Inhibitors of expression and / or function

Abstract

The present invention relates to inhibitors, and compositions comprising the inhibitors, and their use in the treatment or prevention of metabolic diseases or disorders, such as metabolic diseases or disorders associated with non-alcoholic fatty liver disease (NAFLD), and / or diseases or disorders associated with obesity and / or lipogenesis.

Description

[Technical Field]

[0001] The present invention provides inhibitors, such as nucleic acid compounds, such as siRNAs, that are suitable for therapeutic use. In addition, the present invention provides methods for making such compounds and methods for using such compounds to treat various diseases and conditions. [Background technology]

[0002] Inhibitors, such as oligonucleoside / oligonucleotide compounds, that inhibit gene expression and / or the expression or function of other targets, such as lncRNA, may have important therapeutic applications in medicine. Oligonucleotides / oligonucleosides can be used to silence genes that cause specific diseases. Gene silencing prevents the formation of proteins by inhibiting translation. Importantly, gene silencing agents are promising alternatives to traditional small organic compounds that inhibit the function of disease-related proteins. siRNA, antisense RNA, and microRNA are oligonucleoside / oligonucleotide compounds that prevent the formation of proteins through gene silencing.

[0003] In particular, numerous modified siRNA compounds have been developed over the past two decades for diagnostic and therapeutic purposes, including siRNA / RNAi therapeutic agents for the treatment of a variety of diseases, including central nervous system diseases, inflammatory diseases, metabolic disorders, oncology, infectious diseases, and ocular diseases.

[0004] The present invention relates to inhibitors, such oligomers, eg nucleic acids, eg oligonucleoside / oligonucleotide compounds, and their use in the treatment and / or prevention of disease.

[0005] The SLC25A5 gene belongs to the ANT gene family, which itself belongs to a superfamily that includes genes encoding brown fat mitochondrial uncoupling proteins and mitochondrial phosphate transporter proteins. This gene is a member of the mitochondrial transporter subfamily of solute transporter protein genes. Its product, adenine nucleotide transporter 2 (ANT2), functions as a major component of the mitochondrial permeability transition pore complex, catalyzing the exchange of mitochondrial ATP with cytosolic ADP. As a result of its exchanger function, ANT2 maintains the mitochondrial membrane potential by regulating the ADP / ATP ratio in oxidative phosphorylation. When acylated by SIRT4, ANT2 promotes mitochondrial membrane uncoupling. Although membrane potential uncoupling typically leads to apoptosis, ANT2 has been found to be anti-apoptotic. Consequently, it has been hypothesized to mediate the TFIIH-dependent response to DNA damage as a component of MMS19-XPD. Summary of the Invention [Means for solving the problem]

[0006] The present invention is defined in the claims and relates to, inter alia: In one aspect, the present invention relates to inhibitors of SLC25A5 / ANT2 expression and / or function, which are conjugated to one or more ligand moieties.

[0007] In a further aspect, the present invention relates to an inhibitor according to the invention which is a siRNA oligomer.

[0008] In another aspect, the present invention relates to inhibitors of SLC25A5 / ANT2 expression and / or function that are siRNA oligomers.

[0009] In a further aspect, the present invention relates to an inhibitor according to the invention, which comprises an siRNA oligomer conjugated to one or more ligand moieties.

[0010] In a further aspect, the present invention relates to an inhibitor according to the invention, wherein said one or more ligand moieties comprise one or more GalNAc ligands or comprise one or more GalNAc ligand derivatives.

[0011] In a further aspect, the present invention relates to an inhibitor according to the invention, wherein said one or more ligand moieties comprise one or more GalNAc ligand derivatives.

[0012] In a further aspect, the present invention relates to an inhibitor according to the invention, wherein the target of the inhibitor is SLC25A5 / ANT2.

[0013] In a further aspect, the present invention provides an inhibitor according to the present invention, which is a nucleic acid for inhibiting expression of SLC25A5, wherein the inhibitor comprises a double-stranded region comprising a first strand and a second strand that is at least partially complementary to the first strand, (i) is at least partially complementary to a portion of the RNA transcribed from the SLC25A5 gene; and (ii) comprises at least 17 consecutive nucleosides that differ by 0 or 1 nucleoside from any one of the first strand sequences listed in Table 2; Regarding inhibitors.

[0014] In a further aspect, the present invention provides an inhibitor according to the present invention, which is a nucleic acid for inhibiting expression of SLC25A5, wherein the inhibitor comprises a double-stranded region comprising a first strand and a second strand that is at least partially complementary to the first strand, wherein said first strand is (i) is at least partially complementary to a portion of the RNA transcribed from the SLC25A5 gene; and (ii) comprises at least 17 consecutive nucleosides that differ by 0 or 1 nucleoside from any one of the modified sequences of the first strand listed in Table 3; Regarding inhibitors.

[0015] In a further aspect, the present invention relates to an inhibitor according to the invention, wherein the first strand comprises nucleosides 2 to 18 of any one of the sequences according to claim 8 or 9, in particular wherein the first strand comprises nucleosides 2 to 18 of any one of the sequences defined in Table 2 or 3.

[0016] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the second strand comprises a nucleoside sequence of at least 17 consecutive nucleosides that differs by 0 or 1 nucleoside from any one of the second strand sequences listed in Table 2, and wherein the second strand has a region that is at least 85% complementary to the first strand over the 17 consecutive nucleosides.

[0017] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the second strand comprises a nucleoside sequence of at least 17 consecutive nucleosides that differs by 0 or 1 nucleoside from any one of the modified sequences for the second strand listed in Table 4, and wherein the second strand has a region that is at least 85% complementary to the first strand over the 17 consecutive nucleosides.

[0018] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the first chain comprises any one of the first chain sequences listed in Table 2.

[0019] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the first strand comprises any one of the modified first strand sequences listed in Table 3.

[0020] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the second chain comprises any one of the second chains listed in Table 2.

[0021] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the second strand comprises any one of the modified sequences of the first strand listed in Table 4.

[0022] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the first chain comprises any one of the following sequences: SEQ ID NO:304, SEQ ID NO:323, SEQ ID NO:439, SEQ ID NO:453 and SEQ ID NO:496.

[0023] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the first chain comprises any one of the following sequences: SEQ ID NO:856, SEQ ID NO:875, SEQ ID NO:991, SEQ ID NO:1005 and SEQ ID NO:1048.

[0024] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the second chain comprises any one of the following sequences: SEQ ID NO:580, SEQ ID NO:599, SEQ ID NO:715, SEQ ID NO:729 and SEQ ID NO:772.

[0025] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the second chain comprises any one of the following sequences: SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281 and SEQ ID NO:1324.

[0026] In a further aspect, the present invention relates to an inhibitor according to the invention comprising a first strand and a second strand comprising, consisting of, or consisting essentially of a nucleoside sequence that differs by 0 or 1 nucleoside from any one of the following combinations of the first and second sequences:

[0027] [Table 1]

[0028] In a further aspect, the present invention relates to an inhibitor according to the invention comprising a first strand and a second strand comprising, consisting of, or consisting essentially of a nucleoside sequence that differs by 0 or 1 nucleoside from any one of the following combinations of the first and second sequences:

[0029] [Table 2]

[0030] In a further aspect, the present invention relates to an inhibitor according to the invention comprising a first strand and a second strand comprising, consisting of, or consisting essentially of a nucleoside sequence that differs by 0 or 1 nucleoside from any one of the following combinations of the first and second sequences:

[0031] [Table 3]

[0032] In a further aspect, the present invention relates to an inhibitor according to the invention comprising a first strand and a second strand comprising, consisting of, or consisting essentially of a nucleoside sequence that differs by 0 or 1 nucleoside from any one of the following combinations of the first and second sequences:

[0033] [Table 4]

[0034] In a further aspect, the invention provides an siRNA oligomer having a first strand and a second strand, i) the first strand of the siRNA has a length ranging from 15 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 23 or 25, even more preferably 23; and / or ii) the second strand of the siRNA has a length ranging from 15 to 30 nucleosides, preferably from 19 to 25 nucleosides, more preferably 21 nucleosides; The inhibitor according to the present invention is an siRNA oligomer.

[0035] In a further aspect, the present invention relates to an inhibitor according to the invention, wherein the first strand has a length in the range of 17 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 19 or 23 nucleosides.

[0036] In a further aspect, the present invention relates to an inhibitor according to the invention, wherein the second chain has a length in the range of 17 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 19 or 21 or 23 nucleosides.

[0037] In a further aspect, the present invention relates to an inhibitor according to the invention, wherein the duplex region of the nucleic acid is between 17 and 30 nucleosides in length, more preferably 19 or 21 or 23 nucleosides in length.

[0038] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the region of complementarity between the first strand and the portion of the RNA transcribed from the SLC25A5 gene is 17 to 30 nucleosides in length.

[0039] In a further aspect, the present invention relates to an inhibitor according to the invention, wherein the nucleic acid further comprises one or more single-stranded nucleoside overhangs, optionally wherein the overhang is present on the first or second strand, preferably at the 3' end of the first or second strand, and / or wherein the overhang comprises 1 to 4 nucleosides, more preferably 2 nucleosides.

[0040] In a further aspect, the present invention relates to an inhibitor according to the invention, wherein the nucleic acid is an siRNA oligonucleoside.

[0041] In a further aspect, the present invention relates to an inhibitor according to the invention, wherein the second sense strand further comprises one or more abasic nucleosides in the terminal region of the second strand, said abasic nucleosides being connected to adjacent nucleosides via reverse internucleoside linkages.

[0042] In a further aspect, the present invention provides a method for the preparation of a medicament ... i) two or more abasic nucleosides in the terminal region of the second strand, and / or ii) two or more than two abasic nucleosides in either the 5' or 3' terminal region of the second strand, and / or iii) two or more abasic nucleosides in either the 5' or 3' terminal region of the second strand, wherein the two or more abasic nucleosides are present in an overhang as described herein; and / or iv) two or more than two consecutive abasic nucleosides in the terminal region of the second strand, preferably one such abasic nucleoside being the terminal nucleoside; and / or v) two or more than two consecutive abasic nucleosides in either the 5' or 3' terminal region of the second strand, preferably one such abasic nucleoside being the terminal nucleoside in either the 5' or 3' terminal region of the second strand; and / or vi) an inverted internucleoside linkage connecting at least one abasic nucleoside to an adjacent basic nucleoside in the terminal region of the second strand; and / or vii) an inverted internucleoside linkage connecting at least one abasic nucleoside to an adjacent basic nucleoside in either the 5' or 3' terminal region of the second strand; and / or viii) an abasic nucleoside as the penultimate nucleoside connected via a back linkage to a nucleoside that is not the terminal nucleoside (referred to herein as the penultimate nucleoside); and / or ix) an abasic nucleoside as the two terminal nucleosides connected via a 5'-3' linkage when reading the strand in the direction towards its termini; x) an abasic nucleoside as the two terminal nucleosides connected via a 3'-5' linkage when reading the chain in the direction towards the end containing the terminal nucleoside; xi) abasic nucleosides at the two terminal positions, wherein the penultimate nucleoside is connected to the penultimate nucleoside via a reverse linkage, and the reverse linkage is a 5-5' reverse linkage or a 3'-3' reverse linkage; xii) abasic nucleosides at the two terminal positions, the penultimate nucleoside being connected to the penultimate nucleoside via a reverse linkage; (1) the reverse linkage is a 5-5' reverse linkage, and the linkage between the terminal abasic nucleoside and the penultimate abasic nucleoside is 3'5' when read toward the end containing the terminal abasic nucleoside and the penultimate abasic nucleoside; or (2) The reverse linkage is a 3-3' reverse linkage, and the linkage between the terminal abasic nucleoside and the penultimate abasic nucleoside is either 5'3' when read toward the end containing the terminal abasic nucleoside and the penultimate abasic nucleoside. The present invention relates to an inhibitor comprising:

[0043] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the reverse internucleoside linkage is present in a terminal region distal to the 5'-terminal region of the second strand or in a terminal region distal to the 3'-terminal region of the second strand.

[0044] In a further aspect, the present invention relates to an inhibitor according to the invention, wherein the reverse internucleoside linkage is a 3'3 reverse linkage.

[0045] In a further aspect, the present invention relates to an inhibitor according to the invention, wherein the reverse internucleoside linkage is a 5'5 reverse linkage.

[0046] In a further aspect, the present invention relates to an inhibitor according to the invention, wherein the second sense strand further comprises one or more abasic nucleosides in the terminal region of the second strand, said abasic nucleosides being connected to adjacent nucleosides via reverse internucleoside linkages.

[0047] In a further aspect, the present invention provides a method for preparing a nucleotide sequence comprising: a) a second strand comprising two consecutive abasic nucleosides in the 5'-terminal region of the second strand; b) one such abasic nucleoside being the terminal nucleoside in the 5'-terminal region of the second strand; c) another abasic nucleoside being the penultimate nucleoside in the 5'-terminal region of the second strand; (a) the penultimate abasic nucleoside is linked to the adjacent first abasic nucleoside of the adjacent 5'-proximal terminal region via a reverse internucleoside linkage; (b) the reverse ligation is a 5-5' reverse ligation; (c) the linkage between the terminal abasic nucleoside and the penultimate abasic nucleoside is 3'5' when read toward the end containing the terminal abasic nucleoside and the penultimate abasic nucleoside; 12. The inhibitor or inhibitor for use according to claim 10 or 11, wherein the reverse internucleoside linkage is present in a terminal region distal to the 5'-end of the second strand or in a terminal region distal to the 3'-end of the second strand.

[0048] In a further aspect, the present invention provides a method for producing a pharmaceutical composition comprising: (i) the first strand and the second strand each have a length of 23 nucleosides; (ii) two phosphorothioate internucleoside linkages are present between three consecutive positions of the 5′-proximal terminal region of the second strand, respectively, a first phosphorothioate internucleoside linkage is present between the adjacent first base nucleosides of (a) and adjacent second base nucleosides of the 5′-proximal terminal region of the second strand, and a second phosphorothioate internucleoside linkage is present between the adjacent second base nucleosides and adjacent third base nucleosides of the 5′-proximal terminal region of the second strand; (iii) two phosphorothioate internucleoside linkages are present between three consecutive positions in both the 5'- and 3'-terminal regions of the first strand, respectively, and each terminal nucleoside in each of the 5'- and 3'-terminal regions of said first strand, respectively, is attached to the 5'- and 3'-penultimate adjacent nucleoside by a phosphorothioate internucleoside linkage, and each first 5'- and 3'-penultimate nucleoside is attached to the 5'- and 3'-penultimate adjacent third nucleoside by a phosphorothioate internucleoside linkage; (iv) the second strand of the nucleic acid is directly or indirectly conjugated to one or more ligand moieties at the 3'-terminal region of the second strand; The present invention relates to an inhibitor.

[0049] In a further aspect, the present invention provides a method for preparing a 5'-terminal region of a second strand of a nucleotide sequence comprising two consecutive reverse abasic nucleosides in the 5'-terminal region of the second strand, the two consecutive reverse abasic nucleosides in the 5'-terminal region of the second strand having the following 5'-terminal motif:

[0050] [ka] During the ceremony, T represents a 2'Me ribose modification; B represents the nucleoside bases of the first two base nucleosides in the 5'-terminal region of the second strand, and Z represents the remaining 19 consecutive nucleosides of the second strand; The inhibitor according to the present invention is present as

[0051] In a further aspect, the present invention relates to an inhibitor according to the invention, wherein one or more nucleosides of the first strand and / or the second strand have been modified to form a modified nucleoside.

[0052] In a further aspect, the present invention relates to an inhibitor according to the invention, wherein the modification is a modification at the 2'-OH group of the ribose sugar, optionally selected from a 2'-Me modification or a 2'-F modification.

[0053] In a further aspect, the invention relates to an inhibitor according to the invention, wherein the first strand comprises a 2'-F at any of positions 14, 2, 6, or any combination thereof, counting from position 1 of said first strand.

[0054] In a further aspect, the present invention relates to an inhibitor according to the invention, wherein the second strand comprises a 2'-F modification at positions 7, and / or 9, and / or 11, and / or 13, counting from position 1 of said second strand.

[0055] In a further aspect, the present invention relates to an inhibitor according to the invention, wherein the first strand and the second strand each comprise a 2'-Me modification and a 2'-F modification.

[0056] In a further aspect, the invention relates to an inhibitor according to the invention, which is an siRNA, suitably comprising at least one thermodestabilizing modification at one or more of positions 1 to 9 of the first strand and / or at one or more of the positions of the second strand aligned to positions 1 to 9 of the first strand, counting from position 1 of the first strand, wherein the destabilizing modification is selected from a modified unlocked nucleic acid (UNA) and a glycol nucleic acid (GNA), preferably a glycol nucleic acid.

[0057] In a further embodiment, the invention relates to an inhibitor according to the invention, wherein the siRNA comprises at least one thermodestabilizing modification at position 7 of the first strand, counting from position 1 of the first strand.

[0058] In a further aspect, the invention relates to an inhibitor according to the invention, which is an siRNA, wherein the siRNA comprises three or more 2'-F modifications at positions 7-13 of the second strand, counting from position 1 of said second strand, such as four, five, six, or seven 2'-F modifications at positions 7-13 of the second strand.

[0059] In a further aspect, the invention relates to an inhibitor according to the invention, which is an siRNA and wherein said second strand comprises at least three, e.g., four, five, or six 2'-Me modifications at positions 1 to 6 of the second strand, counting from position 1 of said second strand.

[0060] In a further aspect, the present invention relates to an inhibitor according to the present invention, which is an siRNA, and wherein said first strand preferably comprises at least five 2'-Me consecutive modifications in the 3'-terminal region, including the terminal nucleoside of the 3'-terminal region, or within at least one or two nucleosides from the terminal nucleoside of the 3'-terminal region.

[0061] In a further aspect, the present invention relates to an inhibitor according to the invention, which is an siRNA, and wherein said first strand preferably comprises seven consecutive 2'-Me modifications in the 3'-terminal region, including the terminal nucleoside of the 3'-terminal region.

[0062] In a further aspect, the present invention relates to an inhibitor according to the invention, wherein the siRNA oligomer further comprises one or more phosphorothioate internucleoside linkages.

[0063] In a further aspect, the present invention relates to an inhibitor according to the invention, wherein the one or more phosphorothioate internucleoside linkages are present between at least three consecutive positions of the 5' or 3' near-terminal region of the second strand, respectively, the near-terminal region preferably being adjacent to the terminal region in which the one or more abasic nucleosides of the second strand are located as defined herein.

[0064] In a further aspect, the present invention relates to an inhibitor according to the invention, wherein said one or more phosphorothioate internucleoside linkages are present between at least three consecutive positions of the 5' and / or 3' terminal region of the first strand, respectively, and preferably a terminal position of the 5' and / or 3' terminal region of said first strand is attached to its adjacent position by a phosphorothioate internucleoside linkage.

[0065] In a further aspect, the present invention relates to an inhibitor according to the invention, wherein the oligomer is an siRNA, the second strand of which is directly or indirectly conjugated to one or more ligand moieties, said ligand moieties typically being present in the terminal region of the second strand, preferably in its 3'-terminal region.

[0066] In a further aspect, the present invention provides a compound comprising: i) one or more GalNAc ligands, and / or ii) one or more GalNAc ligand derivatives, and / or iii) one or more GalNAc ligands and / or GalNAc ligand derivatives conjugated to said siRNA via a linker; The present invention relates to an inhibitor comprising:

[0067] In a further aspect, the present invention relates to an inhibitor according to the present invention, wherein said one or more GalNAc ligands and / or GalNAc ligand derivatives are conjugated directly or indirectly to the 5' or 3' terminal region of the second strand of the siRNA oligomer, preferably to the 3' terminal region.

[0068] In a further aspect, the present invention provides a compound comprising:

[0069] [ka] The present invention relates to an inhibitor comprising:

[0070] In a further aspect, the present invention provides a compound having the structure:

[0071] [ka] During the ceremony, R1, in each occurrence, is independently selected from the group consisting of hydrogen, methyl, and ethyl; R2 is hydrogen, hydroxy, -OC 1~3Alkyl, -C(=O)OC 1~3 selected from the group consisting of alkyl, halo, and nitro; X1 and X2, in each occurrence, are independently selected from the group consisting of methylene, oxygen, and sulfur; m is an integer from 1 to 6; n is an integer from 1 to 10, q, r, s, t, and v are independently integers from 0 to 4, with the proviso that: (i) q and r cannot both be 0 at the same time; (ii) s, t, and v cannot all be simultaneously 0; Z is an oligonucleoside moiety The present invention relates to an inhibitor comprising:

[0072] In a further aspect, the present invention provides a compound having the structure:

[0073] [ka] wherein the oligonucleotide represents consecutive nucleosides of the second strand, The present invention relates to an inhibitor.

[0074] In a further aspect, the present invention provides a compound having the structure:

[0075] [ka] During the ceremony, r and s are independently integers selected from 1 to 16; and Z is an oligonucleoside moiety; The present invention relates to an inhibitor comprising:

[0076] In a further aspect, the present invention provides a compound having the structure:

[0077] [ka] wherein the oligonucleotide represents consecutive nucleosides of the second strand, The present invention relates to an inhibitor.

[0078] In a further aspect, the present invention relates to an inhibitor according to the invention, wherein the structure is conjugated to the 3'-terminal region of the second strand.

[0079] In a further aspect, the present invention relates to an inhibitor according to the invention formulated as a pharmaceutical composition with excipients and / or carriers.

[0080] In another aspect, the invention relates to a pharmaceutical composition comprising an inhibitor according to one or more of the preceding aspects in combination with a pharmaceutically acceptable excipient or carrier.

[0081] In a further aspect, the present invention relates to a pharmaceutical composition according to the invention, which further comprises a GLP-1 agonist and / or a THR-beta agonist.

[0082] In a further aspect, the present invention relates to a pharmaceutical composition according to the invention, wherein the GLP-1 agonist is a GLP-1 / GIP dual agonist, a GLP-1 / FGF21 dual agonist, a GLP-1 / GCGR dual agonist, or a GLP-1 / GIP / GCGR triple agonist.

[0083] In a further aspect, the present invention relates to a pharmaceutical composition according to the invention, wherein the GLP-1 agonist is semaglutide.

[0084] In a further aspect, the present invention relates to a pharmaceutical composition according to the invention, wherein the THR-beta agonist is resmetirom.

[0085] In a further aspect, the present invention relates to a pharmaceutical composition according to the invention, wherein the GLP-1 / GIP dual agonist is tirzepatide.

[0086] In a further aspect, the present invention relates to a method for treating rheumatoid arthritis with amylin receptor agonists (e.g., pramlintide), and / or dual amylin + calcitonin receptor agonists, and / or glucagon receptor agonists, and / or FXR receptor agonists (e.g., cilofexor or obeticholic acid), and / or FGF-21 analogs or FGF-21 receptor agonists (e.g., effluxifermin), and / or FGF-19 analogs or FGF-19 receptor agonists (e.g., aldafermin), and / or galectin 3 inhibitors (e.g., belapectin), and / or PPARα agonists (e.g., elafibrinor), and / or PPA Rγ agonists (e.g., pioglitazone or rosiglitazone), and / or mixed PPARα and / or δ and / or γ agonists, and / or pan-PPARαδγ agonists (e.g., lanafibranor), and / or acetyl-CoA desaturase activators, and / or ASK1 inhibitors (e.g., selonsertib), and / or LOXL2 inhibitors (e.g., simtuzumab), and / or dual CCR2 / 5 inhibitors (e.g., cenicriviroc), and / or desaturase inhibitors including citrate / isocitrate transporter (CIC), ATP-citrate lyase (ACLY), acetyl-CoA carboxylase (ACC), and fatty acid synthase (FAS). The present invention relates to pharmaceutical compositions according to the present invention, further comprising one or more inhibitors of enzymes in the novo lipid biosynthesis (DNL) pathway, and / or inhibitors of enzymes in the cholesterol biosynthesis pathway (e.g., an HMGCoA reductase inhibitor, e.g., atorvastatin).

[0087] In another aspect, the present invention relates to an inhibitor according to the invention or a pharmaceutical composition according to the invention for use in therapy.

[0088] In another aspect, the present invention relates to an inhibitor according to the invention or a pharmaceutical composition according to the invention for use in the prevention and / or treatment of a metabolic disease or disorder, such as a metabolic disease or disorder associated with non-alcoholic fatty liver disease (NAFLD), and / or a disease or disorder associated with obesity and / or lipogenesis, and / or for use in reducing lipogenesis.

[0089] In a further aspect, the present invention relates to an inhibitor for use according to the invention or a pharmaceutical composition for use according to the invention, to be used in combination with a GLP-1 agonist and / or a THR-beta agonist.

[0090] In a further aspect, the present invention relates to an inhibitor for use according to the present invention or a pharmaceutical composition for use according to the present invention, wherein the GLP-1 agonist is a GLP-1 / GIP dual agonist, a GLP-1 / FGF21 dual agonist, a GLP-1 / GCGR dual agonist, or a GLP-1 / GIP / GCGR triple agonist.

[0091] In a further aspect, the invention relates to an inhibitor for use according to the invention or a pharmaceutical composition for use according to the invention, wherein the GLP-1 agonist is semaglutide.

[0092] In a further aspect, the present invention relates to an inhibitor for use according to the invention or a pharmaceutical composition for use according to the invention, wherein the THR-beta agonist is resmetirom.

[0093] In a further aspect, the present invention relates to an inhibitor for use according to the present invention or a pharmaceutical composition for use according to the present invention, wherein the GLP-1 / GIP dual agonist is tirzepatide.

[0094] In a further aspect, the present invention relates to a method for treating rheumatoid arthritis with amylin receptor agonists (e.g., pramlintide), and / or dual amylin + calcitonin receptor agonists, and / or glucagon receptor agonists, and / or FXR receptor agonists (e.g., cilofexor or obeticholic acid), and / or FGF-21 analogs or FGF-21 receptor agonists (e.g., effluxifermin), and / or FGF-19 analogs or FGF-19 receptor agonists (e.g., aldafermin), and / or galectin 3 inhibitors (e.g., belapectin), and / or PPARα agonists (e.g., elafibrinor), and / or PPA Rγ agonists (e.g., pioglitazone or rosiglitazone), and / or mixed PPARα and / or δ and / or γ agonists, and / or pan-PPARαδγ agonists (e.g., lanafibranor), and / or acetyl-CoA desaturase activators, and / or ASK1 inhibitors (e.g., selonsertib), and / or LOXL2 inhibitors (e.g., simtuzumab), and / or dual CCR2 / 5 inhibitors (e.g., cenicriviroc), and / or desaturase inhibitors including citrate / isocitrate transporter (CIC), ATP-citrate lyase (ACLY), acetyl-CoA carboxylase (ACC), and fatty acid synthase (FAS). The present invention relates to an inhibitor for use according to the present invention or a pharmaceutical composition for use according to the present invention, used in combination with one or more inhibitors of enzymes in the novo lipid biosynthesis (DNL) pathway and / or inhibitors of enzymes in the cholesterol biosynthesis pathway (e.g., an HMGCoA reductase inhibitor, such as atorvastatin).

[0095] In another aspect, the present invention relates to the use of SLC25A5 / ANT2 as a target for identifying one or more therapeutic agents for treating and / or preventing metabolic diseases or disorders, such as metabolic diseases or disorders associated with non-alcoholic fatty liver disease (NAFLD), and / or diseases or disorders associated with obesity and / or lipogenesis, and / or for reducing lipogenesis.

[0096] In another aspect, the present invention relates to a method for treating and / or preventing a metabolic disease or disorder, such as a metabolic disease or disorder associated with non-alcoholic fatty liver disease (NAFLD), and / or a disease or disorder associated with obesity and / or lipogenesis, and / or a method for reducing lipogenesis, comprising administering to a patient an inhibitor of SLC25A5 / ANT2 expression and / or function, such as an inhibitor according to the present invention.

[0097] In a further aspect, the present invention relates to a method according to the invention, wherein the inhibitor of SLC25A5 / ANT2 expression and / or function is administered together with a GLP-1 agonist and / or a THR-beta agonist.

[0098] In a further aspect, the present invention relates to a method according to the invention, wherein the GLP-1 agonist is a GLP-1 / GIP dual agonist, a GLP-1 / FGF21 dual agonist, a GLP-1 / GCGR dual agonist, or a GLP-1 / GIP / GCGR triple agonist.

[0099] In a further aspect, the present invention relates to a method according to the invention, wherein the GLP-1 agonist is semaglutide.

[0100] In a further aspect, the present invention relates to a method according to the invention, wherein the GLP-1 / GIP dual agonist is tirzepatide.

[0101] In a further aspect, the present invention relates to a method according to the invention, wherein the THR-beta agonist is resmetirom.

[0102] In a further aspect, the present invention provides a method for treating SLC25A5 / ANT2 expression and / or function comprising administering to a subject therapies ... )), and / or PPARγ agonists (e.g., pioglitazone or rosiglitazone), and / or mixed PPARα and / or δ and / or γ agonists, and / or pan-PPARαδγ agonists (e.g., lanafibranor), and / or acetyl-CoA desaturase activators, and / or ASK1 inhibitors (e.g., selonsertib), and / or LOXL2 inhibitors (e.g., simtuzumab), and / or dual CCR2 / 5 inhibitors (e.g., cenicriviroc), and / or desaturase inhibitors including citrate / isocitrate transporter (CIC), ATP-citrate lyase (ACLY), acetyl-CoA carboxylase (ACC), and fatty acid synthase (FAS). In another aspect, the present invention relates to methods according to the present invention, wherein the medicament is administered in combination with one or more inhibitors of enzymes in the novo lipid biosynthesis (DNL) pathway, and / or inhibitors of enzymes in the cholesterol biosynthesis pathway (e.g., an HMGCoA reductase inhibitor, such as atorvastatin).

[0103] In another aspect, the present invention relates to the use of an inhibitor according to the invention or a pharmaceutical composition according to the invention in the preparation of a medicament for the treatment of a metabolic disease or disorder, such as a metabolic disease or disorder associated with non-alcoholic fatty liver disease (NAFLD), and / or a disease or disorder associated with obesity and / or lipogenesis, and / or for reducing lipogenesis.

[0104] In another aspect, the present invention relates to SLC25A5 / ANT2 for use as a biomarker for a metabolic disease or disorder, such as a metabolic disease or disorder associated with non-alcoholic fatty liver disease (NAFLD), and / or a disease or disorder associated with obesity and / or lipogenesis.

[0105] In another aspect, the present invention relates to SLC25A5 / ANT2 for use in an in vivo method of predicting susceptibility to prevention and / or treatment of a metabolic disease or disorder, such as a metabolic disease or disorder associated with non-alcoholic fatty liver disease (NAFLD), and / or a disease or disorder associated with obesity and / or lipogenesis, typically by monitoring the sequence and / or level of expression and / or function of SLC25A5 / ANT2 in a sample obtained from a patient.

