Assay Methods and Kits

Abstract

The present invention provides novel components for performing assays, eg, sandwich immunoassays, methods that utilize the novel components, and compositions and kits that include the novel components.

Description

[Technical Field]

[0001] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in XML file format and is incorporated by reference herein in its entirety. The XML copy was created on December 18, 2023, is named 0076-0065WO1_SL.xml, and is 80,962 bytes in size.

[0002] The present invention provides components for performing assays, eg, sandwich immunoassays, methods utilizing the components, and compositions and kits containing the components. [Background technology]

[0003] Immunoassays, such as sandwich immunoassays, are commonly used to detect analytes in samples. Methods for improving assay sensitivity often involve analyte-dependent multi-step optimization procedures that require numerous additional assay components and / or equipment, thereby increasing complexity and cost. Furthermore, optimized assays may require longer run times and / or complex analytical methods. Summary of the Invention

[0004] In embodiments, the present invention provides a method for detecting an analyte, comprising: (a) contacting a template oligonucleotide with a first complex comprising: (1) the analyte; and (2) a detection reagent that binds to the analyte, the detection reagent comprising a nucleic acid primer; (b) hybridizing the nucleic acid primer to the template oligonucleotide to form a second complex, and extending the nucleic acid primer with a polymerase, thereby forming an extended oligonucleotide; (c) binding the extended oligonucleotide to one or more labeled probes, each labeled probe comprising: (1) a detection oligonucleotide capable of binding to the extended oligonucleotide; and (2) comprises a detectable label; and (d) detecting the detectable label, thereby detecting the analyte, wherein the second complex is bound to a surface, and: (i) the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; (ii) the method further comprises terminating the extension by cleaving the template oligonucleotide; (iii) a combination of (i) and (ii); (iv) one or both of (i) and (ii), and the surface further comprises an anchor reagent; (v) the surface comprises an anchor reagent comprising an anchor oligonucleotide, and the anchor oligonucleotide comprises a modified nucleic acid; or (vi) any combination of (i), (ii), and (v).

[0005] In embodiments, the invention provides kits for detecting an analyte, comprising, in one or more vials, containers, or compartments: (a) a capture reagent that binds to the analyte; (b) a detection reagent that binds to the analyte, where the detection reagent comprises a nucleic acid primer or is capable of being linked to a nucleic acid primer; (c) a labeled probe comprising (1) a detection oligonucleotide and (2) a detectable label; and (d) a template oligonucleotide that is capable of hybridizing to the nucleic acid primer and comprises the same sequence as the detection oligonucleotide; the detection reagent comprises a protein or polypeptide; and: (i) the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; (ii) the kit further comprises a nuclease that is capable of cleaving the template oligonucleotide; (iii) a combination of (i) and (ii); (iv) one or both of (i) and (ii), and the kit further comprises an anchor reagent; (v) the kit further comprises an anchor reagent comprising an anchor oligonucleotide, where the anchor oligonucleotide comprises a modified nucleic acid; or (vi) any combination of (i), (ii), and (v).

[0006] In embodiments, the present invention provides a composition for labeling a surface, comprising: (1) a detectable label; and (2) a labeled probe comprising a detection oligonucleotide capable of binding to an extension oligonucleotide bound to the surface, wherein the extension oligonucleotide is formed by extension of a nucleic acid primer by a polymerase based on a template oligonucleotide, and wherein: (i) the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; (ii) the composition further comprises a nuclease capable of cleaving the template oligonucleotide; (iii) a combination of (i) and (ii); (iv) one or both of (i) and (ii), and further, the extension oligonucleotide is bound to the surface via an anchor reagent; (v) the surface comprises an anchor reagent comprising an anchor oligonucleotide, wherein the anchor oligonucleotide comprises a modified nucleic acid; or (vi) any combination of (i), (ii), and (v). In embodiments, the template oligonucleotide is a circular oligonucleotide. In embodiments, the extension of the nucleic acid primer is by rolling circle amplification (RCA).

[0007] In embodiments, the present invention provides a composition for labeling a surface, comprising: (a) a nucleic acid primer immobilized directly or indirectly on a surface; (b) a template oligonucleotide comprising (1) a first region that is complementary to the nucleic acid primer; and (2) a second region that comprises the same sequence as the detection oligonucleotide; (c) a polymerase; and (d) a labeled probe comprising (1) a detectable label; and (2) a detection oligonucleotide capable of binding to an extender oligonucleotide bound to the surface, wherein the extender oligonucleotide is formed by extension of the nucleic acid primer by the polymerase based on the template oligonucleotide, and wherein: (i) the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; (ii) the composition further comprises a nuclease capable of cleaving the template oligonucleotide; (iii) a combination of (i) and (ii); (iv) one or both of (i) and (ii); and further, the extender oligonucleotide is bound to the surface via an anchor reagent; (v) the surface comprises an anchor reagent comprising an anchor oligonucleotide, wherein the anchor oligonucleotide comprises a modified nucleic acid; or (vi) any combination of (i), (ii), and (v). In embodiments, the template oligonucleotide is a circular oligonucleotide. In embodiments, the extension of the nucleic acid primer is by rolling circle amplification (RCA).

[0008] In embodiments, the present invention provides a composition comprising a capture reagent, an analyte, a detection reagent comprising a nucleic acid primer, a template oligonucleotide, a polymerase, and a nuclease, wherein the capture reagent is immobilized on a surface; the capture reagent and the detection reagent are bound to the analyte; the nucleic acid primer is hybridized to the template oligonucleotide; the polymerase is capable of extending the nucleic acid primer; and the nuclease is capable of cleaving the template oligonucleotide.

[0009] In embodiments, the invention provides a composition comprising a capture reagent, an analyte, a detection reagent comprising an extender oligonucleotide, and an anchor reagent comprising an anchor oligonucleotide, wherein the capture reagent and the anchor reagent are immobilized on a surface; the capture reagent and the detection reagent are bound to the analyte; the anchor oligonucleotide comprises a modified nucleic acid selected from a peptide nucleic acid (PNA), a locked nucleic acid (LNA), a bridged nucleic acid (BNA), a nucleoside comprising a 2'-modification, or a combination thereof, optionally wherein the nucleoside comprising a 2'-modification comprises a 2'-O-methyl modification (2'-OMe), a 2'-O-methoxyethyl modification (2'-MOE), a 2'-deoxy-2'-fluoro modification (2'-F), a 2'-hydroxyl modification (2'-OH), or a combination thereof; and the extender oligonucleotide comprises an anchor complement bound to the anchor oligonucleotide.

[0010] In embodiments, the present invention provides a composition comprising a capture reagent, an analyte, a detection reagent comprising an extender oligonucleotide, and a labeled probe comprising a detection oligonucleotide, wherein the capture reagent and the detection reagent are conjugated to the analyte; the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof, wherein the modified nucleic acid is selected from PNA, LNA, BNA, a nucleoside comprising a 2'-modification, or a combination thereof, optionally wherein the nucleoside comprising a 2'-modification comprises a 2'-O-methyl modification (2'-Ome), a 2'-O-methoxyethyl modification (2'-MOE), a 2'-deoxy-2'-fluoro modification (2'-F), a 2'-hydroxyl modification (2'-OH), or a combination thereof; and the extender oligonucleotide is conjugated to the detection oligonucleotide.

[0011] In an embodiment, the present invention provides an oligonucleotide comprising any one of SEQ ID NOs: 7 to 15 or SEQ ID NO: 17. In an embodiment, the present invention provides an oligonucleotide consisting of any one of SEQ ID NOs: 7 to 15 or SEQ ID NO: 17. [Brief explanation of the drawings]

[0012] The following drawings form part of the present specification and are included to further demonstrate illustrative embodiments of certain aspects of the present invention.

[0013] [Figure 1A] Figure 1A shows an exemplary modified nucleic acid according to embodiments herein. Figure 1A is adapted from Duffy et al., BMC Biology 18:112 (2020). [Figure 1B] Figure IB shows an exemplary modified nucleic acid according to embodiments herein. Figure IB shows an exemplary bridged nucleic acid (BNA). [Figure 2A] FIG. 2A shows representative results of a comparative assay performed with a 23 nucleotide long detection oligonucleotide, as described in embodiments herein, and a 10 nucleotide long detection oligonucleotide without any modified nucleic acid ("DNA-23"), containing six locked nucleic acids (LNAs) ("LNA-10 / 6"). [Figure 2B] Figure 2B shows representative results of a comparative assay performed with a 23 nucleotide long detection oligonucleotide and without any modified nucleic acid ("Detection 23"), and with a 10 nucleotide long detection oligonucleotide containing five LNAs ("Detection 10+5L(A)"), as described in the embodiments herein. [Figure 3A] FIG. 3A shows representative results of an assay performed according to an embodiment herein, in which the restriction enzymes DdeI, HpaII, AluI, and StuI, each shown in FIG. 3A, were added to cleave a template oligonucleotide described herein. [Figure 3B] FIG. 3B shows representative results of an assay performed according to an embodiment herein, in which the restriction enzymes DdeI, HpaII, AluI, and StuI, each shown in FIG. 3B, were added to cleave a template oligonucleotide described herein. [Figure 3C]FIG. 3C shows representative results of an assay performed according to an embodiment herein, in which the restriction enzymes DdeI, HpaII, AluI, and StuI, each shown in FIG. 3C, were added to cleave a template oligonucleotide described herein. [Figure 3D] FIG. 3D shows representative results of an assay performed according to an embodiment herein, in which the restriction enzymes DdeI, HpaII, AluI, and StuI, each shown in FIG. 3D, were added to cleave a template oligonucleotide described herein. [Figure 4] 4 shows representative results of a calibration assay performed using varying concentrations of DdeI for cleavage of a template oligonucleotide, as described in an embodiment herein. The Hill slope of the assay is also shown. [Figure 5] FIG. 5 shows representative results of a kinetic assay performed using three different concentrations of DdeI (0, 0.005, or 0.05 U / well) and at three different temperatures (20° C., 23.5° C., and 27° C.), as described in the embodiments herein. [Figure 6A] Figure 6A shows representative results of an assay in which the addition of the restriction enzyme ApoI significantly reduces the temperature dependence of the assay. Figure 6A shows the ECL signal results. [Figure 6B] Figure 6B shows a representative result of an assay in which the addition of the restriction enzyme ApoI significantly reduces the temperature dependence of the assay. Figure 6B shows the ECL signal after normalization of the signal to the ECL signal at 27°C for 1 hour. [Figure 7A] Figure 7A shows representative results of two assays performed at room temperature (23.5°C), where the addition of the restriction enzyme TspRI improves ECL signal stability over time. Figure 7B shows the ECL signal for detection of biotinylated primers on streptavidin. [Figure 7B]Figure 7B shows representative results from two assays performed at room temperature (23.5°C), where the addition of the restriction enzyme TspRI improves ECL signal stability over time. Figure 7B shows the ECL signal after normalization to the ECL signal at the 1 hour time point. [Figure 7C] Figure 7C shows representative results from two assays performed at room temperature (23.5°C), where the addition of the restriction enzyme TspRI improves ECL signal stability over time. Figure 7C shows the ECL signal for the IL-5 immunoassay normalized to the ECL signal at the 1 hour time point. [Figure 8A] Figure 8A shows the dependence of anchor oligonucleotide ("anchor") length on background signal generated from a sample containing an anti-single-stranded DNA antibody, and the improvement upon addition of ssDNA to block this sample interference. The anchor contained the following modified nucleotides: 2'-O-methylated (A12-OM) and locked nucleobases LNA9-1, LNA9-2, LNA9-3, LNA9-6, LNA9-7, LNA9-8, LNA9-9, and A9+3L. [Figure 8B] Figure 8B shows the dependence of anchor oligonucleotide ("anchor") length on background signal generated from a sample containing an anti-single-stranded DNA antibody, and the improvement upon addition of ssDNA to block this sample interference. The anchor contained the following modified nucleotides: 2'-O-methylated (A12-OM) and locked nucleobases LNA9-1, LNA9-2, LNA9-3, LNA9-6, LNA9-7, LNA9-8, LNA9-9, and A9+3L. [Figure 9A] Figure 9A shows the stabilization of ECL signal, expressed as the percentage of ECL signal retained as the washer speed increases. In Figure 9A, the shorter A9+3L6OM anchor contains LNA and 2'-OMe bases. [Figure 9B]Figure 9B shows the stabilization of the ECL signal, expressed as the percentage of ECL signal retained as the washer speed increases, demonstrating similar stability to the A25 DNA-based anchor shown in Figure 9B. [Figure 10A] Figure 10A shows both the reduced nonspecific signal and the range (max-min) of nonspecific signal from the use of anchors with modified bases (A9+3L6OM (and PEG spacer) and A9+4L) vs. a DNA-based anchor (A25) when used in combination with ssDNA in the sample diluent. [Figure 10B] Figure 10B shows both the reduced nonspecific signal and the range (max-min) of nonspecific signal from the use of anchors with modified bases (A9+3L6OM (and PEG spacer) and A9+4L) vs. a DNA-based anchor (A25) when used in combination with ssDNA in the sample diluent. Figure 10B shows the results using A9-NoPeg, A9-1Peg, and A9-2Peg, where A9 is the same as A9+3L6OM from Figure 9A. [Figure 11A] Figure 11A shows the relative stability of three anchor oligonucleotides: (i) DNA-based (A25), (ii) LNA-based (A9+4L), and (iii) LNA, 2'-OMe-based (A9+3L6OM) at different washer speeds, illustrating the improved performance of modified anchors in shorter sequences. [Figure 11B] Figure 11B shows representative results of an assay performed according to embodiments herein, in which an anchor oligonucleotide ("A25") 25 nucleotides in length and without any modified nucleic acid, along with primers of varying concentrations, and either a detection oligonucleotide ("D23") 23 nucleotides in length and without any modified nucleic acid, or a detection oligonucleotide ("D10A+D10B") 10 nucleotides in length and comprising an LNA and / or 2'-OMe modified nucleic acid as described herein. [Figure 11C]Figure 11C shows representative results of an assay performed according to embodiments herein, in which an anchor oligonucleotide 9 nucleotides in length and comprising LNA and / or 2'-OMe nucleotides with varying concentrations of primers ("A9+3L6OM"), and either a detection oligonucleotide 23 nucleotides in length without any modified nucleic acids ("D23"), or a detection oligonucleotide 10 nucleotides in length and comprising LNA and / or 2'-OMe modified nucleic acids as described herein ("D10A+D10B"). [Figure 11D] FIG. 11D shows representative results of an assay performed according to an embodiment herein, in which primers were added at two concentrations, and either 0.05 U / well or 0.1 U / well of DdeI was added for cleavage of the template oligonucleotide and detection oligonucleotide ("D10A+D10B") 10 nucleotides in length and comprising LNA and / or 2'-OMe modified nucleic acids. [Figure 11E] 11E shows representative results of an assay performed according to an embodiment herein, in which TspRI was added for cleavage of the template oligonucleotide, and anchor oligonucleotides (A9+3L6OM containing LNA and / or 2'-OMe modified nucleic acids) and detection oligonucleotides ("D10A+D10B") 10 nucleotides in length and containing LNA and / or 2'-OMe modified nucleic acids were added, demonstrating improved stability of the ECL signal against washer flow rate from this combination of assay improvements. [Figure 12]12 shows representative results of assays performed according to embodiments herein using different combinations of detection and template oligonucleotides. D10A+5L: a 10-nucleotide (nt) detection oligonucleotide with five LNAs; used with a 61-nt template. D10A+5L5OM: a 10-nt detection oligonucleotide with five LNAs and five 2'-OMe nucleotides; used with a 61-nt template. D10A+5L-58A: a 10-nt detection oligonucleotide with five LNAs; used with a 58-nt template. D10A+5L5OM-58A: a 10-nt detection oligonucleotide with five LNAs and five 2'-OMe nucleotides; used with a 58-nt template. D10A+5L / D10B+6L: a mixture of D10A+5L and D10B+6L; used with a 61-nt template. D10A+5L5OM / D10B+6L: a mixture of D10A+5L5OM and D10B+6L; used with a 61 nt template. NSB: non-specific binding. [Figure 13] Figure 13 shows representative results from assays performed with the addition of a single-stranded oligonucleotide (SSO) stabilizer, extremely thermostable single-stranded DNA binding protein (ET SSB), during the extension reaction. The top panel shows the results of adding ET SSB before the polymerase. The bottom panel shows the results of adding ET SSB after the polymerase. [Figure 14] Figure 14 shows representative results of assays performed with different concentrations of ET SSB. The four panels show the addition of ET SSB 0, 5, 15, or 60 minutes after polymerase. [Figure 15] FIG. 15 shows representative results of assay signal fold increase over 24 hours of extension when ET SSB was added at 0, 5, 15, or 60 minutes after polymerase. [Figure 16] FIG. 16 shows representative results of the ratio of assay signal at 24 hours versus 4 hours in the presence of ET SSB or control reactions without ET SSB. [Figure 17]Figure 17 shows an exemplary illustration of an embodiment herein. In the left panel of Figure 17, the anchor reagent portion of the capture reagent-anchor reagent hybrid comprises a first binding partner, which binds to a second binding partner on a surface. In the right panel of Figure 17, the capture reagent portion of the capture reagent-anchor reagent hybrid is directly immobilized on a surface. [Figure 18] Figure 18 shows an exemplary illustration of an embodiment herein. A capture reagent and an anchor reagent ("anchor") are immobilized on a surface. The capture reagent is complexed with an analyte, a first detection reagent comprising a first nucleic acid probe ("PC1"), and a second detection reagent comprising a second nucleic acid probe ("PC2"). A bridging oligonucleotide ("BO"), which comprises a nucleic acid primer, hybridizes to both PC1 and PC2. The nucleic acid primer of the BO is capable of hybridizing to a template oligonucleotide and extending to form an extended oligonucleotide. A labeled probe, which is capable of binding to the extended oligonucleotide, is also shown. [Figure 19A] Figure 19A shows an exemplary illustration of an embodiment herein. In Figure 19A, a first complex is formed, comprising a capture reagent, an analyte ("A"), and a detection reagent, and an extension oligonucleotide is formed from a nucleic acid primer on the detection reagent. The extension oligonucleotide comprises a binding sequence. In Figure 19A, the binding sequence is capable of binding to a surface, which may comprise an anchor reagent. [Figure 19B] Figure 19B shows an exemplary illustration of an embodiment herein. In Figure 19B, a first complex is formed, comprising a capture reagent, an analyte ("A"), and a detection reagent, and an extension oligonucleotide is formed from a nucleic acid primer on the detection reagent. The extension oligonucleotide comprises a binding sequence. In Figure 19B, the anchor reagent is linked to an additional capture reagent on the surface, and the binding sequence binds to the anchor reagent linked to the capture reagent. [Figure 20]Figure 20 shows an exemplary illustration of an embodiment herein. A first complex is formed, comprising a capture reagent, an analyte ("A"), and a detection reagent, and an extension oligonucleotide is formed from a nucleic acid primer on the detection reagent. The extension oligonucleotide comprises a binding moiety (e.g., a hapten, which can be incorporated into the extension oligonucleotide via a hapten-labeled dNTP), which binds to an anchor reagent that binds to a binding moiety (e.g., a protein or antibody that binds to the hapten). [Figure 21] 21 shows an exemplary illustration of an embodiment herein. A first detection reagent comprising a first nucleic acid primer hybridizes to a first region of a template oligonucleotide, and a second detection reagent comprising a second nucleic acid primer hybridizes to a second region of the template oligonucleotide. Both the first and second nucleic acid primers are capable of being extended, thereby forming first and second extended oligonucleotides described herein. [Figure 22] Figure 22 shows an exemplary illustration of an embodiment herein. A first complex is formed, comprising a capture reagent, an analyte ("A"), and a detection reagent, and an extension oligonucleotide is formed from a nucleic acid primer on the detection reagent. The extension oligonucleotide is capable of forming a secondary structure containing a detectable enzymatic activity (e.g., an aptamer that binds hemin). The enzymatic activity, e.g., peroxidase activity, is detected, thereby detecting the analyte described herein. [Figure 23] Figure 23 shows an exemplary illustration of an embodiment herein. An anchor reagent is immobilized on a surface, such as a Western blot membrane, and a first complex is formed on the surface containing the analyte and first and second detection reagents, each containing a first and second nucleic acid primer. The first and second nucleic acid primers hybridize to a template oligonucleotide, which can be ligated to form a circular template. The first or second nucleic acid primer is extended to form an extended oligonucleotide. The extended oligonucleotide can bind to a detectably labeled probe. DETAILED DESCRIPTION OF THE INVENTION

[0014] Unless otherwise defined herein, scientific and technical terms used in this disclosure shall have the meanings commonly understood by those of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.

[0015] The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.

[0016] Use of the term "or" in the claims is used to mean "and / or" unless expressly indicated to refer only to alternatives, or alternatives are mutually exclusive, but the present disclosure supports a definition that refers only to alternatives and "and / or."

[0017] As used herein, the terms "comprising" (and any variation or form of "comprising", such as "comprise" and "comprises"), "having" (and any variation or form of "having", such as "have" and "has"), "including" (and any variation or form of "including", such as "includes" and "include"), or "containing" (and any variation or form of "containing", such as "contains" and "contain") are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.

[0018] The use of the term "for example" and its corresponding abbreviation "eg" means that the particular terms listed are representative examples and embodiments of the present disclosure and are not intended to be limited to the particular examples referenced or cited, unless expressly stated otherwise.

[0019] As used herein, "about" can mean plus or minus 10% of the value provided. When ranges are provided, they are inclusive of the boundaries. "About" can additionally or alternatively mean either within 10% of the stated value, or within 5% of the stated value, or in some cases, within 2.5% of the stated value; alternatively, "about" can mean rounded to the nearest significant figure.

[0020] As used herein, "between" refers to a range that includes the endpoints of the range. For example, a number between x and y explicitly includes the numbers x and y, as well as any number that falls within x and y.

[0021] As used herein, the term "simultaneous" in reference to one or more events (e.g., contacting a template oligonucleotide with a polymerase and a nuclease) means that the events occur at exactly the same time or substantially the same time; for example, simultaneous events described herein can occur less than or about 10 minutes apart, less than or about 5 minutes apart, less than or about 2 minutes apart, less than or about 1 minute apart, less than or about 30 seconds apart, less than or about 15 seconds apart, or less than or about 5 seconds apart.

[0022] As used herein, the term "level" in the context of an analyte refers to the amount, concentration, or biological activity or chemical reactivity (collectively referred to as "activity") of the analyte. The term "level" can also refer to the rate of change of the amount, concentration, or activity of a biomarker. "Level" can also refer to the absolute amount of the analyte in a sample, including an amount or concentration determined under steady-state or non-steady-state conditions, or a relative amount of the analyte. "Level" can further refer to an assay signal that correlates with the amount, concentration, activity, or rate of change of the analyte. The level of the analyte can be determined relative to a control component in the sample.

[0023] As used herein, "nucleic acid" refers to one (i.e., a single nucleotide monomer) or more than one nucleotide. In embodiments where "nucleic acid" refers to more than one nucleotide, the nucleotides may be covalently linked to form a polymeric structure, e.g., a "polynucleotide," an "oligonucleotide," or a "nucleic acid sequence." The term "nucleic acid" includes ribonucleic acid (RNA), e.g., RNA nucleotide monomers, and deoxyribonucleic acid (DNA), e.g., DNA nucleotide monomers. A "nucleotide" comprises a nucleobase and a sugar, which collectively form a "nucleoside," and a phosphate. A "standard" nucleotide referred to herein is a nucleotide with an adenine, guanine, thymine, uracil, or cytosine base, a deoxyribose or ribose sugar, and a phosphate.

[0024] As used herein, a "modified nucleic acid" refers to one (i.e., a single nucleotide monomer) or more nucleotides that contain modifications in the base, sugar, and / or backbone of a standard nucleotide. In embodiments, modified nucleic acids include natural modifications, such as methylation of the 2'-O atom of the ribose ring, modifications at the C5 of pyrimidine bases, and the like, which may be found in natural oligonucleotides but are not part of standard DNA or RNA nucleotides. In embodiments, modified nucleic acids include non-natural modifications, such as locked nucleic acid monomers (LNAs) or peptide nucleic acid monomers (PNAs), which can be synthesized using techniques known in the art. Exemplary modified nucleic acids are further described, for example, in Duffy et al., BMC Biology 18:112 (2020), and are shown in Figure 1A, adapted from Duffy et al., BMC Biology 18:112 (2020).

[0025] "Peptide nucleic acid" or "PNA" refers to a DNA mimic in which the deoxyribose phosphate backbone is replaced by a pseudopeptide polymer to which nucleobases are linked. As used herein, the terms "peptide nucleic acid" and "PNA" encompass a single PNA monomer or more than one PNA monomer. Generally, PNAs hybridize with complementary DNA or RNA, such as the extended oligonucleotides described herein, with greater affinity and specificity than unmodified natural nucleic acids (e.g., DNA or RNA). PNAs are further described, for example, in Pellestor et al., European Journal of Human Genetics 12:694-700 (2004).

[0026] "Locked nucleic acid" or "LNA" refers to a modified RNA nucleotide in which the ribose ring is "locked" using a methylene bridge connecting the 2'-O atom with the 4'-C atom. As used herein, the terms "locked nucleic acid" and "LNA" encompass a single LNA monomer or more than one LNA monomer. Non-limiting examples of LNA are described, for example, in Beigelman et al., Nucleic Acids Research 23(21):4434-4442 (1995).

[0027] "Bridged nucleic acid" or "BNA" refers to a modified RNA nucleotide comprising a bridge between the 2'-O atom and the 4'-C atom of ribose. As used herein, the term "bridged nucleic acid" or "BNA" encompasses a single BNA monomer or more than one BNA monomer. In embodiments, the bridge of the BNA comprises an amine, sulfur, oxygen, or a combination thereof. An example of a BNA is shown in Figure 1B. Further exemplary BNAs include, but are not limited to, 3'-amino-2',4'-BNA; 2',4'-BNA-2-pyridone; 2',4'-ENA; 2',4'-BNA-1-isoquinolone; 2',4'-BNA NC [NH];2',4'-BNA NC [NMe]; and 2',4'-BNA NC [NBn]. See, e.g., Obika et al., Tetrahedron Letters 38(50):8735-8738(1997); Koshkin et al., Tetrahedron 54(14):3607-3630 (1998); Obika et al., Chemical Communications 19:1992-1993(2001); and Soler-Bistue et al., Molecules 24(12):2297(2019).

[0028] In embodiments, the present invention provides assays, e.g., sandwich immunoassays, that utilize novel components to improve assay sensitivity, increase assay signal, reduce nonspecific background signals and nonspecific binding interactions of assay components, and / or improve assay robustness against variations in temperature and / or assay run time. In embodiments, the assay comprises extending a nucleic acid primer to form an extended oligonucleotide; binding the extended oligonucleotide to an anchor oligonucleotide; binding a labeled probe comprising a detection oligonucleotide to the extended oligonucleotide; and detecting the labeled probe bound to the extended oligonucleotide, wherein the amount of extended oligonucleotide corresponds to the amount of analyte. In embodiments, the present invention provides detection oligonucleotides comprising, e.g., RNA, modified nucleic acids, or combinations thereof. In embodiments, the present invention provides anchor oligonucleotides comprising, e.g., modified nucleic acids. In embodiments, the present invention provides an efficient extension step, e.g., by cleaving a template oligonucleotide. In embodiments, the present invention provides compositions and kits comprising the components disclosed herein.

[0029] In an embodiment, the present invention provides a method for detecting an analyte, comprising: (a) contacting a template oligonucleotide with a first complex comprising: (1) an analyte; and (2) a detection reagent that binds to the analyte, the detection reagent comprising a nucleic acid primer; (b) hybridizing a nucleic acid primer to the template oligonucleotide to form a second complex, and extending the nucleic acid primer with a polymerase, thereby forming an extended oligonucleotide; (c) binding the extender oligonucleotide to one or more labeled probes, each of which comprises: (1) a detection oligonucleotide capable of binding to the extender oligonucleotide; and (2) a detectable label; and (d) detecting the detectable label, thereby detecting the analyte; The second complex is bound to the surface, and: (i) the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; (ii) the method further comprises terminating the extension by cleaving the template oligonucleotide; (iii) a combination of (i) and (ii); (iv) one or both of (i) and (ii), further wherein the surface comprises an anchoring reagent; (v) the surface comprises an anchoring reagent comprising an anchoring oligonucleotide, the anchoring oligonucleotide comprising a modified nucleic acid; or (vi) Any combination of (i), (ii), and (v).

[0030] In embodiments, the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; and the method comprises terminating extension by cleaving the template oligonucleotide. In embodiments, the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; and the surface comprises an anchoring reagent. In embodiments, the method comprises terminating extension by cleaving the template oligonucleotide; and the surface comprises an anchoring reagent. In embodiments, the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; the method comprises terminating extension by cleaving the template oligonucleotide; and the surface comprises an anchoring reagent. In embodiments, the anchoring reagent comprises an anchor oligonucleotide, and the anchor oligonucleotide comprises a modified nucleic acid. In embodiments, the detection oligonucleotide comprises any one of SEQ ID NOs: 7-10. In embodiments, the cleavage comprises contacting a nuclease with the template oligonucleotide, and the nuclease comprises one or more restriction enzymes listed in Table 1. In embodiments, the nuclease comprises DdeI, AluI, HpaII, ApoI, DpnI, DpnII, ScrFI, MboI, MluCI, AseI, TaqI, or a combination thereof. In embodiments, the template oligonucleotide comprises the sequence of any one of SEQ ID NOs: 5, 6, or 16. In embodiments, the anchor oligonucleotide comprises the sequence of any one of SEQ ID NOs: 11, 17, and 21-37. [Table 1]

[0031] In an embodiment, the detection oligonucleotide comprises the sequence of any one of SEQ ID NOs: 7 to 10; and One or both of the methods include terminating extension by cleaving the template oligonucleotide, e.g., comprising any one of SEQ ID NOs: 5, 6, or 16; and The surface comprises an anchoring reagent.

[0032] In embodiments, the method includes terminating extension by cleaving a template oligonucleotide comprising the sequence of any one of SEQ ID NOs: 5, 6, or 16, for example; cleaving includes contacting a nuclease with the template oligonucleotide, wherein the nuclease includes DdeI, AluI, HpaII, ApoI, DpnI, DpnII, ScrFI, MboI, MluCI, AseI, TaqI, TspRI, or a combination thereof; and One or both of the detection oligonucleotides comprises RNA, modified nucleic acids, or a combination thereof; and The surface comprises an anchoring reagent.

