Compositions and methods for editing proprotein convertase subtilisin kexin 9 (PCSK9)
Guide RNAs and Cas9 nuclease compositions target the PCSK9 gene to induce breaks, addressing elevated LDL cholesterol issues and associated health risks by reducing PCSK9 expression.
Patent Information
- Application Number
- JP2025536115
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-12-21
- Filing Date
- 2023-12-20
- Publication Date
- 2026-02-24
AI Technical Summary
Excessive production of PCSK9 protein or mutations in the PCSK9 gene lead to elevated LDL cholesterol levels, contributing to cardiovascular diseases and chronic liver damage, for which current treatments are inadequate.
Compositions and methods utilizing guide RNAs and RNA-guided DNA-binding agents, such as Cas9 nuclease, to induce double-strand or single-strand breaks in the PCSK9 gene, reducing its expression in cells or subjects, potentially treating PCSK9-related diseases.
Effectively reduces PCSK9 gene expression, lowering LDL cholesterol levels and mitigating associated health risks, including cardiovascular diseases and liver damage.
Smart Images

Figure 2026506287000001_ABST
Abstract
Description
[Background technology]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to U.S. Provisional Application No. 63 / 434,394, filed December 21, 2022, the entire contents of which are incorporated herein by reference.
[0002] Electronic Sequence Listing Reference This application contains a Sequence Listing that has been submitted electronically in XML format and is incorporated herein by reference in its entirety. The XML copy, created on November 28, 2023, is named "01155-0061-00PCT.xml" and is 508,922 bytes in size. The Sequence Listing contained in this .XML file is a part of the present specification and is incorporated herein by reference in its entirety.
[0003] Proprotein convertase subtilisin kexin 9 (PCSK9) is a member of the subtilisin serine protease family and is expressed in liver, intestinal, and kidney tissues. It is a major regulator of circulating low-density lipoprotein (LDL) cholesterol levels and plays a role in cholesterol and fatty acid metabolism. PCSK9 has been shown to induce degradation of LDL receptors, particularly in the liver, thereby increasing circulating LDL cholesterol levels in the blood.
[0004] Excessive production of PCSK9 protein, or mutations in the PCSK9 gene, have been demonstrated to significantly affect total and LDL cholesterol in the general population and are associated with cardiovascular disease (e.g., autosomal dominant familial hypercholesterolemia) and chronic liver damage. Summary of the Invention
[0005] The present disclosure provides compositions and methods for modifying the PCSK9 gene. In some embodiments, the present disclosure provides guide RNAs, compositions thereof, and pharmaceutical compositions comprising the guide RNAs or compositions described herein. In some embodiments, the present disclosure also provides uses and methods of using guide RNAs, compositions thereof, or pharmaceutical compositions described herein for inducing double-strand breaks or single-strand breaks in the PCSK9 gene, reducing the expression of the PCSK9 gene in cells or subjects, and treating patients with or at risk of having a PCSK9-related disease or condition. In some embodiments, the present disclosure provides uses and methods of using guide RNAs, compositions thereof, or pharmaceutical compositions described herein for inducing double-strand breaks in the PCSK9 gene, reducing the expression of the PCSK9 gene in cells or subjects, and treating patients with or at risk of having a PCSK9-related disease or condition.
[0006] In some embodiments, the guide RNA comprises a guide region and a conserved region. In some embodiments, the guide RNA comprises a nucleotide sequence that targets the locus of the PCSK9 gene. In some embodiments, the guide RNA is a modified guide RNA.
[0007] In some aspects, the present disclosure provides a composition comprising a guide RNA as described herein. In some embodiments, the composition further comprises an RNA-guided DNA-binding agent, i.e., a polypeptide RNA-guided DNA-binding agent or a nucleic acid encoding the RNA-guided DNA-binding agent. In some embodiments, the nucleic acid encoding the RNA-guided DNA-binding agent comprises an mRNA comprising an open reading frame (ORF) encoding the RNA-guided DNA-binding agent. In some embodiments, the RNA-guided DNA-binding agent is a Cas9 nuclease. In some embodiments, the Cas9 is S. pyogenes ("Spy") Cas9. In some embodiments, the Cas9 is a SpyCas9 cleavase.
[0008] In some embodiments, the compositions described herein further comprise a pharmaceutical excipient. In some embodiments, the guide RNA included in the composition is associated with a lipid nanoparticle (LNP). In some embodiments, the LNP comprises a cationic lipid. In some embodiments, the LNP comprises a helper lipid. In some embodiments, the helper lipid is cholesterol. In some embodiments, the LNP comprises a neutral lipid. In some embodiments, the neutral lipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC). In some embodiments, the LNP comprises a stealth lipid. In some embodiments, the stealth lipid is 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (PEG2k-DMG).
[0009] In some aspects, the present disclosure provides pharmaceutical compositions. In some embodiments, the pharmaceutical compositions comprise a guide RNA described herein or a composition described herein. In some embodiments, the pharmaceutical compositions comprise a guide RNA described herein, e.g., a modified guide RNA, and a composition described herein comprising SpyCas9 cleavase.
[0010] In some embodiments, the present disclosure provides the use of the guide RNA described herein or the composition described herein for inducing double-stranded or single-stranded breaks in the PCSK9 gene in a cell.In some embodiments, the present disclosure provides the use of the guide RNA described herein or the composition described herein for inducing double-stranded or single-stranded breaks in the PCSK9 gene in a cell.In some embodiments, the cell is in a subject.In some embodiments, the present disclosure provides the use of the guide RNA described herein or the composition described herein for reducing the expression of the PCSK9 gene in a cell or a subject.In some embodiments, the present disclosure provides a pharmaceutical composition comprising the guide RNA described herein or the composition described herein for reducing the expression of the PCSK9 gene in a cell or a subject.In some embodiments, the cell is in a subject.
[0011] In some embodiments, the present disclosure provides the use of the guide RNA described herein or the composition described herein for inducing double-strand breaks in the PCSK9 gene in a cell.In some embodiments, the present disclosure provides the use of the guide RNA described herein or the pharmaceutical composition described herein for inducing double-strand breaks in the PCSK9 gene in a cell.In some embodiments, the cell is in a subject.In some embodiments, the present disclosure provides the use of the guide RNA described herein or the composition described herein for inducing double-strand breaks in the PCSK9 gene in a cell or for reducing the expression of the PCSK9 gene in a cell or a subject.In some embodiments, the present disclosure provides a pharmaceutical composition comprising the guide RNA described herein or the composition described herein for inducing double-strand breaks in the PCSK9 gene in a cell or for reducing the expression of the PCSK9 gene in a cell or a subject.In some embodiments, the cell is in a subject.
[0012] In some embodiments, the present disclosure provides the use of the guide RNA described herein or the composition described herein, for example, for inducing double-strand breaks in the PCSK9 gene in cells, for treating a subject with a disease or condition related to PCSK9.In some embodiments, the present disclosure provides a pharmaceutical composition comprising the guide RNA described herein or the composition described herein, for example, for inducing double-strand breaks in the PCSK9 gene in cells, for treating a subject with a disease or condition related to PCSK9.
[0013] In some embodiments, the present disclosure provides a method for inducing double-strand breaks or single-strand breaks in PCSK9 gene in cells or reducing the expression of PCSK9 protein in cells, comprising contacting cells with the guide RNA described herein or the composition described herein.In some embodiments, the present disclosure provides a method for inducing double-strand breaks in PCSK9 gene in cells or reducing the expression of PCSK9 protein in cells, comprising contacting cells with the guide RNA described herein or the composition described herein.In some embodiments, the cell is in a subject.In some embodiments, the level of PCSK9 protein is measured in a subject sample selected from blood or serum.
[0014] In some embodiments, the present disclosure provides for the use of a guide RNA described herein, or a composition described herein, in the preparation of a medicament for performing any of the methods described herein, e.g., for inducing a double-stranded break in the PCSK9 gene in a cell.
[0015] In some aspects, the present disclosure provides kits comprising the compositions described herein.
[0016] The following is a non-exhaustive list of embodiments provided herein.
[0017] Embodiment 1 is A. A targeting sequence comprising a sequence at least 95%, 90%, 85%, or 80% identical to or complementary to the nucleotide sequence of SEQ ID NO: 9, 1, 2, 7, 13-15, 17, 18, or 20; B. A targeting sequence comprising a sequence identical to or complementary to at least 17, 18, 19, or 20 consecutive nucleotides of the nucleotide sequence of SEQ ID NO: 9, 1, 2, 7, 13-15, 17, 18, or 20; or C. A guide RNA comprising a targeting sequence that comprises a targeting sequence identical to the nucleotide sequence of SEQ ID NO: 9, 1, 2, 7, 13-15, 17, 18, or 20.
[0018] Embodiment 2 is the guide of embodiment 1, comprising a sequence that is a targeting sequence identical to the nucleotide sequence of SEQ ID NO: 9, 14, or 18.
[0019] Embodiment 3 is the guide RNA of embodiment 1 or 2, further comprising one or more of the following: A. A shortened hairpin 1 region, or a substituted and optionally shortened hairpin 1 region, 1. At least one of the following nucleotide pairs, H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, or H1-4 and H1-9, is substituted with a Watson-Crick pair nucleotide in Hairpin 1, and the Hairpin 1 region optionally lacks: a.One or two of H1-5 to H1-8, b. one, two, or three of the following nucleotide pairs: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, and H1-4 and H1-9; or c. 1 to 8 nucleotides of the hairpin 1 region, or 2. The shortened hairpin 1 region is deleted by 4 to 8 nucleotides, preferably 4 to 6 nucleotides, and a. For an exemplary SpyCas9 sgRNA-1, one or more of positions H1-1, H1-2, or H1-3 are deleted or substituted; or b. For an exemplary SpyCas9 sgRNA-1, one or more of positions H1-6 through H1-10 are substituted; or 3. The shortened hairpin 1 region is missing 5-10 nucleotides, preferably 5-6 nucleotides, and is substituted at one or more of positions N18, H1-12, or n relative to the exemplary SpyCas9 sgRNA-1; or B. A shortened upper stem region, wherein the shortened upper stem region is missing 1 to 6 nucleotides, and 6, 7, 8, 9, 10, or 11 nucleotides of the shortened upper stem region relative to the exemplary SpyCas9 sgRNA-1 contain no more than four substitutions; or C. A substitution for an exemplary SpyCas9 sgRNA at any one or more of LS6, LS7, US3, US10, B3, N7, N15, N17, H2-2, and H2-14, wherein the substituted nucleotide is not a pyrimidine followed by an adenine or a pyrimidine followed by an adenine; or D. An exemplary SpyCas9 sgRNA-1 having an upper stem region, wherein the upper stem modification comprises a modification to any one or more of US1-US12 within the upper stem region.
[0020] Embodiment 4 is the guide RNA of embodiment 3, wherein the guide RNA lacks 6 nucleotides in shortened hairpin 1.
[0021] Embodiment 5 is the guide RNA of embodiment 3, wherein the guide RNA lacks 8 nucleotides in shortened hairpin 1.
[0022] Embodiment 6 is a guide RNA according to any one of embodiments 3 to 5, in which H-1 and H-3 are deleted.
[0023] Embodiment 7 is the guide RNA according to any one of embodiments 3 to 6, wherein the guide RNA further comprises a 3' tail.
[0024] Embodiment 8 is the guide RNA of embodiment 7, wherein the 3' tail is 1 to 4 nucleotides in length, optionally 1 nucleotide in length.
[0025] Embodiment 9 is the guide RNA of any one of Embodiments 3 to 8, wherein the guide RNA comprises an upper stem region comprising a modification to any one or more of US1 to US12 in the upper stem region.
[0026] Embodiment 10 is the guide RNA of embodiment 1 or 2, comprising a modified nucleotide sequence according to the pattern (mN*)3(N)13-17, where "m" indicates a 2'-O-methyl modification, * indicates a phosphorothioate linkage, and N indicates a 2'-OH and a phosphodiester linkage.
[0027] Embodiment 11 is the guide RNA of embodiment 1, wherein the guide RNA comprises a modified nucleotide sequence selected from the sequences of Table 4A (SEQ ID NOs: 501-512, optionally SEQ ID NO: 507 or 512), and the modified nucleotide sequence is 3' to the guide sequence.
[0028] Embodiment 12 is the guide RNA of embodiment 11, which is modified according to a nucleotide sequence pattern selected from the sequences of Table 4B (SEQ ID NOs: 601-612, optionally SEQ ID NO: 607 or 612), wherein (mN*)3N17 refers to the targeting sequence of embodiment 1 or 2.
[0029] Embodiment 13 is the guide RNA of any one of Embodiments 1 to 12, wherein the guide RNA comprises a nucleotide sequence selected from SEQ ID NOs: 121, 109, 101, 102, 107, 113-115, 117, 118, 120, 122, or 123 shown in Table 2, and optionally SEQ ID NOs: 109, 114, 118, 121, 122, or 123.
[0030] Embodiment 14 is the guide RNA of embodiment 13, wherein each nucleotide is any natural or unnatural nucleotide.
[0031] Embodiment 15 is the guide RNA of embodiment 14, wherein the guide RNA comprises a modified nucleotide sequence selected from SEQ ID NOs: 221, 209, 201, 202, 207, 213-215, 217, 218, 220, 222, or 223, optionally SEQ ID NOs: 209, 214, 218, 221, 222, or 223, as provided in Table 2.
