded structure may be referred to as a “double-stranded oligomer compound.”
[0058] As used herein, “oligonucleotide” means a polymer or chain of bound nucleosides linked via nucleoside bonds, where each nucleoside and nucleoside bond may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8 to 50 bound nucleosides. Oligonucleotides may or may not pair with a second oligonucleotide complementary to the oligonucleotide. A “single-stranded oligonucleotide” is an unpaired oligonucleotide. A “double-stranded oligonucleotide” is an oligonucleotide that pairs with a second oligonucleotide. An “oligonucleotide double helix” means a double helix formed by two paired oligonucleotides having complementary nucleic acid base sequences. Each oligo in an oligonucleotide double helix is a “double-stranded oligonucleotide” or “double-stranded oligonucleotide”.
[0059] As used herein, “modified oligonucleotide” means an oligonucleotide in which at least one nucleoside or nucleoside bond has been modified. As used herein, “unmodified oligonucleotide” means an oligonucleotide that does not contain any nucleoside modifications or nucleoside modifications. Thus, each nucleoside of an unmodified oligonucleotide is a DNA or RNA nucleoside, and each nucleoside bond is a phosphodiester bond.
[0060] As used herein, “pharmaceutically acceptable carrier or diluent” means any substance suitable for use in administration to animals. Such particular carriers enable the formulation of pharmaceutical compositions for oral administration by subjects, such as tablets, pills, sugar-coated tablets, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges. In certain embodiments, the pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer, or sterile artificial cerebrospinal fluid.
[0061] As used herein, “pharmaceutically acceptable salt” means a physiologically and pharmaceutically acceptable salt of a compound. A pharmaceutically acceptable salt retains the desired biological activity of the parent compound and does not have any undesirable toxicological effects.
[0062] As used herein, “pharmaceutical composition” means a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition may include an oligomeric compound and a sterile aqueous solution. In certain embodiments, the pharmaceutical composition exhibits activity in a free uptake assay in a specific cell line.
[0063] As used herein, “prodrug” means a first form of therapeutic agent that is in vitro and converted to a second form within an animal or its cells. Typically, the conversion of a prodrug in an animal is facilitated by the action of enzymes (e.g., endogenous or viral enzymes) or chemicals present in cells or tissues, and / or by physiological conditions. In certain embodiments, the first form of the prodrug is less active than the second form.
[0064] As used herein, “reduction or inhibition of quantity or activity” means a reduction or blockage of transcriptional expression or activity compared to the transcriptional expression or activity of an untreated or control sample, and does not necessarily mean a complete elimination of transcriptional expression or activity.
[0065] As used herein, “RNase H compound” means an antisense compound that acts at least partially via RNase H to modulate a target nucleic acid and / or the protein encoded by the target nucleic acid. In certain embodiments, the RNase H compound is single-stranded. In certain embodiments, the RNase H compound is double-stranded. The RNase H compound may contain a conjugate group and / or terminal groups. In certain embodiments, the RNase H compound modulates the amount or activity of the target nucleic acid. The term RNase H compound excludes antisense compounds that act primarily via RISC / Ago2.
[0066] As used herein, “antisense RNase H oligonucleotide” means an oligonucleotide comprising a region that is complementary to the target sequence and contains at least one chemical modification suitable for nucleic acid reduction by RNase H.
[0067] As used herein, “RNAi agent” means an antisense compound that acts to modulate a target nucleic acid and / or the protein encoded by the target nucleic acid, at least in part via RISC or Ago2. RNAi agents include, but are not limited to, double-stranded siRNA, single-stranded RNA (ssRNA), and microRNAs, including microRNA mimetic compounds. RNAi agents may include conjugate groups and / or terminal groups. In certain embodiments, the RNAi agent modulates the quantity or activity of the target nucleic acid. The term RNAi agent excludes antisense compounds that act via RNaseH.
[0068] As used herein, “RNAi oligonucleotide” means either an antisense RNAi oligonucleotide or a sense RNAi oligonucleotide.
[0069] As used herein, “antisense RNAi oligonucleotide” means an oligonucleotide that is complementary to the target sequence and contains a region having at least one chemical modification suitable for RNAi.
[0070] As used herein, "sense RNAi oligonucleotide" is complementary to the region of an antisense RNAi oligonucleotide, and such antisense RNAi oligo This refers to oligonucleotides that contain a region capable of forming a double helix with ligonucleotides. The double helix formed by antisense RNAi oligonucleotides and sense RNAi oligonucleotides is called a double-stranded RNAi agent (dsRNAi) or short interfering RNA (siRNA).
[0071] As used herein with respect to oligonucleotides, “self-complementary” means an oligonucleotide that hybridizes at least partially with itself.
[0072] As used herein, “single-stranded” means nucleic acids (including, but not limited to, oligonucleotides) that are not paired and are not part of a double helix. Single-stranded compounds can hybridize with complementary nucleic acids to form a double helix, at which point they are no longer single-stranded.
[0073] As used herein, “stabilized phosphate group” means a 5'-phosphate analog that is metabolically more stable than the naturally occurring 5'-phosphate on DNA or RNA.
[0074] As used herein, “standard cell assay” means the assay described in Examples 1-3 or 5 and reasonable variations thereof.
[0075] As used herein, “stereorandom chiral center” in the context of a group of molecules of the same molecular formula means a chiral center having a random stereochemical configuration. For example, in a group of molecules containing stereorandom chiral centers, the number of molecules having the (S) configuration of the stereorandom chiral center may be the same as, but not necessarily the same as, the number of molecules having the (R) configuration of the stereorandom chiral center. The stereochemical configuration of a chiral center is considered random if it is the result of a synthetic method not designed to control the stereochemical configuration. In certain embodiments, the stereorandom chiral center is a stereorandom phosphorothioate nucleoside bond.
[0076] As used herein, “subject” means a human or a non-human animal. The terms “subject” and “individual” are used synonymously. In certain embodiments, the subject is a human.
[0077] As used herein, “sugar moiety” means an unmodified sugar moiety or a modified sugar moiety. As used herein, “unmodified sugar moiety” means a 2'-OH(H) ribosyl moiety found in RNA (“unmodified RNA sugar moiety”) or a 2'-H(H) deoxyribosyl sugar moiety found in DNA (“unmodified DNA sugar moiety”). An unmodified sugar moiety has one hydrogen atom at each of the 1', 3', and 4' positions, one oxygen atom at the 3' position, and two hydrogen atoms at the 5' position. As used herein, “modified sugar moiety” or “modified sugar” means a modified furanosyl sugar moiety or sugar surrogate.
[0078] As used herein, “sugar surrogate” means a modified sugar moiety having a furanosyl moiety other than a nucleoside bond, conjugate group, or terminal group in an oligonucleotide that can bond a nucleic acid base to another group in the oligonucleotide. Modified nucleosides containing sugar surrogates can be conjugated at one or more positions in an oligonucleotide, and such oligonucleotides can hybridize to complementary oligomeric compounds or target nucleic acids.
[0079] As used herein, “symptoms or characteristics” means any physical characteristics or test results indicating the presence or degree of a disease or disorder. In particular embodiments, symptoms are evident to the subject or to a medical professional examining or testing the subject. In this state, the characteristics are revealed by invasive diagnostic tests, including but not limited to post-mortem examinations.
[0080] As used herein, “target nucleic acid” and “target RNA” mean nucleic acids designed to be affected by an antisense compound. Target RNA means RNA transcripts and includes premRNA and mRNA unless otherwise specified.
[0081] As used herein, “target region” means the portion of a target nucleic acid designed for the oligomeric compound to hybridize.
[0082] As used herein, “end group” means a chemical group or atomic group covalently bonded to the end of an oligonucleotide.
[0083] As used herein, “therapeutic dose” means the amount of a medicinal agent or composition that produces a therapeutic effect in an animal. For example, a therapeutic dose is the amount that improves the symptoms of a disease.
[0084] As used herein, “to treat” means to improve the disease or disorder of interest by administering the oligomeric agent or oligomeric compound described herein. In certain embodiments, treatment of the subject results in improvement of the symptoms compared to the same symptoms without treatment. In certain embodiments, treatment is a reduction in the severity or frequency of symptoms, or a delay in the onset of symptoms, a slowing of the progression of symptoms, or a slowing of the severity or frequency of symptoms.
[0085] Specific Embodiments This disclosure provides the following non-limiting numbered embodiments.
[0086] Embodiment 1. An oligomer compound comprising a modified oligonucleotide consisting of 12 to 30 bound nucleosides, wherein the nucleic acid base sequence of the modified oligonucleotide is at least 80% complementary to the isolength portion of APP nucleic acid, and the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified nucleoside bond.
[0087] Embodiment 2. An oligomer compound comprising a modified oligonucleotide consisting of 12 to 30 bound nucleosides, wherein the nucleic acid base sequence of the modified oligonucleotide contains at least 12, at least 13, at least 14, at least 15, or 16 consecutive nucleic acid bases from any of the nucleic acid base sequences of SEQ ID NOs. 2543 to 2572, and the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified nucleoside bond.
[0088] Embodiment 3. An oligomer compound comprising a modified oligonucleotide consisting of 12 to 30 bound nucleosides, wherein the nucleic acid base sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleic acid bases from the nucleic acid base sequences of SEQ ID NOs. 30 to 2542 or 2573 to 3057, and the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified nucleoside bond.
[0089] Embodiment 4. An oligomer compound comprising a modified oligonucleotide consisting of 12 to 30 bound nucleosides, wherein the nucleic acid base sequence of the modified oligonucleotide is The equal-length portion of nucleic acid bases 6193-6245 in Sequence ID No. 2, The equal-length portion of nucleic acid bases 9622-9656 in sequence number 2, The equal-length portion of nucleic acid bases 10203-10249 in sequence number 2, The equal-length portion of nucleic acid bases 11246-11287 in Sequence ID No. 2, The equal-length portion of nucleic acid bases 12566-12609 in Sequence ID No. 2, The equal-length portion of nucleic acid bases 22914-22964 in sequence number 2, The isoformed portion of nucleic acid bases 154394-154420 in sequence number 2, The equal-length portion of nucleic acid bases 154736-154760 in Sequence ID No. 2, The isoformed portion of nucleic acid bases 158598-158982 in Sequence ID No. 2, The isoformed portion of nucleic acid bases 159558-159581 in Sequence ID No. 2, The equal-length portion of nucleic acid bases 220028-220077 in Sequence ID No. 2, The isoformed portion of nucleic acid bases 220237-220426 in Sequence ID No. 2, The equal-length portion of nucleic acid bases 220710 to 220766 in Sequence ID No. 2, The isoformed portion of nucleic acid bases 220893-220919 in sequence number 2, The isoformed portion of nucleic acid bases 221002-221025 in Sequence ID No. 2, The isoformed portion of nucleic acid bases 221138-221177 in sequence number 2, The equal-length portion of nucleic acid bases 221315-221364 in Sequence ID No. 2, The isoformed portion of nucleic acid bases 222414~222478 in Sequence ID No. 2, The isoformed portion of nucleic acid bases 222548-222590 in Sequence ID No. 2, The isoformed portion of nucleic acid bases 222663-222697 in Sequence ID No. 2, The isoformed portion of nucleic acid bases 222764-222791 in Sequence ID No. 2, The equal-length portion of nucleic acid bases 225366 to 225400 in Sequence ID No. 2, The isoformed portion of nucleic acid bases 226497-226532 in Sequence ID No. 2, The isoformed portion of nucleic acid bases 229282-229306 in Sequence ID No. 2, The equal-length portion of nucleic acid bases 231282-231310 in sequence number 2, The isoformed portion of nucleic acid bases 234328-234370 in Sequence ID No. 2, The isoformed portion of nucleic acid bases 234802-234827 in Sequence ID No. 2, The equal-length portion of nucleic acid bases 34556-34575 in Sequence ID No. 2, The equal-length portion of nucleic acid bases 101718-101737 in sequence number 2, The isoformed portion of nucleic acid bases 158795-158814 in Sequence ID No. 2, or The oligomer compound is complementary to at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleic acid bases in the isolength portion of nucleic acid bases 292896 to 292922 of Sequence ID No. 2.
[0090] The oligomer compound wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified nucleoside bond.
[0091] Embodiment 5. Consists of 12 to 30 bonded nucleosides, Sequence IDs: 140, 1240, 1279, 1402, 1437; Sequence IDs: 116, 202, 626; Sequence IDs: 830, 912, 962, 1049, 1164, 1236; Sequence IDs: 201, 1741, 1870; Sequence IDs: 273, 744, 824, 898, 1025; Sequence IDs: 296, 384, 1568, 1617, 1701, 1734, 1841; Sequence IDs: 1553, 1593, 1709, 1805, 1873; Sequence IDs: 340, 519, 590, 711, 795, 819; Sequence IDs: 178, 547, 577, 693, 769, 846, 2225, 2480, 3047~3050; Sequence IDs: 200, 1688, 1740, 1820, 1906; Sequence IDs: 2576, 2493, 2660, 2708, 2790, 2806, 2854 , 2900, 2903, 2993, 3013; Sequence IDs: 2590, 2690, 2691, 2760, 2808, 2939, 3002; Sequence IDs: 2580, 2652, 2728, 2772, 2866, 2874, 2931, 3012; Sequence IDs: 2619, 2671, 2783, 2812, 2875, 2929; Sequence IDs: 2638, 2649, 2676, 2753, 2757, 2804, 2932, 2983; Sequence IDs: 2575, 2848, 2890, 2965; Sequence IDs: 2583, 2654, 2748, 2823, 2882; Sequence IDs: 1557, 1613, 1696, 2592, 2699, 2713, 2775, 2844, 2879, 2977, 2986; Sequence IDs: 338, 2574, 2642, 2666, 2689, 2740, 2754, 2847, 2859, 2899, 2950, 2987, 3014; Sequence IDs: 2641, 2675, 2799, 2856, 2933, 2974; Sequence IDs: 2610, 2780, 2851, 2943, 2956; Sequence IDs: 2766, 2855, 2925, 2988; Sequence IDs: 2645, 2715, 2727, 2787, 2842, 2843, 2938, 2940, 2967, 2978; Sequence IDs: 299, 2632, 3020; Sequence IDs: 2591, 2705, 2747, 2865, 2941, 3010; Sequence IDs: 2621, 2629, 2679, 2687, 2735, 2788, 2864, 2912, 2966; Sequence IDs: 2701, 2742, 2828, 2908; Sequence IDs: 2611, 2717, 2979; or, An oligomer compound comprising a modified oligonucleotide having a nucleic acid base sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleic acid bases of a sequence selected from SEQ ID NOs: 35, 411, 482, The oligomer compound wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified nucleoside bond.
[0092] Embodiment 6. The oligomer compound according to any one of Embodiments 1 to 5, wherein, when measured over the entire nucleic acid base sequence of the modified oligonucleotide, the modified oligonucleotide has a nucleic acid base sequence that is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to any of the nucleic acid base sequences of SEQ ID NOs: 1 to 8.
[0093] Embodiment 7. The oligomeric compound according to any one of Embodiments 1 to 6, wherein at least one nucleoside of the modified oligonucleotide is a modified nucleoside.
[0094] Embodiment 8. The oligomeric compound according to Embodiment 7, wherein the modified oligonucleotide contains at least one modified nucleoside containing a modified sugar moiety.
[0095] Embodiment 9. The oligomeric compound according to Embodiment 8, wherein the modified oligonucleotide contains at least one modified nucleoside containing a bicyclic modified sugar moiety.
[0096] Embodiment 10. The oligomeric compound according to Embodiment 9, wherein the bicyclic modified sugar moiety contains a 2'-4' bridge, and the 2'-4' bridge is selected from -O-CH2 and -O-CH(CH3)-. oligomeric compound.
[0097] Embodiment 11. The oligomeric compound according to any one of Embodiments 6 to 10, wherein the modified oligonucleotide contains at least one modified nucleoside containing an acyclic modified sugar moiety.
[0098] Embodiment 12. The oligomeric compound according to Embodiment 8, wherein the modified oligonucleotide contains at least one modified nucleoside containing a bicyclic modified sugar moiety having a 2'-4' bridge and at least one modified nucleoside containing an acyclic modified sugar moiety.
[0099] Embodiment 13. The oligomeric compound according to Embodiment 11 or 12, wherein the acyclic modified sugar moiety is a 2'-MOE sugar moiety or a 2'-OMe sugar moiety.
[0100] Embodiment 14. The oligomeric compound according to any one of Embodiments 1 to 13, wherein the modified oligonucleotide contains at least one modified nucleoside containing a sugar substitute.
[0101] Embodiment 15. The oligomer compound according to Embodiment 14, wherein at least one modified nucleoside of the modified oligonucleotide comprises a sugar substitute selected from morpholino and PNA.
[0102] Embodiment 16. The oligomer compound according to any one of Embodiments 1 to 8, 11, or 13 to 15, wherein the modified oligonucleotide does not contain a bicyclic sugar moiety.
[0103] Embodiment 17. The oligomer compound according to any one of Embodiments 1 to 16, wherein the modified oligonucleotide comprises at least one modified nucleoside bond.
[0104] Embodiment 18. The oligomer compound according to Embodiment 17, wherein each nucleoside bond in the modified oligonucleotide is a modified nucleoside bond.
[0105] Embodiment 19. The oligomer compound according to Embodiment 17 or Embodiment 18, wherein at least one nucleoside bond is a phosphorothioate nucleoside bond.
[0106] Embodiment 20. The oligomer compound according to Embodiment 16 or 17, wherein at least one nucleoside bond is a mesylphosphoramide nucleoside bond.
[0107] Embodiment 21. The oligomer compound according to Embodiments 17 or 19-20, wherein the modified oligonucleotide comprises at least one phosphodiester nucleoside interbonding linkage.
[0108] Embodiment 22. The oligomer compound according to any one of Embodiments 17, 19, or 21, wherein each nucleoside bond is independently selected from phosphodiester nucleoside bonds or phosphorothioate nucleoside bonds.
[0109] Embodiment 23. An oligomeric compound according to any one of Embodiments 17, 19, or 20 - 21, wherein each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage, a phosphorothioate internucleoside linkage, and a mesylphosphoramidate internucleoside linkage.
[0110] Embodiment 24. An oligomeric compound according to any one of Embodiments 1 - 17 or 19 - 21 or 23, wherein at least one, at least two, at least three, at least four, or at least five internucleoside linkages of the modified oligonucleotide are mesylphosphoramidate internucleoside linkages. or 23.
[0111] Embodiment 25. An oligomeric compound according to any one of Embodiments 1 - 24, wherein the modified oligonucleotide contains a modified nucleobase.
[0112] Embodiment 26. An oligomeric compound according to Embodiment 25, wherein the modified nucleobase is 5 - methylcytosine.
[0113] Embodiment 27. An oligomeric compound according to any one of Embodiments 1 - 26, wherein the modified oligonucleotide consists of 12 - 22, 12 - 20, 14 - 18, 14 - 20, 15 - 17, 15 - 25, 16 - 20, 16 - 18, or 18 - 20 linked nucleosides.
[0114] Embodiment 28. An oligomeric compound according to any one of Embodiments 1 - 27, wherein the modified oligonucleotide consists of 16 linked nucleosides.
[0115] Embodiment 29. A compound according to any one of Embodiments 1 - 27, wherein the modified oligonucleotide consists of 20 linked nucleosides.
[0116] Embodiment 30. An oligomeric compound according to any one of Embodiments 1 - 29, wherein the modified oligonucleotide is a gapmer.
[0117] Embodiment 31. The modified oligonucleotide is A 5'-region consisting of 1 to 6 bonded 5'-region nucleosides, A central region consisting of 6 to 10 binding central region nucleosides, and It has a sugar motif containing a 3'-region consisting of 1 to 6 bonded 3'-region nucleosides, The nucleoside on the 3' side of the 5' region and the nucleoside on the 5' side of the 3'- region contain a modified sugar moiety. The oligomer compound according to any one of Embodiments 1 to 29, wherein each of the central region nucleosides is selected from a nucleoside containing a 2'-β-D-deoxyribosyl sugar moiety and a nucleoside containing a 2'-substituted sugar moiety, and the central region comprises at least six nucleosides containing a 2'-β-D-deoxyribosyl sugar moiety and two or fewer nucleosides containing a 2'-substituted sugar moiety.
[0118] Embodiment 32. The oligomer compound according to Embodiment 29, wherein each of the central region nucleosides is a 2'-β-D-deoxynucleoside.
[0119] Embodiment 33. The modified oligonucleotide is A 5'-region consisting of 6 bonded 5'-region nucleosides, A central region consisting of 10 binding central region nucleosides, and It has a sugar motif containing a 3'-region consisting of four bonded 3'-region nucleosides, The oligomer compound according to Embodiment 30 or Embodiment 31, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides is a 2'-MOE nucleoside, and each of the central region nucleosides is a 2'-β-D-deoxynucleoside.
[0120] Embodiment 34. The modified oligonucleotide is A 5'-region consisting of 5 bonded 5'-region nucleosides, A central region consisting of 10 binding central region nucleosides, and It has a sugar motif containing a 3'-region consisting of five bonded 3'-region nucleosides, The oligomer compound according to Embodiment 30 or Embodiment 31, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides is a 2'-MOE nucleoside, and each of the central region nucleosides is a 2'-β-D-deoxynucleoside.
[0121] Embodiment 35. The modified oligonucleotide is A 5'-region consisting of three bonded 5'-region nucleosides, A central region consisting of 10 binding central region nucleosides, and It has a sugar motif containing a 3'-region consisting of three bonded 3'-region nucleosides, The oligomer compound according to Embodiment 30 or Embodiment 31, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides is a cEt nucleoside, and each of the central region nucleosides is a 2'-β-D-deoxynucleoside.
[0122] Embodiment 36. The modified oligonucleotide is A 5'-region consisting of three bonded 5'-region nucleosides, A central region consisting of 10 binding central region nucleosides, and It has a sugar motif containing a 3'-region consisting of three bonded 3'-region nucleosides, Each of the 5'-region nucleosides and each of the 3'-region nucleosides are cEt nucleosides. The oligomer compound according to Embodiment 30, wherein the central region has the following formula: (Nd)(Nx)(Nd)n, (wherein Nx is a 2'-OMe nucleoside, each Nd is a 2'-β-D-deoxynucleoside, and n is 8).
[0123] Embodiment 37. An oligomer compound according to any one of Embodiments 1 to 36, wherein the modified oligonucleotide has an internucleoside linkage motif selected from soossssssssssos, soooosssssssssssss, soooosssssssssssssss, soooossssssssssssss, soooossssssssssssooos or ssoosssssssssssss (where s is a phosphorothioate internucleoside linkage and o is a phosphodiester internucleoside linkage).
[0124] Embodiment 38. The differential endpoint is soosissssssssos, sooozsisssssssos, sooozsisissssssos, sooozsisisssssos, zoosisisissssssoz, sooosssssssssos, sooossssssssssos, sooooosisssssssssos, sooooooosissssssssoss, soooooozsissssssssoss, soooooozsisissssssoss, soooooozsisissssssoss, zooooooosisissssssosi, soooooosssssssssoss, soooooosssssssssoss, soooooosssssssssoss An oligomer compound according to any one of Embodiments 1 to 36, having an internucleoside bonding motif selected from ssssszzss, soooszzsssssssssooss, soooszzzssssssssooss, soooszzzzzssssssooss, soooszzzzssssssoozz, sooosssssssssssooss, sooosssssssssssooss, and sooossssssssssszzoss (where s is a phosphorothioate internucleoside bond, o is a phosphodiester internucleoside bond, and z is a mesylphosphoramide internucleoside bond).
[0125] Embodiment 39. An oligomer compound according to any one of Embodiments 1 to 38, comprising the modified oligonucleotide.
[0126] Embodiment 40. An oligomer compound according to any one of Embodiments 1 to 38, further comprising a conjugate group.
[0127] Embodiment 41. The oligomer compound according to Embodiment 40, wherein the conjugate group comprises a conjugate moiety and a conjugate linker.
[0128] Embodiment 42. The oligomer compound according to Embodiment 41, wherein the conjugate linker consists of a single bond.
[0129] Embodiment 43. The oligomer compound according to Embodiment 41 or Embodiment 42, wherein the conjugate linker is cleavable.
[0130] Embodiment 44. The oligomer compound according to Embodiment 41, wherein the conjugate linker contains 1 to 3 linker nucleosides.
[0131] Embodiment 45. The oligomer compound according to any one of Embodiments 40 to 44, wherein the conjugate group is bonded to the modified oligonucleotide at the 5' end of the modified oligonucleotide.
[0132] Embodiment 46. The oligomer compound according to any one of Embodiments 40 to 44, wherein the conjugate group is bonded to the modified oligonucleotide at the 3' end of the modified oligonucleotide.
[0133] Embodiment 47. An oligomer compound according to any one of Embodiments 1 to 38 or 40 to 45, comprising a terminal group.
[0134] Embodiment 48. An oligomer compound according to any one of Embodiments 1 to 47, which is a single-chain oligomer compound.
[0135] Embodiment 49. An oligomer compound according to any one of Embodiments 1 to 43 or 45 to 48, which does not contain a linker nucleoside.
[0136] Embodiment 50. An oligomeric double chain comprising the oligomeric compound described in any of Embodiments 1 to 47 or 49.
[0137] Embodiment 51. An oligomer compound comprising a modified oligonucleotide consisting of 12 to 30 bound nucleosides, wherein the nucleic acid base sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 nucleic acid bases from any of SEQ ID NOs. 3058 to 3063, and the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified nucleoside bond.
[0138] Embodiment 52. An oligomer double-chain comprising a first oligomer compound comprising a first modified oligonucleotide and a second oligomer compound comprising a second modified oligonucleotide, wherein the first oligomer compound is the oligomer compound of Embodiment 51.
[0139] Embodiment 53. At least one nucleotide of the first modified oligonucleotide is a modification selected from the 2'-OMe sugar moiety, the 2'-F sugar moiety, and the 2'-MOE sugar moiety. An oligomer double chain according to Embodiment 52, comprising a sugar portion.
[0140] Embodiment 54. The oligomer double-stranded molecule according to Embodiment 53, wherein the first modified oligonucleotide consists of 23 bound nucleosides and has a sugar motif of efyyyyyyyyyyyfyfyyyyyyy, where each "e" represents a 2'-MOE sugar moiety, each "f" represents a 2'-F sugar, and each "y" represents a 2'-OMe sugar moiety.
[0141] Embodiment 55. The oligomeric double chain according to any one of Embodiments 52 to 54, wherein the first modified oligonucleotide comprises a 5'-stabilized phosphate group.
[0142] Embodiment 56. The oligomer double chain according to Embodiment 55, wherein the 5'-stabilizing phosphate group is a 5'-vinylphosphonate.
[0143] Embodiment 57. The oligomer double-stranded molecule according to Embodiments 52-56, wherein the first modified oligonucleotide consists of 23 bound nucleosides and has an internucleoside linkage motif of ssooooooooooooooooooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.
[0144] Embodiment 58. The oligomer double-stranded molecule according to Embodiments 52-56, wherein the second modified oligonucleotide consists of 12 to 30 bound nucleosides and includes a complementary region of at least 12 nucleosides that is at least 90% complementary to the nucleic acid bases of the isolength region of the first modified oligonucleotide.
[0145] Embodiment 59. The oligomer double strand according to Embodiment 58, wherein the complementary region consists of 21 nucleosides.
[0146] Embodiment 60. The oligomer duplex according to Embodiment 58 or Embodiment 59, wherein the complementary region is at least 95% or 100% complementary to the equilength portion of the first modified oligonucleotide.
[0147] Embodiment 61. The oligomer double-chain according to any one of Embodiments 58 to 60, wherein at least one nucleoside of the second modified oligonucleotide comprises a 2'-OMe sugar moiety, a 2'-F sugar moiety, or a 2'-MOE sugar moiety.
[0148] Embodiment 62. The oligomer double-stranded according to any one of Embodiments 52 to 61, wherein the second modified oligonucleotide consists of 21 bound nucleosides and has a sugar motif of yyyyyyfyfffyyyyyyyyyy, where each "f" represents a 2'-F sugar moiety and each "y" represents a 2'-OMe sugar moiety.
[0149] Embodiment 63. The oligomer double chain according to any one of Embodiments 52 to 62, wherein the second oligomer compound contains a conjugate group. Embodiment 64. The oligomeric double chain of Embodiment 63, wherein the second oligomeric compound contains a conjugate group linked via a modified phosphoramide nucleoside bond.
[0150] Embodiment 65. The conjugate group is C 12 ~C 20 Alkyl oligomer double chain of Embodiment 63 or Embodiment 64.
[0151] Embodiment 66. The conjugate group is C 16 An alkyl oligomeric double chain of any of embodiments 63 to 65.