[0033] In an embodiment, the surface comprises an anchor reagent, the anchor reagent comprising an anchor oligonucleotide comprising the sequence of any one of SEQ ID NOs: 11 and 21-37; and One or both of the detection oligonucleotides comprises RNA, modified nucleic acids, or a combination thereof; and The method includes terminating extension by cleaving a template oligonucleotide comprising the sequence of any one of SEQ ID NOs: 5, 6, or 16, for example.

[0034] In an embodiment, the detection oligonucleotide comprises any one of SEQ ID NOs: 7 to 10; The method includes terminating extension by cleaving a template oligonucleotide comprising the sequence of any one of SEQ ID NOs: 5, 6, or 16, for example, where cleaving includes contacting a nuclease with the template oligonucleotide, the nuclease including DdeI, AluI, HpaII, ApoI, DpnI, DpnII, ScrFI, MboI, MluCI, AseI, TaqI, TspRI, or a combination thereof; and The surface comprises an anchoring reagent.

[0035] In an embodiment, the detection oligonucleotide comprises any one of SEQ ID NOs: 7 to 10; The method includes terminating extension by cleaving a template oligonucleotide comprising, for example, any one of SEQ ID NOs: 5, 6, or 16; and The surface includes an anchor reagent, and the anchor reagent includes an anchor oligonucleotide including any one of the sequences set forth in SEQ ID NOs: 11, 17, and 21-37.

[0036] In embodiments, the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; The method includes terminating extension by cleaving a template oligonucleotide comprising the sequence of any one of SEQ ID NOs: 5, 6, or 16, for example, where cleaving comprises contacting a nuclease with the template oligonucleotide, the nuclease comprising DdeI, AluI, HpaII, ApoI, DpnI, DpnII, ScrFI, MboI, MluCI, AseI, TaqI, TspRI, or a combination thereof; and The surface includes an anchor reagent, and the anchor reagent includes an anchor oligonucleotide including any one of the sequences set forth in SEQ ID NOs: 11, 17, and 21-37.

[0037] In an embodiment, the detection oligonucleotide comprises any one of SEQ ID NOs: 7 to 10; The method includes terminating extension by cleaving a template oligonucleotide comprising the sequence of any one of SEQ ID NOs: 5, 6, or 16, for example, where cleaving comprises contacting a nuclease with the template oligonucleotide, the nuclease comprising DdeI, AluI, HpaII, ApoI, DpnI, DpnII, ScrFI, MboI, MluCI, AseI, TaqI, TspRI, or a combination thereof; and The surface includes an anchor reagent, and the anchor reagent includes an anchor oligonucleotide including any one of the sequences set forth in SEQ ID NOs: 11, 17, and 21-37.

[0038] Detection Reagents In embodiments, the method includes contacting the template oligonucleotide with a first complex comprising an analyte and a detection reagent. In embodiments, the detection reagent specifically binds to the analyte. In embodiments, the detection reagent comprises a nucleic acid primer.

[0039] In embodiments, the detection reagent comprises a protein or polypeptide, an antibody or antigen-binding fragment thereof, an antigen, a ligand, a receptor, an oligonucleotide, a hapten, an epitope, a mimotope, or an aptamer. In embodiments, the detection reagent comprises an antibody or a variant thereof, including an antigen / epitope-binding portion thereof, an antibody fragment or derivative, an antibody analog, an engineered antibody, or a substance that binds to an antigen in a manner similar to an antibody. In embodiments, the detection reagent comprises at least one heavy or light chain complementarity-determining region (CDR) of an antibody. In embodiments, the detection reagent comprises at least two CDRs from one or more antibodies. In embodiments, the detection reagent comprises an antibody or an antigen-binding fragment thereof. In embodiments, the detection reagent comprises an antigen-binding domain that specifically binds to an epitope of the analyte. In embodiments, the detection reagent comprises an oligonucleotide. In embodiments, the analyte comprises an oligonucleotide, and the detection reagent and the analyte comprise complementary oligonucleotides.

[0040] Nucleic acid primers In an embodiment, the detection reagent is linked to a nucleic acid primer. In an embodiment, the detection reagent comprises an oligonucleotide, and the nucleic acid primer is at the 5' or 3' end of the oligonucleotide. In an embodiment, the detection reagent comprises an antibody or an antigen-binding fragment thereof, and the nucleic acid primer is conjugated to the detection reagent. Conjugation of nucleic acids with biomolecules, such as antibodies or antigen-binding fragments thereof, is known to those skilled in the art. For example, conjugation of nucleic acid primers to detection reagents is described in WO2020 / 180645.

[0041] In an embodiment, the nucleic acid primer is about 10 to about 30 nucleotides in length, or about 12 to about 28 nucleotides in length, or about 13 to about 26 nucleotides in length, or about 14 to about 24 nucleotides in length, or about 11 to about 22 nucleotides in length, or about 12 to about 21 nucleotides in length, or about 13 to about 20 nucleotides in length, or about 13 to about 18 nucleotides in length, or about 14 to about 19 nucleotides in length. In an embodiment, the nucleic acid primer is about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, or about 30 nucleotides in length.

[0042] In embodiments, the nucleic acid primer is about 14 nucleotides in length, or about 15 nucleotides in length. In embodiments, the nucleic acid primer comprises or consists of a sequence shown in Table 2. [Table 2]

[0043] In an embodiment, the present invention provides an oligonucleotide comprising any one of the sequences set forth in SEQ ID NOs: 1 to 4. In an embodiment, the present invention provides an oligonucleotide consisting of any one of the sequences set forth in SEQ ID NOs: 1 to 4.

[0044] Template oligonucleotide In embodiments, the nucleic acid primer comprises a region complementary to a template oligonucleotide, which in embodiments is a template for nucleic acid amplification, e.g., by polymerase chain reaction (PCR); nicking and extension amplification reaction (NEAR); isothermal amplification methods such as strand displacement amplification (SDA), helicase-dependent amplification (HDA), or rolling circle amplification (RCA); or a combination thereof.

[0045] In an embodiment, the template oligonucleotide is about 40 to about 100 nucleotides in length, or about 50 to about 78 nucleotides in length, or about 53 to about 76 nucleotides in length, or about 50 to about 70 nucleotides in length, or about 53 to about 61 nucleotides in length, or about 54 to about 61 nucleotides in length. In an embodiment, the template oligonucleotide is about 53, about 54, about 55, about 56, about 57, about 58, about 59, about 60, about 61, about 62, about 63, about 64, about 65, about 66, about 67, about 68, about 69, about 70, about 71, about 72, about 73, about 74, about 75, or about 76 nucleotides in length.

[0046] In embodiments, the template oligonucleotide comprises the sequence 5'-GTTCTGTC-3' at its 5' end and the sequence 5'-GTGTCTA-3' at its 3' end. In embodiments, the template oligonucleotide comprises or consists of a sequence shown in Table 3. [Table 3]

[0047] In embodiments, the present invention provides an oligonucleotide comprising the sequence of any one of SEQ ID NOs: 5, 6, and 16. In embodiments, the present invention provides an oligonucleotide consisting of the sequence of any one of SEQ ID NOs: 5, 6, and 16.

[0048] In embodiments, the template oligonucleotide comprises one or more connector oligonucleotides, and the one or more connector oligonucleotides are capable of ligating to form a circular template. In embodiments, the 5' and 3' ends of the template oligonucleotide are capable of hybridizing to first and second regions of a nucleic acid primer. In embodiments, the template oligonucleotide is a cyclic oligonucleotide. In embodiments, the template oligonucleotide is a cyclic oligonucleotide, and the method comprises hybridizing the cyclic oligonucleotide to the nucleic acid primer to form a second complex described herein. In embodiments, the template oligonucleotide is a linear oligonucleotide, and the 5' and 3' ends of the linear oligonucleotide are capable of ligating to form a cyclic oligonucleotide. In embodiments, the 5' and 3' ends of the linear oligonucleotide are ligated after hybridization of the 5' and 3' ends of the template oligonucleotide to the first and second regions of the nucleic acid primer. In embodiments, the template oligonucleotide is a linear oligonucleotide, and the method comprises ligating the 5' and 3' ends of the linear oligonucleotide before, during, or after hybridization of a nucleic acid primer to the template oligonucleotide, thereby forming a circular template.

[0049] In embodiments, a nucleic acid primer is hybridized to a template oligonucleotide to form a second complex, and the nucleic acid primer is extended by PCR. In embodiments, a nucleic acid primer is hybridized to a template oligonucleotide to form a second complex, and the nucleic acid primer is extended by NEAR. In embodiments, the template oligonucleotide is a cyclic oligonucleotide, a nucleic acid primer is hybridized to the cyclic oligonucleotide, and the nucleic acid primer is extended by RCA. In embodiments, a nucleic acid primer is hybridized to a template oligonucleotide, the template oligonucleotide is ligated to form a circular template, and the nucleic acid primer is extended by RCA. In embodiments, the extension, e.g., PCR, NEAR, or RCA, is performed at about 15°C to about 35°C, or about 18°C ​​to about 30°C, or about 20°C to about 27°C. In embodiments, the extension, e.g., PCR, NEAR, or RCA, is carried out for about 5 to about 120 minutes, or about 5 to about 90 minutes, or about 45 to about 90 minutes, or about 30 to about 60 minutes, or about 15 to about 30 minutes, or about 10 to about 20 minutes, or about 5 to about 10 minutes. In embodiments, the nucleic acid primer is extended to form an extended oligonucleotide.

[0050] polymerase In embodiments, the nucleic acid primer is extended by a polymerase. In embodiments, the polymerase is capable of performing PCR, NEAR, or an isothermal amplification method such as SDA, HDA, or RCA. In embodiments, the polymerase is capable of performing SDA, i.e., displacing downstream DNA encountered during synthesis. In embodiments, the polymerase is capable of multiple displacement amplification (MDA). Non-limiting examples of polymerases capable of performing PCR, NEAR, SDA, HDA, and / or RCA include Taq polymerase, Vent polymerase, T4 polymerase, T7 polymerase, Phi29 polymerase, Bst polymerase, polymerases from Bacillus bacteriophages Nf, Karezi, and BeachBum (also referred to herein as "Nf polymerase," "Karezi polymerase," and "BeachBum polymerase," respectively), and polymerases from other Phi29-like bacteriophages, e.g., as described in Stanton et al., Viruses 13:1557 (2021).

[0051] In embodiments, the polymerase comprises strand displacement activity, referred to herein as an "SD polymerase." In embodiments, the SD polymerase comprises an amino acid sequence with at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to a DNA polymerase from a bacteriophage. In embodiments, the bacteriophage is Phi29, Nf, Karezi, or BeachBum. In embodiments, the SD polymerase comprises an amino acid sequence with at least 80% sequence identity to a DNA polymerase from a bacteriophage, and the bacteriophage is Phi29, Nf, Karezi, or BeachBum. In embodiments, the SD polymerase comprises an amino acid sequence that is at least 90% identical to a DNA polymerase, a bacteriophage, and the bacteriophage is Phi29, Nf, Karezi, or BeachBum. In embodiments, the SD polymerase is a DNA polymerase, a bacteriophage, and the bacteriophage is Phi29, Nf, Karezi, or BeachBum.

[0052] Mold cutting In embodiments, the method further comprises terminating the extension of the nucleic acid primer by cleaving the template oligonucleotide. Surprisingly, it has been found that cleavage of the template oligonucleotide results in a more stable assay endpoint, thereby providing numerous advantages, including, for example, allowing assays to be performed without requiring strict assay timing and / or temperature conditions; shortening amplification time while improving amplification reproducibility, for example, between multiple wells of an assay plate; allowing optimal assay signal to be determined; and controlling background signal. Assays that can be performed without strict timing and / or temperature requirements provide valuable flexibility, for example, in situations where assay plates are batch-processed (e.g., in non-instrumented point-of-care (POC) devices and automated instruments) and may not allow optimal assay timing, for example, due to scheduling constraints.

[0053] In embodiments, cleavage involves contacting a nuclease with the template oligonucleotide. In embodiments, the template oligonucleotide is contacted with the nuclease and polymerase simultaneously or substantially simultaneously. Surprisingly, it has been discovered that fine-tuning the ratio of polymerase to nuclease within the same reaction allows for a more robust assay procedure. Inclusion of a nuclease with a polymerase allows the two enzymes to function together, achieving the desired result of reducing the temperature and time sensitivity of the reaction, thereby improving assay robustness. Fine-tuning enzyme activity, for example, polymerase amplification of the template and nuclease cleavage and preventing further polymerase activity, optimizes assay robustness. When these two enzyme activities are properly matched, the reaction is controlled by the balance between the two enzyme activities within the reaction: polymerase amplification of the template oligonucleotide and nuclease, which prevents further amplification of the template oligonucleotide by the polymerase. This balance of opposing activities, as defined by the concentrations of polymerase and nuclease, results in a reaction in which the amount of extended oligonucleotide formed is less sensitive to changes in temperature and time, allowing the reaction to be substantially buffered from the effects of temperature and / or time. In embodiments, the reaction is carried out at about 20°C to about 27°C while maintaining a substantially consistent assay signal. In embodiments, the use of both a polymerase and a nuclease allows the assay to be performed without the need for a temperature-controlled incubator.

[0054] In embodiments, the nuclease specifically cleaves the template oligonucleotide. In embodiments, the nuclease does not cleave the nucleic acid primer or the extension oligonucleotide. In embodiments, the nuclease specifically cleaves a double-stranded oligonucleotide, such as a double-stranded DNA, a double-stranded RNA, or a double-stranded DNA / RNA hybrid. In embodiments, the double-stranded DNA, double-stranded RNA, or double-stranded DNA / RNA hybrid comprises the template oligonucleotide and a nucleic acid primer hybridized thereto.

[0055] In embodiments, the template oligonucleotide and the nucleic acid primer each comprise single-stranded DNA, which upon hybridization form a double-stranded DNA oligonucleotide. In embodiments, a nuclease specifically cleaves the double-stranded oligonucleotide formed by hybridization of the template oligonucleotide to the nucleic acid primer. In embodiments, the nuclease is a restriction endonuclease (also known as a restriction enzyme). Non-limiting examples of restriction endonucleases that can be used include the restriction enzymes listed in Table 1. In embodiments, the nuclease is DdeI, AluI, HpaII, ApoI, DpnI, DpnII, ScrFI, MboI, MluCI, AseI, TaqI, TspRI, or a combination thereof.

[0056] In embodiments, one of the template oligonucleotides or nucleic acid primers comprises single-stranded DNA, and the other comprises single-stranded RNA, which form a double-stranded DNA / RNA hybrid upon hybridization. In embodiments, a nuclease specifically cleaves the DNA / RNA hybrid formed by hybridization of the template oligonucleotide and the nucleic acid primer. Non-limiting examples of nucleases capable of cleaving DNA / RNA hybrids include RNase H (including RNase H1, H2, and H3) and restriction endonucleases AvaII, AvrII, BanI, Sau3AI, BstNI, NciI, MvaI, BcnI, and MspI. In embodiments, the nuclease is an endoribonuclease. Non-limiting examples of endoribonucleases include RNase III, RNase A, RNase T1, RNase T2, and RNase H. In embodiments, the nuclease is RNase H2.

[0057] In embodiments, the template oligonucleotide comprises a DNA damage indicator, and the nuclease comprises an excision enzyme that specifically binds to the DNA damage indicator and cleaves the template oligonucleotide. In embodiments, the DNA damage indicator is not present in the nucleic acid primer or extension oligonucleotide, and the nuclease does not bind to or cleave the nucleic acid primer or extension oligonucleotide.

[0058] In embodiments, the DNA damage indicator comprises a nucleobase not typically present in DNA, and the nuclease cleaves DNA containing such nucleobase. In embodiments, the DNA damage indicator comprises a uracil base, and the nuclease comprises uracil-N-glycosylase (UNG). UNG may leave an abasic site at the point of cleavage. In embodiments, cleaving further comprises providing an abasic site endonuclease. In embodiments, the abasic site endonuclease comprises uracil-DNA glycosylase (UDG), apurinic / apyrimidinic (AP) endonuclease 1 (APE1), endonuclease IV, or a combination thereof.

[0059] In embodiments, the DNA damage indicator comprises deoxyinosine and the nuclease comprises endonuclease V. In embodiments, the DNA damage indicator comprises a damaged purine and the nuclease comprises an enzyme that repairs damaged purines. In embodiments, the damaged purine comprises 8-oxoguanine (8oxoG) and the nuclease comprises formamidopyrimidine DNA glycosylase (Fpg).

[0060] As discussed herein, methods that include terminating extension, e.g., by cleaving the template oligonucleotide, offer several advantages over methods that do not include termination. In embodiments, the assay signal range produced by methods that include termination is more stable and less prone to variation based on assay temperature and / or extension time compared to methods that do not include termination. As used herein, "assay signal range" refers to the ratio of maximum signal to minimum signal in an assay performed under the indicated conditions, e.g., an assay temperature range of 20°C to 30°C, or an extension time range of about 5 minutes to about 90 minutes.

[0061] In embodiments, methods that include terminating extension as described herein are less sensitive to variations in assay temperature compared to methods that do not include termination. In embodiments, the extension includes RCA, and the termination includes cleaving the template oligonucleotide described herein, e.g., with a nuclease described herein. In embodiments, the RCA is performed at about 15°C to about 35°C, or about 18°C ​​to about 30°C, or about 20°C to about 27°C. In embodiments, the assay signal range produced by the method does not vary substantially when the method is performed at about 20°C to about 21°C, 22°C, 23°C, 24°C, 25°C, 26°C, 27°C, 28°C, 29°C, or 30°C.

[0062] In embodiments, the assay signal range produced by the methods described herein does not vary more than five-fold over an assay temperature range of about 17°C to about 30°C, or about 18°C ​​to about 29°C, or about 19°C to about 28°C, or about 20°C to about 27°C. In embodiments, the assay signal range produced by the methods does not vary more than four-fold over an assay temperature range of about 17°C to about 30°C, or about 18°C ​​to about 29°C, or about 19°C to about 28°C, or about 20°C to about 27°C. In embodiments, the assay signal range produced by the methods does not vary more than four-fold over an assay temperature range of about 17°C to about 30°C, or about 18°C ​​to about 29°C, or about 19°C to about 28°C, or about 20°C to about 27°C. In embodiments, the assay signal range produced by the method does not vary by more than 3-fold over an assay temperature range of about 17° C. to about 30° C., or about 18° C. to about 29° C., or about 19° C. to about 28° C., or about 20° C. to about 27° C. In embodiments, the assay signal range produced by the method does not vary by more than 1.5-fold over an assay temperature range of about 17° C. to about 30° C., or about 18° C. to about 29° C., or about 19° C. to about 28° C., or about 20° C. to about 27° C.

[0063] In embodiments, the assay signal range produced by the methods described herein does not vary by more than ±50% over an assay temperature range of about 17°C to about 30°C, or about 18°C ​​to about 29°C, or about 19°C to about 28°C, or about 20°C to about 27°C. In embodiments, the assay signal range produced by the methods does not vary by more than ±40% over an assay temperature range of about 17°C to about 30°C, or about 18°C ​​to about 29°C, or about 19°C to about 28°C, or about 20°C to about 27°C. In embodiments, the assay signal range produced by the methods does not vary by more than ±30% over an assay temperature range of about 17°C to about 30°C, or about 18°C ​​to about 29°C, or about 19°C to about 28°C, or about 20°C to about 27°C. In embodiments, the assay signal range produced by the method does not vary by more than ±20% over an assay temperature range of about 17° C. to about 30° C., or about 18° C. to about 29° C., or about 19° C. to about 28° C., or about 20° C. to about 27° C. In embodiments, the assay signal range produced by the method does not vary by more than ±10% over an assay temperature range of about 17° C. to about 30° C., or about 18° C. to about 29° C., or about 19° C. to about 28° C., or about 20° C. to about 27° C.

[0064] In embodiments, methods described herein that include terminating extension are less sensitive to variations in extension time compared to methods that do not include termination. In embodiments, the extension includes RCA, and the termination includes cleaving the template oligonucleotide as described herein. In embodiments, the extension includes RCA, and the termination includes cleaving the template oligonucleotide as described herein, e.g., with a nuclease as described herein. In embodiments, the RCA is performed at about 15°C to about 35°C, or about 18°C ​​to about 30°C, or about 20°C to about 27°C. In embodiments, the assay signal range produced by the method does not vary substantially when the method is performed with an extension time range of about 5 minutes to about 150 minutes, or about 10 minutes to about 120 minutes, or about 15 minutes to about 90 minutes, or about 20 minutes to about 60 minutes, or about 30 minutes to about 45 minutes, or about 5 minutes, about 10 minutes, about 15 minutes, about 20 minutes, about 25 minutes, about 30 minutes, about 35 minutes, about 40 minutes, about 45 minutes, about 50 minutes, about 55 minutes, about 60 minutes, about 75 minutes, about 90 minutes, about 105 minutes, or about 120 minutes.

[0065] In embodiments, the assay signal range produced by the methods described herein does not vary by more than 5-fold, more than 4-fold, more than 3-fold, or more than 2-fold over an extension time range of about 5 to about 120 minutes. In embodiments, the assay signal range produced by the methods does not vary by more than 5-fold, more than 4-fold, more than 3-fold, or more than 2-fold over an extension time range of about 30 to about 120 minutes. In embodiments, the assay signal range produced by the methods does not vary by more than 5-fold, more than 4-fold, more than 3-fold, or more than 2-fold over an extension time range of about 20 to about 90 minutes. In embodiments, the assay signal range produced by the methods does not vary by more than 5-fold, more than 4-fold, more than 3-fold, or more than 2-fold over an extension time range of about 10 to about 45 minutes. In embodiments, the assay signal range produced by the method does not vary by more than 5-fold, more than 4-fold, more than 3-fold, or more than 2-fold over an extension time range of about 5 to about 30 minutes. In embodiments, the assay signal range produced by the method does not vary by more than 5-fold, more than 4-fold, more than 3-fold, or more than 2-fold over an extension time range of 5 to about 15 minutes.

[0066] In embodiments, the assay signal range produced by the methods described herein does not vary by more than 5-fold, more than 4-fold, more than 3-fold, or more than 2-fold over an extension time range of about 5 to about 90 minutes. In embodiments, the assay signal range produced by the methods does not vary by more than 5-fold, more than 4-fold, more than 3-fold, or more than 2-fold over an extension time range of about 45 to about 90 minutes. In embodiments, the assay signal range produced by the methods does not vary by more than 5-fold, more than 4-fold, more than 3-fold, or more than 2-fold over an extension time range of about 30 to about 60 minutes. In embodiments, the assay signal range produced by the methods does not vary by more than 5-fold, more than 4-fold, more than 3-fold, or more than 2-fold over an extension time range of about 15 to about 30 minutes. In embodiments, the assay signal range produced by the method does not vary by more than 5-fold, more than 4-fold, more than 3-fold, or more than 2-fold over an extension time range of about 10 to about 20 minutes. In embodiments, the assay signal range produced by the method does not vary by more than 5-fold, more than 4-fold, more than 3-fold, or more than 2-fold over an extension time range of 5 to about 10 minutes.

[0067] In embodiments, methods comprising terminating extension as described herein have a more stable assay endpoint compared to methods not including termination. In embodiments, methods comprising terminating extension provide extended oligonucleotides of consistent length. In embodiments, the extension comprises RCA, and the termination comprises cleaving the template oligonucleotide as described herein. In embodiments, the extension comprises RCA, and the termination comprises cleaving the template oligonucleotide as described herein, e.g., with a nuclease as described herein. In embodiments, the RCA is performed at about 15°C to about 35°C, or about 18°C ​​to about 30°C, or about 20°C to about 27°C. In embodiments, methods comprising termination produce shorter extended oligonucleotides compared to methods not including termination.

[0068] Extension oligonucleotide In an embodiment, the extended oligonucleotide formed by the method described herein is about 100 to about 100,000 bases in length. In an embodiment, the extended oligonucleotide formed by the method is about 200 to about 75,000 bases in length. In an embodiment, the extended oligonucleotide formed by the method is about 500 to about 50,000 bases in length. In an embodiment, the extended oligonucleotide formed by the method is about 700 to about 20,000 bases in length. In an embodiment, the extended oligonucleotide formed by the method is about 1,000 to about 15,000 bases in length. In an embodiment, the extended oligonucleotide formed by the method is about 2,000 to about 10,000 bases in length. In an embodiment, the extended oligonucleotide formed by the method is about 3,000 to about 8,000 bases in length. In an embodiment, the extended oligonucleotide formed by the method is about 4,000 to about 7,000 bases in length. In an embodiment, the extended oligonucleotides formed by this method are about 5000 to about 6000 bases in length.

[0069] In embodiments, the extended oligonucleotides formed by the methods described herein are about 100 to about 80,000 bases in length, or about 200 to about 60,000 bases in length, or about 500 to about 50,000 bases in length. In embodiments, the extended oligonucleotides formed by the methods are about 4,000 to about 100,000 bases in length, or about 7,500 to about 75,000 bases in length, or about 9,000 to about 40,000 bases in length. In embodiments, the extended oligonucleotides formed by the methods are about 1,000 to about 50,000 bases in length, or about 2,000 to about 25,000 bases in length, or about 3,000 to about 13,000 bases in length. In embodiments, the extended oligonucleotides formed by the methods are about 100 to about 8,000 bases in length, or about 500 to about 6,000 bases in length, or about 1,000 to about 4,500 bases in length.

[0070] In embodiments, the length of an extended oligonucleotide formed by the methods described herein is from about 1% to about 60%, or from about 2% to about 50%, or from about 3% to about 45%, or from about 4% to about 40%, or from about 5% to about 35%, or from about 6% to about 32%, or from about 8% to about 30%, or from about 10% to about 28%, or from about 12% to about 25%, or from about 15% to about 22%, or from about 18% to about 20% of the length of an extended oligonucleotide formed by a method that does not include a termination but is otherwise substantially identical to the methods described herein (i.e., a "substantially identical method that does not include a termination").

[0071] In embodiments, the length of an extended oligonucleotide formed by a method described herein is about 1% to about 50%, about 3% to about 40%, or about 5% to about 35% of the length of an extended oligonucleotide formed by a substantially identical method without a termination. In embodiments, the length of an extended oligonucleotide formed by a method described herein is about 2% to about 40%, about 4% to about 37%, or about 6% to about 32% of the length of an extended oligonucleotide formed by a substantially identical method without a termination. In embodiments, the length of an extended oligonucleotide formed by a method described herein is about 1% to about 20%, about 1% to about 15%, or about 1% to about 10% of the length of an extended oligonucleotide formed by a substantially identical method without a termination.

[0072] In embodiments, the extended oligonucleotide is formed by polymerase extension of a nucleic acid primer described herein and comprises a single-stranded oligonucleotide. In embodiments, the extended oligonucleotide is capable of binding to one or more labeled probes, each of which comprises (1) a detection oligonucleotide capable of binding to the extended oligonucleotide and (2) a detectable label. In embodiments, the template oligonucleotide comprises a region comprising the same sequence as the detection oligonucleotide, thereby generating an extended oligonucleotide comprising a sequence complementary to the detection oligonucleotide, also referred to herein as a "detection oligonucleotide complement."

[0073] Detection oligonucleotides In embodiments, the extension oligonucleotide binds to the detection oligonucleotide, for example, through hybridization of a complementary oligonucleotide. In embodiments, the detection oligonucleotide comprises a single-stranded oligonucleotide. In embodiments, the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof.

[0074] It has been unexpectedly discovered that the detection oligonucleotides provided herein are short oligonucleotides, about 3 to about 30 nucleotides in length, about 5 to about 25 nucleotides in length, or about 0.6 to about 12 nucleotides in length, comprising RNA and / or modified nucleic acids described herein, and have reduced inhibition of polymerases, such as the SD polymerases described herein. Reduced inhibition of the polymerase allows the detection oligonucleotides to be added to the assay reaction simultaneously or substantially simultaneously with the polymerase, thereby reducing assay complexity. Additional advantages of shorter detection oligonucleotides include, for example, the ability to attach multiple (e.g., at least two or at least three) detection oligonucleotides to the extender oligonucleotides described herein, increasing the assay signal; and shorter oligonucleotides require lower cost and reduced effort to produce and validate compared to conventional detection oligonucleotides. The detection oligonucleotides provided herein produce higher assay signals even when provided at lower concentrations than conventional detection oligonucleotides, which are described in WO2014 / 165061; WO2014 / 160192; and WO2015 / 175856. In embodiments, the incorporation of RNA and / or modified nucleic acids into the short detection oligonucleotides described herein significantly reduces assay background signals. In embodiments, detection oligonucleotides containing RNA and / or modified nucleic acids have higher binding affinity to extended oligonucleotides and therefore reduced nonspecific binding and less background signal compared to detection oligonucleotides of the same length that do not contain any RNA or modified nucleic acids. It has also been unexpectedly discovered that RNA oligonucleotides can be used as detection oligonucleotides, which was previously thought to be unfeasible due to the instability of RNA and its susceptibility to RNases.Thus, it was surprising that RNA-based detection oligonucleotides provided equivalent performance in the methods of the present invention as DNA-based detection oligonucleotides, without requiring additional measures to maintain an RNase-free environment. Modified nucleic acids are further described herein.

[0075] In embodiments, the detection oligonucleotide comprises RNA. In embodiments, the detection oligonucleotide consists of RNA. In embodiments, the detection oligonucleotide comprises a modified nucleic acid. In embodiments, the detection oligonucleotide consists of a modified nucleic acid. In embodiments, the detection oligonucleotide comprises a combination of RNA and modified nucleic acid. In embodiments, the modified nucleic acid is a modified RNA nucleic acid. In embodiments, the modified nucleic acid is a modified DNA nucleic acid.

[0076] In embodiments, the modified nucleic acid comprises a peptide nucleic acid (PNA), a locked nucleic acid (LNA), a bridged nucleic acid (BNA), a nucleoside with a 2' modification, or a combination thereof. In embodiments, the modified nucleic acid comprises a PNA, an LNA, a BNA, a nucleoside with a 2' modification, or a combination thereof. In embodiments, the detection oligonucleotide comprises a single modified nucleic acid, e.g., a PNA monomer, an LNA monomer, a BNA monomer, or a single nucleoside with a 2' modification. In embodiments, the detection oligonucleotide comprises more than one modified nucleic acid, e.g., more than one PNA, LNA, BNA monomer and / or nucleoside with a 2' modification.

[0077] In embodiments, the detection oligonucleotide comprises one or more PNAs. In embodiments, the detection oligonucleotide comprises one or more LNAs. In embodiments, the detection oligonucleotide comprises one or more BNAs. PNAs, LNAs, and BNAs are further described herein.