[0106] In another aspect, the present invention provides a method of predicting susceptibility to a metabolic disease or disorder in a patient, such as a metabolic disease or disorder associated with non-alcoholic fatty liver disease (NAFLD), and / or a disease or disorder associated with obesity and / or lipogenesis, comprising: (a) obtaining a sample from a patient; (b) detecting the sequence and / or expression and / or function of SLC25A5 / ANT2 in said sample obtained from the patient; (c) predicting susceptibility to a metabolic disease or disorder, such as a metabolic disease or disorder associated with non-alcoholic fatty liver disease (NAFLD), and / or a disease or disorder associated with obesity and / or lipogenesis, based on the sequence and / or expression and / or function of SLC25A5 / ANT2 in said sample obtained from the patient; (d) preferably administering to the diagnosed patient an effective amount of an inhibitor of SLC25A5 / ANT2. The present invention relates to a method comprising: [Brief explanation of the drawings]

[0107] [Figure 1a] FIG. 1 shows an exemplary linear configuration of the conjugate. [Figure 1b] FIG. 1 shows exemplary branched chain configurations of conjugates. [Figure 2]

[0023] Figure 2 shows the linker and ligand moieties of a suitable construct for use according to the present invention, including tether 1a. While Figure 2 illustrates a linker conjugated to an oligonucleotide, it should be understood that the present invention also encompasses conjugates of the same linker with an oligonucleoside disclosed herein. While Figure 2 illustrates a product molecule based on the linker and ligand moieties specifically depicted in Figure 2 attached to an oligonucleoside moiety also depicted herein, it should be understood that the product may alternatively further comprise or consist essentially of a molecule in which the linker and ligand moieties are essentially as depicted in Figure 2 attached to an oligonucleoside moiety, but in which the F substituent depicted in Figure 2 on the cyclo-octyl ring has been replaced by a substituent that may result from hydrolytic substitution, e.g., an OH substituent, or the OH substituent may itself be synthesized as the linker. Thus, (a) Tether 1a constructs can consist essentially of molecules having linker and ligand moieties as specifically depicted in FIG. 2, with the F substituent on the cyclo-octyl ring; or (b) Tether 1a constructs can consist essentially of molecules having linker and ligand moieties essentially as depicted in FIG. 2, but with the F substituent shown in FIG. 2 on the cyclo-octyl ring replaced by an OH substituent; or (c) Tether 1a constructs can comprise a mixture of molecules as defined in (a) and / or (b). [Figure 3]

[0023] Figure 3 shows the linker and ligand portions of constructs suitable for use according to the present invention, including Tether 1b. While Figure 3 illustrates the linker conjugated to an oligonucleotide, it should be understood that the present invention also encompasses conjugates of the same linker with the oligonucleosides disclosed herein. The comments made in connection with Figure 2, and the possibility that the F substituent shown in Figure 2 on the cyclo-octyl ring may be replaced by an OH substituent, or that the OH substituent may itself be synthesized as a linker, apply equally to Tether 1b constructs. Thus, (a) Tether 1b constructs can consist essentially of molecules having linker and ligand moieties as specifically depicted in FIG. 3, with the F substituent on the cyclo-octyl ring; or (b) Tether 1b constructs can consist essentially of molecules having linker and ligand moieties essentially as depicted in FIG. 3, but with the F substituent shown in FIG. 3 on the cyclo-octyl ring replaced by an OH substituent; or (c) Tether 1b constructs can comprise a mixture of molecules defined in (a) and / or (b). [Figure 4] 4 shows the linker and ligand portions of a construct suitable for use according to the present invention, including tether 2a. While Figure 4 illustrates a linker conjugated to an oligonucleotide, it should be understood that the present invention also encompasses conjugates of the same linkers with the oligonucleosides disclosed herein. [Figure 5] 5 shows the linker and ligand portions of a construct suitable for use according to the present invention, comprising tether 2b. While Figure 5 illustrates a linker conjugated to an oligonucleotide, it should be understood that the present invention also encompasses conjugates of the same linkers with the oligonucleosides disclosed herein. [Figure 6-1] FIG. 1 is a diagram showing the formulas described in Propositions 1 to 101 disclosed in this specification. [Figure 6-2] FIG. 1 is a diagram showing the formulas described in Propositions 1 to 101 disclosed in this specification. [Figure 6-3]FIG. 1 is a diagram showing the formulas described in Propositions 1 to 101 disclosed in this specification. [Figure 6-4] FIG. 1 is a diagram showing the formulas described in Propositions 1 to 101 disclosed in this specification. [Figure 6-5] FIG. 1 is a diagram showing the formulas described in Propositions 1 to 101 disclosed in this specification. [Figure 6-6] FIG. 1 is a diagram showing the formulas described in Propositions 1 to 101 disclosed in this specification. [Figure 6-7] FIG. 1 is a diagram showing the formulas described in Propositions 1 to 101 disclosed in this specification. [Figure 6-8] FIG. 1 is a diagram showing the formulas described in Propositions 1 to 101 disclosed in this specification. [Figure 7-1] FIG. 1 shows the formulas described in items 1 to 56 disclosed herein. [Figure 7-2] FIG. 1 shows the formulas described in items 1 to 56 disclosed herein. [Figure 7-3] FIG. 1 shows the formulas described in items 1 to 56 disclosed herein. [Figure 7-4] FIG. 1 shows the formulas described in items 1 to 56 disclosed herein. [Figure 7-5] FIG. 1 shows the formulas described in items 1 to 56 disclosed herein. [Figure 8]Figures 8a and 8b: Reverse abasic constructs that can be used with the nucleic acid sequences according to the invention described herein. In Figure 8a, the GalNAc linker is attached to the 5' end of the sense strand in use (not shown in Figure 8a). In Figure 8b, the GalNAc linker is attached to the 3' end region of the sense strand in use (not shown in Figure 8b). The iaia shown in the 3'-terminal region of the sense strand in Figure 8a represents (i) two abasic nucleosides provided as the penultimate and terminal nucleosides in the 3'-terminal region of the sense strand, (ii) a 3'-3' backlink is provided between the penultimate nucleoside of the sense strand (i.e., position 21 of the sense strand, where position 1 is the terminal 5' nucleoside of the sense strand) and the adjacent penultimate abasic residue, and (iii) the linkage between the terminal abasic nucleoside and the penultimate abasic nucleoside is 5'-3' when read toward the 3'-terminal region including the terminal abasic nucleoside and the penultimate abasic nucleoside. The iaia shown in the 5'-terminal region of the sense strand in Figure 8b represents (i) two abasic nucleosides provided as the penultimate and terminal nucleosides in the 5'-terminal region of the sense strand, (ii) a 5'-5' backlink is provided between the penultimate nucleoside of the sense strand (i.e., position 1 of the sense strand, which does not include the iaia motif in the 5'-terminal region of the sense strand in the numbering of nucleoside positions in the sense strand) and the adjacent penultimate abasic residue, and (iii) the linkage between the terminal abasic nucleoside and the penultimate abasic nucleoside is 3'-5' when reading toward the 5'-terminal region including the terminal abasic nucleoside and the penultimate abasic nucleoside. [Figure 9] 9a and 9b: Duplex constructs according to Table 5. [Figure 10]Figure 1 shows a summary of the mRNA and protein knockdown effects of a single dose (1 mg / kg or 3 mg / kg) of GalNAc-siRNAs ETX-M00001397, ETX-M00001570, ETX-M00001378, ETX-M00001513, and ETX-M00001527 in mouse liver tissue. Non-target-specific siRNA was used as a negative control. The y-axis values ​​are relative mRNA or protein expression, and data are normalized to the saline control group (n=4). Each data point represents relative mRNA or protein expression as the mean ± SEM from n=4 experiments. [Figure 11] Liver samples stained by H&E were assigned a NAFLD activity score (NAS) using the clinical criteria outlined by Kleiner et al. (2005). The total NAS represents the sum of scores for steatosis, inflammation, and ballooning, and ranges from 0 to 8. NAS scores were determined by the Gubra Histopathological Objective Scoring Technology (GHOST) deep learning application, developed by Gubra using VIS software (Visiopharm, Denmark) for a more accurate and objective method for classifying disease in the DIO-NASH mouse model. Results are expressed as the change (improvement or worsening) in NAS score at the end of the study compared to the pretreatment biopsy. The percentage of animals with at least a 1- or 2-point improvement in NAS is also shown. [Figure 12]ALT and AST were measured in plasma samples after 12 weeks of ETX-312 (ETX-M00001378) treatment using a commercially available kit (Roche Diagnostics) on a cobas c501 automated analyzer. ALT and AST levels were increased in DIO-NASH mice (vehicle sc, siCtrl, vehicle PO). Treatment with ETX-312 (ETX-M00001378) alone or in combination with semaglutide or resmetirom significantly reduced both ALT and AST levels. Results are shown as mean ± SEM absolute levels from n=16 experiments. * p<0.05; *** p<0.001; **** p<0.0001. [Figure 13] TIMP-1 and PIIINP are non-invasive blood biomarkers for NAFLD / NASH that predict liver fibrosis. TIMP-1 was measured in plasma collected in EDTA tubes using a commercially available ELISA kit (R&D Systems). PIIINP was measured in plasma collected in EDTA tubes using a commercially available ELISA kit (Cusabio). TIMP-1 and PIIINP levels were increased in DIO-NASH mice (vehicle sc, siCtrl, vehicle PO). Treatment with ETX-312 (ETX-M00001378) alone or in combination with semaglutide or resmetirom significantly reduced both TIMP-1 and PIIINP levels. Results are shown as mean ± SEM of absolute levels from n=16 experiments. Outlier analysis was performed by comparing the studentized residuals of a linear model fitted to the subcutaneous treatment subset of data with the critical Bonferroni alpha level (0.05 / 88 = ~0.00057). One animal in the semaglutide group was identified as an outlier, which was confirmed by influence analysis. This animal was concluded to be a significant outlier and influencer and was excluded from all TIMP-1 and PIIINP analyses. * p < 0.05; *** p < 0.001; **** p < 0.0001 [Figure 14]Final liver weight-to-body weight ratio demonstrates hepatomegaly in DIO-NASH mice. Treatment with ETX-312 (ETX-M00001378) alone or in combination with semaglutide or resmetirom significantly reduced liver-to-body weight ratio. Results are shown as mean±SEM of percent liver:body weight for n=16 experiments. **p<0.01;****p<0.0001. DETAILED DESCRIPTION OF THE INVENTION

[0108] The present invention provides, inter alia, inhibitors, e.g., oligomers such as nucleic acids, e.g., inhibitory RNA molecules (sometimes referred to as iRNA or siRNA), and compositions comprising them, that can affect the expression of a target, e.g., by binding to mRNA transcribed from a gene. The target may be present within a cell, e.g., within a cell of a subject, such as a human. The inhibitors can be used, for example, to prevent and / or treat medical conditions associated with the expression of the target gene.

[0109] In particular, the present invention identifies inhibitors of SLC25A5 / ANT2 expression and / or function that are useful in the prevention and / or treatment of metabolic diseases or disorders, such as metabolic diseases or disorders associated with non-alcoholic fatty liver disease (NAFLD), and / or diseases or disorders associated with obesity and / or lipogenesis.

[0110] ADP / ATP translocase 2 (ANT2) is a protein encoded by the SLC25A5 gene on the X chromosome in humans. This protein functions as an exchanger for ADP / ATP between the mitochondrial matrix and the cytoplasm.

[0111] The present invention relates to inhibitors of the expression and / or function of SLC25A5 / ANT2. Thus, in certain embodiments, the present invention relates to inhibitors of the expression of the SLC25A5 gene, such as siRNAs that target mRNA transcribed from the SLC25A5 gene. In certain embodiments, the present invention relates to inhibitors of the function of the gene product ANT2. When referring herein to inhibitors of SLC25A5 / ANT2 or inhibitors of the present invention, both options are encompassed.

[0112] In humans, ANT2 is encoded by the SLC25A5 gene (SEQ ID NO: 1381).

[0113] SEQ ID NO: 1381 (SLC25A5)

[0114] We used network analysis, which allows us to assign multiple genes or proteins to a smaller number of driver processes and identify potential drug targets from these processes. The approach takes advantage of information typically ignored in standard gene set analysis: known and predicted interactions between genes (and proteins), as well as the inclusion of other genes in the same or related pathways. In particular, we analyzed genome-wide association study (GWAS) meta-analyses of nonalcoholic fatty liver disease (NAFLD) using a network model that highlighted SLC25A5 / ANT2 as a preferred target for NAFLD among other known targets associated with NAFLD.

[0115] The inhibition disclosed herein may be inhibition of the gene SLC25A5 or the protein ANT2 resulting from expression of the SLC25A5 gene, and reference to SLC25A5 / ANT2 thereby explicitly incorporates reference to inhibition of gene expression or function and, separately, inhibition of the protein product.

[0116] definition " First strand " is also referred to herein as antisense strand or guide strand, which can be used interchangeably herein, and refers to the strand of nucleic acid, such as siRNA, for example, dsiRNA, that comprises a region that is substantially complementary to target sequence, for example, mRNA. As used herein, the term "region of complementarity" refers to the region of the antisense strand that is substantially complementary to sequence, for example, target sequence. If the region of complementarity is not completely complementary to the target sequence, the mismatch can be in the internal region of the molecule or in the terminal region. In some embodiments, the double-stranded nucleic acid of the present invention, for example, siRNA agent, comprises nucleotide mismatch in the antisense strand.

[0117] "Second strand" (also referred to herein as the sense strand or passenger strand, which may be used interchangeably herein) refers to the strand of a nucleic acid, e.g., an siRNA, that includes a region that is substantially complementary to a region of the antisense strand, as that term is defined herein.

[0118] In the context of molecules comprising a nucleic acid with a ligand moiety and optionally also with a linker moiety, the nucleic acid of the invention may be referred to as an oligonucleotide or oligonucleoside moiety.

[0119] Oligonucleotides are short nucleic acid polymers. Although oligonucleotides contain phosphodiester bonds between their nucleoside components (base + sugar), the present invention is not limited to oligonucleotides that are always linked by such phosphodiester bonds between adjacent nucleosides, and other oligomers of nucleosides linked by bonds other than phosphate bonds are contemplated. For example, the linkage between nucleotides may be a phosphorothioate bond. Therefore, the term "oligonucleoside" herein encompasses both oligonucleotides and other oligomers of nucleosides. According to the present invention, oligonucleosides that are nucleic acids with at least a portion being an oligonucleotide are preferred. According to the present invention, oligonucleosides that have one or more or most phosphodiester backbone bonds between nucleosides are also preferred. Also preferred according to the present invention are oligonucleosides that have one or more or mostly phosphodiester backbone linkages between nucleosides and also have one or more phosphorothioate backbone linkages between nucleosides (typically in the terminal regions of the first and / or second strands).

[0120] As used herein, the nucleic acid according to the present invention is preferably a double-stranded oligonucleoside containing one or more phosphorothioate backbone bonds between nucleosides.Therefore, in all instances where the present application specifically refers to an oligonucleotide in the chemical structure disclosed herein, the oligonucleotide may equally be an oligonucleoside as defined herein.

[0121] In some embodiments, the double-stranded nucleic acid of the present invention, for example, the siRNA agent, contains a nucleoside mismatch in the sense strand. In some embodiments, the nucleoside mismatch is, for example, within 5, 4, 3, 2, or 1 nucleoside from the 3' end of the nucleic acid, for example, the siRNA.

[0122] In another embodiment, the nucleoside mismatch is present, for example, at the 3' terminal nucleoside of a nucleic acid, eg, an siRNA.

[0123] A "target sequence" (sometimes called a target RNA or target mRNA) refers to the contiguous portion of the nucleoside sequence of an mRNA molecule formed during transcription of a gene, including mRNA that is the product of RNA processing of a primary transcript, or it may be the contiguous portion of the nucleotide sequence of any RNA molecule, such as an LNCRNA, that is desired to be inhibited.

[0124] The target sequence may be about 10-35 nucleosides in length, for example, about 15-30 nucleosides in length. For example, the target sequence may be about 15-30 nucleosides in length, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29 ... 21-23, 21-24, 21-23, or 21-22 nucleosides in length. Ranges and lengths intermediate to the above-listed ranges and lengths are also contemplated as being part of the present invention.

[0125] The term "ribonucleoside" or "nucleoside" can also refer to modified nucleosides, as further detailed below.

[0126] The nucleic acid may be DNA or RNA and may contain modified nucleosides. The preferred nucleic acid is RNA.

[0127] The terms "iRNA," "siRNA," "RNAi agent," and "iRNA agent," "RNA interfering agent," as used interchangeably herein, refer to agents that contain RNA and mediate targeted cleavage of RNA transcripts via the RNA-induced silencing complex (RISC) pathway. siRNA directs the sequence-specific degradation of mRNA through RNA interference (RNAi).

[0128] Double-stranded RNA, referred to herein as a "double-stranded siRNA (dsiRNA) agent," "double-stranded siRNA (dsiRNA) molecule," "double-stranded RNA (dsRNA) agent," "double-stranded RNA (dsRNA) molecule," "dsiRNA agent," "dsiRNA molecule," or "dsiRNA," refers to a complex of ribonucleic acid molecules having a duplex structure containing two antiparallel, substantially complementary nucleic acid strands, said to have "sense" and "antisense" orientations relative to the target RNA. The majority of nucleosides in each strand of a nucleic acid, e.g., a dsRNA molecule, are preferably ribonucleosides, although in such cases, each or both strands may further contain one or more non-ribonucleosides, such as deoxyribonucleosides or modified ribonucleosides. Additionally, as used herein, "siRNA" may include ribonucleosides with chemical modifications.

[0129] The term "modified nucleoside" refers to a nucleoside having, independently, a modified sugar moiety, a modified internucleoside linkage, or a modified nucleobase, or any combination thereof. Thus, the term modified nucleoside includes, for example, the substitution, addition, or removal of a functional group or atom to the internucleoside linkage, sugar moiety, or nucleobase. Any such modifications used in siRNA-type molecules are encompassed by "iRNA" or "RNAi agent" or "siRNA" or "siRNA agent" for purposes of this specification and claims.

[0130] The duplex region of the nucleic acid of the present invention, e.g., dsRNA, can be about 9 to 40 base pairs in length, e.g., 9 to 36 base pairs in length, e.g., about 15 to 30 base pairs in length, e.g., about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs in length, e.g., about 15 to 30, 15 to 29, 15 to 28, 15 to 27, 15 to 26, 15 to 25, 15 to 24, 15 to 23, 15 to 22, 15 to 21, 15 to 20, 15 to 19, 15 to 18, 15 to 17, 18 to 30, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26 ... The length may be in the range of 9, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs.

[0131] The two strands forming the duplex structure may be different portions of one larger molecule, or may be separate molecules, such as RNA molecules.

[0132] The term "nucleoside overhang" refers to at least one unpaired nucleoside extending from the duplex structure of a double-stranded nucleic acid. A ds nucleic acid may contain an overhang of at least one nucleoside; alternatively, the overhang may contain at least two nucleosides, at least three nucleosides, at least four nucleosides, at least five nucleosides, or more nucleosides. The nucleoside overhang may comprise or consist of nucleoside analogs, including deoxynucleosides. The overhang may be present in the sense strand, the antisense strand, or any combination thereof. Furthermore, the nucleoside of the overhang may be present at the 5'-end, the 3'-end, or both ends of either the antisense strand or the sense strand.

[0133] In certain embodiments, the antisense strand has an overhang of 1 to 10 nucleosides at the 3' or 5' end, e.g., 0 to 3, 1 to 3, 2 to 4, 2 to 5, 4 to 10, 5 to 10, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleosides.

[0134] "Blunt" or "blunt end" means that there are no unpaired nucleosides at the ends of a double-stranded nucleic acid, i.e., there are no nucleoside overhangs. Nucleic acids of the present invention include those that do not have a nucleoside overhang at one end or that do not have a nucleoside overhang at either end.

[0135] Unless otherwise indicated, the term "complementary," when used to describe a first nucleoside sequence in relation to a second nucleoside sequence, refers to the ability of an oligonucleoside comprising the first nucleoside sequence to hybridize to form a duplex structure with an oligonucleoside or polynucleoside comprising the second nucleoside sequence under certain conditions, as will be understood by those of skill in the art. Such conditions may be, for example, stringent conditions, which may include 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, at 50°C or 70°C for 12-16 hours, followed by washing (see, e.g., Molecular Cloning: A Laboratory Manual, Sambrook et al. (1989) Cold Spring Harbor Laboratory Press).

[0136] The complementary sequence in the nucleic acid described herein, for example, dsiRNA, comprises base pairing over the entire length of one or both nucleoside sequences of the oligonucleoside or polynucleoside comprising the first nucleoside sequence and the oligonucleoside or polynucleoside comprising the second nucleoside sequence.Such sequences can be referred to herein as "fully complementary" to each other.However, when the first sequence is referred to herein as "substantially complementary" or "partially complementary" to the second sequence, the two sequences can be fully complementary, or can form one or more, but preferably no more than five, mismatched base pairs, such as 2, 4, or 5 mismatched base pairs, while retaining the ability to hybridize under the conditions most relevant to the final application, for example, the inhibition of gene expression via the RISC pathway.Overhangs are not considered mismatches when determining complementarity. Further, for example, a nucleic acid, e.g., a dsRNA, comprising one oligonucleoside 17 nucleosides in length and another oligonucleoside 19 nucleosides in length, wherein the longer oligonucleoside comprises a sequence of 17 nucleosides that is perfectly complementary to the shorter oligonucleoside, can be said to be "fully complementary."

[0137] "Complementary" sequences, as used herein, may also contain or consist exclusively of non-Watson-Crick base pairs or base pairs formed from non-natural and modified nucleosides, so long as they meet the above requirements for their ability to hybridize. Such non-Watson-Crick base pairs include, but are not limited to, G:U wobble base pairing or Hoogsteen base pairing.

[0138] The terms "complementary," "fully complementary," and "substantially / partially complementary" can be used herein in reference to base matching between a nucleic acid, e.g., the sense strand and antisense strand of a dsiRNA, or between a double-stranded nucleic acid, e.g., the antisense strand of an siRNA agent, and a target sequence.

[0139] In the present invention, the second strand of the nucleic acid of the present invention, particularly the dsiRNA for inhibiting SLC25A5, is at least partially complementary to the first strand of said nucleic acid.In certain embodiments, the first strand and the second strand of the nucleic acid of the present invention are partially complementary when they form a double-stranded region that has a length of at least 17 base pairs and contains 1, 2, 3, 4 or 5 or less mismatched base pairs.

[0140] In certain embodiments, the first and second strands of a nucleic acid according to the invention are partially complementary if they form a duplex region that is 19 base pairs in length and has no more than 1, 2, 3, 4, or 5 mismatched base pairs. In certain embodiments, the first and second strands of a nucleic acid according to the invention are partially complementary if they form a duplex region that is 21 base pairs in length and has no more than 1, 2, 3, 4, or 5 mismatched base pairs.

[0141] Alternatively, the first strand and the second strand of the nucleic acid according to the invention are partially complementary when they form a duplex region having a length of at least 17 base pairs, wherein at least 14, 15, 16, or 17 of said base pairs are complementary base pairs, in particular Watson-Crick base pairs.

[0142] In certain embodiments, the first and second strands of a nucleic acid according to the invention are partially complementary when they form a duplex region having a length of 19 base pairs, in which at least 14, 15, 16, 17, 18, or all 19 base pairs are complementary base pairs, particularly Watson-Crick base pairs. In certain embodiments, the first and second strands of a nucleic acid according to the invention are partially complementary when they form a duplex region having a length of 21 base pairs, in which at least 16, 17, 18, 19, 20, or all 21 base pairs are complementary base pairs, particularly Watson-Crick base pairs.

[0143] As used herein, a nucleic acid that is "substantially complementary" or "partially complementary" to at least a portion of a messenger RNA (mRNA) refers to a polynucleoside that is substantially or partially complementary to a contiguous portion of an mRNA of interest (e.g., an mRNA encoding a gene). In certain embodiments, the contiguous portion of the mRNA is any one of the sequences listed in Table 1, i.e., SEQ ID NOS: 1-276. For example, a polynucleoside is complementary to at least a portion of an mRNA of a gene of interest if its sequence is substantially or partially complementary to a non-interrupted portion of the mRNA encoding that gene.

[0144] Thus, in some preferred embodiments, the antisense oligonucleosides disclosed herein are perfectly complementary to the target gene sequence.

[0145] In other embodiments, the antisense oligonucleosides disclosed herein are substantially or partially complementary to a target RNA sequence, and comprise a contiguous nucleoside sequence that is at least about 80% complementary, e.g., at least about 85%, 86%, 87%, 88%, 89%, about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary, or 100% complementary, to the equivalent region of the target RNA sequence over its entire length.

[0146] In certain embodiments, the first (antisense) strand of a nucleic acid according to the invention is partially or fully complementary to a continuous portion of RNA transcribed from the SLC25A5 gene. In certain embodiments, the first strand of a nucleic acid according to the invention is partially or fully complementary to a continuous portion of at least 17 nucleosides of SLC25A5 mRNA. In certain embodiments, the first strand of a nucleic acid according to the invention is partially or fully complementary to a continuous portion of 17, 18, 19, 20, 21, 22, or 23 nucleosides of SLC25A5 mRNA. In certain embodiments, the first strand of a nucleic acid according to the invention is partially or fully complementary to a continuous portion of 17, 18, 19, 20, 21, 22, or 23 nucleosides of any one of the sequences listed in Table 1, i.e., any one of SEQ ID NOs: 1-276.

[0147] In certain embodiments, the first (antisense) strand of a nucleic acid according to the invention comprises a contiguous nucleoside sequence of at least 17 nucleosides, wherein at least 14, 15, 16, or 17 nucleosides of the contiguous nucleoside sequence are partially complementary to a contiguous portion of SLC25A5 mRNA when the contiguous nucleoside sequence is complementary to a contiguous portion of SLC25A5 mRNA. In certain embodiments, the first strand of a nucleic acid according to the invention comprises a contiguous nucleoside sequence of at least 17 nucleosides, wherein at least 14, 15, 16, or 17 nucleosides of the contiguous nucleoside sequence are complementary to a contiguous portion of any one of the sequences listed in Table 1, i.e., any one of SEQ ID NOs: 1-276. In certain embodiments, a first strand of a nucleic acid according to the invention comprises a 19-nucleoside contiguous nucleoside sequence, wherein at least 14, 15, 16, 17, 18, or all 19 nucleosides of said contiguous nucleoside sequence are complementary to a contiguous portion of any one of the sequences listed in Table 1, i.e., any one of SEQ ID NOs: 1-276. In certain embodiments, a first strand of a nucleic acid according to the invention comprises a 23-nucleoside contiguous nucleoside sequence, wherein at least 18, 19, 20, 21, 22, or all 23 nucleosides of said contiguous nucleoside sequence are complementary to a contiguous portion of any one of the sequences listed in Table 1, i.e., any one of SEQ ID NOs: 1-276.

[0148] In some embodiments, the nucleic acid of the present invention, for example, siRNA, comprises a sense strand that is substantially or partially complementary to antisense oligonucleoside, and antisense oligonucleoside is thus complementary to target gene sequence and comprises a contiguous nucleoside sequence.The nucleoside sequence of sense strand is typically at least about 80% complementary to the equivalent region of the nucleoside sequence of antisense strand over its entire length, for example, about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% complementary, or 100% complementary.

[0149] In some embodiments, the nucleic acids, e.g., siRNAs, of the invention are substantially or partially complementary to a target sequence and comprise an antisense strand comprising a contiguous nucleoside sequence that is at least 80% complementary, e.g., about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary, or 100% complementary, to the target sequence over its entire length.

[0150] As used herein, a "subject" is an animal, such as a mammal, including a primate (human, non-human primate, such as monkeys and chimpanzees), or non-primate, or a bird, that expresses a target gene, either endogenously or heterologously, when the target gene sequence has sufficient complementarity to a nucleic acid, e.g., an iRNA agent, to promote target knockdown. In certain preferred embodiments, the subject is a human.

[0151] The terms "treat" or "treatment" refer to a beneficial or desired result, including, but not limited to, alleviating or ameliorating one or more symptoms associated with gene expression. "Treatment" can also mean prolonging survival as compared to expected survival if not receiving treatment.

[0152] The term "prevent" or "prevention," as used herein, is defined as eliminating or reducing the likelihood of one or more symptoms of a disease or disorder occurring. For example, the inhibitors disclosed herein can be used to prevent the occurrence of metabolic diseases or disorders associated with non-alcoholic fatty liver disease (NAFLD), and / or diseases or disorders associated with obesity and / or lipogenesis.

[0153] A "therapeutically effective amount," as used herein, is intended to include the amount of a nucleic acid, e.g., an iRNA, that, when administered to a patient for treating a subject having a disease, is sufficient to effect treatment of the disease (e.g., by reducing, ameliorating, or maintaining an existing disease or one or more symptoms of the disease or its associated complications).

[0154] The phrase "pharmaceutically acceptable" is used herein to refer to compounds, substances, compositions, or dosage forms that are suitable for use in contact with the tissues of human and animal subjects without undue toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0155] The phrase "pharmaceutically acceptable carrier," as used herein, means a pharmaceutically acceptable substance, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid, or solvent encapsulating substance, that is involved in the transport or transfer of a compound of interest from one organ or part of the body to another. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not harmful to the subject being treated.

[0156] When a value or range of values ​​for a parameter is listed, it is intended that values ​​and ranges intermediate to the listed values ​​are also part of the invention.

[0157] The articles "a" and "an" are used herein to refer to one or to more than one (ie to at least one) of the grammatical object of the article.

[0158] The term "including" is used herein to mean, and is used interchangeably with, the phrase "including but not limited to."

[0159] The term "or" is used herein to mean, and is used interchangeably with, the term "and / or," unless the context clearly dictates otherwise. For example, "the sense strand or the antisense strand" is understood to mean "the sense strand or the antisense strand, or the sense strand and the antisense strand."

[0160] The term "about" is used herein to mean within a typical range of acceptable error in the art. For example, "about" can be understood to be about 2 standard deviations from the mean. In certain embodiments, about means +10%. In certain embodiments, about means +5%. When about is present before a series of numbers or ranges, it is understood that "about" can modify each number in the series or range.

[0161] The term "at least" before a number or series of numbers is understood to include the number adjacent to the term "at least," as well as all subsequent numbers or integers that can be logically included as is apparent from the context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, "at least 18 nucleosides of a 21-nucleoside nucleic acid molecule" means that 18, 19, 20, or 21 nucleosides have the specified property. When at least is present before a series of numbers or range, it is understood that "at least" can modify each number in the series or range.

[0162] As used herein, "less than" or "below" refers to the value adjacent to the term and the theoretically lower, and in some cases, logically zero, value or integer. For example, a duplex with an overhang of "two nucleosides or less" has an overhang of 2, 1, or 0 nucleosides. When "less than" appears after a series of numbers or ranges, it is understood that "less than" can modify each number in the series or range.

[0163] The terminal region of a strand is the last 5 nucleotides from the 5' or 3' end.

[0164] A nucleobase sequence is the sequence of bases in an oligomeric nucleic acid.

[0165] The various embodiments of the invention may be combined as determined to be appropriate by those skilled in the art.

[0166] target The targets of inhibition disclosed herein may be, but are not limited to, mRNA, polypeptides, proteins, or genes.

[0167] These targets are targets whose inhibition is useful in the prevention and / or treatment of metabolic diseases or disorders associated with non-alcoholic fatty liver disease (NAFLD), and / or diseases or disorders associated with obesity and / or lipogenesis, and / or reducing lipogenesis.

[0168] The target of inhibition is the gene SLC25A5 or its gene product, for example, mRNA transcribed from the SLC25A5 gene or the ANT2 protein, and inhibition can be achieved by inhibiting the expression or function of the SLC25A5 / ANT2 gene or protein or both.

[0169] In a preferred embodiment, the target is the mRNA expressed from the SLC25A5 gene. Exemplary target sequences for SLC25A5 mRNA are listed in Table 1 below.

[0170] Table 1 below provides oligonucleoside mRNA target sequences for SLC25A5 along with the corresponding positions in the transcript ENST00000317881.9. It should be understood that SEQ ID NOs: 1-276 refer to human (Homo sapiens) mRNA sequences.

[0171] [Table 5] JPEG2026505829000012.jpg255158JPEG2026505829000013.jpg255158JPEG20265058290 00014.jpg255157JPEG2026505829000015.jpg255158JPEG2026505829000016.jpg143169

[0172] It should be understood that SEQ ID NOs: 1-276 relate to human (Homo sapiens) mRNA sequences.

[0173] Disease / Condition The present invention further provides a method for treating a subject in need thereof.The treatment method of the present invention comprises administering a therapeutically effective amount of a nucleic acid such as an siRNA of the present invention, for example, a nucleic acid such as an siRNA targeting SLC25A5, or a pharmaceutical composition comprising a nucleic acid targeting SLC25A5, to a subject, for example, a subject that will benefit from reducing or inhibiting the expression of the SLC25A5 gene.The disease to be treated is related to metabolic diseases or disorders, for example, metabolic diseases or disorders associated with non-alcoholic fatty liver disease (NAFLD), and / or diseases or disorders associated with obesity and / or lipogenesis and / or lipogenesis.

[0174] The disease to be treated is a metabolic disease or disorder, for example a metabolic disease or disorder associated with non-alcoholic fatty liver disease (NAFLD), and / or a disease or disorder associated with obesity and / or lipogenesis and / or lipogenesis.

[0175] The inhibitors according to the present invention can be used to prevent and / or treat metabolic diseases or disorders. As used herein, the term "metabolic disease" refers to a disease or condition that affects metabolic processes in a subject and is often caused by a disruption of normal metabolism.

[0176] The patient to be treated may be one who already has a metabolic disease or disorder or one who is at risk of developing a metabolic disease or disorder. That is, in certain embodiments, the inhibitors of the present invention can be used to treat and / or manage an existing metabolic disease or disorder. Treatment and / or management of an existing metabolic disease or disorder with the inhibitors of the present invention may prevent the metabolic disease or disorder from worsening and / or may improve the metabolic disease or disorder. In some cases, treatment of an existing metabolic disease or disorder with the inhibitors of the present invention may even cure the metabolic disease or disorder. In certain embodiments, the inhibitors of the present invention may be used to prevent the manifestation of a metabolic disease or disorder in a patient who is at risk of developing a metabolic disease or disorder.

[0177] Those skilled in the art can diagnose whether a patient has metabolic disease or disorder, or whether they are at risk of developing metabolic disease or disorder.For example, metabolic disease or disorder can be diagnosed based on weight gain and / or one or more blood markers, including but not limited to blood glucose level, blood insulin level, blood free fatty acid level, blood HbA1c level, blood fibrinogen level, blood cholesterol level and blood triglyceride level.Those skilled in the art will be aware of the threshold value of one or more blood markers that indicate the existence of metabolic disease or disorder, or the risk of developing metabolic disease or disorder.

[0178] In certain embodiments, the metabolic disease is fatty liver disease, particularly non-alcoholic fatty liver disease (NAFLD).As used herein, "fatty liver disease" refers to a disease in which fat accumulates excessively in the liver, which can lead to serious diseases such as chronic hepatitis and cirrhosis.In patients with fatty liver disease, lipids, particularly triglycerides, accumulate in hepatocytes to an extent that their amount exceeds the physiologically acceptable range.From a biochemical point of view, the criterion for determining fatty liver is that the weight of triglycerides is about 10% or more of the wet weight of liver tissue (100mg / g wet weight).Fatty liver disease is generally detected by observing the increase in serum levels of liver-specific enzymes such as transaminases ALT and AST, which serve as indicators of hepatocellular damage, and by the appearance of symptoms including fatigue and pain in the liver region; however, definitive diagnosis often requires biopsy, which can be assisted by imaging such as ultrasound and / or MRI. The term "NAFLD" or "non-alcoholic fatty liver disease," as used herein, refers to a condition that occurs when fat is deposited in the liver (steatosis) and is not due to excessive alcohol use. It is associated with insulin resistance and metabolic syndrome.

[0179] In preferred embodiments, fatty liver disease is non-alcoholic steatohepatitis (NASH).NASH as used herein refers to the liver disease characterized by the accumulation of fat (lipid droplets) along with inflammation and degeneration of hepatocyte.Once developed, this disease is accompanied by a high risk of liver cirrhosis, which is the state of liver function change, and can progress to liver failure.After that, NASH often progresses to liver cancer.

[0180] In certain embodiments, the present invention relates to an inhibitor according to the present invention for use in reducing one or more of steatosis, intralobular inflammation, and / or hepatocellular ballooning.

[0181] In certain embodiments, the present invention relates to an inhibitor according to the present invention for use in the treatment and / or prevention of a disease or disorder associated with increased steatosis, increased intralobular inflammation, and / or increased hepatocellular ballooning.

[0182] In certain embodiments, the present invention relates to an inhibitor according to the present invention for use in the treatment and / or prevention of fatty liver disease, such as NAFLD or NASH, wherein the inhibitor results in one or more of reduced steatosis, reduced intralobular inflammation, and / or reduced hepatocellular ballooning.

[0183] In certain embodiments, the present invention relates to an inhibitor according to the present invention for use in the treatment and / or prevention of hepatic steatosis.

[0184] In certain embodiments, the present invention relates to an inhibitor according to the present invention for use in the treatment and / or prevention of intralobular inflammation of the liver.

[0185] In certain embodiments, the present invention relates to an inhibitor according to the present invention for use in the treatment and / or prevention of hepatocellular ballooning in the liver.

[0186] In certain embodiments, the present invention relates to an inhibitor according to the present invention for use in the treatment or prevention of liver fibrosis in a patient.

[0187] In certain embodiments, the present invention relates to an inhibitor according to the present invention for use in the treatment and / or prevention of a disease or disorder associated with liver fibrosis.

[0188] In certain embodiments, the present invention relates to an inhibitor according to the present invention for use in the treatment and / or prevention of fatty liver disease, such as NAFLD or NASH, wherein the inhibitor according to the present invention reduces the stage of fibrosis.

[0189] Those skilled in the art are aware of methods for determining the level of hepatic steatosis, intralobular inflammation, hepatocellular ballooning, or stage of fibrosis in a patient.

[0190] In certain embodiments, the present invention relates to an inhibitor according to the present invention for use in reducing the level of one or more of alanine transaminase (ALT), aspartate transaminase (AST), tissue inhibitor of metalloproteinase-1 (TIMP-1) and / or type III procollagen peptide (PIIINP) in a patient.

[0191] In certain embodiments, the present invention relates to an inhibitor according to the invention for use in the treatment and / or prevention of a disease associated with elevated levels of one or more of alanine transaminase (ALT), aspartate transaminase (AST), tissue inhibitor of metalloproteinase-1 (TIMP-1) and / or type III procollagen peptide (PIIINP) in a patient.

[0192] In certain embodiments, the present invention relates to an inhibitor according to the invention for use in the treatment and / or prevention of a metabolic disease or disorder associated with elevated levels of one or more of alanine transaminase (ALT), aspartate transaminase (AST), tissue inhibitor of metalloproteinase-1 (TIMP-1) and / or type III procollagen peptide (PIIINP) in a patient.

[0193] In certain embodiments, the present invention relates to an inhibitor according to the invention for use in the treatment and / or prevention of a metabolic disease or disorder, which reduces the level of one or more of alanine transaminase (ALT), aspartate transaminase (AST), tissue inhibitor of metalloproteinase-1 (TIMP-1) and / or type III procollagen peptide (PIIINP) in a patient.

[0194] In certain embodiments, the present invention relates to an inhibitor according to the invention for use in the treatment and / or prevention of fatty liver disease, such as NAFLD or NASH, which reduces the level of one or more of alanine transaminase (ALT), aspartate transaminase (AST), tissue inhibitor of metalloproteinase-1 (TIMP-1) and / or type III procollagen peptide (PIIINP) in a patient.

[0195] Those skilled in the art are aware of methods and commercially available kits for determining ALT, AST, TIMP-1 and PIIINP levels in patients.

[0196] In certain embodiments, the present invention relates to an inhibitor according to the present invention for use in reducing the ratio between liver weight and body weight.

[0197] In certain embodiments, the present invention relates to an inhibitor according to the present invention for use in the treatment and / or prevention of a disease or disorder associated with increased liver weight.