[0152] Embodiment 67. The oligomer double-stranded molecule according to any one of Embodiments 63 to 66, wherein the second modified oligonucleotide consists of 21 bound nucleosides and has a nucleoside-to-nucleoside linkage motif of ssooo[C16muP]ooooooooooooss, where each "o" represents a phosphodiester nucleoside linkage, each "s" represents a phosphorothioate nucleoside linkage, and each "[C16muP]" represents the modified phosphoramide nucleoside linkage shown below:
[0153] [ka]
[0154] Embodiment 68. An antisense compound comprising or consisting of an oligomeric compound described in any of Embodiments 1 to 49 or 51, or an oligomeric double chain described in any of Embodiments 50 or 53 to 67.
[0155] Embodiment 69. A chiralally concentrated population of oligomeric compounds according to any one of Embodiments 1 to 49 or 51, wherein the population is concentrated with respect to modified oligonucleotides comprising at least one specific phosphorothioate nucleoside bond having a specific stereochemical configuration.
[0156] Embodiment 70. The chiralally enriched population according to Embodiment 69, wherein the population is enriched with respect to modified oligonucleotides containing at least one specific phosphorothioate nucleoside bond having a (Sp) configuration.
[0157] Embodiment 71. The chiralally enriched population according to Embodiment 69, wherein the population is enriched with respect to modified oligonucleotides containing at least one specific phosphorothioate nucleoside bond having a (Rp) configuration.
[0158] Embodiment 72. The chiralally enriched population according to Embodiment 69, wherein the population is enriched with respect to modified oligonucleotides having a specific, independently selected stereochemical configuration in each phosphorothioate nucleoside bond.
[0159] Embodiment 73. The chiralally enriched population according to Embodiment 72, wherein the population is enriched with modified oligonucleotides having a (Rp) configuration in one specific phosphorothioate nucleoside bond and a (Sp) configuration in each of the remaining phosphorothioate nucleoside bonds.
[0160] Embodiment 74. The chiralally enriched population according to Embodiment 72, wherein the population is enriched with respect to modified oligonucleotides having at least three consecutive phosphorothioate nucleoside bonds in Sp configuration, Sp configuration, and Rp configuration in the 5' to 3' direction.
[0161] Embodiment 75. A group of oligomer compounds according to any one of Embodiments 1 to 49 or 51, wherein the phosphorothioate nucleoside interbonding of the modified oligonucleotide The aforementioned group, in which all combinations are stereorandom.
[0162] Embodiment 76. A pharmaceutical composition comprising an oligomeric compound according to any one of Embodiments 1 to 49 or 51, an oligomeric double-chain according to Embodiments 50 or 52 to 67, an antisense compound according to Embodiment 68, or a group according to any one of Embodiments 69 to 75, and a pharmaceutically acceptable carrier or diluent.
[0163] Embodiment 77. The pharmaceutical composition according to Embodiment 76, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid or phosphate-buffered salt solution (PBS).
[0164] Embodiment 78. The pharmaceutical composition according to Embodiment 77, wherein the pharmaceutical composition essentially comprises the oligomer compound, the oligomer double chain, the antisense compound, or the population and artificial cerebrospinal fluid.
[0165] Embodiment 79. The pharmaceutical composition according to Embodiment 77, wherein the pharmaceutical composition essentially comprises the oligomer compound, the oligomer double chain, the antisense compound, or the group and PBS.
[0166] Embodiment 80. A method comprising administering to an oligomeric compound described in any of Embodiments 1 to 49 or 51, an oligomeric double-chain described in any of Embodiments 50 or 52 to 57, an antisense compound described in Embodiment 68, a population described in any of Embodiments 69 to 75, or a pharmaceutical composition described in any of Embodiments 76 to 79.
[0167] Embodiment 81. A method for treating an APP-related disease or disorder, comprising administering a therapeutically effective amount of an oligomeric compound according to any one of Embodiments 1 to 49 or 51, an oligomeric double-chain according to any one of Embodiments 50 or 52 to 67, an antisense compound according to Embodiment 68, a population according to any one of Embodiments 69 to 75, or a pharmaceutical composition according to any one of Embodiments 76 to 79 to a subject who has or is at risk of developing an APP-related disease or disorder.
[0168] Embodiment 82. The method according to Embodiment 81, wherein the disease associated with APP is sporadic Alzheimer's disease, hereditary / familial Alzheimer's disease, Alzheimer's disease in patients with Down syndrome, or cerebral amyloid angiopathy.
[0169] Embodiment 83. The method according to any one of Embodiments 80 to 82, wherein administration of the oligomer compound described in any one of Embodiments 1 to 49 or 51, the oligomer double-chain described in any one of Embodiments 50 or 52 to 57, the antisense compound described in Embodiment 68, the group described in any one of Embodiments 69 to 75, or the pharmaceutical composition described in any one of Embodiments 76 to 79 improves at least one symptom or feature of a disease or disorder related to APP.
[0170] Embodiment 84. The method according to Embodiment 83, wherein administration of the oligomer compound described in any of Embodiments 1 to 49 or 51, the oligomer double-chain described in any of Embodiments 50 or 52 to 57, the antisense compound described in Embodiment 68, the population described in any of Embodiments 69 to 75, or the pharmaceutical composition described in any of Embodiments 76 to 79 reduces or delays cognitive impairment, reduces or delays decline in memory and language ability, improves behavioral and psychological symptoms, reduces apathy, improves motivation, reduces gait disturbance, reduces seizures, reduces or delays progressive dementia, or reduces abnormal amyloid deposition.
[0171] Embodiment 85. The method according to any one of Embodiments 80 to 84, wherein the APP protein level in the subject is reduced.
[0172] Embodiment 86. A method for reducing the expression of APP in cells, comprising contacting the cells with the oligomeric compound described in any of Embodiments 1 to 49 or 51, the oligomeric double-stranded compound described in any of Embodiments 50 or 52 to 57, the antisense compound described in Embodiment 68, the population described in any of Embodiments 69 to 75, or the pharmaceutical composition described in any of Embodiments 76 to 79.
[0173] Embodiment 87. The method according to Embodiment 86, wherein the cells are cortical brain cells or hippocampal cells.
[0174] Embodiment 88. Use of the oligomer compound described in any of Embodiments 1 to 49 or 51, the oligomer double-chain described in any of Embodiments 50 or 52 to 57, the antisense compound described in Embodiment 68, the group described in any of Embodiments 69 to 75, or the pharmaceutical composition described in any of Embodiments 76 to 79, for the treatment of diseases or disorders related to APP.
[0175] Embodiment 89. Use of the oligomer compound described in any of Embodiments 1 to 49 or 51, the oligomer double-chain described in any of Embodiments 50 or 52 to 57, the antisense compound described in Embodiment 68, the group described in any of Embodiments 69 to 75, or the pharmaceutical composition described in any of Embodiments 76 to 79, for the manufacture of a drug for treating an APP-related disease or disorder.
[0176] Embodiment 90. The use according to Embodiment 88 or 89, wherein the disease associated with the APP is sporadic Alzheimer's disease, hereditary / familial Alzheimer's disease, Alzheimer's disease in patients with Down syndrome, or cerebral amyloid angiopathy.
[0177] Embodiment 91. The method according to any one of Embodiments 80 to 85, wherein the subject is a human.
[0178] Embodiment 92. The method according to Embodiment 86 or 87, wherein the cells are human.
[0179] Embodiment 93. Modified oligonucleotides based on the following chemical structure:
[0180] [ka] (Sequence ID 273), or a salt thereof.
[0181] Embodiment 94. The modified oligonucleotide according to Embodiment 93, which is a sodium salt or a potassium salt.
[0182] Embodiment 95. Modified oligonucleotides based on the following chemical structure:
[0183] [ka] (Sequence ID 273).
[0184] Embodiment 96. Modified oligonucleotides based on the following chemical structure:
[0185] [ka] (Sequence ID 452), or a salt thereof.
[0186] Embodiment 97. The modified oligonucleotide according to Embodiment 96, which is a sodium salt or a potassium salt.
[0187] Embodiment 98. Modified oligonucleotides based on the following chemical structure:
[0188] [ka] (Sequence ID 452).
[0189] Embodiment 99. Modified oligonucleotides based on the following chemical structure:
[0190] [ka] (Sequence ID 462), or a salt thereof.
[0191] Embodiment 100. The modified oligonucleotide according to Embodiment 99, which is a sodium salt or a potassium salt.
[0192] Embodiment 101. Modified oligonucleotides based on the following chemical structure:
[0193] [ka] (Sequence ID 462).
[0194] Embodiment 102. Modified oligonucleotides based on the following chemical structure:
[0195] [ka] (Sequence ID 482), or a salt thereof.
[0196] Embodiment 103. The modified oligonucleotide according to Embodiment 102, which is a sodium salt or a potassium salt.
[0197] Embodiment 104. Modified oligonucleotides based on the following chemical structure:
[0198] [ka] (Sequence ID 482).
[0199] Embodiment 105. Modified oligonucleotides based on the following chemical structure:
[0200] [Chemical formula] (SEQ ID NO: 1064), or a salt thereof.
[0201] Embodiment 106. The modified oligonucleotide according to Embodiment 105, which is a sodium salt or a potassium salt.
[0202] Embodiment 107. A modified oligonucleotide based on the following chemical structure:
[0203] [Chemical formula] (SEQ ID NO: 1064).
[0204] Embodiment 108. A modified oligonucleotide based on the following chemical structure:
[0205] [Chemical formula] (SEQ ID NO: 2225), or a salt thereof.
[0206] Embodiment 109. The modified oligonucleotide according to Embodiment 108, which is a sodium salt or a potassium salt.
[0207] Embodiment 110. A modified oligonucleotide based on the following chemical structure:
[0208] [Chemical formula] (SEQ ID NO: 2225).
[0209] Embodiment 111. The following chemical notation: G es m C eo A eo T eo T es m C ds T ds m C ds Tds T ds A ds T ds A ds T ds T ds m C eo m C eo T es T es A e A modified oligonucleotide based on (SEQ ID NO: 273), During the ceremony, A is an adenine nucleic acid base, m C is the 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, and An oligomeric compound comprising the modified oligonucleotide, wherein o is a phosphodiester nucleoside interbonding bond.
[0210] Embodiment 112. Chemical notation below: G es T eo T eo T eo A es m C ds m C ds T ds T ds T ds A ds A ds m C ds A ds T ds T eo m C eo m C es T es m C e A modified oligonucleotide based on (SEQ ID NO: 452), During the ceremony, A is an adenine nucleic acid base, m C is the 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, and An oligomeric compound comprising the modified oligonucleotide, wherein o is a phosphodiester nucleoside interbonding bond.
[0211] Embodiment 113. Chemical notation below: G es m C eo m C eo A eo T es A ds T ds T ds G ds T ds m C ds A ds T ds T ds T ds T eo A eo m C es A es m C e A modified oligonucleotide based on (SEQ ID NO: 462), During the ceremony, A is an adenine nucleic acid base, m C is the 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, and An oligomeric compound comprising the modified oligonucleotide, wherein o is a phosphodiester nucleoside internucleoside linkage.
[0212] Embodiment 114. The following chemical notations: G es T eo A eo T eo m C es m C ds T ds m C ds T ds T ds A ds A ds T ds T ds m C ds m C eo T eo A es T es A e (SEQ ID NO: 482)-based modified oligonucleotide, wherein wherein A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’MOE sugar moiety, d is a 2’-β-D deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside internucleoside linkage, and o is a phosphodiester nucleoside internucleoside linkage, an oligomeric compound comprising the modified oligonucleotide.
[0213] Embodiment 115. The following chemical notations: m C es T eo m C eo m C eo A es A ds T ds T ds Tds T ds A ds A ds m C ds T ds T ds G eo m C eo A es m C es m C e Modified oligonucleotides based on (SEQ ID NO: 1064), During the ceremony, A is an adenine nucleic acid base, m C is the 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, and An oligomeric compound comprising the modified oligonucleotide, wherein o is a phosphodiester nucleoside interbonding bond.
[0214] Embodiment 116. Chemical notation below: G es T eo T eo m C eo A es m C ds A ds G ds T ds T ds T ds A ds m C ds m C ds m C ds m C eo A eo A es G es m C eA modified oligonucleotide based on (SEQ ID NO: 2225), During the ceremony, A is an adenine nucleic acid base, m C is the 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, and An oligomeric compound comprising the modified oligonucleotide, wherein o is a phosphodiester nucleoside interbonding bond.
[0215] Embodiment 117. The compound according to any one of Embodiments 111 to 116, wherein the modified oligonucleotide is covalently bonded to the conjugate group.
[0216] Embodiment 118. A chiralally concentrated population of a modified oligonucleotide according to any of Embodiments 93 to 110, or an oligomer compound according to any of Embodiments 111 to 116, wherein the population is concentrated with respect to a modified oligonucleotide having at least one specific phosphorothioate nucleoside bond having a specific stereochemical configuration.
[0217] Embodiment 119. The chiralally enriched population according to Embodiment 118, wherein the population is enriched with respect to modified oligonucleotides containing at least one specific phosphorothioate nucleoside bond having a (Sp) configuration.
[0218] Embodiment 120. The chiralally enriched population according to Embodiment 118, wherein the population is enriched with respect to modified oligonucleotides containing at least one specific phosphorothioate nucleoside bond having a (Rp) configuration.
[0219] Embodiment 121. The chiralally enriched population according to Embodiment 118, wherein the population is enriched with respect to modified oligonucleotides having a specific, independently selected stereochemical configuration in each phosphorothioate nucleoside bond.
[0220] Embodiment 122. The chiralally enriched population according to Embodiment 121, wherein the population is enriched with modified oligonucleotides having a (Rp) configuration in one specific phosphorothioate nucleoside bond and a (Sp) configuration in each of the remaining phosphorothioate nucleoside bonds.
[0221] Embodiment 123. The chiralally enriched population according to Embodiment 121, wherein the population is enriched with respect to modified oligonucleotides having at least three consecutive phosphorothioate nucleoside bonds in Sp configuration, Sp configuration, and Rp configuration in the 5' to 3' direction.
[0222] Embodiment 124. A group of modified oligonucleotides according to any of Embodiments 93 to 110, or oligomeric compounds according to any of Embodiments 111 to 116, wherein all of the phosphorothioate nucleoside bonds of the modified oligonucleotide are stereorandom.
[0223] Embodiment 125. A pharmaceutical composition comprising a group of modified oligonucleotides described in any of Embodiments 93 to 110, or an oligomer compound described in any of Embodiments 111 to 116, or a group described in any of Embodiments 118 to 124, and a pharmaceutically acceptable diluent or carrier.
[0224] Embodiment 126. The pharmaceutical composition according to Embodiment 125, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid or phosphate-buffered salt solution (PBS).
[0225] Embodiment 127. The pharmaceutical composition according to Embodiment 126, wherein the pharmaceutical composition essentially comprises the modified oligonucleotide, the oligomer compound, the population, and artificial cerebrospinal fluid.
[0226] Embodiment 128. The pharmaceutical composition according to Embodiment 126, wherein the pharmaceutical composition essentially comprises the modified oligonucleotide, the oligomer compound, the population, and PBS.
[0227] Embodiment 129. A method comprising administering to a subject a group of modified oligonucleotides described in any of Embodiments 93 to 110, an oligomer compound described in any of Embodiments 111 to 116, a group described in any of Embodiments 118 to 124, or a pharmaceutical composition described in any of Embodiments 125 to 128.
[0228] Embodiment 130. A method for treating an APP-related disease or disorder, comprising administering a therapeutically effective amount of a group of modified oligonucleotides described in any of Embodiments 93 to 110, an oligomer compound described in any of Embodiments 111 to 116, a group described in any of Embodiments 118 to 124, or a pharmaceutical composition described in any of Embodiments 125 to 128 to a subject who has or is at risk of developing an APP-related disease or disorder.
[0229] Embodiment 131. The method according to Embodiment 130, wherein the disease associated with APP is sporadic Alzheimer's disease, hereditary / familial Alzheimer's disease, Alzheimer's disease in patients with Down syndrome, or cerebral amyloid angiopathy.
[0230] Embodiment 132. The method according to any one of Embodiments 129 to 131, wherein administration of the group of modified oligonucleotides described in any one of Embodiments 93 to 110, the oligomer compound described in any one of Embodiments 111 to 116, the group described in any one of Embodiments 118 to 124, or the pharmaceutical composition described in any one of Embodiments 125 to 128 improves at least one symptom or characteristic of an APP-related disease or disorder.
[0231] Embodiment 133. The method according to Embodiment 132, wherein administration of the group of modified oligonucleotides described in any of Embodiments 93 to 110, the oligomer compound described in any of Embodiments 111 to 116, the group described in any of Embodiments 118 to 124, or the pharmaceutical composition described in any of Embodiments 125 to 128 reduces or delays cognitive impairment, reduces or delays the decline of memory and language abilities, improves behavioral and psychological symptoms, reduces apathy, improves motivation, reduces gait disturbance, reduces seizures, reduces or delays progressive dementia, or reduces abnormal amyloid deposition.
[0232] Embodiment 134. The method according to any one of Embodiments 129 to 134, wherein the APP protein level in the subject is reduced.
[0233] Embodiment 135. A method for reducing the expression of APP in cells, wherein the cells are subjected to The method comprising contacting the group of modified oligonucleotides described in any of embodiments 93 to 110, the oligomer compound described in any of embodiments 111 to 116, the group described in any of embodiments 118 to 124, or the pharmaceutical composition described in any of embodiments 125 to 128.
[0234] Embodiment 136. The method according to Embodiment 135, wherein the cells are cortical brain cells or hippocampal cells.
[0235] Embodiment 137. Use of the group of modified oligonucleotides described in any of Embodiments 93 to 110, the oligomer compound described in any of Embodiments 111 to 116, the group described in any of Embodiments 118 to 124, or the pharmaceutical composition described in any of Embodiments 125 to 128, for the treatment of diseases or disorders related to APP.
[0236] Embodiment 138. Use of the group of modified oligonucleotides described in any of Embodiments 93 to 110, the oligomer compounds described in any of Embodiments 111 to 116, the group described in any of Embodiments 118 to 124, or the pharmaceutical composition described in any of Embodiments 125 to 128, for the manufacture of a drug for treating an APP-related disease or disorder.
[0237] Embodiment 139. The use according to Embodiment 137 or 138, wherein the disease or disorder associated with the APP is sporadic Alzheimer's disease, hereditary / familial Alzheimer's disease, Alzheimer's disease in patients with Down syndrome, or cerebral amyloid angiopathy.
[0238] Embodiment 140. The method according to any one of Embodiments 129 to 134, wherein the subject is a human.
[0239] Embodiment 141. The method according to Embodiment 135 or Embodiment 136, wherein the cells are human cells.
[0240] I. Specific oligonucleotides In certain embodiments, the herein provides oligomeric compounds comprising oligonucleotides consisting of bound nucleosides. The oligonucleotide may be an unmodified oligonucleotide (RNA or DNA) or a modified oligonucleotide. The modified oligonucleotide comprises at least one modification to the unmodified RNA or DNA. That is, the modified oligonucleotide comprises at least one modified nucleoside (including a modified sugar moiety and / or a modified nucleic acid base) and / or at least one modified nucleoside bond. Specific modified nucleosides and modified nucleoside bonds suitable for use in modified oligonucleotides are described below.
[0241] A. Specific modified nucleosides Modified nucleosides include a modified sugar moiety, a modified nucleic acid base, or both. In certain embodiments, modified nucleosides containing the following modified sugar moieties and / or the following modified nucleic acid bases may be incorporated into antisense oligonucleotides.
[0242] 1. Specific sugar portion In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar substitute. Such a sugar substitute may include one or more substitutions corresponding to substitutions of other types of substituted sugar moieties.
[0243] In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety comprising a furanosyl ring having one or more substituents, none of which bridge two atoms of the furanosyl ring to form a bicyclic structure. Such non-bridged substituents may be at any position of the furanosyl ring, including but not limited to substituents at the 2', 3', 4', and / or 5' positions. In certain embodiments, one or more non-bridged substituents of the non-bicyclic modified sugar moiety are branched. Examples of suitable 2'- substituents for the non-bicyclic modified sugar moiety include, but are not limited to, 2'-F, 2'-OCH3 ("OMe" or "O-methyl"), and 2'-O(CH2)2OCH3 ("MOE"). In certain embodiments, the 2'- substituents may be halo, allyl, amino, azide, SH, CN, OCN, CF3, OCF3, O-C1~C 10 Alkoxy, O-C1~C 10 Substitutive alkoxy, O-C1~C 10 Alkyl, O-C1~C 10 Substitutive alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-Alkenyl, O-Alkinyl, S-Alkinyl, N(R m )-Alkynyl, O-Alkyrenyl-O-Alkyl, Alkynyl, Alkalyl, Aralkyl, O-Alkalyl, O-Aralkyl, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ) or OCH2C(=O)-N(R m )(R n ) are selected from the above, and in the formula, each R m and R n These are independently H, an amino protecting group, or substituted or unsubstituted C1-C1. 10Alkyl, -O(CH2)2ON(CH3)2 ("DMAOE"), 2'-OCH2OCH2N(CH2)2 ("DMAEOE"), and 2'-substituents described in Cook et al., US6,531,584; Cook et al., US5,859,221, and Cook et al., US6,005,087. Specific embodiments of these 2'-substituents may be further substituted with one or more substituents independently selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. In specific embodiments, the non-bicyclic modified sugar moiety includes a substituent at the 3' position. Examples of suitable substituents for the 3' position of the modified sugar moiety include, but are not limited to, alkoxy (e.g., methoxy) and alkyl (e.g., methyl, ethyl). In specific embodiments, the non-bicyclic modified sugar moiety includes a substituent at the 4' position. Suitable 4'-substituents for the non-bicyclic modified sugar moiety include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015 / 106128. Suitable 5'-substituents for the non-bicyclic modified sugar moiety include, but are not limited to, 5'-methyl (R or S), 5'-vinyl, ethyl, and 5'-methoxy. In certain embodiments, the non-bicyclic modified sugar moiety comprises two or more non-crosslinked sugar substituents, e.g., a 2'-F-5'-methyl sugar moiety, as well as a modified sugar moiety and a modified nucleoside, as described in Migawa et al., WO 2008 / 101157 and Rajeev et al., US2013 / 0203836.
[0244] In certain embodiments, the 2'-substituted non-bicyclic modified nucleosides are F, NH2, N3, OCF3, OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamide (OCH2C(=O)-N(Rm )(R n The formula comprises a sugar moiety containing a non-crosslinked 2'- substituent selected from )), where each R m and R n These are independently H, an amino protecting group, or substituted or unsubstituted C1-C1. 10 It is alkyl.
[0245] In certain embodiments, the 2'-substituted nucleoside non-bicyclic modified nucleoside comprises a sugar moiety containing a non-crosslinked 2'-substituent selected from F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, O(CH2)2ON(CH3)2 ("DMAOE"), OCH2OCH2N(CH2)2 ("DMAEOE"), and OCH2C(=O)-N(H)CH3 ("NMA").
[0246] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside comprises a sugar moiety containing a non-crosslinked 2' substituent selected from F, OCH3, and OCH2CH2OCH3.
[0247] In naturally occurring nucleic acids, sugars are linked to each other at the 3' and 5' positions. In certain embodiments, oligonucleotides include one or more nucleoside or sugar moieties linked at alternative positions, e.g., at 2', or inversely from 5' to 3'. For example, if the linkage is at the 2' position, the 2'-substituent may instead be at the 3' position.
[0248] Certain modified sugar moieties include substituents that bridge two atoms of a furanosyl ring, forming a second ring and resulting in a bicyclic sugar moiety. Nucleosides containing such bicyclic sugar moieties are called bicyclic nucleosides (BNAs), locked nucleosides, or conformationally restricted nucleotides (CRNs). Certain such compounds are described in U.S. Patent Publication 2013 / 0190383 and PCT Publication WO2013 / 036868. In certain such embodiments, the bicyclic sugar moiety includes a bridge between the 4' and 2' furanose ring atoms. In certain such embodiments, the furanose ring is a ribose ring. Such 4' and 2' bridging sugar substituents include 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' ("LNA"), 4'-CH2-S-2', 4'-(CH2)2-O-2' ("ENA"), 4'-CH(CH3)-O-2' (referred to as "restricted ethyl" or "cEt" in the S configuration), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CH2OCH3)-O-2' ("restricted MOE" or "cMOE") and their analogues (e.g., Seth et al., US7, 399, 845, Bhat et al., US7, 569, 686, Swayze et al.) See al., US7, 741, 457 and Swayze et al., US8, 022, 193), 4'-C(CH3)(CH3)-O-2' and its analogues (see, for example, Seth et al., US8, 278, 283), 4'-CH2-N(OCH3)-2' and its analogues (see, for example, Prakash et al. See all., US8, 278, 425), 4'-CH2-ON(CH3)-2' (see, for example, Allerson et al., US7, 696, 345 and Allerson et al., US8, 124, 745), 4'-CH2-C(H)(CH3)-2' (see, for example, Zhou, et al., J. Org. Chem., 2009, 74, 118-134), 4'-CH2-C(=CH2)-2' and its analogues (see, for example, Seth et al., US8, 278, 426), 4'-C(R a R b )-N(R)-O-2',4'-C(R a R b Examples include )-ON(R)-2', 4'-CH2-ON(R)-2', and 4'-CH2-N(R)-O-2', but are not limited to these, and each R, R a , and R b These are independently H, protecting groups, or C1-C 12 It is alkyl (for example, Imanishi See et al., US7, 427, 672.
[0249] In certain embodiments, such 4' and 2' bridges independently comprise 1 to 4 linking groups independently selected from -[C(Ra)(Rb)]n-, -[C(Ra)(Rb)]nO-, C(Ra)=C(Rb)-, -C(Ra)=N-, C(=NRa)-, -C(=O)-, -C(=S)-, -O-, -Si(Ra)2-, -S(=O)x-, and N(Ra)-. During the ceremony, x is 0, 1, or 2. n is 1, 2, 3, or 4. Each Ra and Rb independently consists of H, protecting group, hydroxyl, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, and C2 ~C12 alkynyl, substituted C2~C12 alkynyl, C5~C20 aryl, substituted C5~C20 aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5~C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1) Furthermore, each J1 and J2 is independently H, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl, or protecting group.
[0250] Freier et al., Nucleic Acids Research,1997,25(22),4429-4443,Albaek et al.,J.Org.Chem.,2006,71,7731-7740,Singh et al.,Chem.Commun.,1998,4,455-456;Koshkin et al al.,Tetrahedron,1998,54,3607-3630;Wahlestedt et al.,Proc.Natl.Acad.Sci.USA,2000,97,5633-5638;Kumar et al.,Bioorg.Med.Chem.Lett.,1998,8,219-222; al.,J.Org.Chem.,1998,63,10035-10039;Srivastava et al.,J.Am.Chem.Soc.,2007,129,8362-8379;Elayadi et al.,Curr.Opinion Invens.Drugs,2001,258-51; al.,Chem.Biol.,2001,8,1-7;Orum et al.,Curr.Opinion Mol.Ther.,2001,3,239-243;Wengel et al.,US7,053,207,Imanishi et al.,US6,268,490,Imanishi et al al.US6,770,748,Imanishi et al.,USRE44,779;Wengel et al.,US6,794,499,Wengel et al.,US6,670,461;Wengel et al.,US7,034,133,Wengel et al.,US8,080,644;Wengel et al. al.,US8,034,909;Wengel et al.,US8,153,365;Wengel et al.,US7,572,582;and Ramasamy et al.,US6,525,191,Torsten et al.,WO 2004 / 106356,Wengel et al.,WO 1999 / 014226;Seth et al.,WO 2007 / 134181;Seth et See al.,US7,547,684;Seth et al.,US7,666,854;Seth et al.,US8,088,746;Seth et al.,US7,750,131;Seth et al.,US8,030,467;Seth et al.,US8,268,980;Seth et al.,US8,546,556;Seth et al.,US8,530,640;Migawa et al.,US9,012,421;Seth et al.,US8,501,805;Allerson et al.,US2008 / 0039618; and Migawa et al.,US2015 / 0191727. In certain embodiments, the bicyclic sugar moiety and the nucleoside incorporating such bicyclic sugar moiety are further defined by their isomer configuration. For example, LNA nucleosides (as described herein) may be in an α-L configuration or a β-D configuration.
[0251] [ka] α-L-methyleneoxy(4'-CH2-O-2') or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that have exhibited antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). Addition of locked nucleic acids to siRNA has been shown to increase the stability of siRNA in serum and reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, OR. et al., (2007) Mal Cane Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). In this specification, both isomer configurations are included in the general description of bicyclic nucleosides. When the position of a particular bicyclic nucleoside (e.g., LNA or cEt) is identified in the exemplary embodiments herein, they are in a β-D configuration unless otherwise specified.
[0252] In certain embodiments, the modified sugar moiety comprises one or more non-crosslinked sugar substituents and one or more crosslinked sugar substituents (e.g., 5'-substituted and 4'-2'-crosslinked sugars).