[0078] In embodiments, the detection oligonucleotide includes one or more nucleosides that include a 2' modification, also referred to herein as a 2'-modified nucleoside. In embodiments, the 2'-modified nucleoside includes a 2'-O-methyl modification (2'-OMe), a 2'-O-methoxyethyl modification (2'-MOE), a 2'-deoxy-2'-fluoro modification (2'-F), a 2'-hydroxyl modification (2'-OH), or a combination thereof. See, e.g., Duffy et al., BMC Biology 18:112 (2020).

[0079] In embodiments, the detection oligonucleotide comprises a modified nucleic acid, for example, comprising a backbone modification in the phosphate backbone of one or more nucleotides. Exemplary backbone modifications include, but are not limited to, substitution of phosphate with phosphorothioate, boranophosphate, methylphosphonate, phosphoramidate (e.g., morpholinophosphoramidate and mesylphosphoramidate), phosphoramidate, or 3'-O-phosphopropylamino. See, e.g., Wickstrom et al., Adv Drug Deliver Rev 87:25-34 (2015).

[0080] In embodiments, the detection oligonucleotide is comprised of a modified nucleic acid, i.e., each nucleotide of the detection oligonucleotide comprises a modified nucleic acid described herein. In embodiments, each modified nucleic acid of the detection oligonucleotide comprises a PNA, an LNA, a BNA, a nucleoside containing a 2'-modification, or a combination thereof. In embodiments, the detection oligonucleotide comprised of a modified nucleic acid has reduced non-specific binding and a lower background signal compared to a detection oligonucleotide comprising only unmodified nucleic acids or a combination of modified and unmodified nucleic acids.

[0081] In embodiments, the detection oligonucleotides are about 3 to about 30 nucleotides in length, or about 4 to about 25 nucleotides in length, or about 4 to about 20 nucleotides in length, or about 5 to about 18 nucleotides in length, or about 6 to about 15 nucleotides in length, or about 8 to about 12 nucleotides in length. In embodiments, the detection oligonucleotides are about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, or about 20 nucleotides in length. As described herein, the detection oligonucleotides provided herein are sufficiently short to allow multiple detection oligonucleotides, e.g., at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 18, to bind to the extender oligonucleotides described herein. Furthermore, the detection oligonucleotides provided herein are sufficiently short so that the polymerase activity of, for example, the SD polymerases described herein, is not substantially inhibited in the presence of the detection oligonucleotides. As used herein, the term "substantially," when referring to enzyme activity under different conditions (e.g., the presence or absence of a detection oligonucleotide), means that the enzyme activity does not vary (increase or decrease) by more than 20%, more than 15%, more than 10%, more than 5%, or more than 1% under the different conditions.

[0082] In embodiments, the methods described herein include simultaneously or substantially simultaneously contacting a nucleic acid primer with (i) a polymerase and (ii) a labeled probe comprising a detection oligonucleotide described herein, wherein the polymerase extends the nucleic acid primer to form an extended oligonucleotide that binds to the detection oligonucleotide of the labeled probe, and the polymerase activity of the polymerase is not substantially inhibited by the detection oligonucleotide. In some embodiments, the activity of the polymerase remains substantially the same, e.g., does not vary by more than 20%, more than 15%, more than 10%, more than 5%, or more than 1%, in the presence of the detection oligonucleotide compared to the activity of the polymerase under the same conditions but without the detection oligonucleotide. In embodiments, the polymerase is an SD polymerase described herein. In embodiments, the SD polymerase comprises an amino acid sequence that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to a DNA polymerase from a bacteriophage, in embodiments, the bacteriophage is Phi29, Nf, Karezi, or BeachBum.

[0083] In embodiments, the detection oligonucleotide comprises or consists of a sequence shown in Table 4. As used in nucleic acid sequences herein, a lower case "m" before a nucleobase indicates a 2'-O-methyl modification at that nucleobase. As used in nucleic acid sequences herein, a "+" before a nucleobase indicates an LNA. [Table 4]

[0084] In an embodiment, the present invention provides an oligonucleotide comprising any one of the sequences set forth in SEQ ID NOs: 7 to 10 and 12 to 15. In an embodiment, the present invention provides an oligonucleotide consisting of any one of the sequences set forth in SEQ ID NOs: 7 to 10 and 12 to 15.

[0085] Detectable Label In embodiments, the labeled probe comprises a detection oligonucleotide and a detectable label as described herein. In embodiments, the labeled probe comprises more than one detectable label. In embodiments, the labeled probe comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 detectable labels. In embodiments, one or more detectable labels are linked to the detection oligonucleotide, for example, to the 5' or 3' end of the detection oligonucleotide. Methods for linking detectable labels to oligonucleotides, for example, the detection oligonucleotides described herein, are known to those skilled in the art and are described, for example, in WO2020 / 180645.

[0086] In embodiments, the detectable label is detectable by light scattering, optical absorbance, fluorescence, chemiluminescence, electrochemiluminescence (ECL), bioluminescence, phosphorescence, radioactivity, magnetic field, or a combination thereof. In embodiments, the method is a multiplex method capable of detecting at least two unique analytes, wherein the detectable label for each unique analyte comprises a different detectable signal. Multiplex methods are further described herein. In embodiments, the detectable label comprises a fluorescent label, and a different fluorescent signature (e.g., fluorescent wavelength and / or intensity) is associated with each unique analyte, thereby allowing the unique analytes to be distinguished from one another.

[0087] In embodiments, the detectable label is an ECL label. In embodiments, the labeled probe comprises about 1-10, or about 2-5, or about 3-4 ECL labels. In embodiments, the labeled probe comprises three ECL labels. In embodiments, the ECL label comprises an electrochemiluminescent organometallic complex of ruthenium, osmium, iridium, rhenium, and / or a lanthanide metal. In embodiments, the ECL label comprises an organometallic complex comprising at least one substituted bipyridine ligand, wherein the substituted bipyridine ligand comprises at least one sulfonic acid group. In embodiments, the ECL label comprises an organometallic complex comprising at least two substituted bipyridine ligands, wherein each substituted bipyridine ligand comprises at least one sulfonic acid group. Exemplary ECL labels can be found in US 5,714,089; US 6,136,268; US 6,316,607; US 6,468,741; US ​​6,479,233; US 6,808,939; and US 9,499,573.

[0088] In embodiments, the method includes detecting the detectable label. In embodiments, the detecting includes measuring light scattering, optical absorbance, fluorescence, chemiluminescence, electrochemiluminescence (ECL), bioluminescence, phosphorescence, radioactivity, a magnetic field, or a combination thereof. In embodiments, the measured amount of the detectable label is used to determine the amount of analyte present in the sample.

[0089] In embodiments, the method includes detecting the amount of detectable label present in the second complex on the surface. In embodiments, the second complex includes the analyte, a detection reagent bound to the analyte, an extension oligonucleotide formed from a nucleic acid primer on the detection reagent, and a labeled probe bound to the extension oligonucleotide. In embodiments, the surface includes particles. In embodiments, the surface includes a well of a multiwell plate. Surfaces are further described herein. In embodiments, the surface includes particles, the detectable label includes a fluorescent label, and the method includes detecting the fluorescent label by a particle analysis method. Methods of analyzing particles include, for example, fluorescent labels and are known to those of skill in the art. In embodiments, the particle analysis method includes detecting the detectable label by flow cytometry. In embodiments, the particle analysis method includes immobilizing particles on a particle collection surface and detecting the detectable label on the immobilized particles. In embodiments, the particles are immobilized in a monolayer on the particle collection surface. In embodiments, the particle collection surface includes an electrode. In embodiments, the particle collection surface includes a slide (e.g., a microscope slide), a chip, or a flow cell. In embodiments, the immobilized particles are detected by imaging the particle collection surface and determining the number of particles comprising a detectable label, e.g., a fluorescent label. In embodiments, the detectable label comprises an ECL label, and the surface comprises an electrode. In embodiments, the electrode comprises a carbon ink electrode. In embodiments, the detecting comprises applying a voltage waveform (e.g., potential) to the electrode to generate an ECL signal. In embodiments, the surface comprises particles, and the method comprises collecting the particles on the electrode and applying a voltage waveform (e.g., potential) to the electrode to generate an ECL signal.

[0090] anchor reagent In embodiments, the second complex is formed by hybridization of the template oligonucleotide to the nucleic acid primer and is bound to the surface. In embodiments, the surface includes an anchoring reagent. In embodiments, the anchoring reagent binds to the extended oligonucleotide formed by extending the nucleic acid primer. In embodiments, the second complex is bound to the surface via binding of the extended oligonucleotide to the anchoring reagent on the surface. In embodiments, binding of the extended oligonucleotide to the anchoring reagent stabilizes the second complex on the surface. In embodiments, binding of the extended oligonucleotide to the anchoring reagent facilitates binding of a labeled probe to the extended oligonucleotide, improving the assay signal. Anchor reagents are further described, for example, in WO2014 / 165061; WO2014 / 160192; WO2015 / 175856; and WO2020 / 180645.

[0091] In embodiments, the template oligonucleotide comprises a region comprising the same sequence as the anchor oligonucleotide, thereby generating an extended oligonucleotide comprising a sequence complementary to the anchor oligonucleotide, also referred to herein as the "anchor oligonucleotide complement." In embodiments, the template oligonucleotide comprises a first region comprising the same sequence as the detection oligonucleotide and a second region comprising the same sequence as the anchor oligonucleotide, thereby generating an extended oligonucleotide comprising a first sequence complementary to the detection oligonucleotide and a second sequence complementary to the anchor oligonucleotide. In embodiments, the extended oligonucleotide binds to an anchor reagent prior to or simultaneously with binding to a labeled probe described herein. In embodiments, the extended oligonucleotide binds to an anchor reagent prior to contact with the labeled probe. In embodiments, the extended oligonucleotide is contacted with the anchor reagent and the labeled probe simultaneously or substantially simultaneously.

[0092] In embodiments, the anchor reagent comprises an oligonucleotide, an aptamer, an aptamer ligand, an antibody, an antigen, a ligand, a receptor, a hapten, an epitope, or a mimotope. In embodiments, the anchor reagent comprises an aptamer ligand, and the extension oligonucleotide comprises an aptamer. In embodiments, the anchor reagent comprises an oligonucleotide-binding protein, and the extension oligonucleotide comprises a sequence capable of binding to the protein. In embodiments, the anchor reagent comprises an anchor oligonucleotide. In embodiments, the anchor oligonucleotide comprises a single-stranded oligonucleotide. In embodiments, the anchor oligonucleotide comprises a double-stranded oligonucleotide.

[0093] In embodiments, binding the extend oligonucleotide to the anchor reagent comprises forming a triple helix between the anchor oligonucleotide and the extend oligonucleotide. In embodiments, binding the extend oligonucleotide to the anchor reagent comprises denaturing the extend oligonucleotide to expose a single-stranded oligonucleotide region prior to binding. In embodiments, binding the extend oligonucleotide to the anchor reagent comprises exposing the extend oligonucleotide to helicase activity prior to binding. In embodiments, binding the extend oligonucleotide to the anchor reagent comprises exposing the extend oligonucleotide to nuclease treatment prior to binding. In embodiments, the extend oligonucleotide comprises one or more hapten-modified bases, and the anchor reagent comprises one or more antibodies specific for the hapten. In embodiments, the hapten of the hapten-modified base comprises digoxigenin, and the anchor reagent comprises an anti-digoxigenin antibody. In embodiments, the extend oligonucleotide comprises one or more ligand-modified bases, and the anchor reagent comprises one or more receptors specific for the ligand. In embodiments, the anchor reagent comprises an anchor oligonucleotide, the anchor oligonucleotide and the extender oligonucleotide comprise complementary oligonucleotides, and binding the extender oligonucleotide to the anchor reagent comprises hybridization of the complementary oligonucleotides.

[0094] In embodiments, the anchor reagents provided herein comprise short oligonucleotides of about 3 to about 30 nucleotides in length. Short anchor oligonucleotides have unexpectedly been found to have improved stability during assay wash steps. However, shorter anchor oligonucleotides can increase sample matrix interference effects. The inventors have further discovered that the combination of a short anchor oligonucleotide length and modified nucleic acids provides improved assay stability without increasing sample matrix interference. In embodiments, anchor oligonucleotides containing modified nucleic acids have reduced sample matrix interference and reduced background signal compared to anchor oligonucleotides that do not contain any modified nucleic acids.

[0095] In embodiments, the anchor oligonucleotide comprises a modified nucleic acid. Modified nucleic acids are further described herein. In embodiments, the modified nucleic acid comprises a modified base, modified sugar, and / or modified backbone. In embodiments, the modified nucleic acid comprises a PNA, an LNA, a BNA, a nucleoside comprising a 2'-modification, or a combination thereof. In embodiments, the nucleoside comprising a 2'-modification comprises 2'-OMe, 2'-MOE, 2'-F, 2'-OH, or a combination thereof. In embodiments, the modified nucleic acid comprises a backbone modification, for example, substitution of the phosphate backbone with phosphorothioate, boranophosphate, methylphosphonate, phosphoramidate (e.g., morpholinophosphoramidate and mesylphosphoramidate), phosphoramidate, 3'-O-phosphopropylamino, or a combination thereof.

[0096] In embodiments, the anchor oligonucleotide comprises a single modified nucleic acid, e.g., a PNA monomer, an LNA monomer, a BNA monomer, or a single nucleoside comprising a 2' modification. In embodiments, the anchor oligonucleotide comprises more than one modified nucleic acid, e.g., more than one PNA, LNA, BNA monomer, and / or a nucleoside comprising a 2' modification.

[0097] In embodiments, the anchor oligonucleotide is comprised of a modified nucleic acid, i.e., each nucleotide of the anchor oligonucleotide comprises a modified nucleic acid described herein. In embodiments, each modified nucleic acid of the anchor oligonucleotide comprises a PNA, an LNA, a BNA, a nucleoside comprising a 2'-modification, or a combination thereof. In embodiments, anchor oligonucleotides comprised of modified nucleic acids have reduced non-specific binding and lower background signal compared to anchor oligonucleotides comprising only unmodified nucleic acids or a combination of modified and unmodified nucleic acids.

[0098] In embodiments, the anchor oligonucleotide is about 3 to about 30 nucleotides in length, or about 4 to about 25 nucleotides in length, or about 4 to about 20 nucleotides in length, or about 5 to about 18 nucleotides in length, or about 6 to about 15 nucleotides in length, or about 8 to about 12 nucleotides in length. In embodiments, the anchor oligonucleotide is about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, or about 20 nucleotides in length. In embodiments, the anchor oligonucleotides provided herein are sufficiently short such that extender oligonucleotides bind to the anchor oligonucleotide with at least 1.1-fold, at least 1.2-fold, at least 1.3-fold, at least 1.4-fold, at least 1.5-fold, at least 1.6-fold, at least 1.7-fold, at least 1.8-fold, at least 1.9-fold, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, or at least 10-fold greater affinity than anchor oligonucleotides longer than about 30 nucleotides in length. In embodiments, anchor oligonucleotides of about 4 to about 20 nucleotides in length and comprising modified nucleic acids as described herein provide equivalent assay performance when present on a surface at the same concentration as anchor oligonucleotides that are at least or about 25 nucleotides in length and do not contain any modified nucleic acids.

[0099] In embodiments, the anchor oligonucleotide comprises or consists of the following sequence: mU+AmGmUmA+C+AmGmC (SEQ ID NO: 11), where the lowercase "m" before a nucleobase indicates a 2'-O-methyl modification in that nucleobase, and the "+" before a nucleobase indicates an LNA as described herein. In embodiments, the present invention provides an oligonucleotide comprising the sequence of any one of SEQ ID NOs: 11, 17, and 20-37. In embodiments, the present invention provides an oligonucleotide consisting of the sequence of any one of SEQ ID NOs: 11, 17, and 20-37.

[0100] In embodiments, the anchor reagent is immobilized on the surface prior to step (a) of the methods described herein. In embodiments, the anchor reagent is immobilized on the surface prior to extension of the nucleic acid primer to form the extended oligonucleotide described herein. In embodiments, the anchor reagent is immobilized on the surface prior to binding of the extended oligonucleotide to the labeled probe described herein. In embodiments, the anchor reagent is immobilized on the surface prior to detecting the detectable label of the labeled probe bound to the extended oligonucleotide. Methods and timing of immobilizing the anchor reagent on the surface are further described, for example, in US 2022 / 0341923.

[0101] In embodiments, the anchor reagent is directly immobilized on the surface, e.g., covalently immobilized to the surface via a covalent linkage described herein. In embodiments, the covalent linkage is formed from a reaction between a thiol group on the anchor reagent and the surface. In embodiments, the anchor reagent comprises an anchor oligonucleotide, which is directly immobilized on the surface. In embodiments, the anchor reagent is indirectly immobilized on the surface, e.g., via a secondary binding partner, as described herein. In embodiments, the anchor reagent comprises an anchor oligonucleotide, which is indirectly immobilized on the surface. In embodiments, the anchor reagent is linked to a first binding partner, the surface comprises a second binding partner, and the anchor reagent is immobilized on the surface via interaction of the first and second binding partners. In embodiments, the first and second binding partners comprise complementary oligonucleotides, receptor-ligand pairs, antigen-antibody pairs, hapten-antibody pairs, epitope-antibody pairs, mimotope-antibody pairs, aptamer-target molecule pairs, hybridization partners, or intercalator-target molecule pairs. In embodiments, the first and second binding partners comprise cross-reactive moieties, such as a thiol and maleimide or iodoacetamide; an aldehyde and hydrazide; or an azide and alkyne or cycloalkyne. In embodiments, the first binding partner comprises biotin, and the second binding partner comprises avidin, streptavidin, an anti-biotin antibody, or a combination thereof. In embodiments, the first and second binding partners are bound to each other via a cross-linking agent, which binds to both the first and second binding partners. In embodiments, the cross-linking agent comprises at least two binding sites, and each of the first and second binding partners binds to a different binding site. In embodiments, the cross-linking agent comprises streptavidin or avidin, and the first and second binding partners are each biotin.

[0102] In embodiments, the anchor reagent comprises an anchor oligonucleotide and a first binding partner, wherein the first binding partner is linked to a nucleotide of the anchor oligonucleotide. In embodiments, the first binding partner is linked to an internal nucleotide of the anchor oligonucleotide. In embodiments, the first binding partner is located at the 5'-end of the anchor reagent. In embodiments, the first binding partner is located at the 3'-end of the anchor reagent. In embodiments, the first binding partner is linked to the 5'- or 3'-terminal nucleotide of the anchor oligonucleotide. In embodiments, the anchor reagent comprises a spacer located between the first binding partner and the anchor oligonucleotide. In embodiments, the spacer comprises polyethylene glycol (PEG) containing about 1 to about 50, or about 2 to about 40, or about 3 to about 30, or about 4 to about 20, or about 5 to about 10, or about 1 to about 15, or about 2 to about 10, or about 3 to about 8, or about 4 to about 7, or about 5 to about 6 ethylene glycol units. In embodiments, the spacer comprises a PEG comprising about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 ethylene glycol units. In embodiments, the first binding partner is positioned at the 3' end of the anchor reagent, and the anchor reagent comprises a PEG spacer comprising about 1 to about 15, or about 2 to about 10, or about 3 to about 8 ethylene glycol units. In embodiments, the anchor reagent comprises a 3' terminal nucleotide linked to a first end of the PEG spacer and a first binding partner linked to a second end of the PEG spacer, and the PEG spacer comprises about 1 to about 15, or about 2 to about 10, or about 3 to about 8 ethylene glycol units.

[0103] First and second complexes In embodiments, a first complex comprising an analyte and a detection reagent is bound to a surface. In embodiments, the first complex further comprises a capture reagent, which specifically binds to the analyte and is immobilized or capable of being immobilized to a surface. In embodiments, the capture reagent is directly immobilized on the surface, e.g., via a covalent linkage between the capture reagent and the surface. In embodiments, the covalent linkage is formed from a reaction between a thiol group on the capture reagent and the surface. In embodiments, the capture reagent is indirectly immobilized on the surface, e.g., via a secondary binding partner. In embodiments, the capture reagent is linked to a first binding partner that binds to a second binding partner immobilized on the surface. In embodiments, the first and second binding partners comprise complementary oligonucleotides, receptor-ligand pairs, antigen-antibody pairs, hapten-antibody pairs, epitope-antibody pairs, mimotope-antibody pairs, aptamer-target molecule pairs, hybridization partners, or intercalator-target molecule pairs. In embodiments, the first and second binding partners comprise cross-reactive moieties, such as a thiol and maleimide or iodoacetamide; an aldehyde and hydrazide; or an azide and alkyne or cycloalkyne. In embodiments, the first binding partner comprises biotin, and the second binding partner comprises avidin, streptavidin, an anti-biotin antibody, or a combination thereof. In embodiments, the first and second binding partners are bound to each other via a cross-linking agent, which binds to both the first and second binding partners. In embodiments, the cross-linking agent comprises at least two binding sites, and each of the first and second binding partners binds to a different binding site. In embodiments, the cross-linking agent comprises streptavidin or avidin, and the first and second binding partners are each biotin.

[0104] In embodiments, the capture reagent comprises a protein or polypeptide, an antibody or antigen-binding fragment thereof, an antigen, a ligand, a receptor, an oligonucleotide, a hapten, an epitope, a mimotope, or an aptamer. In embodiments, the capture reagent comprises an antibody or a variant thereof, including an antigen / epitope-binding portion thereof, an antibody fragment or derivative, an antibody analog, an engineered antibody, or a substance that binds to an antigen in a manner similar to an antibody. In embodiments, the capture reagent comprises the complementarity-determining region (CDR) of at least one heavy or light chain of an antibody. In embodiments, the capture reagent comprises at least two CDRs from one or more antibodies. In embodiments, the capture reagent comprises an antibody or antigen-binding fragment thereof. In embodiments, the capture reagent comprises an antigen-binding domain that specifically binds to an epitope of the analyte. In embodiments, the capture reagent comprises an oligonucleotide. In embodiments, the analyte comprises an oligonucleotide, and the capture reagent and the analyte comprise complementary oligonucleotides.

[0105] In embodiments, the capture reagent and the detection reagent each comprise an antibody or antigen-binding fragment thereof. In embodiments, the capture reagent and the detection reagent each comprise an oligonucleotide.

[0106] In embodiments, the methods of the present invention further comprise forming a first complex prior to contacting the first complex with a template oligonucleotide described herein. In embodiments, the methods of the present invention further comprise forming the first complex substantially simultaneously with contacting the components of the first complex with a template oligonucleotide described herein. In embodiments, the capture reagent is immobilized on the surface prior to formation of the first complex. In embodiments, the capture reagent is immobilized on the surface after formation of the first complex.

[0107] In embodiments, the first complex is formed by contacting the sample containing the analyte with a detection reagent. In embodiments, the first complex is formed by contacting the sample containing the analyte with a capture reagent and a detection reagent. In embodiments, the first complex is formed by contacting the sample containing the analyte first with a capture reagent and second with a detection reagent. In embodiments, the first complex is formed by contacting the sample containing the analyte first with a detection reagent and second with a capture reagent. In embodiments, the first complex is formed by contacting the sample containing the analyte with the capture reagent and the detection reagent simultaneously or substantially simultaneously.

[0108] In embodiments, the method comprises simultaneously or substantially simultaneously contacting the sample comprising the analyte with a detection reagent and a template oligonucleotide described herein. In embodiments, the method comprises simultaneously or substantially simultaneously contacting the sample comprising the analyte with a detection reagent, a template oligonucleotide, and a polymerase described herein. In embodiments, the method comprises simultaneously or substantially simultaneously contacting the sample comprising the analyte with a detection reagent, a template oligonucleotide, a polymerase, and a labeled probe described herein. In embodiments, the method comprises simultaneously or substantially simultaneously contacting the sample comprising the analyte with a detection reagent, a template oligonucleotide, a polymerase, a labeled probe, and a nuclease described herein.

[0109] In embodiments, the method comprises forming a first complex comprising the analyte and a detection reagent and contacting the first complex with a template oligonucleotide as described herein. In embodiments, the method comprises forming a first complex comprising the analyte and a detection reagent and contacting the first complex with a template oligonucleotide and a polymerase simultaneously or substantially simultaneously. In embodiments, the method comprises forming a first complex comprising the analyte and a detection reagent and contacting the first complex with a template oligonucleotide, a polymerase, and a labeled probe simultaneously or substantially simultaneously. In embodiments, the method comprises forming a first complex comprising the analyte and a detection reagent and contacting the first complex with a template oligonucleotide, a polymerase, a labeled probe, and a nuclease simultaneously or substantially simultaneously.

[0110] In embodiments, the method comprises simultaneously or substantially simultaneously contacting the sample comprising the analyte with a capture reagent, a detection reagent, and a template oligonucleotide described herein. In embodiments, the method comprises simultaneously or substantially simultaneously contacting the sample comprising the analyte with a capture reagent, a detection reagent, a template oligonucleotide, and a polymerase described herein. In embodiments, the method comprises simultaneously or substantially simultaneously contacting the sample comprising the analyte with a capture reagent, a detection reagent, a template oligonucleotide, a polymerase, and a labeled probe described herein. In embodiments, the method comprises simultaneously or substantially simultaneously contacting the sample comprising the analyte with a capture reagent, a detection reagent, a template oligonucleotide, a polymerase, a labeled probe, and a nuclease as described herein.

[0111] In embodiments, the method comprises forming a first complex comprising an analyte, a capture reagent, and a detection reagent, and contacting the first complex with a template oligonucleotide as described herein. In embodiments, the method comprises forming a first complex comprising an analyte, a capture reagent, and a detection reagent, and simultaneously or substantially simultaneously contacting the first complex with a template oligonucleotide and a polymerase. In embodiments, the method comprises forming a first complex comprising an analyte, a capture reagent, and a detection reagent, and simultaneously or substantially simultaneously contacting the first complex with a template oligonucleotide, a polymerase, and a labeled probe. In embodiments, the method comprises forming a first complex comprising an analyte, a capture reagent, and a detection reagent, and simultaneously or substantially simultaneously contacting the first complex with a template oligonucleotide, a polymerase, a labeled probe, and a nuclease.

[0112] surface In embodiments, the first and / or second complexes described herein are bound to a surface, e.g., via a capture reagent and / or an anchor reagent, as described herein. In embodiments, the surface comprises particles. In some embodiments, the particles comprise microspheres. In embodiments, the particles comprise paramagnetic beads. In embodiments, the particles comprise beads that can be analyzed via flow cytometry. In embodiments, the flow cytometry detects particles that comprise a detectable label, e.g., a fluorescent label, as described herein. In embodiments, the flow cytometry can distinguish between particles that comprise different fluorescent labels (e.g., different fluorescence wavelengths and / or intensities). In embodiments, the flow cytometry can distinguish between particles of different sizes. In embodiments, the particles comprise beads that can be immobilized on a particle collection surface for detection as described herein, e.g., by imaging. In embodiments, the particles (e.g., beads) can be immobilized in a monolayer on the particle collection surface. In embodiments, immobilization involves dropping a solution containing particles (e.g., beads) onto a particle collection surface and evaporating the solution to form a thin film containing the particles on the particle collection surface, or catalyzing gelatin in the solution to immobilize the particles on the particle collection surface, or a combination thereof. In embodiments, the particle collection surface comprises an electrode. In embodiments, the particle collection surface comprises a glass surface. In embodiments, the particle collection surface comprises a slide (e.g., a microscope slide), a chip, or a flow cell. In embodiments, the immobilized particles are detected by imaging the particle collection surface and determining the number of particles containing a detectable label. In embodiments, the surface comprises a cartridge. In embodiments, the surface comprises a well of a multiwell plate. Non-limiting examples of plates include MSD SECTOR™ and MSD QUICKPLEX® assay plates, e.g., MSD GOLD™ 96-well small spot streptavidin plates.

[0113] In embodiments, the surface comprises a plurality of different binding domains, and the capture reagent and anchor reagent are located on two different binding domains on the surface. In embodiments, the surface comprises a plurality of different binding domains, and the capture reagent and anchor reagent are located on the same binding domain on the surface. In embodiments, the surface comprises particles, and the capture reagent and anchor reagent are located on the same particle. In embodiments, the capture reagent is within about 1 nm to about 500 nm, about 5 nm to about 250 nm, about 10 nm to about 200 nm, or about 15 nm to about 150 nm of the anchor reagent on the surface. In embodiments, the capture reagent is less than 1 μm from the anchor reagent on the surface. In embodiments, the capture reagent is less than 500 nm from the anchor reagent on the surface. In embodiments, the capture reagent is less than 200 nm from the anchor reagent on the surface.

[0114] In embodiments, the surface comprises an electrode. In embodiments, the electrode comprises a carbon ink electrode. In embodiments, the detectable label comprises an ECL label. In embodiments, detecting the detectable label comprises applying a voltage waveform (e.g., potential) to the electrode to generate an ECL signal. In embodiments, the surface comprises particles, and detecting the detectable label comprises collecting the particles on the electrode and applying a voltage waveform (e.g., potential) to the electrode to generate an ECL signal.

[0115] Multiplexing Methods In embodiments, the method is a multiplex method capable of detecting multiple (e.g., at least two) analytes. In embodiments, the multiplex method simultaneously or substantially simultaneously detects about 2 to about 15, or about 3 to about 14, or about 4 to about 13, or about 4 to about 12, or about 5 to about 11, or about 6 to about 10, or about 7 to about 9 analytes. In embodiments, the multiplex method comprises repeating one or more method steps to detect at least two analytes, e.g., about 2 to about 15, or about 3 to about 14, or about 4 to about 13, or about 4 to about 12, or about 5 to about 11, or about 6 to about 10, or about 7 to about 9 analytes. In embodiments, each of the method steps is performed in parallel for each analyte. Methods of performing multiplex assays are further described, for example, in US 10,189,023 and US 10,201,812. In embodiments, each unique analyte is associated with a different detectable label comprising a different detectable signal. In embodiments, the detectable label comprises a fluorescent label, and a different fluorescent signature (e.g., fluorescent wavelength and / or intensity) is associated with each unique analyte, thereby allowing the analytes to be distinguished from one another, for example, via flow cytometry, and the amount of analyte associated with each fluorescent signature to be determined. Fluorescent dyes with different fluorescent signatures are known to those skilled in the art. In embodiments, each unique analyte is associated with a different surface, for example, a particle with a different size. In embodiments, analytes associated with different particle sizes can be separated, for example, by flow cytometry, and the number of particles of each size determined, thereby determining the amount of analyte associated with each particle size.

[0116] In embodiments, each analyte is present in a different first complex. In embodiments, each first complex comprises a different analyte and its corresponding detection reagent. In embodiments, each first complex comprises a different analyte and its corresponding capture reagent and detection reagent. In embodiments, the surface comprises a plurality of different binding domains, and each analyte forms a first complex in a different binding domain. In embodiments, the surface comprises a plurality of capture reagents, each capture reagent immobilized on a different binding domain and surface, and each capture reagent is capable of specifically binding to one of at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 analytes. In embodiments, the surface is contacted with at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 analytes, and each analyte forms a first complex in its corresponding binding domain.