[0198] In certain embodiments, the present invention relates to an inhibitor according to the present invention for use in the treatment and / or prevention of metabolic diseases or disorders associated with increased liver weight.

[0199] In certain embodiments, the present invention relates to an inhibitor according to the present invention for use in the treatment and / or prevention of a metabolic disease or disorder, wherein the inhibitor according to the present invention reduces the ratio between liver weight and body weight in a patient.

[0200] In certain embodiments, the present invention relates to an inhibitor according to the present invention for use in the treatment and / or prevention of fatty liver disease, such as NAFLD or NASH, wherein the inhibitor according to the present invention reduces the ratio between liver weight and body weight in a patient.

[0201] In certain embodiments, the metabolic disease is obesity. As used herein, the term "obesity" refers to a condition in which the natural energy reserves stored in the adipose tissue of animals, particularly humans and other mammals, increase to the point where this condition is associated with increased certain health conditions or mortality. As used herein, the term "obese" is defined for adult humans with a body mass index (BMI) greater than 30. Obesity is generally associated with excessive weight gain, particularly dietary weight gain. "(Dietary) weight gain" is defined herein as weight gain resulting from excessive dietary intake, including excessive dietary intake of fat, particularly saturated fat, and optionally excessive dietary intake of simple sugars, including sucrose and fructose. For a given subject, excessive dietary intake, particularly of fat, and optionally excessive dietary intake of simple sugars, refers to the consumption of a larger amount of food, particularly fat, and optionally simple sugars, than is required to meet physiological needs and maintain the subject's energy balance. The effect of a treatment on reducing or preventing diet-induced weight gain in a subject can be assessed by comparing the weight gain observed in a treated subject with the weight gain observed in the same untreated subject, consuming the same diet and having the same level of physical activity.

[0202] In certain embodiments, a patient is at risk of developing obesity if they have a BMI greater than 25. In certain embodiments, a patient is obese if they have a BMI greater than 30.

[0203] The term "body mass index" as used herein means the ratio of body weight in kg divided by the square of height in meters.

[0204] "Adipogenesis-associated disease" refers to a medical condition characterized by abnormal proliferation and differentiation of adipocytes (fat cells) in the body, resulting in the excessive accumulation of adipose tissue. This condition often leads to health complications such as obesity, metabolic disorders, and related comorbidities.

[0205] In the present invention, "reduced lipogenesis" refers to medical or pharmaceutical intervention designed to reduce the formation and accumulation of adipocytes in the body.The reduced lipogenesis can be determined and / or quantified based on the size and / or number of adipocytes in tissue samples obtained from patients.Alternatively or additionally, the reduced lipogenesis can be determined and / or quantified by gene expression analysis, measuring lipogenesis markers (i.e., by ELISA), assessing lipid accumulation in samples, and / or measuring triglyceride levels in cells or tissues.

[0206] Thus, in certain embodiments, the present invention relates to inhibitors suitable for use in the prevention and / or treatment of metabolic diseases or disorders, such as metabolic diseases or disorders associated with non-alcoholic fatty liver disease (NAFLD), and / or diseases or disorders associated with obesity and / or lipogenesis, and / or for use in reducing lipogenesis.

[0207] inhibitors The inhibitors of the present invention include nucleic acids such as siRNA, antibodies and antigen-binding fragments thereof, such as monoclonal antibodies, polypeptides, antibody-drug conjugates, and small molecules. Nucleic acids such as siRNA are preferred.

[0208] Certain preferred features of inhibitors of the present invention that are oligonucleosides, such as siRNAs, are set out below.

[0209] In certain embodiments, the nucleic acid comprises a first strand comprising a sequence at least partially complementary to a portion of the RNA transcribed from the SLC25A5 gene (SEQ ID NO: 1381). In preferred embodiments, the nucleic acid comprises a first strand comprising a sequence at least partially complementary to the SLC25A5 mRNA.

[0210] In certain embodiments, the nucleic acid for inhibiting expression of the SLC25A5 gene comprises a double-stranded region comprising a first strand and a second strand that is at least partially complementary to the first strand, wherein the first strand comprises: (i) is at least partially complementary to a portion of the RNA transcribed from the SLC25A5 gene; and (ii) Contains at least 17 consecutive nucleosides that differ from any one of SEQ ID NOs: 277 to 552 by 0 or 1 nucleoside.

[0211] In certain embodiments, the first strand comprises nucleosides 2-18 of any one of the sequences set forth in SEQ ID NOs: 277-552.

[0212] In certain embodiments, the first strand comprises any one of SEQ ID NOs: 277-552.

[0213] In certain embodiments, the second strand comprises a nucleoside sequence of at least 17 contiguous nucleosides that differs by 0 or 1 nucleoside from any one of SEQ ID NOs: 553-828; the second strand has a region of at least 85% complementarity over the 17 contiguous nucleosides with the first strand.

[0214] In certain embodiments, the second strand comprises any one of SEQ ID NOs: 553-828.

[0215] In certain embodiments, the nucleic acid for inhibiting expression of the SLC25A5 gene comprises a double-stranded region comprising a first strand and a second strand that is at least partially complementary to the first strand, wherein the first strand comprises: (i) is at least partially complementary to a portion of the RNA transcribed from the SLC25A5 gene; and (ii) Contains at least 21 consecutive nucleosides that differ from any one of SEQ ID NOs: 277 to 552 by 0 or 1 nucleoside.

[0216] In certain embodiments, the first strand comprises nucleosides 2-22 of any one of the sequences set forth in SEQ ID NOs: 277-552.

[0217] In certain embodiments, the second strand comprises a nucleoside sequence of at least 17 contiguous nucleosides that differs by 0 or 1 nucleoside from any one of SEQ ID NOs: 553-828, and the second strand has a region that is at least 85% complementary to the first strand over the 17 contiguous nucleosides.

[0218] In certain embodiments, the second strand comprises any one of SEQ ID NOs: 553-828.

[0219] In certain embodiments, the second strand comprises a nucleoside sequence of at least 19 contiguous nucleosides that differs by 0 or 1 nucleoside from any one of SEQ ID NOs: 553-828, and the second strand has a region that is at least 85% complementary to the first strand over the 19 contiguous nucleosides.

[0220] In certain embodiments, the second strand comprises a nucleoside sequence of at least 21 contiguous nucleosides that differs by 0 or 1 nucleoside from any one of SEQ ID NOs: 553-828, and the second strand has a region that is at least 85% complementary to the first strand over the 21 contiguous nucleosides.

[0221] In certain embodiments, the nucleic acid comprises a first strand comprising, consisting of, or consisting essentially of a nucleoside sequence that differs by 0 or 1 nucleoside from any one of SEQ ID NOs: 277-552; and and a second strand comprising, consisting of, or consisting essentially of a nucleoside sequence that differs by 0 or 1 nucleoside from any one of SEQ ID NOs: 553-828.

[0222] In this specification, the duplex region is preferably formed between a first (antisense) strand and a complementary second (sense) strand. Exemplary pairs of complementary antisense and sense strands are listed in Table 2 below.

[0223] Table 2 provides the unmodified first (antisense) and corresponding unmodified second (sense) strand sequences of siRNA oligonucleosides according to the invention, along with their corresponding positions in the full gene sequence of SEQ ID NO: 1381, as shown below.

[0224] [Table 6] JPEG2026505829000018.jpg251161JPEG2026505829000019.jpg255164JPEG2026505829 000020.jpg255164JPEG2026505829000021.jpg255164JPEG2026505829000022.jpg25516 4JPEG2026505829000023.jpg255164JPEG2026505829000024.jpg255164JPEG2026505829 000025.jpg255164JPEG2026505829000026.jpg255164JPEG2026505829000027.jpg99164

[0225] In certain embodiments, the present invention relates to a nucleic acid comprising a first strand and a second strand that comprise, consist of, or consist essentially of a nucleoside sequence that differs by 0 or 1 nucleoside from any one of the following first and second sequences:

[0226] [Table 7]

[0227] In particularly preferred embodiments, the present invention relates to a nucleic acid comprising a first strand and a second strand that comprise, consist of, or consist essentially of a nucleoside sequence that differs by 0 or 1 nucleoside from any one of the following first and second sequences:

[0228] [Table 8]

[0229] In certain embodiments, the nucleic acid for inhibiting expression of the SLC25A5 gene comprises a double-stranded region comprising a first strand and a second strand that is at least partially complementary to the first strand, wherein the first strand comprises: (i) is at least partially complementary to a portion of the RNA transcribed from the SLC25A5 gene; and (ii) Contains at least 17 consecutive nucleosides that differ from any one of SEQ ID NOs: 829 to 1104 by 0 or 1 nucleoside.

[0230] In certain embodiments, the first strand comprises nucleosides 2-18 of any one of the sequences set forth in SEQ ID NOs: 829-1104.

[0231] In certain embodiments, the nucleic acid for inhibiting expression of the SLC25A5 gene comprises a double-stranded region comprising a first strand and a second strand that is at least partially complementary to the first strand, wherein the first strand comprises: (i) is at least partially complementary to a portion of the RNA transcribed from the SLC25A5 gene; and (ii) Contains at least 21 consecutive nucleosides that differ from any one of SEQ ID NOs: 829 to 1104 by 0 or 1 nucleoside.

[0232] In certain embodiments, the first strand comprises nucleosides 2-22 of any one of the sequences set forth in SEQ ID NOs: 829-1104.

[0233] In certain embodiments, the first strand comprises any one of SEQ ID NOs: 829-1104.

[0234] The modification patterns of the nucleic acids set forth in SEQ ID NOs: 829 to 1104 are summarized in Table 3 below.

[0235] Table 3 provides below modified first (antisense) sequences along with the corresponding unmodified first (antisense) sequences of siRNA oligonucleosides according to the invention.

[0236] [Table 9] JPEG2026505829000031.jpg255166JPEG2026505829000032.jpg255166JPEG2026505829000033.jpg255166JPEG20265058290 00034.jpg255166JPEG2026505829000035.jpg255166JPEG2026505829000036.jpg255166JPEG2026505829000037.jpg255166 JPEG2026505829000038.jpg255166JPEG2026505829000039.jpg255166JPEG2026505829000040.jpg255166JPEG20265058290 00041.jpg255166JPEG2026505829000042.jpg255166JPEG2026505829000043.jpg255166JPEG2026505829000044.jpg177166

[0237] In certain embodiments, the second strand comprises a nucleoside sequence of at least 17 contiguous nucleosides that differs by 0 or 1 nucleoside from any one of SEQ ID NOs: 1105-1380, and the second strand has a region that is at least 85% complementary to the first strand over the 17 contiguous nucleosides.

[0238] In certain embodiments, the second strand comprises a nucleoside sequence of at least 19 contiguous nucleosides that differs by 0 or 1 nucleoside from any one of SEQ ID NOs: 1105-1380, and the second strand has a region that is at least 85% complementary to the first strand over the 19 contiguous nucleosides.

[0239] In certain embodiments, the second strand comprises a nucleoside sequence of at least 21 contiguous nucleosides that differs by 0 or 1 nucleoside from any one of SEQ ID NOs: 1105-1380, and the second strand has a region that is at least 85% complementary to the first strand over the 21 contiguous nucleosides.

[0240] In certain embodiments, the second strand comprises any one of SEQ ID NOs: 1105-1380.

[0241] The modification patterns of the nucleic acids set forth in SEQ ID NOs: 1105 to 1380 are summarized in Table 4 below.

[0242] Table 4 provides below modified second (sense) sequences along with the corresponding unmodified second (sense) sequences of siRNA oligonucleosides according to the invention.

[0243] [Table 10] JPEG2026505829000046.jpg255166JPEG2026505829000047.jpg255166JPEG2026505829000048.jpg255166JPEG20265058290 00049.jpg255166JPEG2026505829000050.jpg255166JPEG2026505829000051.jpg255166JPEG2026505829000052.jpg255166 JPEG2026505829000053.jpg255166JPEG2026505829000054.jpg255166JPEG2026505829000055.jpg255166JPEG20265058290 00056.jpg255166JPEG2026505829000057.jpg255166JPEG2026505829000058.jpg255166JPEG2026505829000059.jpg177166

[0244] As used herein, and particularly in Tables 3 and 4, the following abbreviations are used in reference to modified nucleosides: A-adenosine C-Cytidine G-guanosine T-thymidine m-2'-O-methyl f-2'fluoro s-phosphorothioate bond o-Heat-destabilized nucleosides ia-reverse abasic nucleosides

[0245] Am represents 2'-O-methyl-adenosine, Cm represents 2'-O-methyl-cytidine, Gm represents 2'-O-methyl-guanosine, Um represents 2'-O-methyl-uridine, Af represents 2'-fluoro-adenosine, Cf represents 2'-fluoro-cytidine, Gf represents 2'-fluoro-guanosine, and Uf represents 2'-fluoro-uridine.

[0246] Additionally, the letter "s" is used as an abbreviation for a phosphorothioate linkage between two consecutive (modified) nucleosides. For example, the abbreviation "AmsAm" is used for two consecutive 2'-O-methyl-adenosine nucleosides linked via a 3'5' phosphorothioate linkage. No abbreviation is used for nucleosides linked via a standard 3'5' phosphodiester linkage. For example, the abbreviation "AmAm" is used for two consecutive 2'-O-methyl-adenosine nucleosides linked via a 3'5' phosphodiester linkage.

[0247] Some of the modified second strand sequences exemplified above in Table 4 contain the preferred 5'iaia motif. However, it should be understood that the scope of these modified second strand sequences also includes Me / F modified second strands in the absence of the 5'iaia motif.

[0248] In certain embodiments, the nucleic acid comprises a first strand comprising, consisting of, or consisting essentially of a (modified) nucleoside sequence that differs by 0 or 1 nucleoside from any one of SEQ ID NOs: 829-1104; and and a second strand comprising, consisting of, or consisting essentially of a (modified) nucleoside sequence that differs by 0 or 1 nucleoside from any one of SEQ ID NOs: 1105-1380.

[0249] Preferred combinations of complementary modified antisense (first) and sense (second) strands are listed in Table 5 below.

[0250] Table 5 identifies duplexes by duplex ID, which references modified antisense and sense IDs from Tables 3 and 4 above.

[0251] [Table 11] JPEG2026505829000061.jpg255156JPEG2026505829000062.jpg255156JPEG2026505829000063.jpg255156JPEG2026505829000064.jpg255165

[0252] For the duplexes in Table 5: ETX-M00001351 to ETX-M00001626 preferably have a double-stranded structure according to Figure 8b.

[0253] In particularly preferred embodiments, the present invention relates to a nucleic acid comprising a first strand and a second strand that comprises, consists of, or consists essentially of a nucleoside sequence that differs by 0 or 1 nucleoside from any one of the following first and second sequences:

[0254] [Table 12]

[0255] In an even more preferred embodiment, the present invention relates to a nucleic acid comprising a first strand and a second strand that comprises, consists of, or consists essentially of a nucleoside sequence that differs by 0 or 1 nucleoside from any one of the following first and second sequences:

[0256] [Table 13]

[0257] In the event of any ambiguity between a sequence herein and a sequence in the accompanying sequence listing, the sequence provided herein shall be considered to be the correct sequence.

[0258] Abasic nucleotides In certain embodiments, the nucleic acid of the present invention contains one, for example, two, for example, three, for example, four, or more abasic nucleosides. Abasic nucleosides are modified nucleosides because they lack the base normally found at position 1 of the sugar moiety. Typically, abasic nucleosides present in nucleic acids of the present invention will have a hydrogen at position 1 of the sugar moiety.

[0259] The abasic nucleoside is present in the terminal region of the second strand, preferably located within the terminal pentanucleoside at the end of the strand. The terminal region may be the terminal pentanucleoside containing the abasic nucleoside.

[0260] The second strand may include the following preferred features (all combinations specifically contemplated unless mutually exclusive): two or more abasic nucleosides in the terminal region of the second strand, and / or two or more abasic nucleosides in either the 5' or 3' terminal region of the second strand, and / or two or more abasic nucleosides in either the 5' or 3' terminal region of the second strand, with two or more abasic nucleosides present in an overhang as described herein; and / or two or more consecutive abasic nucleosides in the terminal region of the second strand, preferably one such abasic nucleoside being the terminal nucleoside; and / or two or more consecutive abasic nucleosides in either the 5' or 3' terminal region of the second strand, preferably one such abasic nucleoside being the terminal nucleoside in either the 5' or 3' terminal region of the second strand, and / or an inverted internucleoside linkage connecting at least one abasic nucleoside to an adjacent basic nucleoside in the terminal region of the second strand; and / or an inverted internucleoside linkage connecting at least one abasic nucleoside to an adjacent basic nucleoside in either the 5' or 3' terminal region of the second strand; and / or an abasic nucleoside as the penultimate nucleoside connected via a back linkage to a nucleoside that is not the terminal nucleoside (referred to herein as the penultimate nucleoside); and / or an abasic nucleoside as the two terminal nucleosides connected via a 5'-3' linkage when reading the strand in the direction towards the end containing the terminal nucleoside; an abasic nucleoside as the two terminal nucleosides connected via a 3'-5' linkage when reading the strand in the direction towards the end containing the terminal nucleoside; abasic nucleosides at the two terminal positions, wherein the penultimate nucleoside is connected to the penultimate nucleoside via a reverse linkage, and the reverse linkage is a 5-5' reverse linkage or a 3'-3' reverse linkage; abasic nucleosides at the two terminal positions, the penultimate nucleoside being connected to the penultimate nucleoside via a reverse linkage; (1) the reverse linkage is a 5-5' reverse linkage, and the linkage between the terminal abasic nucleoside and the penultimate abasic nucleoside is 3'5' when read toward the end containing the terminal abasic nucleoside and the penultimate abasic nucleoside; or (2) The reverse linkage is a 3-3' reverse linkage, and the linkage between the terminal abasic nucleoside and the penultimate abasic nucleoside is 5'3' when read toward the end containing the terminal abasic nucleoside and the penultimate abasic nucleoside.

[0261] Preferably, there is an abasic nucleoside at the end of the second strand.

[0262] Preferably, there are two or at least two abasic nucleosides in the terminal region of the second strand, preferably at the terminal and penultimate positions.

[0263] Preferably, two or more abasic nucleosides are contiguous, for example, all of the abasic nucleosides may be contiguous, for example, the terminal 1 nucleotide, or the terminal 2 nucleotides, or the terminal 3 nucleotides, or the terminal 4 nucleotides may be abasic nucleosides.

[0264] In addition, the abasic nucleoside may be linked to an adjacent nucleoside via a 5'-3' phosphodiester linkage or a reverse linkage, except when there is only one abasic nucleoside at the terminal, and when there is only one abasic nucleoside, there will be a reverse linkage with the adjacent nucleoside.

[0265] Inverse linkages (sometimes called inverted linkages and also found in some instances in the art) include either a 5'-5', 3'-3', 3'-2', or 2'-3' phosphodiester linkage between adjacent sugar moieties of nucleosides.

[0266] The non-terminal abasic nucleoside will have two phosphodiester linkages, one to each adjacent nucleoside, which may be reverse linkages, or 5'-3 phosphodiester bonds, or one of each.

[0267] A preferred embodiment comprises two abasic nucleosides at the terminal and penultimate positions of the second strand, with a reverse internucleoside linkage located between the penultimate (abasic) nucleoside and the penultimate nucleoside.

[0268] Preferably, there are two abasic nucleosides at the terminal and penultimate positions of the second strand, with the penultimate nucleoside linked to the penultimate nucleoside via a reverse internucleoside linkage and linked to the terminal nucleoside via a 5'-3' or 3'-5' phosphodiester linkage (when reading towards the ends of the molecule).

[0269] Preferably, the nucleic acid according to the present invention comprises one or more abasic nucleosides, optionally one or more abasic nucleosides being in the terminal region of the second strand and / or at least one abasic nucleoside being linked to an adjacent base nucleoside through a reverse internucleoside linkage.

[0270] Various preferred functions are as follows: The reverse internucleoside linkage is a 3'-3' reverse linkage. The reverse internucleoside linkage is present in the terminal region distal from the 5'-terminal phosphate of the second strand.

[0271] The reverse internucleoside linkage is a 5'-5' reverse linkage. The reverse internucleoside linkage is present in the terminal region distal from the 3'-terminal hydroxide of the second strand.

[0272] In certain embodiments, the second strand comprises two consecutive abasic nucleosides in the 5'-terminal region of the second strand, one such abasic nucleoside being the terminal nucleoside of the 5'-terminal region of the second strand and the other abasic nucleoside being the penultimate nucleoside of the 5'-terminal region of the second strand, (a) the penultimate abasic nucleoside is linked to the adjacent first base nucleoside of the adjacent 5'-proximal terminal region via a reverse internucleoside linkage, (b) the reverse linkage is a 5-5' reverse linkage, and (c) the linkage between the terminal abasic nucleoside and the penultimate abasic nucleoside is 3'5' when read toward the end comprising the terminal abasic nucleoside and the penultimate abasic nucleoside. More typically, (i) the first strand and the second strand each have a length of 23 nucleosides, (ii) two phosphorothioate internucleoside linkages are present between three consecutive positions of the 5'-proximal region of the second strand, respectively, a first phosphorothioate internucleoside linkage is present between the adjacent first base nucleosides of (a) and adjacent second base nucleosides of the 5'-proximal region of the second strand, and a second phosphorothioate internucleoside linkage is present between the adjacent second base nucleosides and adjacent third base nucleosides of the 5'-proximal region of the second strand, and (iii) two phosphorothioate internucleoside linkages are each and (iv) a second strand of the nucleic acid is conjugated directly or indirectly to one or more ligand moieties at the 3'-terminal region of the second strand.

[0273] Alternatively, the second strand preferably comprises two consecutive abasic nucleosides in the overhang of the 3'-terminal region of the second strand, one such abasic nucleoside being the terminal nucleoside of the 3'-terminal region of the second strand and the other abasic nucleoside being the penultimate nucleoside of the 3'-terminal region of the second strand, (a) the penultimate abasic nucleoside being connected to the adjacent first abasic nucleoside of the adjacent 3'-proximal terminal region via a reverse internucleoside linkage, (b) the reverse linkage is a 3-3' reverse linkage, and (c) the linkage between the terminal abasic nucleoside and the penultimate abasic nucleoside is 5'-3' when read toward the end comprising the terminal abasic nucleoside and the penultimate abasic nucleoside. More typically, (i) the first strand and the second strand each have a length of 23 nucleosides, (ii) two phosphorothioate internucleoside linkages are present between three consecutive positions of the 3'-proximal region of the second strand, respectively, a first phosphorothioate internucleoside linkage is present between the adjacent first base nucleosides of (a) and adjacent second base nucleosides of the 3'-proximal region of the second strand, and a second phosphorothioate internucleoside linkage is present between the adjacent second base nucleosides and adjacent third base nucleosides of the 3'-proximal region of the second strand, and (iii) two phosphorothioate internucleoside linkages are each and (iv) a second strand of the nucleic acid is conjugated, directly or indirectly, to one or more ligand moieties at the 5'-terminal region of the second strand.

[0274] Examples of such structures are as follows (the specific RNA nucleosides shown are not limiting and may be any RNA nucleoside): A 3'-3' reverse bond (and the final phosphodiester bond between two abasic molecules in the 5'-3 direction when reading towards the end of the molecule is also shown)

[0275] [ka] B shows the 5'-5' reverse bond (and the final phosphodiester bond between the two abasic molecules in the 3'-5' direction when reading towards the end of the molecule).

[0276] [ka]

[0277] One or more abasic nucleosides present in a nucleic acid are provided in the presence of one or more reverse internucleoside linkages, i.e., 5'-5' or 3'-3' reverse internucleoside linkages. The reverse linkage results from a change in the orientation of adjacent nucleoside sugars, such that the sugars have a 3'-5' orientation (based on the numbering of the ring atoms of the nucleoside sugar) as opposed to the conventional 5'-3' orientation. One or more abasic nucleosides present in a nucleic acid of the present invention preferably comprise such reverse nucleoside sugars.

[0278] When a terminal nucleoside has an inverted orientation, this will result in an "inversion" of the terminal configuration of the overall nucleic acid. While certain structures depicted and referenced herein are represented using the conventional 5'-3' orientation (based on the numbering of the ring atoms of the nucleoside sugar), it will be understood that a change in orientation and the presence of a terminal nucleoside with a proximal 3'-3' inverted linkage will result in a nucleic acid having an overall 5'-5' terminal structure (i.e., a conventional 3' terminal nucleoside becomes a 5' terminal nucleoside). Alternatively, it will be understood that a change in orientation and the presence of a terminal nucleoside with a proximal 5'-5' inverted linkage will result in a nucleic acid having an overall 3'-3' terminal structure.

[0279] The proximal 3'-3' or 5'-5' reverse linkage described herein may include a reverse linkage directly adjacent to / attached to a terminal nucleoside having a reverse orientation, e.g., a single terminal nucleoside having a reverse orientation. Alternatively, the proximal 3'-3' or 5'-5' reverse linkage described herein may include a reverse linkage adjacent to two or more nucleosides having a reverse orientation, e.g., two or more terminal region nucleosides having a reverse orientation, such as a terminal nucleoside and a penultimate nucleoside. Thus, the reverse linkage may be attached to the penultimate nucleoside having a reverse orientation. Those skilled in the art will understand that the inverted orientations described above can result in nucleic acid molecules having the overall 3'-3' or 5'-5' end structures described herein, but will also understand that when one or more additional inverted linkages and / or nucleosides having an inverted orientation are present, the overall nucleic acid can have a 3'-5' end structure corresponding to the conventionally configured 5' / 3' ends.

[0280] In one aspect, the nucleic acid may have a 3'-3' inverse linkage and the terminal sugar moiety may comprise a 5' OH rather than a 5' phosphate group at the 5' position of the terminal sugar.

[0281] Thus, one of skill in the art will clearly understand that 5'-5', 3'-3', and 3'-5' (reading in the direction of the terminal) terminal variants of the more general 5'-3' structure (based on the numbering of the ring atoms of the terminal nucleoside sugar) depicted herein, when one or more reverse linkages are present, are included within the scope of the present disclosure.

[0282] For example, in the context of one or more nucleosides having an inverted orientation creating a reverse internucleoside linkage and / or an inverted terminus, when the relative position of the linkage (e.g., relative to a linker) or the position of an internal feature (e.g., a modified nucleoside) is defined relative to the 5' or 3' end of the nucleic acid, the 5' or 3' end is the conventional 5' or 3' end that would exist if the reverse linkage were not in place, and the conventional 5' or 3' end is determined by considering the directionality of the majority of the internal nucleoside linkages and / or nucleoside orientations within the nucleic acid. From these internal linkages and / or nucleoside orientations, it is possible to determine which ends of the nucleic acid would constitute the conventional 5' and 3' ends (relative to the numbering of the ring atoms of the terminal nucleoside sugar) of the molecule absent the reverse linkage.

[0283] For example, in the structure shown below, there are abasic residues at the first two positions, located at the "5'" end. If the terminal nucleoside has an inverted orientation, the "5'" end, which is the conventional 5' end shown in the diagram below, can actually contain a 3'OH in reference to the inverted nucleoside at the terminal position. Nevertheless, when read in the standard 5'[PO4] to 3'[OH] orientation of a nucleic acid molecule (based on the numbering of the ring atoms of the nucleoside sugar), the majority of the molecule will contain conventional internucleoside linkages extending from the 3'OH of one sugar to the 5'phosphate of the next sugar, which can be used to determine conventional 5' and 3' ends where the absence of an inverted end configuration will be found. A 5'AA-Me-Me-Me-Me-Me-Me-F-Me-FFF-Me-Me-Me-Me-Me-Me-Me-Me-Me-Me3'

[0284] The reverse bond is preferably located at the end of the nucleic acid, eg, RNA, distal to the ligand portion of the molecule, eg, the GalNAc-containing portion.

[0285] A GalNAc-siRNA construct having a 5'-GalNAc on the sense strand can have a reverse linkage at the opposite end of the sense strand.

[0286] A GalNAc-siRNA construct having a 3'-GalNAc on the sense strand can have a reverse linkage at the opposite end of the sense strand.

[0287] In some embodiments, the second (sense) strand of a nucleic acid according to the invention comprises two consecutive abasic nucleosides in the 5'-terminal region as shown in the 5'-terminal motif below.

[0288] [ka] During the ceremony, B represents a nucleoside base; T represents H, OH or 2' ribose modification; Z represents the remaining nucleosides of the second strand.

[0289] In some embodiments, the second (sense) strand of a nucleic acid according to the invention comprises in its 5' terminal region the following 5' terminal motif:

[0290] [ka] During the ceremony, B represents a nucleoside base; T represents H, OH or a 2' ribose modification (preferably a 2' ribose modification, more preferably a 2' Me or 2' F ribose modification); V represents O or S (preferably O), R is H or C 1~4 represents alkyl (preferably H), Z represents the remaining nucleosides of the second strand; More preferably, the following 5' end motif:

[0291] [ka] During the ceremony, B represents a nucleoside base; T represents a 2' ribose modification (preferably a 2' Me or 2' F ribose modification); Z represents the remaining nucleosides of the second strand; It contains two consecutive abasic nucleosides as shown in

[0292] The reverse bond is preferably located at the end of the nucleic acid, eg, RNA, that is distal to the ligand portion, such as the GalNAc-containing portion of the molecule.

[0293] A GalNAc-siRNA construct with a 5'-GalNAc on the sense strand can have a reverse linkage on the opposite side of the sense strand.

[0294] A GalNAc-siRNA construct with a 3'-GalNAc on the sense strand can have a reverse linkage on the opposite side of the sense strand.

[0295] In a preferred embodiment, the second (sense) strand of the nucleic acid according to the invention comprises in its 5' terminal region the following 5' terminal motif:

[0296] [ka] During the ceremony, B represents a nucleoside base; T represents H, OH or a 2' ribose modification (preferably a 2' ribose modification, more preferably a 2' Me or 2' F ribose modification); V represents O or S (preferably O), R is H or C 1~4 represents alkyl (preferably H), Z comprises 11 to 26 consecutive nucleosides, preferably 15 to 21 consecutive nucleosides, and more preferably 19 consecutive nucleosides, and more preferably the following 5'-terminal motif:

[0297] [ka] During the ceremony, B represents a nucleoside base; T represents a 2' ribose modification (preferably a 2' Me or 2' F ribose modification); Z contains 19 consecutive nucleosides It contains two consecutive abasic nucleosides as shown in

[0298] Nucleic acid length In one embodiment, i) the first strand of the nucleic acid has a length in the range of 17 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 19 or 23 nucleosides, and / or ii) the second strand of the nucleic acid has a length in the range of 17 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 19 or 21 nucleosides.

[0299] Typically, the double-stranded region of the nucleic acid is 17 to 30 nucleosides in length, more preferably 19 or 21 nucleosides in length. Similarly, the region of complementarity between the first strand and the portion of the RNA transcribed from the SLC25A5 gene is 17 to 30 nucleosides in length.

[0300] Generally, the duplex structure of a nucleic acid, e.g., an iRNA, is about 15-30 base pairs in length, e.g., 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 20-30, 21-30, 22-30, 23-24, 23-25, 24-26, 23-26, 23-27, 23-28, 23-29, 23-30 ... 21-23, 21-22, 21-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs in length. Ranges and lengths intermediate to the above-mentioned ranges and lengths are also contemplated as part of the invention.

[0301] Similarly, the region of complementarity of the antisense sequence to the target sequence and / or the region of complementarity of the antisense sequence to the sense sequence can be about 15-30 nucleosides in length, e.g., 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-24, 18-23, 18-25, 18-26, 18-27, 18-28, 18-29, 18-30 ... 2, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleosides in length. Ranges and lengths intermediate to the above-mentioned ranges and lengths are also contemplated as part of the invention.

[0302] In certain preferred embodiments, the region of complementarity of the antisense sequence to the target sequence and / or the region of complementarity of the antisense sequence to the sense sequence is at least 17 nucleosides in length. For example, the region of complementarity between the antisense strand and the target is 19 to 21 nucleosides in length, for example, the region of complementarity is 21 nucleosides in length.

[0303] In a preferred embodiment, each strand is 30 nucleosides or less in length.

[0304] In certain preferred embodiments, the duplex structure of the nucleic acid, e.g., siRNA, is 19 or 21 base pairs in length. In particularly preferred embodiments, the duplex may have one of the following structures: For example, ETX-M00001351-ETX-M00001626

[0305] [ka]

[0306] The nucleic acids described herein, e.g., dsRNA, may further comprise one or more single-stranded nucleoside overhangs, e.g., 1 to 4, 2 to 4, 1 to 3, 2 to 3, 1, 2, 3, or 4 nucleosides. The nucleoside overhangs may comprise or consist of nucleoside / nucleoside analogs, including deoxynucleosides / nucleosides. The overhangs may be present in the sense strand, the antisense strand, or any combination thereof. Furthermore, the nucleosides of the overhangs may be present at the 5'-end, the 3'-end, or both ends of the antisense or sense strand of the nucleic acid, e.g., dsRNA.

[0307] In certain preferred embodiments, at least one strand comprises a 3' overhang of at least one nucleoside, for example, at least one strand comprises a 3' overhang of at least two nucleosides, the overhang preferably being present on the antisense / guide strand and / or the sense / passenger strand.

[0308] Nucleic acid modification In certain embodiments, the nucleic acids, e.g., RNA, e.g., dsiRNA, of the invention do not contain further modifications, e.g., chemical modifications or conjugations known in the art and described herein.

[0309] In other preferred embodiments, the nucleic acids of the invention, eg, RNA, eg, dsiRNA, are further chemically modified to enhance stability or other beneficial properties.

[0310] In certain embodiments of the invention, substantially all of the nucleosides are modified.

[0311] The nucleic acids featured in the invention can be synthesized or modified by methods well established in the art, such as those described in "Current protocols in nucleic acid chemistry," Beaucage, S.L. et al. (eds.), John Wiley & Sons, Inc., New York, NY, USA, which is hereby incorporated by reference.

[0312] Modifications include terminal modifications, such as 5'-end modifications (phosphorylation, conjugation, inverted linkage) or 3'-end modifications (conjugation, DNA nucleosides in RNA or RNA nucleosides in DNA, inverted linkage, etc.); base modifications, such as replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, conjugate bases; sugar modifications (e.g., at the 2' or 4' position) or sugar replacement; or backbone modifications, including modification or replacement of phosphodiester linkages.

[0313] Specific examples of nucleic acids such as siRNA compounds useful in the embodiments described herein include, but are not limited to, RNA that comprises modified backbone or does not have natural internucleoside linkages.Nucleic acids such as RNA that have modified backbone include, among others, those that do not have phosphorus atom in backbone.For the purpose of this specification and as sometimes referred to in the art, modified nucleic acids that do not have phosphorus atom in internucleoside backbone, such as RNA, can also be considered as oligonucleosides.In some embodiments, modified nucleic acids, such as siRNA, will have phosphorus atom in their internucleoside backbone.

[0314] Modified nucleic acids, such as RNA backbones, include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates, including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates, including 3'-aminophosphoramidates and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates with normal 3'-5' linkages, their 2'-5' linkage analogs, and those with reverse polarity, in which adjacent pairs of nucleoside units are 5'-3' or 5'-2' linked.Various salts, mixed salts, and free acid forms are also included.

[0315] In addition, modified nucleic acids, such as RNA, may contain one or more substituted sugar moieties.Nucleic acids, such as siRNAs, such as dsiRNAs, characterized herein may contain one of the following at 2'-position: OH, F, O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S-, or N-alkynyl; or O-alkyl-O-alkyl, and alkyl, alkenyl, and alkynyl may be substituted or unsubstituted.2'-O-methyl and 2'-F are preferred modifications.