[0253] In certain embodiments, the modified sugar moiety is a sugar substitute. In certain such embodiments, the oxygen atom of the sugar moiety is replaced with, for example, a sulfur, carbon, or nitrogen atom. In certain such embodiments, such modified sugar moiety also includes crosslinked and / or non-crosslinked substituents as described herein. For example, certain sugar substitutes include substitutions at the 4' sulfur atom and at the 2' position (see, e.g., Bhatetal., US7,875,733 and Bhatetal., US7,939,677) and / or the 5' position.
[0254] In certain embodiments, the sugar substitute comprises a ring having more than five atoms. For example, in certain embodiments, the sugar substitute comprises a six-membered tetrahydropyran ("THP"). Such tetrahydropyran may be further modified or substituted. Nucleosides containing such modified tetrahydropyran include, but are not limited to, hexitol nucleic acid ("HNA"), anitol nucleic acid ("ANA"), mannitol nucleic acid ("MNA") (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoroHNA:
[0255] [ka] (See "F-HNA," Swayze et al. US8,088,904, Swayze et al. US8,440,803, Swayze et al. US8,796,437, and Swayze et al. US9,005,906. F-HNA can also be called F-THP or 3'-fluorotetrahydropyran.) and nucleosides containing further modified THP compounds having the following formula:
[0256] [ka] In the formula, each of the above modified THP nucleosides is independently Bx is the nucleic acid base portion, T3 and T4 are independently nucleoside-binding groups that bind a modified THP nucleoside to the remainder of the oligonucleotide, or one of T3 and T4 is a nucleoside-binding group that binds a modified THP nucleoside to the remainder of the oligonucleotide, and the other of T3 and T4 is H, a hydroxyl protecting group, a bound conjugate group, or a 5' or 3' terminal group. q1, q2, q3, q4, q5, q6, and q7 are each independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl. Each of R1 and R2 is independently selected from hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2, and CN, where X is O, S, or NJ1, and each of J1, J2, and J3 is independently H or C1-C6 alkyl.
[0257] In certain embodiments, modified THP nucleosides are provided in which q1, q2, q3, q4, q5, q6, and q7 are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is not H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In certain embodiments, modified THP nucleosides are provided in which one of R1 and R2 is F. In certain embodiments, R1 is F and R2 is H, in certain embodiments, R1 is methoxy and R2 is H, and in certain embodiments, R1 is methoxyethoxy and R2 is H.
[0258] In certain embodiments, the sugar substitute comprises a ring having more than five atoms and more than one heteroatom. For example, the use of morpholino sugar moieties in nucleosides and oligonucleotides has been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510, and Summerton et al., USA 5,698,685, Summerton et al., USA 5,166,315, Summerton et al., USA 5,185,444, and Summerton et al., USA 5,034,506). As used herein, the term "morpholino" means a sugar substitute having the following structure:
[0259] [ka]
[0260] In certain embodiments, morpholino can be modified, for example, by adding or altering various substituents from the morpholino structure described above. Such sugar substitutes are referred to herein as “modified morpholino.”
[0261] In certain embodiments, the sugar substitute includes an acyclic moiety. Examples of nucleosides and oligonucleotides containing such acyclic sugar substitutes include peptide nucleic acids ("PNA"), acyclic butyl nucleic acids (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and Manoharan et al. This includes, but is not limited to, the nucleosides and oligonucleotides described in al., WO2011 / 133876. In certain embodiments, the sugar substitutes include acyclic moieties. Examples of nucleosides and oligonucleotides containing such acyclic sugar substitutes include, but are not limited to, peptide nucleic acids ("PNA"), acyclic butyl nucleic acids (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and the nucleosides and oligonucleotides described in Manoharan et al., US2013 / 130378. Representative U.S. patents teaching the preparation of PNA compounds include, but are not limited to, U.S. Patents 5,539,082; 5,714,331; and 5,719,262. Additional PNA compounds suitable for use in oligonucleotides of the present invention are described, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.
[0262] In certain embodiments, the sugar substitute is the “unlocked” sugar structure of a UNA (unlocked nucleic acid) nucleoside. UNA is an unlocked acyclic nucleic acid in which all sugar bonds have been removed, forming the unlocked sugar substitute. Representative U.S. publications teaching the preparation of UNA include, but are not limited to, U.S. Patent No. 8,314,227, and U.S. Patent Publications No. 2013 / 0096289, 2013 / 0011922, and 2011 / 0313020, the full contents of which are incorporated herein by reference.
[0263] In certain embodiments, the sugar substitute is GNA (glycol nucleic acid), as shown below. It is glycerol, as found in nucleosides;
[0264] [ka] In the formula, Bx represents any nucleic acid base.
[0265] Many other bicyclic and tricyclic sugars, as well as sugar substitutes, are known in the art and can be used in modified nucleosides.
[0266] 2. Specific modified nucleic acid bases In certain embodiments, the modified oligonucleotide comprises one or more nucleosides containing unmodified nucleic acid bases. In certain embodiments, the modified oligonucleotide comprises one or more nucleosides containing modified nucleic acid bases. In certain embodiments, the modified oligonucleotide comprises one or more nucleosides that do not contain nucleic acid bases, referred to as debased nucleosides. In certain embodiments, the modified oligonucleotide comprises one or more inosine nucleosides (i.e., nucleosides containing hypoxanthine nucleic acid bases).
[0267] In certain embodiments, the modified nucleic acid bases are selected from 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2, N-6, and O-6-substituted purines. In certain embodiments, the modified nucleic acid bases are 5-methylcytosine, 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl(-C≡C-CH3)uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azocymine, 5-ribosyluracil (pseudracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, and 8-hydroxy Selected from ru, 8-aza and other 8-substituted purines, 5-halo, especially 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl4-N-benzoylcytosine, 5-methyl4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleic acid bases include tricyclic pyrimidines such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Modified nucleic acid bases include purine or pyrimidine bases, and other heterocyclic bases, such as 7-deaza- This may also include bases substituted with adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone. Further nucleic acid bases include those disclosed in Meriganetal, US3, 687, 808; The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, JI, Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B., Eds., CRC Press, 1993, 273-288; and Chapters 6 and 15, Antisense Drug Technology, Crooke ST, Ed., CRC Press, 2008, 163-166 and 442-443.
[0268] Publications that instruct on the preparation of the above-mentioned modified nucleic acid bases and some of the other modified nucleic acid bases include: Manoharan et al., US2003 / 0158403, Manoharan et al., US2003 / 0175906, Dinh et al., US4,845,205, Spielvogel et al., US5,130,302, Rogers et al., US5,134,066, Bischofberger et al., US5,175,273, Urdea et al., US5,367,066, Benner et al., US5,432,272, Matteucci et al., US5,434,257, Gmeiner et al., US5,457,187, Cook et al., US5,459,255, Froehler et al. al., US5,484,908, Matteucci et al., US5,502,177, Hawkins et al., US5,525,711, Haralambidis et al., US5,552,540, Cook et al., US5,587,469, Froehler et al., US5,594,121, Switzer et al. al., US5,596,091, Cook et al., US5,614,617, Froehler et al., US5,645,985, Cook Examples include, but are not limited to, Cook et al.,US5,681,941, Cook et al.,US5,811,534, Cook et al.,US5,750,692, Cook et al.,US5,948,903, Cook et al.,US5,587,470, Cook et al.,US5,457,191, Matteucci et al.,US5,763,588, Froehler et al.,US5,830,653, Cook et al.,US5,808,027, Cook et al.,US6,166,199, and Matteucci et al.,US6,005,096.
[0269] 3. Specific modified nucleoside inter-bonding The naturally occurring nucleoside-to-nucleoside bonds in RNA and DNA are 3'-to-5' phosphodiester bonds. In certain embodiments, nucleosides of modified oligonucleotides may be linked together using one or more modified nucleoside-to-nucleoside bonds. Two main classes of nucleoside-to-nucleoside bonds are defined by the presence or absence of a phosphorus atom. Typical phosphorus-containing nucleoside-to-nucleoside bonds include, but are not limited to, phosphodiester bonds ("P=O") (also referred to as unmodified bonds or naturally occurring bonds), phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates ("P=S"), and phosphorodithioates ("HS-P=S"). Typical non-phosphorus-containing nucleoside-to-nucleoside bonds include methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiesters, and thionocarbamates (-OC(=O)(NH)-S-). Examples include, but are not limited to, siloxanes (-O-SiH2-O-) and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Modified nucleoside bonds can be used to alter, typically increase, the nuclease resistance of oligonucleotides compared to naturally occurring phosphate bonds. In certain embodiments, nucleoside bonds having chiral atoms can be prepared as racemic mixtures or as separate enantiomers. Methods for preparing phosphorus-containing and phosphorus-free nucleoside bonds are well known to those skilled in the art.
[0270] Representative nucleoside bonds containing a chiral center include, but are not limited to, alkylphosphonates and phosphorothioates. Modified oligonucleotides containing nucleoside bonds containing a chiral center can be prepared as a group of modified oligonucleotides containing sterically random nucleoside bonds, or as a group of modified oligonucleotides containing phosphorothioate bonds in a specific stereochemical configuration. In certain embodiments, the group of modified oligonucleotides contains phosphorothioate nucleoside bonds in which all phosphorothioate nucleoside bonds are sterically random. Such modified oligonucleotides can be produced using synthetic methods that result in a random selection of the stereochemical configuration of each phosphorothioate bond. Nevertheless, each individual phosphorothioate in each individual oligonucleotide molecule has a defined stereochemical configuration. In certain embodiments, the group of modified oligonucleotides is rich in modified oligonucleotides containing one or more specific phosphorothioate nucleoside bonds in a specific stereochemical configuration that is independently selected. In certain embodiments, a particular arrangement of phosphorothioate bonds is present in at least 65% of molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate bonds is present in at least 70% of molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate bonds is present in at least 80% of molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate bonds is present in at least 90% of molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate bonds is present in at least 99% of molecules in the population. Such a population of chiralally enriched modified oligonucleotides can be synthesized by known synthesis methods in the art, e.g., Oka et al., JACS 125, 8307 (2003), Wan et al. They can be produced using the methods described in al.Nuc.Acid.Res.,42,13456(2014) and WO2017 / 015555. In certain embodiments, the population of modified oligonucleotides is enriched with modified oligonucleotides having at least one indicated phosphorothioate in the (Sp) configuration. In certain embodiments, the population of modified oligonucleotides is enriched with modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, the modified oligonucleotides containing (Rp) and / or (Sp) phosphorothioates each comprise one or more of the following formulas, where "B" represents a nucleic acid base.
[0271] [ka] Unless otherwise specified, the chiral nucleoside bonds of the modified oligonucleotides described herein may be sterically random or in a specific stereochemical configuration.
[0272] Examples of neutral internucleoside bonds, though not limited to these, include phosphotriesters, methylphosphonates, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl (MOP), and thioformacetal (3'-S-CH2-O-5'). Furthermore, neutral nucleoside bonds include nonionic bonds, such as siloxanes (dialkylsiloxanes), carboxylic acid esters, carboxamides, sulfides, sulfonic acid esters, and amides (see, for example, Carbohydrate Modificationsin Antisense Research; YSSanghvi and PDCook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral nucleoside bonds include nonionic bonds containing mixed components of N, O, S, and CH2.
[0273] In certain embodiments, the modified oligonucleotide comprises one or more inverted nucleosides as shown below:
[0274] [ka] In the formula, each Bx independently represents any nucleic acid base.
[0275] In certain embodiments, the inverted nucleoside is terminal (i.e., the last nucleoside at one end of the oligonucleotide), and therefore only one nucleoside bond is present as shown above. In certain such embodiments, additional features (such as a conjugated group) may be attached to the inverted nucleoside. Such terminal inverted nucleosides can be attached to one or both ends of the oligonucleotide.
[0276] In certain embodiments, such a group lacks a nucleic acid base and is referred to herein as an inverted sugar moiety. In certain embodiments, the inverted sugar moiety is terminal (i.e., bonded to the last nucleoside at one end of the oligonucleotide), and therefore there is only one nucleoside bond. In certain such embodiments, additional features (such as a conjugated group) may be bonded to the inverted sugar moiety. Such a terminal inverted sugar moiety can be bonded to one or both ends of the oligonucleotide.
[0277] In certain embodiments, nucleic acids may be linked from 2' to 5' rather than the standard 3' to 5' linkage. Such linkages are illustrated below.
[0278] [ka] In the formula, each Bx represents any nucleic acid base.
[0279] B. Specific motifs In certain embodiments, a modified oligonucleotide comprises one or more modified nucleosides containing a modified sugar moiety. In certain embodiments, a modified oligonucleotide comprises one or more modified nucleosides containing a modified nucleic acid base. In certain embodiments, a modified oligonucleotide comprises one or more modified internucleoside bonds. In such embodiments, the modified, unmodified, and otherwise modified sugar moieties, nucleic acid bases, and / or internucleoside bonds of the modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of the sugar moieties, nucleic acid bases, and internucleoside bonds are each independent of each other. Thus, a modified oligonucleotide can be described by its sugar motif, nucleic acid base motif, and / or internucleoside bond motif (as used herein, the nucleic acid base motif describes a modification to a nucleic acid base that is independent of the sequence of the nucleic acid base).
[0280] 1. Specific sugar motifs In certain embodiments, the oligonucleotide comprises one or more types of modified sugars and / or unmodified sugar moieties arranged in a defined pattern or sugar motif along the oligonucleotide or a region thereof. In certain examples, such sugar motifs include, but are not limited to, any of the sugar modifications discussed herein.
[0281] Uniformly modified oligonucleotides In certain embodiments, the modified oligonucleotide includes or consists of a region having a fully modified sugar motif. In such embodiments, each nucleoside in the fully modified region of the modified oligonucleotide contains a modified sugar moiety. In certain embodiments, each nucleoside in the entire modified oligonucleotide contains a modified sugar moiety. In certain embodiments, the modified oligonucleotide includes or consists of a region having a fully modified sugar motif, and each nucleoside within the fully modified region contains the same modified sugar moiety, which is referred to herein as a homogeneous modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a homogeneously modified oligonucleotide. In certain embodiments, each nucleoside in a homogeneously modified nucleotide contains the same 2' modification.
[0282] Gapmer oligonucleotides In a particular embodiment, the modified oligonucleotide comprises or consists of a region having a gapmer motif defined by two outer regions, i.e., "wings," and a central or inner region, i.e., a "gap." Three of the gapmer motif The regions (5' wing, gap, and 3' wing) form a continuous sequence of nucleosides, where at least some of the sugar moieties of the nucleosides in each wing are different from at least some of the sugar moieties of the nucleosides in the gap. Specifically, the sugar moieties of at least the nucleosides in each wing closest to the gap (the 3'-side nucleosides of the 5'-wing and the 5'-side nucleosides of the 3'-wing) are different from the sugar moieties of the adjacent gap nucleosides, thus defining the boundary between the wing and the gap (i.e., the wing / gap junction). In certain embodiments, the sugar moieties within the gap are identical to each other. In certain embodiments, the gap comprises one or more nucleosides having sugar moieties different from the sugar moieties of one or more other nucleosides in the gap. In certain embodiments, the sugar motifs of the two wings are identical to each other (symmetric gapmer). In certain embodiments, the sugar motif of the 5'-wing is different from the sugar motif of the 3'-wing (asymmetric sugar gapmer).
[0283] In certain embodiments, the gapmer wing contains 1 to 6 nucleosides. In certain embodiments, each nucleoside in each wing of the gapmer contains a modified sugar moiety. In certain embodiments, at least one nucleoside in each wing of the gapmer contains a modified sugar moiety. In certain embodiments, at least two nucleosides in each wing of the gapmer contain a modified sugar moiety. In certain embodiments, at least three nucleosides in each wing of the gapmer contain a modified sugar moiety. In certain embodiments, at least four nucleosides in each wing of the gapmer contain a modified sugar moiety.
[0284] In certain embodiments, the gap of the gapmer contains 7 to 12 nucleosides. In certain embodiments, each nucleoside in the gapmer contains a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside in the gapmer contains a modified sugar moiety.
[0285] In certain embodiments, the gapmer is a deoxygapmer. In certain embodiments, the gap-side nucleoside of each wing / gap junction contains a 2'-deoxyribosyl sugar moiety, and the wing-side nucleoside of each wing / gap junction contains a modified sugar moiety. In certain embodiments, each nucleoside of the gap contains a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of each wing of the gapmer contains a modified sugar moiety. In certain embodiments, at least one nucleoside of the gap of the gapmer contains a modified sugar moiety. In certain embodiments, at least one nucleoside of the gap of the gapmer contains a 2'-OMe sugar moiety.
[0286] In this specification, the lengths (number of nucleosides) of the three regions of a gapmer may be given using the notation [5'-number of nucleosides in the wing]-[number of nucleosides in the gap]-[3'-number of nucleosides in the wing]. Thus, a 3-10-3 gapmer consists of three bound nucleosides in each wing and ten bound nucleosides in the gap. If a specific modification follows such nomenclature, the modification is a modification of each sugar moiety in each wing, and the gap nucleoside contains a 2'-β-D-deoxyribosyl sugar moiety. Thus, a 5-10-5 MOE gapmer consists of five bound 2'-MOE nucleosides in the 5'-wing, ten bound 2'-β-D-deoxynucleosides in the gap, and five bound 2'-MOE nucleosides in the 3'-wing. The 3-10-3cEt gapmer consists of three bound cEt nucleosides in the 5'-wing, ten bound 2'-β-D-deoxynucleosides in the gap, and three bound cEt nucleosides in the 3'-wing. The 5-8-5 gapmer consists of five bound nucleosides containing the modified sugar moiety of the 5'-wing, eight bound 2'-β-D-deoxynucleosides in the gap, and five bound nucleosides containing the modified sugar moiety of the 3'-wing. The 5-8-5 mixed gapmer is 5 The '- and / or 3'- wings have at least two different modified sugar moieties.
[0287] In certain embodiments, the modified oligonucleotide is a 5-10-5 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-3 BNA gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-3 cEt gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-3 LNA gapmer.
[0288] In certain embodiments, the modified oligonucleotide is a 5-8-5 mixed gapmer comprising five linked 2'-MOE nucleosides in the 5' wing, eight linked 2'-β-D-deoxynucleosides in the gap, and a mixture of cEt and 2'-MOE nucleosides in the 3' wing. In certain embodiments, the modified nucleosides have a sugar motif of eeeeeddddddddkkeee, where each "e" represents a nucleoside containing a 2'-MOE modified sugar moiety, each "d" represents a nucleoside containing a 2'-β-D-deoxyribosyl sugar moiety, and each "k" represents a nucleoside containing a cEt modified sugar moiety. In certain embodiments, the modified nucleoside has a sugar motif of eeeeeddddddddkeeee, where each "e" represents a nucleoside containing a 2'-MOE modified sugar moiety, each "d" represents a nucleoside containing a 2'-β-D-deoxyribosyl sugar moiety, and each "k" represents a nucleoside containing a cEt modified sugar moiety.
[0289] 2. Specific nucleic acid base motifs In certain embodiments, the oligonucleotide comprises modified and / or unmodified nucleic acid bases arranged in a specified pattern or motif along the oligonucleotide or its region. In certain embodiments, each nucleic acid base is modified. In certain embodiments, none of the nucleic acid bases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleic acid bases of the modified oligonucleotide are 5-methylcytosine. In certain embodiments, all of the cytosine nucleic acid bases are 5-methylcytosine, and all of the other nucleic acid bases of the modified oligonucleotide are unmodified nucleic acid bases.
[0290] In certain embodiments, the modified oligonucleotide includes a block of modified nucleic acid bases. In certain embodiments, the block is located at the 3' end of the oligonucleotide. In certain embodiments, the block is located within 3 nucleosides from the 3' end of the oligonucleotide. In certain embodiments, the block is located at the 5' end of the oligonucleotide. In certain embodiments, the block is located within 3 nucleosides from the 5' end of the oligonucleotide.
[0291] In certain embodiments, the oligonucleotide having a gapmer motif comprises a nucleoside containing a modified nucleic acid base. In certain such embodiments, one nucleoside containing a modified nucleic acid base is located in the central gap of the oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of the nucleoside is a 2'-deoxyribosyl sugar moiety. In certain embodiments, the modified nucleic acid base is selected from 2-thiopyrimidine and 5-propympyrimidine.
[0292] 3. Specific nucleoside bond motifs In certain embodiments, the oligonucleotide is provided with modified internucleoside bonds arranged in a defined pattern or motif along the oligonucleotide or its region. and / or include unmodified internucleoside bonds. In certain embodiments, each internucleoside bond is a phosphodiester internucleoside bond (P=O). In certain embodiments, each internucleoside bond of a modified oligonucleotide is a phosphorothioate internucleoside bond (P=S). In certain embodiments, each internucleoside bond of a modified oligonucleotide is independently selected from phosphorothioate internucleoside bonds and phosphodiester internucleoside bonds. In certain embodiments, each phosphorothioate internucleoside bond is independently selected from stereorandom phosphorothioate (Sp) phosphorothioate and (Rp) phosphorothioate.
[0293] In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and all nucleoside bonds within the gap are modified. In certain such embodiments, some or all of the nucleoside bonds within the wings are unmodified phosphodiester nucleoside bonds. In certain embodiments, the terminal nucleoside bonds are modified. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and the nucleoside bond motif includes at least one phosphodiester nucleoside bond in at least one wing, where this at least one phosphodiester bond is not a terminal nucleoside bond, and the remaining nucleoside bonds are phosphorothioate nucleoside bonds. In certain such embodiments, all phosphorothioate bonds are sterically random. In certain embodiments, all phosphorothioate bonds within the wings are (Sp)phosphorothioate, and the gap includes at least one Sp,Sp,Rp motif. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides that contain such nucleoside-linking motifs.
[0294] In certain embodiments, the modified nucleotide has a soosssssssssssos nucleoside linkage motif, where each "s" represents a phosphorothioate nucleoside linkage and each "o" represents a phosphate nucleoside linkage. In certain embodiments, the modified nucleotide has a soooooossssssssssss nucleoside linkage motif, where each "s" represents a phosphorothioate nucleoside linkage and each "o" represents a phosphate nucleoside linkage. In certain embodiments, the modified nucleotide has a soooosssssssssssss nucleoside linkage motif, where each "s" represents a phosphorothioate nucleoside linkage and each "o" represents a phosphate nucleoside linkage. In certain embodiments, the modified nucleotide has a soooosssssssssssss nucleoside linkage motif, where each "s" represents a phosphorothioate nucleoside linkage and each "o" represents a phosphate nucleoside linkage. In certain embodiments, the modified nucleotide has a ssoosssssssssssss nucleoside linkage motif, where each "s" represents a phosphorothioate nucleoside linkage and each "o" represents a phosphate nucleoside linkage. In certain embodiments, the modified nucleotide has a soooosssssssssssss nucleoside linkage motif, where each "s" represents a phosphorothioate nucleoside linkage and each "o" represents a phosphate nucleoside linkage.
[0295] C. Specific length It is possible to increase or decrease the length of oligonucleotides without eliminating their activity. For example, Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992) tested the ability of a series of antisense oligonucleotides with lengths of 13 to 25 nucleic acid bases to induce cleavage of target RNA in an oocyte injection model. Oligonucleotides with a length of 25 nucleic acid bases containing 8 or 11 mismatched bases near the end were able to induce specific cleavage of target RNA, albeit to a lower degree than antisense oligonucleotides without mismatches. Similarly, oligonucleotides with a length of 13 nucleic acid bases containing 1 or 3 mismatches... Target-specific cleavage was achieved using oligonucleotides consisting of [the specified components].
[0296] In certain embodiments, oligonucleotides (including modified oligonucleotides) may have any of a range of lengths. In certain embodiments, an oligonucleotide consists of X to Y bound nucleosides, where X represents the minimum number of nucleosides in the range and Y represents the maximum number of nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50, provided that X ≤ Y. For example, in a particular embodiment, the oligonucleotides are 12-13, 12-14, 12-15, 12-16, 12-17, 12-18, 12-19, 12-20, 12-21, 12-22, 12-23, 12-24, 12-25, 12-26, 12-27, 12-28, 12-29, 12-30, 13-14, 13-15, 13~16 pieces, 13~17 pieces, 13~18 pieces, 13~19 pieces, 13~20 pieces, 13~21 pieces, 13~22 pieces, 13~23 pieces, 13~24 pieces, 13~25 pieces, 13~26 pieces, 13~27 pieces , 13~28 pieces, 13~29 pieces, 13~30 pieces, 14~15 pieces, 14~16 pieces, 14~17 pieces, 14~18 pieces, 14~19 pieces, 14~20 pieces, 14~21 pieces, 14~22 pieces, 14~23 pieces, 14~24 pieces, 14~25 pieces, 14~26 pieces, 14~27 pieces, 14~28 pieces, 14~29 pieces, 14~30 pieces, 15~16 pieces, 15~17 pieces, 15~18 pieces, 15~19 pieces, 15~ 20 pieces, 15~21 pieces, 15~22 pieces, 15~23 pieces, 15~24 pieces, 15~25 pieces, 15~26 pieces, 15~27 pieces, 15~28 pieces, 15~29 pieces, 15~30 pieces, 16~17 pieces, 16 ~18 pieces, 16~19 pieces, 16~20 pieces, 16~21 pieces, 16~22 pieces, 16~23 pieces, 16~24 pieces, 16~25 pieces, 16~26 pieces, 16~27 pieces, 16~28 pieces, 16~29 pieces, 1 6~30 pieces, 17~18 pieces, 17~19 pieces, 17~20 pieces, 17~21 pieces, 17~22 pieces, 17~23 pieces, 17~24 pieces, 17~25 pieces, 17~26 pieces, 17~27 pieces, 17~28 pieces,17~29 pieces, 17~30 pieces, 18~19 pieces, 18~20 pieces, 18~21 pieces, 18~22 pieces, 18~23 pieces, 18~24 pieces, 18~25 pieces, 18~26 pieces, 18 ~27 pieces, 18~28 pieces, 18~29 pieces, 18~30 pieces, 19~20 pieces, 19~21 pieces, 19~22 pieces, 19~23 pieces, 19~24 pieces, 19~25 pieces, 19~2 6 pieces, 19~29 pieces, 19~28 pieces, 19~29 pieces, 19~30 pieces, 20~21 pieces, 20~22 pieces, 20~23 pieces, 20~24 pieces, 20~25 pieces, 20~26 pieces , 20~27 pieces, 20~28 pieces, 20~29 pieces, 20~30 pieces, 21~22 pieces, 21~23 pieces, 21~24 pieces, 21~25 pieces, 21~26 pieces, 21~27 pieces, 2 1~28 pieces, 21~29 pieces, 21~30 pieces, 22~23 pieces, 22~24 pieces, 22~25 pieces, 22~26 pieces, 22~27 pieces, 22~28 pieces, 22~29 pieces, 22~ 30 pieces, 23~24 pieces, 23~25 pieces, 23~26 pieces, 23~27 pieces, 23~28 pieces, 23~29 pieces, 23~30 pieces, 24~25 pieces, 24~26 pieces, 24~27 It consists of 1, 24-28, 24-29, 24-30, 25-26, 25-27, 25-28, 25-29, 25-30, 26-27, 26-28, 26-29, 26-30, 27-28, 27-29, 27-30, 28-29, 28-30, or 29-30 bound nucleosides.
[0297] D. Specific modified oligonucleotides In certain embodiments, the above modifications (sugars, nucleic acid bases, nucleoside bonds) are incorporated into the modified oligonucleotide. In certain embodiments, the modified oligonucleotide is characterized by its modification motif and overall length. In certain embodiments, such parameters are independent of each other. Therefore, unless otherwise indicated, each nucleoside bond of an oligonucleotide having a gapmer sugar motif may be modified or unmodified, and may follow a gapmer modification pattern of sugar modification. This is not always the case. For example, the nucleoside bonds within the wing region of a sugar gapmer may be the same or different from each other, and may be the same or different from the nucleoside bonds in the gap region of the sugar motif. Similarly, such sugar gapmer oligonucleotides may contain one or more modified nucleic acid bases, independently of the gapmer pattern of the sugar modification. Unless otherwise indicated, each modification is independent of the nucleic acid base sequence.
[0298] E. A specific group of modified oligonucleotides A population of modified oligonucleotides in which all modified oligonucleotides have the same molecular formula may be a stereorandom population or a chiral-enriched population. All chiral centers of all modified oligonucleotides are stereorandom in a stereorandom population. In a chiral-enriched population, at least one specific chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of a chiral-enriched population are enriched with a β-D-ribosyl sugar moiety and all phosphorothioate nucleoside bonds are stereorandom. In certain embodiments, the modified oligonucleotides of a chiral-enriched population are enriched with both a β-D-ribosyl sugar moiety and at least one specific phosphorothioate nucleoside bond in a specific stereochemical configuration.