[0032] Embodiment 16 is a composition comprising the guide RNA according to any one of embodiments 1 to 15.
[0033] Embodiment 17 is the composition of embodiment 16, further comprising an RNA-guided DNA binder or a nucleic acid encoding the RNA-guided DNA binder.
[0034] Embodiment 18 is the composition of embodiment 17, wherein the nucleic acid encoding the RNA-guided DNA binder comprises an mRNA comprising an open reading frame (ORF) encoding the RNA-guided DNA binder.
[0035] Embodiment 19 is the composition of embodiment 17 or 18, wherein the RNA-guided DNA binding agent is a Cas9 nuclease.
[0036] Embodiment 20 is the composition of embodiment 19, wherein the Cas9 is S. pyogenes Cas9.
[0037] Embodiment 21 is the composition of embodiment 20, wherein the S. pyogenes Cas9 comprises an ORF encoding an S. pyogenes Cas9 having an amino acid sequence at least 90% identical to SEQ ID NO: 1001, 1004, 1007, or 1010, or at least 90% identical to a sequence selected from SEQ ID NOs: 1003, 1006, and 1009.
[0038] Embodiment 22 is the composition of embodiment 21, wherein the ORF encoding the amino acid sequence has at least 95% identity to SEQ ID NO: 1003, 1006, or 1009.
[0039] Embodiment 23 is the composition of any one of embodiments 19 to 22, wherein the nuclease has double-stranded endonuclease activity.
[0040] Embodiment 24 is the composition of any one of embodiments 18 to 23, wherein the ORF is a modified ORF.
[0041] Embodiment 25 is the composition of embodiment 21, wherein the guide RNA comprises a targeting sequence identical to the nucleotide sequence of SEQ ID NO: 9, and the S. pyogenes Cas9 comprises an amino acid sequence having at least 95% identity to SEQ ID NO: 1001, wherein the S. pyogenes Cas9 nuclease has double-stranded endonuclease activity.
[0042] Embodiment 26 is the composition of embodiment 21, wherein the guide RNA comprises a targeting sequence comprising a sequence identical to the nucleotide sequence of SEQ ID NO: 9, and the S. pyogenes Cas9 comprises an amino acid sequence comprising the amino acid sequence of SEQ ID NO: 1001. Embodiment 27 is the composition of embodiment 21, wherein the guide RNA comprises a targeting sequence comprising a sequence identical to the nucleotide sequence of SEQ ID NO: 9, and an ORF encoding the S. pyogenes Cas9 having at least 90% identity to a sequence selected from SEQ ID NO: 1003, wherein the S. pyogenes Cas9 has double-stranded endonuclease activity.
[0043] Embodiment 28 is the composition of any one of embodiments 25 to 27, wherein the ORF is a modified ORF.
[0044] Embodiment 29 is the composition of any one of embodiments 25 to 28, wherein the guide RNA comprises the nucleotide sequence of SEQ ID NO: 121 or 109.
[0045] Embodiment 30 is the composition of any one of embodiments 25 to 28, wherein the guide RNA comprises a modified nucleotide sequence of SEQ ID NO: 221 or 209.
[0046] Embodiment 31 is a composition of any one of embodiments 16 to 30, further comprising a pharmaceutical excipient.
[0047] Embodiment 32 is the composition of any one of embodiments 16 to 31, wherein the guide RNA is associated with a lipid nanoparticle (LNP).
[0048] Embodiment 33 is the composition of embodiment 32, wherein the LNP comprises a cationic lipid.
[0049] Embodiment 34 is the composition of embodiment 33, wherein the cationic lipid is (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also known as 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl(9Z,12Z)-octadeca-9,12-dienoate.
[0050] Embodiment 35 is the composition of any one of embodiments 32-34, wherein the LNP comprises a helper lipid.
[0051] Embodiment 36 is the composition of embodiment 35, wherein the helper lipid is cholesterol.
[0052] Embodiment 37 is the composition of any one of embodiments 32-36, wherein the LNP comprises a neutral lipid.
[0053] Embodiment 38 is the composition of embodiment 37, wherein the neutral lipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC).
[0054] Embodiment 39 is the composition of any one of embodiments 32-38, wherein the LNP comprises a stealth lipid.
[0055] Embodiment 40 is the composition of embodiment 39, wherein the stealth lipid is 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (PEG2k-DMG).
[0056] Embodiment 41 is the composition of embodiment 32, wherein the LNP comprises (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also known as 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl(9Z,12Z)-octadeca-9,12-dienoate, DSPC, cholesterol, and PEG2k-DMG.
[0057] Embodiment 42 is a pharmaceutical composition comprising the guide RNA according to any one of embodiments 1 to 15 or the composition according to any one of embodiments 16 to 41.
[0058] Embodiment 43 is a pharmaceutical composition comprising a guide RNA according to any one of embodiments 1 to 15 or a composition according to any one of embodiments 16 to 41, or use thereof, for inducing a double-strand break or a single-strand break in the PCSK9 gene in a cell or for reducing expression of the PCSK9 gene in a cell.
[0059] Embodiment 44 is a pharmaceutical composition or use according to embodiment 43, wherein the cells are liver cells.
[0060] Embodiment 45 is a pharmaceutical composition or use according to embodiment 44, wherein the cells are in a subject.
[0061] Embodiment 46 is a pharmaceutical composition or use thereof, comprising the guide RNA of any one of embodiments 1 to 15 or the composition of any one of embodiments 16 to 41, for treating a subject having a PCSK9-related disease.
[0062] Embodiment 47 is a method for inducing a double-strand break or a single-strand break in the PCSK9 gene in a cell or reducing expression of a PCSK9 protein in a cell, comprising contacting a cell with a guide RNA according to any one of embodiments 1 to 15 and an RNA-guided DNA binding agent or a nucleic acid encoding the RNA-guided DNA binding agent, or a composition according to any one of embodiments 16 to 41.
[0063] Embodiment 48 is the use of a guide RNA according to any one of embodiments 1 to 15 or a composition according to any one of embodiments 16 to 41 in the preparation of a medicament for carrying out a method according to embodiment 47.
[0064] Embodiment 49 is a human liver cell comprising an indel within a nucleotide sequence selected from the genomic loci in Table 1.
[0065] Embodiment 50 is a human liver cell of embodiment 49, comprising an indel at a nucleotide sequence selected from a genomic locus selected from the genomic loci of SEQ ID NOs: 9, 1, 2, 7, 13-15, 17, 18 or 20.
[0066] Embodiment 51 is a method for modifying a genomic locus in a human liver cell, the method comprising contacting a human liver cell with a guide RNA according to any one of embodiments 1 to 15 and an RNA-guided DNA-binding agent, or a nucleic acid encoding the RNA-guided DNA-binding agent, or a composition according to any one of embodiments 16 to 41.
[0067] Embodiment 52 is the method of embodiment 51, wherein the method is performed in vivo.
[0068] Embodiment 53 is a pharmaceutical composition, method, or cell according to any one of embodiments 44, 45, 49 to 52, wherein the liver cells are hepatocytes.
[0069] Embodiment 54 is a pharmaceutical composition, method, or cell of embodiment 53, wherein the cell is in a subject with a PCSK9-related disease.
[0070] Embodiment 55 is a method for treating a PCSK9-related disease in a subject, the method comprising administering to the subject a guide RNA according to any one of embodiments 1 to 15 and an RNA-guided DNA binder or a nucleic acid encoding the RNA-guided DNA binder, or a composition according to any one of embodiments 16 to 41, or a pharmaceutical composition according to embodiment 42.
[0071] Embodiment 56 is a pharmaceutical composition, method, or cell according to any one of embodiments 42 to 55, further comprising determining the PCSK9 protein level in a blood or serum sample from the subject.
[0072] Embodiment 57 is the use of a guide RNA of any one of embodiments 1 to 15, a composition of any one of embodiments 16 to 41, or a pharmaceutical composition of embodiment 42 for the preparation of a medicament for carrying out a method of any one of embodiments 47 or 51 to 56.
[0073] Embodiment 58 is a kit comprising a guide RNA according to any one of embodiments 1 to 15, an RNA-guided DNA binder or a nucleic acid encoding the RNA-guided DNA binder, a composition according to any one of embodiments 16 to 41, or a pharmaceutical composition according to any one of embodiments 42 to 46.
[0074] Embodiment 59 is a kit for use in or carrying out the method according to any one of embodiments 47 or 51-56. [Brief explanation of the drawings]
[0075] [Figure 1] 1 shows dose-response curves of mean percent editing at the PCSK9 locus in primary human hepatocytes (PHH) treated with various sgRNAs and Cas9 mRNA. [Figure 2] 1 shows the dose-response curves of secreted PCSK9 serum levels in PHH treated with Cas9 mRNA and various sgRNAs targeting the PCSK9 locus. [Figure 3A] Shown is the average percent editing at the inserted human PCSK9 locus in mouse liver after treatment with Cas9 mRNA and the indicated sgRNA. [Figure 3B] Shown is the percent knockdown (KD) of human PCSK9 serum levels in mice treated with Cas9 mRNA and the indicated sgRNA. [Figure 4A] Shown is the average percent editing at the inserted human PCSK9 locus in mouse liver after treatment with Cas9 mRNA and the indicated sgRNA. [Figure 4B] 1 shows human PCSK9 serum levels in mice treated with Cas9 mRNA and the indicated sgRNA. [Figure 4C] Shown is the percent knockdown (KD) of human PCSK9 serum levels in mice treated with Cas9 mRNA and the indicated sgRNA. [Figure 5A]FIG. 1 shows a dose-response curve of the mean percent editing at the PCSK9 locus in primary cynomolgus monkey hepatocytes (PCH) treated with Cas9 mRNA and the indicated sgRNA. [Figure 5B] FIG. 1 shows a dose-response curve of the mean percent editing at the PCSK9 locus in primary cynomolgus monkey hepatocytes (PCH) treated with Cas9 mRNA and the indicated sgRNA. [Figure 6A] Shown is a dose-response curve of the mean percent editing at the PCSK9 locus in PHHs treated with Cas9 mRNA and the indicated sgRNA. [Figure 6B] FIG. 1 shows a dose-response curve of the mean percent editing at the PCSK9 locus in primary cynomolgus monkey hepatocytes (PCH) treated with Cas9 mRNA and the indicated sgRNA. [Figure 6C] FIG. 1 shows a dose-response curve of the mean percent editing at the PCSK9 locus in primary cynomolgus monkey hepatocytes (PCH) treated with Cas9 mRNA and the indicated sgRNA. [Figure 7A] Shown are the mean percent editing DRCs at the PCSK9 locus in PHH treated with Cas9 mRNA and the indicated sgRNAs. [Figure 7B] Shown are the mean percent editing DRCs at the PCSK9 locus in PHH treated with Cas9 mRNA and the indicated sgRNAs. [Figure 7C] Shown are the mean percent editing DRCs at the PCSK9 locus in PHH treated with Cas9 mRNA and the indicated sgRNAs. [Figure 8A] FIG. 1 shows the average editing rate at the inserted human PCSK9 locus in mouse liver after treatment with Cas9 mRNA and the indicated sgRNAs. [Figure 8B] 1 shows human PCSK9 serum levels in mice treated with Cas9 mRNA and the indicated sgRNA. [Figure 8C] Shown is the percent knockdown (KD) of human PCSK9 serum levels in mice treated with Cas9 mRNA and the indicated sgRNA. DETAILED DESCRIPTION OF THE INVENTION
[0076] BRIEF DESCRIPTION OF THE DISCLOSED SEQUENCES [Table 1]
[0077] Reference will now be made in detail to certain embodiments of the present disclosure, examples of which are illustrated in the accompanying drawings. While the present teachings will be described in conjunction with various embodiments, it is not intended that the present teachings be limited to those embodiments. On the contrary, the present teachings encompass various alternatives, modifications, and equivalents, as will be apparent to those skilled in the art.
[0078] Before describing the teachings of the present invention in detail, it is to be understood that the present disclosure is not limited to particular compositions or process steps, as such may vary. It should be noted that, as used in this specification and claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, a reference to "a complex" includes plural complexes, a reference to "a cell" includes plural cells (e.g., a population of cells), etc.
[0079] Numerical ranges are inclusive of the numbers defining the range. Measurements and measurable values are understood to be approximations taking into account the number of significant digits and errors associated with the measurements.
[0080] The use of "comprise," "comprises," "comprising," "contain," "contains," "containing," "include," "includes," and "including" is not intended to be limiting. It is to be understood that both the foregoing general description and detailed description are exemplary and explanatory only and are not intended to limit the present teachings. Unless otherwise stated herein, embodiments described herein as "comprising" various components are also intended to "consist" or "consist essentially of" the described components, and embodiments described herein as "consisting" of various components are also intended to "include" or "consist essentially of" the described components. Also, embodiments described herein as "consisting essentially of" various components are also intended to "consist" of or "include" the described components (this interchangeability does not apply to the use of these terms in the claims).
[0081] The term "or" is used herein in its inclusive sense, ie, equivalent to "and / or," unless the context clearly dictates otherwise.