[0316] In certain preferred embodiments, the nucleic acid comprises at least one modified nucleoside.

[0317] The nucleic acids of the invention may contain one or more modified nucleosides in the first strand and / or the second strand.

[0318] In some embodiments, substantially all of the nucleosides in the sense strand and all of the nucleosides in the antisense strand comprise a modification.

[0319] In some embodiments, all of the nucleosides in the sense strand and substantially all of the nucleosides in the antisense strand comprise a modification.

[0320] In some embodiments, all of the nucleosides in the sense strand and all of the nucleosides in the antisense strand comprise a modification.

[0321] In one embodiment, at least one of the modified nucleosides is selected from the group consisting of a deoxy-nucleoside, a 3' terminal deoxy-thymine (dT) nucleoside, a 2'-O-methyl modified nucleoside (also referred to herein as 2'-Me, where Me is methoxy), a 2'-fluoro modified nucleoside, a 2'-deoxy modified nucleoside, a locked nucleoside, an unlocked nucleoside, or a 2'-methyl modified nucleoside. nucleoside), conformationally restricted nucleosides, constrained ethyl nucleosides, abasic nucleosides, 2'-amino modified nucleosides, 2'-O-allyl modified nucleosides, 2'-C-alkyl modified nucleosides, 2'-hydroxy modified nucleosides, 2'-methoxyethyl modified nucleosides, 2'-O-alkyl modified nucleosides, morpholino nucleosides, phosphoramidates, non-natural base containing nucleosides, tetrahydropyran modified nucleosides, 1,5-anhydrohexitol modified nucleosides, cyclohexenyl modified nucleosides, nucleosides containing phosphorothioate groups, nucleosides containing methylphosphonate groups, nucleosides containing 5'-phosphates, and nucleosides containing 5'-phosphate mimetics. In another embodiment, the modified nucleosides include a short sequence of 3'-terminal deoxy-thymine nucleosides (dT).

[0322] The nucleoside modification can preferably be selected from the group including, but not limited to, LNA, HNA, CeNA, 2-methoxyethyl, 2'-O-alkyl, 2-O-allyl, 2'-C-allyl, 2'-fluoro, 2'-deoxy, 2'-hydroxyl, and combinations thereof. In another embodiment, the nucleoside modification is a 2-O-methyl ("2-Me") or 2'-fluoro modification.

[0323] One preferred modification is a modification at the 2'-OH group of the ribose sugar, optionally selected from a 2'-Me or a 2'-F modification.

[0324] In certain embodiments, nucleic acid, for example, RNAi agent, further comprises at least one phosphorothioate or methylphosphonate internucleoside linkage.For example, phosphorothioate or methylphosphonate internucleoside linkage can be present at the 3'-end or terminal region of one strand, that is, sense strand or antisense strand, or can be present at the terminals of both strands, that is, sense strand and antisense strand.

[0325] In certain embodiments, the phosphorothioate or methylphosphonate internucleoside linkages may be present at the 5'-end or terminal region of one strand, i.e., the sense strand or the antisense strand, or at the termini of both strands, the sense strand and the antisense strand.

[0326] In certain embodiments, the phosphorothioate or methylphosphonate internucleoside linkages may be present at both the 5' and 3' ends or terminal regions of one strand, i.e., the sense strand or the antisense strand, or at the ends of both strands, the sense strand and the antisense strand.

[0327] Any nucleic acid may contain one or more phosphorothioate (PS) modifications within the nucleic acid, for example, at least two PS internucleoside linkages at the ends of the strand.

[0328] At least one of the oligoribonucleoside chains preferably contains at least two consecutive phosphorothioate modifications in the last three nucleosides of the oligonucleoside.

[0329] Thus, the present invention also relates to a nucleic acid as disclosed herein, which comprises phosphorothioate internucleoside linkages between at least two or three consecutive positions, such as the 5' and / or 3' terminal regions and / or near-terminal regions of the second strand, respectively, wherein the near-terminal regions are preferably adjacent to the terminal regions in which the one or more abasic nucleosides of the second strand are located.

[0330] The nucleic acids disclosed herein comprise phosphorothioate internucleoside linkages between at least two or three consecutive positions in the 5' and / or 3' terminal region of the first strand, respectively, and preferably, the terminal positions in the 5' and / or 3' terminal region of the first strand are attached to their adjacent positions by phosphorothioate internucleoside linkages.

[0331] The nucleic acid strand may be RNA containing phosphorothioate internucleoside linkages between the three nucleosides adjacent to the two abasic nucleosides located at the termini.

[0332] A preferred nucleic acid is a double-stranded RNA comprising two adjacent abasic nucleosides at the 5'-end of the second strand and a ligand moiety comprising one or more GalNAc ligand moieties at the opposite 3'-end of the second strand. More preferably, the same nucleic acid may further comprise phosphorothioate linkages between nucleotides 3-4 and 4-5 of the second strand, reading from position 1 of the second strand.

[0333] Position 1 of the first or second strand is the nucleoside that is closest to the end of the nucleic acid (disregarding any abasic nucleosides) and that is joined to the adjacent nucleoside (at position 2) via a 3' to 5' internal bond when referenced to the bond between the sugar moieties of the backbone and reading away from that end of the molecule.

[0334] Thus, "position 1 of the sense strand" can be understood to be the 5'-most nucleoside of the conventional 5'-end of the sense strand (not including the abasic nucleoside). Typically, the nucleoside at this position 1 of the sense strand will be equivalent to the 5' nucleoside of the selected target nucleic acid sequence. More commonly, the sense strand will have a nucleoside equivalent to the nucleoside of the target nucleic acid sequence starting at this position 1 of the sense strand, although allowable mismatches between the sequences are also possible.

[0335] As used herein, "position 1 of the antisense strand" refers to the 5'-most nucleoside of the conventional 5'-end of the antisense strand (not including the abasic nucleoside). As mentioned above, there will be a region of complementarity between the sense strand and the antisense strand, and therefore the antisense strand will also have a region of complementarity to the target nucleic acid sequence referred to above.

[0336] Preferred modifications that can be used with the sequences according to the invention can be: Qualification 1: First strand modification: NmsNfsNmNfNmNfNmNfNmNfNmNmNfNmNmNfNmNmNmNmNmsNmsNm (5' to 3') Second strand modification: iaiaNmsNmsNmNmNmNmNfNfNfNfNmNmNmNmNmNmNmNmNmNmNmNmNm(5' to 3') Qualification 2: First strand modification: NmsNfsNmNfNmNfNmNfNmNfNmNmNfNmNmNfNmNmNmNmNmsNmsNm (5' to 3') Second strand modification: iaiaNmsNmsNmNmNmNfNfNmNfNfNfNmNmNmNmNmNmNmNmNmNmNm(5' to 3') Qualification 3: First strand modification: NmsNfsNmNfNmNfNmNfNmNfNmNmNfNmNmNfNmNmNmNmNmsNmsNm (5' to 3') Second strand modification: iaiaNmsNmsNmNmNmNmNfNmNfNfNfNmNmNmNmNmNmNmNmNmNmNm(5' to 3') Qualification 4: First strand modification: NmsNfsNmNfNmNfNmNmNmNmNmNmNmNfNmNmNmNfNmNmNmNmsNmsNm (5' to 3') Second strand modification: iaiaNmsNmsNmNmNmNmNfNmNfNfNfNmNmNmNmNmNmNmNmNmNmNm(5' to 3') Qualification 5: First strand modification: NmsNfsNmNmNmNfNmNmNfNmNmNmNfNmNmNfNmNmNmNmNmsNmsNm (5' to 3') Second strand modification: iaiaNmsNmsNmNmNmNmNmNmNfNfNmNmNmNmNmNmNmNmNmNmNmNmNm (5' to 3') Qualification 6: First strand modification: NmsNfsNmNmNmNfNmNmNmNmNmNmNmNfNmNmNfNmNfNmNmNmsNmsNm (5' to 3') Second strand modification: iaiaNmsNmsNmNmNmNmNmNmNfNfNmNmNmNmNmNmNmNmNmNmNmNmNm (5' to 3') Qualification 7: First strand modification: NmsNfsNmNmNmNyNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm (5' to 3') Second strand modification: iaiaNmsNmsNmNmNmNmNmNmNfNfNmNmNmNmNmNmNmNmNmNmNmNmNm (5' to 3') Qualification 8: First strand modification: NmsNfsNmNmNmNyNmNfNfNmNmNmNmNfNmNmNfNmNmNmNmsNmsNm (5' to 3') Second strand modification: iaiaNmsNmsNmNmNmNmNmNmNfNfNmNmNmNmNmNmNmNmNmNmNmNmNm (5' to 3') Qualification 9: First strand modification: NmsNfsNmNmNmNfNmNmNmNmNmNmNmNfNmNmNmNfNmNmNmNfNmsNmsNm (5' to 3') Second strand modification: iaiaNmsNmsNmNmNmNmNmNmNfNfNmNmNmNmNmNmNmNmNmNmNmNmNm (5' to 3') Qualification 10: First strand modification: NmsNfsNmNfNmNfNmNmNmNmNmNmNmNfNmNmNmNfNmNmNmNmsNmsNm (5' to 3') Second strand modification: iaiaNmsNmsNmNmNmNmNmNmNfNfNmNmNmNmNmNmNmNmNmNmNmNmNm (5' to 3') Qualification 11: First strand modification: NmsNfsNmNfNmNfNmNfNmNfNmNmNfNmNmNfNmNmNmNmNmsNmsNm (5' to 3') Second strand modification: iaiaNmsNmsNmNmNmNmNmNmNfNfNmNmNmNmNmNmNmNmNmNmNmNmNm (5' to 3') Qualification 12: First strand modification: NmsNfsNmNmNmNfNmNfNmNfNmNmNfNmNmNfNmNfNmNmNmsNmsNm (5' to 3') Second strand modification: iaiaNmsNmsNmNmNmNmNmNmNfNfNmNmNmNmNmNmNmNmNmNmNmNmNm (5' to 3') Qualification 13: First strand modification: NmsNfsNmNmNmNfNmNfNmNfNmNmNmNfNmNmNfNmNmNfNmsNmsNm (5' to 3') Second strand modification: iaiaNmsNmsNmNmNmNmNmNmNfNfNmNmNmNmNmNmNmNmNmNmNmNmNm (5' to 3') In each of the above modifications: ia represents an inverted abasic nucleoside; Nm represents 2'Me ribose-modified nucleoside; Nf represents 2′F ribose-modified nucleoside; Ny represents a nucleoside having a thermal destabilizing modification, preferably the destabilizing modification is selected from a modified unlocked nucleic acid (UNA) and a glycol nucleic acid (GNA), more preferably a glycol nucleic acid, most preferably an (S)-glycol nucleic acid; s represents a phosphorothioate internucleoside linkage.

[0337] Particularly preferred modifications that can be used with the sequences according to the invention can be: Qualification 6: First strand modification: NmsNfsNmNmNmNfNmNmNmNmNmNmNmNfNmNmNfNmNfNmNmNmsNmsNm (5' to 3') Second strand modification: iaiaNmsNmsNmNmNmNmNmNmNfNfNmNmNmNmNmNmNmNmNmNmNmNmNm (5' to 3') wherein in each of the above modifications: ia represents an inverted abasic nucleoside; Nm represents a 2'Me ribose-modified nucleoside; and s represents a phosphorothioate internucleoside linkage.

[0338] Conjugation of nucleic acids with ligands Another modification of the nucleic acids, e.g., RNA, e.g., siRNA, of the invention includes linking the nucleic acid, e.g., siRNA, to one or more ligand moieties to enhance, e.g., the activity, cellular distribution, or cellular uptake, e.g., into cells, of the nucleic acid, e.g., siRNA.

[0339] In certain embodiments, the inhibitor of the present invention is conjugated with the ligand moiety that allows and / or promotes hepatocyte targeting.In certain embodiments, the hepatocyte targeting is achieved by using N-acetylgalactosamine (GalNAc) conjugate, which is described in more detail herein below.That is, in certain embodiments, the inhibitor of the present invention is siRNA-GalNAc conjugate.

[0340] In some embodiments, the described ligand moiety may be attached to a nucleic acid, e.g., an siRNA oligonucleoside, via a linker, which may be cleavable or non-cleavable. The term "linker" or "linking group" refers to an organic moiety that connects two parts of a compound, e.g., covalently attaches two parts of a compound.

[0341] The ligand can be attached to the 3' or 5' end of the sense strand.

[0342] The ligand is preferably conjugated to the 3' end of the sense strand of the nucleic acid, eg, the siRNA agent.

[0343] Thus, in a further aspect, the present invention relates to a conjugate for inhibiting expression of a target, e.g., a target gene, in a cell, said conjugate comprising a nucleic acid moiety and one or more ligand moieties, said nucleic acid moiety comprising a nucleic acid as disclosed herein.

[0344] In one embodiment, the second strand of the nucleic acid is conjugated directly or indirectly (e.g., via a linker) to one or more ligand moieties, which are typically present in a terminal region of the second strand, preferably its 3'-terminal region.

[0345] In certain embodiments, the ligand moiety comprises a GalNAc or GalNAc derivative attached to a nucleic acid, eg, a dsiRNA, via a linker.

[0346] Thus, the present invention provides a compound comprising a ligand moiety: i) one or more GalNAc ligands, and / or ii) one or more GalNAc ligand derivatives, and / or iii) one or more GalNAc ligands conjugated to said nucleic acid via a linker; The present invention relates to a conjugate comprising:

[0347] The GalNAc ligand may be directly or indirectly conjugated to the 5' or 3' terminal region of the second strand of the nucleic acid, preferably to the 3' terminal region thereof.

[0348] GalNAc ligands are well known in the art and are described, inter alia, in EP 3775207.

[0349] In some embodiments, the ligand moiety comprises one or more ligands.

[0350] In some embodiments, the ligand moiety comprises one or more carbohydrate ligands.

[0351] In some embodiments, the one or more carbohydrates may be a monosaccharide, a disaccharide, a trisaccharide, a tetrasaccharide, an oligosaccharide, and / or a polysaccharide.

[0352] In some embodiments, the one or more carbohydrates comprise one or more galactose moieties, one or more lactose moieties, one or more N-acetylgalactosamine moieties, and / or one or more mannose moieties.

[0353] In some embodiments, the one or more carbohydrates comprise one or more N-acetyl-galactosamine moieties.

[0354] In some embodiments, the compounds described anywhere herein contain two or three N-acetylgalactosamine moieties.

[0355] In some embodiments, one or more ligands are attached in a linear or branched configuration, eg, each attached at a branch point on every linker.

[0356] An exemplary linear configuration and an exemplary branched configuration are shown in Figures 1a and 1b.

[0357] In Figure 1a (linear), (a) and / or (b) may typically represent a connecting bond or group such as a phosphate group or a phosphorothioate group.

[0358] In Figure lb (branched), in some embodiments, one or more ligands are attached in a biantennary or triantennary branched chain configuration. Typically, a triantennary branched chain configuration, such as an N-acetylgalactosamine triantennary branched chain configuration, may be preferred.

[0359] Linker Exemplary compounds of the invention include a "linker moiety" that is part of an overall "linker," such as that depicted in formula (I).

[0360] [ka] During the ceremony, R1 in each occurrence is independently selected from the group consisting of hydrogen, methyl, and ethyl; R2 is hydrogen, hydroxy, -OC 1~3 Alkyl, -C(=O)OC 1~3 selected from the group consisting of alkyl, halo, and nitro; X1 and X2, in each occurrence, are independently selected from the group consisting of methylene, oxygen, and sulfur; m is an integer from 1 to 6; n is an integer from 1 to 10, q, r, s, t, and v are independently integers from 0 to 4, with the proviso that: (i) q and r cannot both be 0 at the same time; (ii) s, t, and v cannot all be simultaneously 0; Z is an oligonucleoside moiety.

[0361] As will be further understood in the art, exemplary compounds of the present invention include all linkers located between the oligonucleoside and ligand portions of such compounds, which "link" the oligonucleoside and ligand portions to one another.

[0362] The overall linker is often conceptually envisioned as comprising one or more linker building blocks. For example, there is a linker moiety depicted as the "linker moiety" presented in Formula (I), which is positioned adjacent to the ligand moiety and typically attaches the ligand moiety directly or indirectly to the oligonucleoside moiety via a branch point. The linker moiety depicted in Formula (I) is often also referred to as the "ligand arm or arms" of the overall linker. Additional linker moieties may, but are not always, present between the oligonucleoside moiety and the branch point. The additional linker moiety is often referred to as the "tether moiety" of the overall linker, which "tethers" the oligonucleoside moiety to the remainder of the conjugate compound. Such "ligand arms" and / or "linker moieties" and / or "tether moieties" can be envisioned by reference to the linear and / or branched chain configurations shown above.

[0363] As can be understood from the claims and the remainder of this patent specification, the scope of the invention extends to linear or branched configurations and there is no limit to the number of individual ligands that may be present. Furthermore, the reader will recognize that there are numerous structures that can be used as linker moieties based on the state of the art and the expertise of oligonucleoside chemists.

[0364] The remaining portions (other than the linker portion) of all linkers set forth in the claims and the remainder of the patent specification are represented by the chemical moieties in formula (I) that the inventors believe to be particularly unique to the present invention. However, more generally, such chemical moieties can be described as "tether moieties" as described above, which is the portion of the entire linker including the group of atoms between Z, the oligonucleoside portion, and the linker portion, as depicted in formula (I).

[0365] The tether portion of Formula I With respect to formula (I), the "tether moiety" includes the group of atoms between Z, the oligonucleoside moiety, and the linker moiety.

[0366] In some embodiments, R1 is hydrogen at each occurrence. In some embodiments, R1 is methyl. In some embodiments, R1 is ethyl.

[0367] In some embodiments, R2 is hydroxy. In some embodiments, R2 is halo. In some embodiments, R2 is fluoro. In some embodiments, R2 is chloro. In some embodiments, R2 is bromo. In some embodiments, R2 is iodo. In some embodiments, R2 is nitro.

[0368] In some embodiments, X1 is methylene. In some embodiments, X1 is oxygen. In some embodiments, X1 is sulfur.

[0369] In some embodiments, X2 is methylene. In some embodiments, X2 is oxygen. In some embodiments, X2 is sulfur.

[0370] In some embodiments, m=3.

[0371] In some embodiments, n=6.

[0372] In some embodiments, X1 is oxygen and X2 is methylene. In some embodiments, X1 and X2 are both methylene.

[0373] In some embodiments, q=1, r=2, s=1, t=1, v=1. In some embodiments, q=1, r=3, s=1, t=1, v=1.

[0374] In some embodiments, R1 is hydrogen in each occurrence, n=6, m=3, R2 is fluoro, X2 is methylene, v=1, t=1, s=1, X1 is methylene, q=1, and r=2.

[0375] Thus, in some embodiments, exemplary compounds of the invention include the following structures:

[0376] [ka]

[0377] In some embodiments, R1 is hydrogen in each occurrence, n=6, m=3, R2 is fluoro, X2 is methylene, v=1, t=1, s=1, X1 is oxygen, q=1, and r=2.

[0378] Thus, in some embodiments, exemplary compounds of the invention include the following structures:

[0379] [ka]

[0380] Alternative Tether Portions Alternative tether moiety structures may arise during the synthesis of the compounds of the invention. In some embodiments, alternative tether moieties have a change in one or more atoms of the tether moiety of the overall linker compared to the tether moieties described elsewhere herein.

[0381] In some embodiments, the alternative tether moiety is a compound of Formula (I) described anywhere herein, wherein R2 is hydroxy.

[0382] In some embodiments, R1 is hydrogen in each occurrence, n=6, m=3, R2 is hydroxy, X2 is methylene, v=1, t=1, s=1, X1 is methylene, q=1, and r=2.

[0383] Thus, in some embodiments, the compound of the invention comprises the following structure:

[0384] [ka]

[0385] In some embodiments, R1 is hydrogen in each occurrence, n=6, m=3, R2 is hydroxy, X2 is methylene, v=1, t=1, s=1, X1 is oxygen, q=1, and r=2.

[0386] Thus, in some embodiments, the compound of the invention comprises the following structure:

[0387] [ka]

[0388] Linker part With respect to Formula (I), the "linker moiety" depicted in Formula (I) includes a group of atoms located between a tether moiety, described anywhere herein, and a ligand moiety, described anywhere herein.

[0389] In some embodiments, the compound depicted in formula (I) described elsewhere herein is

[0390] [ka] is any of formula (VIa), (VIb), or (VIc), preferably formula (VIa),

[0391] [ka] During the ceremony, A I is hydrogen or a suitable hydroxy protecting group; a is an integer of 2 or 3, b is an integer from 2 to 5, or

[0392] [ka] During the ceremony, A I is hydrogen or a suitable hydroxy protecting group; a is an integer of 2 or 3, c and d are independently integers from 1 to 6; or

[0393] [ka] During the ceremony, A I is hydrogen or a suitable hydroxy protecting group; a is an integer of 2 or 3, e is an integer from 2 to 10.

[0394] In some embodiments, the moiety depicted in formula (I):

[0395] [ka] is of formula (VIa),

[0396] [ka] During the ceremony, A I is hydrogen or a suitable hydroxy protecting group; a is 3, b is an integer equal to 3.

[0397] In some embodiments, the moiety depicted in formula (I) anywhere herein:

[0398] [ka] is of formula (VII),

[0399] [ka] During the ceremony, A I is hydrogen, a is an integer of 2 or 3, preferably 3.

[0400] Other exemplary compounds of the present invention are represented by formula (I * ) a "linker portion" that is part of the overall "linker";

[0401] [ka] During the ceremony, r and s are independently an integer selected from 1 to 16; Z is an oligonucleoside moiety.

[0402] As will be further understood in the art, exemplary compounds of the present invention include all linkers located between the oligonucleoside and ligand portions of such compounds, which "link" the oligonucleoside and ligand portions to one another.

[0403] All linkers are often conceptually envisioned as comprising one or more linker building blocks. For example, * ) is located adjacent to the ligand moiety and attaches the ligand moiety directly or indirectly to the oligonucleoside moiety, typically via a branch point. *) are often also referred to as the "ligand arm or arms" of the overall linker. Additional linker moieties may, but are not always, present between the oligonucleoside moiety and the branch point. The additional linker moieties are often referred to as the "tether moieties" of the overall linker, which "tether" the oligonucleoside moiety to the remainder of the conjugate compound. Such "ligand arms" and / or "linker moieties" and / or "tether moieties" can be envisioned by reference to the linear and / or branched configurations shown above.

[0404] As can be understood from the claims and the remainder of this patent specification, the scope of the invention extends to linear or branched configurations and there is no limit to the number of individual ligands that may be present. Furthermore, the reader will recognize that there are numerous structures that can be used as linker moieties based on the state of the art and the expertise of oligonucleoside chemists.

[0405] The remaining portions (other than the linker portion) of all linkers set forth in the claims and the remainder of the patent specification are represented by the chemical moieties in formula (I) that the inventors believe to be particularly unique to the present invention. However, more generally, such chemical moieties can be described as "tether moieties" as described above, which is the portion of the entire linker including the group of atoms between Z, the oligonucleoside portion, and the linker portion, as depicted in formula (I).

[0406] Tether part Formula (I * ), the "tether moiety" includes the group of atoms between Z, the oligonucleoside moiety, and the linker moiety.

[0407] In some embodiments, s is an integer selected from 4 to 12. In some embodiments, s is 6.

[0408] In some embodiments, r is an integer selected from 4 to 14. In some embodiments, r is 6. In some embodiments, r is 12.

[0409] In some embodiments, r is 12 and s is 6.

[0410] Thus, in some embodiments, exemplary compounds of the invention include the following structures:

[0411] [ka]

[0412] In some embodiments, r is 6 and s is 6.

[0413] Thus, in some embodiments, exemplary compounds of the invention include the following structures:

[0414] [ka]

[0415] Linker part Formula (I * With respect to (I), the "linker moiety" depicted in formula (I) includes the group of atoms positioned between a tether moiety, described anywhere herein, and a ligand moiety, described anywhere herein.

[0416] In some embodiments, the compound of formula (I) * ) shown in the figure:

[0417] [ka] is represented by formula (IV * ), (V * ), or (VI * ), and preferably any one of the formulas (IV * ) and

[0418] [ka] During the ceremony, A I is hydrogen or a suitable hydroxy protecting group; a is an integer of 2 or 3, b is an integer from 2 to 5, or

[0419] [ka] During the ceremony, A I is hydrogen or a suitable hydroxy protecting group; a is an integer of 2 or 3, c and d are independently integers from 1 to 6; or

[0420] [ka] During the ceremony, A I is hydrogen or a suitable hydroxy protecting group; a is an integer of 2 or 3, e is an integer from 2 to 10.

[0421] In some embodiments, the moiety depicted in formula (I):

[0422] [ka] is represented by the formula (VIa * ) and

[0423] [ka] During the ceremony, A I is hydrogen or a suitable hydroxy protecting group; a is 3, b is an integer equal to 3.

[0424] In some embodiments, the moiety depicted in formula (I) anywhere herein:

[0425] [ka] is represented by the formula (VII * ) and

[0426] [ka] During the ceremony, A I is hydrogen, a is an integer of 2 or 3.

[0427] In some embodiments, a=2. In some embodiments, a=3. In some embodiments, b=3.

[0428] In some embodiments, the GalNAc ligand is included in any one of the linkers shown in Figures 2-5 or 6 (Formula XI), where the "oligonucleotide" can be any nucleic acid disclosed herein. Thus, the "oligonucleotide" can include linkages other than phosphodiester linkages, such as one or more phosphorothioate linkages. Preferably, the nucleic acid according to the present invention is a double-stranded oligonucleoside as defined herein, and the linker is conjugated to the second strand, more preferably the 3'-terminal region of the second strand, via a phosphodiester bond.

[0429] In some embodiments, the GalNAc ligand is included in a linker as shown in Figure 4, where the "oligonucleotide" may be any nucleic acid disclosed herein. Thus, the "oligonucleotide" may include linkages other than phosphodiester linkages, such as one or more phosphorothioate linkages. Preferably, the nucleic acid according to the present invention is a double-stranded oligonucleoside as defined herein, and the linker is conjugated to the second strand, more preferably the 3'-terminal region of the second strand, via a phosphodiester bond.

[0430] In some embodiments, the GalNAc ligand is included in a linker as shown in Figure 6 (Formula XI), where the "oligonucleotide" may be any nucleic acid disclosed herein. Thus, the "oligonucleotide" may contain linkages other than phosphodiester linkages, such as one or more phosphorothioate linkages. Preferably, the nucleic acid according to the present invention is a double-stranded oligonucleoside as defined herein, and the linker is conjugated to the second strand, more preferably the 3'-terminal region of the second strand, via a phosphodiester bond.

[0431] In some embodiments, the GalNAc ligand is included in any one of the linkers shown in Figures 2-5 or Figure 6 (Formula XI), and "oligonucleotide" represents a nucleic acid according to the present invention, which comprises a modified or unmodified second strand comprising or consisting of any one of SEQ ID NOs: 553 to 828, and preferably the linker is conjugated to the 3'-terminal region of the second strand, i.e., the 3'-terminal region of any one of SEQ ID NOs: 553 to 828, via a phosphodiester bond.

[0432] In some embodiments, the GalNAc ligand is included in a linker as shown in Figure 4, where "oligonucleotide" represents a nucleic acid according to the present invention, and the nucleic acid according to the present invention comprises a modified or unmodified second strand comprising or consisting of any one of SEQ ID NOs: 553 to 828, and preferably the linker is conjugated to the 3'-terminal region of the second strand, i.e., the 3'-terminal region of any one of SEQ ID NOs: 553 to 828, via a phosphodiester bond.

[0433] In some embodiments, the GalNAc ligand is included in the linker shown in Figure 6 (Formula XI), and "oligonucleotide" represents a nucleic acid according to the present invention, which comprises a modified or unmodified second strand comprising or consisting of any one of SEQ ID NOs: 553 to 828, and preferably the linker is conjugated to the 3'-terminal region of the second strand, i.e., the 3'-terminal region of any one of SEQ ID NOs: 553 to 828, via a phosphodiester bond.

[0434] In some embodiments, the GalNAc ligand is included in any one of the linkers shown in Figures 2-5 or Figure 6 (Formula XI), and "oligonucleotide" represents a nucleic acid according to the present invention, which comprises a modified or unmodified second strand comprising or consisting of any one of SEQ ID NO:580, SEQ ID NO:599, SEQ ID NO:715, SEQ ID NO:729, or SEQ ID NO:772, and preferably, the linker is conjugated via a phosphodiester bond to the 3'-terminal region of the second strand, i.e., the 3'-terminal region of any one of SEQ ID NO:580, SEQ ID NO:599, SEQ ID NO:715, SEQ ID NO:729, and SEQ ID NO:772.

[0435] In some embodiments, the GalNAc ligand is included in a linker as shown in Figure 4, where "oligonucleotide" represents a nucleic acid according to the present invention, which comprises a modified or unmodified second strand comprising or consisting of any one of SEQ ID NO:580, SEQ ID NO:599, SEQ ID NO:715, SEQ ID NO:729 and SEQ ID NO:772, and preferably the linker is conjugated via a phosphodiester bond to the 3'-terminal region of the second strand, i.e., the 3'-terminal region of any one of SEQ ID NO:580, SEQ ID NO:599, SEQ ID NO:715, SEQ ID NO:729 and SEQ ID NO:772.

[0436] In some embodiments, the GalNAc ligand is included in the linker shown in Figure 5 (Formula XI), and "oligonucleotide" represents a nucleic acid according to the present invention, which comprises a modified or unmodified second strand comprising or consisting of any one of SEQ ID NO:580, SEQ ID NO:599, SEQ ID NO:715, SEQ ID NO:729, and SEQ ID NO:772, and preferably, the linker is conjugated via a phosphodiester bond to the 3'-terminal region of the second strand, i.e., the 3'-terminal region of any one of SEQ ID NO:580, SEQ ID NO:599, SEQ ID NO:715, SEQ ID NO:729, and SEQ ID NO:772.

[0437] In some embodiments, the GalNAc ligand is included in any one of the linkers shown in Figures 2-5 or Figure 6 (Formula XI), and "oligonucleotide" represents a nucleic acid according to the present invention, which comprises a modified second strand comprising or consisting of any one of SEQ ID NOs: 1105 to 1380, and preferably the linker is conjugated to the 3'-terminal region of the second strand, i.e., the 3'-terminal region of any one of SEQ ID NOs: 1105 to 1380, via a phosphodiester bond.

[0438] In some embodiments, the GalNAc ligand is included in a linker as shown in Figure 4, where "oligonucleotide" represents a nucleic acid according to the present invention, and the nucleic acid according to the present invention comprises a modified second strand comprising or consisting of any one of SEQ ID NOs: 1105 to 1380, and preferably the linker is conjugated to the 3'-terminal region of the second strand, i.e., the 3'-terminal region of any one of SEQ ID NOs: 1105 to 1380, via a phosphodiester bond.

[0439] In some embodiments, the GalNAc ligand is included in the linker shown in Figure 6 (Formula XI), and "oligonucleotide" represents a nucleic acid according to the present invention, which comprises a modified second strand comprising or consisting of any one of SEQ ID NOs: 1105 to 1380, and preferably the linker is conjugated to the 3'-terminal region of the second strand, i.e., the 3'-terminal region of any one of SEQ ID NOs: 1105 to 1380, via a phosphodiester bond.

[0440] In some embodiments, the GalNAc ligand is included in any one of the linkers shown in Figures 2-5 or Figure 6 (Formula XI), and "oligonucleotide" represents a nucleic acid according to the present invention, which comprises a modified second strand comprising or consisting of any one of SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281, and SEQ ID NO:1324, and preferably, the linker is conjugated via a phosphodiester bond to the 3'-terminal region of the second strand, i.e., the 3'-terminal region of any one of SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281, and SEQ ID NO:1324.

[0441] In some embodiments, the GalNAc ligand is included in a linker as shown in Figure 4, where "oligonucleotide" represents a nucleic acid according to the present invention, and the nucleic acid according to the present invention comprises a modified second strand comprising or consisting of any one of SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281, and SEQ ID NO:1324, and preferably the linker is conjugated to the 3'-terminal region of the second strand, i.e., any one of SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281, and SEQ ID NO:1324, via a phosphodiester bond.

[0442] In some embodiments, the GalNAc ligand is included in the linker shown in Figure 6 (Formula XI), where "oligonucleotide" represents a nucleic acid according to the present invention, which comprises a modified second strand comprising or consisting of any one of SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281, and SEQ ID NO:1324, and preferably the linker is conjugated to the 3'-terminal region of the second strand, i.e., any one of SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281, and SEQ ID NO:1324, via a phosphodiester bond.

[0443] In some embodiments, the GalNAc ligand is included in a linker shown in Figures 2-5 or 6 (Formula XI), and "oligonucleotide" refers to a nucleic acid according to the invention, wherein the nucleic acid according to the invention comprises a modified second strand comprising or consisting of any one of SEQ ID NO:1105 to SEQ ID NO:1380, preferably any one of SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281, and SEQ ID NO:1324, wherein the second strand has the following structure:

[0444] [ka] and During the ceremony, T represents a 2'Me ribose modification; B represents the nucleoside bases of the first two base nucleosides in the 5'-terminal region of any one of SEQ ID NOs: 1105 to 1380, preferably any one of SEQ ID NOs: 1132, 1151, 1267, 1281, and 1324; and Z represents the remaining 19 consecutive nucleosides of any one of SEQ ID NOs: 1105 to 1380, preferably any one of SEQ ID NOs: 1132, 1151, 1267, 1281, and 1324.

[0445] In some embodiments, the GalNAc ligand is included in the linker shown in Figure 6 (Formula XI), and "oligonucleotide" refers to a nucleic acid according to the invention, wherein the nucleic acid according to the invention comprises a modified second strand comprising or consisting of any one of SEQ ID NO:1105 to SEQ ID NO:1380, preferably any one of SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281, and SEQ ID NO:1324, wherein the second strand has the following structure:

[0446] [ka] and During the ceremony, T represents a 2'Me ribose modification; B represents the nucleoside bases of the first two base nucleosides in the 5'-terminal region of any one of SEQ ID NOs: 1105 to 1380, preferably any one of SEQ ID NOs: 1132, 1151, 1267, 1281, and 1324; and Z represents the remaining 19 consecutive nucleosides of any one of SEQ ID NOs: 1105 to 1380, preferably any one of SEQ ID NOs: 1132, 1151, 1267, 1281, and 1324.

[0447] In some embodiments, the GalNAc ligand is included in the linker shown in FIG. 4, and "oligonucleotide" refers to a nucleic acid according to the invention, wherein the nucleic acid according to the invention comprises a modified second strand comprising or consisting of any one of SEQ ID NO:1105 to SEQ ID NO:1380, preferably any one of SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281, and SEQ ID NO:1324, wherein the second strand has the following structure:

[0448] [ka] and During the ceremony, T represents a 2'Me ribose modification; B represents the nucleoside bases of the first two base nucleosides in the 5'-terminal region of any one of SEQ ID NOs: 1105 to 1380, preferably any one of SEQ ID NOs: 1132, 1151, 1267, 1281, and 1324; and Z represents the remaining 19 consecutive nucleosides of any one of SEQ ID NOs: 1105 to 1380, preferably any one of SEQ ID NOs: 1132, 1151, 1267, 1281, and 1324.

[0449] Vectors and cells In one aspect, the invention provides a cell comprising a nucleic acid, such as an inhibitory RNA [RNAi], described herein.