[0299] F. Nucleic acid base sequence In certain embodiments, oligonucleotides (unmodified or modified oligonucleotides) are further described by their nucleic acid base sequences. In certain embodiments, an oligonucleotide has a nucleic acid base sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid (e.g., a target nucleic acid). In certain such embodiments, a region of the oligonucleotide has a nucleic acid base sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid (e.g., a target nucleic acid). In certain embodiments, a region or the entire nucleic acid base sequence of an oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the second oligonucleotide or nucleic acid (e.g., a target nucleic acid).
[0300] II. Specific Oligomer Compounds In certain embodiments, oligomeric compounds comprising oligonucleotides (modified or unmodified) and optionally one or more conjugate groups and / or terminal groups are provided herein. A conjugate group comprises one or more conjugate moieties and a conjugate linker that attaches the conjugate moieties to an oligonucleotide. The conjugate group may be attached to either end or both ends and / or any internal position of the oligonucleotide. In certain embodiments, the conjugate group is attached to the 2' position of the nucleoside of the modified oligonucleotide. In certain embodiments, a conjugate group attached to either end or both ends of the oligonucleotide is a terminal group. In certain such embodiments, the conjugate group or terminal group is attached to the 3' end and / or 5' end of the oligonucleotide. In certain such embodiments, the conjugate group (or terminal group) is attached to the 3' end of the oligonucleotide. In certain embodiments, the conjugate group is attached near the 3' end of the oligonucleotide. In certain embodiments, the conjugate group (or terminal group) is attached to the 5' end of the oligonucleotide. In certain embodiments, the conjugate group is attached near the 5' end of the oligonucleotide.
[0301] Examples of terminal groups, though not limited to these, include conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and independently modified groups. Examples include two or more unmodified nucleosides.
[0302] A. Specific conjugate groups In certain embodiments, an oligonucleotide is covalently bonded to one or more conjugate groups. In certain embodiments, the conjugated groups modify one or more properties of the conjugated oligonucleotide, including, but not limited to, pharmacodynamic properties, pharmacokinetic properties, stability properties, binding properties, absorption properties, tissue distribution properties, cell distribution properties, cell uptake properties, charge properties, and clearance properties.
[0303] In certain embodiments, the conjugation of one or more carbohydrate moieties to a modified oligonucleotide can optimize one or more properties of the modified oligonucleotide. In certain embodiments, the carbohydrate moiety is bound to a modified subunit of the modified oligonucleotide. For example, the ribose sugar of one or more ribonucleotide subunits of the modified oligonucleotide can be replaced by another moiety, e.g., a non-carbohydrate (preferably cyclic) support to which a carbohydrate ligand is bound. A ribonucleotide subunit in which the ribose sugar of the subunit is thus substituted is referred herein to as a ribose-substituted modified subunit (RRMS), which is the modified sugar moiety. The cyclic support may be a carbocyclic system, i.e., one or more ring atoms may be heteroatoms, e.g., nitrogen, oxygen, sulfur. The cyclic support may be a monocyclic system or may include two or more rings, e.g., a fused ring. The cyclic support may be a fully saturated system or it may include one or more double bonds. In certain embodiments, the modified oligonucleotide is a gapmer.
[0304] In certain embodiments, the conjugated group imparts a novel property to the conjugated oligonucleotide, such as a fluorophore or reporter group that enables the detection of the oligonucleotide. Specific conjugate groups and conjugate moieties have been previously described, for example, the cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manohara et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), and thioethers, such as hexyl-S-tritylthiol (Manohara et al., Ann. NYA Acad. Sci. ,1992,660,306-309, Manohara et al., Bioorg. Med. Chem. Lett.,1993,3,2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res.,1992,20,533-538), aliphatic chains, e.g., do-decane-diol) or undecyl residues (Saison-Behmoarasetal., EMBOJ.,1991,10,1111-1118, Kabanovetal.,FEBSLe) tt.,1990,259,327-330, Svinarchuketal.,Biochimie,1993,75,49-54), phospholipids, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharanetal.,TetrahedronLett.,1995,36,3651-3654, Sheaetal.,Nucl.AcidsRes.,1990,18,3777- 3783), polyamine or polyethylene glycol chain (Manohara et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetate, palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crookeetal., J. Pharmacol. Exp. Ther.,1996,277,923-937), tocopherol group (Nishinaetal., Molecular Therapy Nucleic Acids, 2015,4,e220; and Nishinaetal., Molecular Therapy, 2008,16,734-740), and also. This is a GalNAc cluster (e.g., WO2014 / 179620).
[0305] In a particular embodiment, the conjugate group can be selected from any of the following: C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.
[0306] In certain embodiments, the conjugate group may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, and the alkyl chain has one or more unsaturated bonds.
[0307] 1. Conjugate portion The conjugate portion includes, but is not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, sugars (e.g., GalNAc), vitamin portions, polyethylene glycol, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid portions, folic acid, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluorescein, rhodamine, coumarin, fluorophores, and pigments.
[0308] In certain embodiments, the conjugate portion may contain an active ingredient, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansyl sarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazine, chlorothiazide, diazepine, indomethacin, barbiturates, cephalosporins, sulfonamides, antidiabetic drugs, antibacterial agents, or antibiotics.
[0309] 2. Conjugate Linker The conjugate portion is bonded to the oligonucleotide via a conjugate linker. In certain oligomeric compounds, the conjugate linker is a single bond (i.e., the conjugate portion is directly bonded to the oligonucleotide via a single bond). In certain embodiments, the conjugate linker includes a chain structure such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, a nucleoside, or an amino acid unit.
[0310] In certain embodiments, the conjugate linker contains pyrrolidine.
[0311] In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises a group selected from alkyl, amino, oxo, amide, and ether groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and ether groups. In certain embodiments, the conjugate linker The linker contains at least one phosphorus moiety. In certain embodiments, the conjugated linker contains at least one phosphate group. In certain embodiments, the conjugated linker contains at least one neutral bonding group.
[0312] In certain embodiments, conjugated linkers, including the conjugated linker described above, are known in the art to be useful as conjugated groups to compounds, such as difunctional linking moieties, for example, oligonucleotides provided herein. Generally, a difunctional linking moiety includes at least two functional groups. One of the functional groups is selected to bond to a specific site on the compound, and the other is selected to bond to a conjugate group. Examples of functional groups used in a difunctional linking moiety include, but are not limited to, electrophiles for reacting with nucleophiles and nucleophiles for reacting with electrophiles. In certain embodiments, the difunctional linking moiety includes one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl groups.
[0313] Examples of conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include substituted or unsubstituted C1-C 10Alkyl, substituted, or unsubstituted C2-C 10 Alkenyl, or substituted or unsubstituted C2-C 10 Alkynnyls are included, and a non-limiting list of preferred substituents includes, but is not limited to, hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.
[0314] In certain embodiments, the conjugate linker contains 1 to 10 linker nucleosides. In certain embodiments, the conjugate linker contains 2 to 5 linker nucleosides. In certain embodiments, the conjugate linker contains exactly 3 linker nucleosides. In certain embodiments, the conjugate linker contains a TCA motif. In certain embodiments, such linker nucleosides are modified nucleosides. In certain embodiments, such linker nucleosides contain a modified sugar moiety. In certain embodiments, the linker nucleosides are unmodified. In certain embodiments, the linker nucleosides contain a protected heterocyclic base selected from purines, substituted purines, pyrimidines, or substituted pyrimidines. In certain embodiments, the cleavable portion is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. It is generally desirable that the linker nucleoside be cleaved from the oligomer compound after reaching the target tissue. Therefore, the linker nucleosides are typically linked to each other and to the remainder of the oligomer compound via cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.
[0315] In this specification, linker nucleosides are not considered part of oligonucleotides. Therefore, in embodiments in which an oligomeric compound comprises an oligonucleotide consisting of a specific number or range of conjugated nucleosides and / or a specific complement (%) to a reference nucleic acid, and the oligomeric compound also comprises a conjugate group containing a conjugate linker with linker nucleosides, these linker nucleosides are not counted in the length of the oligonucleotide and are not used in determining the complement (%) of the oligonucleotide to the reference nucleic acid. For example, the oligomeric compound comprises (1) a modified oligonucleotide consisting of 8 to 30 nucleosides, and (2) a conjugate group containing 1 to 10 linker nucleosides consecutive to the nucleosides of the modified oligonucleotide. It may include. The total number of consecutively bonded nucleosides in such an oligomer compound is greater than 30. Alternatively, the oligomer compound may include a modified oligonucleotide consisting of 8 to 30 nucleosides and not containing a conjugate group. The total number of consecutively bonded nucleosides in such an oligomer compound is 30 or less. Unless otherwise indicated, the conjugate linker contains 10 or fewer linker nucleosides. In certain embodiments, the conjugate linker contains 5 or fewer linker nucleosides. In certain embodiments, the conjugate linker contains 3 or fewer linker nucleosides. In certain embodiments, the conjugate linker contains 2 or fewer linker nucleosides. In certain embodiments, the conjugate linker contains only 1 linker nucleoside.
[0316] In certain embodiments, it is desirable that the conjugate group be cleaved from the oligonucleotide. For example, in certain circumstances, an oligomeric compound containing a particular conjugate moiety is readily taken up by a particular cell type, but after the oligomeric compound is taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide. Therefore, a particular conjugate linker may contain one or more cleavable moieties. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is an atomic group containing at least one cleavable bond. In certain embodiments, the cleavable moiety includes an atomic group having one, two, three, four, or more than four cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved inside or within an intracellular compartment of a cell, such as a lysosome. In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme, such as a nuclease.
[0317] In certain embodiments, the cleavable bond is selected from amides, esters, ethers, one or both phosphodiesters, phosphate esters, carbamates, or disulfides. In certain embodiments, the cleavable bond is one or both phosphodiesters. In certain embodiments, the cleavable moiety includes phosphate or a phosphodiester. In certain embodiments, the cleavable moiety is a phosphate bond between the oligonucleotide and the conjugate moiety or conjugate group.
[0318] In certain embodiments, the cleavable portion comprises or consists of one or more linker nucleosides. In certain such embodiments, one or more linker nucleosides are bonded to each other and / or to the remainder of the oligomeric compound by cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, the cleavable portion is a 2'-deoxynucleoside bonded to either the 3' or 5' terminal nucleoside of the oligonucleotide by a phosphate nucleoside bond and covalently bonded to the conjugated linker or the remainder of the conjugated portion by a phosphate or phosphorothioate bond. In certain such embodiments, the cleavable portion is 2'-deoxyadenosine.
[0319] 3. Cell targeting part In certain embodiments, the conjugate group includes a cell-targeting moiety. In certain embodiments, the conjugate group has the following general formula:
[0320] [ka] In the formula, n is between 1 and approximately 3, m is 0 when n is 1, m is 1 when n is 2 or greater, j is 1 or 0, and k is 1 or 0.
[0321] In a particular embodiment, n is 1, j is 1, and k is 0. In a particular embodiment, n is 1, j is 0, and k is 1. In a particular embodiment, n is 1, j is 1, and k is 1. In a particular embodiment, n is 2, j is 1, and k is 0. In a particular embodiment, n is 2, j is 0, and k is 1. In a particular embodiment, n is 2, j is 1, and k is 1. In a particular embodiment, n is 3, j is 1, and k is 0. In a particular embodiment, n is 3, j is 0, and k is 1. In a particular embodiment, n is 3, j is 1, and k is 1.
[0322] In certain embodiments, the conjugate group comprises a cell-targeting moiety having at least one tether ligand. In certain embodiments, the cell-targeting moiety comprises two tether ligands covalently bonded to a branching group. In certain embodiments, the cell-targeting moiety comprises three tether ligands covalently bonded to a branching group.
[0323] In certain embodiments, each ligand of the cell targeting moiety has affinity for at least one receptor type on the target cell. In certain embodiments, each ligand has affinity for at least one receptor type on the surface of mammalian liver cells. In certain embodiments, each ligand has affinity for the hepatic glycoprotein receptor (ASGP-R). In certain embodiments, each ligand is a carbohydrate.
[0324] In certain embodiments, the cell targeting portion targets neurons. In certain embodiments, the cell targeting portion targets neurotransmitter receptors. In certain embodiments, the cell targeting portion targets neurotransmitter transporters. In certain embodiments, the cell targeting portion targets GABA transporters. See, for example, WO2011 / 131693 and WO2014 / 064257.
[0325] B. Specific terminal groups In certain embodiments, the oligomeric compound comprises one or more terminal groups. In certain such embodiments, the oligomeric compound comprises a stabilized 5'-phosphate. The stabilized 5'-phosphate comprises 5'-phosphonates, including but not limited to 5'-vinylphosphonates. In certain embodiments, the terminal group comprises one or more debasic sugar moieties and / or reverse nucleosides. In certain embodiments, the terminal group comprises one or more 2'-bonded nucleosides or sugar moieties. In certain such embodiments, the 2'-bonded group is a debasic sugar moiety.
[0326] III. Antisense Activation In certain embodiments, the oligomeric compound and the oligomeric double-strand can confer at least one antisense activity by hybridizing to a target nucleic acid. Such oligomeric compound and oligomeric double-strand are antisense compounds. In certain embodiments, the antisense compound has antisense activity if it reduces or inhibits the amount or activity of the target nucleic acid by 25% or more in a standard cell assay. In certain embodiments, The antisense compound selectively affects one or more target nucleic acids. Such an antisense compound comprises nucleic acid sequences that hybridize to one or more target nucleic acids to derive one or more desired antisense activities, but do not hybridize to one or more non-target nucleic acids, or do not hybridize to one or more non-target nucleic acids in a manner that results in significant undesirable antisense activity.
[0327] In certain antisense activities, hybridization of an antisense compound to a target nucleic acid results in the recruitment of a protein that cleaves the target nucleic acid. For example, certain antisense compounds result in RNaseH-mediated cleavage of the target nucleic acid. RNaseH is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA double helix. The DNA in such an RNA:DNA double helix does not need to be unmodified DNA. In certain embodiments, antisense compounds that are sufficiently "DNA-like" to induce RNaseH activity are described herein. In certain embodiments, one or more non-DNA-like nucleosides within the gapmer gap are acceptable.
[0328] In certain antisense activities, the antisense compound or a portion of the antisense compound is incorporated into the RNA-induced silencing complex (RISC), ultimately leading to cleavage of the target nucleic acid. For example, certain antisense compounds result in cleavage of the target nucleic acid by Argonaut. The antisense compound loaded into the RISC is an RNAi compound. RNAi compounds can be double-stranded (siRNA or dsRNAi) or single-stranded (ssRNA).
[0329] In certain embodiments, hybridization of an antisense compound to a target nucleic acid does not result in the recruitment of proteins that cleave the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in a change in the splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in the inhibition of the binding interaction between the target nucleic acid and proteins or other nucleic acids. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in a change in the translation of the target nucleic acid.
[0330] Antisense activity can be observed directly or indirectly. In certain embodiments, observation or detection of antisense activity involves observing or detecting changes in the amount of a target nucleic acid or the amount of protein encoded by such a target nucleic acid, changes in the ratio of splice variants of the nucleic acid or protein, and / or changes in phenotype in cells or animals.
[0331] IV. A specific target nucleic acid In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide containing a region complementary to the target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from mature mRNA and premRNA (including introns, exons, and untranslated regions). In certain embodiments, the target RNA is mature mRNA. In certain embodiments, the target nucleic acid is premRNA. In certain embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, at least 50% of the target region is within an intron. In certain embodiments, the target nucleic acid is an RNA transcript of a retrogene. In certain embodiments, the target nucleic acid is non-coding RNA. In certain embodiments, the target non-coding RNA is selected from long non-coding RNA, short non-coding RNA, and intron RNA molecules.
[0332] A. Complementarity / mismatch for target nucleic acids and double-strand complementarity In certain embodiments, the oligonucleotide is complementary to the target nucleic acid throughout its entire length. In certain embodiments, the oligonucleotide is 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, the oligonucleotide is at least 80% complementary to the target nucleic acid throughout its entire length and includes regions that are 100% or completely complementary to the target nucleic acid. In certain embodiments, the regions of complete complementarity are nucleic acid bases with lengths of 6–20, 10–18, or 18–20.
[0333] It is possible to introduce mismatched bases without losing activity. For example, Gautschi et al (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated that an oligonucleotide with 100% complementarity to bcl-2 mRNA and three mismatches to bcl-xL mRNA could reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide also showed potent antitumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested tandem oligonucleotides consisting of a series of 14 nucleic acid bases, as well as oligonucleotides consisting of 28 nucleic acid bases and 42 nucleic acid bases, each consisting of two or three sequences from the tandem oligonucleotides, for their ability to halt human DHFR translation in a rabbit reticulocyte assay. Each of the three 14-nucleotide oligonucleotides could inhibit translation individually, although at lower levels than the 28- or 42-nucleotide oligonucleotides.
[0334] In certain embodiments, the oligonucleotide contains one or more mismatched nucleic acid bases with respect to the target nucleic acid. In certain embodiments, the antisense activity against the target is reduced by such mismatch, but the activity against the non-target is reduced by a greater amount. Thus, in certain embodiments, the selectivity of the oligonucleotide is improved. In certain embodiments, the mismatch is specifically located within the oligonucleotide having a gapmer motif. In certain embodiments, the mismatch is located at positions 1, 2, 3, 4, 5, 6, 7, or 8 from the 5' end of the gap region. In certain embodiments, the mismatch is located at positions 9, 8, 7, 6, 5, 4, 3, 2, or 1 from the 3' end of the gap region. In certain embodiments, the mismatch is located at positions 1, 2, 3, or 4 from the 5' end of the wing region. In certain embodiments, the mismatch is located at positions 4, 3, 2, or 1 from the 3' end of the wing region.
[0335] B.APP In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide containing a region complementary to a target nucleic acid, wherein the target nucleic acid is APP. In certain embodiments, the APP nucleic acid has the sequence described in SEQ ID NO: 1 (cDNA of Ensembl transcript ENST00000346798.7, version 94:2018) or a complement of SEQ ID NO: 2 (GenBank accession number NC_00021.9, with nucleotides 25878001-26174000 cleaved). In certain embodiments, the APP nucleic acid has a sequence described in any of the known splice variants of APP, including but not limited to SEQ ID NO: 3 (cDNA of Ensembl transcript ENST00000357903.7), SEQ ID NO: 4 (cDNA of Ensembl transcript ENST00000348990.9), SEQ ID NO: 5 (cDNA of Ensembl transcript ENST00000440126.7), SEQ ID NO: 6 (cDNA of Ensembl transcript ENST00000354192.7), SEQ ID NO: 7 (cDNA of Ensembl transcript ENST00000358918.7, version 94: October 2018), and / or SEQ ID NO: 8 (GenBank accession number NM_201414.2). In certain embodiments, the cells have a sequence described in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 Contact with an oligomeric compound complementary to SEQ ID NO: 7 or SEQ ID NO: 8 reduces the amount of APP RNA, and in certain embodiments, reduces the amount of APP protein. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, contact with an oligomeric compound complementary to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, or SEQ ID NO: 8 reduces β-amyloid aggregation. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide and a conjugated group.
[0336] C. Specific target nucleic acids in specific tissues In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide having a region complementary to the target nucleic acid, the target nucleic acid being expressed in a pharmacologically relevant tissue. In certain embodiments, the pharmacologically relevant tissue is the cells and tissues that make up the central nervous system. Such tissues include the cortex and the hippocampus. Such cells include cortical brain cells and hippocampal cells. In certain embodiments, such cells include cells within the limbic system, e.g., cells within the hippocampus, amygdala, and / or parahippocampal gyrus.
[0337] V. Specific Pharmaceutical Compositions In certain embodiments, pharmaceutical compositions comprising one or more oligomeric compounds are provided herein. In certain embodiments, the one or more oligomeric compounds each consist of a modified oligonucleotide. In certain embodiments, the pharmaceutical composition includes a pharmaceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises or consists of sterile saline and one or more oligomeric compounds. In certain embodiments, the sterile saline is pharmaceutical-grade saline. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and sterile water. In certain embodiments, the sterile water is pharmaceutical-grade water. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and phosphate-buffered saline (PBS). In certain embodiments, the sterile PBS is pharmaceutical-grade PBS. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical-grade.
[0338] In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition essentially consists of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.
[0339] In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and one or more excipients. In certain such embodiments, the excipients are selected from water, saline solution, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.
[0340] In certain embodiments, the oligomeric compound may be mixed with pharmaceutically acceptable active and / or inactive substances for the preparation of a pharmaceutical composition or formulation. The compositions and methods for formulating a pharmaceutical composition depend on several criteria, including, but not limited to, the route of administration, the severity of the disease or impairment, or the dose administered.
[0341] In certain embodiments, the pharmaceutical composition comprising the oligomeric compound comprises any pharmaceutically acceptable salt of the oligomeric compound, an ester of the oligomeric compound, or a salt of such ester. In certain embodiments, it comprises one or more oligonucleotides. Pharmaceutical compositions containing oligomeric compounds can provide (directly or indirectly) biologically active metabolites or their residues when administered to animals, including humans. Therefore, for example, this disclosure also covers pharmaceutically acceptable salts, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents of oligomeric compounds. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In certain embodiments, the prodrug comprises one or more conjugate groups bonded to an oligonucleotide, which are cleaved by endogenous nucleases in the body.
[0342] Lipid moieties are used in nucleic acid therapy in various ways. In certain such methods, nucleic acids, such as oligomeric compounds, are introduced into pre-formed liposomes or lipoplexes prepared from a mixture of cationic and neutral lipids. In certain methods, DNA complexes with mono- or polycationic lipids are formed in the absence of neutral lipids. In certain embodiments, lipid moieties are selected to increase the distribution of a drug to specific cells or tissues. In certain embodiments, lipid moieties are selected to increase the distribution of a drug to adipose tissue. In certain embodiments, lipid moieties are selected to increase the distribution of a drug to muscle tissue.
[0343] In certain embodiments, the pharmaceutical composition includes a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions, including those containing hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethyl sulfoxide, are used.
[0344] In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more pharmaceuticals of the present invention to a specific tissue or cell type. For example, in certain embodiments, the pharmaceutical composition comprises liposomes coated with tissue-specific antibodies.
[0345] In certain embodiments, the pharmaceutical composition includes a cosolvent system. Certain such cosolvent systems include, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such a cosolvent system is used for hydrophobic compounds. A non-limiting example of such a cosolvent system is the VPD cosolvent system, which is a solution of anhydrous ethanol containing 3% w / v benzyl alcohol, 8% w / v nonpolar surfactant Polysorbate 80™, and 65% w / v polyethylene glycol 300. The proportions of such cosolvent systems can be varied considerably without significantly altering their solubility and toxicity properties. Furthermore, the identity of the cosolvent components can be varied; for example, other surfactants may be used instead of Polysorbate 80™; the fraction size of polyethylene glycol can be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinylpyrrolidone; and other sugars or polysaccharides may replace dextrose.
[0346] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for buccal administration. In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intraventricular (ICV), etc.). In certain such embodiments, the pharmaceutical composition comprises a carrier and is formulated in an aqueous solution such as water, or in a physiologically compatible buffer such as Hanks' solution, Ringer's solution, or saline buffer. In certain embodiments, other components are included (e.g., components that aid solubility or serve as preservatives). In certain embodiments, the injectable suspension is prepared using a suitable liquid carrier, suspension, etc. Certain pharmaceutical compositions for injection are provided in unit dosage forms, for example, in ampoule units or in multi-dose containers. Certain pharmaceutical compositions for injection are provided in an oily or aqueous vehicle The substance may be a suspension, solution, or emulsion containing formulation agents such as suspending agents, stabilizers, and / or dispersants. Specific solvents suitable for use in injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents and fatty oils (e.g., sesame oil), synthetic fatty acid esters (e.g., ethyl oleate or triglycerides), and liposomes.
[0347] VI. Specific Compositions 1. Compound number 1353686 In a particular embodiment, compound number 1353686 is a 5-10-5 MOE gapmer having the sequence (5' to 3') of GCATTCTCTTATATTCCTTA (SEQ ID NO: 273), where each of nucleosides 1-5 and 16-20 (5' to 3') is a 2'-MOE nucleoside, each of nucleosides 6-15 is a 2'-β-D-deoxynucleoside, and nucleosides 2-3, 3-4, 4-5, 1 The internucleoside bonds between nucleosides 6-17 and 17-18 are phosphodiester internucleoside bonds, and the internucleoside bonds between nucleosides 1-2, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate internucleoside bonds, and each cytosine is characterized as 5-methylcytosine.
[0348] In certain embodiments, compound number 1353686 is represented by the following chemical notation (from 5' to 3'): G es m C eo A eo T eo T es m C ds T ds m C ds T ds T ds A ds T ds A ds T ds T ds m C eom C eo T es T es A e (Sequence No. 273) (In the formula, A is an adenine nucleic acid base, m C is a 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, and (o is a phosphodiester nucleoside bond).
[0349] In certain embodiments, compound 1353686 is represented by the following chemical structure:
[0350] [ka] Sequence ID 273.
[0351] Structure 1. Compound number 1353686 In certain embodiments, the sodium salt of compound 1353686 is represented by the following chemical structure:
[0352] [ka] Sequence ID 273.
[0353] Structure 2. Sodium salt of compound number 1353686 2. Compound number 1353884 In a particular embodiment, compound number 1353884 is a 5-10-5 MOE gapmer having the sequence (5' to 3') of GTTTACCTTTAACATTCCTC (SEQ ID NO: 452), where each of nucleosides 1-5 and 16-20 (5' to 3') is a 2'-MOE nucleoside, each of nucleosides 6-15 is a 2'-β-D-deoxynucleoside, and nucleosides 2-3, 3-4, 4-5, 1 The internucleoside bonds between nucleosides 6-17 and 17-18 are phosphodiester internucleoside bonds, and the internucleoside bonds between nucleosides 1-2, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate internucleoside bonds, and each cytosine is characterized as 5-methylcytosine.
[0354] In certain embodiments, compound number 1353884 is represented by the following chemical notation (5' to 3'): G es T eo T eo T eo A es m C ds m C ds T ds T ds T ds A ds A ds m C ds A ds T ds T eo m C eo m C es T es m C e (Sequence code 452) (In the formula, A is an adenine nucleic acid base, m C is a 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, and (o is a phosphodiester nucleoside bond).
[0355] In certain embodiments, compound 1353884 is represented by the following chemical structure:
[0356] [ka] (Sequence ID 452).
[0357] Structure 3. Compound number 1353884 In certain embodiments, the sodium salt of compound 1353884 is represented by the following chemical structure:
[0358] [ka] (Sequence ID 452).
[0359] Structure 4. Sodium salt of compound number 1353884 3. Compound number 1353931 In a particular embodiment, compound number 1353931 is a 5-10-5 MOE gapmer having the sequence (5' to 3') of GCCATATTGTCATTTTACAC (sequence number 462), where each of nucleosides 1-5 and 16-20 (5' to 3') is a 2'-MOE nucleoside, each of nucleosides 6-15 is a 2'-β-D-deoxynucleoside, and nucleosides 2-3, 3-4, 4-5, 1 The internucleoside bonds between nucleosides 6-17 and 17-18 are phosphodiester internucleoside bonds, and the internucleoside bonds between nucleosides 1-2, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate internucleoside bonds, and each cytosine is characterized as 5-methylcytosine.
[0360] In certain embodiments, compound number 1353931 is represented by the following chemical notation (from 5' to 3'): G es m C eo m C eo A eo T es A ds T ds T ds G ds T ds m C ds A ds T ds T ds T ds T eo A eo m C es A es m C e (Sequence code 462) (In the formula, A is an adenine nucleic acid base, m C is a 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, and (o is a phosphodiester nucleoside bond).
[0361] In certain embodiments, compound 1353931 is represented by the following chemical structure:
[0362] [ka] (Sequence number: 462).
[0363] Structure 5. Compound number 1353931 In certain embodiments, the sodium salt of compound 1353931 is represented by the following chemical structure:
[0364] [ka] (Sequence number: 462).
[0365] Structure 6. Sodium salt of compound number 1353931 4. Compound number 1354035 In a particular embodiment, compound number 1354035 is a 5-10-5 MOE gapmer having the sequence (5' to 3') of GTATCCTCTTAATTCCTATA (SEQ ID NO: 482), where each of nucleosides 1-5 and 16-20 (5' to 3') is a 2'-MOE nucleoside, each of nucleosides 6-15 is a 2'-β-D-deoxynucleoside, and nucleosides 2-3, 3-4, 4-5, 1 The internucleoside bonds between nucleosides 6-17 and 17-18 are phosphodiester internucleoside bonds, and the internucleoside bonds between nucleosides 1-2, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate internucleoside bonds, and each cytosine is characterized as 5-methylcytosine.