[0082] The term "about," when used before a list, modifies every member of the list. The term "about" is understood to encompass variations or errors accepted within the art, such as two standard deviations from the mean, or the sensitivity of the method used to make the measurement. When "about" is present before the first value in a series, it is understood to modify every value in the series.
[0083] Ranges are understood to include the endpoints of the range and all logical values therebetween, e.g., 5-10 nucleotides is understood to mean 5, 6, 7, 8, 9, or 10 nucleotides, and 5-10% is understood to include all possible values from 5% to 10%.
[0084] At least 17 nucleotides of a 20 nucleotide sequence is understood to include 17, 18, 19, or 20 nucleotides of the provided sequence, thereby providing an upper limit unless otherwise expressly stated, as is clearly understood. Similarly, up to 3 nucleotides is understood to encompass 0, 1, 2, or 3 nucleotides, thereby providing a lower limit unless otherwise specified. When modifying a numerical value with "at least," "up to," or other similar language, it is understood to modify each numerical value in the series.
[0085] As used herein, "less than" or "less than" is understood to refer to the expression and the logical lower zero or neighboring integer value that is logical from the context. For example, a duplex region of "2 nucleotide base pairs or less" has 2, 1, or 0 nucleotide base pairs. When "less than" or "less than" precedes a series of numbers or ranges, it is understood that each of the series or ranges is modified.
[0086] As used herein, ranges include both upper and lower limits.
[0087] In the event of a conflict between a sequence in the application and a designated accession number or location within an accession number, the sequence in the application will control.
[0088] As used herein, "detecting an analyte" and the like is understood as performing an assay that can detect the analyte, if present, where the analyte is present in an amount above the detection level of the assay.
[0089] As used herein, when the maximum amount of a value is represented by 100% (for example, 100% inhibition or 100% encapsulation), it is understood that the value is limited by the detection method.For example, 100% inhibition is understood to be inhibition to a level below the detection level of the assay, and 100% encapsulation is understood to be that the substance intended to be encapsulated cannot be detected outside the vesicle.
[0090] The section headings used herein are for organizational purposes only and should not be construed as limiting the desired subject matter in any way. In the event that any material incorporated by reference conflicts with any term defined herein or any other express content of this specification, the present specification shall control.
[0091] I. Definition Unless otherwise stated, the following terms and phrases used herein are intended to have the following meanings:
[0092] "Polynucleotide" and "nucleic acid" are used herein to refer to polymeric compounds containing nucleosides or nucleoside analogs with nitrogen-containing heterocyclic bases or base analogs linked together along the backbone, and "polynucleotide" and "nucleic acid" include polymers of traditional RNA, DNA, mixed RNA-DNA, and analogs thereof. The nucleic acid "backbone" can be composed of various linkages, including one or more of sugar-phosphodiester linkages, peptide-nucleic acid linkages ("peptide nucleic acid" or PNA, PCT Publication No. WO 95 / 32305), phosphorothioate linkages, methylphosphonate linkages, or combinations thereof. The sugar moiety of the nucleic acid can be ribose, deoxyribose, or similar compounds with substitutions (e.g., 2'-methoxy, 2'-halide, or 2'-O-(2-methoxyethyl) (2'-O-moe) substitutions). RNA can contain, for example, one or more deoxyribose nucleotides as modifications, and similarly, DNA can contain one or more ribonucleotides. Nitrogenous bases include conventional bases (A, G, C, T, U), their analogs (e.g., modified uridines, e.g., 5-methoxyuridine, pseudouridine, or N1-methylpseudouridine, etc.), derivatives of inosine, purines, or pyrimidines (e.g., N 4 -methyldeoxyguanosine, deaza- or aza-purines, deaza- or aza-pyrimidines, pyrimidine bases with substituents at the 5- or 6-position (e.g., 5-methylcytosine), purine bases with substituents at the 2-, 6-, or 8-position, 2-amino-6-methylaminopurine, O 6-methylguanine, 4-thio-pyrimidine, 4-amino-pyrimidine, 4-dimethylhydrazine-pyrimidine, and O 4 5,378,825 and PCT Publication WO 93 / 13121). For a general discussion, see The Biochemistry of the Nucleic Acids, vol. 5-36, Adams et al., ed., 11 th ed., 1992). Nucleic acids can contain one or more "abasic" residues when the backbone does not contain a nitrogenous base at one or more positions in the polymer (U.S. Patent No. 5,585,481). Nucleic acids can contain only conventional RNA or DNA sugars, bases, and linkages, or they can contain both conventional components and substitutions (e.g., conventional nucleosides with 2' methoxy substituents, or polymers containing both conventional nucleosides and one or more nucleoside analogs). Nucleic acids include "locked nucleic acids" (LNAs), which are analogs containing one or more LNA nucleotide monomers with a bicyclic furanose unit locked in an RNA-mimetic sugar conformation, enhancing hybridization affinity to complementary RNA and DNA sequences (Vester and Wengel, 2004, Biochemistry 43(42):13233-41). Nucleic acids include "unlocked nucleic acids," which allow for tuning of thermodynamic stability and also provide nuclease stability. RNA and DNA can differ by having different sugar moieties and by the presence of uridine or its analogs in RNA and thymine or its analogs in DNA.
[0093] As used herein, "polypeptide" refers to a multimeric compound comprising amino acid residues capable of adopting a three-dimensional conformation. Polypeptides include, but are not limited to, enzymes, proenzyme proteins, regulatory proteins, structural proteins, receptors, nucleic acid binding proteins, antibodies, and the like. Polypeptides can, but need not, include post-translational modifications, unnatural amino acids, prosthetic groups, and the like.
[0094] "Guide RNA," "gRNA," and simply "guide" are used interchangeably herein and refer to, for example, either a single guide RNA or a combination of crRNA and trRNA (also known as tracrRNA). The crRNA and trRNA can associate as a single RNA strand (as a single guide RNA, sgRNA) or, for example, as two separate RNA strands (dual guide RNA, dgRNA). "Guide RNA" or "gRNA" refers to either sgRNA or dgRNA. The trRNA may be a naturally occurring sequence or may contain modifications or mutations. Such modifications or mutations may be chemically induced.
[0095] As used herein, a "guide sequence" refers to a sequence within a guide RNA that is complementary to a target sequence and functions to direct the guide RNA to the target sequence for binding or modification (e.g., cleavage) by an RNA-guided DNA-binding agent. A "guide sequence" may also be referred to as a "targeting sequence" or a "spacer sequence." A guide sequence may be approximately 20 nucleotides in length, for example, when used in combination with an RNA-guided DNA-binding agent such as Streptococcus pyogenes (i.e., "Spy") Cas9. Preferred guide sequence lengths for related Cas9 homologs / orthologs, including shorter or longer sequences, may also be used and are known in the art.
[0096] For example, a Spy Cas9 guide can be 16, 17, preferably 18, 19, or 20 nucleotides in length, such that in some embodiments, the Spy Cas9 guide sequence comprises 16, 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-20, optionally SEQ ID NOs: 1, 2, 7, 9, 13-15, 17, 18, or 20, and optionally SEQ ID NOs: 9, 14, or 18. In some embodiments, a target sequence, e.g., within a gene or on a chromosome, is complementary to the guide sequence. In some embodiments, the degree of complementarity or identity between a guide sequence and its corresponding target sequence is at least 80%, 85%, preferably 90%, or 95%, or 100%. For example, in some embodiments, the guide sequence comprises at least 16, 17, preferably 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1, 2, 7, 9, 13-15, 17, 18, or 20, optionally SEQ ID NOs: 9, 14, or 18. In some embodiments, the guide sequence and target region may be 100% complementary or identical. In other embodiments, the guide sequence and target region may contain at least one mismatch, i.e., one nucleotide that is not identical or complementary, relative to the reference sequence. For example, the guide sequence and target sequence may contain one, two, three, or four mismatches within the duplex formed by the guide sequence and the target sequence, and the total length of the target sequence is 16, 17, 18, 19, 20, or more nucleotides. In some embodiments, the guide sequence and target region may contain one, two, three, or four mismatches, in which case the guide sequence comprises at least 20 nucleotides. In some embodiments, the guide sequence and target region may contain 1, 2, 3, or 4 mismatches, in which case the guide sequence comprises 20 nucleotides. That is, the guide sequence and target region may form a double-stranded region having 16, 17, 18, 19, 20 base pairs, or more. In certain embodiments, the double-stranded region may contain 1, 2, 3, or 4 mismatches such that the guide strand and target sequence are not perfectly complementary.For example, the guide strand and target sequence may be complementary over a 20-nucleotide region containing two mismatches, resulting in a 90% complementary guide and target sequence duplex region of 18 base pairs out of 20 base pairs. The locations of tolerated mismatches are known in the art. For example, protospacer adjacent motif (PAM)-distal mismatches tend to be better tolerated than PAM-proximal matches, and mismatch tolerance at other positions has been characterized (see, e.g., Sternberg et al., 2015, Nature:527:110-113).
[0097] The target sequence for the RNA-guided DNA-binding agent, as defined by the targeting sequence of the guide RNA, can be present in either the plus or minus strand. The tables and other disclosures provided herein may list genomic coordinates as the target sequence. It is understood that the guide can be complementary to either the plus or minus strand of DNA, as defined by the genomic coordinates. The sequence to which the guide is complementary depends on the presence of a PAM appropriate for the RNA-guided DNA-binding agent on the opposite strand. Thus, in some embodiments, when the guide sequence binds to the reverse complement of the target sequence, i.e., when the guide sequence is identical to a specific nucleotide in the sense (plus) strand of the target sequence, and when the PAM is present in the sense strand, except for the substitution of T for U in the guide sequence, the PAM is present in the sense strand.
[0098] As used herein, "RNA-guided DNA binder" or "RNA-guided DNA-binding protein" refers to a polypeptide or polypeptide complex, or a DNA-binding subunit of such a complex, that has RNA-binding and DNA-binding activity, and whose DNA-binding activity is sequence-specific and dependent on the presence of a PAM and the sequence of the guide RNA. Exemplary RNA-guided DNA binders include Cas cleavases / Cas nickases and their inactivated forms (e.g., "dCas DNA binders"). As used herein, "Cas nuclease" encompasses Cas cleavases, Cas nickases, and dCas DNA binders. Cas nickases include nucleases in which one of the RuvC or HNH domains of the Cas protein is mutated to cleave only one strand. dCas DNA binders can be inactive nucleases that contain a non-functional nuclease domain (i.e., a RuvC or HNH domain). In some embodiments, the Cas cleavase or Cas nickase comprises a dCas DNA binder modified to enable DNA cleavage, for example, via fusion with a FokI domain.
[0099] Exemplary nucleotide and polypeptide sequences of Cas9 molecules are provided below. Methods for identifying alternative nucleotide sequences encoding Cas9 polypeptide sequences (including alternative naturally occurring variants) are known in the art. Also contemplated are sequences with at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to any of the Cas9 nucleic acid sequences or nucleic acid sequences encoding the amino acid sequences provided herein. In some embodiments, the nucleotide sequence encoding the Cas9 amino acid sequence is not a naturally occurring Cas9 nucleotide sequence. Also contemplated are sequences with at least 95%, 96%, 97%, 98%, or 99% identity to any of the Cas9 amino acid sequences provided herein. In some embodiments, the Cas9 amino acid sequence is not a naturally occurring Cas9 sequence.
[0100] Exemplary open reading frames for Cas9 are shown in Table 23 below.
[0101] The term "linker," as used herein, refers to a chemical group or molecule that connects two adjacent molecules or moieties. Typically, a linker is located between or sandwiched between two groups, molecules, or other moieties and is linked to each other by a covalent bond. In some embodiments, the linker is an amino acid or multiple amino acids (e.g., a peptide or protein). Exemplary peptide linkers are disclosed elsewhere herein.
[0102] As used herein, "modified uridine" refers to a nucleoside other than thymidine that has the same hydrogen bond acceptor as uridine and one or more structural differences from uridine. In some embodiments, the modified uridine is a substituted uridine, i.e., a uridine in which one or more aprotic substituents (e.g., alkoxy, such as methoxy) replace a proton. In some embodiments, the modified uridine is a pseudouridine. In some embodiments, the modified uridine is a substituted pseudouridine, i.e., a pseudouridine in which one or more aprotic substituents (e.g., alkyl, such as methyl) replace a proton. In some embodiments, the modified uridine is either a substituted uridine, pseudouridine, or a substituted pseudouridine, e.g., N1-methyl-pseudouridine.
[0103] As used herein, a "uridine position" refers to a position in a polynucleotide that is occupied by a uridine or modified uridine. Thus, for example, a polynucleotide in which "100% of the uridine positions are modified uridines" contains modified uridines at all positions that would be uridines in conventional RNA of the same sequence (all bases are standard A, U, C, or G bases). Unless otherwise specified, U in the polynucleotide sequences in this disclosure or the accompanying sequence listing or sequence listings can be uridine or modified uridine.
[0104] As used herein, "ribonucleoprotein" (RNP) or "RNP complex" refers to a guide RNA together with an RNA-guided DNA-binding agent, such as a Cas nuclease, e.g., a Cas cleavase, a Cas nickase, or a dCas DNA-binding agent (e.g., Cas9). In some embodiments, the guide RNA guides the RNA-guided DNA-binding agent, such as Cas9, to a target sequence; the guide RNA hybridizes to the target sequence; the binding agent binds to the target sequence; and, if the binding agent is a cleavase or nickase, binding may be followed by cleavage or nicking.