[0450] In one aspect, the invention provides a cell comprising a vector described herein.

[0451] In one aspect, the invention provides a vector comprising an oligonucleotide inhibitor, e.g., an iRNA, e.g., an siRNA.

[0452] Pharmaceutically acceptable compositions In one aspect, the present invention provides a pharmaceutical composition for inhibiting expression of a target gene, the composition comprising an inhibitor, such as an oligomer, such as a nucleic acid, disclosed herein.

[0453] A pharmaceutically acceptable composition may include an excipient and / or carrier.

[0454] Some examples of substances that can serve as pharmaceutically acceptable carriers include: (1) sugars, such as lactose, glucose, and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose and its derivatives, such as sodium carboxymethylcellulose, ethylcellulose, and cellulose acetate; (4) tragacanth powder; (5) malt; (6) gelatin; (7) lubricants, such as magnesium stearate, sodium lauryl sulfate, and talc; (8) excipients, such as cocoa butter and suppository wax; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; (10) glycols; (11) polyols, such as propylene glycol, (12) esters, such as ethyl oleate and ethyl laurate, (13) agar, (14) buffers, such as magnesium hydroxide and aluminum hydroxide, (15) alginic acid, (16) pyrogen-free water, (17) isotonic saline, (18) Ringer's solution, (19) ethyl alcohol, (20) pH buffer solutions, (21) polyesters, polycarbonates, and / or polyanhydrides, (22) bulking agents, such as polypeptides and amino acids, (23) serum components, such as serum albumin, HDL, and LDL, and (24) other non-toxic, compatible substances used in pharmaceutical formulations.

[0455] Typical pharmaceutical carriers include, but are not limited to, binders (such as pregelatinized maize starch, polyvinylpyrrolidone, or hydroxypropyl methylcellulose), fillers (such as lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethylcellulose, polyacrylates, or calcium hydrogen phosphate), lubricants (such as magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, maize starch, polyethylene glycol, sodium benzoate, sodium acetate), disintegrants (such as starch, sodium starch glycolate), and wetting agents (such as sodium lauryl sulfate).

[0456] Pharmaceutically acceptable organic or inorganic excipients suitable for parenteral administration that do not adversely react with nucleic acids can also be used to formulate the compositions of the present invention.Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solution, alcohol, polyethylene glycol, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.

[0457] Preparations for topical administration of nucleic acid can include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohol, or solutions of nucleic acid in liquid or solid oil bases.The solution can also contain buffers, diluents, and other suitable additives.Pharmaceutically acceptable organic or inorganic excipients suitable for parenteral administration that do not adversely react with nucleic acid can be used.

[0458] In one embodiment, nucleic acid or composition is administered in non-buffered solution.In certain embodiments, non-buffered solution is saline or water.In other embodiments, nucleic acid, for example, RNAi agent, is administered in buffered solution.In such embodiments, buffered solution may contain acetate, citrate, prolamin, carbonate, or phosphate, or any combination thereof.For example, buffered solution may be phosphate buffered saline (PBS).

[0459] Dosage The pharmaceutical compositions of the present invention can be administered in a dosage sufficient to inhibit gene expression or modify target expression or function. Generally, when the composition contains a nucleic acid, a suitable dose of the nucleic acid, e.g., siRNA, of the present invention will be in the range of about 0.001 to about 200.0 milligrams per kilogram of recipient body weight per day, generally about 1 to 50 mg per kilogram of recipient body weight per day. Typically, a suitable dose of the nucleic acid, e.g., siRNA, of the present invention will be in the range of about 0.1 mg / kg to about 5.0 mg / kg, e.g., about 0.3 mg / kg to about 3.0 mg / kg.

[0460] A repeat dose regimen can include administering a therapeutic amount of a nucleic acid, e.g., an siRNA, on a regular basis, e.g., every other day or yearly. In certain embodiments, the nucleic acid, e.g., an siRNA, is administered about once a month to about once a quarter (i.e., about once every three months).

[0461] In various embodiments, the nucleic acid, e.g., siRNA agent, is administered at a dose of about 0.01 mg / kg to about 10 mg / kg or about 0.5 mg / kg to about 50 mg / kg. In some embodiments, the nucleic acid, e.g., siRNA agent, is administered at a dose of about 10 mg / kg to about 30 mg / kg. In certain embodiments, the nucleic acid, e.g., siRNA agent, is administered at a dose selected from about 0.5 mg / kg, 1 mg / kg, 1.5 mg / kg, 3 mg / kg, 5 mg / kg, 10 mg / kg, and 30 mg / kg. In certain embodiments, the nucleic acid, e.g., siRNA agent, is administered at a dose of about 0.1 mg / kg to about 5.0 mg / kg approximately once a week, once a month, once every two months, or once a quarter (i.e., once every three months). In certain embodiments, the nucleic acid, e.g., siRNA agent, is administered to the subject once a week. In certain embodiments, the nucleic acid, e.g., siRNA agent, is administered to the subject once a month. In certain embodiments, the nucleic acid, eg, siRNA agent, is administered quarterly (ie, once every three months).

[0462] After the initial treatment regimen, treatments may be administered less frequently, for example, once per week or once every two weeks for three months, followed by monthly, once every six months, or once a year or longer.

[0463] Pharmaceutical compositions can be administered once a day, or can be administered as divided doses twice, three times or more at appropriate intervals throughout the day, or even by continuous infusion or controlled-release formulation.In this case, the amount of nucleic acid, such as siRNA, contained in each divided dose must be correspondingly smaller to achieve the total daily dosage.Dosage units can also be formulated to be delivered over several days, for example, by using conventional sustained-release formulations that provide the sustained release of nucleic acid, such as siRNA, over several days.Sustained-release formulations are well known in the art and are particularly useful for delivering active agents at specific sites, such as those that can be used with the active agents of the present invention.In this embodiment, dosage units comprise the corresponding multiple of daily dose.

[0464] In other embodiments, a single dose of the pharmaceutical composition may be long-lasting, such that subsequent doses are administered at intervals of no more than 3, 4, or 5 days, or at intervals of no more than 1, 2, 3, or 4 weeks. In some embodiments of the present invention, a single dose of the pharmaceutical composition of the present invention is administered once a week. In other embodiments of the present invention, a single dose of the pharmaceutical composition of the present invention is administered once every two months. In certain embodiments, the siRNA is administered about once a month to about once a quarter (i.e., about once every three months), or even once every six or twelve months.

[0465] Estimation of effective dosages and in vivo half-lives of particular nucleic acids encompassed by the invention, e.g., siRNAs, can be made using conventional methodologies or based on in vivo studies using appropriate animal models known in the art.

[0466] The pharmaceutical compositions of the present invention can be administered in a variety of ways, depending on whether local or systemic treatment is desired and the area to be treated. Administration can be topical (e.g., by transdermal patch), pulmonary, for example, by inhalation or insufflation of powder or aerosol, including by nebulizer, intratracheal, intranasal, epidermal and transdermal, oral, or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion, subcutaneous, for example, by implantable device, or intracranial, for example, intraparenchymal, intrathecal, or intraventricular administration. In certain preferred embodiments, the composition is administered by intravenous infusion or injection. In certain embodiments, the composition is administered by subcutaneous injection.

[0467] In one embodiment, the nucleic acid, eg, the siRNA agent, is administered subcutaneously to the subject.

[0468] Inhibitors, such as nucleic acids, eg, siRNA, can be delivered in a manner that targets specific tissues (eg, specific liver cells).

[0469] Methods for inhibiting gene expression in vitro or for inhibiting target expression or function The present invention also provides a method for inhibiting SLC25A5 gene expression in a cell. Such a method comprises contacting a cell with an effective amount of a nucleic acid of the present invention, such as a siRNA agent, for example, a double-stranded siRNA agent, to inhibit SLC25A5 gene expression in the cell, thereby inhibiting SLC25A5 gene expression in the cell. It should be noted that the nucleic acid "for inhibiting SLC25A5 expression" is preferably a nucleic acid capable of inhibiting SLC25A5 expression as described herein below.

[0470] The contact of cells with nucleic acid, for example, siRNA, for example, double-stranded siRNA agent, can be carried out in vitro or in vivo. Contacting cells with nucleic acid in vivo includes, for example, contacting cells or a group of cells in a subject, for example, a human subject, with nucleic acid, for example, siRNA. A combination of in vitro and in vivo methods for contacting cells is also possible. As discussed above, contacting cells can be direct or indirect. Furthermore, contacting cells can be achieved by a targeting ligand moiety, including any ligand moiety described herein or known in the art. In a preferred embodiment, the targeting ligand moiety is a carbohydrate moiety, for example, a GalNAc3 ligand, or any other ligand moiety that directs siRNA agent to a target site.

[0471] The term "inhibit," as used herein, is used interchangeably with "reduce," "silencing," "downregulate," "suppress," and other similar terms, and includes any level of inhibition.

[0472] In some embodiments of the methods of the present invention, the expression or activity of the gene or inhibition target is preferably inhibited by at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or is inhibited to a level below the detection level of the assay, as determined by qPCR as described herein and / or when siRNA is introduced into target cells by transfection. In certain embodiments, such methods include clinically relevant inhibition of target gene expression, as demonstrated, for example, by a clinically relevant outcome after treating a subject with an agent that reduces gene expression and / or target activity.

[0473] In some embodiments, the nucleic acids of the invention, when transfected into cells, inhibit expression of the SLC25A5 gene with an IC50 value below a defined threshold, which in some embodiments may be 2500 pM, 2000 pM, 1900 pM, 1800 pM, 1700 pM, 1600 pM, 1500 pM, 1400 pM, 1300 pM, 1200 pM, 1100 pM, 1000 pM, 900 pM, 800 pM, 700 pM, 600 pM, 500 pM, 400 pM, 300 pM, 200 pM, or 100 pM, as determined preferably by qPCR, more preferably by reverse transcriptase (RT)-qPCR, as described herein.

[0474] In a preferred embodiment, when transfected into a cell, the nucleic acid of the present invention inhibits the expression of the SLC25A5 gene with an IC50 value of less than 2500 pM. In a more preferred embodiment, when transfected into a cell, the nucleic acid of the present invention inhibits the expression of the SLC25A5 gene with an IC50 value of less than 1000 pM. In an even more preferred embodiment, when transfected into a cell, the nucleic acid of the present invention inhibits the expression of the SLC25A5 gene with an IC50 value of less than 500 pM. In a most preferred embodiment, when transfected into a cell, the nucleic acid of the present invention inhibits the expression of the SLC25A5 gene with an IC50 value of less than 100 pM.

[0475] Inhibition of the SLC25A5 gene can be quantified by the following method.

[0476] Huh7 cells (a human hepatocyte-derived cell line obtained from the JCRB Cell Bank) may be maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% FBS and 1% non-essential amino acids at 37°C in a 5% CO atmosphere. The cells may then be transfected with siRNA duplexes targeting SLC25A5 mRNA or a negative control siRNA (siRNA-Control; sense strand 5'-GCCTGTACCAAGGCTTTAA-3' (SEQ ID NO: 1383), antisense strand 5'-TTAAAGCCTTGGTACAGGC-3' (SEQ ID NO: 1382)) using six 10-fold serial dilutions spanning a final duplex concentration range of 3 nM to 0.03 pM. Transfections may be performed by adding 9.7 μL of Opti-MEM (ThermoFisher) plus 0.3 μL of Lipofectamine RNAiMAX (ThermoFisher) to 10 μL of each siRNA duplex. The mixture may be incubated at room temperature for 15 minutes before being added to 100 μL of complete growth medium containing 20,000 Huh7 cells. Cells may be incubated at 37°C / 5% CO for 24 hours before total RNA is purified using an RNeasy 96 kit (Qiagen). Each duplex may be tested by transfecting duplicate wells in a single experiment.

[0477] cDNA synthesis can be performed using the FastKing RT (with gDNase) kit (Tiangen). Real-time quantitative PCR (qPCR) can be performed using the SensiFAST SYBR Hi-ROX kit (Meridian) with primers specific for human SLC25A5 (forward: ACTGACATCATGTACACAGGCAC (SEQ ID NO: 1384), reverse: ACCCATGCCTCTGAGAACATT (SEQ ID NO: 1385)) and human GAPDH (forward: GAAGGTGAAGGTCGGAGTC (SEQ ID NO: 1386), reverse: GAAGATGGTGATGGGATTTC (SEQ ID NO: 1387)) on an ABI Prism 7900HT or ABI QuantStudio 7.

[0478] qPCR was performed in duplicate on cDNA from each well, and the average cycle threshold (Ct) value was calculated. Relative SLC25A5 expression was calculated from the average Ct values ​​using the comparative Ct (ΔΔCt) method and normalized to GAPDH and to untreated cells. The percent maximum inhibition of SLC25A5 expression and IC50 values ​​were calculated using a four-parameter (variable slope) model using GraphPad Prism9.

[0479] In some embodiments, the nucleic acids of the invention, when transfected into cells, inhibit expression of the SLC25A5 gene with a pEC50 value of less than 5, 6, 7, 8, 9, or 10, preferably as determined by qPCR, more preferably by reverse transcriptase (RT)-qPCR, as described herein.

[0480] Huh7 cells (a human hepatocyte-derived cell line obtained from the JCRB Cell Bank) may be maintained at 37°C, 5% CO2, and 95% humidity in Dulbecco's modified Eagle's medium (DMDM) supplemented with 10% FBS and 1% non-essential amino acids. siRNA duplexes targeting either SLC25A5 mRNA or a negative control siRNA (siRNA-Control; sense strand 5'-GCCTGTACCAAGGCTTTAA-3' (SEQ ID NO: 1383), antisense strand 5'-TTAAAGCCTTGGTACAGGC-3' (SEQ ID NO: 1382)) may be transfected into cells in a six-point logarithmic dose-response curve to yield final assay concentrations ranging from 3 nM to 0.03 pM. Transfections may be performed by diluting Lipofectamine RNAiMAX (ThermoFisher) in Opti-MEM (ThermoFisher) medium at a ratio of 48.5:1.5. This solution may be added to an equal volume of siRNA and diluted to the required concentration in phosphate-buffered saline. The Lipofectamine RNAiMAX and siRNA mixture may be incubated at room temperature for 15 minutes, after which 20 μL may be added to wells of a 96-well plate. Huh7 cells may be dissociated from the flask using trypsin and resuspended to a density of 200,000 cells / mL. 100 μL of the Huh7 cell suspension may be added to each well of the 96-well plate containing siRNA. The cells may be incubated at 37°C, 5% CO2, and 95% humidity for 24 hours. Each siRNA may be tested in triplicate wells on two separate days, for a total of six replicates.

[0481] Intracellular RNA may be isolated using an Rneasy kit (Qiagen) according to the manufacturer's instructions. cDNA synthesis may be performed using a FastKing RT kit with gDNase (Tiangen). Target cDNA may be quantified by qPCR using a SensiFAST SYBR Hi-ROX kit (Meridian) with primers specific for human SLC25A5 (forward: ACTGACATCATGTACACAGGCAC (SEQ ID NO: 1384), reverse: ACCCATGCCTCTGAGAACATT (SEQ ID NO: 1385)) and human GAPDH (forward: GAAGGTGAAGGTCGGAGTC (SEQ ID NO: 1386), reverse: GAAGATGGTGATGGGATTTC (SEQ ID NO: 1387)) on an ABI Prism 7900HT or ABI QuantStudio 7.

[0482] qPCR can be performed in duplicate on cDNA from each well, and the average Ct can be calculated. Relative SLC25A5 expression can be calculated from the average Ct values ​​using the comparative Ct (ΔΔCt) method and normalized to GAPDH and to untreated cells. The percent maximum inhibition of SLC25A5 expression and pEC50 value (-log of EC50) can be calculated. 10 ) can be calculated using a four-parameter (variable slope) model using NumPy (Python).

[0483] Alternatively or additionally, inhibition of expression of the SLC25A5 gene may be characterized by a reduction in the average relative expression of the SLC25A5 gene.

[0484] In some embodiments, when cells are transfected with 0.1 nM of a nucleic acid of the invention, the average relative expression of SLC25A5 is below 1, 0.9, 0.8, 0.7, 0.6, 0.5, or 0.4, as measured preferably by qPCR, more preferably by reverse transcriptase (RT)-qPCR, as described herein.

[0485] In some embodiments, when cells are transfected with 5 nM of a nucleic acid of the invention, the average relative expression of SLC25A5 is below 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, or 0.3, preferably measured by qPCR, more preferably by reverse transcriptase (RT)-qPCR, as described herein.

[0486] The average relative expression of the SLC25A5 gene can be quantified by the following method.

[0487] Huh7 cells (a human hepatocyte-derived cell line obtained from the JCRB Cell Bank) may be maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% FBS at 37°C in a 5% CO atmosphere. The cells may be transfected with siRNA duplexes targeting SLC25A5 mRNA or negative control siRNA (siRNA control, sense strand 5'-GCCTGTACCAAGGCTTTAA-3' (SEQ ID NO: 1383), antisense strand 5'-TTAAAGCCTTGGTACAGGC-3' (SEQ ID NO: 1382)) at final duplex concentrations of 5 nM and 0.1 nM. Transfection may be performed by adding 9.7 μL of Opti-MEM (ThermoFisher) + 0.3 μL of Lipofectamine RNAiMAX (ThermoFisher) to 10 μL of each siRNA duplex. The mixture may be incubated at room temperature for 15 minutes before being added to 100 μL of complete growth medium containing 20,000 Huh7 cells. The cells may be incubated at 37°C / 5% CO for 24 hours before total RNA is purified using the Rneasy 96 kit (Qiagen). Each duplex may be tested by transfecting duplicate wells in two independent experiments.

[0488] cDNA synthesis can be performed using the FastKing RT (with gDNase) kit (Tiangen). Real-time quantitative PCR (qPCR) can be performed using the SensiFAST SYBR Hi-ROX kit (Meridian) with primers specific for human SLC25A5 (forward: ACTGACATCATGTACACAGGCAC (SEQ ID NO: 1384), reverse: ACCCATGCCTCTGAGAACATT (SEQ ID NO: 1385)) and human GAPDH (forward: GAAGGTGAAGGTCGGAGTC (SEQ ID NO: 1386), reverse: GAAGATGGTGATGGGATTTC (SEQ ID NO: 1387)) on an ABI Prism 7900HT or ABI QuantStudio 7.

[0489] qPCR can be performed in duplicate on cDNA from each well, and the average Ct can be calculated. Relative SLC25A5 expression can be calculated from the average Ct values ​​using the comparative Ct (ΔΔCt) method and normalized to GAPDH and to untreated cells.

[0490] Inhibition of expression of the SLC25A5 gene may be manifested by a reduction in the amount of mRNA of the target SLC25A5 gene compared to a suitable control.

[0491] In other embodiments, inhibition of expression of the SLC25A5 gene may be assessed in terms of a reduction in gene expression, for example protein expression or a parameter functionally related to a signaling pathway.

[0492] Methods for treating or preventing diseases associated with the expression of target gene expression / function The present invention also provides a method for reducing or inhibiting gene expression in cells, or reducing target expression or function, using nucleic acid of the present invention, such as siRNA, or a composition comprising nucleic acid of the present invention, such as siRNA.This method comprises contacting cell with nucleic acid of the present invention, such as dsiRNA, and maintaining the cell for a sufficient time to obtain the degradation of the mRNA transcript of gene, thereby inhibiting the expression of gene in cell.The reduction of target gene expression or function can be evaluated by any method known in the art.In a preferred embodiment, the gene is SLC25A5.

[0493] In the methods of the present invention, the cells may be contacted in vitro or in vivo, that is, the cells may be present within a subject.

[0494] A cell suitable for treatment using the methods of the present invention may be any cell that expresses a gene of interest associated with a metabolic disease or disorder, such as a metabolic disease or disorder associated with non-alcoholic fatty liver disease (NAFLD), and / or a disease or disorder associated with obesity and / or lipogenesis and / or lipogenesis.

[0495] The in vivo method of the present invention involves administering to a subject a composition comprising a nucleic acid, e.g., an siRNA, of the present invention, wherein the nucleic acid, e.g., the siRNA, comprises a nucleoside sequence complementary to at least a portion of an RNA transcript of the SLC25A5 gene of the mammal to be treated.

[0496] The present invention further provides a method for treating a subject in need thereof.The treatment method of the present invention comprises administering a therapeutically effective amount of a nucleic acid such as an siRNA of the present invention, for example, a nucleic acid such as an siRNA that targets a gene, or a pharmaceutical composition that comprises a nucleic acid that targets a gene, to a subject, for example, a subject that will benefit from reducing or inhibiting the expression and / or expression and / or function of a gene and / or target.

[0497] The nucleic acid of the present invention, for example, siRNA, may be administered as a "free" nucleic acid or "free" siRNA, which is administered without a pharmaceutical composition. The naked nucleic acid may be present in a suitable buffer solution. The buffer solution may contain acetate, citrate, prolamin, carbonate, or phosphate, or any combination thereof. In one embodiment, the buffer solution is phosphate-buffered saline (PBS). The pH and osmolality of the buffer solution can be adjusted to be suitable for administration to a subject.

[0498] Alternatively, the nucleic acids of the invention, eg, siRNA, may be administered as pharmaceutical compositions, such as dsiRNA liposome formulations.

[0499] In one embodiment, the method comprises administering a composition described herein such that expression of the target gene is reduced, such as for about 1, 2, 3, 4, 5, 6, 7, 8, 12, 16, 18, 24, 28, 32, or about 36 hours. In one embodiment, expression of the target gene is reduced for an extended period of time, such as at least about 2, 3, 4 days or longer, such as for about 1 week, 2 weeks, 3 weeks, or 4 weeks or longer, such as for about 1 month, 2 months, or 3 months.

[0500] The subject can be administered a therapeutic amount of a nucleic acid, eg, an siRNA, for example, from about 0.01 mg / kg to about 200 mg / kg.

[0501] Nucleic acid, for example, siRNA, can be administered by intravenous infusion periodically over a period of time.In certain embodiments, after the initial treatment regimen, treatment can be administered less frequently.For example, administration of siRNA can reduce the gene product level of target gene in patient's cells or tissue by at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95%, or to a level below the detection level of the assay used.In certain embodiments, administration causes clinical stabilization or preferably clinically relevant reduction of at least one sign or symptom of gene-related disorder.

[0502] Alternatively, the nucleic acid, e.g., siRNA, can be administered subcutaneously, i.e., by subcutaneous injection. One or more injections can be used to deliver the desired daily dose of nucleic acid, e.g., siRNA, to the subject. The injections can be repeated over a period of time. The administration can be repeated periodically. In certain embodiments, after an initial treatment regimen, treatment can be administered less frequently. A repeat dose regimen can include administering a therapeutic amount of nucleic acid periodically, for example, every other day to once a year. In certain embodiments, the nucleic acid is administered about once a month to about once a quarter (i.e., about once every three months).

[0503] Combination Therapy The inhibitors of the present invention may be combined with other therapeutic agents for use in therapy, particularly for use in treating any of the metabolic diseases or disorders disclosed herein.

[0504] In certain embodiments, an inhibitor of the present invention, such as any of the siRNA molecules disclosed herein, may be combined with a GLP-1 agonist, including but not limited to a GLP-1 / GIP dual agonist, a GLP-1 / FGF21 dual agonist, a GLP-1 / GCGR dual agonist and a GLP-1 / GIP / GCGR triple agonist, and / or a THR-beta agonist.

[0505] That is, in certain embodiments, the inhibitors of the present invention, particularly the siRNA molecules disclosed herein, may be combined with GLP-1 agonists for the treatment of metabolic diseases or disorders.In certain embodiments, the inhibitors of the present invention, particularly the siRNA molecules disclosed herein, may be combined with GLP-1 agonists for the treatment of fatty liver disease, particularly NAFLD and / or NASH.

[0506] The term "GLP-1 agonist" as used herein refers to a compound that fully or partially activates human GLP-1 receptor.Therefore, this term is equivalent to the term "GLP-1 receptor agonist" used in other documents.The term GLP-1 agonist and specific GLP-1 agonist described herein also include their salt forms.

[0507] It follows that a GLP-1 agonist must exhibit "GLP-1 activity," as known in the art, which refers to the ability of a compound, i.e., a GLP-1 analog or a compound comprising a GLP-1 analog, to bind to the GLP-1 receptor and initiate a signal transduction pathway that results in an insulinotropic or other physiological effect. In some embodiments, a "GLP-1 agonist" is one that exhibits a certain affinity constant (K D ) or with a potency (EC ) of less than 1 mM, e.g., less than 100 nM, as measured by methods known in the art (see, e.g., WO 98 / 08871 ). 50 ) and exhibit insulinotropic activity, which can be measured by in vivo or in vitro assays known to those skilled in the art. For example, a GLP-1 agonist may be administered to an animal with elevated blood glucose (e.g., obtained using an intravenous glucose tolerance test (IVGTT)). Those skilled in the art can determine, for example, a suitable glucose dosage and a suitable blood sampling regimen in an IVGTT depending on the animal species, and determine plasma insulin concentration over time. Suitable assays are described, for example, in WO 2015 / 155151.

[0508] Half-maximal effective concentration (EC 50 ) generally refers to the concentration that induces a response halfway between baseline and maximum, in reference to a dose-response curve. 50 The value is used as a measure of the compound's potency and represents the concentration at which 50% of its maximal effect is observed. Due to the albumin binding effect of GLP-1 agonists containing the substituents described herein, it is important to pay attention to whether the assay includes human serum albumin.

[0509] In vitro potency of GLP-1 agonists was determined in the absence of human serum albumin (HSA) as described in Example 29 of WO 2015 / 155151 and EC 50 EC 50 The lower the titer, the better the potency. In one embodiment, the potency (EC50) determined (in the absence of HSA) is between 5 and 1000 pM, for example, between 10 and 750 pM, between 10 and 500 pM, or between 10 and 200 pM. In one embodiment, the EC50 (in the absence of HSA) is at most 500 pM, for example, at most 300 pM, for example, at most 200 pM.

[0510] In one embodiment, the EC50 (in the absence of HSA) is equivalent to human GLP-1(7-37).

[0511] In one embodiment, the EC50 (in the absence of HSA) is at most 50 pM. In further such embodiments, the EC50 is at most 40 pM, such as at most 30 pM, such as at most 20 pM, for example at most 10 pM. In one embodiment, the EC50 is approximately 10 pM.

[0512] Similarly, or alternatively, albumin binding of GLP-1 agonists may be measured using the in vitro potency assay of Example 29 of WO 2015 / 155151, which includes HSA. In vitro potency in the presence of serum albumin, i.e., EC 50 Increasing values ​​reflect affinity for serum albumin.

[0513] In one embodiment, the potency (EC50) determined (in the presence of 1% HSA) is between 5 and 1000 pM, such as between 100 and 750 pM, 200 and 500 pM or 100 and 400 pM. In one embodiment, the EC50 (in the presence of 1% HSA) is at most 750 pM, such as at most 500 pM, for example at most 400 pM, such as at most 300 or for example at most 250 pM.

[0514] If desired, the fold change relative to a known GLP-1 receptor agonist may be calculated as EC50(test analog) / EC50(known analog), and efficacy is considered equivalent if this ratio is, for example, between 0.5 and 1.5, or between 0.8 and 1.2.

[0515] In one embodiment, the potency, EC50 (in the absence of HSA) is equivalent to that of liraglutide. In one embodiment, the potency, EC50 (in the absence of HSA) is equivalent to that of semaglutide.

[0516] In some embodiments, the GLP-1 agonist is a GLP-1 analogue, optionally containing "one substitution." The term "analog," as used herein, referring to a GLP-1 peptide (hereinafter "peptide"), means a peptide in which at least one amino acid residue of the peptide has been replaced with another amino acid residue, and / or at least one amino acid residue has been deleted from the peptide, and / or at least one amino acid residue has been added to the peptide, and / or at least one amino acid residue of the peptide has been modified. Such addition or deletion of an amino acid residue may occur at the N-terminus of the peptide and / or the C-terminus of the peptide.

[0517] In some embodiments, the term "GLP-1 analog" or "analog of GLP-1," as used herein, refers to a peptide or compound that is a variant of human glucagon-like peptide-1 (GLP-1(7-37)). GLP-1(7-37) has the sequence HAEGTFTSDV SSYLEGQAAKEFIAWLVKGRG (SEQ ID NO: 1388). In some embodiments, the term "variant" refers to a compound that includes one or more amino acid substitutions, deletions, additions, and / or insertions.

[0518] In one embodiment, the GLP-1 agonist exhibits at least 60%, 65%, 70%, 80% or 90% sequence identity with GLP-1(7-37) over the entire length of GLP-1(7-37).

[0519] Generally, the term GLP-1 agonist is meant to include GLP-1 agonist and any pharmaceutically acceptable salt, amide or ester thereof.In some embodiments, the composition comprises GLP-1 agonist or its pharmaceutically acceptable salt, amide or ester thereof.In some embodiments, the composition comprises GLP-1 agonist and one or more pharmaceutically acceptable counterions.

[0520] In certain embodiments, the inhibitors of the invention, in particular the siRNA molecules of the invention, are selected from the group consisting of WO 93 / 19175, WO 96 / 29342, WO 98 / 08871, WO 99 / 43707, WO 99 / 43706, WO 99 / 43341, WO 99 / 43708, WO 2005 / 027978, WO 2005 / 058954, WO 2005 / 058958, WO 2006 / 005667, WO 2006 / 037810 , WO 2006 / 037811, WO 2006 / 097537, WO 2006 / 097538, WO 2008 / 023050, WO 2009 / 030738, WO 2009 / 030771, WO 2009 / 030774 and WO 2021 / 219710, which are incorporated herein by reference in their entireties.

[0521] In certain embodiments, the inhibitors of the present invention, in particular the siRNA molecules of the present invention, may be administered together with a GLP-1 agonist selected from the group consisting of dulaglutide (Trulicity®), exenatide (Byetta®), exenatide extended-release tablets (Bydureon®), liraglutide (Victoza®), lixisenatide (Adlyxin®), semaglutide injection (Ozempic®), and semaglutide tablets (Rybelsus®).

[0522] In some embodiments, the GLP-1 agonist is semaglutide, which has the formula N-epsilon 26-[2-(2-{2-[2-(2-{2-[(S)-4-carboxy-4-(17-carboxy-heptadecanoylamino)butyrylamino]ethoxy}ethoxy)acetylamino]ethoxy}ethoxy)acetyl][Aib8,Arg34]GLP-1(7-37).

[0523] The term "GLP-1 agonist" as used herein also encompasses dual or triple agonists that can activate more than one receptor. These dual or triple agonists may be molecules capable of activating the GLP-1 receptor and at least one additional receptor. In some embodiments, the dual or triple agonist may be a chimeric molecule comprising a first portion that activates the GLP-1 receptor and an additional portion that activates an additional receptor. In certain embodiments, the GLP-1 agonist is a dual or triple agonist that further activates one or more of the glucose-dependent insulinotropic polypeptide (GIP) receptor, fibroblast growth factor 21 (FGF21) receptor, and glucagon receptor (GCGR) in addition to the GLP-1 receptor.

[0524] In certain embodiments, the inhibitors of the present invention, particularly the siRNA molecules disclosed herein, may be combined with a GLP-1 / GIP dual agonist for the treatment of metabolic diseases or disorders. In certain embodiments, the inhibitors of the present invention, particularly the siRNA molecules disclosed herein, may be combined with a GLP-1 / GIP dual agonist for the treatment of fatty liver disease, particularly NAFLD and / or NASH.

[0525] The term "GLP-1 / GIP dual agonist," as used in the context of the present invention, refers to a substance or ligand capable of activating the GLP-1 receptor and the glucose-dependent insulinotropic polypeptide (GIP) receptor. GLP-1 / GIP receptor coagonists and their potential medical uses are described in several patent documents, e.g., WO 2010 / 011439, WO 2013 / 164483, WO 2014 / 192284, WO 2015 / 067715, WO 2015 / 022420, WO 2015 / 086728, WO 2015 / 086729, WO 2016 / 111971, WO 2017 / 111972, WO 2018 / 111973, WO 2019 / 112122, WO 2019 / 112132, WO 2019 / 112142, WO 2019 / 112154, WO 2019 / 112162, WO 2019 / 112172, WO 2019 / 112182, WO 2019 / 112193, WO 2020 / 112194, WO 2020 / 112195, WO 2020 / 112196, WO 2020 / 1121973, WO 2020 / 1121974, WO 2020 / 112198, WO 2020 / 112199, WO 2020 / 112199, WO 2020 / 112199, WO 2020 / 112199, WO No. 2020 / 023386, U.S. Patent No. 9,745,360, U.S. Patent Application Publication No. 2014 / 162945, U.S. Patent Application Publication No. 2014 / 0357552, WO 2021 / 150673, WO 2021 / 260530, WO 2022 / 018185, and WO 2022 / 079639, which are incorporated herein by reference in their entireties.

[0526] In certain embodiments, the inhibitors of the present invention, particularly the siRNA molecules disclosed herein, may be combined with the GLP-1 / GIP dual agonist tirzepatide (Mounjaro®) for the treatment of metabolic diseases or disorders. In certain embodiments, the inhibitors of the present invention, particularly the siRNA molecules disclosed herein, may be combined with the GLP-1 / GIP dual agonist tirzepatide (Mounjaro®) for the treatment of fatty liver disease, particularly NAFLD and / or NASH.

[0527] As used herein, "tirzepatide" refers to the GLP-1 / GIP dual agonist peptide described in U.S. Patent No. 9,474,780 and set forth under CAS Registry Number: 2023788-19-2. Tirzepatide is described in Example 1 of U.S. Patent No. 9,474,780 and has the following sequence: YX1EGTFTSDYSIX2LDKIAQKAFVQWLMGGPSSGAPPPS (SEQ ID NO: 1389) wherein X1 is α-aminoisobutyric acid (Aib); X2 is Aib; K at position 20 is (2-[2-(2-amino-ethoxy)-ethoxy]-acetyl)2-(γGlu)1-CO—(CH2) 18 It is chemically modified through conjugation of the epsilon-amino group of the K side chain with -CO2H; and the C-terminal amino acid is amidated as a C-terminal primary amide.

[0528] In certain embodiments, the inhibitors of the present invention, particularly the siRNA molecules disclosed herein, may be combined with a GLP-1 / FGF21 dual agonist for the treatment of metabolic diseases or disorders. In certain embodiments, the inhibitors of the present invention, particularly the siRNA molecules disclosed herein, may be combined with a GLP-1 / FGF21 dual agonist for the treatment of fatty liver disease, particularly NAFLD and / or NASH.

[0529] The term "GLP-1 / FGF21 dual agonist" as used in the context of the present invention refers to a substance or ligand that can activate the GLP-1 receptor and the fibroblast growth factor 21 (FGF21) receptor. Preferably, the GLP-1 / FGF21 dual agonist is a chimeric molecule comprising a GLP-1 agonist as defined hereinabove and the molecule FGF21 or a functionally active variant or analog thereof. In certain embodiments, the GLP-1 / FGF21 dual agonist may further comprise an antibody Fc region.

[0530] GLP-1 / FGF21 receptor co-agonists and their potential medical uses are described in several patent applications, such as WO 2010 / 142665, WO 2014 / 037373, WO 2018 / 115401, WO 2018 / 166461, WO 2019 / 243557, and WO 2022 / 002408, which are incorporated herein by reference in their entireties.

[0531] In certain embodiments, the inhibitors of the present invention, particularly the siRNA molecules disclosed herein, may be combined with GLP-1 / GCGR dual agonists for the treatment of metabolic diseases or disorders.In certain embodiments, the inhibitors of the present invention, particularly the siRNA molecules disclosed herein, may be combined with GLP-1 / GCGR dual agonists for the treatment of fatty liver disease, particularly NAFLD and / or NASH.