[0117] In embodiments, the plurality of different binding domains are on a single surface. In embodiments, the surface comprises a multiwell plate, and each binding domain is in a different well. In embodiments, the surface comprises a multiwell plate, and each binding domain is in a different region of the well. In embodiments, the plurality of different binding domains are on one or more surfaces. In embodiments, the surface comprises particles, and each binding domain is on a different particle. In embodiments, the particles are arranged in a particle array. In embodiments, the particles are coded to allow identification of specific particles and to distinguish between each binding domain. In embodiments, the binding domains are separable from one another, for example, via flow cytometry. In embodiments, each unique analyte is associated with a different detectable label comprising a different detectable signal, as described herein. In embodiments, each different detectable label comprises a different fluorescent signature (e.g., wavelength and / or intensity), thereby allowing flow cytometry to identify unique analytes on the particles based on the different fluorescent signatures. In embodiments, each unique analyte is associated with a different particle size, thereby allowing flow cytometry to identify unique analytes on particles based on their different particle sizes. In embodiments, the surface is a multi-well plate containing removable wells, and each binding domain is in a different well. In embodiments, the surface contains one or more particles, and each particle is separable from the remaining particles. Methods for separating particles are known in the art and include, for example, flow cytometry, magnetic separation, affinity separation, and the like.

[0118] Analytes and Samples In embodiments, the sample is a biological sample. In embodiments, the sample is an environmental sample. In embodiments, the sample is obtained from a human subject. In embodiments, the sample is obtained from an animal subject. In embodiments, the sample comprises a mammalian bodily fluid, secretion, or excretion. In embodiments, the sample is a purified mammalian bodily fluid, secretion, or excretion. In embodiments, the mammalian bodily fluid, secretion, or excretion is whole blood, plasma, serum, saliva, peritoneal fluid, lymphatic fluid, synovial fluid, pleural effusion, urine, sweat, cerebrospinal fluid, peritoneal fluid, milk, stool, bronchial lavage fluid, saliva, amniotic fluid, nasal secretions, vaginal secretions, surface biopsies, sperm, semen / seminal plasma, wound secretions, and excretions, or extracts, purified products, or dilutions thereof. Further exemplary samples include, but are not limited to, physiological samples, samples comprising suspensions of cells, such as mucosal swabs, tissue aspirates, tissue homogenates, cell cultures, and cell culture supernatants. In embodiments, the sample is whole blood, serum, plasma, cerebrospinal fluid, urine, saliva, or an extract or purification thereof, or a dilution thereof. In embodiments, the sample is serum or plasma. In embodiments, the plasma is in EDTA, heparin, or citrate. The sample may be obtained from a single source as described herein, or may comprise a mixture from two or more sources.

[0119] Analytes that may be measured using the methods of the present invention include, but are not limited to, proteins, toxins, nucleic acids, microorganisms, viruses, cells, fungi, spores, carbohydrates, lipids, glycoproteins, lipoproteins, polysaccharides, drugs, hormones, steroids, nutrients, metabolites, and any modified derivatives of the above molecules, or any complexes containing one or more of the above molecules or combinations thereof. The level of an analyte of interest in a sample may be indicative of a disease or disease state, or it may simply indicate whether a subject has been exposed to the analyte.

[0120] In embodiments, the analyte comprises a biomarker. As used herein, the term "biomarker" refers to a biological substance that is indicative of a normal or abnormal process, e.g., disease, infection, or environmental exposure. Biomarkers can be small molecules, such as ligands, signaling molecules, or peptides, or macromolecules, such as antibodies, receptors, or proteins and protein complexes. Changes in the level of a biomarker can correlate with the risk or progression of a disease or disorder, or with the susceptibility or responsiveness of a disease or disorder to a given treatment. Biomarkers can be useful in diagnosing disease risk or the presence of a disease in an individual, or for adjusting treatment for a disease in an individual (e.g., selecting a drug treatment or administration regimen). When evaluating potential drug treatments, biomarkers can be used as surrogates for natural endpoints, such as survival or irreversible morbidity. When a treatment alters a biomarker that has a direct association with improved health, the biomarker serves as a "surrogate endpoint" for assessing clinical benefit. Biomarkers are further described in, for example, Mayeux, NeuroRx 1(2):182-188 (2004); Strimbu et al., Curr Opin HIV AIDS 5(6):463-466 (2010); and Bansal et al., Statist Med 32:1877-1892 (2013). The term "biomarker," when used in the context of a particular organism (e.g., a human, a non-human primate, or another animal), refers to a biomarker native to that particular organism. Unless otherwise specified, biomarkers referred to herein include human biomarkers. In embodiments, biomarkers include immune response biomarkers. In embodiments, biomarkers include antibodies or fragments thereof, e.g., antigen-binding fragments of antibodies.

[0121] In embodiments, the analyte comprises exosomes. In embodiments, the sample comprises purified exosomes. Exosomes, also known as extracellular vesicles or EVs, are small membrane vesicles released by most cell types. The release and subsequent uptake of exosomes is a method of intercellular communication and plays a role in regulating many physiological and pathological processes. Exosomes have been shown to contain a wide variety of signaling molecules, including, but not limited to, surface-associated and cytoplasmic proteins, lipids, mRNA, and miRNA, and it has been suggested that the identity and concentration of these species in each exosome can be used to infer its cellular origin and function. Thus, genomic or proteomic profiling of a patient's total exosome population can provide valuable prognostic information for various pathological conditions, including cancer, infectious diseases, kidney and liver diseases, and traumatic brain injury, among others. In embodiments, the analyte comprises an internal analyte of the exosome, e.g., cargo proteins, lipids, or nucleic acids. The detection of exosomes is further described, for example, in WO2015 / 175856; WO2019 / 222708; WO2020 / 086751; and WO2022 / 051481.

[0122] Assay Format In embodiments, the methods provided herein are in a competitive assay format. Generally, in competitive assays, such as competitive immunoassays or competitive inhibition assays, the analyte and competitor compete for binding to a capture reagent and / or detection reagent. In such assays, the analyte is typically measured indirectly by directly measuring the competitor. As used herein, "competitor" refers to a compound capable of binding to the same capture reagent and / or detection reagent as the analyte, such that the capture reagent and / or detection reagent can only bind to either the analyte or the competitor, but not both. In embodiments, a competitive assay is used to detect and measure analytes that are not capable of binding to more than one capture reagent and / or detection reagent, such as small molecule analytes or analytes that do not have more than one distinct binding site. In embodiments, a competitive assay is used to detect and measure antibody biomarkers. Examples of competitive immunoassays include those described in US 4,235,601; US ​​4,442,204; and US 5,028,535.

[0123] The methods herein can be performed in a single assay chamber, such as a single well of an assay plate. The methods herein can also be performed in an assay chamber of an assay cartridge. Assay modules, e.g., assay plates or assay cartridges, methods and apparatus for performing assay measurements suitable for the present invention are described, for example, in US 8,343,526; US 9,731,297; US 9,921,166; US 10,184,884; US 10,281,678; US 10,272,436; US 2004 / 0022677; US 2004 / 0189311; US ​​2005 / 0052646; US 2005 / 0142033; US 2018 / 0074082; and US 2019 / 0391170.

[0124] The methods herein can be performed manually, using automated techniques, or both. The automated techniques may be partially automated, e.g., using one or more modular instruments, or fully integrated, automated instruments. Exemplary automated systems and devices are described in WO2018 / 017156, WO2017 / 015636, and WO2016 / 164477.

[0125] Assay devices consistent with embodiments herein can be used, for example, to perform assays in multiwell plate formats having one or more of the following desirable attributes: (i) high sensitivity, (ii) large dynamic range, (iii) small size and weight, (iv) array-based multiplexing capabilities, (v) automated operation, and (vi) the ability to handle multiple plates. The devices and methods may be used with a variety of assay detection techniques, including, but not limited to, techniques that measure one or more detectable signals. Some aspects are suitable for electrochemiluminescence measurements, and particularly for embodiments suitable for use with multiwell plates with integrated electrodes (and assay methods using these plates), such as those described in U.S. Pat. No. 7,842,246; U.S. Pat. No. 7,807,448; and U.S. Pat. No. 10,281,678.

[0126] kit In embodiments, the present invention provides a kit for detecting an analyte, comprising in one or more vials, containers, or compartments: (a) a capture reagent that binds to the analyte; (b) a detection reagent that binds to the analyte, the detection reagent comprising or capable of being linked to a nucleic acid primer; (c) (1) a detection oligonucleotide and (2) a labeled probe comprising a detectable label; and (d) a template oligonucleotide capable of hybridizing to the nucleic acid primer and comprising the same sequence as the detection oligonucleotide; the detection reagent comprises a protein or polypeptide; and: (i) the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; (ii) the kit further comprises a nuclease capable of cleaving the template oligonucleotide; (iii) a combination of (i) and (ii); (iv) one or both of (i) and (ii), wherein the kit further comprises an anchoring reagent; (v) the kit further comprises an anchor reagent comprising an anchor oligonucleotide, the anchor oligonucleotide comprising a modified nucleic acid; or (vi) Any combination of (i), (ii), and (v).

[0127] In embodiments, the kit includes a labeled probe comprising a detection oligonucleotide comprising RNA, a modified nucleic acid, or a combination thereof; and a nuclease capable of cleaving the template oligonucleotide. In embodiments, the kit includes a labeled probe comprising a detection oligonucleotide comprising RNA, a modified nucleic acid, or a combination thereof; a nuclease capable of cleaving the template oligonucleotide; and an anchor reagent. In embodiments, the kit includes a labeled probe comprising a detection oligonucleotide comprising RNA, a modified nucleic acid, or a combination thereof; a nuclease capable of cleaving the template oligonucleotide; an anchor reagent; and a surface. In embodiments, the kit includes a labeled probe comprising a detection oligonucleotide comprising RNA, a modified nucleic acid, or a combination thereof; a nuclease capable of cleaving the template oligonucleotide; and a surface comprising an anchor reagent. In embodiments, the anchor reagent includes an anchor oligonucleotide, and the anchor oligonucleotide includes a modified nucleic acid. In embodiments, the detection oligonucleotide includes a sequence set forth in any one of SEQ ID NOs: 7-10. In embodiments, the nuclease includes one or more restriction enzymes listed in Table 1. In embodiments, the nuclease comprises DdeI, AluI, HpaII, ApoI, DpnI, DpnII, ScrFI, MboI, MluCI, AseI, TaqI, or a combination thereof. In embodiments, the template oligonucleotide comprises the sequence of any one of SEQ ID NOs: 5, 6, or 16. In embodiments, the anchor reagent comprises an anchor oligonucleotide comprising the sequence of any one of SEQ ID NOs: 11, 17, or 20-37.

[0128] In embodiments, the kit comprises a labeled probe comprising a detection oligonucleotide comprising RNA, a modified nucleic acid, or a combination thereof; and an anchor reagent. In embodiments, the kit comprises a labeled probe comprising a detection oligonucleotide comprising RNA, a modified nucleic acid, or a combination thereof; an anchor reagent; and a surface. In embodiments, the kit comprises a labeled probe comprising a detection oligonucleotide comprising RNA, a modified nucleic acid, or a combination thereof; and a surface comprising an anchor reagent. In embodiments, the anchor reagent comprises an anchor oligonucleotide, and the anchor oligonucleotide comprises a modified nucleic acid. In embodiments, the detection oligonucleotide comprises the sequence of any one of SEQ ID NOs: 7 to 10. In embodiments, the anchor reagent comprises an anchor oligonucleotide comprising the sequence of any one of SEQ ID NOs: 11, 17, or 20 to 37.

[0129] In embodiments, the kit comprises a nuclease capable of cleaving the template oligonucleotide; and an anchor reagent. In embodiments, the kit comprises a nuclease capable of cleaving the template oligonucleotide; an anchor reagent; and a surface. In embodiments, the kit comprises a surface comprising a nuclease capable of cleaving the template oligonucleotide; and an anchor reagent. In embodiments, the anchor reagent comprises an anchor oligonucleotide, and the anchor oligonucleotide comprises a modified nucleic acid. In embodiments, the nuclease comprises one or more restriction enzymes listed in Table 1. In embodiments, the nuclease comprises DdeI, AluI, HpaII, ApoI, DpnI, DpnII, ScrFI, MboI, MluCI, AseI, TaqI, or a combination thereof. In embodiments, the template oligonucleotide comprises the sequence of any one of SEQ ID NOs: 5, 6, or 16. In embodiments, the anchor reagent comprises an anchor oligonucleotide comprising the sequence of any one of SEQ ID NOs: 11, 17, or 20-37.

[0130] In embodiments, the kit includes a labeled probe comprising a detection oligonucleotide comprising RNA, a modified nucleic acid, or a combination thereof; a nuclease capable of cleaving a template oligonucleotide; and an anchor reagent. In embodiments, the kit includes a labeled probe comprising a detection oligonucleotide comprising RNA, a modified nucleic acid, or a combination thereof; a nuclease capable of cleaving a template oligonucleotide; an anchor reagent; and a surface. In embodiments, the kit includes a labeled probe comprising a detection oligonucleotide comprising RNA, a modified nucleic acid, or a combination thereof; a nuclease capable of cleaving a template oligonucleotide; and a surface comprising an anchor reagent. In embodiments, the anchor reagent includes an anchor oligonucleotide, and the anchor oligonucleotide includes a modified nucleic acid. In embodiments, the anchor reagent includes an anchor oligonucleotide, and the anchor oligonucleotide includes a modified nucleic acid. In embodiments, the detection oligonucleotide includes any one of SEQ ID NOs: 7-10. In embodiments, the nuclease is one or more restriction enzymes listed in Table 1. In embodiments, the nuclease comprises DdeI, AluI, HpaII, ApoI, DpnI, DpnII, ScrFI, MboI, MluCI, AseI, TaqI, or a combination thereof. In embodiments, the template oligonucleotide comprises the sequence of any one of SEQ ID NOs: 5, 6, or 16. In embodiments, the anchor reagent comprises an anchor oligonucleotide comprising the sequence of any one of SEQ ID NOs: 11, 17, or 20-37.

[0131] Labeled probes In embodiments, the kit includes a labeled probe comprising a detection oligonucleotide and a detectable label. The detection oligonucleotide and the detectable label are further described herein. In embodiments, the detectable label is detectable by light scattering, light absorbance, fluorescence, chemiluminescence, ECL, bioluminescence, phosphorescence, radioactivity, magnetic field, or a combination thereof. In embodiments, the kit is for performing a multiplex method capable of detecting at least two analytes as described herein, and the detectable label for each analyte comprises a different detectable signal. In embodiments, the detectable label comprises a fluorescent label, and a different fluorescent signature (e.g., fluorescent wavelength and / or intensity) is associated with each unique analyte, thereby enabling the analytes to be distinguished from one another. In embodiments, the detectable label is an ECL label. In embodiments, the labeled probe comprises about 1 to 10, or about 2 to 5, or about 3 to 4 ECL labels. In embodiments, the labeled probe comprises three ECL labels. ECL labels are further described herein.

[0132] In embodiments, the detection oligonucleotide of the labeled probe comprises RNA, a modified nucleic acid, or a combination thereof, as described herein. In embodiments, the detection oligonucleotide comprises RNA. In embodiments, the detection oligonucleotide comprises a modified nucleic acid. In embodiments, the detection oligonucleotide comprises a combination of RNA and a modified nucleic acid. In embodiments, the modified nucleic acid is a modified RNA nucleic acid. In embodiments, the modified nucleic acid is a modified DNA nucleic acid.

[0133] In embodiments, the modified nucleic acid comprises a PNA, an LNA, a BNA, a nucleoside comprising a 2'-modification, or a combination thereof. In embodiments, the modified nucleic acid comprises a PNA, an LNA, a BNA, a nucleoside comprising a 2'-modification, or a combination thereof. In embodiments, the 2'-modified nucleoside comprises 2'-OMe, 2'-MOE, 2'-F, 2'-OH, or a combination thereof. In embodiments, the modified nucleic acid comprises a backbone modification, for example, in the phosphate backbone of one or more nucleotides. In embodiments, the backbone modification comprises phosphorothioate, boranophosphate, methylphosphonate, phosphoramidate (e.g., morpholino phosphoramidate and mesyl phosphoramidate), phosphoramidate, 3'-O-phosphopropylamino, or a combination thereof. Modified nucleic acids, for example, PNA, LNA, BNA, and nucleosides comprising a 2'-modification, are further described herein.

[0134] In embodiments, the detection oligonucleotide comprises a single modified nucleic acid, e.g., a PNA monomer, an LNA monomer, a BNA monomer, or a single nucleoside comprising a 2' modification. In embodiments, the detection oligonucleotide comprises more than one modified nucleic acid, e.g., more than one PNA, LNA, BNA monomer and / or nucleoside comprising a 2' modification.

[0135] In embodiments, the detection oligonucleotide is comprised of a modified nucleic acid, and each nucleotide of the detection oligonucleotide comprises a modified nucleic acid as described herein. In embodiments, each modified nucleic acid of the detection oligonucleotide comprises a PNA, an LNA, a BNA, a nucleoside comprising a 2'-modification, or a combination thereof.

[0136] In embodiments, the detection oligonucleotide is about 3 to about 30 nucleotides in length, or about 4 to about 25 nucleotides in length, or about 4 to about 20 nucleotides in length, or about 5 to about 18 nucleotides in length, or about 6 to about 15 nucleotides in length, or about 8 to about 12 nucleotides in length. In embodiments, the detection oligonucleotide is about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, or about 20 nucleotides in length. In embodiments, the detection oligonucleotide comprises or consists of a sequence set forth in Table 4 herein.

[0137] In embodiments, the detection oligonucleotide is linked to a detectable label via a conjugated linkage. Conjugation of detectable labels to oligonucleotides is known to those of skill in the art. In embodiments, the detection oligonucleotide comprises a 3' amino modifier, an internal amino modifier, an internal spacer, or a combination thereof. In embodiments, the detectable label is linked to the detection oligonucleotide via a 3' amino modifier, an internal amino modifier, and / or an internal spacer. In embodiments, the detection oligonucleotide comprises a sequence shown in Table 5. The lowercase "m" and "+" notations are as defined herein. As used herein, "iAmMC6T" refers to an amino-modified C6 dT linker; "iSp18" refers to an 18-atom hexaethylene glycol spacer; and 3AmMO refers to a 3' amino modifier. See, e.g., "Attachment Chemistry / Linkers Modifications" idtdna.com / site / Catalog / Modifications / Category / 2. [Table 5]

[0138] In an embodiment, the present invention provides an oligonucleotide comprising any one of the sequences set forth in SEQ ID NOs: 12 to 15. In an embodiment, the present invention provides an oligonucleotide consisting of any one of the sequences set forth in SEQ ID NOs: 12 to 15.

[0139] polymerase In embodiments, the kit includes a labeled probe comprising a detection oligonucleotide, as described herein; and a polymerase. Polymerases are further described herein. In embodiments, the polymerase is capable of extending a nucleic acid primer on a detection reagent. In embodiments, the polymerase is capable of performing PCR, NEAR, or an isothermal amplification method, such as SDA, HDA, or RCA. In embodiments, the polymerase is capable of performing MDA. In embodiments, the polymerase includes strand displacement activity (i.e., is an SD polymerase). In embodiments, the SD polymerase includes an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identical to a DNA polymerase from a bacteriophage, e.g., Phi29, Nf, Karezi, or BeachBum. In embodiments, the SD polymerase comprises an amino acid sequence that has at least 80% or at least 90% sequence identity to a DNA polymerase from a bacteriophage, and the bacteriophage is Phi29, Nf, Karezi, or BeachBum. In embodiments, the SD polymerase is a DNA polymerase, a bacteriophage, and the bacteriophage is Phi29, Nf, Karezi, or BeachBum. In embodiments, the activity of the polymerase is not substantially inhibited by the detection oligonucleotides described herein.

[0140] Template oligonucleotide In embodiments, the kit includes a template oligonucleotide, which is capable of hybridizing to a nucleic acid primer and contains the same sequence as a detection oligonucleotide, thereby enabling the generation of an extension oligonucleotide containing a sequence complementary to the detection oligonucleotide. Template oligonucleotides are further described herein. In embodiments, the template oligonucleotide is a template for nucleic acid amplification by a polymerase described herein. In embodiments, the template oligonucleotide is about 40 to about 100 nucleotides in length, or about 50 to about 78 nucleotides in length, or about 53 to about 76 nucleotides in length, or about 50 to about 70 nucleotides in length, or about 53 to about 61 nucleotides in length, or about 54 to about 61 nucleotides in length. In embodiments, the template oligonucleotide is about 53, about 54, about 55, about 56, about 57, about 58, about 59, about 60, about 61, about 62, about 63, about 64, about 65, about 66, about 67, about 68, about 69, about 70, about 71, about 72, about 73, about 74, about 75, or about 76 nucleotides in length.

[0141] In embodiments, the template oligonucleotide comprises one or more connector oligonucleotides, and the one or more connector oligonucleotides are capable of ligating to form a circular template. In embodiments, the 5' and 3' ends of the template oligonucleotide are capable of hybridizing to first and second regions of a nucleic acid primer on the detection reagent. In embodiments, the template oligonucleotide is a circular oligonucleotide. In embodiments, the template oligonucleotide is a linear oligonucleotide, and the 5' and 3' ends of the linear oligonucleotide are capable of ligating to form a circular oligonucleotide. In embodiments, the template oligonucleotide comprises 5'-GTTCTGTC-3' at its 5' end and 5'-GTGTCTA-3' at its 3' end. In embodiments, the template oligonucleotide comprises or consists of a sequence set forth in Table 3 herein. In embodiments, the template oligonucleotide is 5'-phosphorylated. In embodiments, 5'-phosphorylation of the template oligonucleotide allows for ligation of its 5' and 3' ends as described herein. In an embodiment, the template oligonucleotide comprises the sequence / 5Phos / GTTCTGTCATATTTCAGTGAATGCGAGTCCGTCTAAGAGAGTAGTACAGCAAGAGTGTCTA (SEQ ID NO: 16).

[0142] In an embodiment, the template oligonucleotide comprises the sequence of SEQ ID NO: 5 or 6. In an embodiment, the template oligonucleotide consists of the sequence of SEQ ID NO: 5 or 6.

[0143] nuclease In embodiments, the kit includes a nuclease capable of cleaving the template oligonucleotide. Nucleases are further described herein. In embodiments, the nuclease specifically cleaves the template oligonucleotide. In embodiments, the nuclease does not cleave the nucleic acid primer or the extension oligonucleotide. In embodiments, the nuclease specifically cleaves a double-stranded oligonucleotide, such as a double-stranded DNA, a double-stranded RNA, or a double-stranded DNA / RNA hybrid. In embodiments, the double-stranded DNA, double-stranded RNA, or double-stranded DNA / RNA hybrid comprises the template oligonucleotide and a nucleic acid primer hybridized thereto.

[0144] In embodiments, the nuclease cleaves the double-stranded portion of the template oligonucleotide hybridized to the nucleic acid primer. In embodiments, the template oligonucleotide and the nucleic acid primer each comprise single-stranded DNA. In embodiments, the nuclease is a restriction endonuclease. Exemplary restriction endonucleases are provided herein. In embodiments, the nuclease comprises one or more restriction enzymes set forth in Table 1. In embodiments, the nuclease is DdeI, AluI, HpaII, ApoI, DpnI, DpnII, ScrFI, MboI, MluCI, AseI, TaqI, TspRI, or a combination thereof.

[0145] In embodiments, the nuclease cleaves the double-stranded portion of the template oligonucleotide that forms a DNA / RNA hybrid with the nucleic acid primer. In embodiments, the template oligonucleotide comprises single-stranded DNA, and the nucleic acid primer comprises single-stranded RNA. In embodiments, the template oligonucleotide comprises single-stranded RNA, and the nucleic acid primer comprises single-stranded DNA. Exemplary nucleases capable of cleaving DNA / RNA hybrids are provided herein. In embodiments, the nuclease is RNase H2.

[0146] In embodiments, the template oligonucleotide comprises a DNA damage indicator, and the nuclease comprises an excision enzyme that specifically binds to the DNA damage indicator and cleaves the template oligonucleotide. In embodiments, the DNA damage indicator is not present in the nucleic acid primer or the extension oligonucleotide, and the nuclease does not bind to or cleave the nucleic acid primer or the extension oligonucleotide. DNA damage indicators and their corresponding excision enzymes are further described herein. In embodiments, the DNA damage indicator comprises a uracil base, and the nuclease comprises UNG. In embodiments, the kit further comprises an abasic site endonuclease, which further assists in the cleavage of the template oligonucleotide by UNG. In embodiments, the abasic site endonuclease comprises UDG, APE1, endonuclease IV, or a combination thereof. In embodiments, the DNA damage indicator comprises deoxyinosine, and the nuclease comprises endonuclease V. In embodiments, the DNA damage indicator comprises a damaged purine, and the nuclease comprises an enzyme that repairs damaged purines. In an embodiment, the damaged purine comprises 8oxoG and the template-cleaving enzyme comprises Fpg.

[0147] anchor reagent In embodiments, the kit includes an anchor reagent. In embodiments, the anchor reagent is lyophilized. In embodiments, the anchor reagent is provided in solution. The anchor reagent is further described herein. In embodiments, the template oligonucleotide of the kit includes a region containing the same sequence as the anchor oligonucleotide, thereby enabling the generation of an extension oligonucleotide containing a sequence complementary to the anchor oligonucleotide. In embodiments, the template oligonucleotide of the kit includes (i) a first region containing the same sequence as the detection oligonucleotide described herein, and (ii) a second region containing the same sequence as the anchor oligonucleotide, thereby enabling the generation of an extension oligonucleotide containing (I) a first sequence complementary to the detection oligonucleotide, and (II) a second sequence complementary to the anchor oligonucleotide.

[0148] In embodiments, the anchor reagent comprises an oligonucleotide, an aptamer, an aptamer ligand, an antibody, an antigen, a ligand, a receptor, a hapten, an epitope, or a mimotope. In embodiments, the anchor reagent comprises an anchor oligonucleotide. In embodiments, the anchor oligonucleotide comprises a single-stranded oligonucleotide. In embodiments, the anchor oligonucleotide comprises a double-stranded oligonucleotide.

[0149] In embodiments, the anchor oligonucleotide comprises a modified nucleic acid. Modified nucleic acids are further described herein. In embodiments, modified nucleic acids comprise modified bases, modified sugars, and / or modified backbones. In embodiments, modified nucleic acids comprise PNA, LNA, BNA, nucleosides comprising 2'-modifications, or combinations thereof. In embodiments, nucleosides comprising 2'-modifications comprise 2'-OMe, 2'-MOE, 2'-F, 2'-OH, or combinations thereof. In embodiments, modified nucleic acids comprise a backbone modification, for example, in the phosphate backbone of one or more nucleotides. In embodiments, the backbone modification comprises phosphorothioate, boranophosphate, methylphosphonate, phosphoramidate (e.g., morpholino phosphoramidate and mesyl phosphoramidate), phosphoramidate, 3'-O-phosphopropylamino, or combinations thereof. Modified nucleic acids, for example, PNA, LNA, BNA, and nucleosides comprising 2'-modifications, are further described herein.

[0150] In embodiments, the anchor reagent is comprised of a modified nucleic acid, and each nucleotide of the anchor oligonucleotide comprises a modified nucleic acid as described herein, hi embodiments, each modified nucleic acid of the anchor oligonucleotide comprises a PNA, an LNA, a BNA, a nucleoside comprising a 2'-modification, or a combination thereof.

[0151] In embodiments, the anchor oligonucleotide is about 3 to about 30 nucleotides in length, or about 4 to about 25 nucleotides in length, or about 4 to about 20 nucleotides in length, or about 5 to about 18 nucleotides in length, or about 6 to about 15 nucleotides in length, or about 8 to about 12 nucleotides in length. In embodiments, the anchor oligonucleotide is about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, or about 20 nucleotides in length. In embodiments, the anchor oligonucleotide comprises or consists of the sequence mU+AmGmUmA+C+AmGmC (SEQ ID NO: 11). In embodiments, the anchor oligonucleotide comprises a biotin at the 3' end for immobilization of the anchor reagent to a surface, e.g., as described herein. In embodiments, the anchor oligonucleotide comprises the sequence mU+AmGmUmA+C+AmGmC / 3Bio / (SEQ ID NO: 17). In embodiments, the anchor oligonucleotide comprises a thiol at the 3' end for immobilization of the anchor reagent to a surface, e.g., as described herein. In embodiments, the anchor oligonucleotide comprises the sequence of any one of SEQ ID NOS: 20-37.

[0152] Capture Reagent In embodiments, the kit includes a capture reagent. In embodiments, the capture reagent is lyophilized. In embodiments, the capture reagent is provided in solution. Capture reagents are further described herein. In embodiments, the capture reagent comprises a protein or polypeptide, an antibody or antigen-binding fragment thereof, an antigen, a ligand, a receptor, an oligonucleotide, a hapten, an epitope, a mimotope, or an aptamer. In embodiments, the capture reagent comprises an antibody or a variant thereof, including an antigen / epitope-binding portion thereof, an antibody fragment or derivative, an antibody analog, an engineered antibody, or a substance that binds to an antigen in a manner similar to an antibody. In embodiments, the capture reagent is a complementarity-determining region (CDR) of at least one heavy or light chain of an antibody. In embodiments, the capture reagent comprises at least two CDRs from one or more antibodies. In embodiments, the capture reagent comprises an antibody or antigen-binding fragment thereof. In embodiments, the capture reagent comprises an antigen-binding domain that specifically binds to an epitope of the analyte. In embodiments, the capture reagent comprises an oligonucleotide. In embodiments, the analyte comprises an oligonucleotide and the capture reagent comprises an oligonucleotide that is complementary to the analyte.

[0153] surface In embodiments, the kit comprises a surface, and each of the capture reagent and anchor reagent can be immobilized on the surface. In embodiments, the kit comprises a surface, and each of the capture reagent and anchor reagent is provided on the surface. In embodiments, the kit comprises a surface, the anchor reagent is immobilized on the surface, and the capture reagent is not provided on the surface and can be immobilized on the surface. In embodiments, the kit comprises a surface, the capture reagent is immobilized on the surface, and the anchor reagent is not provided on the surface and can be immobilized on the surface. Immobilization of the capture reagent and / or anchor reagent on a surface is further described herein.