[0105] As used herein, " control " is understood to be the appropriate corresponding sample or object for comparison.For example, control can be the cell population that is treated in the same way as test population, except that the treatment used for control population lacks at least one active agent, such as guide RNA, mRNA encoding nuclease, insertion construct or lipid formulation.In some embodiments, control can be an internal control, for example, the cell population or object before treatment.
[0106] In some embodiments, the "control" in a control subject is a comparison subject for a measurement, e.g., a diagnostic measurement of a sign or symptom of a disease. In some embodiments, the control can be a subject sample from the same subject at an earlier time point, e.g., before treatment intervention. In some embodiments, the control can be a measurement from a normal subject, i.e., a subject not having the disease of the subject being treated, providing a normal control, e.g., enzyme concentration or activity in the subject sample. In some embodiments, the normal control can be a population control, i.e., the average of subjects in the general population. In some embodiments, the control can be an untreated subject with the same disease. In some embodiments, the control can be a subject treated with a different treatment, e.g., standard treatment. In some embodiments, the control can be a subject or population of subjects from a natural history study of subjects with the disease being compared. In some embodiments, the control is matched to the subject being tested for certain factors, e.g., age, sex. In some embodiments, the control can be a control level for a particular test, e.g., a clinical test. The ability to design or select an appropriate control is within the capabilities of one of ordinary skill in the art. It is understood that when relative values are provided, they can be considered relative values compared to an appropriate control.
[0107] As used herein, "purified," such as in "purified composition," "purified protein," or "purified nucleic acid," refers to a composition (or the like, e.g., protein or nucleic acid) from which at least some non-compositional (or the like) components have been removed by human intervention from the initial composition or mixture from which it was created, e.g., a cell, a subject sample, or a reaction mixture. In certain embodiments, when the term "purified" is used, the composition (or the like, e.g., protein or nucleic acid) is predominantly free, e.g., at least 80%, 85%, 90%, or 95% free from other components.
[0108] As used herein, a "subject" includes primates, including humans and non-human primates, mice, and rats. In some embodiments, the subject is a human subject. In some embodiments, the subject is a non-human subject. In some embodiments, the subject is a non-human subject expressing one or more human genes, such as a transgenic mouse expressing human genes, or a mouse whose liver has been repopulated with human hepatocytes. Such models are well known in the art.
[0109] As used herein, "target sequence" refers to a nucleic acid sequence of a target gene in either the plus or minus strand that is complementary to the guide sequence of a gRNA, i.e., sufficiently complementary to the guide sequence to allow specific binding of the guide sequence. The interaction between the target sequence and the guide sequence induces an RNA-guided DNA binding agent to bind to the target sequence and potentially nick or cleave the target sequence (depending on the activity of the binding agent). The specific length of the target sequence and the number of possible mismatches between the target sequence and the guide sequence depend, for example, on the identity of the Cas nuclease induced by the gRNA.
[0110] As used herein, a first sequence is considered to be "identical" or "100% identical" to a second sequence if alignment of the first and second sequences shows that all positions of the second sequence are identical to the first sequence as a whole. For example, the sequence AAG has 100% identity to the sequence AAGA because the alignment results in 100% identity in that all three positions of the first sequence match without gaps. Identities less than 100% can be calculated using standard methods. For example, ACG has 67% identity to AAGA (2 / 3=67%) because two of the three positions of the first sequence match the second sequence. Differences between RNA and DNA (generally, uridine to thymidine exchange or vice versa) and the presence of nucleoside analogs such as modified uridines do not contribute to differences in identity or complementarity between polynucleotides, as long as the related nucleotide (e.g., thymidine, uridine, or modified uridine) has the same complement (e.g., adenosine for all thymidine, uridine, or modified uridine; another example is cytosine and 5-methylcytosine, both of which have guanosine or modified guanosine as their complement). Thus, for example, in the sequence 5'-AXG, if X is any modified uridine, such as pseudouridine, N1-methylpseudouridine, or 5-methoxyuridine, it is considered 100% identical to AUG, since all are perfectly complementary to the same sequence (5'-CAU). Exemplary alignment algorithms are the Smith-Waterman and Needleman-Wunsch algorithms, which are well known in the art. Those skilled in the art will understand what selection of algorithm and parameter settings is appropriate for a given pair of sequences to be aligned. For sequences that are generally similar in length and predicted to have greater than 50% amino acid identity or greater than 75% nucleotide identity, the Needleman-Wunsch algorithm (provided by the EBI on its web server at www.ebi.ac.uk) with the Needleman-Wunsch algorithm interface at default settings is generally appropriate.
[0111] Similarly, as used herein, a first sequence is considered "fully complementary" or "100% complementary" to a second sequence if all nucleotides of the first sequence are complementary to the second sequence without gaps. For example, the sequence UCU is considered to be fully complementary to the sequence AAGA because each nucleobase of the first sequence base pairs with a nucleotide of the second sequence without gaps. The sequence UGU is considered to be 67% complementary to the sequence AAGA because two of the three nucleobases of the first sequence base pair with a nucleobase of the second sequence. Those skilled in the art will understand that algorithms are available with various parameter settings to determine the percent complementarity of any pair of sequences, for example, using the NCBI BLAST interface (blast.ncbi.nlm.nih.gov / Blast.cgi) or the Needleman-Wunsch algorithm.
[0112] "Messenger RNA" or "mRNA" is used herein to refer to a polynucleotide containing an open reading frame that can be translated into a polypeptide (i.e., can serve as a substrate for translation by ribosomes and aminoacylated tRNAs). mRNA may contain one or more chemically modified nucleosides, such as 5-methyl-cytidine (5mC), 2-thio-uridine (2sU), N1-methylpseudouridine (m1ψU) and pseudouridine (ψU), or modified cap structures as provided below.
[0113] Exemplary guide sequences useful in the guide RNA compositions and methods described herein are provided in Table 1 and throughout the application. For example, Table 1 provides guide sequences that can be used within a guide RNA to guide an RNA-guided DNA-binding agent, e.g., a nuclease, such as a Cas nuclease, such as Cas9, to a target sequence. Target sequences are provided in Table 1 as genomic coordinates and include both the plus and minus strands of genomic DNA (i.e., the specified sequence and its reverse complement). In some embodiments, when a guide sequence binds to the reverse complement of a target sequence, the guide sequence is identical to a particular nucleotide of the target sequence, except for a T to U substitution in the guide sequence.
[0114] As used herein, "indel" refers to an insertion / deletion mutation consisting of multiple nucleotides that is either inserted or deleted at the site of a double-strand break (DSB) in a target nucleic acid. As used herein, in the case of indel formation resulting in an insertion, the insertion is a random insertion at the site of the double-strand break and is not guided or based on a template sequence.
[0115] As used herein, "inhibiting expression" refers to a reduction (e.g., knockdown or knockout) of the expression of a particular gene product (e.g., protein, mRNA, or both). Protein (i.e., gene product) expression can be measured by detecting the total cellular amount of protein from a tissue of interest, e.g., a biopsy, or a cell population, by detecting the expression of the protein in individual members of a cell population, e.g., by determining the percentage of cells expressing the protein by cell sorting, or by detecting the expression of the protein in aggregated cells, e.g., by ELISA or Western blotting. Inhibition of expression can result from genetic modification of a gene sequence, e.g., a genomic sequence, such that the full-length gene product or any gene product is no longer detectable, e.g., gene knockdown. Certain genetic modifications can introduce frameshift or nonsense mutations that prevent translation of the full-length gene product. Genetic modifications close enough to a splice site, e.g., a splice acceptor site or splice donor site to disrupt splicing, can prevent translation of the full-length protein. Inhibition of expression can occur through genetic modifications in regulatory sequences within genomic sequences required for expression of a gene product, such as promoter sequences, 3'UTR sequences (e.g., cap sequences), and 5'UTR sequences (e.g., polyA sequences). Inhibition of expression can also occur through disruption of the expression or activity of regulatory factors required for translation of a gene product, e.g., the production of non-gene products. For example, genetic modifications of a transcription factor sequence that inhibit the expression of a full-length transcription factor can have downstream effects and inhibit the expression of one or more gene products controlled by the transcription factor. Inhibition of expression can be predicted by changes in the genomic or mRNA sequence. Mutations predicted to result in inhibition of expression can be detected by known methods, including next-generation sequencing of DNA isolated from a tissue sample or cell population of interest. Inhibition of expression can be determined as a reduction in the percentage of cells in a population having a predetermined level of protein expression, i.e., the percentage or number of cells in a population that express a protein of interest at at least a particular level.Inhibition of expression can also be assessed by measuring a decrease in overall protein levels, for example, in a cell or tissue sample, such as a biopsy sample. In certain embodiments, inhibition of expression of a secreted protein can be assessed in a liquid sample, such as cell culture medium or a bodily fluid. Proteins may be present in bodily fluids, such as blood or urine, to allow for analysis of protein levels. In certain embodiments, protein levels may be determined by the level of protein activity or metabolites, for example, in urine or blood. In some embodiments, "inhibition of expression" may refer to some loss of expression of a particular gene product, e.g., a decrease in the amount of mRNA or protein expressed in a tissue sample or by a cell population. In some embodiments, "inhibition" may refer to some loss of expression of a particular gene product, e.g., a gene product secreted at the cell surface or into a bodily fluid, such as blood. In some embodiments, "inhibition" refers to some loss of expression in one or more cell or tissue types, but not all cell or tissue types (e.g., inhibition of expression in the liver but not in other organs). It is understood that the level of inhibition of expression is relative to a starting level, reference level, or control level in a subject sample of the same type. For example, routine monitoring of protein level can be carried out in liquid samples from subjects, such as blood or urine, or tissue samples, such as biopsy samples.In some embodiments, a correlation is known or established, for example, the level of biomarker in blood or urine correlates with the level of inhibition of target gene expression.It is understood that the level of inhibition of expression is relative to the sample being assayed.Similarly, in animal studies where serial tissue samples, such as liver tissue, are obtained, the target may be expressed in other tissues.Therefore, the level of inhibition of expression is not necessarily the level of inhibition of systemic expression, but the level in the tissue, cell type, or body fluid being sampled.
[0116] As used herein, a "genetic modification" refers to a change at the DNA level, e.g., induced by a CRISPR / Cas9 gRNA and Cas9 system. A genetic modification typically includes an insertion, deletion, or substitution (i.e., base sequence substitution, i.e., mutation) within a defined sequence or genomic locus. A genetic modification alters the nucleic acid sequence of DNA. A genetic modification may occur at a single nucleotide position. A genetic modification may occur at multiple nucleotides, e.g., 2, 3, 4, 5, or more nucleotides, typically close to each other, e.g., adjacent nucleotides. A genetic modification may occur within a coding sequence, e.g., an exon sequence. A genetic modification may occur at a splice site, i.e., sufficiently close to a splice acceptor or splice donor site to disrupt splicing. A genetic modification may include the insertion of a nucleotide sequence that is not endogenous to the genomic locus, e.g., the insertion of a heterologous open reading frame or coding sequence of a gene. As used herein, genetic modification may be used to prevent translation of a full-length protein having the amino acid sequence of an endogenous full-length protein prior to genetic modification of a genomic locus. Prevention of translation of a full-length protein or gene product includes prevention of translation of a protein or gene product of any length. Endogenous full-length protein translation can be prevented, for example, by a frameshift mutation resulting in the creation of a premature stop codon or by the creation of a nonsense mutation. Endogenous full-length protein translation can be prevented by disrupting splicing. Full-length protein translation can be prevented by inserting a heterologous coding sequence. Endogenous full-length protein translation can be prevented, for example, by correcting a point mutation, by altering the coding sequence of the endogenous full-length protein by changing one or more positions to provide a modified full-length coding sequence that differs from the endogenous sequence present in the cell, for example, if the endogenous full-length protein contains an undesirable mutation. Endogenous full-length protein translation can be prevented by altering the splicing of the endogenous full-length protein to generate a different protein through alternative splicing.
[0117] As used herein, "treatment" is understood as reducing at least one sign or symptom of a disease or condition. Reduction may include to such an extent that the signs or symptoms of the disease are no longer detectable in frequency or severity. Treatment may include administration of multiple doses of an agent. Treatment may include administration with other agents. Effective treatment does not require a cure or complete elimination of the disease or condition. The rate of disease progression or onset can be compared to the disease progression or onset in appropriately matched controls, e.g., population controls, controls from natural history studies. As used herein, "delivery" and "administration" may be used interchangeably.
[0118] Co-administration, as used herein, means that two or more agents are administered sufficiently close in time that the agents act together. Co-administration includes administering the agents together in a single formulation, as well as administering the agents in separate formulations sufficiently close in time that the agents act together.
[0119] As used herein, the phrase "pharmaceutically acceptable" means useful in preparing pharmaceutical compositions that are generally non-toxic, not biologically undesirable, and not otherwise unacceptable for pharmaceutical use. Pharmaceutically acceptable generally refers to a non-pyrogenic substance. Pharmaceutically acceptable can refer to a substance that is sterile, particularly for pharmaceutical substances for injection or infusion.