[0532] The term "GLP-1 / GCGR dual agonist", as used in the context of the present invention, refers to a substance or ligand that is capable of activating the GLP-1 receptor and the glucagon receptor (GCGR). GLP-1 / GCGR receptor co-agonists and their potential medical uses have been described in several patent applications, such as WO 2008 / 101017, WO 2009 / 155258, WO 2011 / 075393, WO 2011 / 160630, WO 2014 / 056872, WO 2014 / 091316, WO 2015 / 086733, WO 2017 / 181452, WO 2018 / 100174, WO 2019 / 030268, WO 2019 / 060660 and WO 2023 / 006923, which are incorporated herein by reference in their entireties.

[0533] In certain embodiments, the inhibitors of the present invention, particularly the siRNA molecules disclosed herein, may be combined with the GLP-1 / GCGR dual agonist sulbodutide (BI 456906) for the treatment of metabolic diseases or disorders. In certain embodiments, the inhibitors of the present invention, particularly the siRNA molecules disclosed herein, may be combined with the GLP-1 / GCGR dual agonist sulbodutide (BI 456906) for the treatment of fatty liver disease, particularly NAFLD and / or NASH.

[0534] In certain embodiments, the inhibitors of the present invention, particularly the siRNA molecules disclosed herein, may be combined with a GLP-1 / GIP / GCGR triple agonist for the treatment of metabolic diseases or disorders. In certain embodiments, the inhibitors of the present invention, particularly the siRNA molecules disclosed herein, may be combined with a GLP-1 / GIP / GCGR dual agonist for the treatment of fatty liver disease, particularly NAFLD and / or NASH.

[0535] The term "GLP-1 / GIP / GCGR triple agonist" as used in the context of the present invention refers to a substance or ligand that can activate the GLP-1 receptor, the GIP receptor, and the glucagon receptor (GCGR). GLP-1 / GIP / GCGR receptor coagonists and their potential medical uses are described in several patent applications, such as WO 2014 / 096150, WO 2015 / 067716, WO 2019 / 125292, WO 2022 / 090447, and WO 2022 / 268029, which are incorporated herein by reference in their entirety.

[0536] In certain embodiments, the inhibitors of the present invention, particularly the siRNA molecules disclosed herein, may be combined with retatortide (LY-3437943) for the treatment of metabolic diseases or disorders. In certain embodiments, the inhibitors of the present invention, particularly the siRNA molecules disclosed herein, may be combined with retatortide (LY-3437943) for the treatment of fatty liver disease, particularly NAFLD and / or NASH.

[0537] Those skilled in the art will know how to formulate GLP-1 agonists, including dual and triple agonists, for any suitable route of administration. In certain embodiments, the GLP-1 agonist may be administered orally or by injection, for example, by subcutaneous injection.

[0538] In certain embodiments, the inhibitor of the present invention, particularly the siRNA molecule disclosed herein, can be combined with THR-beta agonist to treat metabolic disease or disorder.In certain embodiments, the inhibitor of the present invention, particularly the siRNA molecule disclosed herein, can be combined with THR-beta agonist to treat fatty liver disease, particularly NAFLD and / or NASH.

[0539] The term "THR-beta agonist," as used herein, refers to a compound that fully or partially activates the human thyroid hormone receptor-beta. The terms THR-beta agonist, as well as the specific THR-beta agonists described herein, also encompass salt forms thereof.

[0540] Various THR-beta agonists have been described in the art and are summarized, inter alia, by Zucchi (Thyroid Hormone Analogues: An Update, Thyroid. August 2020; Vol. 30(8): pp. 1099-1105), which is incorporated herein by reference in its entirety.

[0541] In certain embodiments, the THR-beta agonist administered in combination with an inhibitor of the invention is MGL-3196 (resmetirom), KB-2115 (eprotirom), GC-1 (sobetirom), or MB07344 / VK2809, e.g., as described by Zucchi.

[0542] In certain embodiments, the THR-beta agonist is MGL-3196 (resmetirom) or any of the compounds disclosed in International Publication No. 2014 / 043706, the entire contents of which are incorporated herein by reference. Resmetirom is a thyroid hormone receptor (THR) beta-selective agonist. Further disclosures regarding resmetirom can be found in U.S. Patent No. 9,266,861, U.S. Patent Application No. 16 / 343,065, and PCT Application No. PCT / US2019 / 040276, the contents of each of which are incorporated herein by reference in their entirety.

[0543] In certain embodiments, the THR-beta agonist is KB-2115 (eprotirom) or any of the compounds disclosed in WO 2007 / 110226 or WO 2009 / 077147, which are incorporated by reference in their entireties.

[0544] Those skilled in the art will know how to formulate a THR-beta agonist for any suitable route of administration.

[0545] In certain embodiments, the inhibitors of the present invention, particularly the siRNA molecules disclosed herein, may be combined with a GLP-1 agonist, for example any one of the GLP-1 agonists disclosed herein above, including dual or triple agonists, and a THR-beta agonist, for example any one of the THR-beta agonists disclosed herein above, for the treatment of metabolic diseases or disorders; In certain embodiments, the inhibitors of the present invention, particularly the siRNA molecules disclosed herein, may be combined with a GLP-1 agonist, for example any one of the GLP-1 agonists disclosed herein above, including dual or triple agonists, and a THR-beta agonist, for example any one of the THR-beta agonists disclosed herein above, for the treatment of fatty liver diseases, particularly NAFLD and / or NASH.

[0546] The inhibitors of the present invention, in particular the siRNA molecules disclosed herein, may alternatively or additionally be used in combination with an amylin receptor agonist (e.g., pramlintide), and / or a dual amylin plus calcitonin receptor agonist, and / or a glucagon receptor agonist, and / or an FXR receptor agonist (e.g., cilofexor or obeticholic acid), and / or an FGF-21 analog or FGF-21 receptor agonist (e.g., effluxifermin), and / or an FGF-19 analog or FGF-19 receptor agonist (e.g., aldafermin), and / or a galectin 3 inhibitor (e.g., belapectin), and / or a PP2 inhibitor, preferably for the treatment of any of the metabolic diseases or disorders disclosed herein, more preferably for the treatment of NAFLD. ARα agonists (e.g., elafibranor), and / or PPARγ agonists (e.g., pioglitazone or rosiglitazone), and / or mixed PPARα and / or δ and / or γ agonists, and / or pan-PPARαδγ agonists (e.g., lanifibranol), and / or acetyl-CoA desaturase activators, and / or ASK1 inhibitors (e.g., selonsertib), and / or LOXL2 inhibitors (e.g., simtuzumab), and / or dual CCR2 / 5 inhibitors (e.g., cenicriviroc), and / or desaturase inhibitors including citrate / isocitrate transporter (CIC), ATP-citrate lyase (ACLY), acetyl-CoA carboxylase (ACC), and fatty acid synthase (FAS). It may be combined and / or co-administered with one or more inhibitors of enzymes in the de novo lipogenesis (DNL) pathway and / or inhibitors of enzymes in the cholesterol biosynthesis pathway (e.g., HMGCoA reductase inhibitors, e.g., atorvastatin).

[0547] In certain embodiments, the inhibitors of the present invention, particularly the siRNA molecules disclosed herein, can be administered in combination with any of the molecules disclosed in Figure 1 of Nathani and Bansal (Gastroenterol Hepatol (NY). July 2023; Vol. 19(7):371-381; incorporated herein by reference), particularly THR-beta agonists (e.g., resmetirom, VK2809, or TERN-501), PPAR agonists (e.g., lanifibranol, saroglitazar, or elafibranor), GLP-1 agonists (e.g., liraglutide, semaglutide, or tirzepatide), CCR2 / 5 inhibitors (e.g., cenicriviroc), ASK1 inhibitors (e.g., selonsertib), ACC inhibitors (e.g., filsocostat or PF-0522), or combinations thereof. 1304), SCD inhibitors (e.g., aramchol), FGF21 analogs (e.g., effluxfermin or pegbelfermin), galectin-3 inhibitors (e.g., belapectin), LOXL2 inhibitors (e.g., simtuzumab), FXR agonists (e.g., obeticholic acid, tropifexor, cilofexor, EDP-305, or MET409), and / or FGF19 analogs (e.g., Aldafermina) may be used in the treatment of any of the metabolic diseases or disorders disclosed herein, more preferably in the treatment of NAFLD.

[0548] In certain embodiments, the inhibitors of the present invention, particularly the siRNA molecules disclosed herein, can be administered in combination with any of the molecules disclosed in Batchuluun et al. (Nat Rev Drug Discov, 2022, 21(4):283-305. doi:10.1038 / s41573-021-00367-2; incorporated herein by reference), particularly citrate / isocitrate transporter (CIC) inhibitors (e.g., benzenetricarboxylate, CPTI-1 or CPTI-2), ATP-citrate lyase (ACLY) inhibitors (e.g., bempedoic acid, hydroxycitric acid, BMS-303141, emodin derivatives, furanocarboxylate derivatives, MEDICA16, SB-204990, or NDI-091143), acetyl-CoA carboxylase (ACC) inhibitors (e.g., filsocostat, PF-05221304), or the like. , PF-05175157, MK-4074, A-908292, carboxamide derivative-1k, CP-640186, monocyclic derivative-1q, ND-654, ND-646, olefin derivative-2e, (S)-9c, soraphen A, TOFA, or WZ66), and / or fatty acid synthase (FAS) inhibitors (e.g., orlistat, TVB-2640, FT-4101, BI-99179, cerulenin, C75, fastal, GSK2194069, IPI-9119, MP-ML-24-N1, or TVB-3166) for the treatment of any of the metabolic diseases or disorders disclosed herein, more preferably for the treatment of NAFLD.

[0549] The combination therapy or "combination" contemplated herein includes co-administration of an inhibitor according to the present invention, particularly an siRNA according to the present invention, with one or more additional therapeutic agents, preferably one or more of the additional therapeutic agents disclosed herein above. The inhibitor according to the present invention may be administered before, after, or simultaneously with the one or more additional therapeutic agents.

[0550] In certain embodiments, the inhibitors according to the present invention, in particular the siRNAs according to the present invention, may be co-administered with GLP-1 agonists, including GLP-1 / GIP dual agonists, GLP-1 / FGF21 dual agonists, GLP-1 / GCGR dual agonists and GLP-1 / GIP / GCGR triple agonists, and / or THR-beta agonists, and the inhibitors according to the present invention may be administered before, after, or simultaneously with the GLP-1 agonist and / or THR-beta agonist.

[0551] In an exemplary embodiment, the co-administration comprises administering an siRNA according to the present invention and any of the GLP-1 agonists disclosed herein or incorporated by reference herein, including GLP-1 / GIP dual agonists, GLP-1 / FGF21 dual agonists, GLP-1 / GCGR dual agonists, and GLP-1 / GIP / GCGR triple agonists. In another exemplary embodiment, the co-administration comprises administering an siRNA according to the present invention and the GLP-1 agonist semaglutide. In another exemplary embodiment, the co-administration comprises administering an siRNA according to the present invention and the GLP-1 / GIP dual agonist terzapetide.

[0552] In yet another exemplary embodiment, the co-administration comprises administering an siRNA according to the present invention and any of the THR-beta agonists disclosed herein or incorporated by reference herein, hi another exemplary embodiment, the co-administration comprises administering an siRNA according to the present invention and the THR-beta agonist resmetirom.

[0553] In another exemplary embodiment, the co-administration comprises administering an siRNA according to the present invention, the GLP-1 agonist semaglutide or terzapeptide, and the THR-beta agonist resmetirom.

[0554] The combination therapy of the present disclosure, comprising an inhibitor according to the present invention and at least one additional therapeutic agent, may be administered via any route. In some embodiments, the inhibitor according to the present invention and at least one additional therapeutic agent may be delivered orally, subcutaneously, intravenously, intranasally, transdermally, intraperitoneally, intramuscularly, intrapulmonary, vaginally, rectally, or intraocularly. In exemplary embodiments, the inhibitor according to the present invention may be administered intravenously (IV) and / or subcutaneously, and the GLP-1 agonist may be administered subcutaneously.

[0555] In one aspect, the present invention may be applicable to the compounds, methods, compositions, or uses of Propositions Nos. 1-101 below, and references to any formula in Propositions 1-101 refer only to the formula as defined within Propositions 1-101. Such formulas are reproduced in Figure 6. Specifically, the oligonucleoside moiety represented by Z in any of the following propositions may comprise a nucleic acid for inhibiting expression of SLC25A5 as defined in any of the following claims.

[0556] 1. The following structure:

[0557] [ka] A compound comprising During the ceremony, R1 in each occurrence is independently selected from the group consisting of hydrogen, methyl, and ethyl; R2 is hydrogen, hydroxy, -OC 1~3 Alkyl, -C(=O)OC 1~3 selected from the group consisting of alkyl, halo, and nitro; X1 and X2, in each occurrence, are independently selected from the group consisting of methylene, oxygen, and sulfur; m is an integer from 1 to 6; n is an integer from 1 to 10, q, r, s, t, and v are independently integers from 0 to 4, with the proviso that: (i) q and r cannot both be 0 at the same time; (ii) s, t, and v cannot all be simultaneously 0; Z is an oligonucleoside moiety; compound.

[0558] 2. The compound according to Proposition 1, wherein R1, in each occurrence, is hydrogen.

[0559] 3. The compound according to Proposition 1, wherein R1 is methyl.

[0560] 4. The compound according to Proposition 1, wherein R1 is ethyl.

[0561] 5. The compound of any of Propositions 1 to 4, wherein R2 is hydroxy.

[0562] 6. The compound of any of Propositions 1 to 4, wherein R2 is halo.

[0563] 7. The compound according to Proposition 6, wherein R2 is fluoro.

[0564] 8. The compound according to Proposition 6, wherein R2 is chloro.

[0565] 9. The compound according to Proposition 6, wherein R2 is bromo.

[0566] 10. The compound according to Proposition 6, wherein R2 is iodo.

[0567] 11. The compound according to Proposition 6, wherein R2 is nitro.

[0568] 12. The compound of any one of Propositions 1 to 11, wherein X1 is methylene.

[0569] 13. The compound according to any one of Propositions 1 to 11, wherein X1 is oxygen.

[0570] 14. The compound according to any one of claims 1 to 11, wherein X1 is sulfur.

[0571] 15. The compound of any one of Propositions 1 to 14, wherein X2 is methylene.

[0572] 16. The compound according to any one of Propositions 1 to 15, wherein X2 is oxygen.

[0573] 17. The compound according to any one of Propositions 1 to 16, wherein X2 is sulfur.

[0574] 18. The compound according to any one of Propositions 1 to 17, wherein m=3.

[0575] 19. The compound of any one of Propositions 1 to 18, wherein n=6.

[0576] 20. X1 is oxygen and X2 is methylene, preferably q=1, r=2, s=1, t=1, v=1, The compounds described in Propositions 13 and 15.

[0577] 21. X1 and X2 are both methylene, preferably q=1, r=3, s=1, t=1, v=1, The compounds of Propositions 12 and 15.

[0578] 22. Z is

[0579] [ka] where: Z1, Z2, Z3, Z4 are independently in each occurrence oxygen or sulfur; one of the bonds between P and Z2 and between P and Z3 is a single bond, and the other bond is a double bond; 22. A compound according to any one of claims 1 to 21.

[0580] 23. The compound of Proposition 22, wherein the oligonucleoside is an RNA compound capable of modulating, preferably inhibiting, expression of a target gene.

[0581] 24. The compound of Proposition 23, wherein the RNA compound comprises an RNA duplex comprising a first strand and a second strand, wherein the first strand is at least partially complementary to an RNA sequence of a target gene, and the second strand is at least partially complementary to the first strand, and each of the first strand and the second strand has a 5' and a 3' end.

[0582] 25. The compound of Proposition 24, wherein the RNA compound is attached to an adjacent phosphate at the 5' end of its second strand.

[0583] 26. The compound of Proposition 24, wherein the RNA compound is attached to an adjacent phosphate at the 3' end of its second strand.

[0584] 27. A compound of formula (II).

[0585] [ka]

[0586] 28. A compound of formula (III).

[0587] [ka]

[0588] 29. The compound of Proposition 27 or 28, wherein the oligonucleoside comprises an RNA duplex comprising a first strand and a second strand, wherein the first strand is at least partially complementary to an RNA sequence of a target gene, and the second strand is at least partially complementary to said first strand, each of the first and second strands having a 5' and a 3' end, and wherein said RNA duplex is attached to adjacent phosphates at the 5' end of the second strand.

[0589] 30. A composition comprising a compound of formula (II) as defined in Proposition 27 and a compound of formula (III) as defined in Proposition 28, and optionally subject to Proposition 29.

[0590] 31. The composition of claim 30, wherein the compound of formula (III) as defined in claim 28 is present in an amount ranging from 10 to 15% by weight of the composition.

[0591] 32. A compound of formula (IV).

[0592] [ka]

[0593] 33. A compound of formula (V).

[0594] [ka]

[0595] 34. The compound of Proposition 32 or 33, wherein the oligonucleoside comprises an RNA duplex comprising a first strand and a second strand, wherein the first strand is at least partially complementary to an RNA sequence of a target gene, and the second strand is at least partially complementary to said first strand, each of the first and second strands having a 5' and a 3' end, and wherein said RNA duplex is attached to adjacent phosphates at the 3' end of the second strand.

[0596] 35. A composition comprising a compound of formula (IV) as defined in Proposition 32 and a compound of formula (V) as defined in Proposition 33, and optionally subject to Proposition 34.

[0597] 36. The composition of claim 35, wherein the compound of formula (V) defined in proposition 33 is present in an amount ranging from 10 to 15% by weight of the composition.

[0598] 37. An oligonucleoside is a compound as defined in any of Propositions 1-29 or 32-34, including an RNA duplex further comprising one or more riboses modified at the 2' position, preferably multiple riboses modified at the 2' position.

[0599] 38. The compound according to Proposition 37, wherein the modification is selected from 2'-O-methyl, 2'-deoxy-fluoro, and 2'-deoxy.

[0600] 39. The compound of any of Propositions 1-29, 32-34, or 37-38, wherein the oligonucleoside further comprises one or more degradation-protecting moieties at one or more termini.

[0601] 40. The compound of Proposition 39, wherein the one or more degradation protecting moieties are not present at the termini of an oligonucleoside chain bearing a ligand moiety, and / or the one or more degradation protecting moieties are selected from phosphorothioate internucleoside linkages, phosphorodithioate internucleoside linkages, and inverted abasic nucleosides, and the inverted abasic nucleosides are present at the distal ends of chains bearing a ligand moiety.

[0602] 41. The compound of any of Propositions 1-29, 32-34, or 37-40, wherein the ligand moiety depicted in formula (I) of Proposition 1 comprises one or more ligands.

[0603] 42. The compound of Proposition 41, wherein the ligand moiety depicted in formula (I) of Proposition 1 comprises one or more carbohydrate ligands.

[0604] 43. The compound of Proposition 42, wherein the one or more carbohydrates may be a monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, or polysaccharide.

[0605] 44. The compound of Proposition 43, wherein the one or more carbohydrates comprise one or more galactose moieties, one or more lactose moieties, one or more N-acetylgalactosamine moieties, and / or one or more mannose moieties.

[0606] 45. The compound of Proposition 44, wherein the one or more carbohydrates comprise one or more N-acetyl-galactosamine moieties.

[0607] 46. ​​The compound of Proposition 45, comprising two or three N-acetylgalactosamine moieties.

[0608] 47. The compound of any of Propositions 41 to 46, wherein the one or more ligands are attached in a linear or branched configuration.

[0609] 48. The compound of Proposition 47, wherein the one or more ligands are attached in a biantennary or triantennary branched chain configuration.

[0610] 49. The moiety illustrated in formula (I) of Proposition 1:

[0611] [ka] is any of formula (VIa), (VIb), or (VIc), preferably formula (VIa),

[0612] [ka] During the ceremony, A I is hydrogen or a suitable hydroxy protecting group; a is an integer of 2 or 3, b is an integer from 2 to 5, or

[0613] [ka] During the ceremony, A I is hydrogen or a suitable hydroxy protecting group; a is an integer of 2 or 3, c and d are independently integers from 1 to 6; or

[0614] [ka] During the ceremony, A I is hydrogen or a suitable hydroxy protecting group; a is an integer of 2 or 3, e is an integer from 2 to 10. The compound according to Propositions 46 to 48.

[0615] 50. The moiety illustrated in formula (I) of Proposition 1:

[0616] [ka] is represented by formula (VII):

[0617] [ka] where: A I is hydrogen, a is an integer of 2 or 3; The compound according to Propositions 46 to 48.

[0618] 51. The compound according to Proposition 49 or 50, wherein a=2.

[0619] 52. The compound according to Proposition 49 or 50, wherein a=3.

[0620] 53. The compound according to Proposition 49, wherein b=3.

[0621] 54. A compound of formula (VIII).

[0622] [ka]

[0623] 55. A compound of formula (IX).

[0624] [ka]

[0625] 56. The compound of Proposition 54 or 55, wherein the oligonucleoside comprises an RNA duplex comprising a first strand and a second strand, wherein the first strand is at least partially complementary to an RNA sequence of a target gene, and the second strand is at least partially complementary to said first strand, each of the first strand and the second strand having a 5' and a 3' end, and wherein said RNA duplex is attached to adjacent phosphates at the 5' end of its second strand.

[0626] 57. A composition comprising a compound of formula (VIII) as defined in proposition 54 and a compound of formula (IX) as defined in proposition 55, and optionally subject to proposition 56.

[0627] 58. The composition of claim 57, wherein the compound of formula (IX) defined in proposition 55 is present in an amount ranging from 10 to 15% by weight of the composition.

[0628] 59. A compound of formula (X).

[0629] [ka]

[0630] 60. A compound of formula (XI).

[0631] [ka]

[0632] 61. The compound of Proposition 59 or 60, wherein the oligonucleoside comprises an RNA duplex comprising a first strand and a second strand, wherein the first strand is at least partially complementary to an RNA sequence of a target gene, and the second strand is at least partially complementary to the first strand, each of the first and second strands having a 5' and a 3' end, and wherein the RNA duplex is attached to adjacent phosphates at the 3' end of the second strand.

[0633] 62. A composition comprising a compound of formula (X) as defined in Proposition 59 and a compound of formula (XI) as defined in Proposition 60, and optionally subject to Proposition 61.

[0634] 63. The composition of claim 62, wherein the compound of formula (XI) defined in proposition 60 is present in an amount ranging from 10 to 15% by weight of the composition.

[0635] 64. An oligonucleoside is a compound as defined in any of Propositions 54 to 63, including an RNA duplex further comprising one or more riboses modified at the 2' position, preferably multiple riboses modified at the 2' position.

[0636] 65. The compound according to Proposition 64, wherein the modification is selected from 2'-O-methyl, 2'-deoxy-fluoro, and 2'-deoxy.

[0637] 66. The compound of any of Propositions 54 to 65, wherein the oligonucleoside further comprises one or more degradation-protecting moieties at one or more termini.

[0638] 67. The compound of Proposition 66, wherein the one or more degradation protecting moieties are not present at the termini of an oligonucleoside chain bearing a ligand moiety, and / or the one or more degradation protecting moieties are selected from phosphorothioate internucleoside linkages, phosphorodithioate internucleoside linkages, and inverted abasic nucleosides, and the inverted abasic nucleosides are present at the distal ends of chains bearing a ligand moiety as shown in either formula (VIII), (IX), (X), or (XI) of any of Propositions 54, 55, 59, or 60.

[0639] 68. A method for preparing a compound according to any one of Propositions 1 to 29, 32 to 34, 37 to 56, 59 to 61, and 64 to 67, and / or a composition according to any one of Propositions 30, 31, 35, 36, 57, 58, 62, 63, comprising: a compound represented by formula (XII) and (XIII):

[0640] [ka] is a compound of the formula R1 in each occurrence is independently selected from the group consisting of hydrogen, methyl, and ethyl; R2 is hydrogen, hydroxy, -OC 1~3 Alkyl, -C(=O)OC 1~3 selected from the group consisting of alkyl, halo, and nitro; X1 and X2, in each occurrence, are independently selected from the group consisting of methylene, oxygen, and sulfur; m is an integer from 1 to 6; n is an integer from 1 to 10, q, r, s, t, and v are independently integers from 0 to 4, with the proviso that: (i) q and r cannot both be 0 at the same time; (ii) s, t, and v cannot all be simultaneously 0; Z is an oligonucleoside moiety; reacting the compounds, and If appropriate, deprotecting the ligand and / or annealing the second strand of the oligonucleoside moiety. A method comprising:

[0641] 69. The compound of formula (XII) can be prepared by reacting the compound of formula (XIV) and (XV):

[0642] [ka] and R1 in each occurrence is independently selected from the group consisting of hydrogen, methyl, and ethyl; R2 is hydrogen, hydroxy, -OC 1~3 Alkyl, -C(=O)OC 1~3 selected from the group consisting of alkyl, halo, and nitro; X1 and X2, in each occurrence, are independently selected from the group consisting of methylene, oxygen, and sulfur; q, r, s, t, and v are independently integers from 0 to 4, with the proviso that: (i) q and r cannot both be 0 at the same time; (ii) s, t, and v cannot all be simultaneously 0; Z is an oligonucleoside moiety; 69. The method of claim 68, wherein the compound is prepared by reacting

[0643] 70. The compound of formula (XII) is of formula (XIIa):

[0644] [ka] The compound of formula (XIII) is of formula (XIIIa):

[0645] [ka] The oligonucleoside comprises an RNA duplex comprising a first strand and a second strand, wherein the first strand is at least partially complementary to an RNA sequence of a target gene, and the second strand is at least partially complementary to said first strand, each of the first and second strands having a 5' and a 3' end, and wherein said RNA duplex is attached to adjacent phosphates at the 5' end of the second strand; The method of claim 68 for preparing a compound of any one of propositions 20, 25, 27, 29, 54, 56, and / or a composition of any one of propositions 30, 31, 57, 58.

[0646] 71. The compound of formula (XII) is formula (XIIb):

[0647] [ka] The compound of formula (XIII) is of formula (XIIIa):

[0648] [ka] The oligonucleoside comprises an RNA duplex comprising a first strand and a second strand, wherein the first strand is at least partially complementary to an RNA sequence of a target gene, and the second strand is at least partially complementary to said first strand, each of the first and second strands having a 5' and a 3' end, and wherein said RNA duplex is attached to adjacent phosphates at the 5' end of the second strand; The method of claim 68 for preparing a compound of any one of propositions 20, 25, 28, 29, 55, 56, and / or a composition of any one of propositions 30, 31, 57, 58.

[0649] 72. The compound of formula (XII) is of formula (XIIc):

[0650] [ka] The compound of formula (XIII) is of formula (XIIIa):

[0651] [ka] The oligonucleoside comprises an RNA duplex comprising a first strand and a second strand, wherein the first strand is at least partially complementary to an RNA sequence of a target gene, and the second strand is at least partially complementary to said first strand, each of the first and second strands having a 5' and a 3' end, and wherein said RNA duplex is attached to adjacent phosphates at the 3' end of the second strand; The method of claim 68 for preparing a compound of any one of propositions 21, 26, 32, 34, 59, 61, and / or a composition of any one of propositions 35, 36, 62, 63.

[0652] 73. The compound of formula (XII) is of formula (XIId):

[0653] [ka] The compound of formula (XIII) is of formula (XIIIa):

[0654] [ka] The oligonucleoside comprises an RNA duplex comprising a first strand and a second strand, wherein the first strand is at least partially complementary to an RNA sequence of a target gene, and the second strand is at least partially complementary to said first strand, each of the first and second strands having a 5' and a 3' end, and wherein said RNA duplex is attached to adjacent phosphates at the 3' end of the second strand; The method of claim 68 for preparing a compound of any one of propositions 21, 26, 33, 34, 60, 61, and / or a composition of any one of propositions 35, 36, 62, 63.

[0655] 74. The compound of formula (XIIIa) can be converted to a compound of formula (XIIIb):

[0656] [ka] The method of any one of Propositions 70 to 73,

[0657] 75. The compound of formula (XIV) is either of formula (XIVa) or of formula (XIVb):

[0658] [ka] The compound of formula (XV) is either of formula (XVa) or of formula (XIVb):

[0659] [ka] The oligonucleoside comprises an RNA duplex comprising a first strand and a second strand, wherein the first strand is at least partially complementary to an RNA sequence of a target gene and the second strand is at least partially complementary to said first strand, each of the first strand and the second strand having a 5' and a 3' end, and (i) said RNA duplex is attached to adjacent phosphates at the 5' end of its second strand in formula (XVa), or (ii) said RNA duplex is attached to adjacent phosphates at the 3' end of its second strand in formula (XVb), The method of Proposition 69, dependent on Propositions 70 to 73.

[0660] 76. A compound of formula (XII):

[0661] [ka] During the ceremony, R1 in each occurrence is independently selected from the group consisting of hydrogen, methyl, and ethyl; R2 is hydrogen, hydroxy, -OC 1~3 Alkyl, -C(=O)OC 1~3 selected from the group consisting of alkyl, halo, and nitro; X1 and X2, in each occurrence, are independently selected from the group consisting of methylene, oxygen, and sulfur; q, r, s, t, and v are independently integers from 0 to 4, with the proviso that: (i) q and r cannot both be 0 at the same time; (ii) s, t, and v cannot all be simultaneously 0; Z is an oligonucleoside moiety; compound.

[0662] 77. A compound of formula (XIIa).

[0663] [ka]

[0664] 78. A compound of formula (XIIb).

[0665] [ka]

[0666] 79. A compound of formula (XIIc).

[0667] [ka]

[0668] 80. A compound of formula (XIId).

[0669] [ka]

[0670] 81. A compound of formula (XIII):

[0671] [ka] During the ceremony, R1 in each occurrence is independently selected from the group consisting of hydrogen, methyl, and ethyl; m is an integer from 1 to 6; n is an integer from 1 to 10. compound.

[0672] 82. A compound of formula (XIIIa).

[0673] [ka]

[0674] 83. A compound of formula (XIIIb).

[0675] [ka]

[0676] 84. A compound of formula (XIV):

[0677] [ka] During the ceremony, R1 is selected from the group consisting of hydrogen, methyl, and ethyl; R2 is hydrogen, hydroxy, -OC 1~3 Alkyl, -C(=O)OC 1~3 selected from the group consisting of alkyl, halo, and nitro; X2 is selected from the group consisting of methylene, oxygen, and sulfur; s, t, and v are independently integers from 0 to 4, with the proviso that s, t, and v cannot all simultaneously be 0; compound.

[0678] 85. A compound of formula (XIVa).

[0679] [ka]

[0680] 86. A compound of formula (XIVb).

[0681] [ka]

[0682] 87. A compound of formula (XV):

[0683] [ka] During the ceremony, R1 in each occurrence is independently selected from the group consisting of hydrogen, methyl, and ethyl; X1 is selected from the group consisting of methylene, oxygen, and sulfur; q and r are independently an integer of 0 to 4, provided that q and r cannot simultaneously be 0; Z is an oligonucleoside moiety; compound.

[0684] 88. A compound of formula (XVa).

[0685] [ka]

[0686] 89. A compound of formula (XVb).

[0687] [ka]

[0688] 90. Use of a compound according to any one of propositions 76, 81 to 84, and 87 for preparing a compound according to any one of propositions 1 to 29, 32 to 34, 37 to 56, 59 to 61, and 64 to 67, and / or a composition according to any one of propositions 30, 31, 35, 36, 57, 58, 62, and 63.

[0689] 91. Use of a compound according to Proposition 85 for preparing a compound according to any one of Propositions 1 to 29, 32 to 34, 37 to 56, 59 to 61, and 64 to 67, and / or a composition according to any one of Propositions 30, 31, 35, 36, 57, 58, 62, and 63, wherein R2=F.

[0690] 92. Use of a compound according to Proposition 86 for preparing a compound according to any one of Propositions 1 to 29, 32 to 34, 37 to 56, 59 to 61, and 64 to 67, and / or a composition according to any one of Propositions 30, 31, 35, 36, 57, 58, 62, and 63, wherein R2=OH.

[0691] 93. Use of a compound according to Proposition 77 for preparing a compound according to any one of Propositions 20, 25, 27, 29, 54, 56, and / or a composition according to any one of Propositions 30, 31, 57, 58.

[0692] 94. Use of a compound according to Proposition 78 for preparing a compound according to any one of Propositions 20, 25, 28, 29, 55, 56, and / or a composition according to any one of Propositions 30, 31, 57, 58.

[0693] 95. Use of a compound according to Proposition 79 for preparing a compound according to any one of Propositions 21, 26, 32, 34, 59, and 61, and / or a composition according to any one of Propositions 35, 36, 62, and 63.

[0694] 96. Use of a compound according to Proposition 80 for preparing a compound according to any one of Propositions 21, 26, 33, 34, 60, 61, and / or a composition according to any one of Propositions 35, 36, 62, 63.

[0695] 97. Use of a compound according to Proposition 88 for preparing a compound according to any one of Propositions 20, 25, 27 to 29, 54 to 56, and / or a composition according to any one of Propositions 30, 31, 57, 58.

[0696] 98. Use of a compound according to Proposition 89 for preparing a compound according to any one of Propositions 21, 26, 32 to 34, 59 to 61, and / or a composition according to any one of Propositions 35, 36, 62, 63.

[0697] 99. A compound or composition obtained or obtainable by the method of any of propositions 68 to 75.

[0698] 100. A pharmaceutical composition comprising a compound according to any one of Propositions 1 to 29, 32 to 34, 37 to 56, 59 to 61, and 64 to 67, and / or a composition according to any one of Propositions 30, 31, 35, 36, 57, 58, 62, and 63, together with a pharmaceutically acceptable carrier, diluent, or excipient.

[0699] 101. A compound according to any one of propositions 1 to 29, 32 to 34, 37 to 56, 59 to 61, and 64 to 67, and / or a composition according to any one of propositions 30, 31, 35, 36, 57, 58, 62, and 63, for use in therapy.

[0700] In another aspect, the present invention may be applicable to compounds, methods, compositions, or uses in items numbered 1 to 56 below, and reference to any formula in an item refers only to the formula defined within items 1 to 56. Such formulas are reproduced in Figure 7. Specifically, the oligonucleoside moiety represented by Z in any of the following items may comprise a nucleic acid for inhibiting expression of SLC25A5 as defined in any of the following claims.

[0701] 1. The following structure:

[0702] [ka] A compound comprising During the ceremony, r and s are independently an integer selected from 1 to 16; Z is an oligonucleoside moiety; compound.

[0703] 2. The compound according to item 1, wherein s is an integer selected from 4 to 12.

[0704] 3. The compound according to item 2, wherein s is 6.

[0705] 4. The compound according to any one of items 1 to 3, wherein r is an integer selected from 4 to 14.

[0706] 5. The compound according to item 4, wherein r is 6.

[0707] 6. The compound according to item 4, wherein r is 12.

[0708] 7. The compound according to item 5, which is dependent on item 3.

[0709] 8. The compound according to item 6, which is dependent on item 3.

[0710] 9. Z is

[0711] [ka] and During the ceremony, Z1, Z2, Z3, Z4 are independently in each occurrence oxygen or sulfur; one of the bonds between P and Z2 and between P and Z3 is a single bond, and the other bond is a double bond; 9. A compound according to any one of items 1 to 8.

[0712] 10. The compound according to any of items 1 to 9, wherein the oligonucleoside is an RNA compound capable of modulating, preferably inhibiting, the expression of a target gene.