[0154] In embodiments, the capture reagent is immobilized or capable of being immobilized on the surface via a covalent linkage between the capture reagent and the surface, e.g., a reaction between a thiol group of the capture reagent and the surface. In embodiments, the capture reagent is linked to a first binding partner, which is capable of binding to a second binding partner immobilized on the surface. In embodiments, the first and second binding partners comprise complementary oligonucleotides, receptor-ligand pairs, antigen-antibody pairs, hapten-antibody pairs, epitope-antibody pairs, mimotope-antibody pairs, aptamer-target molecule pairs, hybridization partners, or intercalator-target molecule pairs. In embodiments, the first and second binding partners comprise cross-reactive moieties, e.g., a thiol and maleimide or iodoacetamide; an aldehyde and hydrazide; or an azide and alkyne or cycloalkyne. In embodiments, the first binding partner comprises biotin, and the second binding partner comprises avidin, streptavidin, an anti-biotin antibody, or a combination thereof. In embodiments, the first and second binding partners are bound to one another via a cross-linking agent, which binds to both the first and second binding partners. In embodiments, the cross-linking agent comprises at least two binding sites, and each of the first and second binding partners binds to a different binding site. In embodiments, the cross-linking agent comprises streptavidin or avidin, and the first and second binding partners are each biotin.

[0155] In embodiments, the anchor reagent is immobilized or capable of being immobilized on a surface via a covalent linkage between the anchor reagent and the surface, e.g., a reaction between a thiol group of the anchor reagent and the surface. In embodiments, the anchor reagent is linked to a first binding partner, which is capable of binding to a second binding partner immobilized on the surface. In embodiments, the first and second binding partners comprise complementary oligonucleotides, receptor-ligand pairs, antigen-antibody pairs, hapten-antibody pairs, epitope-antibody pairs, mimotope-antibody pairs, aptamer-target molecule pairs, hybridization partners, or intercalator-target molecule pairs. In embodiments, the first and second binding partners comprise cross-reactive moieties, e.g., a thiol and maleimide or iodoacetamide; an aldehyde and hydrazide; or an azide and alkyne or cycloalkyne. In embodiments, the first binding partner comprises biotin, and the second binding partner comprises avidin, streptavidin, an anti-biotin antibody, or a combination thereof. In embodiments, the first and second binding partners are bound to one another via a cross-linking agent, which binds to both the first and second binding partners. In embodiments, the cross-linking agent comprises at least two binding sites, and each of the first and second binding partners binds to a different binding site. In embodiments, the cross-linking agent comprises streptavidin or avidin, and the first and second binding partners are each biotin.

[0156] In embodiments, the anchor reagent comprises an anchor oligonucleotide and a first binding partner, wherein the first binding partner is linked to a nucleotide of the anchor oligonucleotide. In embodiments, the first binding partner is linked to an internal nucleotide of the anchor oligonucleotide. In embodiments, the first binding partner is located at the 5'-end of the anchor reagent. In embodiments, the first binding partner is located at the 3'-end of the anchor reagent. In embodiments, the first binding partner is linked to the 5'- or 3'-terminal nucleotide of the anchor oligonucleotide. In embodiments, the anchor reagent comprises a spacer located between the first binding partner and the anchor oligonucleotide. In embodiments, the spacer comprises PEG containing about 1 to about 50, or about 2 to about 40, or about 3 to about 30, or about 4 to about 20, or about 5 to about 10, or about 1 to about 15, or about 2 to about 10, or about 3 to about 8, or about 4 to about 7, or about 5 to about 6 ethylene glycol units. In embodiments, the spacer comprises a PEG comprising about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 ethylene glycol units. In embodiments, the first binding partner is positioned at the 3' end of the anchor reagent, and the anchor reagent comprises a PEG spacer comprising about 1 to about 15, or about 2 to about 10, or about 3 to about 8 ethylene glycol units. In embodiments, the anchor reagent comprises a 3' terminal nucleotide linked to a first end of the PEG spacer and a first binding partner linked to a second end of the PEG spacer, and the PEG spacer comprises about 1 to about 15, or about 2 to about 10, or about 3 to about 8 ethylene glycol units.

[0157] In embodiments, the first binding partner of the capture reagent and the first binding partner of the anchor reagent are substantially non-cross-reactive, i.e., the first binding partner of the capture reagent and the first binding partner of the anchor reagent bind to different second binding partners on the surface. In embodiments, the first binding partner of the capture reagent and the first binding partner of the anchor reagent are capable of binding to the same second binding partner on the surface.

[0158] Surfaces are further described herein. In embodiments, the surface comprises particles. In some embodiments, the particles comprise microspheres. In embodiments, the particles comprise paramagnetic beads. In embodiments, the surface comprises a cartridge. In embodiments, the surface comprises a well of a multiwell plate. Non-limiting examples of plates include MSD® SECTOR™ and MSD QUICKPLEX® assay plates, e.g., MSD® GOLD™ 96-well small spot streptavidin plates. In embodiments, the surface comprises a plurality of different binding domains, and the capture reagent and anchor reagent are or can be immobilized on two different binding domains on the surface. In embodiments, the surface comprises a plurality of different binding domains, and the capture reagent and anchor reagent are or can be immobilized on the same binding domain on the surface. In embodiments, the surface comprises particles, and the capture reagent and anchor reagent are or can be immobilized on the same particle. In embodiments, the capture reagent is within about 1 nm to about 500 nm, about 5 nm to about 250 nm, about 10 nm to about 200 nm, or about 15 nm to about 150 nm of the anchor reagent on the surface. In embodiments, the capture reagent is less than 1 μm from the anchor reagent on the surface. In embodiments, the capture reagent is less than 500 nm from the anchor reagent on the surface. In embodiments, the capture reagent is less than 200 nm from the anchor reagent on the surface.

[0159] In embodiments, the surface comprises an electrode. In embodiments, the electrode comprises a carbon ink electrode. In embodiments, the surface comprises particles and the kit further comprises an electrode for collecting the particles. In embodiments, the kit further comprises a reagent for immobilizing the capture reagent and / or anchor reagent to the surface.

[0160] Detection Reagents In embodiments, the kit includes a detection reagent, wherein the detection reagent comprises a protein or polypeptide. In embodiments, the detection reagent is lyophilized. In embodiments, the detection reagent is provided in solution. Detection reagents are further described herein. In embodiments, the detection reagent comprises an antibody or a variant thereof, including an antigen / epitope-binding portion thereof, an antibody fragment or derivative, an antibody analog, an engineered antibody, or a substance that binds to an antigen in a manner similar to an antibody. In embodiments, the detection reagent comprises at least one heavy or light chain complementarity-determining region (CDR) of an antibody. In embodiments, the detection reagent comprises at least two CDRs from one or more antibodies. In embodiments, the detection reagent comprises an antibody or antigen-binding fragment thereof. In embodiments, the detection reagent comprises an antigen-binding domain that specifically binds to an epitope of the analyte. In embodiments, the detection reagent comprises a protein or polypeptide antigen. In embodiments, the detection reagent comprises a protein or polypeptide ligand or receptor.

[0161] In embodiments, the detection reagent comprises a nucleic acid primer or can be linked to a nucleic acid primer. Nucleic acid primers and their conjugation to proteins or polypeptides, such as antibodies or antigen-binding fragments thereof, are further described herein. In embodiments, the nucleic acid primer comprises a conjugate moiety for conjugation to a detection reagent. In embodiments, the conjugate moiety is at the 5' or 3' end of the nucleic acid primer. In embodiments, the conjugate moiety comprises a thiol. In embodiments, the nucleic acid primer comprises a 5'-thiol.

[0162] In an embodiment, the nucleic acid primer is about 10 to about 30 nucleotides in length, or about 12 to about 28 nucleotides in length, or about 13 to about 26 nucleotides in length, or about 14 to about 24 nucleotides in length, or about 11 to about 22 nucleotides in length, or about 12 to about 21 nucleotides in length, or about 13 to about 20 nucleotides in length, or about 13 to about 18 nucleotides in length, or about 14 to about 19 nucleotides in length. In an embodiment, the nucleic acid primer is about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, or about 30 nucleotides in length. In an embodiment, the nucleic acid primer is about 14 nucleotides in length or about 15 nucleotides in length. In an embodiment, the nucleic acid primer comprises or consists of a sequence set forth in Table 2 herein. In embodiments, the nucleic acid primer comprises the sequence / 5ThioMC6-D / GACAGAACTAGACAC (SEQ ID NO: 18), where "5ThioMC6-D" refers to a 5' thiol modifier C6 SS modification. In embodiments, the 5' thiol modifier allows for conjugation of the nucleic acid primer to a detection reagent, as described herein.

[0163] Additional Embodiments In embodiments, the kit further comprises a calibration reagent, a blocking reagent, a diluent, a stabilizer, a buffer, a ligase, a reagent for conjugating a nucleic acid primer to a detection reagent, a co-reactant for a detectable label, a surfactant, a salt, a preservative, or a combination thereof.

[0164] In embodiments, the kit includes a calibration reagent. In embodiments, the calibration reagent includes a known amount of analyte. In embodiments, the kit includes a plurality of calibration reagents comprising a range of analyte concentrations. In embodiments, the plurality of calibration reagents includes analyte concentrations near the upper and lower limits of quantitation for the method. In embodiments, the plurality of calibration reagents spans the entire dynamic range of the method. In embodiments, the calibration reagent is a positive control reagent. In embodiments, the calibration reagent is a negative control reagent. In embodiments, a positive or negative control reagent is used to provide a basis of comparison for samples tested using the methods of the invention. In embodiments, the calibration reagent is lyophilized. In embodiments, the calibration reagent is provided in solution.

[0165] In embodiments, the kit includes a blocking reagent. In embodiments, the blocking reagent reduces nonspecific binding of components other than tau to the capture and detection reagents described herein. Exemplary blocking agents include, but are not limited to, mBSA, sheared poly(A), polyBSA-I, mIgG, Tween, polyBSA-II, yeast RNA, mBSA + poly(A), and / or polyBSA + poly(A). In embodiments, the kit further includes a diluent for one or more components of the kit. In embodiments, kits including the above components include stock concentrations of the components that are 5X, 10X, 20X, 30X, 40X, 50X, 60X, 70X, 80X, 90X, 100X, 125X, 150X, or more times the working concentrations of the methods provided herein. In embodiments, the kit further includes a stabilizer, for example, for storage of one or more components of the kit.

[0166] In embodiments, the kit includes a buffer, such as an assay buffer, a reconstitution buffer, a storage buffer, a read buffer, or a combination thereof. In embodiments, the kit further includes a coreactant, for example, for performing an electrochemiluminescence measurement. Exemplary coreactants are described, for example, in WO2020 / 142313.

[0167] In embodiments, the kit includes a ligase. In embodiments, the ligase is capable of ligating a linear template oligonucleotide provided herein to form a circular template oligonucleotide described herein. In embodiments, the ligase is T4 DNA ligase, T7 DNA ligase, Taq DNA ligase, ELECTROLIGASE®, SPLINTR® ligase, or a combination thereof.

[0168] In embodiments, the kit includes reagents for conjugating nucleic acid primers to detection reagents. Exemplary reagents are described, for example, in WO2021 / 092004 and Wong, SS and Jameson, DM, Chemistry of Protein and Nucleic Acid Cross-Linking and Conjugation, 2004. nd Ed., CRC Press (2011).

[0169] In embodiments, the kits further include assay consumables, e.g., assay modules, vials, tubes, liquid handling and transfer devices, e.g., pipette tips, covers and seals, racks, labels, and the like. In embodiments, the kits further include electrodes, e.g., for performing ECL measurements. In embodiments, the electrodes are applied to a surface provided herein. In embodiments, the kits further include an assay device and / or instructions for performing the methods described herein.

[0170] Those skilled in the art will understand that the components of the kits described herein may be provided in one or more vials, containers, or compartments, but are not necessarily contained in the same container, e.g., the same box, and / or at the same time. In embodiments, the components of the kits described herein are provided in one or more separate containers or compartments, either simultaneously or sequentially. Those skilled in the art will further understand that, for example, as described in the embodiments herein, one may obtain (e.g., purchase or own) the components of the kit (e.g., the signal amplification reagents described herein) separately, e.g., in one or more separate containers or compartments, but that the components are nevertheless considered part of a "kit" when used in combination. In some embodiments, the kit includes multiple containers, vials, or compartments provided together in a single package or container. In embodiments, the components of the kits described herein are provided separately, e.g., according to the optimal shipping or storage temperatures of the components.

[0171] composition In embodiments, the present invention provides a composition for labeling a surface, comprising: (1) a detectable label; and (2) a labeled probe comprising a detection oligonucleotide capable of binding to an extender oligonucleotide bound to the surface, wherein the extender oligonucleotide is formed by extension of a nucleic acid primer by a polymerase based on a template oligonucleotide, and wherein: (i) the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; (ii) the composition further comprises a nuclease capable of cleaving the template oligonucleotide; (iii) a combination of (i) and (ii); (iv) one or both of (i) and (ii), and further, the extender oligonucleotide is bound to the surface via an anchor reagent; (v) the surface comprises an anchor reagent comprising an anchor oligonucleotide, wherein the anchor oligonucleotide comprises a modified nucleic acid; or (vi) any combination of (i), (ii), and (v). In embodiments, the composition comprises a detection oligonucleotide comprising RNA, a modified nucleic acid, or a combination thereof; and a nuclease capable of cleaving the template oligonucleotide. In embodiments, the composition comprises a detection oligonucleotide comprising RNA, a modified nucleic acid, or a combination thereof; and an anchor reagent comprising an anchor oligonucleotide, wherein the anchor oligonucleotide comprises a modified nucleic acid. In an embodiment, the composition comprises a nuclease capable of cleaving a template oligonucleotide; and an anchor reagent comprising an anchor oligonucleotide, wherein the anchor oligonucleotide comprises a modified nucleic acid. In an embodiment, the composition comprises a detection oligonucleotide comprising RNA, a modified nucleic acid, or a combination thereof; a nuclease capable of cleaving a template oligonucleotide; and an anchor reagent comprising an anchor oligonucleotide, wherein the anchor oligonucleotide comprises a modified nucleic acid. In an embodiment, the template oligonucleotide is a circular oligonucleotide. In an embodiment, the extension of the nucleic acid primer is by rolling circle amplification (RCA).

[0172] In embodiments, the present invention provides a composition for labeling a surface, comprising: (a) a nucleic acid primer immobilized directly or indirectly on a surface; (b) a template oligonucleotide comprising (1) a first region that is complementary to the nucleic acid primer; and (2) a second region that comprises the same sequence as the detection oligonucleotide; (c) a polymerase; and (d) a labeled probe comprising (1) a detectable label; and (2) a detection oligonucleotide capable of binding to an extender oligonucleotide bound to the surface, wherein the extender oligonucleotide is formed by extension of the nucleic acid primer by the polymerase based on the template oligonucleotide, and wherein: (i) the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; (ii) the composition further comprises a nuclease capable of cleaving the template oligonucleotide; (iii) a combination of (i) and (ii); (iv) one or both of (i) and (ii), and further, the extender oligonucleotide is bound to the surface via an anchor reagent; (v) the surface comprises an anchor reagent comprising an anchor oligonucleotide, wherein the anchor oligonucleotide comprises a modified nucleic acid; or (vi) any combination of (i), (ii), and (v). In embodiments, the composition comprises a detection oligonucleotide comprising RNA, a modified nucleic acid, or a combination thereof; and a nuclease capable of cleaving the template oligonucleotide. In embodiments, the composition comprises a detection oligonucleotide comprising RNA, a modified nucleic acid, or a combination thereof; and an anchor reagent comprising an anchor oligonucleotide, wherein the anchor oligonucleotide comprises a modified nucleic acid. In embodiments, the composition comprises a nuclease capable of cleaving the template oligonucleotide; and an anchor reagent comprising an anchor oligonucleotide, wherein the anchor oligonucleotide comprises a modified nucleic acid. In embodiments, the composition comprises a detection oligonucleotide comprising RNA, a modified nucleic acid, or a combination thereof; a nuclease capable of cleaving the template oligonucleotide; and an anchor reagent comprising an anchor oligonucleotide, wherein the anchor oligonucleotide comprises a modified nucleic acid. In embodiments, the template oligonucleotide is a cyclic oligonucleotide.In an embodiment, the extension of the nucleic acid primer is by rolling circle amplification (RCA).

[0173] In embodiments, the composition comprises a detection oligonucleotide comprising RNA, a modified nucleic acid, or a combination thereof. In embodiments, the detection oligonucleotide comprises a modified nucleic acid. In embodiments, the composition is suitable for detecting an analyte present on a surface, for example. In embodiments, the composition is suitable for generating a detectable signal from a detectable label. In embodiments, the detection oligonucleotide comprises the sequence of any one of SEQ ID NOs: 7-10.

[0174] Labeled probes, including detectable labels and detection oligonucleotides, are further described herein. In embodiments, the detectable label is an ECL label. In embodiments, the detection oligonucleotide comprises a modified nucleic acid. In embodiments, the modified nucleic acid comprises a PNA, an LNA, a BNA, a nucleoside containing a 2'-modification, or a combination thereof. In embodiments, the nucleoside containing a 2'-modification comprises 2'-OMe, 2'-MOE, 2'-F, 2'-OH, or a combination thereof. In embodiments, the modified nucleic acid comprises a backbone modification, as described herein, such as phosphorothioate, boranophosphate, methylphosphonate, phosphoramidate (e.g., morpholino phosphoramidate and mesyl phosphoramidate), phosphoramidate, 3'-O-phosphopropylamino, or a combination thereof. Modified nucleic acids are further described herein.

[0175] In embodiments, the detection oligonucleotide is about 3 to about 30 nucleotides in length, or about 4 to about 25 nucleotides in length, or about 4 to about 20 nucleotides in length, or about 5 to about 18 nucleotides in length, or about 6 to about 15 nucleotides in length, or about 8 to about 12 nucleotides in length. In embodiments, the detection oligonucleotide is about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, or about 20 nucleotides in length. In embodiments, the detection oligonucleotide comprises or consists of a sequence set forth in Table 4 herein.

[0176] In embodiments, the composition further comprises one or more of a polymerase, a primer, a template oligonucleotide, or a combination thereof.

[0177] In embodiments, the composition comprises a polymerase, wherein the polymerase is an SD polymerase described herein. In embodiments, the SD polymerase comprises an amino acid sequence that shares at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with a DNA polymerase from a bacteriophage. In embodiments, the bacteriophage is Phi29, Nf, Karezi, or BeachBum. In embodiments, the SD polymerase comprises an amino acid sequence that shares at least 80% sequence identity with a DNA polymerase from a bacteriophage, wherein the bacteriophage is Phi29, Nf, Karezi, or BeachBum. In embodiments, the SD polymerase comprises an amino acid sequence that is at least 90% identical to a DNA polymerase, a bacteriophage, and the bacteriophage is Phi29, Nf, Karezi, or BeachBum. In embodiments, the SD polymerase is a DNA polymerase, a bacteriophage, and the bacteriophage is Phi29, Nf, Karezi, or BeachBum.

[0178] In embodiments, the composition comprises a nucleic acid primer linked to a detection reagent described herein. In embodiments, the detection reagent comprises a protein or polypeptide. In embodiments, the detection reagent comprises an antibody or antigen-binding fragment thereof. In embodiments, the extended oligonucleotide is formed by extending the nucleic acid primer, e.g., with a polymerase described herein.

[0179] In embodiments, the composition includes a template oligonucleotide for nucleic acid amplification, e.g., as described herein. Template oligonucleotides are further described herein. In embodiments, the composition includes a polymerase, a nucleic acid primer, and a template oligonucleotide, as described herein. In embodiments, the template oligonucleotide is capable of binding to the nucleic acid primer, and the polymerase is capable of extending the nucleic acid primer from the template oligonucleotide by PCR, NEAR, and / or an isothermal amplification method, such as SDA, HDA, RCA, or a combination thereof, to form an extended oligonucleotide, as described herein. In embodiments, the template oligonucleotide comprises or consists of a sequence set forth in Table 3 herein. In embodiments, the template oligonucleotide is a circular template oligonucleotide formed by ligating the 5' and 3' ends of the sequence set forth in Table 3 herein.

[0180] In embodiments, the composition comprises a nuclease capable of cleaving the template oligonucleotide. Nucleases are further described herein. In embodiments, the nuclease comprises one or more restriction enzymes listed in Table 1. In some embodiments, the nuclease comprises DdeI, AluI, HpaII, ApoI, DpnI, DpnII, ScrFI, MboI, MluCI, AseI, TaqI, or a combination thereof.

[0181] In embodiments, the composition comprises an extender oligonucleotide on a surface, the extender oligonucleotide being formed by polymerase extension of a nucleic acid primer from a template oligonucleotide. Extender oligonucleotides are further described herein. In embodiments, the extender oligonucleotide is about 100 to about 100,000 bases in length, or about 200 to about 75,000 bases in length, or about 500 to about 50,000 bases in length, or about 700 to about 20,000 bases in length, or about 1,000 to about 15,000 bases in length, or about 2,000 to about 10,000 bases in length, or about 3,000 to about 8,000 bases in length, or about 4,000 to about 7,000 bases in length, or about 5,000 to about 6,000 bases in length. In embodiments, the extender oligonucleotide is about 100 to about 80,000 bases, or about 200 to about 60,000 bases, or about 500 to about 50,000 bases, or about 4,000 to about 100,000 bases, or about 7,500 to about 75,000 bases, or about 9,000 to about 40,000 bases, or about 1,000 to about 50,000 bases, or about 2,000 to about 25,000 bases, or about 3,000 to about 13,000 bases in length. In embodiments, the extender oligonucleotide is about 100 to about 8,000 bases, or about 500 to about 6,000 bases, or about 1,000 to about 4,500 bases in length.

[0182] In embodiments, the extended oligonucleotide is attached to the surface via an anchoring reagent. Anchor reagents are further described herein. In embodiments, the anchoring reagent comprises an anchor oligonucleotide. In embodiments, the anchor oligonucleotide comprises a modified nucleic acid described herein. In embodiments, the modified nucleic acid comprises a PNA, an LNA, a BNA, a nucleoside comprising a 2'-modification, or a combination thereof. In embodiments, the nucleoside comprising a 2'-modification comprises 2'-OMe, 2'-MOE, 2'-F, 2'-OH, or a combination thereof. In embodiments, the modified nucleic acid comprises a backbone modification, as described herein, such as phosphorothioate, boranophosphate, methylphosphonate, phosphoramidate (e.g., morpholino phosphoramidate and mesyl phosphoramidate), phosphoramidate, 3'-O-phosphopropylamino, or a combination thereof. Modified nucleic acids are further described herein.

[0183] In embodiments, the present invention provides a composition comprising a capture reagent, an analyte, a detection reagent comprising a nucleic acid primer, a template oligonucleotide, a polymerase, and a nuclease. The components of the composition, i.e., the capture reagent, the analyte, the detection reagent, the nucleic acid primer, the template oligonucleotide, the polymerase, and the nuclease, are further described herein. In embodiments, the capture reagent and the detection reagent each comprise an antibody or an antigen-binding fragment thereof. In embodiments, the nucleic acid primer comprises the sequence of any one of SEQ ID NOS: 1-4. In embodiments, the template oligonucleotide comprises the sequence of any one of SEQ ID NOS: 5, 6, or 16. In embodiments, the polymerase comprises an amino acid sequence having at least 90% sequence identity to a DNA polymerase from a bacteriophage, and the bacteriophage is Phi29, Nf, Karezi, or BeachBum. In embodiments, the nuclease comprises one or more restriction enzymes listed in Table 1. In some embodiments, the nuclease comprises DdeI, AluI, HpaII, ApoI, DpnI, DpnII, ScrFI, MboI, MluCI, AseI, TaqI, or a combination thereof.

[0184] In embodiments, the present invention provides a composition comprising a capture reagent, an analyte, a detection reagent comprising an extension oligonucleotide, and an anchor reagent comprising an anchor oligonucleotide. The components of the composition, i.e., the capture reagent, the analyte, the detection reagent, the extension oligonucleotide, the anchor reagent, and the anchor oligonucleotide, are further described herein. In embodiments, the capture reagent and the detection reagent each comprise an antibody or an antigen-binding fragment thereof. In embodiments, the extension oligonucleotide is extended from a template oligonucleotide set forth in any one of SEQ ID NOs: 5, 6, or 16. In embodiments, the anchor reagent comprises an anchor oligonucleotide comprising the sequence of any one of SEQ ID NOs: 11, 17, or 20-37.

[0185] In embodiments, the present invention provides a composition comprising a capture reagent, an analyte, a detection reagent comprising an extension oligonucleotide, and a labeled probe comprising a detection oligonucleotide. The components of the composition, i.e., the capture reagent, the analyte, the detection reagent, the extension oligonucleotide, the labeled probe, and the detection oligonucleotide, are further described herein. In embodiments, the capture reagent and the detection reagent each comprise an antibody or an antigen-binding fragment thereof. In embodiments, the extension oligonucleotide is extended from a template oligonucleotide set forth in any one of SEQ ID NOs: 5, 6, or 16. In embodiments, the detection oligonucleotide comprises the sequence of any one of SEQ ID NOs: 7-10.

[0186] In embodiments, the capture reagent is immobilized on a surface as described herein. In embodiments, the capture reagent and detection reagent are bound to the analyte to form a complex on the surface. In embodiments, the detection reagent is an antibody or an antigen-binding fragment thereof. In embodiments, each of the capture reagent and detection reagent is an antibody or an antigen-binding fragment thereof.

[0187] In embodiments, the composition comprises a detection reagent, wherein the detection reagent comprises a nucleic acid primer. In embodiments, the nucleic acid primer comprises a sequence shown in Table 2. In embodiments, the composition comprises a template oligonucleotide, e.g., a circular template oligonucleotide, and the nucleic acid primer is hybridized to the template oligonucleotide. In embodiments, the template oligonucleotide comprises a sequence shown in Table 3. In embodiments, the composition comprises a polymerase, wherein the polymerase is capable of extending the nucleic acid primer in a nucleic acid amplification reaction, e.g., PCR, NEAR, etc., and / or an isothermal amplification method, e.g., SDA, HDA, RCA, or a combination thereof. In embodiments, the polymerase is an SD polymerase described herein, e.g., comprising an amino acid sequence of at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to a DNA polymerase from a bacteriophage. In embodiments, the bacteriophage is Phi29, Nf, Karezi, or BeachBum. In embodiments, the composition comprises a nuclease, wherein the nuclease is capable of cleaving a double-stranded portion of a template oligonucleotide, e.g., a template oligonucleotide hybridized to a nucleic acid primer. In embodiments, the nuclease comprises one or more restriction enzymes listed in Table 1. In embodiments, the nuclease is DdeI, AluI, HpaII, ApoI, DpnI, DpnII, ScrFI, MboI, MluCI, AseI, TaqI, TspRI, or a combination thereof. In embodiments, the nuclease is RNase H2. In embodiments, the nuclease is UNG, endonuclease V, or Fpg. In embodiments, the composition further comprises an abasic endonuclease, e.g., UDG, APE1, and / or endonuclease IV, as described herein.

[0188] In an embodiment, the composition comprises a detection reagent, and the detection reagent comprises an extender oligonucleotide. In an embodiment, the extender oligonucleotide is formed from nucleic acid amplification of a nucleic acid primer on the detection reagent as described herein. In an embodiment, the extender oligonucleotide is about 100 to about 100,000 bases, or about 200 to about 75,000 bases, or about 500 to about 50,000 bases, or about 700 to about 20,000 bases, or about 1,000 to about 15,000 bases, or about 2,000 to about 10,000 bases, or about 3,000 to about 8,000 bases, or about 4,000 to about 7,000 bases, or about 5,000 to about 6,000 bases in length. In embodiments, the extender oligonucleotide is about 100 to about 80,000 bases, or about 200 to about 60,000 bases, or about 500 to about 50,000 bases, or about 4,000 to about 100,000 bases, or about 7,500 to about 75,000 bases, or about 9,000 to about 40,000 bases, or about 1,000 to about 50,000 bases, or about 2,000 to about 25,000 bases, or about 3,000 to about 13,000 bases in length. In embodiments, the extender oligonucleotide is about 100 to about 8,000 bases, or about 500 to about 6,000 bases, or about 1,000 to about 4,500 bases in length.

[0189] In embodiments, the composition comprises an anchor reagent, and the anchor reagent comprises an anchor oligonucleotide. In embodiments, the anchor oligonucleotide comprises or consists of the sequence of any one of SEQ ID NOS: 11, 17, or 20-37. In embodiments, the anchor oligonucleotide comprises a modified nucleic acid described herein. In embodiments, the modified nucleic acid comprises a PNA, an LNA, a BNA, a nucleoside comprising a 2'-modification, or a combination thereof. In embodiments, the nucleoside comprising a 2'-modification comprises 2'-OMe, 2'-MOE, 2'-F, 2'-OH, or a combination thereof. In embodiments, the modified nucleic acid comprises a backbone modification, as described herein, such as phosphorothioate, boranophosphate, methylphosphonate, phosphoramidate (e.g., morpholino phosphoramidate and mesyl phosphoramidate), phosphoramidate, 3'-O-phosphopropylamino, or a combination thereof. Modified nucleic acids are further described herein. In embodiments, the extension oligonucleotide comprises an anchor oligonucleotide complement that is complementary to the anchor oligonucleotide. In embodiments, the extend oligonucleotide is attached to the anchor reagent via hybridization of the anchor oligonucleotide complement to the anchor oligonucleotide.

[0190] In embodiments, the composition comprises a labeled probe, wherein the labeled probe comprises a detection oligonucleotide. In embodiments, the labeled probe further comprises a detectable label as described herein. In embodiments, the detection oligonucleotide comprises or consists of a sequence shown in Table 4. In embodiments, the detection oligonucleotide comprises a modified nucleic acid as described herein. In embodiments, the modified nucleic acid comprises a PNA, an LNA, a BNA, a nucleoside comprising a 2'-modification, or a combination thereof. In embodiments, the nucleoside comprising a 2'-modification comprises 2'-OMe, 2'-MOE, 2'-F, 2'-OH, or a combination thereof. In embodiments, the modified nucleic acid comprises a backbone modification as described herein, such as phosphorothioate, boranophosphate, methylphosphonate, phosphoramidate (e.g., morpholino phosphoramidate and mesyl phosphoramidate), phosphoramidate, 3'-O-phosphopropylamino, or a combination thereof. Modified nucleic acids are further described herein. In embodiments, the extension oligonucleotide comprises a detection oligonucleotide complement that is complementary to the detection oligonucleotide. In embodiments, the extension oligonucleotide is bound to the detection oligonucleotide via hybridization of the detection oligonucleotide complement to the detection oligonucleotide.