[0366] In certain embodiments, compound number 1354035 is represented by the following chemical notation (5' to 3'): G es T eo A eo T eo m C es m C ds T ds m C ds T ds T ds A ds A ds T ds T ds m C ds m Ceo T eo A es T es A e (Sequence No. 482) (In the formula, A is an adenine nucleic acid base, m C is a 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, and (o is a phosphodiester nucleoside bond).
[0367] In certain embodiments, compound 1354035 is represented by the following chemical structure:
[0368] [ka] (Sequence number: 482).
[0369] Structure 7. Compound number 1354035 In certain embodiments, the sodium salt of compound 1354035 is represented by the following chemical structure:
[0370] [ka] (Sequence number: 482).
[0371] Structure 8. Sodium salt of compound number 1354035 5. Compound number 1398227 In a particular embodiment, compound number 1398227 is a 5-10-5 MOE gapmer having the sequence (5' to 3') of CTCCAATTTTAACTTGCACC (SEQ ID NO: 1064), where each of nucleosides 1-5 and 16-20 (5' to 3') is a 2'-MOE nucleoside, and each of nucleosides 6-15 is a 2'-β-D-deoxynucleoside, and nucleosides 2-3, 3-4, 4-5, The internucleoside bonds between nucleosides 16-17 and 17-18 are phosphodiester internucleoside bonds, and the internucleoside bonds between nucleosides 1-2, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate internucleoside bonds, and each cytosine is characterized as 5-methylcytosine.
[0372] In certain embodiments, compound number 1398227 is represented by the following chemical notation (from 5' to 3'): m C es T eo m C eo m C eo A es A ds T ds T ds T ds T ds A ds A ds m C ds T ds T ds G eo m C eo A es m C es m C e (Sequence code 1064) (In the formula, A is an adenine nucleic acid base, m C is a 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, and (o is a phosphodiester nucleoside bond).
[0373] In certain embodiments, compound 1398227 is represented by the following chemical structure:
[0374] [ka] (Sequence ID: 1064).
[0375] Structure 9. Compound number 1398227 In certain embodiments, the sodium salt of compound 1398227 is represented by the following chemical structure:
[0376] [ka] (Sequence ID: 1064).
[0377] Structure 10. Sodium salt of compound number 1398227 6. Compound number 1398456 In a particular embodiment, compound number 1398456 is a 5-10-5 MOE gapmer having the sequence (5' to 3') of GTTCACAGTTTACCCCAAGC (SEQ ID NO: 2225), where each of nucleosides 1-5 and 16-20 (5' to 3') is a 2'-MOE nucleoside, each of nucleosides 6-15 is a 2'-β-D-deoxynucleoside, and nucleosides 2-3, 3-4, 4-5, The internucleoside bonds between nucleosides 16-17 and 17-18 are phosphodiester internucleoside bonds, and the internucleoside bonds between nucleosides 1-2, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate internucleoside bonds, and each cytosine is characterized as 5-methylcytosine.
[0378] In certain embodiments, compound number 1398456 is represented by the following chemical notation (5' to 3'): G es T eo T eo m C eo A es m C ds A ds G ds T ds T ds T ds A ds m C ds m C ds m C ds m C eo A eo A es G es m C e (Sequence No. 2225) (In the formula, A is an adenine nucleic acid base, m C is a 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, and (o is a phosphodiester nucleoside bond).
[0379] In certain embodiments, compound 1398456 is represented by the following chemical structure:
[0380] [ka] (Sequence number: 2225).
[0381] Structure 11. Compound number 1398456 In certain embodiments, the sodium salt of compound 1398456 is represented by the following chemical structure:
[0382] [ka] (Sequence number: 2225).
[0383] Structure 12. Sodium salt of compound number 1398456 Under certain conditions, certain compounds disclosed herein function as acids. Such compounds may be illustrated or described in protonated (free acid) form or in ionized and associated with a cation (salt) form, but aqueous solutions of such compounds exist in equilibrium between these forms. For example, the phosphate bond of an oligonucleotide in aqueous solution exists in equilibrium between free acid, anionic, and salt forms. Unless otherwise indicated, the compounds disclosed herein are intended to include all such forms. Furthermore, certain oligonucleotides have several such bonds, each in equilibrium. Thus, oligonucleotides in solution all exist in equilibrium in ensemble forms at multiple positions. The term “oligonucleotide” is intended to include all such forms. Illustrated structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such drawings are also intended to include the corresponding form. In this specification, when the term “its salt” follows a structure depicting the free acid of a compound, it expressly includes all such forms, which may be fully or partially protonated / deprotonated / associated with a cation. In certain cases, one or more specific cations are identified.
[0384] In certain embodiments, the modified oligonucleotide or oligomer compound is in an aqueous solution containing sodium. In certain embodiments, the modified oligonucleotide or oligomer compound is in an aqueous solution containing potassium. In certain embodiments, the modified oligonucleotide or oligomer compound is in PBS. In certain embodiments, the modified oligonucleotide The ocide or oligomeric compound is in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and / or HCl to achieve the desired pH.
[0385] In this specification, certain doses are described. Dose may be in the form of a dosage unit. For clarity, a dose (or dosage unit) of a modified oligonucleotide or oligomer compound in milligrams represents the mass of the free acid form of the modified oligonucleotide or oligomer compound. As described above, in aqueous solution, the free acid is in equilibrium with the anionic and salt forms. However, for the purpose of calculating doses, it is assumed that the modified oligonucleotide or oligomer compound exists as solvent-free, sodium acetate-free, anhydrous, and free acid. For example, if the modified oligonucleotide or oligomer compound is in a sodium-containing solution (e.g., physiological saline), the modified oligonucleotide or oligomer compound may be partially or completely deprotonated and associate with Na+ ions. However, the mass of the proton is still counted in the weight of the dose, while the mass of the Na+ ion is not. Therefore, for example, a dose or dosage unit of 10 mg of several fully protonated molecules is weighed as 10 mg. This corresponds to 10.59 mg of solvent-free, sodium acetate-free, anhydrous sodium compound numbers 1353686, 1353884, 1353931, 1354035, 1398227, or 1398456. If the oligomeric compound contains a conjugate group, the mass of the conjugate group is included in the calculation of the dose of such oligomeric compound. If the conjugate group also has an acid, the conjugate group is also assumed to be fully protonated for the purpose of calculating the dose.
[0386] VII. Specific Comparative Compositions In certain embodiments, compound number 1369631, disclosed as APP2585 in WO / 2005 / 042777 (incorporated herein by reference), is a comparative compound. Compound number 1369631 is a 5-8-5 ENA-modified oligonucleotide having the nucleic acid base sequence (5' to 3') TCATGTGCATGTTCAGTC (incorporated herein by reference as SEQ ID NO 3070). Compound number 1369631 has a sugar motif (5' to 3') aaaaaddddddddaaaaa, where each "a" represents an ENA sugar moiety and each "d" represents a 2'-β-D-deoxyribosyl sugar moiety. Compound number 1369631 has a nucleoside-to-nucleoside linkage motif (5' to 3'): ssssssssssssssssss, where each "s" represents a phosphorothioate nucleoside linkage. Each cytosine residue in compound number 1369631 is 5-methylcytosine.
[0387] Compound number 1369632, disclosed as "APP2-666" in WO / 2005 / 042777 in certain embodiments, is a comparative compound. Compound number 1369632 is a 6-6-6 ENA-modified oligonucleotide having the nucleic acid base sequence (5' to 3') TCATGTGCATGTTCAGTC (SEQ ID NO: 3070). Compound number 1369632 has a sugar motif (5' to 3') aaaaaaddddddaaaaaa, where each "a" represents the ENA sugar moiety and each "d" represents the 2'-β-D-deoxyribosyl sugar moiety. Compound number 1369632 has a nucleoside-to-nucleoside bond motif (5' to 3'): ssssssssssssssssss, where each "s" represents the phosphorothioate nucleoside bond. Each cytosine residue in compound number 1369632 is 5-methylcytosine.
[0388] In certain embodiments, compound number 156352, disclosed in US2003 / 0232435 (incorporated herein by reference), is a comparative compound. Compound number 156352 is a 5-10-5 MOE gapmer having the nucleic acid base sequence (5' to 3') TGTCACTTTCTTCAGCCAGT (incorporated herein as SEQ ID NO: 3071). Compound number 156352 has a sugar motif (5' to 3') eeee Compound 156352 has eddddddddddeeeee, where each "d" represents the 2'-β-D-deoxyribosyl sugar moiety and each "e" represents the 2'-MOE sugar moiety. Compound number 156352 has an internucleoside bonding motif (5' to 3'): sssssssssssssssssss, where each "s" represents a phosphorothioate internucleoside bond. Each cytosine residue in compound number 156352 is 5-methylcytosine.
[0389] In certain embodiments, the compounds described herein are superior to the compounds described in WO / 2005 / 042777 and US2003 / 0232435 in that they exhibit one or more improved properties.
[0390] For example, as provided in Examples 7, 17, and 28, compounds 1353686, 1353884, 1353931, and 1354035 showed 3-hour functional observation battery (FOB) scores of 0, 0, 1.33, and 0 in mice, respectively, while comparative compounds 1369631, 1369632, and 156352 showed FOB scores of 6, 2.5, and 6, respectively. Compounds 1353686, 1353884, 1353931, and 1354035 are clearly more tolerable in this assay than comparative compounds 1369631, 1369632, and 156352, respectively.
[0391] For example, as shown in Example 27, in a standard cell assay using SH-SY5Y cells, compound number 1398227 showed an 81% reduction in APP RNA in vitro, compound number 1398456 showed an 84% reduction in APP RNA, while comparative compound number 1369632 showed a 15% reduction in APP RNA. Compound numbers 1398227 and 1398456 are clearly more active than comparative compound number 1369632 in this assay.
[0392] VIII. Specific Hotspot Areas a. Nucleic acid bases 12566-12609 of Sequence ID No. 2 In certain embodiments, nucleic acid bases 12566-12609 of SEQ ID NO: 2 include a hotspot region (hotspot number 5). In certain embodiments, the modified oligonucleotide is complementary within nucleic acid bases 12566-12609 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is a 20-length nucleic acid base. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the modified oligonucleotide is a 5-10-5 or 6-10-4 gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the modified oligonucleotide has a sugar motif eeeeeddddddddddeeeee, where each "e" is a nucleoside containing a 2'-MOE sugar moiety and each "d" is a nucleoside containing a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide has a sugar motif eeeeeeddddddddddeeee, where each "e" is a nucleoside containing a 2'-MOE sugar moiety and each "d" is a nucleoside containing a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate nucleoside bonds and phosphodiester nucleoside bonds. In certain embodiments, the nucleoside bonds of the phosphodiester ("o") and phosphorothioate ("s") are arranged from 5' to 3' in the order sooossssssssssssooss or soooooosssssssssssss.
[0393] The nucleic acid base sequences of SEQ ID NOs. 273, 744, 824, 898, and 1025 are complementary within nucleic acid bases 12566-12609 of SEQ ID NO: 2.
[0394] Compounds 1353686, 1397821, 1397908, 1398005, 1399 362 and 1539870 are complementary within nucleic acid bases 12566-12609 of Sequence ID No. 2.
[0395] In certain embodiments, complementary modified oligonucleotides within nucleic acid bases 12566-12609 of SEQ ID NO: 2 achieve at least a 49% reduction in APP RNA in vitro in a standard cell assay in SH-SY5Y cells. In certain embodiments, complementary modified oligonucleotides within nucleic acid bases 12566-12609 of SEQ ID NO: 2 achieve an average 69% reduction in APP RNA in vitro in a standard cell assay in SH-SY5Y cells.
[0396] b. Nucleic acid bases of Sequence ID No. 2: 158596-158982 In certain embodiments, nucleic acid bases 158596-158982 of SEQ ID NO: 2 include a hotspot region (hotspot number 9). In certain embodiments, the modified oligonucleotide is complementary within nucleic acid bases 158596-158982 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 20 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the modified oligonucleotide is a 5-10-5 or 6-10-4 gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the modified oligonucleotide has a sugar motif eeeeeddddddddddeeeee, where each "e" is a nucleoside containing a 2'-MOE sugar moiety and each "d" is a nucleoside containing a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide has a sugar motif eeeeeeddddddddddeeee, where each "e" is a nucleoside containing a 2'-MOE sugar moiety and each "d" is a nucleoside containing a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate nucleoside bonds and phosphodiester nucleoside bonds. In certain embodiments, the nucleoside bonds of the phosphodiester ("o") and phosphorothioate ("s") are arranged from 5' to 3' in the order sooossssssssssssooss or soooooosssssssssssss.
[0397] The nucleic acid base sequences of SEQ ID NOs. 178, 547, 577, 693, 769, 846, 2225, 2480, and 3047-30505 are complementary within the nucleic acid bases 158596-158982 of SEQ ID NO. 2.
[0398] Compounds 1354057, 1397573, 1398456, 1398549, 1398604, 1398618, 1398913, 1399136, 1539237-1539240, and 1539867 are complementary within the nucleic acid bases 158596-158982 of SEQ ID NO: 2.
[0399] In certain embodiments, complementary modified oligonucleotides within nucleic acid bases 158596-158982 of SEQ ID NO: 2 achieve at least a 60% reduction in APP RNA in vitro in a standard cell assay in SH-SY5Y cells. In certain embodiments, complementary modified oligonucleotides within nucleic acid bases 12566-12609 of SEQ ID NO: 2 achieve an average 73% reduction in APP RNA in vitro in a standard cell assay in SH-SY5Y cells.
[0400] c. Nucleic acid bases of Sequence ID No. 2: 292896~292922 In certain embodiments, nucleic acid bases 292896-292922 of SEQ ID NO: 2 include a hotspot region (hotspot number 32). In certain embodiments, the modified oligonucleotide is complementary within nucleic acid bases 292896-292922 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is a 20-length nucleic acid base. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the modified oligonucleotide is a 5-10-5 gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the modified oligonucleotide has a sugar motif eeeeeddddddddddeeeee, where each "e" is a nucleoside containing a 2'-MOE sugar moiety and each "d" is a nucleoside containing a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the nucleosides of the modified oligonucleotide are linked by phosphorothioate nucleoside bonds and phosphodiester nucleoside bonds. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") nucleoside bonds are arranged in the order sooosssssssssssooss from 5' to 3'.
[0401] The nucleic acid base sequences of SEQ ID NOs. 35, 411, and 482 are complementary within the nucleic acid bases 292896-292922 of SEQ ID NO. 2.
[0402] Compounds 1354044, 1354035, and 1353677 are complementary within the nucleic acid bases 292896–292922 of Sequence ID No. 2.
[0403] In certain embodiments, complementary modified oligonucleotides within nucleic acid bases 292896-292922 of SEQ ID NO: 2 achieve at least a 65% reduction in APP RNA in vitro in a standard cell assay in SH-SY5Y cells. In certain embodiments, complementary modified oligonucleotides within nucleic acid bases 292896-292922 of SEQ ID NO: 2 achieve an average 71% reduction in APP RNA in vitro in a standard cell assay in SH-SY5Y cells.
[0404] d. Additional hotspot areas In certain embodiments, the ranges listed in the following table include hotspot regions, including those described above. Each hotspot region begins with the nucleic acid base of SEQ ID NO: 2, as identified in the "Start Site SEQ ID NO: 2" column, and ends with the nucleic acid base of SEQ ID NO: 2, as identified in the "End Site SEQ ID NO: 2" column. In certain embodiments, the oligomer compound includes a modified oligonucleotide that is complementary to one of the hotspot regions 1 to 32, as defined in the following table. In certain embodiments, the modified oligonucleotide is 16 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 20 nucleic acid bases long.
[0405] In certain embodiments, the oligomeric compound comprises a modified oligonucleotide that is a gapmer. In certain embodiments, the modified oligonucleotide has a sugar motif eeeeeddddddddddeeeee, where each "e" is a nucleoside containing a 2'-MOE sugar moiety and each "d" is a nucleoside containing a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide has a sugar motif eeeeeeddddddddddeeee, where each "e" is a nucleoside containing a 2'-MOE sugar moiety and each "d" is a nucleoside containing a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide has a sugar motif kkkddddddddddkkk, where each "k" is a nucleoside containing a cEt sugar moiety and each "d" is a nucleoside containing a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide has a sugar motif kkkdyddddddddkkk, where each "y" is a nucleoside containing a 2'-OMe sugar moiety, each "k" is a nucleoside containing a cEt sugar moiety, and each "d" is a nucleoside containing a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide is a 5-10-5 or 6-10-4 MOE gapmer. In certain embodiments, the modified oligonucleotide is The 3-10-3 cEt gapmer is a gapmer. In certain embodiments, the gapmer contains a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside contains a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is located at position 2 (from 5' to 3') of the gap.
[0406] In certain embodiments, the nucleoside-to-nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds and phosphodiester nucleoside bonds. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") nucleoside bonds are arranged in 5' to 3' order: In certain embodiments, the modified nucleotide has a nucleoside-to-
[0407] In certain embodiments, modified oligonucleotides complementary to the nucleoside bases within the in vitro hotspot region achieve at least "minimum in vitro reduction %" (minimum reduction %) in APP RNA in vitro in a standard cell assay in SH-SY5Y and / or A431 cells, as shown in the table below. In certain embodiments, modified oligonucleotides complementary to the nucleoside bases within the hotspot region achieve the average "mean in vitro reduction %" (average reduction %) in APP RNA in vitro in a standard cell assay in SH-SY5Y and / or A431 cells, as shown in the table below. In certain embodiments, modified oligonucleotides complementary to the nucleoside bases within the hotspot region achieve the maximum "maximum in vitro reduction %" (maximum reduction %) in APP RNA in vitro in a standard cell assay in SH-SY5Y and / or A431 cells, as shown in the table below.
[0408] [Table 1-1]
[0409] [Table 1-2]
[0410] [Table 1-3]
[0411] [Table 1-4]
[0412] [Table 1-5]
[0413] [Table 1-6]
[0414] [Table 1-7]
[0415] [Table 1-8] IX. Specific RNAi compositions In certain embodiments, the oligomeric duplex comprises a first oligomeric compound containing a first modified oligonucleotide and a second oligomeric compound containing a second modified oligonucleotide. In certain embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide, and the second modified oligonucleotide is a sense RNAi oligonucleotide. In certain embodiments, the oligomeric duplex comprises an antisense RNAi oligonucleotide complementary to human APP nucleic acid and a sense oligonucleotide complementary to the antisense RNAi oligonucleotide.
[0416] In certain embodiments, compound number 1581405 is an oligomeric double-strand comprising a first oligomeric compound containing antisense RNAi oligonucleotide compound number 1551732 and a second oligomeric compound containing sense RNAi oligonucleotide compound number 1579196. In certain embodiments, compound number 1581406 is a first oligomeric compound containing antisense RNAi oligonucleotide compound number 1551735 and a second oligomeric compound containing sense RNAi oligonucleotide compound number 1551736. The compounds are oligomeric double-stranded. In certain embodiments, compound number 1581407 is an oligomeric double-stranded compound comprising a first oligomeric compound containing antisense RNAi oligonucleotide compound number 1551737 and a second oligomeric compound containing sense RNAi oligonucleotide compound number 1551741. In certain embodiments, compound number 1581408 is an oligomeric double-stranded compound comprising a first oligomeric compound containing antisense RNAi oligonucleotide compound number 1551739 and a second oligomeric compound containing sense RNAi oligonucleotide compound number 1551740. In certain embodiments, compound number 1581409 is an oligomeric double-stranded compound comprising a first oligomeric compound containing antisense RNAi oligonucleotide compound number 1551742 and a second oligomeric compound containing sense RNAi oligonucleotide compound number 1551743. In a particular embodiment, compound number 1581410 is an oligomeric double-strand comprising a first oligomeric compound containing antisense RNAi oligonucleotide compound number 1551744 and a second oligomeric compound containing sense RNAi oligonucleotide compound number 1551745.
[0417] A specific oligomeric double chain comprises a first oligomeric compound containing a first modified alkyl group and a second oligomeric compound containing a second modified alkyl group, according to the chemical notation shown in Table B below. As shown in Table B: A is an adenine nucleic acid base, C is a cytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, U is a uracil nucleic acid base. e is the 2'MOE sugar moiety, y is the 2'-O-methylliposyl sugar moiety, f is the 2'-fluoroliposyl sugar moiety, s is a phosphorothioate nucleoside bond, o is a phosphodiester nucleoside bond, C16muP is a hexadecanesulfonyl phosphoramide nucleoside bond, and VP is 5'-vinylphosphonate.
[0418] [Table 2]
[0419] Non-exclusive disclosure and referential use by reference Each of the documents and patent publications listed herein is incorporated in their entirety by reference. While certain compounds, compositions, and methods described herein are specifically described according to certain embodiments, the following examples are merely illustrative of the compounds described herein and are not intended to limit them. Each of the references, GenBank accession numbers, and ENSEMBL identification numbers listed in this application is incorporated in their entirety by reference.
[0420] The sequence listings attached to this application identify each sequence as either "RNA" or "DNA" where necessary, but in practice, these sequences can be modified by any combination of chemical modifications. Those skilled in the art will immediately understand that the designation of "RNA" or "DNA" for describing modified oligonucleotides is optional in certain cases. For example, an oligonucleotide containing a nucleoside with a 2'-OH sugar moiety and a thymine base can be described as DNA having a modified sugar (a 2'-OH instead of one 2'-H in DNA) or as RNA having a modified base (thymine (methylated uracil) instead of uracil in RNA). Therefore, nucleic acid sequences provided herein, including but not limited to those in the sequence listings, are intended to encompass nucleic acids containing any combination of natural or modified RNA and / or DNA, including but not limited to those containing modified nucleic acid bases. As further examples, without limitation, oligomeric compounds having the nucleic acid base sequence "ATCGATCG" include, but are not limited to, compounds containing RNA bases, such as those having the sequence "AUCGAUCG" and those having several DNA bases and several RNA bases such as "AUCGATCG", as well as "AT m CGAUCG" (in the notation, m C represents a cytosine base with a methyl group at the 5th position, and other modifications such as This includes any oligomeric compound having such a nucleic acid base sequence, including oligomeric compounds having decorated nucleic acid bases.
[0421] Certain compounds described herein (e.g., modified oligonucleotides) have one or more chiral centers and thus give rise to enantiomers, diastereomers, and other stereoisomer configurations that can be defined with respect to absolute stereochemistry, such as as (R) or (S), as α or β in sugar anomers, or as (D) or (L) in amino acids. Compounds provided herein that are described or stated as having a particular stereoisomer configuration include only the compounds indicated. Compounds provided herein that are described or stated with an undefined stereochemistry include all such possible isomers (such as their stereorandom and optically pure forms) unless otherwise specified. Similarly, tautomers of the compounds herein are also included unless otherwise specified. Unless otherwise specified, the compounds described herein are intended to include the corresponding salts.
[0422] The compounds described herein include variant forms in which one or more atoms of the element shown are replaced with non-radioactive or radioactive isotopes. For example, the compounds described herein that contain a hydrogen atom are: 1 For each of the H hydrogen atoms, all possible deuterium substitutions are included. The isotopic substitutions included by the compounds herein include: 1 Replace H 2 H or 3 H, 12 Replace C 13 C or 14 C, 14 Replace N 15 N, 16 Replace O 17 O or 18 O, and 32 Replace S 33 S, 34 S, 35 S, or 36 This includes, but is not limited to, sulfur (S). In certain embodiments, substitution with non-radioactive isotopes can impart novel properties to oligomeric compounds that are beneficial for use as therapeutic or research tools. In certain embodiments, substitution with radioactive isotopes can make compounds suitable for research purposes such as imaging or for diagnostic purposes. [Examples]
[0423] The following examples illustrate, but do not limit, certain embodiments of the present disclosure. Furthermore, where specific embodiments are provided, the inventors intend to provide a general application of those specific embodiments. For example, the disclosure of an oligonucleotide having a particular motif provides reasonable support for further oligonucleotides having that motif or a similar motif. Similarly, for example, where a particular high-affinity modification is found at a particular position, other high-affinity modifications at the same position are also considered appropriate unless otherwise indicated.
[0424] Example 1: Effect of mixed backbone 5-10-5 MOE gapmer on human APP in vitro, single dose. We synthesized modified oligonucleotides complementary to human APP nucleic acid and tested their effects on APP RNA levels in vitro. The modified oligonucleotides were tested in a series of experiments using similar culture conditions. The results of each experiment are shown in the separate table below.
[0425] The modified oligonucleotides in the table below are 5-10-5MOE gapmers. The gapmers have a length of 20 nucleosides. The sugar motif of the gapmer is (from 5' to 3'): eeeeeddddddddddeeeee, where "d" represents the 2'-β-D-deoxyribosyl sugar moiety and "e" represents the 2'-MOE sugar moiety. The nucleoside-to-nucleoside linkage motif of the gapmer is (from 5' to 3'): sooossssssssssssooss, where each "s" represents a phosphorothioate nucleoside linkage and each "o" represents a phosphodiester nucleoside linkage. All cytosine nucleic acid bases are 5-methylcytosine.
[0426] The "start site" indicates the 5' end nucleoside of the target sequence to which the modified oligonucleotide is complementary. The "termination site" indicates the target sequence to which the modified oligonucleotide is complementary. The nucleoside furthest 3' in the column is shown. As shown in the table below, the modified oligonucleotide is complementary to SEQ ID NO: 1 (ENSEMBL accession number ENST00000346798.7: October 2018, version 94) and / or SEQ ID NO: 2 (GenBank accession number NC_000021.9, nucleotides 25878001 to 26174000 truncated). "N / A" indicates that the modified oligonucleotide is not 100% complementary to its particular target sequence.
[0427] SH-SY5Y cells cultured at a density of 20,000 cells per well were treated with 4,000 nM modified oligonucleotides by electroporation. After approximately 24 hours of treatment, RNA was isolated from the cells, and APP RNA levels were measured by quantitative real-time RTPCR. RNA levels were measured using the human APP primer probe set RTS35572 (forward sequence CGGAGCAGACACAGACTATG, referred to herein as SEQ ID NO: 11; reverse sequence CCTCTACCTCATCACCATCCT, referred to herein as SEQ ID NO: 12; probe sequence AGTAGAAGTAGCAGAGGAGGAAGAAGTGG, referred to herein as SEQ ID NO: 13). APP RNA levels were normalized to the total RNA content measured with RIBOGREEN®. Results are presented as APP RNA percentage (%UTC) relative to untreated control cells. Values marked with "†" indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the activity of modified oligonucleotides complementary to the amplicon region.
[0428] [Table 3-1]
[0429] [Table 3-2]
[0430] Table 3-3
[0431] Table 4-1
[0432] Table 4-2
[0433] Table 4-3
[0434] Table 5-1
[0435] Table 5-2
[0436] Table 5-3
[0437] Table 6-1
[0438] Table 6-2
[0439] Table 6-3
[0440] Table 7-1
[0441] Table 7-2
[0442] Table 7-3
[0443] Table 8-1
[0444] Table 8-2
[0445] Table 8-3
[0446] Table 9-1
[0447] Table 9-2
[0448] Table 9-3
[0449] Table 10-1
[0450] Table 10-2
[0451] Table 10-3
[0452] Table 11-1
[0453] Table 11-2
[0454] Table 11-3
[0455] Table 12-1
[0456] Table 12-2
[0457] Table 12-3
[0458] Table 13-1
[0459] Table 13-2
[0460] Table 13-3
[0461] Table 14-1
[0462] Table 14-2
[0463] Table 14-3
[0464] Table 15-1
[0465] Table 15-2
[0466] Table 15-3
[0467] Table 16-1
[0468] Table 16-2
[0469] Table 16-3
[0470] Table 17-1
[0471] Table 17-2
[0472] Table 17-3
[0473] Table 18-1
[0474] Table 18-2
[0475] Table 18-3
[0476] Table 19-1
[0477] Table 19-2
[0478] Table 19-3
[0479] Table 20-1
[0480] Table 20-2
[0481] Table 20-3
[0482] Table 21-1
[0483] Table 21-2
[0484] Table 21-3
[0485] Table 22-1
[0486] Table 22-2
[0487] Table 22-3
[0488] Table 23-1
[0489] Table 23-2
[0490] Table 23-3
[0491] Table 24-1
[0492] Table 24-2
[0493] Table 24-3
[0494] Table 25-1
[0495] Table 25-2
[0496] Table 25-3
[0497] Table 26-1
[0498] Table 26-2
[0499] Table 26-3
[0500] Table 27-1
[0501] Table 27-2
[0502] Table 27-3
[0503] Table 28-1
[0504] Table 28-2
[0505] Table 28-3
[0506] Table 29-1
[0507] Table 29-2
[0508] Table 29-3
[0509] Table 30-1
[0510] Table 30-2
[0511] Table 30-3
[0512] Table 31-1
[0513] Table 31-2
[0514] Table 31-3
[0515] Table 32-1
[0516] Table 32-2
[0517] Table 32-3
[0518] Table 33-1
[0519] Table 33-2
[0520] Table 33-3
[0521] Table 34-1
[0522] [Table 34-2]
[0523] [Table 34-3]
[0524] Example 2: Effect of mixed backbone gapmer on human APP RNA in vitro, single dose. Modified oligonucleotides complementary to human APP nucleic acid were synthesized and their effects on APP RNA levels in vitro were tested. The modified oligonucleotides were tested in Experiment A or Experiment B using similar culture conditions, as shown in the table below. In all tables below, "start site" indicates the 5' nucleoside of the target sequence to which the modified oligonucleotide is complementary. In all tables below, "end site" indicates the 3' nucleoside of the target sequence to which the modified oligonucleotide is complementary. As shown in the table below, the modified oligonucleotides are complementary to SEQ ID NO: 1 (as specified above), SEQ ID NO: 2 (as specified above), or SEQ ID NO: 8 (GENBANK accession number NM_201414.2). "N / A" indicates that the modified oligonucleotide is not complementary to that particular nucleic acid sequence with 100% complementarity.