[0120] As used herein, "PCSK9" refers to the nucleic acid or protein sequence of "proprotein convertase subtilisin kexin 9" or "proprotein convertase subtilisin kexin type 9." The human wild-type PCSK9 sequence is available on the World Wide Web at NCBI Gene ID: 255738 (ncbi.nlm.nih.gov / gene?cmd=retrieve&dopt=default&rn=1&list_uids=255738, in the version available at the time of filing this application); Ensembl: ENSG00000169174 MIM: 607786, chr1:55039548-chr1:55064852. Synonyms for PCSK9 include NARC1, FH3, HCHOLA3, PC9, FHCL3, and LDLCQ1. The PCSK9 gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors transported through the regulatory or constitutive branches of the secretory pathway. The encoded protein undergoes autocatalytic processing with its prosegment in the ER and is constitutively secreted as an inactive protease into the extracellular matrix and the trans-Golgi network. It is expressed in liver, intestinal, and kidney tissues and has a specific receptor for lysosomal degradation. PCSK9 protease is involved in regulating circulating LDL cholesterol levels and plays a role in cholesterol and fatty acid metabolism. Certain mutations or overproduction of PCSK9 are associated with cardiovascular disease and chronic liver injury. Single nucleotide polymorphisms and other variations in the human PCSK9 sequence can be found, for example, at www.ncbi.nlm.nih.gov / SNP / snp_ref.cgi?locusId=255738.
[0121] As used herein, the term "within genomic coordinates" includes the boundaries of that given genomic coordinate range. For example, given chr1:55039548 to chr1:55064852, coordinates chr1:55039548 and chr1:55064852 are encompassed. Throughout this application, references to genomic coordinates are based on the genome annotation in the Genome Reference Consortium's GRCh38 (also known as hg38) assembly of the human genome, which is available on the website of the National Center for Biotechnology Information. Tools and methods for converting genomic coordinates between one assembly and another are known in the art and can be used to convert the genomic coordinates shown herein to corresponding coordinates in another assembly of the human genome, including conversions to previous assemblies produced by the same organization or using the same algorithm (e.g., converting from GRCh38 to GRCh37), and conversions between assemblies produced by different organizations or algorithms (e.g., converting from GRCh38 to NCBI33, produced by the International Human Genome Sequencing Consortium). Available methods and tools known in the art include, but are not limited to, the NCBI Genome Remapping Service (available on the National Center for Biotechnology Information website), UCSC LiftOver (available on the UCSC Genome Brower website), and Assembly Converter (available on the Ensembl.org website).
[0122] II. Composition Compositions containing guide RNA (gRNA)
[0123] For example, compositions useful for modifying DNA sequences, such as inducing single-strand (SSB) or double-strand breaks (DSB) within the PCSK9 gene, using guide RNAs with RNA-guided DNA binding agents (e.g., CRISPR / Cas systems) are provided herein. Guide sequences targeting the PCSK9 gene are set forth in SEQ ID NOS: 1-20 in Table 1, as are the genomic coordinates targeted by such guide RNAs.
[0124] Each of the guide sequences set forth in SEQ ID NOS: 1-20 in Table 1 can further include additional nucleotides to form a crRNA, for example, having the following exemplary nucleotide sequence following the guide sequence at its 3' end: GUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO: 301) in the 5' to 3' direction.
[0125] In the case of an sgRNA, the guide sequence described above may further include additional nucleotides to form an sgRNA, for example, having the following exemplary nucleotide sequence following the 3' end of the guide sequence: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 303) from 5' to 3'.
[0126] In the case of an sgRNA, the guide sequence described above may further include additional nucleotides to form an sgRNA, for example, having the following exemplary nucleotide sequence following the 3' end of the guide sequence: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 302) from 5' to 3'.
[0127] For sgRNAs, guide sequences can incorporate the following modified motif: mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 601), where "N" can be any natural or non-natural nucleotide, preferably an RNA nucleotide; the sugar moiety of the nucleotide can be ribose, deoxyribose, or a substituted similar compound; m is a 2'-O-methyl modified nucleotide, * is a phosphorothioate linkage to the adjacent nucleotide residue; and N collectively is the nucleotide sequence of the guide sequence. In the context of modified sequences, A, C, G, N, and U are unmodified RNA nucleotides, ie, a 2'-OH sugar moiety with a phosphodiesterase linkage to the adjacent nucleotide residue, or a 5'-terminal PO4.
[0128] In the case of an sgRNA, the guide sequence may further comprise a SpyCas9 sgRNA sequence. An example of a SpyCas9 sgRNA sequence is shown in the table below (SEQ ID NO: 303: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUC CGUUAUCAACUUGAAAAAGUGGCACCGAGU CGGUGC "exemplary SpyCas9 sgRNA-1"), which is included at the 3' end of the guide sequence and has the domains shown in Table A below. LS is the lower stem. B is the bulge. US is the upper stem. H1 and H2 are hairpin 1 and hairpin 2, respectively. H1 and H2 together are referred to as the hairpin region. A model of the structure is provided in Figure 10A of WO2019237069, which is incorporated herein by reference.
[0129] The nucleotide sequence of the exemplary SpyCas9 sgRNA-1 can serve as a template sequence for specific chemical modifications, sequence substitutions, and cleavage.
[0130] In some embodiments, the gRNA is, for example, an sgRNA or a dgRNA, and optionally includes chemical modifications. In some embodiments, the modified sgRNA includes a guide sequence and a SpyCas9 sgRNA sequence, such as the exemplary SpyCas9 sgRNA-1. The gRNA, such as the sgRNA, can include modifications at one or more of the terminal nucleotides, e.g., one, two, three, or four of the 3'- or 5'-terminal nucleotides, at the 5'-end of the guide sequence or the 3'-end of the SpyCas9 sgRNA sequence, such as the exemplary SpyCas9 sgRNA-1. In some embodiments, the modified nucleotides are selected from 2'-O-methyl (2'-OMe)-modified nucleotides, 2'-O-(2-methoxyethyl) (2'-O-moe)-modified nucleotides, 2'-fluoro (2'-F)-modified nucleotides, phosphorothioate (PS) internucleotide linkages, or inverted abasic modified nucleotides, or combinations thereof. In some embodiments, the modified nucleotide comprises a 2'-OMe modified nucleotide. In some embodiments, the modified nucleotide comprises a PS linkage. In some embodiments, the modified nucleotide comprises a 2'-OMe modified nucleotide and a PS linkage.
[0131] In one embodiment, using SEQ ID NO: 303 (the "exemplary SpyCas9 sgRNA-1" shown in Table A) as an example, the exemplary SpyCas9 sgRNA-1 further comprises one or more of the following: A. A shortened hairpin 1 region, or a substituted and optionally shortened hairpin 1 region, 1. At least one of the following nucleotide pairs, H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, or H1-4 and H1-9, is substituted with a Watson-Crick paired nucleotide in Hairpin 1, and the Hairpin 1 region optionally lacks: a.One or two of H1-5 to H1-8, b. one, two, or three of the following nucleotide pairs: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, and H1-4 and H1-9; or c. 1 to 8 nucleotides of the hairpin 1 region, or 2. The shortened hairpin 1 region is deleted by 4 to 8 nucleotides, preferably 4 to 6 nucleotides, and a. One or more of positions H1-1, H1-2, or H1-3 are deleted or substituted relative to the exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 303), or b. Exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 303) with substitutions at one or more of positions H1-6 through H1-10; or 3. The shortened hairpin 1 region is a deletion of 5-10 nucleotides, preferably 5-6 nucleotides, and one or more of positions N18, H1-12, or n are substituted relative to the exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 303); or B. A shortened upper stem region, wherein the shortened upper stem region is missing 1 to 6 nucleotides, and 6, 7, 8, 9, 10, or 11 nucleotides of the shortened upper stem region relative to exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 303) contain no more than four substitutions; or C. A substitution compared to exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 303) in any one or more of LS6, LS7, US3, US10, B3, N7, N15, N17, H2-2, and H2-14, wherein the substituted nucleotide is not a pyrimidine followed by an adenine or a pyrimidine followed by an adenine; or D. An exemplary SpyCas9 sgRNA-1 (SEQ ID NO: 303) having an upper stem region, wherein the upper stem modification comprises a modification to any one or more of US1-US12 within the upper stem region, wherein: 1. the modified nucleotides are optionally selected from 2'-O-methyl (2'-OMe) modified nucleotides, 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotides, 2'-fluoro (2'-F) modified nucleotides, phosphorothioate internucleotide (PS) linkages, inverted abasic modified nucleotides, or combinations thereof; or 2. The modified nucleotides optionally include 2'-OMe modified nucleotides.
[0132] In one embodiment, an exemplary SpyCas9 sgRNA-1 lacks six nucleotides in the shortened hairpin 1.
[0133] In one embodiment, an exemplary SpyCas9 sgRNA-1 lacks 8 nucleotides in the shortened hairpin 1.
[0134] In one embodiment, the exemplary SpyCas9 sgRNA-1 lacks H-1 and H-3.
[0135] In some embodiments, the exemplary SpyCas9 sgRNA-1 further comprises a 3' tail, which in some embodiments is 1 to 4 nucleotides in length, optionally 1 nucleotide in length.
[0136] In certain embodiments, an exemplary SpyCas9 sgRNA-1 comprises an upper stem region that includes modifications to any one or more of US1-US12 in the upper stem region.
[0137] In some embodiments, the sgRNA, such as the exemplary SpyCas9 sgRNA-1, or an sgRNA comprising the exemplary SpyCas9 sgRNA-1, further comprises a 3' tail, e.g., a 3' tail of 1, 2, 3, 4, or more nucleotides. In some embodiments, the tail comprises one or more modified nucleotides. In some embodiments, the modified nucleotides are selected from 2'-O-methyl (2'-OMe) modified nucleotides, 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotides, 2'-fluoro (2'-F) modified nucleotides, 2'-deoxy (2'H-) modified nucleotides, abasic nucleotides, locked nucleic acid (LNA) nucleotides, unlocked nucleic acid (UNA) nucleotides, phosphorothioate (PS) internucleotide linkages, terminal inverted abasic modified nucleotides, or combinations thereof. In some embodiments, the modified nucleotides comprise 2'-OMe modified nucleotides. In some embodiments, the modified nucleotides comprise PS internucleotide linkages. In certain embodiments, the modified nucleotides comprise 2'-OMe modified nucleotides and internucleotide PS linkages.
[0138] In some embodiments, the hairpin region comprises one or more modified nucleotides. In some embodiments, the modified nucleotides are selected from 2'-O-methyl (2'-OMe) modified nucleotides, 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotides, 2'-fluoro (2'-F) modified nucleotides, internucleotide phosphorothioate (PS) linkages, inverted abasic modified nucleotides, or combinations thereof. In some embodiments, the modified nucleotides comprise 2'-OMe modified nucleotides.
[0139] In some embodiments, the upper stem region comprises one or more modified nucleotides. In some embodiments, the modified nucleotides are selected from 2'-O-methyl (2'-OMe) modified nucleotides, 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotides, 2'-fluoro (2'-F) modified nucleotides, internucleotide phosphorothioate (PS) linkages, inverted abasic modified nucleotides, or combinations thereof. In some embodiments, the modified nucleotides comprise 2'-OMe modified nucleotides.
[0140] In some embodiments, an exemplary SpyCas9 sgRNA-1 comprises one or more YA dinucleotides, where Y is a pyrimidine, and the YA dinucleotide comprises a modified nucleotide. In some embodiments, the modified nucleotide is selected from 2'-O-methyl (2'-OMe) modified nucleotides, 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotides, 2'-fluoro (2'-F) modified nucleotides, internucleotide phosphorothioate (PS) linkages, inverted abasic modified nucleotides, or combinations thereof. In some embodiments, the modified nucleotide comprises a 2'-OMe modified nucleotide. [Table 2] [Table 3] [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4] [Table 4-5]
[0141] Within the above table, in reference to the unmodified sequence, A, C, G, U, and N are independently any natural or unnatural adenine, cytosine, guanine, uridine, and any nucleotide (e.g., A, C, G, or U), respectively. With reference to the modified sequences, m indicates a 2'-O-methyl modified nucleotide, * indicates a phosphorothioate internucleotide linkage, and A, C, G, U, and N are RNA nucleotides, i.e., a 2'-OH and, if present, a phosphodiesterase linkage to the 3' nucleotide.
[0142] In some embodiments, compositions are provided that include one or more guide RNAs (gRNAs) that include a guide sequence that directs an RNA-guided DNA-binding agent, which may be a nuclease (e.g., a Cas nuclease, such as Cas9, such as SpyCas9 cleavase), to a target DNA sequence of PCSK9. In some embodiments, engineered cells are provided that include a genetic modification in a human PCSK9 sequence within the genomic coordinates of chr1:55039548..55064852. In some embodiments, engineered cells are provided that include a genetic modification in a human PCSK9 sequence, wherein the genetic modification comprises a modification of at least one nucleotide within a genomic coordinate corresponding to a PCSK9 guide sequence selected from SEQ ID NOs: 1-20, optionally SEQ ID NOs: 1, 2, 7, 9, 13-15, 17, 18, or 20, optionally SEQ ID NO: 9, 14, or 18. In some embodiments, engineered cells are provided that include a genetic modification in a human PCSK9 sequence, wherein the genetic modification comprises a modification of at least one nucleotide within a genomic coordinate selected from Table 1.