[0191] In embodiments, the present invention provides a composition comprising a capture reagent, an analyte, a detection reagent comprising an extension oligonucleotide, an anchor reagent comprising an anchor oligonucleotide, and a labeled probe comprising a detection oligonucleotide. The components of the composition, i.e., the capture reagent, the analyte, the detection reagent, the extension oligonucleotide, the anchor reagent, the anchor oligonucleotide, the labeled probe, and the detection oligonucleotide, are further described herein. In embodiments, the extension oligonucleotide comprises (i) an anchor oligonucleotide complement that is complementary to the anchor oligonucleotide; and (ii) a detection oligonucleotide complement that is complementary to the detection oligonucleotide. In embodiments, the extension oligonucleotide is bound to (I) the anchor reagent on the surface via the anchor oligonucleotide and (II) the labeled probe via the detection oligonucleotide. In embodiments, the extension oligonucleotide bound to both the surface and the labeled probe via the anchor reagent can be detected with higher sensitivity than the extension oligonucleotide bound to the labeled probe and not bound to the surface. In embodiments, each of the capture reagent and the detection reagent comprises an antibody or an antigen-binding fragment thereof. In embodiments, the extension oligonucleotide is extended from a template oligonucleotide of any one of SEQ ID NOs: 5, 6, or 16. In an embodiment, the anchor reagent comprises an anchor oligonucleotide comprising the sequence of any one of SEQ ID NOs: 11, 17, and 20 to 37. In an embodiment, the detection oligonucleotide comprises the sequence of any one of SEQ ID NOs: 7 to 10.

[0192] Additional Embodiments The inventions described herein, eg, methods, kits, and / or compositions, may further include aspects of one or more of the following additional embodiments.

[0193] Additional embodiment (1) An additional embodiment (1) includes a method for detecting an analyte, comprising: (a) contacting a template oligonucleotide with a first complex comprising: (1) the analyte; and (2) a detection reagent that binds to the analyte, where the detection reagent comprises a nucleic acid primer; (b) hybridizing the nucleic acid primer to the template oligonucleotide to form a second complex, and extending the nucleic acid primer with a polymerase, thereby forming an extended oligonucleotide; (c) contacting the extended oligonucleotide with a single-stranded oligonucleotide (SSO) stabilizer; and (d) detecting the extended oligonucleotide, thereby detecting the analyte.

[0194] In embodiments, detecting comprises binding the extended oligonucleotide to one or more labeled probes, each of which comprises (1) a detection oligonucleotide capable of binding to the extended oligonucleotide; and (2) a detectable label; and detecting the detectable label. In embodiments, the second complex is bound to a surface.

[0195] In embodiments, the SSO stabilizer prevents aggregation and / or self-hybridization of the extended oligonucleotides, thereby increasing the availability of the extended oligonucleotides for detection. In embodiments, extension is carried out for at least 5 minutes, at least 10 minutes, at least 15 minutes, at least 30 minutes, at least 45 minutes, at least 1 hour, at least 2 hours, at least 3 hours, at least 4 hours, at least 6 hours, at least 8 hours, at least 10 hours, at least 12 hours, at least 14 hours, at least 16 hours, at least 18 hours, at least 20 hours, at least 22 hours, or at least 24 hours. In embodiments, the SSO stabilizer is contacted with the extended oligonucleotides at least 5 minutes, at least 10 minutes, at least 15 minutes, at least 20 minutes, at least 30 minutes, at least 45 minutes, or at least 1 hour after extension is initiated. In embodiments, extension is carried out for at least 60 minutes, and the SSO stabilizer is added about 5 to about 15 minutes after extension is initiated. In embodiments, extension is initiated upon contacting the second complex with a polymerase.

[0196] In embodiments, the SSO stabilizer comprises a DNA-binding protein. In embodiments, the DNA-binding protein specifically binds to single-stranded DNA. In embodiments, the SSO stabilizer is an extremely thermostable single-stranded DNA-binding protein (ET SSB). In embodiments, the concentration of ET SSB is about 50 ng / mL to about 500 ng / mL, or about 60 ng / mL to about 450 ng / mL, or about 70 ng / mL to about 400 ng / mL, or about 80 ng / mL to about 350 ng / mL, or about 90 ng / mL to about 300 ng / mL, or about 100 ng / mL to about 250 ng / mL, or about 125 ng / mL to about 200 ng / mL, or about 150 ng / mL to about 175 ng / mL.

[0197] In embodiments, the SSO stabilizer is ET SSB, and the concentration of ET SSB is about 50 ng / mL to about 100 ng / mL immediately after elongation is initiated. In embodiments, the SSO stabilizer is ET SSB, and the concentration of ET SSB is about 100 ng / mL to about 150 ng / mL about 5 minutes after elongation is initiated. In embodiments, the SSO stabilizer is ET SSB, and the concentration of ET SSB is about 200 ng / mL to about 300 ng / mL about 15 minutes after elongation is initiated.

[0198] In embodiments, a method comprising contacting an extend oligonucleotide with an SSO stabilizer comprises an assay signal that is at least 1.1-fold, at least 1.2-fold, at least 1.3-fold, at least 1.4-fold, at least 1.5-fold, at least 1.6-fold, at least 1.7-fold, at least 1.8-fold, at least 1.9-fold, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, or at least 10-fold higher at a given time point compared to an otherwise identical method that does not include contact with an SSO stabilizer.

[0199] Additional embodiment (2) An additional embodiment (2) includes a method for detecting an analyte, comprising: (a) contacting a template oligonucleotide with (i) the analyte; (ii) a first complex comprising a capture reagent that binds to the analyte, wherein the capture reagent is linked to an anchor reagent comprising an anchor oligonucleotide to form a capture reagent-anchor reagent hybrid, which is immobilized or capable of being immobilized to a surface; and (iii) a detection reagent for the analyte, comprising a nucleic acid primer; (b) hybridizing the nucleic acid primer to the template oligonucleotide to form a second complex, and extending the nucleic acid primer with a polymerase, thereby forming an extended oligonucleotide, wherein the extended oligonucleotide comprises an anchor complement capable of binding to the anchor oligonucleotide; (c) binding the extended oligonucleotide to the anchor reagent; and (d) detecting the extended oligonucleotide, thereby detecting the analyte.

[0200] In embodiments, detecting comprises binding the extended oligonucleotide to one or more labeled probes, each of which comprises (1) a detection oligonucleotide capable of binding to the extended oligonucleotide; and (2) a detectable label; and detecting the detectable label.

[0201] In embodiments, the anchor reagent is linked to the capture reagent via covalent or non-covalent means. In embodiments, the linking comprises utilizing a cross-linking agent. In embodiments, the cross-linking agent is sulfosuccinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC). In embodiments, the anchor reagent is linked to the capture reagent via a disulfide bond. In embodiments, the anchor reagent is linked to the capture reagent via a coupling reaction, e.g., a click reaction.

[0202] In embodiments, the capture reagent-anchor reagent hybrid is directly immobilized on the surface, e.g., via covalent linkage. In embodiments, the capture-anchor reagent is directly immobilized on the surface via covalent linkage between the capture reagent portion of the capture reagent-anchor reagent hybrid and the surface. In embodiments, the capture reagent-anchor reagent hybrid comprises a first binding partner, which binds to a second binding partner on the surface. In embodiments, the first binding partner is on the capture reagent portion of the capture reagent-anchor reagent hybrid. In embodiments, the first binding partner is on the anchor reagent portion of the capture reagent-anchor reagent hybrid. In embodiments, the first and second binding partners comprise biotin and streptavidin. In embodiments, the first and second binding partners comprise a hapten and a protein capable of binding the hapten. In embodiments, the first binding partner is biotin and the second binding partner is streptavidin. In embodiments, the anchor oligonucleotide comprises biotin and the surface comprises streptavidin, and the capture anchor reagent hybrid is immobilized to the surface via the biotin on the anchor oligonucleotide and the streptavidin on the surface.

[0203] In embodiments, linking the anchor reagent to the capture reagent (a) provides improved uniformity and control in the preparation of the assay surface; (b) simplifies the assay preparation process by reducing the number of individual components that need to be immobilized on the surface; and / or (c) provides a consistent ratio of the amounts of anchor and capture reagent present on the surface.

[0204] FIG. 17 shows an exemplary illustration of additional embodiment (2).

[0205] Additional embodiment (3) An additional embodiment (3) includes a method for detecting an analyte, comprising: (a) hybridizing a template oligonucleotide to (i) an analyte; (ii) a first detection reagent that binds to the analyte and comprises a first nucleic acid probe; (iii) a second detection reagent that binds to the analyte and comprises a second nucleic acid probe; and (iv) a bridging oligonucleotide, wherein a first portion of the bridging oligonucleotide is capable of binding to the first nucleic acid probe and a second portion of the bridging oligonucleotide is capable of binding to the second nucleic acid probe, and the bridging oligonucleotide further comprises a nucleic acid primer; (b) hybridizing the nucleic acid primer to the template oligonucleotide to form a second complex, and extending the nucleic acid primer with a polymerase, thereby forming an extended oligonucleotide; and (c) detecting the extended oligonucleotide, thereby detecting the analyte.

[0206] In embodiments, detecting comprises binding the extended oligonucleotide to one or more labeled probes, each of which comprises (1) a detection oligonucleotide capable of binding to the extended oligonucleotide; and (2) a detectable label; and detecting the detectable label. In embodiments, the second complex is bound to a surface.

[0207] In embodiments, each of the first and second detection reagents is a detection reagent, e.g., a protein or polypeptide, an antibody or antigen-binding fragment thereof, an antigen, a ligand, a receptor, an oligonucleotide, a hapten, an epitope, a mimotope, or an aptamer, as described herein.

[0208] In embodiments, the nucleic acid primer of the bridging oligonucleotide is a nucleic acid primer, as described herein, e.g., capable of hybridizing to a template oligonucleotide and being extended to form an extended oligonucleotide, as described herein. In embodiments, the nucleic acid primer of the bridging oligonucleotide comprises any one of SEQ ID NOs: 1-4.

[0209] FIG. 18 shows an exemplary illustration of additional embodiment (3).

[0210] Additional embodiment (4) An additional embodiment (4) includes a method for detecting an analyte, comprising: (a) contacting a template oligonucleotide with a first complex comprising (i) the analyte; and (ii) a detection reagent that binds to the analyte, the detection reagent comprising a nucleic acid primer; (b) hybridizing the nucleic acid primer to the template oligonucleotide to form a second complex, and extending the nucleic acid primer with a polymerase, thereby forming an extended oligonucleotide, the extended oligonucleotide comprising a binding sequence capable of binding to an anchor reagent, the anchor reagent comprising a nucleic acid primer immobilized on a surface. or the first complex further comprises a capture reagent that binds to the analyte, the capture reagent being immobilized or capable of being immobilized on the surface, and the anchor reagent being linked to the capture reagent, and the binding sequence being capable of forming an aptamer or a tertiary oligonucleotide structure, and the anchor reagent comprising a protein, antibody, hapten, or affinity tag capable of binding to the aptamer or tertiary oligonucleotide structure; (c) binding the binding sequence to the anchor reagent; and (d) detecting the extended oligonucleotide bound to the surface, thereby detecting the analyte.

[0211] In embodiments, detecting comprises binding the extended oligonucleotide to one or more labeled probes, each of which comprises (1) a detection oligonucleotide capable of binding to the extended oligonucleotide; and (2) a detectable label; and detecting the detectable label. In embodiments, the second complex is bound to a surface.

[0212] In embodiments, the binding sequence forms a G-quadruplex complex, and the anchoring reagent comprises a DNA binding protein capable of binding to the G-quadruplex. In embodiments, the binding sequence that forms the G-quadruplex has the formula d(G 3+N 1-7 G 3+ N 1-7 G 3+ N 1-7 G 3+ (SEQ ID NO: 45)), wherein G is guanine, and N is any nucleotide. In embodiments, the template oligonucleotide comprises a 3+ N 1-7 C 3+ N 1-7 C 3+ N 1-7 C 3+ (SEQ ID NO: 46)), where C is cytosine and N is any nucleotide. In an embodiment, the template oligonucleotide comprises the sequence CCCTCCCTCCCTCCC (SEQ ID NO: 38).

[0213] In embodiments, the binding sequence forms an aptamer, and the anchoring reagent comprises an antibody, hapten, or affinity tag capable of binding to the aptamer. In embodiments, the aptamer-forming binding sequence and its corresponding anchoring reagent are as shown in Table 6. [Table 6]

[0214] 19A and 19B show an exemplary illustration of additional embodiment (4).

[0215] Additional embodiment (5) An additional embodiment (5) includes a method for detecting an analyte, comprising: (a) contacting a template oligonucleotide with a first complex comprising (i) the analyte; and (ii) a detection reagent that binds to the analyte, wherein the detection reagent comprises a nucleic acid primer; (b) hybridizing the nucleic acid primer to the template oligonucleotide to form a second complex, and extending the nucleic acid primer with a polymerase, thereby forming an extended oligonucleotide, wherein the extended oligonucleotide comprises a binding sequence capable of binding to an anchor reagent, and the anchor reagent is immobilized on a surface, or the first complex further comprises a capture reagent that binds to the analyte, and the capture reagent is immobilized or capable of being immobilized on the surface, and the anchor reagent is linked to the capture reagent, and the binding sequence comprises a binding moiety, and the anchor reagent comprises a protein or antibody capable of binding to the binding moiety; (c) binding the binding sequence to the anchor reagent; and (d) detecting the extended oligonucleotide bound to the surface, thereby detecting the analyte.

[0216] In embodiments, detecting comprises binding the extended oligonucleotide to one or more labeled probes, each of which comprises (1) a detection oligonucleotide capable of binding to the extended oligonucleotide; and (2) a detectable label; and detecting the detectable label. In embodiments, the second complex is bound to a surface.

[0217] In embodiments, the binding moiety is linked to a nucleotide of the binding sequence. In embodiments, extending comprises incorporating one or more nucleotides linked to the binding moiety into the extending oligonucleotide. In embodiments, the binding sequence comprises at least two binding moieties, and the anchor reagent is capable of multivalently binding to the at least two binding moieties. In embodiments, the binding moiety comprises a hapten. Non-limiting examples of haptens include digoxigenin, biotin, or dinitrophenol (DNP). In embodiments, the binding sequence comprises at least two haptens, e.g., at least two of digoxigenin, biotin, and / or DNP. In embodiments, the binding moiety comprises digoxigenin, and the anchor reagent comprises an anti-digoxigenin antibody. In embodiments, the binding moiety comprises biotin, and the anchor reagent comprises avidin, streptavidin, or an anti-biotin antibody. In embodiments, the binding moiety comprises DNP, and the anchor reagent comprises an anti-DNP antibody.

[0218] FIG. 20 shows an exemplary illustration of additional embodiment (5).

[0219] Additional embodiment (6) An additional embodiment (6) includes a method for detecting an analyte, comprising: (a) contacting a template oligonucleotide with a first complex comprising: (i) the analyte; (ii) a first detection reagent that binds to the analyte and comprises a first nucleic acid primer; and (iii) a second detection reagent that binds to the analyte and comprises a second nucleic acid primer, wherein the template oligonucleotide comprises a first region that is hybridizable to the first nucleic acid primer and a second region that is hybridizable to the second nucleic acid primer; (b) hybridizing the first and second nucleic acid primers to the template oligonucleotide to form a second complex; (c) extending the first nucleic acid primer to form a first extended oligonucleotide, and extending the second nucleic acid primer to form a second extended oligonucleotide; and (d) detecting the first and second extended oligonucleotides, thereby detecting the analyte.

[0220] In embodiments, the detecting comprises binding the first and / or second extender oligonucleotides to one or more labeled probes, each labeled probe comprising (1) a detection oligonucleotide capable of binding to the first and / or second extender oligonucleotide; and (2) a detectable label, and detecting the detectable label. In embodiments, the second complex is bound to a surface.

[0221] In embodiments, each of the first and second detection reagents is a detection reagent as described herein, e.g., a protein or polypeptide, an antibody or antigen-binding fragment thereof, an antigen, a ligand, a receptor, an oligonucleotide, a hapten, an epitope, a mimotope, or an aptamer. In embodiments, the first nucleic acid primer and the second nucleic acid primer comprise different sequences. In embodiments, each of the first and second nucleic acid primers independently comprises any one of SEQ ID NOs: 1-4, with the proviso that the first and second nucleic acid primers are not identical.

[0222] In embodiments, the template oligonucleotide comprises one or more connector oligonucleotides that can be ligated to form a circular template, wherein the first region is on the first connector oligonucleotide and the second region is on the second connector oligonucleotide. In embodiments, the method comprises ligating the first and second connector oligonucleotides before, during, or after hybridization of the first and second nucleic acid primers to the connector oligonucleotides, thereby forming the circular template. In embodiments, the circular template is a template for RCA. In embodiments, the extension comprises RCA.

[0223] In embodiments, a method comprising extending both a first and a second nucleic acid primer to form a first and a second extended oligonucleotide, respectively, comprises at least a 25%, at least a 50%, at least a 75%, at least a 100%, at least a 150%, at least a 200%, or at least a 300% increase in signal over an otherwise identical method except that only one of the first and second nucleic acid primers is extended.

[0224] FIG. 21 shows an exemplary illustration of an additional embodiment (6).

[0225] Additional embodiment (7) An additional embodiment (7) includes a method for detecting an analyte, comprising: (a) contacting a template oligonucleotide with a first complex comprising (i) the analyte; (ii) a first detection reagent that binds to the analyte and comprises a first nucleic acid primer; and (iii) a second detection reagent that binds to the analyte and comprises a second nucleic acid primer, wherein the analyte is present on a surface; (b) hybridizing the first and second nucleic acid primers to the template oligonucleotide to form a second complex; and extending the first and / or second nucleic acid primer with a polymerase, thereby forming extended oligonucleotides; and (c) detecting the extended oligonucleotides, thereby detecting the analyte.

[0226] In embodiments, the template oligonucleotide comprises one or more connector oligonucleotides that can be ligated to form a circular template, wherein the first region is on the first connector oligonucleotide and the second region is on the second connector oligonucleotide. In embodiments, the method comprises ligating the first and second connector oligonucleotides before, during, or after hybridization of the first and second nucleic acid primers to the connector oligonucleotides, thereby forming the circular template. In embodiments, the circular template is a template for RCA. In embodiments, the extension comprises RCA.

[0227] In embodiments, detecting comprises binding the extended oligonucleotide to one or more labeled probes, each of which comprises (1) a detection oligonucleotide capable of binding to the extended oligonucleotide; and (2) a detectable label; and detecting the detectable label.

[0228] In embodiments, the surface comprises a membrane. In embodiments, the membrane comprises a Western blot membrane. In embodiments, the membrane comprises a nitrocellulose membrane or a polyvinylidene fluoride (PVDF) membrane. In embodiments, the method further comprises transferring the analyte from a protein gel to the surface prior to the contacting of (a). Methods for transferring an analyte, e.g., a protein, from a protein gel to a membrane, e.g., a Western blot membrane, are known to those skilled in the art. See, e.g., Mahmood et al., N Am J Med Sci 4(9):429-434 (2012).

[0229] In embodiments, the surface further comprises an anchor reagent capable of binding to the extended oligonucleotides, and the method further comprises binding the extended oligonucleotides to the anchor reagent prior to detecting (c). In embodiments, the method further comprises immobilizing the anchor reagent on the surface before, during, or after contacting (a). In embodiments, the anchor reagent comprises a protein component, and immobilizing comprises binding the protein component to the surface.

[0230] The anchor reagent of additional embodiment (7) may be supplied as a component of a kit described herein. In embodiments, the anchor reagent is provided pre-immobilized on a surface, e.g., a Western blot membrane, described herein. In embodiments, the anchor reagent is provided in a Western blot transfer buffer, and the anchor reagent is transferred from the transfer buffer to the surface, e.g., a Western blot membrane, prior to transfer of the analyte onto the surface, e.g., a Western blot membrane.

[0231] In embodiments, the analyte includes a protein, and the method includes contacting the protein with (i) a first detection reagent that binds to a post-translational modification on the protein and that includes a first nucleic acid primer; and (ii) a second detection reagent that specifically binds to the protein and that includes a second nucleic acid primer, thereby forming a first complex that includes the analyte, the first detection reagent, and the second detection reagent. Analyte complexes that include the first and second detection reagents are further described herein. In embodiments, the post-translational modification on the protein includes phosphorylation, methylation, acetylation, hydroxylation, deamidation, prenylation, glycosylation, ubiquitination, AMPylation, ADP-ribosylation, or a combination thereof. In embodiments, the methods described herein use two detection reagents, one that specifically binds to the protein and the other that binds to the post-translational modification, to enable sensitive and specific detection of post-translationally modified proteins.

[0232] In embodiments, the surface comprises at least two different analytes, and the method is capable of detecting each different analyte. In embodiments, each different analyte is located at a different location on the surface. In embodiments, each different analyte is associated with a different template oligonucleotide, such that extension oligonucleotides formed from the first complexes bind to different anchor reagents. In embodiments, each different template oligonucleotide, and thus each different analyte, is associated with a unique detectable label, e.g., a fluorescent label, a quantum dot, or an enzymatic activity, allowing for independent detection of the at least two different analytes.

[0233] FIG. 23 shows an exemplary illustration of an additional embodiment (7).

[0234] Additional embodiment (8) An additional embodiment (8) includes a method for detecting an analyte, comprising: (a) contacting a template oligonucleotide with a first complex comprising (i) the analyte; and (ii) a detection reagent that binds to the analyte, where the detection reagent comprises a nucleic acid primer; (b) hybridizing the nucleic acid primer to the template oligonucleotide to form a second complex, and extending the nucleic acid primer with a polymerase, thereby forming an extended oligonucleotide, where the extended oligonucleotide is capable of forming a secondary structure comprising a detectable enzymatic activity; and (c) detecting the detectable enzymatic activity, thereby detecting the analyte.

[0235] In an embodiment, the second complex is bound to a surface.

[0236] In embodiments, the secondary structure comprises an aptamer. In embodiments, the aptamer comprises enzymatic activity. In embodiments, the aptamer comprises enzymatic activity in the presence of an activator compound. In embodiments, the enzymatic activity is peroxidase activity, and the activator compound is hemin. Aptamers with peroxidase activity in the presence of hemin are described, for example, in Liu et al., Bull. Chem. Soc. Jpn. 82(1):99-104 (2009). In embodiments, the aptamer comprises the sequence ATTGGGAGGGATTGGGTGGG (SEQ ID NO: 43).

[0237] FIG. 22 shows an exemplary illustration of an additional embodiment (8).

[0238] array In an embodiment, the present invention provides an oligonucleotide having any one of SEQ ID NOs: 1 to 37. In an embodiment, the present invention provides an oligonucleotide having any one of SEQ ID NOs: 1 to 18. In an embodiment, the present invention provides an oligonucleotide comprising SEQ ID NO: 11, SEQ ID NO: 17, or any one of SEQ ID NOs: 20 to 37. In an embodiment, the present invention provides an oligonucleotide comprising any one of SEQ ID NOs: 7 to 10, any one of SEQ ID NOs: 12 to 15, or SEQ ID NO: 19. In an embodiment, the present invention provides an oligonucleotide consisting of SEQ ID NO: 11, SEQ ID NO: 17, or any one of SEQ ID NOs: 20 to 37. In an embodiment, the present invention provides an oligonucleotide consisting of any one of SEQ ID NOs: 7 to 10, any one of SEQ ID NOs: 12 to 15, or SEQ ID NO: 19. [Table 7-1] [Table 7-2]

[0239] All references cited herein, including patents, patent applications, articles, textbooks, and the like, and the references cited therein, to the extent they are not already cited, are incorporated herein by reference in their entirety. [Example]

[0240] Example 1. General protocol for sandwich immunoassays An ECL-based detection assay according to embodiments herein is performed as follows:

[0241] The detection antibody is modified by the addition of a nucleic acid primer using oligonucleotide-polypeptide conjugation techniques known to those skilled in the art, for example, as described in WO2020 / 180645. Streptavidin-coated plate wells of a multiwell plate are coated with biotinylated anchor oligonucleotides and biotinylated capture antibodies, followed by washing. A blocking solution and a sample containing the target analyte are then added to the wells. After incubation at room temperature, the wells are washed. A solution containing nucleic acid primer-conjugated detection antibodies is added to each well (25 μL per well) and incubated with shaking for 1-2 hours. A ligation mixture, which contains (i) template oligonucleotide (4 nM), ligation buffer, ATP (1 mM), and T4 DNA ligase (0.15 U / pL), is then added to each well. The plate is incubated with the ligation mixture for 30 minutes at room temperature, washed to remove excess template oligonucleotides, and incubated with a rolling circle amplification (RCA) mixture containing RCA buffer, dNTPs (250 pM each), and Phi29 DNA polymerase (0.125 U / ml) for 1.5 hours at 37°C. After incubation with the RCA mixture, the plate is washed and then incubated with a detection mixture containing 20 mM Tris, 1 mM EDTA, 250 mM NaCl, 0.01% TRITON, BSA (200 μg / mL), TWEEN 20 (0.05%), and a mixture of labeled probes (6.25 nM) containing detection oligonucleotides for 30 minutes at 37°C. After incubation with the detection mixture, the plate is washed, and 150 μL of MSD read buffer is added. Plates are read immediately after addition of read buffer on an MSD SECTOR® 6000 reader (plates and reader supplied by Meso Scale Discovery, Rockville, MD, USA).

[0242] Example 2. Improved Detection Oligonucleotides Conventional detection oligonucleotides (i.e., those that do not contain any modified nucleotides) of the labeled probes used in ECL-based detection assays inhibit the activity of Phi29 DNA polymerase during RCA, resulting in lower assay sensitivity and longer assay run times. To alleviate the problem of polymerase inhibition, the assay is typically performed without the labeled probe during the extension step, and the labeled probe is added in a separate step after extension, as described in the protocol of Example 1. See, for example, WO2014 / 165061; WO2014 / 160192; and WO2015 / 175856. This two-part extension and detection increases assay performance, but also increases assay run times.

[0243] Improved detection oligonucleotides were developed to be shorter (less than 20 nucleotides in length) than conventional detection oligonucleotides (greater than 20 nucleotides in length) and incorporate locked nucleic acid (LNA) residues. Such detection oligonucleotides were found not to inhibit DNA polymerase, thereby generating higher ECL assay signals. Shorter detection oligonucleotides can reduce assay development complexity compared to conventional detection oligonucleotides and can be used to generate higher assay signals even when provided at lower concentrations compared to conventional detection oligonucleotides. Furthermore, when shorter detection oligonucleotides are used, more copies of the detection oligonucleotide can bind to the extension oligonucleotide compared to conventional detection oligonucleotides, thereby increasing the assay signal.

[0244] The improved detection oligonucleotides were synthesized and purified by FPLC prior to use in the assays described herein. For FPLC, a HiTrap Q HP 1 mL anion exchange column was used with an AKTA™ PURE 25 system. Two gradients were tested: Method 1—0 to 800 mM NaCl gradient; Method 2—400 to 700 mM NaCl gradient. Elution fractions were analyzed on a 15% urea-TEB gel using an IDT 20 / 100 DNA ladder and then visualized with SYBR Gold stain.

[0245] The improved detection oligonucleotides were used in a comparative assay to conventional detection oligonucleotides according to a simplified version of the protocol described in Example 1. In this simplified protocol, instead of using a biotinylated capture antibody that attaches to a streptavidin-coated plate surface to form a sandwich complex (which includes the capture antibody, the target analyte, and the detection antibody conjugated to the nucleic acid primer), biotinylated nucleic acid primer oligonucleotides were used, e.g., at 10 per well. 6 The primer oligonucleotides of the molecule were attached directly to a streptavidin-coated surface at a concentration of 33 fM. Figure 2A shows representative results of comparative assays performed with a conventional detection oligonucleotide 23 nucleotides in length, without any modified nucleic acid (labeled "DNA-23" in Figure 2A), and with an improved detection oligonucleotide according to the present invention 10 nucleotides in length, containing six LNAs (labeled "LNA-10 / 6" in Figure 2A). Each of the two detection oligonucleotides was added at a concentration of 6.25 nM either during the extension step ("combined" format) or in a separate step after extension ("separate" format). The results show that the improved detection oligonucleotide provided a higher assay signal in both the separate and combined formats.

[0246] Figure 2B shows representative results of a further comparison between a conventional 23-nucleotide detection oligonucleotide (labeled "Detect23" in Figure 2B) and an improved detection oligonucleotide according to the present invention, which comprises a length of 10 nucleotides and contains five LNAs (labeled "Detect10+5L(A)" in Figure 2B). The signal to nonspecific background (NSB) ratio was significantly better in both the "combined" and "separate" formats for the improved detection oligonucleotide compared to the conventional detection oligonucleotide.

[0247] The sequences of the detection oligonucleotides are provided below (shown with modifiers for conjugation to a detectable label). Each oligonucleotide was conjugated with three SULFO-TAG®-NHS.

[0248] Sequences of detection oligonucleotides used in this example: 23-nucleotide conventional detection oligonucleotide (DNA-23 or Detect23): CAGTGAATGCGAGTCCGTCTAAG / iAmMC6T / iSp18 / iAmMC6T / iSp18 / 3AmMO / (SEQ ID NO: 19) 10-nucleotide detection oligonucleotide with 6 LNAs (LNA-10 / 6): G+A+G+T+C+C+GTCT / iAmMC6T / iSp18 / iAmMC6T / iSp18 / 3AmMO / (SEQ ID NO: 14) 10-nucleotide detection oligonucleotide with 5 LNAs (Detect10+5L(A)): G+A+G+T+C+CGTCT / iAmMC6T / iSp18 / iAmMC6T / iSp18 / 3AmMO / (SEQ ID NO: 15)

[0249] Benchmark assays comparing detection oligonucleotides with various combinations of LNA and / or 2'-OMe nucleotides demonstrated that the inclusion of 2'-OMe nucleotides aids in reducing interference between the polymerase and the detection oligonucleotides in the reaction mixture. The results of the benchmark assays are shown in Figure 12. The detection oligonucleotides and template oligonucleotides depicted in Figure 12 are as follows: D10A+5L: 10 nucleotide (nt) detector oligonucleotide with 5 LNAs; used with a 61 nt template D10A+5L5OM: 10 nt detection oligonucleotide with 5 LNA and 5 2'-OMe nucleotides; used with 61 nt template D10A+5L-58A: 10 nt detection oligonucleotide with 5 LNAs; used with 58 nt template D10A+5L5OM-58A: 10 nt detection oligonucleotide with 5 LNA and 5 2'-OMe nucleotides; used with 58 nt template D10A+5L / D10B+6L: a mixture of D10A+5L and D10B+6L; used with a 61 nt template D10A+5L5OM / D10B+6L: a mixture of D10A+5L5OM and D10B+6L; used with a 61 nt template

[0250] Assays performed with the D10A+5L-58A and D10A+5L5OM-58A detection oligonucleotides utilized a 58 nt template oligonucleotide containing three copies of the D10A sequence, while assays performed with the D10A+5L, D10A+5L5OM, D10A+5L / D10B+6L, and D10A+5L5OM / D10B+6L detection oligonucleotides utilized a 61 nt template oligonucleotide containing one copy of the D10A sequence and only one copy of the "D10B" sequence. As shown in Figure 12, D10A+5L5OM (containing 2'-OMe nucleotides) had a higher signal / nonspecific binding (NSB) ratio than D10A+5L (without 2'-OMe nucleotides), and D10A+5L5OM / D10B+6L (containing 2'-OMe nucleotides) had a higher signal / NSB ratio than D10A+5L / D10B+6L (without 2'-OMe nucleotides) for all detection oligonucleotide concentrations tested. When D10A+5L was tested with a 58-nt template ("D10A+5L-58A"), the signal / NSB ratio dependence on detection oligonucleotide concentration was similar to that observed with the 61-nt template, with a gradual decrease in the ratio with increasing detection concentration, likely due to increased interference with the polymerase. When D10A+5L5OM5L was tested with a 58-nt template ("D10A+5L5OM-58A"), both the signal and signal / NSB ratio increased with increasing detection oligonucleotide concentration, demonstrating reduced interference with the polymerase compared to D10A+5L. However, with the 58-nt template oligonucleotide, the signal and signal / NSB ratio were lower for D10A+5L5OM at 6.2 and 19 nM concentrations of detection oligonucleotide, and were higher only at a 56 nM detection oligonucleotide concentration compared to D10A+5L at the same concentration. Sequence differences between the 58-nt and 61-nt templates and the presence of a triple repeat sequence in the 58-nt template likely contributed to the observed differences in signal and signal / NSB ratio between the two templates tested with similar pairs of detection oligonucleotides.