[0525] SH-SY5Y cells cultured at a density of 20,000 cells per well were transfected with 4,000 nM modified oligonucleotides by electroporation using 4,000 nM modified oligonucleotides. After a treatment period of approximately 24 hours, RNA was isolated from the cells, and APP RNA levels were measured by quantitative real-time RTPCR. APP RNA levels were measured using the human APP primer probe set RTS35572 (described above herein). APP RNA levels were normalized to the total RNA content measured with RIBOGREEN®. Results are shown as APP RNA percentage relative to untreated control cells (%UTC). Values marked with "†" indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the activity of modified oligonucleotides complementary to the amplicon region.
[0526] The modified oligonucleotides in the table below are 5-10-5MOE gapmers. The gapmers have a length of 20 nucleosides. The sugar motif of the gapmer is (5' to 3') eeeeeddddddddddeeeee, where each "d" represents the 2'-β-D-deoxyribosyl sugar moiety and each "e" represents the 2'-MOE sugar moiety. The intercleoside bond motif is (5' to 3'): sooosssssssssssooss, where each "s" represents a phosphorothioate nucleoside bond and each "o" represents a phosphodiester nucleoside bond. Each cytosine nucleoside is 5-methylcytosine.
[0527] [Table 35]
[0528] [Table 36]
[0529] The modified oligonucleotides in the table below are 3-10-3cEt gapmers. The gapmers have a length of 16 nucleosides. The sugar motif of the gapmer is (5' to 3'): kkkddddddddddkkk, where each "d" represents the 2'-β-D-deoxyribosyl sugar moiety and each "k" represents the cEt sugar moiety. The nucleoside-to-nucleoside linkage motif of the gapmer is (5' to 3'): soosssssssssssos, where each "s" represents a phosphorothioate nucleoside linkage and each "o" represents a phosphodiester nucleoside linkage. Each cytosine nucleoside is 5-methylcytosine.
[0530] [Table 37]
[0531] The modified oligonucleotides in the table below are 3-10-3 gapmers. The gapmers are 16 nucleosides long. The sugar motif of the gapmer is (5' to 3'): kkkdyddddddddkkk, where each "d" represents the 2'-β-D-deoxyribosyl sugar moiety, each "y" represents the 2'-O-Me sugar moiety, and each "k" represents the cEt sugar moiety. The nucleoside-to-nucleoside linkage motif of the gapmer is (5' to 3'): soosssssssssssos, where each "s" represents a phosphorothioate nucleoside linkage, and each "o" represents a phosphodiester nucleoside linkage. Each 2'-OMe cytosine nucleoside is unmethylated and is shown in bold underlined.
[0532] [ka] This is shown. Each other cytosine nucleoside is 5-methylcytosine.
[0533] [Table 38]
[0534] Example 3: Effect of mixed backbone 5-10-5MOE gapmer on human APP RNA in vitro, single dose. We synthesized modified oligonucleotides complementary to human APP nucleic acid and tested their effects on APP RNA levels in vitro. The modified oligonucleotides were tested in a series of experiments using similar culture conditions. The results of each experiment are shown in the separate table below.
[0535] All modified oligonucleotides are 5-10-5MOE gapmers. The sugar motif of the gapmer is (from 5' to 3'): eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. The nucleoside-to-nucleoside bond motif of the gapmer is (from 5' to 3'): sooossssssssssssooss, where each "s" represents a phosphorothioate nucleoside bond and each "o" represents a phosphodiester nucleoside bond. All cytosine nucleic acid bases throughout each modified oligonucleotide are 5-methylcytosine.
[0536] The "start site" indicates the 5' end nucleoside of the target sequence to which the modified oligonucleotide is complementary. The "end site" indicates the 3' end nucleoside of the target sequence to which the modified oligonucleotide is complementary. As shown in the table below, the modified oligonucleotide is complementary to either SEQ ID NO: 1 (as described herein above) or SEQ ID NO: 2 (as described herein above), or both. "N / A" indicates that the modified oligonucleotide is 10 0% complementarity indicates that the specific nucleic acid sequence is not complementary to that sequence.
[0537] Cultured A431 cells at a density of 10,000 cells per well were treated with 4000 nM modified oligonucleotides via free uptake. After approximately 48 hours of treatment, RNA was isolated from the cells, and APP RNA levels were measured by quantitative real-time RTPCR. RNA levels were measured using the human primer-probe set RTS35432 (forward sequence GACAGACAGCACACCCTAAA, referred to herein as SEQ ID NO: 14; reverse sequence CACACGGAGGTGTGTCATAA, referred to herein as SEQ ID NO: 15; probe sequence ATCCCAAGAAAGCCGCTCAGATCC, referred to herein as SEQ ID NO: 16). APP RNA levels were normalized to the total RNA content measured with RIBOGREEN®. Results are shown as APP RNA percentage (%UTC) relative to untreated control cells. Values marked with "†" indicate that the modified oligonucleotide is complementary to the amplicon region of the primer-probe set. Additional assays may be used to measure the activity of modified oligonucleotides complementary to the amplicon region.
[0538] [Table 39-1]
[0539] [Table 39-2]
[0540] [Table 39-3]
[0541] [Table 40-1]
[0542] [Table 40-2]
[0543] Table 40-3
[0544] Table 41-1
[0545] Table 41-2
[0546] Table 41-3
[0547] Table 42-1
[0548] Table 42-2
[0549] Table 42-3
[0550] Table 43-1
[0551] Table 43-2
[0552] Table 43-3
[0553] [Table 44-1]
[0554] [Table 44-2]
[0555] [Table 44-3]
[0556] Example 4: Dose-dependent inhibition of human APP in SH-SY5Y cells by modified oligonucleotides Modified oligonucleotides selected from the above examples were tested at various doses in SH-SY5Y cells. The modified oligonucleotides were tested in a series of experiments using similar culture conditions. The results of each experiment are shown in separate tables below. Cells plated at a density of 20,000 cells per well were transfected with various doses of modified oligonucleotides using electroporation, as shown in the table below. After a treatment period of approximately 24 hours, APP RNA levels were measured as described above using the human APP primer probe set RTS35572 (described herein). APP RNA levels were normalized to total RNA measured with RIBOGREEN®. Results are presented as APP RNA percentage (%UTC) relative to untreated control cells.
[0557] The maximum inhibitory concentration (IC) for each modified oligonucleotide (IC) 50 The values were calculated using linear regression on a logarithmic / linear plot of the data in Excel, and are shown in the table below. ND in the table below indicates cases where the value is not defined. Compound IDs 912255, 912262, 9 12263, 912267, 912272, 912294, 912295, 912298, and 912301 have been previously described in PCT / US20 / 15701.
[0558] Table 45
[0559] Table 46
[0560] Table 47
[0561] Table 48
[0562] Table 49
[0563] Table 50
[0564] Table 51
[0565] Table 52
[0566] Table 53
[0567] Table 54
[0568] [Table 55]
[0569] Example 5: Dose-dependent inhibition of human APP in A431 cells by modified oligonucleotides. We selected specific modified oligonucleotides described in the above study that demonstrate significant in vitro inhibition of APP RNA and tested them at various doses in A431 cells. The modified oligonucleotides were tested in a series of experiments using similar culture conditions. The results of each experiment are shown in separate tables below. Cells plated at a density of 10,000 cells per well were treated with various doses of modified oligonucleotides by free uptake, as shown in the table below. After a treatment period of approximately 48 hours, APP RNA levels were measured as described above using the human APP primer probe set RTS35432 (described herein). APP RNA levels were normalized to total RNA measured with RIBOGREEN®. Results are presented as APP RNA percentage (%UTC) relative to untreated control cells. The maximum inhibitory concentration (IC) for each modified oligonucleotide is shown. 50 The values were calculated using linear regression on a logarithmic / linear plot of the data in Excel, and are shown in the table below. ND in the table below indicates cases where the value is not defined.
[0570] [Table 56]
[0571] [Table 57]
[0572] [Table 58]
[0573] [Table 59]
[0574] Example 6: Design and synthesis of MOE gapmer-modified oligonucleotides containing mixed PO / PS nucleoside bonds complementary to human APP nucleic acid. Modified oligonucleotides complementary to human APP nucleic acid were designed and synthesized. The "start site" indicates the 5' end nucleoside of the target sequence to which the modified oligonucleotide is complementary. The "end site" indicates the 3' end nucleoside of the target sequence to which the modified oligonucleotide is complementary. As shown in the table below, the modified oligonucleotides are complementary to either or both of SEQ ID NO: 1 (described herein above) and / or SEQ ID NO: 2 (described herein above). "N / A" indicates that the modified oligonucleotide is not complementary to its particular nucleic acid sequence with 100% complementarity.
[0575] The modified oligonucleotides in the table below are 5-10-5MOE gapmers. The sugar motif of the gapmer is (from 5' to 3'): eeeeeddddddddddeeeee, where "d" represents the 2'-β-D-deoxyribosyl sugar moiety and "e" represents the 2'-MOE sugar moiety. The nucleoside-to-nucleoside linkage motif of the gapmer is (from 5' to 3'): sooossssssssssssooss, where each "s" represents a phosphorothioate nucleoside linkage and each "o" represents a phosphodiester nucleoside linkage. Each cytosine nucleoside is 5-methylcytosine.
[0576] [Table 60]
[0577] The modified oligonucleotides in the table below are 6-10-4MOE gapmers. The gapmers have a length of 20 nucleosides. The sugar motif of the gapmer is (5' to 3') eeeeeeddddddddddeeee, where "d" represents the 2'-β-D-deoxyribosyl sugar moiety and "e" represents the 2'-β-D-MOE sugar moiety. The nucleoside-to-nucleoside linkage motif of the gapmer is (5' to 3'): soooooosssssssssssoss, where each "s" represents a phosphorothioate nucleoside linkage and each "o" represents a phosphodiester nucleoside linkage. Each cytosine nucleoside is 5-methylcytosine.
[0578] [Table 61]
[0579] The modified oligonucleotides in the table below are 6-10-4MOE gapmers. The gapmers have a length of 20 nucleosides. The sugar motif of the gapmer is (5' to 3'): eeeeeeddddddddddeeee, where "d" represents the 2'-β-D-deoxyribosyl sugar moiety and "e" represents the 2'-MOE sugar moiety. The nucleoside-to-nucleoside linkage motif of the gapmer is (5' to 3'): soooossssssssssssoss, where each "s" represents a phosphorothioate nucleoside linkage and each "o" represents a phosphodiester nucleoside linkage. Each cytosine nucleoside is 5-methylcytosine.
[0580] [Table 62]
[0581] The modified oligonucleotides in the table below are 5-10-5MOE gapmers. The gapmers have a length of 20 nucleosides. The sugar motif of the gapmer is (from 5' to 3'): eeeeeddddddddddeeeee, where "d" represents the 2'-β-D-deoxyribosyl sugar moiety and "e" represents the 2'-MOE sugar moiety. The nucleoside-to-nucleoside linkage motif of the gapmer is (from 5' to 3'): ssoossssssssssssooss, where each "s" represents a phosphorothioate nucleoside linkage and each "o" represents a phosphodiester nucleoside linkage. Each cytosine nucleoside is 5-methylcytosine.
[0582] [Table 63]
[0583] Example 7: Tolerability of modified oligonucleotides containing 2'-MOE nucleotides complementary to human APP in wild-type mice (3-hour test) The modified oligonucleotides described above were tested in wild-type female C57 / Bl6 mice to evaluate oligonucleotide tolerability. Each wild-type female C57 / Bl6 mouse received a single ICV dose of 700 μg of modified oligonucleotide. Each treatment group consisted of 2-4 mice. To conduct the experiment, one group of 2-4 mice was administered PBS as a negative control. Each experiment is shown in the individual tables below. Three hours after injection, the mice were evaluated according to seven different criteria. The criteria were as follows: (1) The mouse was active, agile, and responsive. (2) The mouse stood up or arched its back without stimulation. (3) The mouse showed any movement without stimulation. (4) When the mouse was lifted, it showed forward movement. (5) The mouse made some movement when lifted. (6) The mouse responded when its tail was pinched. (7) It breathed regularly. For each of these seven criteria, the mouse was given a subscore of 0 if it met the criterion, and a subscore of 1 if it did not (Functional Observational Total Score or FOB). After evaluating all seven criteria, the scores were totaled for each mouse and averaged within each treatment group. The results are shown in the table below.
[0584] [Table 64-1]
[0585] [Table 64-2]
[0586] [Table 65]
[0587] [Table 66]
[0588] [Table 67]
[0589] [Table 68]
[0590] [Table 69]
[0591] [Table 70]
[0592] [Table 71]
[0593] Example 8: Tolerability of modified oligonucleotides containing cEt nucleotides complementary to human APP in wild-type mice (3-hour test) The modified oligonucleotides described above were tested in wild-type female C57 / Bl6 mice to evaluate oligonucleotide tolerability. Each wild-type female C57 / Bl6 mouse received a single ICV dose of 300 μg of modified oligonucleotide. Each treatment group consisted of 2-4 mice. To conduct the experiment, one group of 2-4 mice was administered PBS as a negative control. Each experiment is shown in the individual tables below. Three hours after injection, the mice were evaluated according to seven different criteria. The criteria were as follows: (1) The mouse was active, agile, and responsive. (2) The mouse stood up or arched its back without stimulation. (3) The mouse showed any movement without stimulation. (4) When the mouse was lifted, it showed forward movement. (5) When the mouse was lifted, it showed any movement. (6) The mouse responded when its tail was pinched. (7) Regular breathing. For each of these seven criteria, mice were given a subscore of 0 if they met the criterion and a subscore of 1 if they did not (Functional Observation Total Score or FOB). After evaluating all seven criteria, the scores were totaled for each mouse and averaged within each treatment group. The results are shown in the table below.
[0594] [Table 72-1]
[0595] [Table 72-2]
[0596] Example 9: Tolerability of modified oligonucleotides complementary to human APP in rats, 3-hour experiment The modified oligonucleotides described above were tested in rats to evaluate their tolerability. Each SpragueDawley rat received a single intrathecal (IT) dose of the oligonucleotides listed in the table below. Compounds containing MOE nucleosides were administered at a dose of 3 mg, and compounds containing cEt nucleosides were administered at a dose of 2.4 mg. Each treatment group consisted of three rats. Each group of three rats was given PBS as a negative control. Each experiment is shown in the separate table below. Three hours after injection, the movement of seven different body parts was evaluated in each rat. The seven body parts were: (1) the rat's tail, (2) the rat's posterior dorsal region, (3) the rat's hind limbs, (4) the rat's hind feet, (5) the rat's forelegs, (6) the rat's anterior dorsal region, and (7) the rat's head. For each of the seven different body parts, each rat was given a subscore of 0 if the body part was moving, and a subscore of 1 if the body part was paralyzed (Functional Observational Total Score or FOB). After evaluating each of the seven body parts, the subscores were summed for each rat and then averaged across all groups. For example, if a rat's tail, head, and all other evaluated body parts were moving 3 hours after a 3 mg dose of IT, the rat would receive a total score of 0. If another rat's tail was not moving 3 hours after a 3 mg dose of IT, but all other evaluated body parts were moving, the rat would receive a score of 1. The results are presented as the average score for each treatment group.
[0597] [Table 73]
[0598] [Table 74]
[0599] [Table 75]
[0600] [Table 76]
[0601] [Table 77]
[0602] [Table 78]
[0603] [Table 79]
[0604] [Table 80]
[0605] [Table 81]
[0606] [Table 82]
[0607] [Table 83]
[0608] [Table 84]
[0609] Example 10: Activity of modified oligonucleotides complementary to human APP in Tc1 transgenic mice To test the activity of the above-mentioned modified oligonucleotides, we used an aneuploid mouse strain (Tc1) expressing human APP, as previously described in O'Doherty A., et al., An Aneuploid Mouse Strain Carrying Human Chromosome 21 with Down Syndrome Phenotypes, Science 2005, 309(5743):2033-2037.
[0610] treatment Tc1 mice were divided into groups of 2-3 mice each (the number of mice in each study is shown in the table below). Each mouse was given a single ICV bolus of 300 μg of modified oligonucleotide. One group of 3-4 mice was given PBS as a negative control.
[0611] RNA analysis Two weeks after treatment, mice were sacrificed, and RNA was extracted from cortical brain tissue and spinal cord for RTPCR analysis. The amount of APP RNA was measured using the human primer set RTS35571 (forward sequence CCCACTTTGTGATTCCCTACC (referred to herein as SEQ ID NO: 17); reverse sequence ATCCATCCTCTCCTGGTGTAA (referred to herein as SEQ ID NO: 18); probe sequence TGATGCCCTTCTCGTTCCTGACAA (referred to herein as SEQ ID NO: 19)). The results are expressed as the percentage of human APP RNA relative to a PBS control normalized to mouse cyclophyllin A. Mouse cyclophyllin A was amplified using the primer-probe set m_cyclo24 (forward sequence TCGCCGCTTGCTGCA, shown herein as SEQ ID NO: 20; reverse sequence ATCGGCCGTGATGTCGA, shown herein as SEQ ID NO: 21; probe sequence CCATGGTCAACCCCACCGTGTTC, shown herein as SEQ ID NO: 22).
[0612] Values marked with the symbol "†" indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. In such cases, the activity of the modified oligonucleotide was further evaluated using the human primer probe set RTS35572 (described herein above) or the human primer probe set HS.PT.56a.38768352 (Integrated DNA Technologies, Inc.).
[0613] [Table 85]
[0614] [Table 86]
[0615] [Table 87]
[0616] [Table 88]
[0617] [Table 89]
[0618] [Table 90-1]
[0619] [Table 90-2]
[0620] Example 11: Design of modified oligonucleotides complementary to human APP nucleic acid Modified oligonucleotides complementary to human APP nucleic acid were designed as shown in the table below. The "start site" indicates the 5' nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. The "end site" indicates the 3' nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 1 (described herein above), SEQ ID NO: 2 (described herein above), or both. "N / A" indicates that the modified oligonucleotide is not 100% complementary to its particular target nucleic acid sequence.
[0621] The modified oligonucleotides in the table below are 5-10-5MOE gapmers. The gapmer has a length of 20 nucleosides, and the sugar motif of the gapmer is (5' to 3') eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. The gapmer has a nucleoside-to-nucleoside linkage motif (5' to 3') sooossssssssssssooss, where each "s" represents a phosphorothioate nucleoside linkage and each "o" represents a phosphodiester nucleoside linkage. Each cytosine residue is 5-methylcytosine.
[0622] [Table 91-1]
[0623] [Table 91-2]
[0624] The modified oligonucleotides in the table below are 5-10-5MOE gapmers. The gapmer has a length of 20 nucleosides, and the sugar motif of the gapmer is (5' to 3') eeeeeddddddddddeeeee, where each "d" represents the 2'-β-D-deoxyribosyl sugar moiety and each "e" represents the 2'-MOE sugar moiety. The gapmer has a nucleoside-to-nucleoside linkage motif (5' to 3') sooossssssssssssooos, where each "s" represents a phosphorothioate nucleoside linkage and each "o" represents a phosphodiester nucleoside linkage. Each cytosine residue is 5-methylcytosine.
[0625] [Table 92]
[0626] The modified oligonucleotides in the table below are 6-10-4MOE gapmers. The gapmer has a length of 20 nucleosides, and the sugar motif of the gapmer is (5' to 3') eeeeeeddddddddddeeee, where each "d" represents the 2'-β-D-deoxyribosyl sugar moiety and each "e" represents the 2'-MOE sugar moiety. The gapmer has a nucleoside-to-nucleoside linkage motif (5' to 3') soooooosssssssssssoss, where each "s" represents a phosphorothioate nucleoside linkage and each "o" represents a phosphodiester nucleoside linkage. Each cytosine residue is 5-methylcytosine.
[0627] [Table 93]
[0628] The modified oligonucleotides in the table below are 6-10-4MOE gapmers. The gapmer has a length of 20 nucleosides, and the sugar motif of the gapmer is (5' to 3') eeeeeeddddddddddeeee, where each "d" represents the 2'-β-D-deoxyribosyl sugar moiety and each "e" represents the 2'-MOE sugar moiety. The gapmer has a nucleoside-to-nucleoside linkage motif (5' to 3') soooossssssssssssoss, where each "s" represents a phosphorothioate nucleoside linkage and each "o" represents a phosphodiester nucleoside linkage. Each cytosine residue is 5-methylcytosine.
[0629] [Table 94]
[0630] Example 12: Activity of modified oligonucleotides complementary to human APP in Tc1 transgenic mice To test the activity of the above-mentioned modified oligonucleotides, we used an aneuploid mouse strain (Tc1) expressing human APP, as previously described in O'Doherty A., et al., An Aneuploid Mouse Strain Carrying Human Chromosome 21 with Down Syndrome Phenotypes, Science 2005, 309(5743):2033-2037.
[0631] treatment Tc1 mice were divided into groups of two. Each mouse was given a single ICV bolus of 300 μg of modified oligonucleotide. One group of 3-4 mice was given PBS as a negative control.
[0632] RNA analysis Two weeks after treatment, mice were sacrificed, and RNA was extracted from cortical brain tissue, spinal cord, and brainstem for RTPCR analysis. The amount of APP RNA was measured using the human primer probe set RTS35571 (described herein). Results are shown as a percentage of human APP RNA relative to PBS control, normalized to mouse cyclophyllin A. Values marked with "†" indicate that the modified oligonucleotide was an ampersand in the primer probe set. This demonstrates complementarity to the precone region. In such cases, the activity of the modified oligonucleotide was further evaluated using the human primer probe set HS.PT.56a.38768352 (Integrated DNA Technologies, Inc.).
[0633] [Table 95]
[0634] [Table 96-1]
[0635] [Table 96-2]
[0636] Example 13: Activity of a modified oligonucleotide complementary to human APP in YAC-APP transgenic mice, single dose. To test the activity of the above-mentioned modified oligonucleotides, we used the London V717I and Swedish YAC transgenic mice K670N / M671L mutant (YAC-APP transgenic mice) that express human APP, as previously described in Lamb B., et al., Altered metabolism of familial Alzheimer's disease-linked amyloid precursor protein variants in yeast artificial chromosome transgenic mice, Hum Mol Genet 1997 Sep;6(9):1535-41.
[0637] treatment YAC-APP lancegenic mice were divided into groups of two mice each. Each mouse was given a single ICV bolus of 300 μg of modified oligonucleotide. One group of 3-4 mice was given PBS as a negative control.
[0638] RNA analysis Two weeks after treatment, mice were sacrificed, and RNA was extracted from cortical brain tissue, spinal cord, and brainstem for RTPCR analysis. The amount of APP RNA was measured using the human primer probe set RTS35571 (described herein). Results are shown as a percentage of human APP RNA relative to PBS control, normalized to mouse cyclophyllin A. Values marked with "†" indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. In such cases, the activity of the modified oligonucleotide was further evaluated using the human primer probe set HS.PT.56a.38768352 (IntegratedDNA Technologies, Inc.).
[0639] [Table 97]
[0640] [Table 98]
[0641] [Table 99]
[0642] Example 14: Activity of modified oligonucleotides complementary to human APP in YAC-APP transgenic mice, after multiple administrations. The activity of the modified oligonucleotides described above was tested using the YAC-APP transgenic mice mentioned above.
[0643] treatment YAC-APP lancegenic mice were divided into groups of four mice each. Each mouse was given a single ICV bolus of 30 μg, 100 μg, 300 μg, or 700 μg of modified oligonucleotide. One of the groups of four mice was given PBS as a negative control.
[0644] RNA analysis Two weeks after treatment, mice were sacrificed, and RNA was extracted from cortical brain tissue, spinal cord, and brainstem for real-time quantitative RTPCR analysis. The amount of APP RNA was measured using the human primer probe set RTS35571 (described herein). Results are expressed as a percentage of human APP RNA relative to PBS control, normalized to mouse cyclophyllin A. ED50 was calculated from the log conversion dose and individual animal mRNA levels using the built-in GraphPad formula "Log (agonist) vs. Response - FindECanything" (constraints: bottom=0, top=100, F=50).
[0645] [Table 100]
[0646] Example 15: Tolerability of modified oligonucleotides containing 2'-MOE nucleotides complementary to human APP in wild-type mice (3-hour test) The modified oligonucleotides described above were tested in wild-type female C57 / Bl6 mice to evaluate oligonucleotide tolerability. Each wild-type female C57 / Bl6 mouse received a single ICV dose of 700 μg of modified oligonucleotide. Each treatment group consisted of four mice. In each experiment, one group of four mice was given PBS as a negative control. Each experiment is shown in the individual tables below. Three hours after injection, the mice were evaluated according to seven different criteria. The criteria were as follows: (1) The mouse was active, agile, and responsive. (2) The mouse stood up or arched its back without stimulation. (3) The mouse made any movement without stimulation. (4) When the mouse was lifted, it made forward movement. (5) When the mouse was lifted, it made any movement. (6) The mouse responded when its tail was pinched. (7) Regular breathing. For each of the seven criteria, a subscore of 0 was given if the mouse met the criterion, and a subscore of 1 if it did not (Functional Observational Overall Score or FOB). After evaluating all seven criteria, the scores were totaled for each mouse and averaged within each treatment group. The results are shown in the table below.
[0647] [Table 101]
[0648] [Table 102]
[0649] [Table 103]
[0650] Example 16: Tolerability of complementary modified oligonucleotides to human APP in rats, 3-hour experiment The modified oligonucleotides described above were tested in rats to evaluate their tolerability. Each SpragueDawley rat received a single intrathecal (IT) dose of the oligonucleotide listed in the table below. The modified oligonucleotide was administered at a dose of 3 mg. Each treatment group consisted of four rats. Each group of four rats was given PBS as a negative control. Each experiment is shown in the separate table below. Three hours after injection, the movement of seven different body parts was evaluated in each rat. The seven body parts were: (1) the rat's tail, (2) the rat's posterior dorsal region, (3) the rat's hind limbs, (4) the rat's hind feet, (5) the rat's forelegs, (6) the rat's anterior dorsal region, and (7) the rat's head. For each of the seven different body parts, each rat was given a subscore of 0 if the body part was moving and a subscore of 1 if the body part was paralyzed (Functional Observational Total Score or FOB). After evaluating each of the seven body parts, the subscores were summed for each rat and then averaged for each group. For example, if a rat's tail, head, and all other evaluated body parts were moving 3 hours after administration of 3 mg of IT, the rat would receive a total score of 0. If another rat did not move its tail 3 hours after administration of 3 mg of IT, but all other evaluated body parts were moving, the rat would receive a score of 1. The results are shown as the average score for each treatment group.
[0651] [Table 104]
[0652] [Table 105]
[0653] [Table 106]
[0654] [Table 107]
[0655] Example 17: Tolerance of modified oligonucleotides complementary to human APP in wild-type mice (3-hour test) The above modified oligonucleotides were used to evaluate the tolerability of the oligonucleotides in the wild. The study was conducted using wild-type female C57 / Bl6 mice. Each wild-type female C57 / Bl6 mouse received a single ICV dose of 700 μg of modified oligonucleotide. Each treatment group consisted of four mice. In each experiment, one group of four mice was given PBS as a negative control. Each experiment is shown in the separate table below. Three hours after injection, the mice were evaluated according to seven different criteria. The criteria were as follows: (1) The mouse was active, agile, and responsive. (2) The mouse stood up or arched its back without stimulation. (3) The mouse made any movement without stimulation. (4) When the mouse was lifted, it made forward movement. (5) When the mouse was lifted, it made any movement. (6) The mouse responded when its tail was pinched. (7) Regular breathing. For each of the seven criteria, a subscore of 0 was given if the mouse met the criterion, and a subscore of 1 if it did not (Functional Observational Overall Score or FOB). After evaluating all seven criteria, the scores were totaled for each mouse and averaged within each treatment group. The results are shown in the table below.