[0713] 11. The compound according to item 10, wherein the RNA compound comprises an RNA duplex comprising a first strand and a second strand, wherein the first strand is at least partially complementary to an RNA sequence of a target gene, and the second strand is at least partially complementary to the first strand, and each of the first strand and the second strand has a 5' and a 3' end.

[0714] 12. The compound according to item 11, preferably also according to items 3 and 6, wherein the RNA compound is attached to an adjacent phosphate at the 5' end of its second strand.

[0715] 13. The compound according to item 11, preferably also according to items 3 and 5, wherein the RNA compound is attached to an adjacent phosphate at the 3' end of its second strand.

[0716] 14. A compound of the formula (II), preferably according to item 12. * ) compound.

[0717] [ka]

[0718] 15. A compound of the formula (III), preferably according to item 13. * ) compound.

[0719] [ka]

[0720] 16. Oligonucleosides are compounds as defined in any of items 1 to 15, including RNA duplexes further comprising one or more riboses modified at the 2' position, preferably multiple riboses modified at the 2' position.

[0721] 17. The compound according to item 16, wherein the modification is selected from 2'-O-methyl, 2'-deoxy-fluoro, and 2'-deoxy.

[0722] 18. The compound according to any one of items 1 to 17, wherein the oligonucleoside further comprises one or more degradation-protecting moieties at one or more termini.

[0723] 19. The compound according to item 18, wherein the one or more degradation protecting moieties are not present at the terminus of the oligonucleoside chain carrying the linker / ligand moiety, and / or the one or more degradation protecting moieties are selected from a phosphorothioate internucleoside linkage, a phosphorodithioate internucleoside linkage, and an inverted abasic nucleoside, and the inverted abasic nucleoside is present at the distal end of the same chain as the end carrying the linker / ligand moiety.

[0724] 20. Item 1 formula (I * 20. The compound according to any of items 1 to 19, wherein the ligand moiety depicted in (a) comprises one or more ligands.

[0725] 21. Item 1 formula (I * 21. The compound according to claim 20, wherein the ligand moiety depicted in Figure 21 comprises one or more carbohydrate ligands.

[0726] 22. The compound according to item 21, wherein the one or more carbohydrates may be monosaccharides, disaccharides, trisaccharides, tetrasaccharides, oligosaccharides, or polysaccharides.

[0727] 23. The compound according to item 22, wherein the one or more carbohydrates comprise one or more galactose moieties, one or more lactose moieties, one or more N-acetylgalactosamine moieties, and / or one or more mannose moieties.

[0728] 24. The compound according to item 23, wherein the one or more carbohydrates comprise one or more N-acetyl-galactosamine moieties.

[0729] 25. The compound according to item 24, which contains two or three N-acetylgalactosamine moieties.

[0730] 26. The compound of any of the preceding items, wherein the one or more ligands are attached in a linear or branched configuration.

[0731] 27. The compound according to item 26, wherein the one or more ligands are attached as a biantennary or triantennary branched chain configuration.

[0732] 28. Item 1 formula (I * ) the part shown in FIG.

[0733] [ka] is represented by formula (IV * ), (V * ), or (VI * ), and preferably any one of the formulas (IV * ) and

[0734] [ka] During the ceremony, A I is hydrogen or a suitable hydroxy protecting group; a is an integer of 2 or 3, b is an integer from 2 to 5, or

[0735] [ka] During the ceremony, A I is hydrogen or a suitable hydroxy protecting group; a is an integer of 2 or 3, c and d are independently integers from 1 to 6; or

[0736] [ka] During the ceremony, A Iis hydrogen or a suitable hydroxy protecting group; a is an integer of 2 or 3, e is an integer from 2 to 10. 28. The compound according to items 20 to 27.

[0737] 29. Item 1 formula (I * ) the part shown in FIG.

[0738] [ka] is represented by the formula (VII * ):

[0739] [ka] where: A I is hydrogen, a is an integer of 2 or 3; 29. A compound according to any one of items 1 to 28.

[0740] 30. The compound according to item 28 or 29, wherein a=2.

[0741] 31. The compound according to item 28 or 29, wherein a=3.

[0742] 32. The compound according to item 28, wherein b=3.

[0743] 33. Formula (VIII * ) compound.

[0744] [ka]

[0745] 34. Formula (IX * ) compound.

[0746] [ka]

[0747] 35. The compound according to item 33 or 34, wherein the oligonucleoside comprises an RNA duplex further comprising one or more riboses modified at the 2' position, preferably multiple riboses modified at the 2' position.

[0748] 36. The compound according to item 35, wherein the modification is selected from 2'-O-methyl, 2'-deoxy-fluoro, and 2'-deoxy.

[0749] 37. The compound according to any one of items 33 to 36, wherein the oligonucleoside further comprises one or more degradation-protecting moieties at one or more termini.

[0750] 38. The compound according to item 37, wherein the one or more degradation protecting moieties are not present at the terminus of the oligonucleoside chain carrying the linker / ligand moiety, and / or the one or more degradation protecting moieties are selected from a phosphorothioate internucleoside linkage, a phosphorodithioate internucleoside linkage, and an inverted abasic nucleoside, and the inverted abasic nucleoside is present at the distal end of the same chain as the end carrying the linker / ligand moiety.

[0751] 39. The compound according to item 33, wherein the oligonucleoside comprises an RNA duplex comprising a first strand and a second strand, wherein the first strand is at least partially complementary to an RNA sequence of a target gene, and the second strand is at least partially complementary to the first strand, each of the first strand and the second strand having a 5' and a 3' end, and wherein the RNA duplex is attached to adjacent phosphates at the 5' end of the second strand.

[0752] 40. The compound according to item 34, wherein the oligonucleoside comprises an RNA duplex comprising a first strand and a second strand, wherein the first strand is at least partially complementary to an RNA sequence of a target gene, and the second strand is at least partially complementary to the first strand, each of the first strand and the second strand having a 5' and a 3' end, and wherein the RNA duplex is attached to adjacent phosphates at the 3' end of the second strand.

[0753] 41. A method for preparing a compound according to any one of items 1 to 40, comprising: * ) and (XI * ):

[0754] [ka] is a compound of the formula r and s are independently an integer selected from 1 to 16; Z is an oligonucleoside moiety; reacting the compounds, and If appropriate, deprotecting the ligand and / or annealing the second strand of the oligonucleoside. A method comprising:

[0755] 42. Expression(X * ) is a compound of formula (Xa * ) and

[0756] [ka] Formula (XI * The compound of formula (XIa * ) and

[0757] [ka] The oligonucleoside comprises an RNA duplex comprising a first strand and a second strand, wherein the first strand is at least partially complementary to an RNA sequence of a target gene, and the second strand is at least partially complementary to said first strand, each of the first and second strands having a 5' and a 3' end, and wherein said RNA duplex is attached to adjacent phosphates at the 5' end of the second strand; Item 41, a method for preparing a compound according to any one of items 6, 8 to 14, 16 to 33, and 35 to 40.

[0758] 43. Expression(X * ) is a compound of the formula (Xb * ) and

[0759] [ka] Formula (XI * The compound of formula (XIa * ) and

[0760] [ka] The oligonucleoside comprises an RNA duplex comprising a first strand and a second strand, wherein the first strand is at least partially complementary to an RNA sequence of a target gene, and the second strand is at least partially complementary to said first strand, each of the first and second strands having a 5' and a 3' end, and wherein said RNA duplex is attached to adjacent phosphates at the 3' end of the second strand; Item 41, a method for preparing a compound according to any one of items 5, 7, 9 to 13, 15 to 32, and 34 to 40.

[0761] 44. Formula (XIa * The compound of formula (XIb * )

[0762] [ka] Item 44. The method according to item 42 or 43.

[0763] 45. Expression(X * ):

[0764] [ka] A compound of the formula: During the ceremony, r is independently an integer selected from 1 to 16; Z is an oligonucleoside moiety; compound.

[0765] 46. ​​Formula (Xa * ) compound.

[0766] [ka]

[0767] 47. Formula (Xb * ) compound.

[0768] [ka]

[0769] 48. Formula (XI * ):

[0770] [ka] A compound of the formula: During the ceremony, s is independently an integer selected from 1 to 16; Z is an oligonucleoside moiety; compound.

[0771] 49. Formula (XIa * ) compound.

[0772] [ka]

[0773] 50. Equation (XIb * ) compound.

[0774] [ka]

[0775] 51. Use of a compound according to any one of items 45 and 48 to 50 for preparing a compound according to any one of items 1 to 40.

[0776] 52. Use of the compound according to item 46 for preparing a compound according to any one of items 6, 8 to 14, 16 to 33, and 35 to 40.

[0777] 53. Use of the compound according to item 47 for preparing a compound according to any one of items 5, 7, 9 to 13, 15 to 32, and 34 to 40.

[0778] 54. A compound or composition obtained or obtainable by a method according to any of items 41 to 44.

[0779] 55. A pharmaceutical composition comprising a compound according to any one of items 1 to 40 together with a pharmaceutically acceptable carrier, diluent, or excipient.

[0780] 41. A compound according to any of items 1 to 40 for use in therapy. Example

[0781] The present invention will be more fully understood by reference to the following examples. However, these examples should not be construed as limiting the scope of the present invention. The examples and embodiments described herein are for illustrative purposes only, and it is understood that various modifications or changes thereto will be suggested to those skilled in the art, and that these are within the spirit and scope of this application and the scope of the appended claims. [Example]

[0782] Target identification background All biological functions arise from the coordinated interactions of hundreds of interacting molecules, primarily proteins, and can be thought of as functional outcomes emerging from protein-protein interaction networks, where each node in the network is a protein, and each end of the protein link can represent a possible interaction type, ranging from complex formation to catalytic activation, etc.

[0783] Historically, such functions have been represented by simplified linear pathways, but growing knowledge has made it clear that pathways are more complex and that networks are the minimum level of complexity that can adequately represent the functional properties of biological processes and capture the characteristics of individual components: resilience to perturbations and robustness to random insults.

[0784] Networks useful for biological function may consist of several interacting canonical pathways as well as additional proteins that become primarily involved when canonical function is perturbed. It is therefore crucial to develop methods that can model this complexity in a meaningful and tractable way, and to generate target hypotheses that take into account the inherent resistance to change that results from the robustness of the network.

[0785] Oversimplification of biology and the inability to rationally select drug targets based on realistic models of biological processes contribute to the failure of drug discovery. Furthermore, there is a lack of rigorous, objective methods for creating network models of processes and for prioritizing protein targets within these models. As a result, target selection decisions are often made ad hoc, based on preference or evidence unrelated to a functional model.

[0786] Processes and processes for identifying targets The starting point for identifying the SLC25A5 / ANT2 target was HepNet, a proprietary computational platform for drug target identification and validation in hepatocytes. Two independent approaches were used to identify SLC25A5 / ANT2. The first utilized omics data in the form of genome-wide association study (GWAS) meta-analyses to identify nonalcoholic fatty liver disease (NAFLD) targets from experimental data. The second utilized the HepNet Knowledge Graph, a semantic network that describes interactions between entities such as genes, drugs, diseases, and / or biological processes in the context of hepatocytes.

[0787] For GWAS-based approaches, meta-analyses were quality controlled with respect to sample size, target population, and quality of statistical analysis. More specifically, a sample size of greater than 1,000 was used as the cutoff.

[0788] SNPs were carried forward if their p-value reflected multiple testing correction. Finally, SNPs of all sex-combined ancestry were selected (Continental Europe, UK, Other); SNPs with sex-specific significance were excluded.

[0789] The resulting selected GWAS were used to extract SNPs that were strongly associated with the trait of interest, in this case NAFLD pathology and associated metabolic dysfunction (e.g., risk of NAFLD and cardiometabolic disease or steatosis and NAFLD).

[0790] As a next step, SNPs were mapped to genes using the Variant-to-Gene (V2G) pipeline data from Open Targets Genetics (https: / / genetics.opentargets.org / ). More specifically, for each SNP of interest, the gene with the highest score based on the V2G pipeline (or multiple genes in the case of a top score tie) was selected, along with genes with a score higher than 0.2.

[0791] This generated a gene set that could be used as input for constructing a protein-protein interaction network using a proprietary algorithm (Algorithm A). The resulting network was then subjected to impact analysis (Algorithm B) to identify enriched biological processes in the network. These processes were then manually evaluated by an internal team to identify the most relevant biological processes for NAFLD target identification.

[0792] A protein-protein interaction network was then created around the selected processes and nodes were scored for their importance to the network using a proprietary algorithm (Algorithm C). The highest scoring nodes from Algorithm C were manually evaluated by an internal team to identify targets of interest for the treatment of NAFLD metabolic disease.

[0793] In the knowledge graph-based approach, we used machine learning algorithms to predict interactions between genes and diseases based on the structure of the knowledge graph, a task commonly referred to as "link prediction." This generated gene sets that could be used for network-based target identification using the proprietary algorithms A to C described above. The networks and other outputs from these algorithms were evaluated by a different internal team, distinct from those generated by GWAS-based analyses.

[0794] Both analyses independently identified ANT2 / SLC25A5 as a key node in the biological processes involved in “lipogenesis / non-alcoholic fatty liver disease” (named supercluster 574 in algorithm B).

[0795] Therefore, the present inventors analyzed these network models using a unique analytical method. This method uses directional information to capture important "target" characteristics, such as whether a protein is an integrator of information, whether it is an important conduit for information to other parts of the network, whether it is an influencer of important proteins, and the degree to which the influencer influences or influences other proteins (based on the absolute and relative number and direction of inputs and outputs). Directional information also allows for the estimation of hierarchical relationships between proteins. Proteins that are higher in the hierarchy and have certain characteristics may be preferred over proteins with otherwise similar characteristics. By comparing the relative specificity and magnitude of each characteristic with other characteristics, the present inventors were able to score and rank proteins in terms of their target suitability.

[0796] The ability to characterize the properties of these targets in terms of their network relationships allows one to determine the selectivity and magnitude of their effects in selected situations, and therefore their respective suitability for a given indication.

[0797] Then, proprietary analysis techniques are applied to the network model to identify targets that are likely to be pharmacologically successful within the network. Their knockdown will have a significant impact on the network and therefore on the biological function being modeled. These algorithms extensively utilize directional information and hierarchical relationships to identify targets that have a set of specific properties that make them good siRNA targets. Then, targets are further filtered by protein class and hepatocyte-specific properties according to therapeutic needs.

[0798] The above workflow, leveraging proprietary data resources and network node measurements, has identified provided targets for provided uses.

[0799] The outcomes of the network approach are shown in Table 6. Surprisingly, ANT2 was identified as a drug target for NAFLD among a variety of other targets already associated with metabolic disorders such as NAFLD (APOA5, HMDH, APOC3, NR1H3, MTP, PCSK9, SOAT1 and ABCA1).

[0800] [Table 14] [Example]

[0801] Synthesis of Tether 1 Basic experimental conditions: Thin-layer chromatography (TLC) was performed on silica-coated aluminum plates using a Macherey-Nagel 254 nm fluorescent indicator. Compounds were visualized under UV light (254 nm) or after spraying with 5% H2SO4 or ninhydrin reagent in methanol (MeOH) according to Stahl (Sigma-Aldrich) followed by heating. Flash chromatography was performed using Biotage Sfaer silica 10, 25, 50, or 100 g columns (Uppsala, Sweden) on a Biotage Isolera One flash chromatography instrument equipped with a dual-variable UV wavelength detector (200–400 nm).

[0802] All moisture-sensitive reactions were performed under anhydrous conditions using dry glassware, anhydrous solvents, and an argon atmosphere. All commercially available reagents were purchased from Sigma-Aldrich, and solvents were purchased from Carl Roth GmbH. D-Galactosamine pentaacetate was purchased from AK scientific.

[0803] HPLC / ESI-MS was performed on a Dionex UltiMate 3000RS UHPLC system and a Thermo Scientific MSQ Plus mass spectrometer using a Waters Acquity UPLC Protein BEH C4 column (300 Å, 1.7 μm, 2.1 × 100 mm) at 60 °C. The solvent system consisted of solvent A with 0.1% formic acid in HO and solvent B with 0.1% formic acid in acetonitrile (ACN). A gradient of 5% to 100% B in 15 min was used at a flow rate of 0.4 mL / min. Detector and conditions: Corona ultra charged aerosol detection (from esa). Nebulizer temperature: 25 °C. N2 pressure: 35.1 psi. Filter: Corona.

[0804] 1 H and 13 C NMR spectra were measured at room temperature using a 500 MHz ( 1 H NMR) and 125 MHz ( 13 C NMR) were recorded on a Varian spectrometer. Chemical shifts are given in ppm relative to the solvent residual peak (CDCl3- 1 H NMR: δ 7.26 ppm and 13 C NMR δ 77.2 ppm; DMSO-d6- 1 H NMR: δ 2.50 ppm and 13 C NMR δ 39.5 ppm. Coupling constants are given in Hertz. Signal splitting patterns are described as singlet (s), doublet (d), triplet (t), or multiplet (m).

[0805] Synthetic Route to Conjugate Building Block TriGalNAc_Tether 1:

[0806] [ka]

[0807] Preparation of Compound 2: D-galactosamine pentaacetate (3.00 g, 7.71 mmol, 1.0 equiv.) was dissolved in anhydrous dichloromethane (DCM) (30 mL) under argon, and trimethylsilyl trifluoromethanesulfonate (TMSOTf, 4.28 g, 19.27 mmol, 2.5 equiv.) was added. The reaction was stirred at room temperature for 3 h. The reaction mixture was diluted with DCM (50 mL) and washed with cold saturated aqueous NaHCO3 (100 mL) and water (100 mL). The organic layer was separated, dried over Na2SO4, and concentrated to give the title compound as a yellow oil. It was purified by flash chromatography (gradient elution: 0-10% MeOH in DCM, 10 CV). The product was obtained as a colorless oil (2.5 g, 98%, rf = 0.45 (2% MeOH in DCM)).

[0808] [ka]

[0809] Preparation of Compound 4: Compound 2 (2.30 g, 6.98 mmol, 1.0 equiv.) and azido-PEG3-OH (1.83 g, 10.5 mmol, 1.5 equiv.) were dissolved in anhydrous DCM (40 mL) under argon, and molecular sieves 3 Å (5 g) were added to the solution. The mixture was stirred at room temperature for 1 h. TMSOTf (0.77 g, 3.49 mmol, 0.5 equiv.) was then added to the mixture, and the reaction was stirred overnight. The molecular sieves were filtered, and the filtrate was diluted with DCM (100 mL) and washed with cold saturated aqueous NaHCO3 (100 mL) and water (100 mL). The organic layer was separated, dried over Na2SO4, and the solvent was removed under reduced pressure. The crude material was purified by flash chromatography (gradient elution: 0-3% MeOH in DCM, 10 CV) to give the title product as a light yellow oil (3.10 g, 88%, rf=0.25 (2% MeOH in DCM)). MS: C 20 H 32 N4O 11Calculated value, 504.21. Actual value 505.4. 1H NMR (500 MHz, CDCl3) δ 6.21-6.14 (m, 1H), 5.30 (dd, J = 3.4, 1.1 Hz, 1H), 5.04 (dd, J = 11.2, 3.4 Hz,1H), 4.76 (d, J = 8.6 Hz, 1H), 4.23-4.08 (m, 3H), 3.91-3.80 (m, 3H), 3.74-3.59 (m, 9H), 3.49-3.41 (m, 2H), 2.14 (s, 3H), 2.02 (s, 3H), 1.97 (d, J = 4.2 Hz, 6H). 13C NMR (125 MHz, CDCl3) δ 170.6 (C), 170.5 (C), 170.4 (C), 170.3 (C), 102.1 (CH), 71.6 (CH), 70.8 (CH), 70.6 (CH), 70.5 (CH), 70.3 (CH2), 69.7 (CH2), 68.5 (CH2), 66.6 (CH2), 61.5 (CH2), 23.1 (CH3), 20.7 (3xCH3).

[0810] [ka]

[0811] Preparation of Compound 5: Compound 4 (1.00 g, 1.98 mmol, 1.0 equiv) was dissolved in a mixture of ethyl acetate (EtOAc) and MeOH (30 mL 1:1 v / v), and Pd / C (100 mg) was added. The reaction mixture was degassed by vacuum / argon cycle (3 times) and hydrogenated under balloon pressure overnight. The reaction mixture was filtered through Celite and washed with EtOAc (30 mL). The solvent was removed under reduced pressure to give the title compound as a colorless oil (0.95 g, quantitative yield, rf=0.25 (10% MeOH in DCM)). This compound was used without further purification. MS: C 20 H 34 N2O 11 Calculated value: 478.2. Measured value: 479.4.

[0812] [ka]

[0813] Preparation of Compound 7: Tris{[2-(tert-butoxycarbonyl)ethoxy]methyl}-methylamine 6 (3.37 g, 6.67 mmol, 1.0 equiv.) was dissolved in a DCM / water mixture (40 mL 1:1 v / v), and Na2CO3 (0.18 g, 1.7 mmol, 0.25 equiv.) was added with vigorous stirring. Benzyl chloroformate (2.94 mL, 20.7 mmol, 3.10 equiv.) was added dropwise to the previous mixture, and the reaction was stirred at room temperature for 24 h. The reaction mixture was diluted with CHCl2 (100 mL) and washed with water (100 mL). The organic layer was separated and dried over Na2SO4. The solvent was removed under reduced pressure and the resulting crude material was purified by flash chromatography (gradient elution: 0-10% ethyl acetate in cyclohexane, 12 CV) to give the title compound as a pale yellow oil (3.9 g, 91%, rf=0.56 (10% EtOAc in cyclohexane)). MS: C 33 H 53 NO 11 Calculated value: 639.3. Measured value: 640.9. 1H NMR (500 MHz, DMSO-d6) δ 7.38-7.26 (m, 5H), 4.97 (s, 2H), 3.54 (t, 6H), 3.50 (s, 6H), 2.38 (t, 6H), 1.39 (s, 27H). 13C NMR (125 MHz, DMSO-d6) δ 170.3 (3xC), 154.5 (C), 137.1 (C), 128.2 (2xCH), 127.7 (CH), 127.6 (2xCH), 79.7 (3xC), 68.4 (3xCH2), 66.8 (3xCH2), 64.9 (C), 58.7 (CH2), 35.8 (3xCH2), 27.7 (9xCH3).

[0814] [ka]

[0815] Preparation of compound 8: Cbz-NH-tris-Boc-ester 7 (0.20 g, 0.39 mmol, 1.0 equiv.) was dissolved in CHCl (1 mL) under argon, trifluoroacetic acid (TFA, 1 mL) was added, and the reaction was stirred at room temperature for 1 h. The solvent was removed under reduced pressure, and the residue was coevaporated three times with toluene (5 mL) and dried under high vacuum to give the compound as the TFA salt (0.183 g, 98%). This compound was used without further purification. MS: C 21 H 29 NO 11 Calculated value: 471.6. Measured value: 472.4.

[0816] [ka]

[0817] Preparation of Compound 9: CbzNH-Tris-COOH 8 (0.72 g, 1.49 mmol, 1.0 equiv.) and GalNAc-PEG3-NH25 (3.56 g, 7.44 mmol, 5.0 equiv.) were dissolved in N,N-dimethylformamide (DMF) (25 mL). To this solution was then added N,N,N',N'-tetramethyl-O-(1H-benzotriazol-1-yl)uronium hexafluorophosphate (HBTU) (2.78 g, 7.44 mmol, 5.0 equiv.), 1-hydroxybenzotriazole hydrate (HoBt) (1.05 g, 7.44 mmol, 5.0 equiv.), and N,N-diisopropylethylamine (DIPEA) (2.07 mL, 11.9 mmol, 8.0 equiv.), and the reaction was stirred for 72 h. The solvent was removed under reduced pressure, and the residue was dissolved in DCM (100 mL) and washed with saturated aqueous NaHCO3 (100 mL). The organic layer was dried over Na2SO4, the solvent was evaporated, and the crude material was purified by flash chromatography (gradient elution: 0-5% MeOH in DCM, 14 CV). The product was obtained as a pale yellow oil (1.2 g, 43%, rf=0.20 (5% MeOH in DCM)). MS: C 81 H 125 N7O 41Calculated value, 1852.9. Measured value, 1854.7. ¹H NMR (500 MHz, DMSO-d6) δ 7.90–7.80 (m, 10H), 7.65–7.62 (m, 4H), 7.47–7.43 (m, 3H), 7.38–7.32 (m, 8H), 5.24–5.22 (m, 3H), 5.02–4.97 (m, 4H), 4.60–4.57 (m, 3H), 4.07–3.90 (m 10H), 3.67–3.36 (m, 70H), 3.23–3.07 (m, 25H), 2.18 (s, 10H), 2.00 (s, 13H), 1.89 (s, 11H), 1.80-1.78 (m, 17H). 13C NMR (125 MHz, DMSO-d6) δ 170.1 (C), 169.8 (C), 169.7 (C), 169.4 (C), 169.2 (C), 169.1 (C), 142.7 (C), 126.3 (CH), 123.9 (CH), 118.7 (CH), 109.7 (CH), 100.8 (CH), 70.5 (CH), 69.8 (CH), 69.6 (CH), 69.5 (CH), 69.3 (CH2), 69.0 (CH2), 68.2 (CH2), 67.2 (CH2), 66.7 (CH2), 61.4 (CH2), 22.6 (CH2), 22.4 (3xCH3), 20.7 (9xCH3).

[0818]

change

[0819] Preparation of Compound 10: Tri-branched GalNAc compound 9 (0.27 g, 0.14 mmol, 1.0 equiv.) was dissolved in MeOH (15 mL), and 3 drops of acetic acid (AcOH) and Pd / C (30 mg) were added. The reaction mixture was degassed using a vacuum / argon cycle (3 times) and hydrogenated under balloon pressure overnight. Completion of the reaction was followed by mass analysis, and the resulting mixture was filtered through a thin pad of Celite. The solvent was evaporated, and the resulting residue was dried under high vacuum and used in the next step without further purification. The product was obtained as a pale yellow oil (0.24 g, quantitative yield). MS: C 73 H 119 N7O 39 Calculated value: 1718.8. Measured value: 1719.3.

[0820] [ka]

[0821] Preparation of Compound 11: Commercially available suberic acid bis(N-hydroxysuccinimide ester) (3.67 g, 9.9 mmol, 1.0 equiv.) was dissolved in DMF (5 mL) and triethylamine (1.2 mL) was added. To this solution was added a solution of 3-azido-1-propylamine (1.0 g, 9.9 mmol, 1.0 equiv.) in DMF (5 mL) dropwise. The reaction was stirred at room temperature for 3 hours. The reaction mixture was diluted with EtOAc (100 mL) and washed with water (50 mL). The organic layer was separated, dried over Na2SO4, and the solvent was removed under reduced pressure. The crude material was purified by flash chromatography (gradient elution: 0-5% MeOH in DCM, 16 CV). The product was obtained as a white solid (1.54 g, 43%, rf=0.71 (5% MeOH in DCM)). MS: C 15 H 23 Calculated value of N5O5: 353.4. Measured value: 354.3.

[0822] [ka]

[0823] Preparation of TriGalNAc (12): Tri-branched GalNAc compound 10 (0.35 g, 0.24 mmol, 1.0 equiv.) and compound 11 (0.11 g, 0.31 mmol, 1.5 equiv.) were dissolved in DCM (5 mL) under argon, and triethylamine (0.1 mL, 0.61 mmol, 3.0 equiv.) was added. The reaction was stirred overnight at room temperature. The solvent was removed under reduced pressure, and the residue was dissolved in EtOAc (100 mL) and washed with water (100 mL). The organic layer was separated and dried over Na2SO4. The solvent was evaporated, and the resulting crude material was purified by flash chromatography (gradient elution: 0-10% MeOH in DCM, 20 CV) to give the title compound as a white fluffy solid (0.27 g, 67%, rf = 0.5 (10% MeOH in DCM)). MS: C 84 H 137 N 11 O 41 Calculated value, January 1957. Measured value, June 1959.

[0824] Conjugation of Tether 1 to siRNA strands: Monofluorocyclooctyne (MFCO) conjugation at the 5'- or 3'-end 5'-Terminal MFCO Conjugation

[0825] [ka] 3'-Terminal MFCO Conjugation

[0826] [ka]

[0827] Basic conditions for MFCO conjugation: Amine-modified single strands were dissolved at 700 OD / mL in 50 mM carbonate / bicarbonate buffer pH 9.6 / dimethyl sulfoxide (DMSO) 4:6 (vol / vol). To this solution was added 1 molar equivalent of a 35 mM DMF solution of MFCO-C6-NHS ester (Berry & Associates, catalog no. LK4300). The reaction was carried out at room temperature, and after 1 h, another 1 molar equivalent of MFCO solution was added. The reaction was allowed to proceed for an additional 1 h and monitored by LC / MS. A quantitative consumption of the starting material required at least a 2-molar excess of MFCO NHS ester reagent relative to the amino-modified oligonucleotide. The reaction mixture was diluted 15-fold with water, filtered through a 1.2 μm Sartorius filter, and then purified by reverse phase (RP HPLC) using an Aekta Pure instrument (GE Healthcare).

[0828] Purification was performed using a Waters XBridge C18 Prep 19 x 50 mm column. Buffer A was 100 mM TEAAc pH 7, and buffer B contained 95% acetonitrile in buffer A. A flow rate of 10 mL / min and a temperature of 60°C were used. A UV trace at 280 nm was recorded. A gradient of 0-100% B was used within 60 column volumes.

[0829] Fractions containing the full-length conjugated oligonucleotide were pooled and precipitated with 3 M NaOAc, pH 5.2, and 85% ethanol in a freezer. The collected pellet was dissolved in water. The sample was desalted by size-exclusion chromatography and concentrated using a speed-vac concentrator, yielding the conjugated oligonucleotide in 40-80% isolated yield. 5'-GalNAc-T1 conjugate

[0830] [ka] 3'-GalNAc-T1 conjugate

[0831] [ka]

[0832] General procedure for TriGalNAc conjugation: MFCO-modified single strand was dissolved in water at 2000 OD / mL, and 1 equivalent of a DMF solution of compound 12 (10 mM) was added to this solution. The reaction was carried out at room temperature, and after 3 hours, 0.7 molar equivalents of compound 12 solution was added. The reaction was allowed to proceed overnight and monitored for completion by LCMS. The conjugate was diluted 15-fold with water, filtered through a 1.2 μm Sartorius filter, and then purified by RP HPLC on an Aekta Pure instrument (GE Healthcare).

[0833] RP HPLC purification was performed using a Waters XBridge C18 Prep 19 x 50 mm column. Buffer A was 100 mM triethylammonium acetate pH 7, and buffer B contained 95% acetonitrile in buffer A. A flow rate of 10 mL / min and a temperature of 60°C were used. A UV trace at 280 nm was recorded. A gradient of 0-100% B was used within 60 column volumes.

[0834] Fractions containing the full-length conjugated oligonucleotide were pooled and precipitated with 3M NaOAc, pH 5.2, and 85% ethanol in a freezer. The collected pellet was dissolved in water to obtain an oligonucleotide solution of approximately 1000 OD / mL. O-acetate was removed by adding 20% ​​aqueous ammonia. Quantitative removal of these protecting groups was verified by LC-MS.

[0835] The conjugate was desalted by size exclusion chromatography using Sephadex G25 Fine resin (GE Healthcare) on an Aekta Pure (GE Healthcare) instrument, giving conjugated oligonucleotides in 50-70% isolated yield.

[0836] The synthetic route is further illustrated in the scheme below.

[0837] [ka]

[0838] [ka]

[0839] [ka]

[0840] [ka]

[0841] [ka] [Example]

[0842] Double-strand annealing To generate the desired siRNA duplex, the two complementary strands were annealed by combining equimolar aqueous solutions of both strands. The mixture was placed in a 70°C water bath for 5 minutes and then allowed to cool to ambient temperature within 2 hours. The duplexes were lyophilized for 2 days and stored at -20°C.

[0843] The duplexes were analyzed by analytical SEC HPLC on a Superdex™ 75 Increase 5 / 150GL column 5 × 153-158 mm (Cytiva) on a Dionex Ultimate 3000 (Thermo Fisher Scientific) HPLC system. The mobile phase consisted of 1 × PBS containing 10% acetonitrile. An isocratic gradient was run at room temperature for 10 min at a flow rate of 1.5 mL / min. UV traces were recorded at 260 and 280 nm. Water (LC-MS grade) was purchased from Sigma-Aldrich, and phosphate-buffered saline (PBS; 10x, pH 7.4) was purchased from GIBCO (Thermo Fisher Scientific). [Example]

[0844] Synthesis of Tether 2 Basic experimental conditions: Thin-layer chromatography (TLC) was performed on silica-coated aluminum plates using a Macherey-Nagel 254 nm fluorescent indicator. Compounds were visualized under UV light (254 nm) or after spraying with 5% H2SO4 or ninhydrin reagent in methanol (MeOH) according to Stahl (Sigma-Aldrich) followed by heating. Flash chromatography was performed using Biotage Sfaer silica 10, 25, 50, or 100 g columns (Uppsala, Sweden) on a Biotage Isolera One flash chromatography instrument equipped with a dual-variable UV wavelength detector (200–400 nm).

[0845] All moisture-sensitive reactions were performed under anhydrous conditions using dry glassware, anhydrous solvents, and an argon atmosphere. All commercially available reagents were purchased from Sigma-Aldrich, and solvents were purchased from Carl Roth GmbH. D-Galactosamine pentaacetate was purchased from AK scientific.

[0846] HPLC / ESI-MS was performed on a Dionex UltiMate 3000RS UHPLC system and a Thermo Scientific MSQ Plus mass spectrometer using a Waters Acquity UPLC Protein BEH C4 column (300 Å, 1.7 μm, 2.1 × 100 mm) at 60 °C. The solvent system consisted of solvent A with 0.1% formic acid in HO and solvent B with 0.1% formic acid in acetonitrile (ACN). A gradient of 5% to 100% B in 15 min was used at a flow rate of 0.4 mL / min. Detector and conditions: Corona ultra charged aerosol detection (from esa). Nebulizer temperature: 25 °C. N2 pressure: 35.1 psi. Filter: Corona.

[0847] 1 H and 13 C NMR spectra were measured at room temperature using a 500 MHz ( 1 H NMR) and 125 MHz ( 13 C NMR) were recorded on a Varian spectrometer. Chemical shifts are given in ppm relative to the solvent residual peak (CDCl3- 1 H NMR: δ 7.26 ppm and 13 C NMR δ 77.2 ppm; DMSO-d6- 1 H NMR: δ 2.50 ppm and 13 C NMR δ 39.5 ppm. Coupling constants are given in Hertz. Signal splitting patterns are described as singlet (s), doublet (d), triplet (t), or multiplet (m).

[0848] Synthetic Route to Conjugate Building Block TriGalNAc_Tether 2:

[0849] [ka]

[0850] Preparation of Compound 2: D-galactosamine pentaacetate (3.00 g, 7.71 mmol, 1.0 equiv.) was dissolved in anhydrous dichloromethane (DCM) (30 mL) under argon, and trimethylsilyl trifluoromethanesulfonate (TMSOTf, 4.28 g, 19.27 mmol, 2.5 equiv.) was added. The reaction was stirred at room temperature for 3 h. The reaction mixture was diluted with DCM (50 mL) and washed with cold saturated aqueous NaHCO3 (100 mL) and water (100 mL). The organic layer was separated, dried over Na2SO4, and concentrated to give the title compound as a yellow oil. It was purified by flash chromatography (gradient elution: 0-10% MeOH in DCM, 10 CV). The product was obtained as a colorless oil (2.5 g, 98%, rf = 0.45 (2% MeOH in DCM)).