[0251] Example 3. Cleavage of template oligonucleotide Termination of the extension reaction in the assay described herein by cleaving the template oligonucleotide was tested for assay endpoint stability and robustness to variations in time and temperature.

[0252] The following restriction enzymes with different types and lengths of recognition sites were evaluated: AvaII, BstMutI, DdeI, HinfI, Hpy188I, NciI, Sau96I, ScrFI, TspRI (5 nt); AluI, BfaI, CviAII, CviKI01, CviQI, DpnII, FatI, HpaII, HpyCH4IV, MboI, MluCI, MseI, MspI, NlaIII, RsaI, Sau3AI, TaqI-v2 (4 nt); and StuI, ApoI, AseI, AvaI, BsaAI, BsmI, BsrI, PmlI, PvuI, SmaI, XmaI (6 nt).

[0253] The restriction enzymes DdeI, AluI, HpaII, and StuI were tested in a simplified assay protocol as described in Example 2. The assay additionally used a 58-nucleotide template oligonucleotide with a DdeI, HpaII, or AluI restriction site and a 59-nucleotide template oligonucleotide with a StuI restriction site. Amplification was performed for 1 hour at 27°C using Phi29 polymerase (0.5 μg / mL). 6.25 nM of Detect10+5L(A) detection oligonucleotide and DdeI, HpaII, AluI, or StuI were added at the same time as the polymerase. Amplification was stopped at each time point by the addition of PBS with 10 mM EDTA. ECL assay signals were generated using MSD® Read Buffer A. Results are shown in Figures 3A-3D for DdeI, HpaII, AluI, and StuI, respectively. All restriction enzymes except StuI demonstrated clear ability to terminate the assay.

[0254] Further experiments were performed using DdeI cleavage of the template oligonucleotide to generate a calibration curve and measure termination kinetics. For the calibration curve, the same assay as above was performed with a 61-nucleotide template oligonucleotide, 0-0.3 U / well DdeI, at 27°C for 0.5 hours. The calibration curve is shown in Figure 4 and demonstrates that the termination rate was not affected by the Hill slope, which remained stable with varying DdeI concentrations.

[0255] To measure termination kinetics, the same assay as above was performed at 20°C, 23.5°C, and 27°C using a 58-nucleotide template oligonucleotide with 0, 0.005, or 0.05 U / well DdeI for time points up to 180 minutes. The termination kinetics data in Figure 5 show that in the presence of restriction enzyme, as opposed to the "no enzyme" condition, there are time points at which signal intensity is similar for all three temperatures tested. The time at which signals are equivalent at different temperatures is dependent on the DdeI concentration. For a DdeI concentration of 0.005 U / well, similar signals could be achieved around the 120-minute time point for all three conditions: 20°C, 23.5°C, and 27°C, while for a DdeI concentration of 0.05 U / well, equivalent signals could be reached around the 60-minute time point. This observation suggests that there is a time window at different enzyme concentrations where signal generation is not temperature-dependent.

[0256] Temperature-independent signal generation could be achieved using specific enzyme concentrations in the amplification step. Figure 6A shows a significant signal dependence on temperature in the absence of enzyme, with the signal varying from approximately 60,000 ECL at 20°C to 150,000 ECL at 23.5°C and 300,000 ECL at 27°C. In the presence of 0.5 U / well of ApoI, the signal remained within 45,000–50,000 ECL at all three temperatures. Figure 6B shows the same results, with the signal normalized to 1 hour at 27°C. While the signal varied from 20 to 100% without termination, with ApoI in the reaction mixture, the overall signal difference between temperatures remained within the 80–120% interval.

[0257] Termination of the amplification reaction by template cleavage also contributes toward achieving time-independent signal generation. Amplification reactions were tested at three different temperatures, 20°C, 23.5°C, and 27°C, in the presence and absence of enzyme (exemplary results with TspRI are shown in Figures 7A-7C), and signal generation was measured at several time points: 45, 60, 75, and 90 minutes. The results demonstrate that at all temperatures tested, signal generation is less time-dependent with termination compared to amplification without termination. Examples of amplification results generated at 23.5°C are shown in Figures 7A and 7B: no signal difference was observed at 45 minutes compared to the 60-minute time point with TspRI termination, and an approximately 30% difference was observed between the 45- and 60-minute time points in the absence of enzyme. Additionally, signal changes of 13% vs. 33% and 43% vs. 55% were observed at the 75- and 90-minute time points for terminated vs. non-terminated reactions, respectively. A "full" version of the two-antibody sandwich immunoassay (with IL-5 as the analyte) according to Example 1 was performed at 23.3°C on MSD® streptavidin-coated plates with and without TspRI termination (Figure 7C). Results using the simplified immunoassay described in Example 2 (Figure 7B) and the full version of the immunoassay (Figure 7C) were similar, confirming the improved signal independence of time with termination compared to no termination.

[0258] Example 4. Improved anchor oligonucleotides Shorter anchor oligonucleotides can reduce assay development complexity compared to longer anchor oligonucleotides. Thus, anchor reagents including 12-nucleotide long anchor oligonucleotides ("12-mers," e.g., designated A12 in Figures 8A and 8B) and 9-mer oligonucleotides with locked nucleic acids (LNAs) and / or 2'-O-methylated (2'-OMe or OM) nucleic acids (e.g., designated A9 in Figures 8-11) were tested in assays against longer, conventional anchor oligonucleotides 25 nucleotides in length, as described in Example 2.

[0259] Figure 8A shows that shorter anchor oligonucleotides were found to reduce background signal when used at the same concentration as longer oligonucleotides. However, as shown in Figure 8B, a higher coating concentration was required for shorter anchor oligonucleotides, which increased background. In Figure 8A, ECL signal is shown on the y-axis of the graph, and various anchor oligonucleotides are displayed on the x-axis. "IL-4 only" indicates the assay without anchor oligonucleotides, while "A12-300" and "A25-300" represent 12-mer and 25-mer anchor oligonucleotides without any modified nucleotides at a concentration of 300 nM, respectively. LNA9-1-300, LNA9-2-300, etc. represent anchor oligonucleotides that are 9 nucleotides in length and have one or two locked bases, respectively. It was discovered that incorporation of locked nucleic acids and / or 2'-O-methylated (2'-OMe) nucleic acids into the anchor oligonucleotide reduced the required coating concentration, further reducing background (Figures 8A and 8B).

[0260] Anchor oligonucleotides were immobilized on the surface via binding of a biotin moiety on the anchor oligonucleotide to streptavidin on the surface or by conjugation to the surface via a thiol moiety on the anchor oligonucleotide. Anchor oligonucleotides containing a thiol moiety further contained a PEG spacer between the anchor oligonucleotide and the thiol group. Results for modified short anchors are shown in Figure 9A, and for longer 25-mer oligonucleotides in Figure 9B. Figures 9A-9B show the stabilization of ECL signal, expressed as the percentage of ECL signal retained, as the washer speed increases. In Figure 9A, the shorter A9+3L6OM anchor, containing LNA and 2'-OMe bases, demonstrated similar stability to the A25 DNA-based anchor in Figure 9B.

[0261] Sample matrix interference was reduced when using short, modified anchor oligonucleotides compared to longer, conventional anchor oligonucleotides. This reduction in sample matrix interference was a reduction in both the average nonspecific signal and the range of nonspecific signals across the samples (Figures 10A and 10B). This lower average and range of nonspecific signals within a sample set allows for improved real-world sample sensitivity. The background and variability of human samples on surfaces with longer conventional anchors and short modified anchors immobilized on the surface via attachment of a biotin moiety are shown in Figure 10A, and with anchors immobilized via a thiol moiety in Table 10B.

[0262] Example 5. Combination of modified anchor oligonucleotide, modified detection oligonucleotide, and template oligonucleotide cleavage As described in Examples 2-4, improved anchor oligonucleotides comprising LNA and 2'-OMe modified nucleic acids, improved detection oligonucleotides comprising LNA, and template oligonucleotide cleavage with DdeI were tested individually and in combination for assay wash stability.

[0263] Figure 11A shows representative results of washout stability in a standard sandwich immunoassay mediated by different anchor oligonucleotides (anchors), including a conventional 25-mer anchor (A25), a modified 9-mer anchor with three LNAs and six 2'-OMe nucleotides (A9+3L6OM), and a modified 9-mer anchor with four LNAs (A9+4L), each immobilized on a surface via attachment of a biotin moiety. Four different immunoassays were tested using different anchors and conventional detection oligonucleotides, and the results were averaged for all four assays. The modified anchor oligonucleotides showed improved wash stability compared to the conventional anchor oligonucleotides.

[0264] Figure 11B shows representative results for a conventional anchored 25-mer oligonucleotide without modification, as described herein, with a conventional detection oligonucleotide ("D23"), or with a mixture of a modified detection oligonucleotide containing five LNAs and five 2'-OMe modified nucleic acids ("D10A") and a modified detection oligonucleotide containing six LNAs and no 2'-OMe modified nucleic acids ("D10B") (the mixture labeled "D10A+10B"), where various concentrations of primer oligonucleotide were used in a simplified version of the sandwich assay. The modified detection oligonucleotides showed improved wash stability compared to the conventional detection oligonucleotides.

[0265] Figure 11C shows representative results for anchor oligonucleotides containing nine nucleotides, three of which are LNA, and six of which are 2'-OMe nucleotides, along with D23 or D10A+D10B detection oligonucleotides. The modified detection oligonucleotides showed improved wash stability compared to conventional detection oligonucleotides.

[0266] Figure 11D shows representative results of an assay performed with template oligonucleotide cleavage, using two concentrations of DdeI and two concentrations of primer oligonucleotides, and the D10A+D10B detection oligonucleotides used in a simplified version of the sandwich assay described in Example 2. All four conditions showed comparable wash stability, which was significantly improved compared to the condition without termination by template cleavage (Figure 11C).

[0267] Figure 11E shows representative results of a two-antibody sandwich immunoassay according to embodiments herein performed on an MSD® streptavidin-coated plate using conventional anchor and detector oligonucleotides (AVR 1.0) compared with modified anchor oligonucleotides (A9+3L6OM) immobilized to the surface via thiol moieties, modified detector oligonucleotides (D10A+D10B), and template oligonucleotide cleavage with TspRI (AVR 2.0 TspRI). The signals generated from the 12 assays were normalized and averaged for each reagent combination, and the results show significant improvements in wash stability and template cleavage termination with the new modified oligonucleotides compared to conventional oligonucleotides without termination.

[0268] Example 6. Single-stranded oligonucleotide (SSO) stabilizers during extension To test the effect of SSO stabilizers during extension reactions, an extremely thermostable single-stranded DNA binding protein (ET SSB) was added in a benchmark assay based on the simplified assay, as described in Example 2. A primer concentration corresponding to 500,000 molecules per well was used. Extension reactions were carried out for 1 hour, 4 hours, or 24 hours using Phi29 in a combined format with the "D10A+5L" detection oligonucleotide, as described in Example 2. ET SSB was added to the plate either before or after the polymerase.

[0269] When SSB was added before the polymerase, signal recovery was observed from 4 hours to 24 hours with 31.25 ng / mL ET SSB, but the 24-hour signal did not exceed the 4-hour signal. See Figure 13, top panel. Higher concentrations of ET SSB appear to inhibit polymerase activity. When ET SSB was added after the polymerase, the signal at 24 hours exceeded the signal at 4 hours with 125 ng / mL ET SSB. See Figure 13, bottom panel.

[0270] Further benchmark assays with 100,000 primers per well were performed using different concentrations of ET SSB. Extension reactions were performed using Phi29 in a combined format with "D10A+5L" for 1 hour, 4 hours, or 24 hours. ET SSB was added to the assay at 0, 5, 15, or 60 minutes after polymerase.

[0271] Under these assay conditions, addition of ET SSB 15 minutes after the start of the extension reaction resulted in the strongest signal recovery, as shown in Figure 14. Furthermore, addition of ET SSB 15 minutes after the start of the extension reaction increased the signal by 2.8-fold (Figure 15) and 47% (Figure 16) at 24 hours compared to 4 hours of amplification.

Claims

1. 1. A method for detecting an analyte, comprising: (a) contacting a template oligonucleotide with a first complex comprising: (1) the analyte; and (2) a detection reagent that binds to the analyte, wherein the detection reagent comprises a nucleic acid primer; (b) hybridizing the nucleic acid primer to the template oligonucleotide to form a second complex, and extending the nucleic acid primer with a polymerase, thereby forming an extended oligonucleotide; (c) binding the extender oligonucleotide to one or more labeled probes, each of which comprises: (1) a detection oligonucleotide capable of binding to the extender oligonucleotide; and (2) a detectable label; and (d) detecting the detectable label, thereby detecting the analyte; The second complex is bound to a surface, and: (i) the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; (ii) the method further comprises terminating the extension by cleaving the template oligonucleotide; (iii) a combination of (i) and (ii); (iv) one or both of (i) and (ii), further wherein the surface comprises an anchoring reagent; (v) the surface comprises an anchoring reagent comprising an anchoring oligonucleotide, the anchoring oligonucleotide comprising a modified nucleic acid; or (vi) any combination of (i), (ii), and (v).

2. 10. The method of claim 1, wherein the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof.

3. 3. The method of claim 1 or claim 2, wherein the modified nucleic acid comprises a peptide nucleic acid (PNA), a locked nucleic acid (LNA), a bridged nucleic acid (BNA), a nucleoside containing a 2' modification, or a combination thereof.

4. 4. The method of claim 3, wherein the nucleoside comprising the 2' modification comprises a 2'-O-methyl modification (2'-OMe), a 2'-O-methoxyethyl modification (2'-MOE), a 2'-deoxy-2'-fluoro modification (2'-F), a 2'-hydroxyl modification (2'-OH), or a combination thereof.

5. The method of any one of claims 1 to 4, wherein the detection oligonucleotide is from about 4 to about 30 nucleotides in length.

6. The method of claim 5, wherein the detection oligonucleotide is from about 5 to about 25 nucleotides in length.

7. The method of claim 6, wherein the detection oligonucleotide is about 6 to about 12 nucleotides in length.

8. The method of any one of claims 1 to 7, wherein the detection oligonucleotides consist of modified nucleic acids, each modified nucleic acid comprising a PNA, an LNA, a BNA, a nucleoside containing a 2' modification, or a combination thereof.

9. The method of any one of claims 1 to 8, wherein the polymerase comprises strand displacement activity (SD polymerase).

10. 10. The method of claim 9, wherein the SD polymerase comprises an amino acid sequence of at least 80% sequence identity to a DNA polymerase from a bacteriophage, and the bacteriophage is Phi29, Nf, Karezi, or BeachBum.

11. 11. The method of claim 10, wherein the SD polymerase comprises an amino acid sequence that has at least 90% sequence identity to a DNA polymerase from a bacteriophage, and the bacteriophage is Phi29, Nf, Karezi, or BeachBum.

12. 12. The method of claim 11, wherein the SD polymerase is a DNA polymerase from a bacteriophage, and the bacteriophage is Phi29, Nf, Zaresi, or BeachBum.

13. 13. The method of any one of claims 1 to 12, wherein the template oligonucleotide is a linear oligonucleotide, and the method comprises ligating the 5' and 3' ends of the linear oligonucleotide before, during, or after hybridization of the nucleic acid primer to the template oligonucleotide, thereby forming a circular template.

14. 14. The method of claim 1, wherein step (b) comprises hybridizing the nucleic acid primer to the template oligonucleotide and extending the nucleic acid primer by a nicking and extension amplification reaction (NEAR).

15. 14. The method of any one of claims 1 to 13, wherein step (b) comprises hybridizing the nucleic acid primer to the template oligonucleotide, ligating the template oligonucleotide to form a circular template, and extending the nucleic acid primer by rolling circle amplification (RCA).

16. The method of any one of claims 1 to 15, wherein the method further comprises terminating the extension by cleaving the template oligonucleotide.

17. The method of any one of claims 1 to 16, wherein the cleaving comprises contacting a nuclease with the template oligonucleotide.

18. 18. The method of claim 17, wherein the nuclease specifically cleaves the double-stranded portion of the template oligonucleotide hybridized to the nucleic acid primer.

19. 19. The method of claim 18, wherein the nuclease specifically cleaves a DNA / RNA hybrid formed from hybridization of the template oligonucleotide and the nucleic acid primer.

20. The method of any one of claims 17 to 19, wherein the nuclease is a restriction endonuclease.

21. 21. The method of claim 20, wherein the nuclease is DdeI, AluI, HpaII, ApoI, DpnI, DpnII, ScrFI, MboI, MluCI, AseI, TaqI, TspRI, or a combination thereof.

22. 20. The method of claim 19, wherein the nuclease is an endoribonuclease, optionally RNase H2.

23. 18. The method of claim 17, wherein the template oligonucleotide comprises a DNA damage indicator, and the nuclease comprises an excision enzyme that specifically binds to the DNA damage indicator and cleaves the template oligonucleotide.

24. 24. The method of claim 23, wherein the DNA damage indicator comprises a uracil base and the nuclease comprises uracil-N-glycosylase (UNG).

25. 25. The method of claim 24, wherein said cleaving further comprises providing an abasic site endonuclease.

26. 26. The method of claim 25, wherein the abasic site endonuclease comprises uracil-DNA glycosylase (UDG), APE1, endonuclease IV, or a combination thereof.

27. 24. The method of claim 23, wherein the DNA damage indicator comprises deoxyinosine and the nuclease comprises endonuclease V.

28. 24. The method of claim 23, wherein the DNA damage indicator comprises a damaged purine and the nuclease comprises an enzyme that repairs the damaged purine.

29. 29. The method of claim 28, wherein the damaged purine comprises 8oxoG and the nuclease comprises formamidopyrimidine DNA glycosylase (Fpg).

30. 30. The method of any one of claims 1 to 29, wherein the extension comprises rolling circle amplification (RCA) and the method, when it comprises termination, produces an assay signal range that does not vary by more than two-fold over an assay temperature range of about 20°C to about 27°C.

31. 31. The method of claim 30, wherein the assay signal range does not vary by more than 1.5-fold over the assay temperature range of about 20°C to about 27°C.

32. 32. The method of any one of claims 1 to 31, wherein the extension comprises rolling circle amplification (RCA) and the method, if it comprises termination, has an assay signal range produced by the method that does not vary by more than ±50% over an assay temperature range of about 20°C to about 27°C.

33. 33. The method of claim 32, wherein the assay signal range does not vary by more than ±30% over the assay temperature range of about 20°C to about 27°C.

34. 34. The method of any one of claims 1 to 33, wherein the extension comprises rolling circle amplification (RCA), and wherein, if the method comprises termination, the assay signal range produced by the method does not vary by more than two-fold over an extension time range of about 5 to about 90 minutes.

35. 35. The method of claim 34, wherein the assay signal range does not vary more than two-fold over the extension time range of about 45 to about 90 minutes.

36. 35. The method of claim 34, wherein the assay signal range does not vary more than two-fold over the extension time range of about 30 to about 60 minutes.

37. 35. The method of claim 34, wherein the assay signal range does not vary more than two-fold over the extension time range of about 15 to about 30 minutes.

38. 35. The method of claim 34, wherein the assay signal range does not vary more than two-fold over the extension time range of about 10 to about 20 minutes.

39. 35. The method of claim 34, wherein the assay signal range does not vary more than two-fold over the extension time range of about 5 to about 10 minutes.

40. 40. The method of any one of claims 1 to 39, wherein the extension comprises rolling circle amplification (RCA), and wherein the method comprises termination, and wherein the extension oligonucleotide is from about 500 to about 50,000 bases in length.

41. 41. The method of claim 40, wherein the extend oligonucleotide is from about 9,000 to about 40,000 bases in length.

42. 41. The method of claim 40, wherein the extend oligonucleotide is from about 3,000 to about 13,000 bases in length.

43. 41. The method of claim 40, wherein the extend oligonucleotide is from about 1,000 to about 4,500 bases in length.

44. 40. The method of any one of claims 1 to 39, wherein the extension comprises rolling circle amplification (RCA), and when the method includes a termination, the extended oligonucleotide comprises from about 5% to about 35% of the length of an extended oligonucleotide formed by a substantially identical method that does not include a termination.

45. 45. The method of claim 44, wherein the extended oligonucleotide comprises from about 6% to about 32% of the length of an extended oligonucleotide formed by substantially the same method but without the termination.

46. 45. The method of claim 44, wherein the extended oligonucleotide comprises from about 1% to about 10% of the length of an extended oligonucleotide formed by substantially the same method but without the termination.

47. 47. The method of any one of claims 40 to 46, wherein the RCA is carried out at about 20°C to about 27°C.

48. 48. The method of any one of claims 30 to 47, wherein the terminating comprises providing a nuclease to the template oligonucleotide, wherein the nuclease is DdeI, AluI, HpaII, ApoI, DpnI, DpnII, ScrFI, MboI, MluCI, AseI, TaqI, TspRI, or a combination thereof.

49. The method of any one of claims 1 to 48, wherein the surface does not comprise an anchoring reagent.

50. 50. The method of any one of claims 1 to 49, wherein the surface comprises an anchoring reagent.

51. 51. The method of claim 50, wherein the anchor reagent comprises an anchor oligonucleotide.

52. 52. The method of claim 51 , wherein the anchor oligonucleotide comprises a modified nucleic acid.

53. 53. The method of claim 52, wherein the modified nucleic acid comprises a PNA, an LNA, a BNA, a nucleoside containing a 2' modification, or a combination thereof.

54. 54. The method of claim 53, wherein the nucleoside comprising a 2'-modification comprises a 2'-O-methyl modification (2'-OMe), a 2'-O-methoxyethyl modification (2'-MOE), a 2'-deoxy-2'-fluoro modification (2'-F), a 2'-hydroxyl modification (2'-OH), or a combination thereof.

55. 55. The method of any one of claims 50-54, wherein the extend oligonucleotide comprises an anchor complement capable of binding to the anchor oligonucleotide, and the method further comprises binding the extend oligonucleotide to the anchor reagent.

56. 56. The method of claim 55, wherein the extend oligonucleotide is attached to the anchor reagent before or during step (c) of the method.

57. 57. The method of any one of claims 51 to 56, wherein the anchor oligonucleotide is from about 4 to about 30 nucleotides in length.

58. 58. The method of claim 57, wherein the anchor oligonucleotide is from about 6 to about 25 nucleotides in length.

59. 59. The method of claim 58, wherein the anchor oligonucleotide is about 8 to about 12 nucleotides in length.

60. 60. The method of any one of claims 50 to 59, wherein the anchor oligonucleotides are comprised of modified nucleic acids, each modified nucleic acid comprising a PNA, an LNA, a BNA, a nucleoside comprising a 2' modification, or a combination thereof.

61. 61. The method of any one of claims 50 to 60, wherein the surface comprises a carbon composite and the anchoring reagent is covalently immobilized on the surface.

62. 62. The method of any one of claims 50 to 61, wherein the anchor reagent comprises a first binding partner, the surface comprises a second binding partner, and the anchor reagent is immobilized on the surface via interaction of the first and second binding partners.

63. 63. The method of claim 62, wherein the first and second binding partners comprise a binding pair selected from a cross-reactive group, a complementary oligonucleotide, a receptor-ligand pair, an antigen-antibody pair, a hapten-antibody pair, an epitope-antibody pair, a mimotope-antibody pair, an aptamer-target molecule pair, a hybridization partner, or an intercalator-target molecule pair.

64. 64. The method of claim 63, wherein the first binding partner comprises biotin and the second binding partner comprises streptavidin, avidin, an anti-biotin antibody, or a combination thereof.

65. 65. The method of any one of claims 62 to 64, wherein the first binding partner is linked to a nucleotide of the anchor oligonucleotide.

66. 66. The method of any one of claims 62 to 65, wherein the first binding partner is located at the 5' or 3' end of the anchor reagent.

67. 67. The method of claim 66, wherein the anchor reagent further comprises a spacer positioned between the first binding partner and the anchor oligonucleotide.

68. 68. The method of claim 67, wherein the spacer comprises polyethylene glycol (PEG) containing from about 2 to about 10 ethylene glycol units.

69. 69. The method of claim 68, wherein the PEG comprises from about 3 to about 8 ethylene glycol units.

70. 70. The method of any one of claims 62 to 69, wherein the first binding partner is positioned at the 3' end of the anchor reagent, and the anchor reagent comprises a PEG spacer comprising from about 3 to about 8 ethylene glycol units.

71. 71. The method of any one of claims 1 to 70, wherein the first complex further comprises a capture reagent that binds to the analyte, and wherein the first complex is formed before or during step (a) by contacting a sample containing the analyte with the first capture reagent and the second detection reagent.

72. 71. The method of any one of claims 1 to 70, wherein the first complex further comprises a capture reagent that binds to the analyte, and wherein the first complex is formed before or during step (a) by contacting a sample containing the analyte with the first detection reagent and the second capture reagent.

73. 71. The method of any one of claims 1 to 70, wherein the first complex further comprises a capture reagent that binds to the analyte, and wherein the first complex is formed before or during step (a) by contacting a sample containing the analyte with the capture reagent and the detection reagent simultaneously or substantially simultaneously.

74. 74. The method of any one of claims 1 to 73, wherein the first complex and / or the second complex are contacted with the polymerase and the labeled probe simultaneously or substantially simultaneously.

75. 75. The method of any one of claims 17 to 74, wherein the first complex and / or the second complex are contacted with the polymerase, the labeled probe, and the nuclease simultaneously or substantially simultaneously.

76. (i) the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; and (ii) the method comprises terminating the extension by cleaving the template oligonucleotide; 76. The method of any one of claims 1 to 75, optionally wherein the surface comprises an anchoring reagent.

77. (i) the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; and (ii) the surface comprises an anchoring reagent.

78. (i) the method includes terminating the extension by cleaving the template oligonucleotide; and (ii) the surface comprises an anchoring reagent.

79. 79. The method of any one of claims 76 to 78, wherein the anchor reagent comprises an anchor oligonucleotide, and the anchor oligonucleotide comprises a modified nucleic acid.

80. (i) the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; (ii) the method includes terminating the extension by cleaving the template oligonucleotide; and (iii) the surface comprises an anchoring reagent comprising an anchor oligonucleotide, and the anchor oligonucleotide comprises a modified nucleic acid.

81. 81. The method of any one of claims 1 to 80, wherein the anchor oligonucleotide comprises SEQ ID NO:

11.

82. 82. The method of any one of claims 1 to 81, wherein the detection oligonucleotide comprises any one of SEQ ID NOs: 7 to 10.

83. 83. The method of any one of claims 1 to 82, wherein the nucleic acid primer comprises SEQ ID NO:

1.

84. 84. The method of any one of claims 1 to 83, wherein the template oligonucleotide comprises SEQ ID NO:

5.

85. 85. The method of any one of claims 1 to 84, wherein the first complex further comprises a capture reagent that binds to the analyte, and wherein the capture reagent and the detection reagent each independently comprise an antibody or antigen-binding fragment thereof, an oligonucleotide, an antigen, a ligand, a receptor, a hapten, an epitope, a mimotope, or an aptamer.

86. 86. The method of claim 85, wherein the capture reagent and the detection reagent each comprise an antibody or an antigen-binding fragment thereof.

87. 86. The method of claim 85, wherein the capture reagent and the detection reagent each comprise an oligonucleotide.

88. 88. The method of any one of claims 1 to 87, wherein the detectable label is measurable by light scattering, optical absorbance, fluorescence, chemiluminescence, electrochemiluminescence (ECL), bioluminescence, phosphorescence, radioactivity, magnetic field, or a combination thereof.

89. 89. The method of claim 88, wherein the detectable label is an ECL label.

90. The method of any one of claims 1 to 89, wherein the surface comprises particles.

91. 90. The method of any one of claims 1 to 89, wherein the surface comprises a well of a multi-well plate.

92. The method of any one of claims 1 to 91, wherein the surface comprises an electrode.

93. 92. The method of claim 91, wherein said detecting comprises applying a voltage waveform to said electrodes to generate an ECL signal.

94. 91. The method of claim 90, wherein said detecting comprises collecting said particles on an electrode and applying a voltage waveform to said electrode to generate an ECL signal.

95. 1. A kit for detecting an analyte, comprising in one or more vials, containers, or compartments: (a) a capture reagent that binds to the analyte; (b) a detection reagent that binds to the analyte, the detection reagent comprising or capable of being linked to a nucleic acid primer; (c) (1) a detection oligonucleotide and (2) a label probe comprising a detectable label; and (d) a template oligonucleotide capable of hybridizing to the nucleic acid primer and comprising the same sequence as the detection oligonucleotide; The detection reagent comprises a protein or polypeptide, and: (i) the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; (ii) the kit further comprises a nuclease capable of cleaving the template oligonucleotide; (iii) a combination of (i) and (ii); (iv) one or both of (i) and (ii), and the kit further comprises an anchoring reagent; (v) the kit further comprises an anchor reagent comprising an anchor oligonucleotide, wherein the anchor oligonucleotide comprises a modified nucleic acid; or (vi) A kit comprising any combination of (i), (ii), and (v).