[0656] [Table 108]
[0657] Example 18: Activity of modified oligonucleotides complementary to human APP in Tc1 transgenic mice, after multiple administrations. To test the activity of the above-mentioned modified oligonucleotides, we used an aneuploid mouse strain (Tc1) expressing human APP, as previously described in O'Doherty A., et al., An Aneuploid Mouse Strain Carrying Human Chromosome 21 with Down Syndrome Phenotypes, Science 2005, 309(5743):2033-2037.
[0658] treatment Tc1 transgenic mice were divided into groups of three mice each. Each mouse was given a single ICV bolus of 30 μg, 100 μg, 300 μg, or 700 μg of modified oligonucleotide. One of the groups of three mice was given PBS as a negative control.
[0659] RNA analysis Two weeks after treatment, mice were sacrificed, and RNA was extracted from cortical brain tissue, hippocampus, spinal cord, and brainstem for real-time quantitative RTPCR analysis. The amount of APP RNA was measured using the human primer probe set RTS35571 (described herein). The results were expressed as a percentage of human APP RNA compared to a PBS control normalized to mouse cyclophyllin A. It is presented as [a specific format / option].
[0660] [Table 109]
[0661] Example 19: Activity of modified oligonucleotides complementary to human APP in YAC-APP transgenic mice, after multiple administrations. The activity of the modified oligonucleotides described above was tested using the YAC-APP transgenic mice mentioned above.
[0662] treatment YAC-APP lancegenic mice were divided into groups of three mice each. Each mouse was administered a single ICV bolus of 30 μg, 100 μg, 300 μg, or 700 μg of modified oligonucleotide. One of the groups of three mice was given PBS as a negative control.
[0663] RNA analysis Two weeks after treatment, mice were sacrificed, and RNA was extracted from cortical brain tissue, hippocampus, spinal cord, and brainstem for real-time quantitative RTPCR analysis. The amount of APP RNA was measured using the human primer probe set RTS35571 (described herein). Results are presented as a percentage of human APP RNA relative to a PBS control normalized to mouse cyclophyllin A. ND means the value could not be determined.
[0664] [Table 110]
[0665] [Table 111]
[0666] [Table 112]
[0667] Example 20: Design of modified oligonucleotides complementary to human APP nucleic acid Modified oligonucleotides complementary to human APP nucleic acid were designed as shown in the table below. The "start site" indicates the 5' nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. The "end site" indicates the 3' nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 1 (described herein above) and SEQ ID NO: 2 (described herein above).
[0668] The modified oligonucleotides in the table below are 3-10-3cEt gapmers. The gapmers have a length of 16 nucleosides. The sugar motif of the gapmer is (5' to 3') kkkddddddddddkkk, where each "d" represents the 2'-β-D-deoxyribosyl sugar moiety and each "k" represents the cEt sugar moiety. The nucleoside linkage motif of the gapmer is shown in the table below, where each "s" represents a phosphorothioate nucleoside linkage, each "o" represents a phosphodiester nucleoside linkage, and each "z" represents a mesylphosphoamide nucleoside linkage. Each cytosine residue is 5-methylcytosine.
[0669] [Table 113]
[0670] The modified oligonucleotides in the table below are 6-10-4MOE gapmers. The gapmers have a length of 20 nucleosides. The sugar motif of the gapmer is (5' to 3') eeeeeeddddddddddeeee, where each "d" represents the 2'-β-D-deoxyribosyl sugar moiety and each "e" represents the 2'-β-D-MOE sugar moiety. The nucleoside linkage motifs of the gapmer are shown in the table below, where each "s" represents a phosphorothioate nucleoside linkage, each "o" represents a phosphodiester nucleoside linkage, and each "z" represents a mesylphosphoamide nucleoside linkage. Each cytosine residue is 5-methylcytosine.
[0671] [Table 114]
[0672] The modified oligonucleotides in the table below are 5-10-5MOE gapmers. The gapmer length is 20 nucleosides, and the sugar motif of the gapmer is (5' to 3') eeeeeddddddddddeeeee, where each "d" represents the 2'-β-D-deoxyribosyl sugar moiety and each "e" represents the 2'-MOE sugar moiety. The nucleoside linkage motifs of the gapmer are shown in the table below, where each "s" represents the nucleoside linkage of a phosphorothioate, each "o" represents the nucleoside linkage of a phosphodiester, and each "z" represents the nucleoside linkage of a mesylphosphoamide. Each cytosine residue is 5-methylcytosine.
[0673] [Table 115]
[0674] Example 21: Tolerability of modified oligonucleotides containing cEt nucleotides complementary to human APP in wild-type mice (3-hour test) The modified oligonucleotides described above were tested in wild-type female C57 / Bl6 mice to evaluate oligonucleotide tolerability. Each wild-type female C57 / Bl6 mouse received a single ICV dose of 540 μg of modified oligonucleotide. Each treatment group consisted of four mice. In each experiment, one group of four mice was given PBS as a negative control. Each experiment is shown in the separate table below. Three hours after injection, the mice were evaluated according to seven different criteria. The criteria were as follows: (1) The mouse was active, agile, and responsive. (2) The mouse stood up or arched its back without stimulation. (3) The mouse made any movement without stimulation. (4) When the mouse was lifted, it made forward movement. (5) When the mouse was lifted, it made any movement. (6) The mouse responded when its tail was pinched. (7) Regular breathing. For each of the seven criteria, a subscore of 0 was given if the mouse met the criterion, and a subscore of 1 if it did not (Functional Observational Overall Score or FOB). After evaluating all seven criteria, the scores were totaled for each mouse and averaged within each treatment group. The results are shown in the table below.
[0675] [Table 116]
[0676] Example 22: Tolerability of modified oligonucleotides containing 2'-MOE nucleotides complementary to human APP in wild-type mice (3-hour test) The modified oligonucleotides described above were tested in wild-type female C57 / Bl6 mice to evaluate oligonucleotide tolerability. Each wild-type female C57 / Bl6 mouse received a single ICV dose of 700 μg of modified oligonucleotide. Each treatment group consisted of 3-4 mice (n in each study is shown in the table below). In each experiment, one group of 3-4 mice was given PBS as a negative control. Each experiment is shown in the individual tables below. Mice were evaluated 3 hours after injection according to seven different criteria. The criteria were as follows: (1) The mouse was active, agile, and responsive. (2) The mouse stood up or arched its back without stimulation. (3) The mouse made any movement without stimulation. (4) When the mouse was lifted, it moved forward. (5) When the mouse was lifted, it made any movement. (6) The mouse responded when its tail was pinched. (7) Regular breathing. For each of the seven criteria, a subscore of 0 was assigned if the mouse met the criterion, and a subscore of 1 if it did not (Functional Observational Overall Score or FOB). After evaluating all seven criteria, the scores were totaled for each mouse and averaged within each treatment group. The results are shown in the table below.
[0677] [Table 117]
[0678] Example 23: Tolerance of complementary modified oligonucleotides to human APP in rats, 3-hour experiment The modified oligonucleotides described above were tested in rats to evaluate oligonucleotide tolerability. Each SpragueDawley rat received a single intrathecal (IT) dose of the oligonucleotides listed in the table below. Compounds containing MOE nucleosides were administered at a dose of 3 mg, and compounds containing cEt nucleosides were administered at a dose of 2.4 mg. Each treatment group consisted of 3-4 rats (n in each study is shown in the table below). Groups of 3-4 rats were given PBS as a negative control. Each experiment is shown in a separate table below. Three hours after injection, the movement of seven different body parts was evaluated in each rat. The seven body parts were: (1) the rat's tail, (2) the rat's posterior dorsal region, (3) the rat's hind limbs, (4) the rat's hind feet, (5) the rat's forelegs, (6) the rat's anterior dorsal region, and (7) the rat's head. For each of the seven different body parts, a subscore of 0 was assigned to each rat if the body part was moving, and a subscore of 1 was assigned if the body part was paralyzed (Functional Observation Total Score or FOB). After evaluating each of the seven body parts, the subscores were summed for each rat and then averaged for each group. For example, if a rat's tail, head, and all other evaluated body parts were moving 3 hours after IT administration, the rat would receive a total score of 0. If another rat's tail was not moving 3 hours after IT administration, but all other evaluated body parts were moving, the rat would receive a score of 1. The results are presented as the average score for each treatment group.
[0679] [Table 118]
[0680] [Table 119]
[0681] Example 24: Activity of a modified oligonucleotide complementary to human APP in YAC-APP transgenic mice, single dose. The activity of the modified oligonucleotides described above was tested using the YAC-APP transgenic mice mentioned above.
[0682] treatment YAC-APP transgenic mice were divided into groups of 2-3 mice each (the number of mice in each study is shown in the table below). Each mouse was given a single ICV bolus of 300 μg of modified oligonucleotide. One group of 3-4 mice was given PBS as a negative control.
[0683] RNA analysis Two weeks after treatment, mice were sacrificed, and RNA was extracted from cortical brain tissue, spinal cord, and brainstem for real-time quantitative RTPCR analysis. The amount of APP RNA was measured using the human primer probe set RTS35571 (described herein). Results are presented as a percentage of human APP RNA relative to a PBS control normalized to mouse cyclophyllin A (control %). Values marked with "†" indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. In such cases, the activity of the modified oligonucleotide was further evaluated using the human primer probe set HS.PT.56a.38768352 (IntegratedDNA Technologies, Inc.).
[0684] [Table 120]
[0685] [Table 121]
[0686] Example 25: Design of RNAi compounds having antisense RNAi oligonucleotides complementary to human APP nucleic acid. RNAi compounds containing antisense RNAi oligonucleotides complementary to human APP nucleic acid, and sense RNAi oligonucleotides complementary to the antisense RNAi oligonucleotides, were designed as follows.
[0687] The RNAi compounds in the table below consist of an antisense RNAi oligonucleotide and a sense RNAi oligonucleotide. Each antisense RNAi oligonucleotide is 23 nucleotides long and has a sugar motif (5' to 3'): efyyyyyyyyyyyfyfyyyyyyy, where each "e" represents a 2'-MOE sugar, each "y" represents a 2'-O methylribosyl sugar moiety, each "f" represents a 2'-fluororibosyl sugar moiety, and also has a nucleoside-to-nucleoside linkage motif (5' to 3'): ssooooooooooooooooooooss, where each "o" represents a phosphodiester nucleoside-to-nucleoside linkage, and each "s" represents a phosphorothioate nucleoside-to-nucleoside linkage. Each antisense RNAi oligonucleotide contains 5'-vinylphosphonate ("vP"). Each sense RNAi oligonucleotide is 21 nucleotides long and has a sugar motif (5' to 3'): yyyyyyfyfffyyyyyyyyyy, where each "y" represents a 2'-O methylribosyl sugar moiety and each "f" represents a 2'-fluororibosyl sugar moiety, and also has an internucleoside binding motif (5' to 3'): ssooo[C16muP]ooooooooooooss Each "o" represents a phosphodiester nucleoside bond, each "s" represents a phosphorothioate nucleoside bond, and each [C16muP] represents a modified phosphoramidoic acid nucleoside bond as shown below.
[0688] [ka] Each antisense RNAi oligonucleotide is complementary to the target nucleic acid (APP), each sense RNAi oligonucleotide is complementary to the first of the 21 nucleosides (5' to 3') of the antisense RNAi oligonucleotide, and the last two 3'-nucleosides of the antisense RNAi oligonucleotide are unpaired overhang nucleosides.
[0689] The "start site" indicates the 5' nucleoside to which the antisense RNAi oligonucleotide is complementary in the human gene sequence. The "stop site" indicates the 3' nucleoside to which the antisense RNAi oligonucleotide is complementary in the human gene sequence. Each antisense RNAi oligonucleotide listed in the table below is complementary to Sequence ID No. 1 (described herein above). Non-complementary nucleic acid bases are indicated in underlined bold italics in the antisense sequence column.
[0690] [Table 122]
[0691] Example 26: Activity of RNAi compounds against human APP in YAC-APP transgenic mice, single dose The activity of the above double-stranded RNAi compounds was tested using the YAC-APP transgenic mice described above.
[0692] treatment YAC-APP lancegenic mice were divided into groups of two mice each. Each mouse received a single 150 μg double-stranded RNAi ICV bolus. Compound number 13 32212, the modified oligonucleotide benchmarks described herein were administered at a dose of 300 μg. One group of three mice was given PBS as a negative control.
[0693] RNA analysis Two weeks after treatment, mice were sacrificed, and RNA was extracted from cortical brain tissue, spinal cord, and brainstem for real-time quantitative RTPCR analysis. The amount of APP RNA was measured using the human primer probe set RTS35571 (described herein). Results are presented as a percentage of human APP RNA relative to a PBS control normalized to mouse cyclophyllin A (control %). Values marked with "†" indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. In such cases, the activity of the modified oligonucleotide was further evaluated using the human primer probe set HS.PT.56a.38768352 (Integrated DNA Technologies, Inc.).
[0694] [Table 123]
[0695] Example 27: In vitro activity of modified oligonucleotides in human APP RNA, single dose. Complementary modified oligonucleotides (as described herein) to human APP nucleic acid were tested for their activity in human APP RNA in vitro. Comparative compound number 1369632, as described herein and in WO / 2005 / 042777, was also tested.
[0696] SH-SY5Y cells cultured at a density of 20,000 cells per well were treated with 4,000 nM modified oligonucleotides by electroporation. After approximately 24 hours of treatment, total RNA was isolated from the cells, and human APP RNA levels were measured by quantitative real-time RTPCR. Human APP RNA levels were measured using the probe set RTS35572 (described herein). Human APP RNA levels were normalized to the total RNA content measured by RIBOGREEN®. The decrease in human APP RNA is shown in the table below as a percentage of APP RNA relative to untreated control cells (%UTC).
[0697] [Table 124]
[0698] Example 28: Tolerance of modified oligonucleotides complementary to human APP in wild-type mice (3-hour test) Modified oligonucleotides (as described herein) were tested in wild-type female C57 / Bl6 mice to evaluate oligonucleotide tolerability. Comparative compounds 156352, 1369361, and 1369362 (as described herein) were also tested. Each wild-type female C57 / Bl6 mouse received a single ICV dose of 700 μg of modified oligonucleotide. Each treatment group consisted of 2 to 4 mice (n in each study is shown in the table below). In each experiment, one group of 3 to 4 mice was given PBS as a negative control. Each experiment is shown in the individual tables below. Mice were evaluated 3 hours after injection according to seven different criteria. The criteria were as follows: (1) The mouse was active, agile, and responsive. (2) The mouse stood up or arched its back without stimulation. (3) The mouse showed any movement without stimulation. (4) When the mouse was lifted, the mouse showed forward movement. (5) When the mouse was lifted, the mouse showed any movement. (6) The mice responded when their tails were pinched. (7) Regular breathing. For each of these seven criteria, the mice were given a subscore of 0 if they met the criterion and a subscore of 1 if they did not (Functional Observational Total Score or FOB). After evaluating all seven criteria, the scores were totaled for each mouse and averaged within each treatment group. The results are shown in the table below.
[0699] Compounds 828428 and 828565, listed in WO2020 / 160163, were also tested using this assay. Compound 828428 has the nucleic acid sequence (5' to 3'): CTTCCTTGGTATCAATGC (SEQ ID NO: 3072). Compound 828565 has the nucleic acid sequence (5' to 3'): GATACTTGTCAACGGCAT (SEQ ID NO: 3073). The sugar motifs of both compound 828428 and compound 828565 are (5' to 3'): eeeeeddddddddkkeee, where each "d" represents the 2'-β-D-deoxyribosyl sugar moiety, each "k" represents the cEt sugar moiety, and each "e" represents the 2'-MOE sugar moiety. The nucleoside-to-nucleoside bonding motif in both compound numbers 828428 and 828565 is (5' to 3'): sooosssssssssooss, where each "s" represents a phosphorothioate nucleoside bond and each "o" represents a phosphodiester nucleoside bond. Each cytosine residue in both compound numbers 828428 and 828565 is 5-methylcytosine.
[0700] [Table 125]
[0701] [Table 126]
[0702] [Table 127]
[0703] Example 29: Tolerability of RNAi compounds and modified oligonucleotides targeting human APP in rats, 3-hour experiment The RNAi compounds and modified oligonucleotides described herein were tested in rats to evaluate the tolerability of the oligonucleotides.
[0704] Furthermore, compound number 1581404 was tested as a comparison compound. Compound number 1581404 consists of compound number 1551732 (described herein) which is an antisense RNAi oligonucleotide and compound number 1551733 which is a sense RNAi oligonucleotide. The antisense RNAi oligonucleotide is complementary to the target nucleic acid (APP), and the sense RNAi oligonucleotide is complementary to the first of the 21 nucleosides (5' to 3') of the antisense RNAi oligonucleotide, while the last two 3'-nucleosides of the antisense RNAi oligonucleotide are not paired with the sense RNAi oligonucleotide (they are overhang nucleosides).
[0705] Sense RNAi oligonucleotides are listed in the table below. The length of each sense RNAi oligonucleotide is 21 nucleosides. In the table below, the subscript "y" represents a 2'-methylribosyl sugar, the subscript "f" represents a 2'-fluororibosyl sugar, the subscript "o" represents a phosphodiester nucleoside bond, and the subscript "s" represents a phosphorothioate nucleoside bond. As shown below, the subscript "[16C2r]" represents a 2'-O-hexadecyl modified nucleoside.
[0706] [ka] In the formula, Bx is the heterocyclic base portion.
[0707] [Table 128]
[0708] Each Sprague Dolly rat was administered a single intrathecal (IT) dose of 1.5 mg of an RNAi compound. Each treatment group consisted of three rats. The groups of three rats were given PBS as a negative control. Three hours after injection, the movement of seven different body parts was evaluated for each rat. The seven body parts were: (1) the rat's tail, (2) the rat's posterior dorsal region, (3) the rat's hind limbs, (4) the rat's hind feet, (5) the rat's forelimbs, (6) the rat's anterior dorsal region, and (7) the rat's head. For each of the seven different body parts, a subscore of 0 was given to each rat if the body part was moving, and a subscore of 1 was given if the body part was paralyzed (Functional Observational Total Score or FOB). After evaluating each of the seven body parts, the subscores were summed for each rat and then averaged for each group. For example, if a rat's tail, head, and all other evaluated body parts were moving three hours after IT administration, the rat would receive a total score of 0. A rat receives a score of 1 if, three hours after IT administration, its tail was not moving, but all other evaluated body parts were moving. Results are shown as the average score for each treatment group.
[0709] [Table 129]
[0710] Example 30: Tolerability and long-term evaluation of RNAi compounds and modified oligonucleotides complementary to human APP in rats. The selected modified oligonucleotides and RNAi compounds described above were tested in SpragueDawley rats to evaluate long-term tolerance. Each SpragueDawley rat received a single intrathecal (IT) delivery dose of 1.5 mg of either the RNAi compound or PBS. Each treatment group consisted of three rats. The group of three rats received PBS as a negative control. Starting two weeks post-treatment, the animals were regularly evaluated, and a functional observation battery score was calculated for each animal as follows: movement of seven different body parts of each rat was evaluated. The seven body parts were: (1) the rat's tail, (2) the rat's posterior dorsal region, (3) the rat's hind limbs, (4) the rat's hind feet, (5) the rat's forelegs, (6) the rat's anterior dorsal region, and (7) the rat's head. For each of the seven different body parts, if the body part was moving, each rat was evaluated. A subscore of 0 was assigned to any body part that was paralyzed, and a subscore of 1 was assigned to any body part that was paralyzed (Functional Observational Balance Score, or FOB). After evaluating each of the seven body parts, the subscores were summed up for each rat. For example, if a rat's tail, head, and all other evaluated body parts were moving, the rat would receive a total score of 0. If another rat's tail was not moving but all other evaluated body parts were moving, the rat would receive a score of 1. The results are presented as the maximum FOB score for each animal during an evaluation period of more than four weeks.
[0711] [Table 130]
[0712] Example 31: Tolerance of complementary modified oligonucleotides to human APP in rats, 3-hour experiment The modified oligonucleotides described above were tested in rats to evaluate their tolerability. Each Sprague Dolly rat received a single intrathecal (IT) dose of 3 mg of the modified oligonucleotide. The modified oligonucleotide was administered in doses of 3 mg. Each treatment group consisted of 3-4 rats. The group of 4 rats was given PBS as a negative control. Three hours after injection, the movement of seven different body parts was evaluated for each rat. The seven body parts were: (1) the rat's tail, (2) the rat's posterior dorsal region, (3) the rat's hind limbs, (4) the rat's hind feet, (5) the rat's forelegs, (6) the rat's anterior dorsal region, and (7) the rat's head. For each of the seven different body parts, a subscore of 0 was given to each rat if the body part was moving, and a subscore of 1 was given if the body part was paralyzed (Functional Observational Total Score or FOB). After evaluating each of the seven body parts, the subscores were summed for each rat and then averaged for each group. For example, if a rat's tail, head, and all other evaluated body parts were moving 3 hours after administration of 3 mg of IT, the rat would receive a total score of 0. If another rat did not move its tail 3 hours after administration of 3 mg of IT, but all other evaluated body parts were moving, the rat would receive a score of 1. The results are shown as the average score for each treatment group.