[0143] In some embodiments comprising a gRNA, the gRNA may comprise a crRNA comprising a guide sequence shown in Table 1 as a guide sequence. In some embodiments, the gRNA comprises a guide sequence shown in Table 1, e.g., as an sgRNA. In some embodiments, the gRNA may comprise a guide sequence selected from SEQ ID NOs: 1, 2, 7, 9, 13-15, 17, 18, or 20. In some embodiments, the gRNA may comprise a guide sequence selected from SEQ ID NOs: 9, 14, or 18.
[0144] The gRNA comprises a guide sequence comprising 16, 17, preferably 18, 19, or 20 contiguous nucleotides of a guide sequence set forth in Table 1, e.g., SEQ ID NO: 1, 2, 7, 9, 13-15, 17, 18, or 20, and optionally SEQ ID NO: 9, 14, or 18. In some embodiments, the gRNA comprises a guide sequence having at least 80%, 85%, preferably 90%, 95%, or 100% identity to a guide sequence set forth in SEQ ID NO: 1, 2, 7, 9, 13-15, 17, 18, or 20, and optionally SEQ ID NO: 9, 14, or 18, of Table 1. In each embodiment described herein, the gRNA can comprise a crRNA and a trRNA associated as a single RNA (sgRNA) or on separate RNAs (dgRNA). With respect to the sgRNA, the crRNA and trRNA components can be covalently linked, e.g., via a phosphodiester bond or other covalent linkage.
[0145] In each embodiment described herein, the gRNA can include crRNA and trRNA associated as a single RNA (sgRNA) or on separate RNAs (dgRNA). With respect to the sgRNA, the crRNA and trRNA components can be covalently linked, for example, via a phosphodiester bond or other covalent bond.
[0146] In each embodiment described herein, the guide RNA may comprise two non-covalently linked RNA strands, referred to as a "dual guide RNA" or "dgRNA." The dgRNA comprises a first RNA molecule comprising a crRNA, e.g., comprising a guide sequence as shown in Table 1, and a second RNA molecule comprising a trRNA. The first and second RNA molecules may not be covalently linked, but may form an RNA duplex via base pairing between portions of the crRNA and the trRNA.
[0147] In each embodiment described herein, the guide RNA may comprise a single RNA molecule referred to as a "single guide RNA" or "sgRNA." The sgRNA may comprise a guide sequence shown in Table 1, or a crRNA (or portion thereof) comprising a guide sequence selected from SEQ ID NOs: 1, 2, 7, 9, 13-15, 17, 18, or 20, and optionally SEQ ID NOs: 9, 14, or 18, covalently linked to a trRNA.
[0148] The sgRNA can comprise 16, 17, preferably 18, 19, or 20 contiguous nucleotides of a guide sequence shown in Table 1, or a guide sequence selected from SEQ ID NOs: 1, 2, 7, 9, 13-15, 17, 18, or 20, and optionally SEQ ID NOs: 9, 14, or 18. In some embodiments, the crRNA and trRNA are covalently linked via a linker. In some embodiments, the sgRNA forms a stem-loop structure through base pairing between portions of the crRNA and trRNA. In some embodiments, the crRNA and trRNA are covalently linked via one or more bonds that are not phosphodiester bonds.
[0149] In some embodiments, the trRNA can comprise all or a portion of a trRNA sequence derived from a naturally occurring CRISPR / Cas system. In some embodiments, the trRNA comprises a truncated or modified wild-type trRNA. The length of the trRNA depends on the CRISPR / Cas system used. In some embodiments, the trRNA comprises or consists of 55, 60, 65, 70, 75, 80, 90, 100, or more than 100 nucleotides. In some embodiments, the trRNA can comprise certain secondary structures, such as one or more hairpin or stem-loop structures, or one or more bulge structures.
[0150] In some embodiments, compositions are provided that include one or more guide RNAs comprising a guide sequence of any one of SEQ ID NOs: 1-20, optionally SEQ ID NOs: 1, 2, 7, 9, 13-15, 17, 18 or 20, optionally SEQ ID NO: 9, 14, or 18.
[0151] In some embodiments, compositions are provided that include one or more sgRNAs comprising any one of SEQ ID NOs: 1, 2, 7, 9, 13-15, 17, 18, or 20, and optionally SEQ ID NOs: 9, 14, or 18.
[0152] In one aspect, a composition is provided that includes a gRNA that includes a guide sequence that is at least 90% or 95% identical to any of the nucleic acids of SEQ ID NOs: 1-20. In some embodiments, a composition is provided that includes a gRNA that includes a guide sequence that is at least 90% or 95% identical to any of SEQ ID NOs: 1-20, optionally SEQ ID NOs: 1, 2, 7, 9, 13-15, 17, 18, or 20, optionally SEQ ID NO: 9, 14, or 18.
[0153] In some embodiments, compositions are provided that include at least one, e.g., at least two, gRNAs that include a guide sequence selected from any one or more of SEQ ID NOs: 1-20, optionally SEQ ID NOs: 1, 2, 7, 9, 13-15, 17, 18, or 20, and optionally SEQ ID NO: 9, 14, or 18. In some embodiments, the compositions include at least two gRNAs, each including a guide sequence that is at least 90% or 95% identical to any of the nucleic acids in SEQ ID NOs: 1-20, optionally SEQ ID NOs: 1, 2, 7, 9, 13-15, 17, 18, or 20, and optionally SEQ ID NO: 9, 14, or 18.
[0154] The guide RNA compositions provided herein are designed to recognize (e.g., hybridize to) a target sequence within the PCSK9 gene. For example, the PCSK9 target sequence can be recognized and cleaved by the provided Cas cleavase comprising the guide RNA. In some embodiments, an RNA-guided DNA-binding agent, such as a Cas cleavase, such as SpyCas9 cleavase, can be guided by the guide RNA to the target sequence of the PCSK9 gene, where the guide sequence of the guide RNA hybridizes to the target sequence and the RNA-guided DNA-binding agent, such as a Cas cleavase, cleaves the target sequence.
[0155] In some embodiments, the selection of one or more guide RNAs is determined based on a target sequence within the PCSK9 gene.
[0156] Without being bound by any particular theory, mutations in certain regions of a gene (e.g., indels, i.e., frameshift mutations resulting from insertions or deletions, that occur as a result of nuclease-mediated DSBs) may be less tolerated than mutations in other regions of a gene, so the location of the DSB is an important factor in the amount or type of protein knockdown that can occur. In some embodiments, a gRNA that is complementary to or has complementarity with a target sequence within PCSK9 is used to target an RNA-guided DNA-binding agent to a specific location within the appropriate PCSK9 gene.
[0157] In some embodiments, the Spy guide sequence is at least 90%, 95%, or 100% identical to the reverse complement of the target sequence present in the human PCSK9 gene. In some embodiments, the target sequence is complementary to the guide sequence of the guide RNA. In some embodiments, the degree of complementarity or identity between the guide sequence of the Spy guide RNA and its corresponding target sequence is at least 80%, 85%, preferably 90%, or 95%; or 100%. In some embodiments, the target sequence can be 100% complementary or identical to the guide sequence of the Spy gRNA.
[0158] In some embodiments, the target region and guide sequence of a Spy gRNA may contain at least one mismatch. For example, the target sequence and guide sequence of a gRNA may contain 1, 2, 3, or 4 mismatches, and the total length of the guide sequence is 20 nucleotides. In some embodiments, the target sequence and guide sequence of a gRNA may contain 1 to 4 mismatches, and the guide sequence is 20 nucleotides.
[0159] In some embodiments, the Spy guide sequence comprises a sequence of at least 16, 17, preferably 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-20, optionally 1, 2, 7, 9, 13-15, 17, 18, or 20, optionally SEQ ID NO: 9, 14, or 18.
[0160] In some embodiments, a composition or formulation disclosed herein comprises an mRNA comprising an open reading frame (ORF) encoding an RNA-guided DNA-binding agent, such as a Cas nuclease, as described herein. In some embodiments, an mRNA comprising an ORF encoding an RNA-guided DNA-binding agent, such as a Cas nuclease, is provided, used, or administered.
[0161] Modified gRNA and mRNA In some embodiments, the gRNA is chemically modified. A gRNA that includes one or more modified nucleosides or nucleotides is referred to as a "modified" gRNA or a "chemically modified" gRNA to account for the presence of one or more non-natural or natural components or configurations used in place of, or in addition to, the standard A, G, C, and U residues. In some embodiments, the modified gRNA is synthesized with non-standard nucleosides or nucleotides and is referred to herein as "modified." Modified nucleosides and nucleotides can include one or more of the following: (i) an alteration, e.g., substitution, of one or both of the non-linked phosphate oxygens in the phosphodiester backbone linkage, or one or both of the linking phosphate oxygens (exemplary backbone modifications); (ii) an alteration, e.g., substitution, of a component of the ribose sugar, e.g., of the 2' hydroxyl on the ribose sugar (exemplary sugar modifications); (iii) a modification or substitution of a naturally occurring nucleobase, including a non-standard nucleobase (exemplary base modifications); and (iv) a nucleotide modification at the 3' or 5' end of the oligonucleotide to provide exonuclease stability, e.g., with a 2'O-me, 2' halide, or 2' deoxy substituted ribose, or an inverted abasic terminal nucleotide, or a replacement of a phosphodiester with a phosphothioate.
[0162] Chemical modifications such as those listed above can be combined to provide modified gRNAs or mRNAs containing nucleosides and nucleotides (collectively "residues") that may have two, three, four, or more modifications. For example, modified residues can have modified sugars and modified nucleobases. In certain embodiments, phosphate groups of the gRNA molecule are replaced with phosphorothioate groups. In some embodiments, modified gRNAs contain at least one modified residue at or near the 5' end of the RNA. In some embodiments, modified gRNAs contain at least one modified residue at or near the 3' end of the RNA.
[0163] In some embodiments, the gRNA comprises one, two, three, or more modified residues. In some embodiments, at least 5% (e.g., at least 5%, 10%, 15%, preferably at least 20%, 25%, 30%, 35%, 40%, 45%, or 50%) of the positions in the modified gRNA are modified nucleosides or nucleotides. In some embodiments, at least 5% of the positions in the modified guide RNA are modified nucleosides or nucleotides. In some embodiments, at least 10% of the nucleotides at the positions in the modified guide RNA are modified nucleosides or nucleotides. In some embodiments, at least 15% of the positions in the modified gRNA are modified nucleosides or nucleotides. In some embodiments, preferably, at least 20% of the positions in the modified gRNA are modified nucleosides or nucleotides. In some embodiments, no more than 65% of the positions in the modified gRNA are modified nucleotides. In some embodiments, no more than 55% of the positions in the modified gRNA are modified nucleotides. In some embodiments, 50% or less of the positions in the modified gRNA are modified nucleotides. In some embodiments, 10-70% of the positions in the modified gRNA are modified nucleotides. In some embodiments, 20-70% of the positions in the modified gRNA are modified nucleotides. In some embodiments, 20-80% of the positions in the modified gRNA are modified nucleotides. In some embodiments, 20-50% of the positions in the modified gRNA are modified nucleotides and the nuclease is Spy Cas9 nuclease.
[0164] Unmodified nucleic acids can be susceptible to degradation, for example, by intracellular nucleases or nucleases found in serum. For example, nucleases can hydrolyze phosphodiester bonds in nucleic acids. Thus, in one aspect, the gRNAs described herein can contain one or more modified nucleosides or nucleotides to confer stability against, for example, intracellular or serum nucleases. In some embodiments, the modified gRNA molecules described herein can exhibit a reduced innate immune response when introduced into a cell population, both in vivo and ex vivo. The term "innate immune response" includes cellular responses to exogenous nucleic acids, including single-stranded nucleic acids, including the induction of cytokine expression and release (particularly interferon) and cell death.
[0165] In some embodiments of backbone modification, the phosphate group of the modified residue can be modified by replacing one or more of the oxygen atoms with different substituents.Furthermore, modified residues, such as modified residues present in modified nucleic acids, can include replacing unmodified phosphate moieties with modified phosphate groups as described herein.In some embodiments, backbone modification of the phosphate backbone can include modifications that result in either an uncharged linker or a charged linker with asymmetric charge distribution.
[0166] Examples of modified phosphate groups include phosphorothioates, boranophosphate esters, methyl phosphonates, phosphoramidates, phosphodithioates, alkyl or aryl phosphonates, and phosphotriesters. The phosphorus atom of an unmodified phosphate group is achiral. However, the phosphorus atom can be made chiral by replacing one of the non-bridging oxygens with the atoms or groups listed above. The asymmetric phosphorus atom can have either the "R" configuration (herein Rp) or the "S" configuration (herein Sp). The backbone can also be modified by replacing the bridging oxygen (i.e., the oxygen linking the phosphate group to the nucleoside) with nitrogen (bridging phosphoramidates), sulfur (bridging phosphorothioates), or carbon (bridging methylene phosphonates). Replacement can occur at either or both of the linking oxygens.