[0851] [ka]

[0852] Preparation of Compound 4: Compound 2 (2.30 g, 6.98 mmol, 1.0 equiv.) and azido-PEG3-OH (1.83 g, 10.5 mmol, 1.5 equiv.) were dissolved in anhydrous DCM (40 mL) under argon, and molecular sieves 3 Å (5 g) were added to the solution. The mixture was stirred at room temperature for 1 h. TMSOTf (0.77 g, 3.49 mmol, 0.5 equiv.) was then added to the mixture, and the reaction was stirred overnight. The molecular sieves were filtered, and the filtrate was diluted with DCM (100 mL) and washed with cold saturated aqueous NaHCO3 (100 mL) and water (100 mL). The organic layer was separated, dried over Na2SO4, and the solvent was removed under reduced pressure. The crude material was purified by flash chromatography (gradient elution: 0-3% MeOH in DCM, 10 CV) to give the title product as a light yellow oil (3.10 g, 88%, rf=0.25 (2% MeOH in DCM)). MS: C 20 H 32 N4O 11Calculated value, 504.21. Actual value 505.4. 1H NMR (500 MHz, CDCl3) δ 6.21-6.14 (m, 1H), 5.30 (dd, J = 3.4, 1.1 Hz, 1H), 5.04 (dd, J = 11.2, 3.4 Hz,1H), 4.76 (d, J = 8.6 Hz, 1H), 4.23-4.08 (m, 3H), 3.91-3.80 (m, 3H), 3.74-3.59 (m, 9H), 3.49-3.41 (m, 2H), 2.14 (s, 3H), 2.02 (s, 3H), 1.97 (d, J = 4.2 Hz, 6H). 13C NMR (125 MHz, CDCl3) δ 170.6 (C), 170.5 (C), 170.4 (C), 170.3 (C), 102.1 (CH), 71.6 (CH), 70.8 (CH), 70.6 (CH), 70.5 (CH), 70.3 (CH2), 69.7 (CH2), 68.5 (CH2), 66.6 (CH2), 61.5 (CH2), 23.1 (CH3), 20.7 (3xCH3).

[0853] [ka]

[0854] Preparation of Compound 5: Compound 4 (1.00 g, 1.98 mmol, 1.0 equiv) was dissolved in a mixture of ethyl acetate (EtOAc) and MeOH (30 mL 1:1 v / v), and Pd / C (100 mg) was added. The reaction mixture was degassed by vacuum / argon cycle (3 times) and hydrogenated under balloon pressure overnight. The reaction mixture was filtered through Celite and washed with EtOAc (30 mL). The solvent was removed under reduced pressure to give the title compound as a colorless oil (0.95 g, quantitative yield, rf=0.25 (10% MeOH in DCM)). This compound was used without further purification. MS: C 20 H 34 N2O 11 Calculated value: 478.2. Measured value: 479.4.

[0855] [ka]

[0856] Preparation of Compound 7: Tris{[2-(tert-butoxycarbonyl)ethoxy]methyl}-methylamine 6 (3.37 g, 6.67 mmol, 1.0 equiv.) was dissolved in a DCM / water mixture (40 mL 1:1 v / v), and Na2CO3 (0.18 g, 1.7 mmol, 0.25 equiv.) was added with vigorous stirring. Benzyl chloroformate (2.94 mL, 20.7 mmol, 3.10 equiv.) was added dropwise to the previous mixture, and the reaction was stirred at room temperature for 24 h. The reaction mixture was diluted with CHCl2 (100 mL) and washed with water (100 mL). The organic layer was separated and dried over Na2SO4. The solvent was removed under reduced pressure and the resulting crude material was purified by flash chromatography (gradient elution: 0-10% ethyl acetate in cyclohexane, 12 CV) to give the title compound as a pale yellow oil (3.9 g, 91%, rf=0.56 (10% EtOAc in cyclohexane)). MS: C 33 H 53 NO 11 Calculated value: 639.3. Measured value: 640.9. 1H NMR (500 MHz, DMSO-d6) δ 7.38-7.26 (m, 5H), 4.97 (s, 2H), 3.54 (t, 6H), 3.50 (s, 6H), 2.38 (t, 6H), 1.39 (s, 27H). 13C NMR (125 MHz, DMSO-d6) δ 170.3 (3xC), 154.5 (C), 137.1 (C), 128.2 (2xCH), 127.7 (CH), 127.6 (2xCH), 79.7 (3xC), 68.4 (3xCH2), 66.8 (3xCH2), 64.9 (C), 58.7 (CH2), 35.8 (3xCH2), 27.7 (9xCH3).

[0857] [ka]

[0858] Preparation of compound 8: Cbz-NH-tris-Boc-ester 7 (0.20 g, 0.39 mmol, 1.0 equiv.) was dissolved in CHCl (1 mL) under argon, trifluoroacetic acid (TFA, 1 mL) was added, and the reaction was stirred at room temperature for 1 h. The solvent was removed under reduced pressure, and the residue was coevaporated three times with toluene (5 mL) and dried under high vacuum to give the compound as the TFA salt (0.183 g, 98%). This compound was used without further purification. MS: C 21 H 29 NO 11 Calculated value: 471.6. Measured value: 472.4.

[0859] [ka]

[0860] Preparation of Compound 9: CbzNH-Tris-COOH 8 (0.72 g, 1.49 mmol, 1.0 equiv.) and GalNAc-PEG3-NH2 5 (3.56 g, 7.44 mmol, 5.0 equiv.) were dissolved in N,N-dimethylformamide (DMF) (25 mL). To this solution was then added N,N,N',N'-tetramethyl-O-(1H-benzotriazol-1-yl)uronium hexafluorophosphate (HBTU) (2.78 g, 7.44 mmol, 5.0 equiv.), 1-hydroxybenzotriazole hydrate (HoBt) (1.05 g, 7.44 mmol, 5.0 equiv.), and N,N-diisopropylethylamine (DIPEA) (2.07 mL, 11.9 mmol, 8.0 equiv.), and the reaction was stirred for 72 h. The solvent was removed under reduced pressure, and the residue was dissolved in DCM (100 mL) and washed with saturated aqueous NaHCO3 (100 mL). The organic layer was dried over Na2SO4, the solvent was evaporated, and the crude material was purified by flash chromatography (gradient elution: 0-5% MeOH in DCM, 14 CV). The product was obtained as a pale yellow oil (1.2 g, 43%, rf=0.20 (5% MeOH in DCM)). MS: C 81 H 125 N7O 41Calculated value, 1852.9. Measured value, 1854.7. ¹H NMR (500 MHz, DMSO-d6) δ 7.90–7.80 (m, 10H), 7.65–7.62 (m, 4H), 7.47–7.43 (m, 3H), 7.38–7.32 (m, 8H), 5.24–5.22 (m, 3H), 5.02–4.97 (m, 4H), 4.60–4.57 (m, 3H), 4.07–3.90 (m 10H), 3.67–3.36 (m, 70H), 3.23–3.07 (m, 25H), 2.18 (s, 10H), 2.00 (s, 13H), 1.89 (s, 11H), 1.80-1.78 (m, 17H). 13C NMR (125 MHz, DMSO-d6) δ 170.1 (C), 169.8 (C), 169.7 (C), 169.4 (C), 169.2 (C), 169.1 (C), 142.7 (C), 126.3 (CH), 123.9 (CH), 118.7 (CH), 109.7 (CH), 100.8 (CH), 70.5 (CH), 69.8 (CH), 69.6 (CH), 69.5 (CH), 69.3 (CH2), 69.0 (CH2), 68.2 (CH2), 67.2 (CH2), 66.7 (CH2), 61.4 (CH2), 22.6 (CH2), 22.4 (3xCH3), 20.7 (9xCH3).

[0861]

change

[0862] Preparation of Compound 10: Tri-branched GalNAc compound 9 (0.27 g, 0.14 mmol, 1.0 equiv.) was dissolved in MeOH (15 mL), and 3 drops of acetic acid (AcOH) and Pd / C (30 mg) were added. The reaction mixture was degassed using a vacuum / argon cycle (3 times) and hydrogenated under balloon pressure overnight. Completion of the reaction was followed by mass analysis, and the resulting mixture was filtered through a thin pad of Celite. The solvent was evaporated, and the resulting residue was dried under high vacuum and used in the next step without further purification. The product was obtained as a pale yellow oil (0.24 g, quantitative yield). MS: C 73 H 119 N7O 39 Calculated value: 1718.8. Measured value: 1719.3.

[0863] [ka]

[0864] Preparation of compound 14: Tri-branched GalNAc compound 10 (0.45 g, 0.26 mmol, 1.0 equiv.), HBTU (0.19 g, 0.53 mmol, 2.0 equiv.), and DIPEA (0.23 mL, 1.3 mmol, 5.0 equiv.) were dissolved in DCM (10 mL) under argon. To this mixture, a solution of compound 13 (0.14 g, 0.53 mmol, 2.0 equiv.) in DCM (5 mL) was added dropwise. The reaction was stirred overnight at room temperature. The solvent was removed, and the residue was dissolved in EtOAc (50 mL), washed with water (50 mL), and dried over Na2SO4. The solvent was evaporated, and the crude material was purified by flash chromatography (gradient elution: 0-5% MeOH in DCM, 20 CV). The product was obtained as a white fluffy solid (0.25 g, 48%, rf=0.4 (10% MeOH in DCM)). MS: C 88 H 137 N7O 42 Calculated value, January 1965. Measured value, June 1965.

[0865] [ka]

[0866] Preparation of TriGalNAc (15): Triantennary GalNAc compound 14 (0.31 g, 0.15 mmol, 1.0 equiv.) was dissolved in EtOAc (15 mL) and Pd / C (40 mg) was added. The reaction mixture was degassed by vacuum / argon cycles (3 times) and hydrogenated under balloon pressure overnight. Completion of the reaction was monitored by mass spectrometry, and the resulting mixture was filtered through a thin pad of Celite. The solvent was removed under reduced pressure, and the resulting residue was dried under high vacuum overnight. The residue was used for conjugation with oligonucleosides without further purification (0.28 g, quantitative yield). MS: C 81 H 131 N7O 42 Calculated value: September 1874. Measured value: March 1875.

[0867] Conjugation of Tether 2 to siRNA strand: TriGalNAc Tether 2 (GalNAc-T2) conjugation at the 5' or 3' end 5'-GalNAc-T2 conjugate

[0868] [ka] 3'-GalNAc-T2 conjugate

[0869] [ka]

[0870] Preparation of TriGalNAc tether 2 NHS ester: To a solution of carboxylic acid tether 2 (compound 15, 227 mg, 121 μmol) in DMF (2.1 mL), N-hydroxysuccinimide (NHS) (15.3 mg, 133 μmol) and N,N'-diisopropylcarbodiimide (DIC) (19.7 μL, 127 μmol) were added. The solution was stirred at room temperature for 18 h and used in subsequent conjugation reactions without purification.

[0871] Basic conditions for triGalNAc Tether 2 conjugation: Amine-modified single strands were dissolved at 700 OD / mL in 50 mM carbonate / bicarbonate buffer pH 9.6 / DMSO 4:6 (vol / vol). To this solution, 1 molar equivalent of Tether 2 NHS ester (57 mM) solution in DMF was added. The reaction was carried out at room temperature, and after 1 h, another 1 molar equivalent of NHS ester solution was added. The reaction was allowed to proceed for an additional 1 h, and reaction progress was monitored by LCMS. At least a 2-molar excess of NHS ester reagent relative to the amino-modified oligonucleoside was required to achieve quantitative consumption of the starting material. The reaction mixture was diluted 15-fold with water, filtered through a 1.2 μm Sartorius filter, and then purified by reverse-phase (RP HPLC) on an Aekta Pure (GE Healthcare) instrument.

[0872] Purification was performed using a Waters XBridge C18 Prep 19 x 50 mm column. Buffer A was 100 mM TEAA pH 7, and buffer B contained 95% acetonitrile in buffer A. A flow rate of 10 mL / min and a temperature of 60°C were used. A UV trace at 280 nm was recorded. A gradient of 0-100% B was used within 60 column volumes.

[0873] Fractions containing full-length conjugated oligonucleosides were pooled and precipitated with 3 M NaOAc, pH 5.2, and 85% ethanol in a freezer, then dissolved in water at 1000 OD / mL. O-acetate was removed with 20% aqueous ammonium hydroxide until complete removal (monitored by LC-MS).

[0874] The conjugate was desalted by size exclusion chromatography using Sephadex G25 Fine resin (GE Healthcare) on an Aekta Pure (GE Healthcare) instrument, giving conjugated oligonucleotides in 60-80% isolated yield.

[0875] The conjugate was characterized by HPLC-MS analysis using a Dionex Ultimate 3000 (Thermo Fisher Scientific) HPLC system equipped with a Compact ESI-Qq-TOF mass spectrometer (Bruker Daltonics) and a 2.1 x 50 mm XBridge C18 column (Waters). Buffer A was 16.3 mM triethylamine, 100 mM HFIP in 1% aqueous MeOH, and buffer B contained 95% MeOH in buffer A. A flow rate of 250 μL / min and a temperature of 60°C were used. UV traces were recorded at 260 and 280 nm. A gradient of 1-100% B was used within 31 min.

[0876] The synthetic route is further illustrated in the scheme below.

[0877] [ka]

[0878] [ka]

[0879] [ka]

[0880] [ka] [Example]

[0881] Double-strand annealing To generate the desired siRNA duplex, the two complementary strands were annealed by combining equimolar aqueous solutions of both strands. The mixture was placed in a 70°C water bath for 5 minutes and then allowed to cool to ambient temperature within 2 hours. The duplexes were lyophilized for 2 days and stored at -20°C.

[0882] The duplexes were analyzed by analytical SEC HPLC on a Superdex™ 75 Increase 5 / 150GL column 5 × 153-158 mm (Cytiva) on a Dionex Ultimate 3000 (Thermo Fisher Scientific) HPLC system. The mobile phase consisted of 1 × PBS containing 10% acetonitrile. An isocratic gradient was run at room temperature for 10 min at a flow rate of 1.5 mL / min. UV traces were recorded at 260 and 280 nm. Water (LC-MS grade) was purchased from Sigma-Aldrich, and phosphate-buffered saline (PBS; 10x, pH 7.4) was purchased from GIBCO (Thermo Fisher Scientific). [Example]

[0883] Alternative synthetic route to the conjugate building block TriGalNAc_tether 2

[0884] [ka]

[0885] [ka]

[0886] Conjugation of Tether 2 to siRNA strand: TriGalNAc Tether 2 (GalNAc-T2) conjugation at the 5' or 3' end Conjugation Conditions

[0887] [ka] Preactivation: To a solution of compound 15 (16 μmol, 4 equiv.) in DMF (160 μL), TFA-O-PFP (15 μL, 21 equiv.) was added, followed by DIPEA (23 μL, 32 equiv.) at 25° C. The tube was shaken at 25° C. for 2 h. The reaction was quenched with HO (10 μL). Coupling: The resulting mixture was diluted with DMF (400 μL), followed by the addition of oligo-amine solution (4.0 μmol in 10× PBS, pH 7.4, 500 μL; final oligo concentration in organic and aqueous solutions: 4 μmol / ml = 4 mM). The tube was shaken at 25°C for 16 hours, and the reaction was analyzed by LCMS. The resulting mixture was treated with 28% NH4OH (4.5 ml) and shaken at 25°C for 2 hours. The mixture was analyzed by LCMS, concentrated, and purified by IP-RP HPLC to produce the tethered 2GalNAc-conjugated oligonucleotide. 5'-GalNAc-T2 conjugate

[0888] [ka] 3'-GalNAc-T2 conjugate

[0889] [ka] [Example]

[0890] Solid phase synthesis: scale ≦1 μmol Synthesis of siRNA sense and antisense strands was performed on a MerMade 192X synthesizer using commercially available solid supports made of controlled-pore glass with universal linkers (Universal CPG, loading 40 μmol / g; LGC Biosearch or Glen Research).

[0891] RNA phosphoramidites were purchased from ChemGenes or Hongene.

[0892] The 2'-O-methyl phosphoramidites used were as follows: 5'-(4,4'-dimethoxytrityl)-N-benzoyl-adenosine 2'-O-methyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-acetyl-cytidine 2'-O-methyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, isopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-isobutyryl-guanosine 2'-O-methyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-uridine 2'-O-methyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite.

[0893] The 2'-F-phosphoramidites used were as follows: 5'-dimethoxytrityl-N-benzoyl-deoxyadenosine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-dimethoxytrityl-N-acetyl-deoxycytidine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-dimethoxytrityl-N-isobutyryl-deoxyguanosine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, and 5'-dimethoxytrityl-deoxyuridine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite.

[0894] All phosphoramidites were dissolved in anhydrous acetonitrile (Honeywell Research Chemicals) at a concentration of 0.05 M, except for 2'-O-methyl-uridine phosphoramidite, which was dissolved in DMF / MeCN (1:4, vol / vol). 0.02 M iodine (DNAchem) in acetonitrile / pyridine / HO was used as the oxidation reagent. Thiolation of the phosphorothioate linkages was carried out with 0.2 M PADS (TCI) in 1:1 acetonitrile / pyridine vol / vol. 0.25 mM 5-ethylthiotetrazole (ETT) in acetonitrile was used as the activator solution.

[0895] The inverted abasic phosphoramidite, 3-O-dimethoxytrityl-2-deoxyribose-5-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, was purchased from Chemgenes (ANP-1422) or Hongene (OP-040).

[0896] In each cycle, DMT was removed with a deblocking solution, 3% TCA in DCM (DNAchem).

[0897] The coupling time was 180 seconds. The oxidant contact time was set at 80 seconds, and the thiolation time was 2 seconds. * It was 100 seconds.

[0898] At the end of the synthesis, the oligonucleotides were cleaved from the solid support using a 4:1 (volume / volume) NH4OH:EtOH solution (TCI) for 20 h at 45° C. The solid support was then filtered, the filter was washed extensively with HO, and the volume of the mixed solution was reduced by evaporation under reduced pressure.

[0899] Oligonucleotides were treated to form sodium salts by ultracentrifugation using Amicon Ultra-2 centrifugal filter units; PBS buffer (10x, Teknova, pH 7.4, sterile) or by EtOH precipitation from 1 M sodium acetate.

[0900] The identity of the single strands was assessed by MS ESI and then annealed in water to form the final duplex siRNA, and the duplex purity was assessed by size exclusion chromatography. [Example]

[0901] Solid phase synthesis: Scale ≥ 5 μmol Sense and antisense siRNA strands were synthesized at a 5 μmol scale on a MerMade 12 synthesizer using commercially available controlled-pore glass solid supports with universal linkers (Universal CPG, loading 40 μmol / g; LGC Biosearch or Glen Research). The sense strand intended for 3' conjugation was synthesized at a 12 μmol scale on a 3'-PT-amino-modified C6 CPG 500 Å solid support (LGC) with a loading of 86 μmol / g.

[0902] RNA phosphoramidites were purchased from ChemGenes or Hongene.

[0903] The 2'-O-methyl phosphoramidites used were as follows: 5'-(4,4'-dimethoxytrityl)-N-benzoyl-adenosine 2'-O-methyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-acetyl-cytidine 2'-O-methyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, isopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-isobutyryl-guanosine 2'-O-methyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-uridine 2'-O-methyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite.

[0904] The 2'-F-phosphoramidites used were as follows: 5'-dimethoxytrityl-N-benzoyl-deoxyadenosine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-dimethoxytrityl-N-acetyl-deoxycytidine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-dimethoxytrityl-N-isobutyryl-deoxyguanosine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, and 5'-dimethoxytrityl-deoxyuridine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite.

[0905] The inverted abasic phosphoramidite, 3-O-dimethoxytrityl-2-deoxyribose-5-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, was purchased from Chemgenes (ANP-1422) or Hongene (OP-040).

[0906] All phosphoramidites were dissolved in anhydrous acetonitrile (Honeywell Research Chemicals) at a concentration of 0.05 M, except for 2'-O-methyl-uridine phosphoramidite, which was dissolved in DMF / MeCN (1:4, vol / vol). 0.02 M iodine (DNAchem) in acetonitrile / pyridine / HO was used as the oxidation reagent. Thiolation of the phosphorothioate linkages was carried out with 0.2 M PADS (TCI) in 1:1 acetonitrile / pyridine vol / vol. 0.25 mM 5-ethylthiotetrazole (ETT) in acetonitrile was used as the activator solution.

[0907] In each cycle, DMT was removed with a deblocking solution, 3% TCA in DCM (DNAchem).

[0908] For chains synthesized with Universal CPG, coupling was performed using 8 equivalents of amidite for 130 seconds, with an oxidation time of 47 seconds and a thiolation time of 210 seconds.

[0909] For chains synthesized with 3'-PT-amino-modified C6 CPG, coupling was performed using 8 equivalents of amidite in 2 * The reaction was carried out for 150 seconds, with an oxidation time of 47 seconds and a thiolation time of 250 seconds.

[0910] At the end of the synthesis, the oligonucleotides were cleaved from the solid support using a 4:1 (volume / volume) NH4OH:EtOH solution (TCI) for 20 h at 45° C. The solid support was then filtered, the filter was washed extensively with HO, a...

Claims

1. An inhibitor of the expression and / or function of SLC25A5 / ANT2, said inhibitor being conjugated to one or more ligand moieties, preferably said ligand moieties enabling targeting to hepatocytes.

2. The inhibitor of claim 1 which is an siRNA oligomer.

3. Inhibitors of SLC25A5 / ANT2 expression and / or function that are siRNA oligomers.

4. The inhibitor of claim 3, wherein the inhibitor comprises an siRNA oligomer conjugated to one or more ligand moieties, preferably the ligand moieties enable targeting of hepatocytes.

5. The inhibitor of claim 1, 2 or 4, wherein the one or more ligand moieties comprise one or more GalNAc ligands or further comprise one GalNAc ligand derivative.

6. The inhibitor of claim 1, 2, or 4, wherein the one or more ligand moieties comprise one or more GalNAc ligand derivatives.

7. 10. The inhibitor of claim 1, wherein the target of the inhibitor is SLC25A5 / ANT2.

8. the inhibitor is a nucleic acid for inhibiting expression of SLC25A5, comprising a double-stranded region comprising a first strand and a second strand that is at least partially complementary to the first strand; (i) is at least partially complementary to a portion of the RNA transcribed from the SLC25A5 gene; and (ii) comprises at least 17 consecutive nucleosides that differ by 0 or 1 nucleoside from any one of the first strand sequences listed in Table 2; 10. An inhibitor according to one or more of the preceding claims.

9. The inhibitor is a nucleic acid for inhibiting expression of SLC25A5, comprising a double-stranded region comprising a first strand and a second strand that is at least partially complementary to the first strand, wherein the first strand comprises: (i) is at least partially complementary to a portion of the RNA transcribed from the SLC25A5 gene; and (ii) comprises at least 17 consecutive nucleosides that differ by 0 or 1 nucleoside from any one of the modified sequences of the first strand listed in Table 3; 10. An inhibitor according to one or more of the preceding claims.

10. 10. The inhibitor of claim 8 or 9, wherein the first strand comprises nucleosides 2 to 18 of any one of the sequences according to claim 8 or 9, in particular the first strand comprises nucleosides 2 to 18 of any one of the sequences defined in Table 2 or 3.

11. 9. The inhibitor of claim 8, wherein the second strand comprises a nucleoside sequence of at least 17 contiguous nucleosides that differs by 0 or 1 nucleoside from any one of the second strand sequences listed in Table 2, and the second strand has a region that is at least 85% complementary to the first strand over the 17 contiguous nucleosides.

12. 10. The inhibitor of claim 9, wherein the second strand comprises a nucleoside sequence of at least 17 contiguous nucleosides that differs by 0 or 1 nucleoside from any one of the modified sequences for the second strand listed in Table 4, and the second strand has a region that is at least 85% complementary to the first strand over the 17 contiguous nucleosides.

13. 9. The inhibitor of claim 8, wherein the first strand comprises any one of the first strand sequences listed in Table 2.

14. 10. The inhibitor of claim 9, wherein the first strand comprises any one of the modified first strand sequences listed in Table 3.

15. 12. The inhibitor of claim 11, wherein the second strand comprises any one of the second strand sequences listed in Table 2.

16. 13. The inhibitor of claim 12, wherein the second strand comprises any one of the modified first strand sequences listed in Table 4.

17. 14. The inhibitor of claim 13, wherein the first chain comprises any one of the following sequences: SEQ ID NO:304, SEQ ID NO:323, SEQ ID NO:439, SEQ ID NO:453, and SEQ ID NO:

496.

18. 15. The inhibitor of claim 14, wherein the first chain comprises any one of the following sequences: SEQ ID NO:856, SEQ ID NO:875, SEQ ID NO:991, SEQ ID NO:1005, and SEQ ID NO:1048.

19. 16. The inhibitor of claim 15, wherein the second chain comprises any one of the following sequences: SEQ ID NO:580, SEQ ID NO:599, SEQ ID NO:715, SEQ ID NO:729, and SEQ ID NO:

772.

20. 17. The inhibitor of claim 16, wherein the second chain comprises any one of the following sequences: SEQ ID NO:1132, SEQ ID NO:1151, SEQ ID NO:1267, SEQ ID NO:1281, and SEQ ID NO:1324.

21. 12. The inhibitor of any one of claims 8 and 11, comprising a first strand and a second strand comprising, consisting of, or consisting essentially of a nucleoside sequence that differs by 0 or 1 nucleoside from any one of the following combinations of the first and second sequences: Table 1

22. 13. The inhibitor of any one of claims 9 and 12, comprising a first strand and a second strand comprising, consisting of, or consisting essentially of a nucleoside sequence that differs by 0 or 1 nucleoside from any one of the following combinations of the first and second sequences: Table 2

23. 23. The inhibitor of any one of claims 8 to 22, wherein the first strand has a length ranging from 17 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 19 or 23 nucleosides.

24. 24. The inhibitor of any one of claims 8 to 23, wherein the second strand has a length ranging from 17 to 30 nucleosides, preferably 19 to 25 nucleosides, more preferably 19 or 21 or 23 nucleosides.

25. 25. The inhibitor of any one of claims 8 to 24, wherein the duplex region of the nucleic acid is between 17 and 30 nucleosides in length, more preferably 19 or 21 or 23 nucleosides in length.

26. 26. The inhibitor of any one of claims 8 to 25, wherein the region of complementarity between the first strand and the portion of RNA transcribed from the SLC25A5 gene is between 17 and 30 nucleosides in length.

27. 27. The inhibitor of any one of claims 8 to 26, wherein the nucleic acid further comprises one or more single-stranded nucleoside overhangs, optionally wherein the overhangs are present on the first or second strand, preferably at the 3' end of the first or second strand, and / or wherein the overhangs comprise 1 to 4 nucleosides, more preferably 2 nucleosides.

28. The inhibitor of any one of claims 8 to 27, wherein the nucleic acid is an siRNA oligonucleoside.

29. 29. The inhibitor of any one of claims 8 to 28, wherein the second sense strand further comprises one or more abasic nucleosides at a terminal region of the second strand, the abasic nucleosides being connected to adjacent nucleosides via reverse internucleoside linkages.

30. the second strand comprises two consecutive abasic nucleosides in the 5'-terminal region of the second strand, one such abasic nucleoside being the terminal nucleoside of the 5'-terminal region of the second strand and the other abasic nucleoside being the penultimate nucleoside of the 5'-terminal region of the second strand; (a) the penultimate abasic nucleoside is linked to the adjacent first abasic nucleoside of the adjacent 5'-proximal terminal region via a reverse internucleoside linkage; (b) the reverse linkage is a 5-5' reverse linkage; 30. The inhibitor of any one of claims 8 to 29, wherein (c) the linkage between the terminal abasic nucleoside and the penultimate abasic nucleoside is 3'5' when read toward the end comprising the terminal abasic nucleoside and the penultimate abasic nucleoside.

12. The inhibitor or inhibitor for use according to claim 10 or 11, wherein the reverse internucleoside linkage is present in a terminal region distal from the 5'-terminal region of the second strand or in a terminal region distal from the 3'-terminal region of the second strand.

31. (i) the first strand and the second strand each have a length of 23 nucleosides; (ii) two phosphorothioate internucleoside linkages are present between three consecutive positions of the 5′-proximal terminal region of the second strand, respectively, a first phosphorothioate internucleoside linkage is present between the adjacent first base nucleosides of (a) and adjacent second base nucleosides in the 5′-proximal terminal region of the second strand, and a second phosphorothioate internucleoside linkage is present between the adjacent second base nucleosides and adjacent third base nucleosides in the 5′-proximal terminal region of the second strand; (iii) two phosphorothioate internucleoside linkages are present between three consecutive positions in both the 5'- and 3'-terminal regions of the first strand, respectively, and each terminal nucleoside in each of the 5'- and 3'-terminal regions of the first strand is attached to the 5'- and 3'-penultimate adjacent nucleoside, respectively, by a phosphorothioate internucleoside linkage, and each first 5'- and 3'-penultimate nucleoside is attached to the 5'- and 3'-penultimate adjacent third nucleoside, respectively, by a phosphorothioate internucleoside linkage; (iv) the second strand of the nucleic acid is directly or indirectly conjugated to one or more ligand moieties at the 3' terminal region of the second strand; The inhibitor of claim 30.

32. The two consecutive reverse abasic nucleosides in the 5'-terminal region of the second strand have the following 5'-terminal motif: 【Chemistry 1】 During the ceremony, T represents a 2'Me ribose modification; B represents the nucleoside bases of the first two base nucleosides in the 5'-terminal region of the second strand; and Z represents the remaining 19 consecutive nucleosides of the second strand.

32. The inhibitor of claim 30 or 31, present as

33. 33. The inhibitor of any one of claims 8 to 32, wherein the nucleic acid is directly or indirectly conjugated to one or more ligand moieties, optionally wherein the ligand moieties are present in a terminal region of the second strand, preferably in its 3'-terminal region.

34. The ligand moiety is (i) one or more N-acetylgalactosamine (GalNAc) ligands, and / or (ii) one or more N-acetylgalactosamine (GalNAc) ligand derivatives 34. The inhibitor of claim 33, comprising:

35. 35. The inhibitor of claim 34, wherein the one or more GalNAc ligands and / or GalNAc ligand derivatives are directly or indirectly conjugated to the 5' or 3' terminal region of the second strand of the nucleic acid, preferably to the 3' terminal region thereof.

36. structure: 【Chemistry 2】 Including, During the ceremony, R １ is independently in each occurrence selected from the group consisting of hydrogen, methyl and ethyl; R ２ is hydrogen, hydroxy, -OC １～３ Alkyl, —C(═O)OC １～３ selected from the group consisting of alkyl, halo, and nitro; X １ and X ２ is independently in each occurrence selected from the group consisting of methylene, oxygen, and sulfur; m is an integer from 1 to 6, n is an integer from 1 to 10, q, r, s, t, and v are independently integers from 0 to 4, with the proviso that: (i) q and r cannot both be 0 at the same time; (ii) s, t, and v cannot all be 0 simultaneously; Z is an oligonucleoside moiety; 36. An inhibitor according to any one of claims 33 to 35.

37. structure 【Transformation 3】 Including, an oligonucleotide representing said consecutive nucleosides of said second strand, The inhibitor of claim 36.

38. structure 【Chemistry 4】 Including, During the ceremony, r and s are independently integers selected from 1 to 16; Z is an oligonucleoside moiety; 36. An inhibitor according to any one of claims 33 to 35.

39. structure 【Transformation 5】 Including, an oligonucleotide representing said consecutive nucleosides of said second strand, The inhibitor of claim 38.

40. 40. The inhibitor of any one of claims 37 or 39, wherein the structure is conjugated to the 3'-terminal region of the second strand.

41. 41. An inhibitor according to any one of claims 22, 32, 37 and 40.

42. 41. An inhibitor according to any one of claims 22, 32, 39 and 40.

43. 10. The inhibitor according to one or more of the preceding claims, formulated as a pharmaceutical composition with excipients and / or carriers.

44. 10. A pharmaceutical composition comprising an inhibitor according to one or more of the preceding claims in combination with a pharmaceutically acceptable excipient or carrier.

45. An inhibitor according to any one of claims 1 to 43 or a pharmaceutical composition according to claim 44 for use in therapy.

46. An inhibitor according to any one of claims 1 to 43 or a pharmaceutical composition according to claim 44 for use in the prevention and / or treatment of a metabolic disease or disorder, such as a metabolic disease or disorder associated with non-alcoholic fatty liver disease (NAFLD), and / or a disease or disorder associated with obesity and / or lipogenesis, and / or for use in reducing lipogenesis.

47. Use of SLC25A5 / ANT2 as a target for identifying one or more therapeutic agents for the prevention and / or treatment of metabolic diseases or disorders, such as metabolic diseases or disorders associated with non-alcoholic fatty liver disease (NAFLD), and / or diseases or disorders associated with obesity and / or lipogenesis, and / or for reducing lipogenesis.

48. A method for treating or preventing a metabolic disease or disorder, such as a metabolic disease or disorder associated with non-alcoholic fatty liver disease (NAFLD), and / or a disease or disorder associated with obesity and / or lipogenesis, and / or a method for reducing lipogenesis, said method comprising administering to a patient an inhibitor of SLC25A5 / ANT2, such as an inhibitor described in any one of claims 1 to 43, or a pharmaceutical composition comprising an inhibitor of SLC25A5 / ANT2, such as the composition described in claim 44.

49. Use of an inhibitor described in any one of claims 1 to 43 or a pharmaceutical composition described in claim 44 in the preparation of a medicament for the treatment of a metabolic disease or disorder, such as a metabolic disease or disorder associated with non-alcoholic fatty liver disease (NAFLD), and / or a disease or disorder associated with obesity and / or lipogenesis, and / or for reducing lipogenesis.

50. SLC25A5 / ANT2 for use as a biomarker for a metabolic disease or disorder, for example a metabolic disease or disorder associated with non-alcoholic fatty liver disease (NAFLD), and / or a disease or disorder associated with obesity and / or lipogenesis.

51. Typically, SLC25A5 / ANT2 for use in an in vivo method of predicting susceptibility to a metabolic disease or disorder, such as a metabolic disease or disorder associated with non-alcoholic fatty liver disease (NAFLD), and / or a disease or disorder associated with obesity and / or lipogenesis, by monitoring the sequence and / or level of expression and / or function of SLC25A5 / ANT2 in a sample obtained from a patient.

53. 1. A method of predicting susceptibility to and optionally treating a metabolic disease or disorder in a patient, such as a metabolic disease or disorder associated with non-alcoholic fatty liver disease (NAFLD), and / or a disease or disorder associated with obesity and / or lipogenesis, comprising: (a) obtaining a sample from said patient; (b) detecting the sequence and / or expression and / or function of SLC25A5 / ANT2 in said sample obtained from said patient; (c) predicting susceptibility to a metabolic disease or disorder, such as a metabolic disease or disorder associated with non-alcoholic fatty liver disease (NAFLD), and / or a disease or disorder associated with obesity and / or lipogenesis, based on the sequence and / or expression and / or function of SLC25A5 / ANT2 in said sample obtained from said patient; (d) preferably administering to said diagnosed patient an effective amount of an inhibitor of SLC25A5 / ANT2, preferably an inhibitor of SLC25A5 / ANT2 according to any one of claims 1 to 43, or a pharmaceutical composition comprising an inhibitor of SLC25A5 / ANT2, such as the composition according to claim 44. A method comprising:

Images