[0713] [Table 131] In one embodiment, the present invention may be described as follows. [Aspect 1] An oligomer compound comprising a modified oligonucleotide consisting of 12 to 30 bound nucleosides, wherein the nucleic acid base sequence of the modified oligonucleotide is at least 80% complementary to the isolength portion of APP nucleic acid, and the modified oligonucleotide comprises at least one modification selected from a modified sugar portion and a modified nucleoside bond. [Aspect 2] An oligomer compound comprising a modified oligonucleotide consisting of 12 to 30 bound nucleosides, wherein the nucleic acid base sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15 or 16 consecutive nucleic acid bases from any of the nucleic acid base sequences of SEQ ID NOs. 2543 to 2572, and the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified nucleoside bond. [Aspect 3] An oligomer compound comprising a modified oligonucleotide consisting of 12 to 30 bound nucleosides, wherein the nucleic acid base sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleic acid bases from the nucleic acid base sequences of SEQ ID NOs. 30 to 2542 or 2573 to 3057, and the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified nucleoside bond. [Aspect 4] An oligomer compound comprising a modified oligonucleotide consisting of 12 to 30 bound nucleosides, wherein the nucleic acid base sequence of the modified oligonucleotide is The equal-length portion of nucleic acid bases 6193-6245 in Sequence ID No. 2, The equal-length portion of nucleic acid bases 9656-9656 in sequence number 2, The equal-length portion of nucleic acid bases 10203-10249 in sequence number 2, The equal-length portion of nucleic acid bases 11246-11287 in Sequence ID No. 2, The equal-length portion of nucleic acid bases 12566-12609 in Sequence ID No. 2, The equal-length portion of nucleic acid bases 22914-22964 in sequence number 2, The isoformed portion of nucleic acid bases 154394-154420 in sequence number 2, The equal-length portion of nucleic acid bases 154736-154760 in Sequence ID No. 2, The isoformed portion of nucleic acid bases 158598-158982 in Sequence ID No. 2, The isoformed portion of nucleic acid bases 159558-159581 in Sequence ID No. 2, The equal-length portion of nucleic acid bases 220028-220077 in Sequence ID No. 2, The isoformed portion of nucleic acid bases 220237-220426 in Sequence ID No. 2, The equal-length portion of nucleic acid bases 220710 to 220766 in Sequence ID No. 2, The isoformed portion of nucleic acid bases 220893-220919 in sequence number 2, The isoformed portion of nucleic acid bases 221002-221025 in Sequence ID No. 2, The isoformed portion of nucleic acid bases 221138-221177 in sequence number 2, The equal-length portion of nucleic acid bases 221315-221364 in Sequence ID No. 2, The isoformed portion of nucleic acid bases 222414~222478 in Sequence ID No. 2, The isoformed portion of nucleic acid bases 222548-222590 in Sequence ID No. 2, The isoformed portion of nucleic acid bases 222663-222697 in Sequence ID No. 2, The isoformed portion of nucleic acid bases 222764-222791 in Sequence ID No. 2, The equal-length portion of nucleic acid bases 225366 to 225400 in Sequence ID No. 2, The isoformed portion of nucleic acid bases 226497-226532 in Sequence ID No. 2, The isoformed portion of nucleic acid bases 229282-229306 in Sequence ID No. 2, The equal-length portion of nucleic acid bases 231282-231310 in sequence number 2, The isoformed portion of nucleic acid bases 234328-234370 in Sequence ID No. 2, The isoformed portion of nucleic acid bases 234802-234827 in Sequence ID No. 2, The equal-length portion of nucleic acid bases 34556-34575 in Sequence ID No. 2, The equal-length portion of nucleic acid bases 101718-101737 in sequence number 2, The isoformed portion of nucleic acid bases 158795-158814 in Sequence ID No. 2, or It is complementary to at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleic acid bases in the isolength portion of nucleic acid bases 292896-292922 of Sequence ID No. 2, The oligomer compound wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified nucleoside bond. [Aspect 5] It consists of 12 to 30 bonded nucleosides, Sequence IDs: 140, 1240, 1279, 1402, 1437; Sequence IDs: 116, 202, 626; Sequence IDs: 830, 912, 962, 1049, 1164, 1236; Sequence IDs: 201, 1741, 1870; Sequence IDs: 273, 744, 824, 898, 1025; Sequence IDs: 296, 384, 1568, 1617, 1701, 1734, 1841; Sequence IDs: 1553, 1593, 1709, 1805, 1873; Sequence IDs: 340, 519, 590, 711, 795, 819; Sequence IDs: 178, 547, 577, 693, 769, 846, 2225, 2480, 3047~3050; Sequence IDs: 200, 1688, 1740, 1820, 1906; Sequence IDs: 2576, 2493, 2660, 2708, 2790, 2806, 2854, 2900, 2903, 2993, 3013; Sequence IDs: 2590, 2690, 2691, 2760, 2808, 2939, 3002; Sequence IDs: 2580, 2652, 2728, 2772, 2866, 2874, 2931, 3012; Sequence IDs: 2619, 2671, 2783, 2812, 2875, 2929; Sequence IDs: 2638, 2649, 2676, 2753, 2757, 2804, 2932, 2983; Sequence IDs: 2575, 2848, 2890, 2965; Sequence IDs: 2583, 2654, 2748, 2823, 2882; Sequence IDs: 1557, 1613, 1696, 2592, 2699, 2713, 2775, 2844, 2879, 2977, 2986; Sequence IDs: 338, 2574, 2642, 2666, 2689, 2740, 2754, 2847, 2859, 2899, 2950, 2987, 3014; Sequence IDs: 2641, 2675, 2799, 2856, 2933, 2974; Sequence IDs: 2610, 2780, 2851, 2943, 2956; Sequence IDs: 2766, 2855, 2925, 2988; Sequence IDs: 2645, 2715, 2727, 2787, 2842, 2843, 2938, 2940, 2967, 2978; Sequence IDs: 299, 2632, 3020; Sequence IDs: 2591, 2705, 2747, 2865, 2941, 3010; Sequence IDs: 2621, 2629, 2679, 2687, 2735, 2788, 2864, 2912, 2966; Sequence IDs: 2701, 2742, 2828, 2908; Sequence IDs: 2611, 2717, 2979; or, An oligomer compound comprising a modified oligonucleotide having a nucleic acid base sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleic acid bases of a sequence selected from SEQ ID NOs: 35, 411, 482, The oligomer compound wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified nucleoside bond. [Aspect 6] The oligomer compound according to any one of aspects 1 to 5, wherein, when measured over the entire nucleic acid base sequence of the modified oligonucleotide, the modified oligonucleotide has a nucleic acid base sequence that is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to any of the nucleic acid base sequences of SEQ ID NOs: 1 to 8. [Aspect 7] The oligomer compound according to any one of aspects 1 to 6, wherein at least one nucleoside of the modified oligonucleotide is a modified nucleoside. [Aspect 8] The oligomer compound according to aspect 7, wherein the modified oligonucleotide comprises at least one modified nucleoside containing a modified sugar moiety. [Aspect 9] The oligomer compound according to aspect 8, wherein the modified oligonucleotide comprises at least one modified nucleoside including a bicyclic modified sugar moiety. [Aspect 10] The oligomer compound according to aspect 9, wherein the bicyclic modified sugar portion includes a 2'-4' crosslink, and the 2'-4' crosslink is selected from -O-CH2 and -O-CH(CH3)-. [Aspect 11] The oligomer compound according to any one of aspects 6 to 10, wherein the modified oligonucleotide comprises at least one modified nucleoside including a non-bicyclic modified sugar moiety. [Aspect 12] The oligomer compound according to aspect 8, wherein the modified oligonucleotide comprises at least one modified nucleoside containing a bicyclic modified sugar moiety having a 2'-4' bridge, and at least one modified nucleoside containing a non-bicyclic modified sugar moiety. [Aspect 13] The oligomer compound according to aspect 11 or 12, wherein the non-bicyclic modified sugar portion is a 2'-MOE sugar portion or a 2'-OMe modified sugar portion. [Aspect 14] The oligomer compound according to any one of aspects 1 to 13, wherein the modified oligonucleotide comprises at least one modified nucleoside containing a sugar substitute. [Aspect 15] The oligomer compound according to aspect 14, wherein at least one modified nucleoside of the modified oligonucleotide comprises a sugar substitute selected from morpholino and PNA. [Aspect 16] The oligomer compound according to any one of aspects 1 to 8, 11, or 13 to 15, wherein the modified oligonucleotide does not contain a bicyclic sugar moiety. [Aspect 17] The oligomer compound according to any one of aspects 1 to 16, wherein the modified oligonucleotide comprises at least one modified nucleoside bond. [Aspect 18] The oligomer compound according to aspect 17, wherein each nucleoside bond of the modified oligonucleotide is a modified nucleoside bond. [Aspect 19] The oligomer compound according to aspect 17 or aspect 18, wherein at least one nucleoside bond is a phosphorothioate nucleoside bond. [Aspect 20] The oligomer compound according to aspect 16 or 17, wherein at least one internucleoside bond is a mesylphosphoramide internucleoside bond. [Aspect 21] The oligomer compound according to aspect 17 or 19-20, wherein the modified oligonucleotide comprises at least one phosphodiester nucleoside interbonding linkage. [Aspect 22] The oligomer compound according to any one of aspects 17, 19, or 21, wherein each nucleoside bond is independently selected from phosphodiester nucleoside bonds or phosphorothioate nucleoside bonds. [Aspect 23] The oligomer compound according to any one of aspects 17, 19, or 20-21, wherein each nucleoside bond is independently selected from phosphodiester nucleoside bonds, phosphorothioate nucleoside bonds, and mesylphosphoramide nucleoside bonds. [Aspect 24] The oligomer compound according to any one of aspects 1 to 17 or 19 to 21 or 23, wherein at least one, at least two, at least three, at least four, or at least five internucleoside bonds of the modified oligonucleotide are mesylphosphoramide internucleoside bonds. [Aspect 25] The oligomer compound according to any one of aspects 1 to 24, wherein the modified oligonucleotide comprises a modified nucleic acid base. [Aspect 26] The oligomer compound according to aspect 25, wherein the modified nucleic acid base is 5-methylcytosine. [Aspect 27] The oligomer compound according to any one of aspects 1 to 26, wherein the modified oligonucleotide consists of 12 to 22, 12 to 20, 14 to 18, 14 to 20, 15 to 17, 15 to 25, 16 to 20, 16 to 18, or 18 to 20 bound nucleosides. [Aspect 28] The oligomer compound according to any one of aspects 1 to 27, wherein the modified oligonucleotide consists of 16 bound nucleosides. [Aspect 29] The oligomer compound according to any one of aspects 1 to 27, wherein the modified oligonucleotide consists of 20 bound nucleosides. [Aspect 30] The oligomer compound according to any one of aspects 1 to 29, wherein the modified oligonucleotide is a gapmer. [Aspect 31] The modified oligonucleotide is A 5'-region consisting of 1 to 6 bonded 5'-region nucleosides, A central region consisting of 6 to 10 binding central region nucleosides, and It has a sugar motif containing a 3'-region consisting of 1 to 6 bonded 3'-region nucleosides, and the nucleoside on the 3' side of the 5' region and the nucleoside on the 5' side of the 3'- region contain a modified sugar moiety. The oligomer compound according to any one of embodiments 1 to 29, wherein each of the central region nucleosides is selected from a nucleoside containing a 2'-β-D-deoxyribosyl sugar moiety and a nucleoside containing a 2'-substituted sugar moiety, and the central region comprises at least six nucleosides containing a 2'-β-D-deoxyribosyl sugar moiety and two or fewer nucleosides containing a 2'-substituted sugar moiety. [Aspect 32] The oligomer compound according to aspect 29, wherein each of the central region nucleosides is a 2'-β-D-deoxynucleoside. [Aspect 33] The modified oligonucleotide is A 5'-region consisting of 6 bonded 5'-region nucleosides, A central region consisting of 10 binding central region nucleosides, and It has a sugar motif containing a 3'-region consisting of four bonded 3'-region nucleosides, The oligomer compound according to embodiment 30 or embodiment 31, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides is a 2'-MOE nucleoside, and each of the central region nucleosides is a 2'-β-D-deoxynucleoside. [Aspect 34] The modified oligonucleotide is A 5'-region consisting of 5 bonded 5'-region nucleosides, A central region consisting of 10 binding central region nucleosides, and It has a sugar motif containing a 3'-region consisting of five bonded 3'-region nucleosides, The oligomer compound according to embodiment 30 or embodiment 31, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides is a 2'-MOE nucleoside, and each of the central region nucleosides is a 2'-β-D-deoxynucleoside. [Aspect 35] The modified oligonucleotide is A 5'-region consisting of three bonded 5'-region nucleosides, A central region consisting of 10 binding central region nucleosides, and It has a sugar motif containing a 3'-region consisting of three bonded 3'-region nucleosides, The oligomer compound according to embodiment 30 or embodiment 31, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides is a cEt nucleoside, and each of the central region nucleosides is a 2'-β-D-deoxynucleoside. [Aspect 36] The modified oligonucleotide is A 5'-region consisting of three bonded 5'-region nucleosides, A central region consisting of 10 binding central region nucleosides, and It has a sugar motif containing a 3'-region consisting of three bonded 3'-region nucleosides, Each of the 5'-region nucleosides and each of the 3'-region nucleosides are cEt nucleosides. The oligomer compound according to embodiment 30, wherein the central region has the following formula: (Nd)(Nx)(Nd)n, (wherein Nx is a 2'-OMe nucleoside, each Nd is a 2'-β-D-deoxynucleoside, and n is 8). [Aspect 37] The oligomer compound according to any one of aspects 1 to 36, wherein the modified oligonucleotide has an internucleoside linkage motif selected from soossssssssssos, soooossssssssssssss, soooossssssssssssssss, soooosssssssssssssss, soooossssssssssssooos or ssoosssssssssssss (where s is a phosphorothioate internucleoside linkage and o is a phosphodiester internucleoside linkage). [Aspect 38] The aforementioned differential oligonucleotide is soozzissssssssos, soozzissssssssos, soozzissssssssos, soozzissssssssos, zoozzisssssssssoz, soozzisssssssssos, soozzissssssssssos, sooooozzissssssssssos, sooooozzissssssssssoss, sooooozzisssssssssoss, sooooozzisssssssssoss, sooooozzissssssssoss, sooooozzissssssssoss, zooooozzissssssssozz, sooooozzisssssssssoss, sooooozzisssssssssoss, sooooo An oligomer compound according to any one of embodiments 1 to 36, having an internucleoside bonding motif selected from ssssssssszzss, soooszzsssssssssooss, soooszzzssssssssooss, soooszzzzzssssssooss, soooszzzzzsssssooss, sooosssssssssssooss, sooosssssssssssooss, and sooossssssssssszzoss (where s is a phosphorothioate internucleoside bond, o is a phosphodiester internucleoside bond, and z is a mesylphosphoramide internucleoside bond). [Aspect 39] An oligomer compound according to any one of aspects 1 to 38, comprising the modified oligonucleotide. [Aspect 40] The oligomer compound according to any one of aspects 1 to 38, further comprising a conjugate group. [Aspect 41] The oligomer compound according to aspect 40, wherein the conjugate group comprises a conjugate moiety and a conjugate linker. [Aspect 42] The oligomer compound according to aspect 41, wherein the conjugate linker consists of a single bond. [Aspect 43] The oligomer compound according to aspect 41 or aspect 42, wherein the conjugate linker is cleavable. [Aspect 44] The oligomer compound according to aspect 41, wherein the conjugate linker contains 1 to 3 linker nucleosides. [Aspect 45] The oligomer compound according to any one of aspects 40 to 44, wherein the conjugate group is bonded to the modified oligonucleotide at the 5' end of the modified oligonucleotide. [Aspect 46] The oligomer compound according to any one of aspects 40 to 44, wherein the conjugate group is bonded to the modified oligonucleotide at the 3' end of the modified oligonucleotide. [Aspect 47] An oligomer compound according to any one of aspects 1 to 38 or 40 to 45, comprising a terminal group. [Aspect 48] An oligomer compound according to any one of aspects 1 to 47, which is a single-chain oligomer compound. [Aspect 49] An oligomer compound according to any one of aspects 1 to 43 or 45 to 48, which does not contain a linker nucleoside. [Aspect 50] An oligomer double chain comprising the oligomer compound described in any one of aspects 1 to 47 or 49. [Aspect 51] An oligomer compound comprising a modified oligonucleotide consisting of 12 to 30 bound nucleosides, wherein the nucleic acid base sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 nucleic acid bases from any of SEQ ID NOs. 3058 to 3063, and the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified nucleoside bond. [Aspect 52] An oligomer double-chain comprising a first oligomer compound comprising a first modified alkyl group and a second oligomer compound comprising a second modified alkyl group, wherein the first oligomer compound is the oligomer compound of Aspect 51. [Aspect 53] The oligomer double-stranded oligomer according to aspect 52, wherein at least one nucleotide of the first modified oligonucleotide comprises a modified sugar moiety selected from a 2'-OMe sugar moiety, a 2'-F sugar moiety, and a 2'-MOE sugar moiety. [Aspect 54] The oligomer double chain according to aspect 53, wherein the first modified oligonucleotide consists of 23 bound nucleosides and has a sugar motif of efyyyyyyyyyyyfyfyyyyyyy, where each "e" represents a 2'-MOE sugar moiety, each "f" represents a 2'-F sugar, and each "y" represents a 2'-OMe sugar moiety. [Aspect 55] The oligomer double chain according to any one of aspects 52 to 54, wherein the first modified oligonucleotide comprises a 5'-stabilized phosphate group. [Aspect 56] The oligomer double chain according to aspect 55, wherein the 5'-stabilizing phosphate group is a 5'-vinylphosphonate. [Aspect 57] The oligomer double-stranded according to aspects 52 to 56, wherein the first modified oligonucleotide consists of 23 bound nucleosides and has an internucleoside linkage motif of ssooooooooooooooooooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. [Aspect 58] The oligomer double-stranded according to aspects 52 to 56, wherein the second modified oligonucleotide consists of 12 to 30 bound nucleosides and includes a complementary region of at least 12 nucleosides that is at least 90% complementary to the nucleic acid bases of the isolength region of the first modified oligonucleotide. [Aspect 59] The oligomer double helix according to aspect 58, wherein the complementary region consists of 21 nucleosides. [Aspect 60] The oligomer duplex according to aspect 58 or aspect 59, wherein the complementary region is at least 95% or 100% complementary to the equilength portion of the first modified oligonucleotide. [Aspect 61] The oligomer double chain according to any one of aspects 58 to 60, wherein at least one nucleoside of the second modified oligonucleotide comprises a 2'-OMe sugar moiety, a 2'-F sugar moiety, or a 2'-MOE sugar moiety. [Aspect 62] The oligomer double chain according to any one of aspects 52 to 61, wherein the second modified oligonucleotide consists of 21 bound nucleosides and has a sugar motif of yyyyyyfyfffyyyyyyyyyy, where each "f" represents a 2'-F sugar moiety and each "y" represents a 2'-OMe sugar moiety. [Aspect 63] The oligomer double chain according to any one of aspects 52 to 62, wherein the second oligomer compound contains a conjugate group. [Aspect 64] The oligomer double chain of aspect 63, wherein the second oligomer compound includes a conjugate group linked via a modified phosphoramide nucleoside bond. [Aspect 65] The conjugate group is C 12 ~C 20 An alkyl oligomeric double chain according to embodiment 63 or embodiment 64. [Aspect 66] The conjugate group is C 16 An alkyl oligomer double chain according to any of embodiments 63 to 65. [Aspect 67] The oligomer double-stranded according to any one of aspects 63 to 66, wherein the second modified oligonucleotide consists of 21 bound nucleosides and has a nucleoside-to-nucleoside linkage motif of ssooo[C16muP]ooooooooooooss, where each "o" represents a phosphodiester nucleoside linkage, each "s" represents a phosphorothioate nucleoside linkage, and each "[C16muP]" represents the modified phosphoramide nucleoside linkage shown below: [ka] [Aspect 68] An antisense compound comprising or consisting of an oligomer compound according to any one of aspects 1 to 49 or 51, or an oligomer double chain according to any one of aspects 50 or 53 to 67. [Aspect 69] A chiralally concentrated population of oligomer compounds according to any one of aspects 1 to 49 or 51, wherein the population is concentrated with respect to modified oligonucleotides comprising at least one specific phosphorothioate nucleoside bond having a specific stereochemical configuration. [Aspect 70] The chiralally enriched population according to aspect 69, wherein the population is enriched with respect to modified oligonucleotides comprising at least one specific phosphorothioate nucleoside bond having a (Sp) configuration. [Aspect 71] The chiralally enriched population according to aspect 69, wherein the population is enriched with respect to modified oligonucleotides comprising at least one specific phosphorothioate nucleoside bond having a (Rp) configuration. [Aspect 72] The chiralally enriched population according to aspect 69, wherein the population is enriched with respect to modified oligonucleotides having a specific, independently selected stereochemical configuration in each phosphorothioate nucleoside bond. [Aspect 73] The chiralally enriched population according to aspect 72, wherein the population is enriched with modified oligonucleotides having a (Rp) configuration in one specific phosphorothioate nucleoside bond and a (Sp) configuration in each of the remaining phosphorothioate nucleoside bonds. [Aspect 74] The chiralally enriched population according to aspect 72, wherein the population is enriched with respect to modified oligonucleotides having at least three consecutive phosphorothioate nucleoside bonds in Sp configuration, Sp configuration, and Rp configuration in the 5' to 3' direction. [Aspect 75] A group of oligomer compounds according to any one of aspects 1 to 49 or 51, wherein all of the phosphorothioate nucleoside bonds of the modified oligonucleotide are stereorandom. [Aspect 76] A pharmaceutical composition comprising an oligomeric compound according to any one of aspects 1 to 49 or 51, an oligomeric double chain according to aspects 50 or 52 to 67, an antisense compound according to aspect 68, or a group according to any one of aspects 69 to 75, and a pharmaceutically acceptable carrier or diluent. [Aspect 77] The pharmaceutical composition according to aspect 76, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid (aCSF) or phosphate buffer solution (PBS). [Aspect 78] The pharmaceutical composition according to aspect 77, wherein the pharmaceutical composition essentially comprises the oligomer compound, the oligomer double chain, the antisense compound, or the population and artificial cerebrospinal fluid. [Aspect 79] The pharmaceutical composition according to aspect 77, wherein the pharmaceutical composition essentially comprises the oligomer compound, the oligomer double chain, the antisense compound, or the group and PBS. [Aspect 80] A method comprising administering to an oligomer compound according to any one of aspects 1 to 49 or 51, an oligomer double-chain according to any one of aspects 50 or 52 to 57, an antisense compound according to aspect 68, a population according to any one of aspects 69 to 75, or a pharmaceutical composition according to any one of aspects 76 to 79. [Aspect 81] A method for treating an APP-related disease or disorder, comprising administering a therapeutically effective amount of an oligomer compound according to any one of aspects 1 to 49 or 51, an oligomer double-chain according to any one of aspects 50 or 52 to 67, an antisense compound according to aspect 68, a population according to any one of aspects 69 to 75, or a pharmaceutical composition according to any one of aspects 76 to 79 to a subject who has or is at risk of developing an APP-related disease or disorder. [Aspect 82] The method according to aspect 81, wherein the disease associated with APP is sporadic Alzheimer's disease, hereditary / familial Alzheimer's disease, Alzheimer's disease in patients with Down syndrome, or cerebral amyloid angiopathy. [Aspect 83] The method according to any one of aspects 80 to 82, wherein administration of an oligomeric compound according to any one of aspects 1 to 49 or 51, an oligomeric double chain according to any one of aspects 50 or 52 to 57, an antisense compound according to aspect 68, a population according to any one of aspects 69 to 75, or a pharmaceutical composition according to any one of aspects 76 to 79 improves at least one symptom or characteristic of an APP-related disease or disorder. [Aspect 84] The method according to aspect 83, wherein administration of an oligomer compound according to any one of aspects 1 to 49 or 51, an oligomer double-chain according to any one of aspects 50 or 52 to 57, an antisense compound according to aspect 68, a population according to any one of aspects 69 to 75, or a pharmaceutical composition according to any one of aspects 76 to 79 reduces or delays cognitive impairment, reduces or delays the decline of memory and language ability, improves behavioral and psychological symptoms, reduces apathy, improves motivation, reduces gait disturbance, reduces seizures, reduces or delays progressive dementia, or reduces abnormal amyloid deposition. [Aspect 85] The method according to any one of aspects 80 to 84, wherein the APP protein level in the subject is reduced. [Aspect 86] A method for reducing the expression of APP in cells, comprising contacting the cells with an oligomeric compound according to any one of aspects 1 to 49 or 51, an oligomeric double-chain according to any one of aspects 50 or 52 to 57, an antisense compound according to aspect 68, a population according to any one of aspects 69 to 75, or a pharmaceutical composition according to any one of aspects 76 to 79. [Aspect 87] The method according to aspect 86, wherein the cells are cortical brain cells or hippocampal cells. [Aspect 88] Use of an oligomeric compound according to any one of aspects 1 to 49 or 51, an oligomeric double-chain according to any one of aspects 50 or 52 to 57, an antisense compound according to aspect 68, a group according to any one of aspects 69 to 75, or a pharmaceutical composition according to any one of aspects 76 to 79, for the treatment of an APP-related disease or disorder. [Aspect 89] Use of an oligomeric compound according to any one of aspects 1 to 49 or 51, an oligomeric double-chain according to any one of aspects 50 or 52 to 57, an antisense compound according to aspect 68, a group according to any one of aspects 69 to 75, or a pharmaceutical composition according to any one of aspects 76 to 79, for the purpose of manufacturing a drug for treating an APP-related disease or disorder. [Aspect 90] The use according to aspect 88 or 89, wherein the disease associated with the APP is sporadic Alzheimer's disease, hereditary / familial Alzheimer's disease, Alzheimer's disease in patients with Down syndrome, or cerebral amyloid angiopathy. [Aspect 91] The method according to any one of aspects 80 to 85, wherein the subject is a human. [Aspect 92] The method according to aspect 86 or 87, wherein the cells are human. [Aspect 93] Modified oligonucleotides based on the following chemical structures: [ka] (Sequence ID 273), or a salt thereof. [Aspect 94] The modified oligonucleotide according to aspect 93, wherein the modified oligonucleotide is a sodium salt or a potassium salt. [Aspect 95] Modified oligonucleotides based on the following chemical structures: [ka] (Sequence ID 273). [Aspect 96] Modified oligonucleotides based on the following chemical structures: [ka] (Sequence ID 452), or a salt thereof. [Aspect 97] The modified oligonucleotide according to aspect 96, wherein the modified oligonucleotide is a sodium salt or a potassium salt. [Aspect 98] Modified oligonucleotides based on the following chemical structures: [ka] (Sequence ID 452). [Aspect 99] Modified oligonucleotides based on the following chemical structures: [ka] (Sequence ID 462), or a salt thereof. [Aspect 100] The modified oligonucleotide according to aspect 99, which is a sodium salt or a potassium salt. [Aspect 101] Modified oligonucleotides based on the following chemical structure: [ka] (Sequence ID 462). [Aspect 102] Modified oligonucleotides based on the following chemical structures: [ka] (Sequence ID 482), or a salt thereof. [Aspect 103] The modified oligonucleotide according to aspect 102, wherein the modified oligonucleotide is a sodium salt or a potassium salt. [Aspect 104] Modified oligonucleotides based on the following chemical structures: [ka] (Sequence ID 482). [Aspect 105] Modified oligonucleotides based on the following chemical structures: [ka] (Sequence ID 1064), or a salt thereof. [Aspect 106] The modified oligonucleotide according to aspect 105, wherein it is a sodium salt or a potassium salt. [Aspect 107] Modified oligonucleotides based on the following chemical structures: [ka] (Sequence ID 1064). [Aspect 108] Modified oligonucleotides based on the following chemical structures: [ka] (Sequence ID 2225), or a salt thereof. [Aspect 109] The modified oligonucleotide according to aspect 108, wherein it is a sodium salt or a potassium salt. [Aspect 110] Modified oligonucleotides based on the following chemical structure: [ka] (Sequence ID 2225). [Aspect 111] Chemical notation below: G es m C eo A eo T eo T es m C ds T ds m C ds T ds T ds A ds T ds A ds T ds T ds m C eo m C eo T es T es A e A modified oligonucleotide based on (SEQ ID NO: 273), During the ceremony, A is an adenine nucleic acid base, m C is a 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, and o is an oligomeric compound containing the modified oligonucleotide, which is a phosphodiester nucleoside bond. [Aspect 112] Chemical notation below: G es T eo T eo T eo A es m C ds m C ds T ds T ds T ds A ds A ds m C ds Ads T ds T eo m C eo m C es T es m C e A modified oligonucleotide based on (SEQ ID NO: 452), During the ceremony, A is an adenine nucleic acid base, m C is a 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, and o is an oligomeric compound containing the modified oligonucleotide, which is a phosphodiester nucleoside bond. [Aspect 113] Chemical notation below: G es m C eo m C eo A eo T es A ds T ds T ds G ds T ds m C ds A ds T ds T ds T ds T eo A eo m C es A es m C e A modified oligonucleotide based on (SEQ ID NO: 462), During the ceremony, A is an adenine nucleic acid base, m C is a 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, and o is an oligomeric compound containing the modified oligonucleotide, which is a phosphodiester nucleoside bond. [Aspect 114] Chemical notation below: G es T eo A eo T eo m C es m C ds T ds m C ds T ds T ds A ds A ds T ds T ds m C ds m C eo T eo A es T es A e A modified oligonucleotide based on (SEQ ID NO: 482), During the ceremony, A is an adenine nucleic acid base, m C is a 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, and o is an oligomeric compound containing the modified oligonucleotide, which is a phosphodiester nucleoside bond. [Aspect 115] Chemical notation below: m C es T eo m Ceo m C eo A es A ds T ds T ds T ds T ds A ds A ds m C ds T ds T ds G eo m C eo A es m C es m C e Modified oligonucleotides based on (SEQ ID NO: 1064), During the ceremony, A is an adenine nucleic acid base, m C is a 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, and o is an oligomeric compound containing the modified oligonucleotide, which is a phosphodiester nucleoside bond. [Aspect 116] Chemical notation below: G es T eo T eo m C eo A es m C ds A ds G ds T ds T ds T ds A ds m C ds m C ds m C ds m C eo A eoA es G es m C e A modified oligonucleotide based on (SEQ ID NO: 2225), During the ceremony, A is an adenine nucleic acid base, m C is a 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, and o is an oligomeric compound containing the modified oligonucleotide, which is a phosphodiester nucleoside bond. [Aspect 117] The compound according to any one of aspects 111 to 116, wherein the modified oligonucleotide is covalently bonded to the conjugate group. [Aspect 118] A chiralally concentrated population of a modified oligonucleotide according to any one of aspects 93 to 110, or an oligomer compound according to any one of aspects 111 to 116, wherein the population is concentrated with respect to a modified oligonucleotide having at least one specific phosphorothioate nucleoside bond having a specific stereochemical configuration. [Aspect 119] The chiralally enriched population according to aspect 118, wherein the population is enriched with respect to modified oligonucleotides containing at least one specific phosphorothioate nucleoside bond having a (Sp) configuration. [Aspect 120] The chiralally enriched population according to aspect 118, wherein the population is enriched with respect to modified oligonucleotides containing at least one specific phosphorothioate nucleoside linkage having a (Rp) configuration. [Aspect 121] The chiralally enriched population according to aspect 118, wherein the population is enriched with respect to modified oligonucleotides having a specific, independently selected stereochemical configuration in each phosphorothioate nucleoside bond. [Aspect 122] The chiralally enriched population according to aspect 121, wherein the population is enriched with modified oligonucleotides having a (Rp) configuration in one specific phosphorothioate nucleoside bond and a (Sp) configuration in each of the remaining phosphorothioate nucleoside bonds. [Aspect 123] The chiralally enriched population according to aspect 121, wherein the population is enriched with modified oligonucleotides having at least three consecutive phosphorothioate nucleoside bonds in Sp configuration, Sp configuration, and Rp configuration in the 5' to 3' direction. [Aspect 124] The population of modified oligonucleotides according to any one of aspects 93 to 110, or oligomeric compounds according to any one of aspects 111 to 116, wherein all of the phosphorothioate nucleoside bonds of the modified oligonucleotides are stereorandom. [Aspect 125] A pharmaceutical composition comprising a group of modified oligonucleotides according to any one of aspects 93 to 110, or an oligomer compound according to any one of aspects 111 to 116, or a group according to any one of aspects 118 to 124, and a pharmaceutically acceptable diluent or carrier. [Aspect 126] The pharmaceutical composition according to aspect 125, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid or phosphate-buffered salt solution (PBS). [Aspect 127] The pharmaceutical composition according to aspect 126, wherein the pharmaceutical composition essentially comprises the modified oligonucleotide, the oligomer compound, the population, and artificial cerebrospinal fluid. [Aspect 128] The pharmaceutical composition according to aspect 126, wherein the pharmaceutical composition essentially comprises the modified oligonucleotide, the oligomer compound, the population, and PBS. [Aspect 129] A method comprising administering to a subject a group of modified oligonucleotides according to any one of aspects 93 to 110, an oligomer compound according to any one of aspects 111 to 116, a group according to any one of aspects 118 to 124, or a pharmaceutical composition according to any one of aspects 125 to 128. [Aspect 130] A method for treating an APP-related disease or disorder, comprising administering a therapeutically effective amount of a group of modified oligonucleotides described in any of aspects 93 to 110, an oligomer compound described in any of aspects 111 to 116, a group described in any of aspects 118 to 124, or a pharmaceutical composition described in any of aspects 125 to 128 to a subject who has or is at risk of developing an APP-related disease or disorder. [Aspect 131] The method according to aspect 130, wherein the disease associated with APP is sporadic Alzheimer's disease, hereditary / familial Alzheimer's disease, Alzheimer's disease in patients with Down syndrome, or cerebral amyloid angiopathy. [Aspect 132] The method according to any one of aspects 129 to 131, wherein administration of a group of modified oligonucleotides according to any one of aspects 93 to 110, an oligomer compound according to any one of aspects 111 to 116, a group according to any one of aspects 118 to 124, or a pharmaceutical composition according to any one of aspects 125 to 128 improves at least one symptom or characteristic of an APP-related disease or disorder. [Aspect 133] The method according to aspect 132, wherein administration of the group of modified oligonucleotides described in any of aspects 93 to 110, the oligomer compound described in any of aspects 111 to 116, the group described in any of aspects 118 to 124, or the pharmaceutical composition described in any of aspects 125 to 128 reduces or delays cognitive impairment, reduces or delays the decline of memory and language ability, improves behavioral and psychological symptoms, reduces apathy, improves motivation, reduces gait disturbance, reduces seizures, reduces or delays progressive dementia, or reduces abnormal amyloid deposition. [Aspect 134] The method according to any one of aspects 129 to 134, wherein the APP protein level in the subject is reduced. [Aspect 135] A method for reducing the expression of APP in cells, comprising contacting the cells with a group of modified oligonucleotides according to any one of aspects 93 to 110, an oligomer compound according to any one of aspects 111 to 116, a group according to any one of aspects 118 to 124, or a pharmaceutical composition according to any one of aspects 125 to 128. [Aspect 136] The method according to aspect 135, wherein the cells are cortical brain cells or hippocampal cells. [Aspect 137] Use of the group of modified oligonucleotides described in any of aspects 93 to 110, the oligomer compound described in any of aspects 111 to 116, the group described in any of aspects 118 to 124, or the pharmaceutical composition described in any of aspects 125 to 128, for the treatment of diseases or disorders related to APP. [Aspect 138] Use of a group of modified oligonucleotides according to any one of aspects 93 to 110, an oligomer compound according to any one of aspects 111 to 116, a group according to any one of aspects 118 to 124, or a pharmaceutical composition according to any one of aspects 125 to 128, for the purpose of manufacturing a drug for treating an APP-related disease or disorder. [Aspect 139] The use according to aspect 137 or 138, wherein the disease or disorder associated with the APP is sporadic Alzheimer's disease, hereditary / familial Alzheimer's disease, Alzheimer's disease in patients with Down syndrome, or cerebral amyloid angiopathy. [Aspect 140] The method according to any one of aspects 129 to 134, wherein the subject is a human. [Aspect 141] The method according to aspect 135 or aspect 136, wherein the cells are human cells.
Claims
[Claim 1] The invention described in the specification.