96. 96. The kit of claim 95, wherein the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof.

97. 97. The kit of claim 95 or claim 96, wherein the modified nucleic acid comprises a PNA, an LNA, a BNA, a nucleoside containing a 2' modification, or a combination thereof.

98. 98. The kit of claim 97, wherein the nucleoside comprising a 2'-modification comprises a 2'-O-methyl modification (2'-OMe), a 2'-O-methoxyethyl modification (2'-MOE), a 2'-deoxy-2'-fluoro modification (2'-F), a 2'-hydroxyl modification (2'-OH), or a combination thereof.

99. 99. The kit of any one of claims 95 to 98, wherein the detection oligonucleotides are from about 4 to about 30 nucleotides in length.

100. 100. The kit of claim 99, wherein the detection oligonucleotides are from about 5 to about 25 nucleotides in length.

101. 101. The kit of claim 100, wherein the detection oligonucleotides are from about 6 to about 12 nucleotides in length.

102. 102. The kit of any one of claims 95 to 101, wherein the detection oligonucleotides consist of modified nucleic acids, each modified nucleic acid comprising a PNA, an LNA, a BNA, a nucleoside comprising a 2' modification, or a combination thereof.

103. The kit of any one of claims 95 to 102, further comprising a polymerase.

104. 104. The kit of claim 103, wherein the polymerase comprises strand displacement activity (SD polymerase).

105. 105. The kit of claim 104, wherein the SD polymerase comprises an amino acid sequence of at least 80% sequence identity to a DNA polymerase from a bacteriophage, and the bacteriophage is Phi29, Nf, Karezi, or BeachBum.

106. 106. The kit of claim 105, wherein the SD polymerase comprises an amino acid sequence of at least 90% sequence identity to a DNA polymerase from a bacteriophage, and the bacteriophage is Phi29, Nf, Karezi, or BeachBum.

107. 107. The kit of claim 106, wherein the SD polymerase is a DNA polymerase from a bacteriophage, and the bacteriophage is Phi29, Nf, Zaresi, or BeachBum.

108. 108. The kit of any one of claims 95 to 107, wherein the template oligonucleotide is a linear oligonucleotide, the 5' end and 3' end of the linear oligonucleotide being capable of ligation.

109. The kit of any one of claims 95 to 108, wherein the kit comprises the nuclease.

110. 110. The kit of claim 109, wherein the nuclease specifically cleaves the double-stranded portion of the template oligonucleotide that is capable of hybridizing to the nucleic acid primer.

111. 111. The kit of claim 110, wherein the template oligonucleotide is capable of hybridizing to the nucleic acid primer, and the nuclease specifically cleaves a DNA / RNA hybrid formed from hybridization of the template oligonucleotide and the nucleic acid primer.

112. The kit of any one of claims 109 to 111, wherein the nuclease is a restriction endonuclease.

113. 113. The kit of claim 112, wherein the nuclease is DdeI, AluI, HpaII, ApoI, DpnI, DpnII, ScrFI, MboI, MluCI, AseI, TaqI, TspRI, or a combination thereof.

114. 112. The kit of claim 111, wherein the nuclease is an endoribonuclease, optionally RNase H2.

115. 110. The kit of claim 109, wherein the template oligonucleotide comprises a DNA damage indicator, and the nuclease comprises an excision enzyme that specifically binds to the DNA damage indicator.

116. 116. The kit of claim 115, wherein the DNA damage indicator comprises a uracil base and the nuclease comprises uracil-N-glycosylase (UNG).

117. 117. The kit of claim 116, further comprising an abasic endonuclease.

118. 118. The kit of claim 117, wherein the abasic site endonuclease comprises uracil-DNA glycosylase (UDG), APE1, endonuclease IV, or a combination thereof.

119. 116. The kit of claim 115, wherein the DNA damage indicator comprises deoxyinosine and the nuclease comprises endonuclease V.

120. 116. The kit of claim 115, wherein the DNA damage indicator comprises a damaged purine and the nuclease comprises an enzyme that repairs the damaged purine.

121. 121. The kit of claim 120, wherein the damaged purine comprises 8oxoG and the template cleavage enzyme comprises formamidopyrimidine DNA glycosylase (Fpg).

122. The kit of any one of claims 95 to 121, wherein the kit comprises an anchoring reagent.

123. 123. The kit of claim 122, wherein the anchor reagent comprises an anchor oligonucleotide.

124. 124. The kit of claim 123, wherein the anchor oligonucleotide comprises a modified nucleic acid.

125. 125. The kit of claim 124, wherein the modified nucleic acid comprises a PNA, an LNA, a BNA, a nucleoside containing a 2' modification, or a combination thereof.

126. 126. The kit of claim 125, wherein the nucleoside comprising a 2'-modification comprises a 2'-O-methyl modification (2'-OMe), a 2'-O-methoxyethyl modification (2'-MOE), a 2'-deoxy-2'-fluoro modification (2'-F), a 2'-hydroxyl modification (2'-OH), or a combination thereof.

127. 127. The kit of any one of claims 123 to 126, wherein the anchor oligonucleotide is from about 4 to about 30 nucleotides in length.

128. 128. The kit of claim 127, wherein the anchor oligonucleotide is from about 6 to about 25 nucleotides in length.

129. 129. The kit of claim 128, wherein the anchor oligonucleotide is about 8 to about 12 nucleotides in length.

130. 130. The kit of any one of claims 124 to 129, wherein the anchor oligonucleotides are comprised of modified nucleic acids, each modified nucleic acid comprising a PNA, an LNA, a BNA, a nucleoside comprising a 2' modification, or a combination thereof.

131. 131. The kit of any one of claims 122 to 130, wherein the kit further comprises a surface, and one or both of the capture reagent and the anchor reagent are provided on the surface.

132. 132. The kit of claim 131, wherein the surface comprises a carbon composite and the anchoring reagent is covalently immobilized on the surface.

133. 131. The kit of any one of claims 122 to 130, wherein the capture reagent and the anchor reagent are each capable of being immobilized on a surface.

134. 134. The kit of claim 133, further comprising the surface.

135. 135. The kit of claim 133 or claim 134, wherein the anchoring reagent comprises a thiol and the surface comprises a carbon composite.

136. 136. The kit of any one of claims 133 to 135, wherein the anchoring reagent comprises a first binding partner and the surface comprises a second binding partner capable of interacting with the first binding partner.

137. 137. The kit of claim 136, wherein the first and second binding partners comprise a binding pair selected from a cross-reactive group, a complementary oligonucleotide, a receptor-ligand pair, an antigen-antibody pair, a hapten-antibody pair, an epitope-antibody pair, a mimotope-antibody pair, an aptamer-target molecule pair, a hybridization partner, or an intercalator-target molecule pair.

138. 138. The kit of claim 137, wherein the first binding partner comprises biotin and the second binding partner comprises streptavidin, avidin, an anti-biotin antibody, or a combination thereof.

139. 139. The kit of any one of claims 136 to 138, wherein the first binding partner is linked to a nucleotide of the anchor oligonucleotide.

140. 140. The kit of any one of claims 136 to 139, wherein the first binding partner is located at the 5' or 3' end of the anchor reagent.

141. 141. The kit of claim 140, wherein the anchor reagent further comprises a spacer positioned between the first binding partner and the anchor oligonucleotide.

142. 142. The kit of claim 141, wherein the spacer comprises polyethylene glycol (PEG) comprising from about 2 to about 10 ethylene glycol units.

143. 143. The kit of claim 142, wherein the PEG comprises from about 3 to about 8 ethylene glycol units.

144. 144. The kit of any one of claims 136 to 143, wherein the first binding partner is positioned at the 3' end of the anchor reagent, and the anchor reagent comprises a PEG spacer comprising from about 3 to about 8 ethylene glycol units.

145. the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; and the kit further comprises a nuclease capable of cleaving the template oligonucleotide; 145. The kit of any one of claims 95 to 144, optionally further comprising one or both of a surface and an anchoring reagent.

146. the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; and 146. The kit of any one of claims 95 to 145, wherein the kit further comprises an anchoring reagent and, optionally, a surface.

147. the kit further comprises a nuclease capable of cleaving the template oligonucleotide; and 146. The kit of any one of claims 95 to 145, wherein the kit further comprises an anchoring reagent and, optionally, a surface.

148. 148. The kit of any one of claims 145 to 147, wherein the anchor reagent comprises an anchor oligonucleotide, and the anchor oligonucleotide comprises a modified nucleic acid.

149. the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; the kit comprising a nuclease capable of cleaving a template oligonucleotide; the kit comprises an anchor reagent comprising an anchor oligonucleotide, the anchor oligonucleotide comprising a modified nucleic acid; and 149. The kit of any one of claims 95 to 148, optionally comprising a surface.

150. 150. The kit of any one of claims 95 to 149, wherein the anchor oligonucleotide comprises SEQ ID NO:

11.

151. 151. The kit of claim 150, wherein the anchor oligonucleotide comprises a 3' biotin.

152. 152. The kit of claim 151, wherein the anchor oligonucleotide comprises SEQ ID NO:

17.

153. The kit of any one of claims 95 to 152, wherein the detection oligonucleotide comprises any one of SEQ ID NOs: 7 to 10.

154. 154. The kit of claim 153, wherein the detection oligonucleotide comprises a 3' amino modifier, an internal amino modifier, an internal spacer, or a combination thereof.

155. 155. The kit of claim 154, wherein the detection oligonucleotide comprises any one of SEQ ID NOs: 12-15.

156. 156. The kit of any one of claims 95 to 155, wherein the nucleic acid primer comprises SEQ ID NO:

1.

157. 157. The kit of claim 156, wherein the nucleic acid primer is capable of being linked to the detection reagent and comprises a 5' thiol.

158. 158. The kit of claim 157, wherein the nucleic acid primer comprises SEQ ID NO:

18.

159. The kit of any one of claims 95 to 158, wherein the template oligonucleotide comprises SEQ ID NO:

5.

160. 160. The kit of claim 159, wherein the template oligonucleotide is 5'-phosphorylated.

161. 161. The kit of claim 160, wherein the template oligonucleotide comprises SEQ ID NO:

16.

162. 162. The kit of any one of claims 95-161, wherein the capture reagent comprises an antibody or antigen-binding fragment thereof, an oligonucleotide, an antigen, a ligand, a receptor, a hapten, an epitope, a mimotope, an aptamer, or a combination thereof.

163. 163. The kit of any one of claims 95 to 162, wherein the capture reagent and the detection reagent each comprise an antibody or antigen-binding fragment thereof.

164. 164. The kit of any one of claims 95 to 163, wherein the detectable label is measurable by light scattering, optical absorbance, fluorescence, chemiluminescence, electrochemiluminescence (ECL), bioluminescence, phosphorescence, radioactivity, magnetic field, or a combination thereof.

165. 165. The kit of claim 164, wherein the detectable label is an ECL label.

166. 166. The kit of any one of claims 131 to 165, wherein the surface comprises particles.

167. The kit of any one of claims 131 to 166, wherein the surface comprises a well of a multi-well plate.

168. The kit of any one of claims 131 to 167, wherein the surface comprises an electrode.

169. 169. The kit of any one of claims 95-168, further comprising a calibration reagent, a blocking reagent, a buffer, a ligase, a reagent for conjugating the nucleic acid primer to the detection reagent, a co-reactant for the detectable label, a detergent, a salt, a preservative, or a combination thereof.

170. A composition for labeling a surface, comprising: (1) a detectable label; and (2) a label probe comprising a detection oligonucleotide capable of binding to an extender oligonucleotide bound to the surface; The extension oligonucleotide is formed by extension of a nucleic acid primer by a polymerase based on a template oligonucleotide, and (i) the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; (ii) the composition further comprises a nuclease capable of cleaving the template oligonucleotide; (iii) a combination of (i) and (ii); (iv) one or both of (i) and (ii), and further wherein the extend oligonucleotide is attached to the surface via an anchoring reagent; (v) the surface comprises an anchoring reagent comprising an anchoring oligonucleotide, the anchoring oligonucleotide comprising a modified nucleic acid; or (vi) A composition comprising any combination of (i), (ii), and (v).

171. 1. A composition for labeling a surface, comprising: (a) a nucleic acid primer immobilized directly or indirectly on a surface; (b) a template oligonucleotide comprising: (1) a first region that is complementary to the nucleic acid primer; and (2) a second region that comprises the same sequence as a detection oligonucleotide; (c) a polymerase; and (d) a labeled probe comprising: (1) a detectable label; and (2) a detection oligonucleotide capable of binding to the surface-bound extender oligonucleotide. An extension oligonucleotide is formed by extension of the nucleic acid primer by the polymerase based on the template oligonucleotide, and (i) the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; (ii) the composition further comprises a nuclease capable of cleaving the template oligonucleotide; (iii) a combination of (i) and (ii); (iv) one or both of (i) and (ii), and further wherein the extend oligonucleotide is attached to a surface via an anchoring reagent; (v) the surface comprises an anchoring reagent comprising an anchoring oligonucleotide, the anchoring oligonucleotide comprising a modified nucleic acid; or (vi) A composition comprising any combination of (i), (ii), and (v).

172. 172. The composition of claim 170 or 171, wherein the detectable label is an electrochemiluminescence (ECL) label.

173. 173. The composition of any one of claims 170 to 172, wherein the detection oligonucleotide comprises a modified nucleic acid, wherein the modified nucleic acid comprises a PNA, an LNA, a BNA, a nucleoside comprising a 2' modification, or a combination thereof.

174. 174. The composition of claim 173, wherein the nucleoside comprising a 2'-modification comprises a 2'-O-methyl modification (2'-OMe), a 2'-O-methoxyethyl modification (2'-MOE), a 2'-deoxy-2'-fluoro modification (2'-F), a 2'-hydroxyl modification (2'-OH), or a combination thereof.

175. 175. The composition of any one of claims 170 to 174, wherein the detection oligonucleotide is from about 4 to about 30 nucleotides in length, preferably from about 5 to about 25 nucleotides in length, more preferably from about 6 to about 12 nucleotides in length.

176. 176. The composition of any one of claims 170-175, further comprising one or more of the polymerase, the nucleic acid primer, the template oligonucleotide, or combinations thereof.

177. 177. The composition of claim 176, wherein the composition comprises a polymerase with strand displacement activity (SD polymerase), wherein the SD polymerase is a DNA polymerase from a bacteriophage, and wherein the bacteriophage is Phi29, Nf, Karezi, or BeachBum.

178. The composition of claim 176 or claim 177, wherein the composition comprises the nucleic acid primer, the nucleic acid primer is linked to a detection reagent, and optionally the detection reagent comprises an antibody or an antigen-binding fragment thereof.

179. 180. The composition of any one of claims 170 to 179, wherein the composition comprises the nuclease.

180. 180. The composition of claim 179, wherein the nuclease is DdeI, AluI, HpaII, ApoI, DpnI, DpnII, ScrFI, MboI, MluCI, AseI, TaqI, TspRI, or a combination thereof.

181. 181. The composition of any one of claims 170 to 180, wherein the extender oligonucleotide is attached to the surface via an anchoring reagent comprising an anchor oligonucleotide.

182. 182. The composition of claim 181, wherein the anchor oligonucleotide comprises a modified nucleic acid, optionally wherein the modified nucleic acid is a PNA, an LNA, a BNA, a nucleoside comprising a 2' modification, or a combination thereof.

183. 183. The composition of claim 182, wherein the nucleoside comprising the 2'-modification comprises a 2'-O-methyl modification (2'-Ome), a 2'-O-methoxyethyl modification (2'-MOE), a 2'-deoxy-2'-fluoro modification (2'-F), a 2'-hydroxyl modification (2'-OH), or a combination thereof.

184. A composition comprising a capture reagent, an analyte, a detection reagent comprising a nucleic acid primer, a template oligonucleotide, a polymerase, and a nuclease, the capture reagent is immobilized on the surface; the capture reagent and the detection reagent are bound to the analyte; the nucleic acid primer is hybridized to the template oligonucleotide; the polymerase is capable of extending the nucleic acid primer; and The composition, wherein the nuclease is capable of cleaving a template oligonucleotide.

185. 185. The composition of claim 184, wherein the composition is at about 20°C to about 27°C.

186. 186. The composition of claim 184 or claim 185, wherein the nuclease is DdeI, AluI, HpaII, ApoI, DpnI, DpnII, ScrFI, MboI, MluCI, AseI, TaqI, TspRI, or a combination thereof.

187. 187. The composition of any one of claims 170-186, wherein the extend oligonucleotide is from about 500 to about 50,000 bases in length.

188. 188. The composition of claim 187, wherein the extend oligonucleotide is from about 9,000 to about 40,000 bases in length.

189. 189. The composition of claim 187 or 188, wherein the extend oligonucleotide is from about 3,000 to about 13,000 bases in length.

190. 190. The composition of any one of claims 187-189, wherein the extend oligonucleotide is from about 1,000 to about 4,500 bases in length.

191. 1. A composition comprising a capture reagent, an analyte, a detection reagent comprising an extender oligonucleotide, and an anchor reagent comprising an anchor oligonucleotide, the capture reagent and the anchor reagent are immobilized on the surface; the capture reagent and the detection reagent are bound to the analyte; the anchor oligonucleotide comprises a modified nucleic acid selected from a PNA, an LNA, a BNA, a nucleoside comprising a 2' modification, or a combination thereof, optionally wherein the nucleoside comprising the 2' modification comprises a 2'-O-methyl modification (2'-OMe), a 2'-O-methoxyethyl modification (2'-MOE), a 2'-deoxy-2'-fluoro modification (2'-F), a 2'-hydroxyl modification (2'-OH), or a combination thereof; and The composition, wherein the extender oligonucleotide comprises an anchor complement bound to the anchor oligonucleotide.

192. 1. A composition comprising a capture reagent, an analyte, a detection reagent comprising an extender oligonucleotide, and a labeled probe comprising a detection oligonucleotide, the capture reagent and the detection reagent are bound to the analyte; the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof, wherein the modified nucleic acid is selected from a PNA, an LNA, a BNA, a nucleoside comprising a 2' modification, or a combination thereof, and optionally the nucleoside comprising a 2' modification comprises a 2'-O-methyl modification (2'-OMe), a 2'-O-methoxyethyl modification (2'-MOE), a 2'-deoxy-2'-fluoro modification (2'-F), a 2'-hydroxyl modification (2'-OH), or a combination thereof; and The composition, wherein the extender oligonucleotide is bound to the detector oligonucleotide.

193. An oligonucleotide comprising or consisting of SEQ ID NO:

11.

194. An oligonucleotide comprising or consisting of SEQ ID NO:

17.

195. An oligonucleotide comprising or consisting of any one of SEQ ID NOs: 7 to 10.

196. An oligonucleotide comprising or consisting of any one of SEQ ID NOs: 12 to 15.

197. 191. The composition of any one of claims 170 to 190, wherein the template oligonucleotide is a cyclic oligonucleotide.

198. 184. The composition of any one of claims 170 to 183, wherein said extension of said nucleic acid primer is by rolling circle amplification (RCA).

199. 1. A method for detecting an analyte, comprising: (a) contacting a template oligonucleotide with a first complex comprising: (i) the analyte; and (ii) a detection reagent that binds to the analyte, the detection reagent comprising a nucleic acid primer; (b) hybridizing the nucleic acid primer to the template oligonucleotide to form a second complex, and extending the nucleic acid primer with a polymerase, thereby forming an extended oligonucleotide; (c) contacting the extended oligonucleotide with a single-stranded oligonucleotide (SSO) stabilizer; and (d) detecting said extended oligonucleotide, thereby detecting said analyte.

200. 200. The method of claim 199, wherein the SSO stabilizer comprises a single-stranded DNA binding protein.

201. 201. The method of claim 200, wherein the single-stranded DNA binding protein is an extremely thermostable single-stranded DNA binding protein (ET SSB).

202. 202. The method of any one of claims 199 to 201, wherein the second complex is bound to a surface.

203. 1. A method for detecting an analyte, comprising: (a) contacting a template oligonucleotide with a first complex comprising: (i) the analyte; (ii) a capture reagent that binds to the analyte, the capture reagent being linked to an anchor reagent comprising an anchor oligonucleotide to form a capture anchor reagent, the capture anchor reagent being immobilized or capable of being immobilized on a surface; and (iii) a detection reagent for the analyte, the detection reagent comprising a nucleic acid primer; (b) hybridizing the nucleic acid primer to the template oligonucleotide to form a second complex and extending the nucleic acid primer with a polymerase, thereby forming an extended oligonucleotide, wherein the extended oligonucleotide comprises an anchor complement capable of binding to the anchor oligonucleotide; (c) binding the extender oligonucleotide to the anchor reagent; and (d) detecting said extended oligonucleotide, thereby detecting said analyte.

204. 204. The method of claim 203, wherein the anchor reagent is linked to the capture reagent via a cross-linking agent.

205. 205. The method of claim 203 or 204, wherein the anchor oligonucleotide is further linked to biotin and the surface comprises streptavidin.

206. 1. A method for detecting an analyte, comprising: (a) contacting a template oligonucleotide with a first complex comprising: (i) the analyte; (ii) a first detection reagent that binds to the analyte and comprises a first nucleic acid probe; (iii) a second detection reagent that binds to the analyte and includes a second nucleic acid probe; and (iv) a bridging oligonucleotide, wherein a first portion of the bridging oligonucleotide is capable of binding to the first nucleic acid probe and a second portion of the bridging oligonucleotide is capable of binding to the second nucleic acid probe, and the bridging oligonucleotide further comprises a nucleic acid primer; (b) hybridizing the nucleic acid primer to the template oligonucleotide to form a second complex, and extending the nucleic acid primer with a polymerase, thereby forming an extended oligonucleotide; (c) detecting said extended oligonucleotide, thereby detecting said analyte.

207. 207. The method of claim 206, wherein the second complex is bound to a surface.

208. 1. A method for detecting an analyte, comprising: (a) contacting a template oligonucleotide with a first complex comprising: (i) the analyte; and (ii) a detection reagent that binds to the analyte, wherein the detection reagent comprises a nucleic acid primer; (b) hybridizing the nucleic acid primer to the template oligonucleotide to form a second complex and extending the nucleic acid primer with a polymerase, thereby forming an extended oligonucleotide, the extended oligonucleotide comprising a binding sequence capable of binding to an anchor reagent; the anchor reagent is immobilized on a surface, or the first complex further comprises a capture reagent that binds to the analyte, the capture reagent being immobilized or capable of being immobilized on the surface, and the anchor reagent being linked to the capture reagent; and the binding sequence is capable of forming an aptamer or a tertiary oligonucleotide structure, and the anchoring reagent comprises a protein, antibody, hapten, or affinity tag capable of binding to the aptamer or tertiary oligonucleotide structure; (c) attaching the binding sequence to the anchor reagent; and (d) detecting said extended oligonucleotide, thereby detecting said analyte.

209. 209. The method of claim 208, wherein the binding sequence forms a G-quadruplex and the anchoring reagent comprises a DNA binding protein capable of binding to the G-quadruplex.

210. The binding sequence forming the G-quadruplex is represented by the formula d(G ３＋ N １－７ G ３＋ N １－７ G ３＋ N １－７ G ３＋ (SEQ ID NO: 45)), wherein G is guanine, and N is any nucleotide.

211. 211. The method of claim 210, wherein the binding sequence forms an aptamer and the anchoring reagent comprises an antibody, hapten, or affinity tag capable of binding to the aptamer.

212. 212. The method of claim 211, wherein the binding sequence forming the aptamer comprises TCGATTTCCTTAGTTGTCTTCCTTAGTGAG (SEQ ID NO: 39), and the anchoring reagent comprises an anti-FLAG M2 antibody.

213. 212. The method of claim 211, wherein the binding sequence forming the aptamer comprises GCTATGGGTGGTCTGGTTGGGGATTGGCCCCGGGAGCTGGC (SEQ ID NO: 40), and the anchor reagent comprises a 6X-histidine tag (SEQ ID NO: 44).

214. 212. The method of claim 211, wherein the binding sequence forming the aptamer comprises CCGGCCAAGGGTGGGAGGGAGGGGGGCCGG (SEQ ID NO: 41), and the anchoring reagent comprises sulforhodamine B.

215. 212. The method of claim 211, wherein the binding sequence forming the aptamer comprises AGCGAGGGCGGTGTCCAACAGCGGTTTTTTTCASCGAGGAGGTTGGCGGTGG (SEQ ID NO: 42), and the anchor reagent comprises digoxin.

216. 1. A method for detecting an analyte, comprising: (a) contacting a template oligonucleotide with a first complex comprising: (i) the analyte; and (ii) a detection reagent that binds to the analyte, wherein the detection reagent comprises a nucleic acid primer; (b) hybridizing the nucleic acid primer to the template oligonucleotide to form a second complex and extending the nucleic acid primer with a polymerase, thereby forming an extended oligonucleotide, the extended oligonucleotide comprising a binding sequence capable of binding to an anchor reagent; the anchor reagent is immobilized on a surface, or the first complex further comprises a capture reagent that binds to the analyte, the capture reagent being immobilized or capable of being immobilized on the surface, and the anchor reagent being linked to the capture reagent; and the binding sequence comprises a binding moiety, and the anchoring reagent comprises a protein or antibody capable of binding the binding moiety; (c) attaching the binding sequence to the anchor reagent; and (d) detecting said extended oligonucleotide, thereby detecting said analyte.

217. 217. The method of claim 216, wherein the binding moiety is linked to a nucleotide of the binding sequence.

218. 218. The method of claim 216 or 217, wherein said extending comprises incorporating one or more nucleotides linked to said binding moiety into said extending oligonucleotide.

219. 219. The method of any one of claims 216 to 218, wherein the binding sequence comprises at least two binding moieties, and the anchoring reagent is capable of multivalent binding to the at least two binding moieties.

220. 220. The method of any one of claims 216 to 219, wherein the binding moiety comprises a hapten, biotin, or dinitrophenol (DNP).

221. 1. A method for detecting an analyte, comprising: (a) a template oligonucleotide, (i) the analyte; (ii) a first detection reagent that binds to the analyte and includes a first nucleic acid primer; and (iii) contacting with a first complex comprising a second detection reagent that binds to the analyte and comprises a second nucleic acid primer; the template oligonucleotide comprises a first region hybridizable with the first nucleic acid primer and a second region hybridizable with the second nucleic acid primer; (b) hybridizing the first and second nucleic acid primers to the template oligonucleotide to form a second complex; (c) extending the first nucleic acid primer to form a first extension oligonucleotide, and extending the second nucleic acid primer to form a second extension oligonucleotide; and (d) detecting said first and second extended oligonucleotides, thereby detecting said analyte.

222. 222. The method of claim 221, wherein the second complex is bound to a surface.

223. 223. The method of claim 221 or 222, wherein the template oligonucleotide comprises one or more connector oligonucleotides that can be ligated to form a circular template, the first region being on a first connector oligonucleotide and the second region being on a second connector oligonucleotide.

224. 224. The method of claim 223, wherein the extension comprises rolling circle amplification.

225. 1. A method for detecting an analyte, comprising: (a) contacting a template oligonucleotide with a first complex comprising: (i) the analyte; (ii) a first detection reagent that binds to the analyte and that comprises a first nucleic acid primer; and (iii) a second detection reagent that binds to the analyte and that comprises a second nucleic acid primer, wherein the analyte is present on a surface; (b) hybridizing the first and second nucleic acid primers to the template oligonucleotide to form a second complex; and extending the first and / or second nucleic acid primers with a polymerase, thereby forming extended oligonucleotides; and (c) detecting said extended oligonucleotide, thereby detecting said analyte.

226. 226. The method of Claim 225, wherein the template oligonucleotide comprises one or more connector oligonucleotides that can be ligated to form a circular template, the first region being on a first connector oligonucleotide and the second region being on a second connector oligonucleotide.

227. 227. The method of claim 226, wherein the extension comprises rolling circle amplification.

228. 228. The method of any one of claims 225 to 227, wherein the surface comprises a Western blot membrane.

229. 229. The method of claim 228, wherein the membrane comprises a nitrocellulose or polyvinylidene fluoride (PVDF) membrane.

230. 230. The method of any one of claims 225 to 229, wherein the surface further comprises an anchor reagent capable of binding to the extend oligonucleotide, and the method comprises binding the extend oligonucleotide to the anchor reagent prior to the detecting in (c).

231. 231. The method of claim 230, wherein the method further comprises immobilizing the anchoring reagent on the surface prior to the contacting of (a).

232. 232. The method of any one of claims 225-231, wherein the method further comprises transferring the analyte from a protein gel to the surface prior to the contacting of (a).

233. 1. A method for detecting an analyte, comprising: (e) contacting the template oligonucleotide with a first complex comprising (i) the analyte; and (ii) a detection reagent that binds to the analyte, wherein the detection reagent comprises a nucleic acid primer; (f) hybridizing the nucleic acid primer to the template oligonucleotide to form a second complex, and extending the nucleic acid primer with a polymerase, thereby forming an extended oligonucleotide, wherein the extended oligonucleotide is capable of enzymatic activity; and (g) detecting said enzymatic activity, thereby detecting said analyte.

234. 234. The method of claim 233, wherein the extended oligonucleotide comprises an aptamer, and the aptamer comprises enzymatic activity in the presence of an activator compound.

235. 235. The method of claim 234, wherein the enzymatic activity is peroxidase activity and the activator compound is hemin.

236. 236. The method of any one of claims 233 to 235, wherein the second complex is bound to a surface.

237. The detecting Binding the extender oligonucleotide to one or more labeled probes, each labeled probe comprising: (1) a detection oligonucleotide capable of binding to the extender oligonucleotide; and (2) a detectable label; and 233. The method of any one of claims 199 to 220 or any one of claims 225 to 232, comprising detecting the detectable label.

238. The detecting Binding the first and / or second extender oligonucleotides to one or more labeled probes, each labeled probe comprising: (1) a detection oligonucleotide capable of binding to the first and / or second extender oligonucleotide; and (2) a detectable label; and 225. The method of any one of claims 221 to 224, comprising detecting the detectable label.

239. The second complex is bound to a surface, and (i) the detection oligonucleotide comprises RNA, a modified nucleic acid, or a combination thereof; (ii) the method further comprises terminating the extension by cleaving the template oligonucleotide; (iii) a combination of (i) and (ii); (iv) one or both of (i) and (ii), further wherein the surface comprises an anchoring reagent; (v) the surface comprises an anchoring reagent comprising an anchoring oligonucleotide, the anchoring oligonucleotide comprising a modified nucleic acid; or (vi) The method of any one of claims 237-238, which is any combination of (i), (ii), and (v).

Images