[0167] In certain backbone modifications, such as amide bonds, the phosphate group can be replaced with a non-phosphorus-containing connector. In some embodiments, the charged phosphate group can be replaced with a neutral moiety. Examples of moieties that can replace the phosphate group include, but are not limited to, methyl phosphonate, carboxymethyl, carbamate, amide, and thioether. Further examples of moieties that can replace the phosphate group include, but are not limited to, ethylene oxide linkers, sulfonates, sulfonamides, thioformacetals, formacetals, methyleneimino, methylenemethylimino, methylenehydrazo, methylenedimethylhydrazo, and methyleneoxymethylimino.
[0168] Nucleic acid-mimicking scaffolds can also be constructed in which the phosphate linker and ribose sugar are replaced with nuclease-resistant nucleoside or nucleotide surrogates. Such modifications can include backbone and sugar modifications. In some embodiments, the nucleobases can be tethered by the surrogate backbone. Examples include, but are not limited to, morpholino, cyclobutyl, pyrrolidine, and peptide nucleic acid (PNA) nucleoside surrogates.
[0169] Modified nucleosides and nucleotides can include one or more modifications to the sugar group, i.e., sugar modifications. For example, the 2' hydroxyl group (OH) can be modified, e.g., replaced with a number of different "oxy" or "deoxy" substituents. In some embodiments, modifying the 2' hydroxyl group can improve the stability of the nucleic acid by deprotonating the hydroxyl so that it cannot form a 2'-alkoxide ion.
[0170] Examples of 2' hydroxyl group modifications include alkoxy or aryloxy (OR, where "R" can be, for example, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar), polyethylene glycol (PEG), O(CH2CHO) n The 2' hydroxyl group may include CH2CH2OR, where R can be, for example, H or an optionally substituted alkyl, and n can be an integer from 0 to 20 (e.g., 0-4, 0-8, 0-10, 0-16, 1-4, 1-8, 1-10, 1-16, 1-20, 2-4, 2-8, 2-10, 2-16, 2-20, 4-8, 4-10, 4-16, 4-20). In some embodiments, the 2' hydroxyl group modification can be 2'-O-Me. In some embodiments, the 2' hydroxyl group modification can be a 2'-fluoro modification, where the 2' hydroxyl group is replaced with fluoride. In some embodiments, the 2' hydroxyl group modification can be a 2'-fluoro modification, where the 2' hydroxyl is replaced with, for example, C 1~6 Alkylene or C 1~6 "Locked" nucleic acids (LNAs) can be linked to the 4' carbon of the same ribose sugar by a heteroalkylene bridge (exemplary bridges can include a methylene bridge, a propylene bridge, an ether bridge, or an amino bridge), O-amino (amino can be, for example, NH, alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino) and aminoalkoxy, and O(CH) n-amino (wherein amino can be, for example, NH, alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino). In some embodiments, the 2' hydroxyl group modification can include an "unlocked" nucleic acid (UNA), in which the ribose ring lacks a C2'-C3' bond. In some embodiments, the 2' hydroxyl group modification can include a methoxyethyl group (MOE), (OCH2CHOCH3, e.g., a PEG derivative). 2' modifications can include hydrogen (i.e., deoxyribose sugar), halo (e.g., bromine, chlorine, fluorine, or iodo), amino (wherein amino can be, for example, NH, alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid), NH(CH2CH2NH) n Included are CH2CH2-amino (wherein amino can be, for example, as described herein), -NHC(O)R (wherein R can be, for example, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar), cyano, mercapto, alkyl-thio-alkyl, thioalkoxy, and alkyl, cycloalkyl, aryl, alkenyl, and alkynyl, which may be optionally substituted, such as with amino, as described herein.
[0171] Sugar modifications can include sugar groups that can contain one or more carbons with the opposite stereochemical configuration to that of the corresponding carbon in ribose. Thus, modified nucleic acids can include, for example, nucleotides containing arabinose as the sugar. Modified nucleic acids can also include abasic sugars. These abasic sugars can also be further modified at one or more of the constituent sugar atoms. Modified nucleic acids can also include one or more sugars that are in the L-form (e.g., L-nucleosides). As used herein, a single abasic sugar is not understood to result in a discontinuity in the duplex.
[0172] In certain embodiments, 2' modifications include, for example, 2'-OMe, 2'-F, or 2'-H, optionally 2'-O-Me.
[0173] The modified nucleosides and modified nucleotides described herein that can be incorporated into modified nucleic acids can contain modified bases, also referred to as modified nucleobases. Examples of nucleobases include, but are not limited to, adenine (A), guanine (G), cytosine (C), and uridine (U). These nucleobases can be modified or completely replaced to provide modified residues that can be incorporated into modified nucleic acids. The nucleobases of the nucleotides can be independently selected from purines, pyrimidines, purine analogs, or pyrimidine analogs. In some embodiments, the nucleobases can include, for example, naturally occurring and synthetic derivatives of bases.
[0174] In embodiments using dual guide RNAs, the crRNA and tracrRNA can each contain modifications. Such modifications can be at one or both ends of the crRNA or tracrRNA. In embodiments including an sgRNA, one or more residues at one or both ends of the sgRNA can be chemically modified, or internal nucleosides can be modified, or the entire sgRNA can be chemically modified. Some embodiments include a 5'-end modification. Some embodiments include a 3'-end modification. Some embodiments include both a 5'-end modification and a 3'-end modification.
[0175] In some embodiments, the guide RNA disclosed herein comprises one of the modification patterns disclosed in WO2018 / 107028 (the entire contents of which are incorporated herein by reference). In some embodiments, the guide RNA disclosed herein comprises one of the structure / modification patterns disclosed in US2017 / 0114334, the entire contents of which are incorporated herein by reference. In some embodiments, the guide RNA disclosed herein comprises one of the structure / modification patterns disclosed in WO2017 / 136794, the entire contents of which are incorporated herein by reference. In some embodiments, the guide RNA disclosed herein comprises one of the structure / modification patterns disclosed in WO2019 / 237069, the entire contents of which are incorporated herein by reference. In some embodiments, the guide RNA disclosed herein comprises one of the structure / modification patterns disclosed in WO2021 / 119275, the entire contents of which are incorporated herein by reference.
[0176] In some embodiments, the sgRNA comprises any of the modification patterns set forth herein, wherein N is any natural or unnatural nucleotide, and the entirety of N comprises a PCSK9 guide sequence set forth in Table 1 herein. In some embodiments, the modified sgRNA comprises the following sequence: mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 601), where the entire N comprises a PCSK9 guide sequence as set forth in Table 1, e.g., N is replaced with any of the guide sequences disclosed in Table 1, optionally N is replaced with SEQ ID NOs: 1-20, optionally SEQ ID NOs: 1, 2, 7, 9, 13-15, 17, 18, or 20, optionally SEQ ID NO: 9, 14, or 18.
[0177] In some embodiments, the sgRNA comprises any of the modification patterns set forth herein, wherein N is any natural or non-natural nucleotide, and the entirety of N comprises a PCSK9 guide sequence set forth in Table 1 herein. In some embodiments, the modified sgRNA comprises the following sequence: mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC (SEQ ID NO: 607), wherein the entirety of N comprises a PCSK9 guide sequence set forth in Table 1, e.g., N is replaced with any of the guide sequences disclosed in Table 1, optionally N is replaced with PCSK9 numbers 1-20, optionally SEQ ID NO: 1, 2, 7, 9, 13-15, 17, 18, or 20, optionally SEQ ID NO: 9, 14, or 18.
[0178] In some embodiments, the sgRNA comprises any of the modification patterns set forth herein, wherein N is any natural or non-natural nucleotide, and the entirety of N comprises a PCSK9 guide sequence set forth in Table 1 herein. In some embodiments, the modified sgRNA comprises the following sequence: mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGGmU*mG*mC*mU (SEQ ID NO: 612), where the entirety of N comprises a PCSK9 guide sequence set forth in Table 1, e.g., N is replaced with any of the guide sequences disclosed in Table 1, optionally where N is replaced with SEQ ID NOs: 1-20, optionally SEQ ID NOs: 1, 2, 7, 9, 13-15, 17, 18, or 20, optionally SEQ ID NO: 9, 14, or 18.
[0179] Any of the modifications described below may be present in the gRNAs and mRNAs described herein.
[0180] With respect to chemically modified sequences, "A," "C," "G," "N," and "U" represent RNA nucleotides, i.e., a 2'-OH with a phosphodiesterase linkage to the 3' nucleotide.
[0181] The terms "mA", "mC", "mU" or "mG" are used to refer to 2'-O-Me modified adenine, cytosine, uridine or guanidine nucleotides, respectively.
[0182] The 2'-O-methyl modification can be represented as follows: [ka] Another chemical modification shown to affect the sugar ring of nucleotides is halogen substitution: for example, 2'-fluoro (2'-F) substitution on the nucleotide sugar ring can increase oligonucleotide binding affinity and nuclease stability.
[0183] In this application, the terms "fA," "fC," "fU," or "fG" are used to refer to nucleotides substituted with 2'-F.
[0184] The 2'-F substitution can be represented as follows: [ka]
[0185] Phosphorothioate (PS) linkages or bonds refer to phosphodiester linkages, such as those between nucleotide bases, in which a sulfur atom is replaced with a non-bridging phosphate oxygen. When phosphorothioates are used to generate oligonucleotides, the modified oligonucleotides are also called S-oligos.
[0186] "*" is used to indicate a PS modification. In this application, the terms A*, C*, U*, or G* may be used to indicate a nucleotide that is linked to the next (e.g., 3') nucleotide by a PS bond.
[0187] In this application, the terms "mA*," "mC*," "mU*," or "mG*" are used to refer to a nucleotide that is substituted with 2'-O-Me and linked to the next (e.g., 3') nucleotide by a PS bond.
[0188] The diagram below shows the substitution of S- for the non-bridging phosphate oxygen, creating a PS bond instead of a phosphodiester bond: [ka]
[0189] Abasic nucleotide refers to the nucleotide that lacks nitrogenous base.The following figure shows the oligonucleotide that has the abasic site (also called apurinic site) that lacks base.As used herein, the existence of a single abasic site is not considered to break the duplex, for example, the duplex formed between the targeting sequence of guide RNA and the target site in genome. [ka]
[0190] An inverted base refers to a base with a linkage that is reversed from the normal 5' to 3' linkage (i.e., either a 5' to 5' linkage or a 3' to 3' linkage). Such an inverted base can only occur as a terminal nucleotide. In chemical synthesis methods performed 3' to 5', the inverted base does not have a 5' hydroxyl available for chain growth. For example, [ka]
[0191] The abasic nucleotide can be linked by an inverted linkage. For example, the abasic nucleotide can be linked to the terminal 5' nucleotide via a 5' to 5' linkage, or the abasic nucleotide can be linked to the terminal 3' nucleotide via a 3' to 3' linkage. An inverted abasic nucleotide at either the terminal 5' or 3' nucleotide is also called an inverted abasic end cap.
[0192] In some embodiments, one or more of the first 3, 4, or 5 nucleotides at the 5' end and one or more of the last 3, 4, or 5 nucleotides at the 3' end are modified, hi some embodiments, the modifications are 2'-O-Me, 2'-F, inverted abasic nucleotides, PS linkages, or other nucleotide modifications known in the art for enhancing stability or performance.
[0193] In some embodiments, the first four nucleotides at the 5' end and the last four nucleotides at the 3' end are linked by phosphorothioate (PS) bonds.
[0194] In some embodiments, the first three nucleotides of the 5' end and the last three nucleotides of the 3' end comprise 2'-O-methyl (2'-O-Me) modified nucleotides. In some embodiments, the first three nucleotides of the 5' end and the last three nucleotides of the 3' end comprise 2'-fluoro (2'-F) modified nucleotides. In some embodiments, the first three nucleotides of the 5' end and the last three nucleotides of the 3' end comprise inverted abasic nucleotides.
[0195] In some embodiments, the guide RNA comprises a modified sgRNA. In some embodiments, the sgRNA comprises the modification pattern set forth in mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmCmAmCmCmGmAmGmUmCmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 601), where N is any natural or non-natural nucleotide, and where the entire N comprises a guide sequence that directs a nuclease to a target sequence of PCSK9, e.g., a genomic coordinate set forth in Table 1, e.g., SEQ ID NOs: 1-20, optionally SEQ ID NOs: 1, 2, 7, 9, 13-15, 17, 18, or 20, optionally SEQ ID NO: 9, 14, or 18.
[0196] In some embodiments, the guide RNA comprises an sgRNA comprising any one of the guide sequences of SEQ ID NOs: 1-20, optionally SEQ ID NOs: 1, 2, 7, 9, 13-15, 17, 18, or 20, optionally SEQ ID NO: 9, 14, or 18, and a conserved portion of an sgRNA, e.g., the conserved portion of the sgRNA shown as exemplary SpyCas9 sgRNA-1, or the conserved portion of a gRNA shown in Tables 3-4 and throughout the specification. In some embodiments, the guide RNA comprises an sgRNA comprising any one of the guide sequences of SEQ ID NOs: 1-20, optionally SEQ ID NOs: 1, 2, 7, 9, 13-15, 17, 18, or 20, optionally SEQ ID NO: 9, 14, or 18, and the nucleotides GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 302), wherein the nucleotides are Located at the 3' end of the guide sequence, the sgRNA can be modified as shown herein or such as the sequence mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 601). In some embodiments, the sgRNA comprises the exemplary SpyCas9 sgRNA-1 provided herein or a modified version thereof, or a version provided in Tables 3B or 4B below, wherein the entirety of N comprises the guide sequence that directs the nuclease to the target sequence. Each N is independently modified or unmodified. In certain embodiments, in the absence of any indication of modification, the nucleotide is an unmodified RNA nucleotide residue, i.e., a ribose sugar and a phosphodiester backbone. [Table 5] [Table 6]
[0197] where N collectively represents a guide sequence provided herein. Within the above table, in the context of the unmodified sequence, A, C, G, U, and N are independently any natural or unnatural adenine, cytosine, guanine, uridine, and any nucleotide (e.g., A, C, G, or U), respectively. [Table 7] [Table 8-1] [Table 8-2]
[0198] where "m" indicates a 2'-O-Me modification, "f" indicates a 2'-fluoro modification, "*" indicates a phosphorothioate linkage between nucleotides, and no modification in the context of a modified sequence indicates an RNA (2'-OH) and phosphodiesterase linkage to the 3' nucleotide, if present.
[0199] In some embodiments, the chemically modified scaffold sequence of Table 4A further comprises a chemically modified targeting sequence. In some embodiments, the chemically modified guide sequence is (mN*)3(N). In some embodiments, the guide sequence is (mN*)3(N), i.e., mN*mN*mN*NNNNNNNNNNNNNNNNN. In some embodiments, each N in (N)13-17 or (N)17 is unmodified. In some embodiments, each N in (N)13-17 or (N)17 is independently modified, e.g., independently modified with a 2'-O-methyl modification.
[0200] As noted above, in some embodiments, a composition or formulation disclosed herein comprises an mRNA comprising an open reading frame (ORF) encoding an RNA-guided DNA binder, such as a Cas nuclease, e.g., a Cas9 nuclease listed in Table 23. In some embodiments, an mRNA is provided, used, or administered that comprises an ORF encoding an RNA-guided DNA binder, such as a Cas nuclease, e.g., a Cas9 nuclease. In some embodiments, the ORF encoding the RNA-guided DNA nuclease is a "modified RNA-guided DNA binder ORF," or simply a "modified ORF," used as an abbreviation to indicate that the ORF is modified.
[0201] In some embodiments, the mRNA or modified ORF can contain modified uridines at at least one, more than one, or all uridine positions. In some embodiments, the modified uridine is a uridine modified at the 5-position, e.g., with a halogen, methyl, or ethyl. In some embodiments, the modified uridine is a pseudouridine modified at the 1-position, e.g., with a halogen, methyl, or ethyl. The modified uridine can be, for example, pseudouridine, N1-methyl-pseudouridine, 5-methoxyuridine, 5-iodouridine, or a combination thereof. In some embodiments, the modified uridine is 5-methoxyuridine. In some embodiments, the modified uridine is 5-iodouridine. In some embodiments, the modified uridine is pseudouridine. In some embodiments, the modified uridine is N1-methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and N1-methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and 5-methoxyuridine. In some embodiments, the modified uridine is a combination of N1-methylpseudouridine and 5-methoxyuridine. In some embodiments, the modified uridine is a combination of 5-iodouridine and N1-methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and 5-iodouridine. In some embodiments, the modified uridine is a combination of 5-iodouridine and 5-methoxyuridine.
[0202] In some embodiments, the mRNAs disclosed herein include a 5' cap (e.g., Cap0, Cap1, or Cap2). The 5' cap is generally a 7-methylguanine ribonucleotide (which may be further modified, e.g., with respect to ARCA, as discussed below) linked via a 5'-triphosphate to the first nucleotide of the 5'-to-3' strand of the mRNA, i.e., the 5' position of the first cap-proximal nucleotide. In Cap0, the riboses of the first and second cap-proximal nucleotides of the mRNA both include a 2'-hydroxyl. In Cap1, the riboses of the first and second transcribed nucleotides of the mRNA include a 2'-methoxy and a 2'-hydroxyl, respectively. In Cap2, the riboses of the first and second cap-proximal nucleotides of the mRNA both include a 2'-methoxy. See, for example, Katibah et al. (2014) Proc Natl Acad Sci USA 111(33):12025-30; and Abbas et al. (2017) Proc Natl Acad Sci USA 114(11):E2106-E2115. Most endogenous mRNAs in higher eukaryotes, including mammalian mRNAs such as human mRNAs, contain Cap1 or Cap2. Cap0 and other cap structures distinct from Cap1 and Cap2 can be immunogenic in mammals, including humans, because they are recognized as "non-self" by components of the innate immune system, such as IFIT-1 and IFIT-5, which can lead to increased levels of cytokines, such as type I interferons. Components of the innate immune system, such as IFIT-1 and IFIT-5, can also compete with eIF4E for binding to mRNAs with caps other than Cap1 or Cap2, potentially inhibiting mRNA translation.
[0203] A cap can be included co-transcriptionally. For example, ARCA (anti-reverse cap analog; Thermo Fisher Scientific catalog no. AM8045) is a cap analog containing 7-methylguanine 3'-methoxy-5'-triphosphate linked to the 5' position of a guanine ribonucleotide that can be incorporated into transcripts during transcription initiation in vitro. ARCA generates a Cap0 cap in which the 2' position of the first cap-proximal nucleotide is hydroxyl. See, e.g., Stepinski et al. (2001) "Synthesis and properties of mRNAs containing the novel 'anti-reverse' cap analogs 7-methyl(3'-O-methyl)GpppG and 7-methyl(3'deoxy)GpppG," RNA 7: 1486-1495. The structure of ARCA is shown below. [ka]
[0204] To obtain the Cap1 structure by co-transcription, CleanCap™ AG (m7G(5')ppp(5')(2'OMeA)pG; TriLink Biotechnologies catalog number N-7113) or CleanCap™ GG (m7G(5')ppp(5')(2'OMeG)pG; TriLink Biotechnologies catalog number N-7133) can be used. 3'-O-methylated versions of CleanCap™ AG and CleanCap™ GG are also available from TriLink Biotechnologies under catalog numbers N-7413 and N-7433, respectively, or CleanCap AU; available from TriLink Biotechnologies under catalog number N-7114. The CleanCap™ AG structure is shown below. [ka]
[0205] Alternatively, a cap can be added to RNA post-transcriptionally. For example, vaccinia capping enzyme is commercially available (New England Biolabs, catalog number M2080S), which possesses RNA triphosphatase and guanylyltransferase activities provided by its D1 subunit and a guanine methyltransferase activity provided by its D12 subunit. Therefore, in the presence of S-adenosylmethionine and GTP, 7-methylguanine can be added to RNA to give Cap0. See, e.g., Guo, P. and Moss, B. (1990) Proc. Natl. Acad. Sci. USA 87, 4023-4027; and Mao, X. and Shuman, S. (1994) J. Biol. Chem. 269, 24472-24479.
[0206] In some embodiments, the mRNA further comprises a polyadenylation (polyA) tail. In some embodiments, the polyA tail comprises at least 20, 30, 40, 50, 60, 70, 80, 90, or 100 adenines, optionally up to 300 adenines. In some embodiments, the polyA tail comprises 95, 96, 97, 98, 99, or 100 adenine nucleotides. In some embodiments, the polyA tail comprises non-adenine nucleotides, i.e., the polyA tail is an interrupted polyA tail. In certain embodiments, the polyA tail is interrupted by a non-adenine nucleotide about every 40, 50, 60, 70, 80, or 90 nucleotides. In certain embodiments, the polyA tail is interrupted by a non-adenine nucleotide about every 50 nucleotides.
[0207] Ribonucleoprotein complex In some embodiments, compositions are included that include one or more gRNAs comprising one or more guide sequences from Table 1 or one or more sgRNAs from Table 2, and an RNA-guided DNA-binding agent, e.g., a nuclease such as a Cas nuclease, such as Cas9. In some embodiments, the RNA-guided DNA-binding agent has cleavase activity, which activity can also be referred to as double-stranded endonuclease activity. In some embodiments, the RNA-guided DNA-binding agent comprises a Cas nuclease. Examples of Cas9 nucleases include those from S. pyogenes and prokaryotic Type II CRISPR systems known in the art, as well as modified versions (e.g., engineered or mutant) thereof.
[0208] In some embodiments, the Cas nuclease is a Cas9 nuclease from Streptococcus pyogenes, which induces a double-stranded break, i.e., is a cleavase.
[0209] In some embodiments, the gRNA together with the RNA-guided DNA-binding agent is referred to as a ribonucleoprotein complex (RNP). In some embodiments, the RNA-guided DNA-binding agent is a Cas nuclease. In some embodiments, the gRNA together with the Cas protein is referred to as a Cas RNP. In some embodiments, the Cas nuclease is a Cas9 protein from the Spy CRISPR / Cas system. In some embodiments, the gRNA together with Cas9 is referred to as a Cas9 RNP.
[0210] Wild-type Cas9 has two nuclease domains, RuvC and HNH. The RuvC domain cleaves the non-target DNA strand, and the HNH domain cleaves the target strand of DNA. In some embodiments, the Cas9 protein comprises multiple RuvC domains or multiple HNH domains. In some embodiments, the Cas9 protein is wild-type Cas9. In each of the composition, use, and method embodiments, wild-type Cas induces a double-strand break in the target DNA.
[0211] In some embodiments, chimeric Cas nucleases are used in which one domain or region of a protein is replaced with a portion of a different protein. In some embodiments, the Cas nuclease domain may be replaced with a domain from a different nuclease, such as Fok1. In some embodiments, the Cas nuclease may be a modified nuclease.
[0212] In some embodiments, the RNA-guided DNA-binding agent has single-stranded nickase activity, i.e., it can cleave a single DNA strand to generate a single-stranded break (also known as a "nick"). In some embodiments, the RNA-guided DNA-binding agent comprises a Cas nickase. A nickase is an enzyme that creates nicks in dsDNA, i.e., it cleaves one strand of a DNA double helix but not the other. In some embodiments, the Cas nickase is a variant of a Cas nuclease (e.g., the Cas nucleases described above) in which the endonucleolytic activity site has been inactivated, for example, by one or more alterations (e.g., point mutations) in the catalytic domain. For a discussion of Cas nickases and exemplary catalytic domain modifications, see, e.g., U.S. Patent No. 8,889,356. In some embodiments, the Cas nickase (e.g., Cas9 nickase) has an inactivated RuvC or HNH domain.
[0213] In some embodiments, the RNA-guided DNA binder is modified to contain only one functional nuclease domain.For example, the drug protein can be modified such that one of the nuclease domains is mutated or completely or partially deleted to reduce its nucleic acid cleavage activity.In some embodiments, a nickase with a RuvC domain that has reduced activity is used.In some embodiments, a nickase with an inactive RuvC domain is used.In some embodiments, a nickase with an HNH domain that has reduced activity is used.In some embodiments, a nickase with an inactive HNH domain is used.
[0214] In some embodiments, conserved amino acids within the Cas protein nuclease domain are substituted to reduce or alter nuclease activity. In some embodiments, the Cas nuclease may comprise an amino acid substitution in the RuvC or RuvC-like nuclease domain. Exemplary amino acid substitutions in the RuvC or RuvC-like nuclease domain include D10A (based on the S. pyogenes Cas9 protein). See, e.g., Zetsche et al. (2015) Cell Oct 22:163(3):759-771. In some embodiments, the Cas nuclease may comprise an amino acid substitution in the HNH or HNH-like nuclease domain. Exemplary amino acid substitutions in the HNH or HNH-like nuclease domain include E762A, H840A, N863A, H983A, and D986A (based on the S. pyogenes Cas9 protein). See, e.g., Zetsche et al. (2015). Exemplary amino acid substitutions in the HNH or HNH-like nuclease domain, or the RuvC or RuvC-like domain of N. meningitidis include Nme2Cas9D16A (HNH nickase) and Nme2Cas9H588A (RuvC nickase).
[0215] In some embodiments, an mRNA encoding a nickase is provided in combination with a pair of guide RNAs that are complementary to the sense and antisense strands of the target sequence, respectively. In this embodiment, the guide RNA guides the nickase to the target sequence, where it introduces a DSB by nicking opposite strands of the target sequence (i.e., double nicking). In some embodiments, the use of double nicking can improve specificity and reduce off-target effects. In some embodiments, to generate a double nick in the target DNA, a nickase is used with two separate guide RNAs that target opposite strands of DNA. In some embodiments, a nickase is used with two separate guide RNAs that are selected to be adjacent to each other, generating a double nick in the target DNA.
[0216] In some embodiments, the RNA-guided DNA-binding agent lacks cleavase and nickase activity. In some embodiments, the RNA-guided DNA-binding agent comprises a dCas DNA-binding polypeptide. The dCas polypeptide has DNA-binding activity but essentially lacks catalytic (cleavase / nickase) activity. In some embodiments, the dCas polypeptide is a dCas9 polypeptide. In some embodiments, the RNA-guided DNA-binding agent or dCas DNA-binding polypeptide lacking cleavase and nickase activity is a version of a Cas nuclease (e.g., a Cas nuclease discussed above) in which its endonucleolytic active site has been inactivated, e.g., by one or more alterations (e.g., point mutations) in its catalytic domain. See, e.g., US20140186958, US20150166980; and US20190338308.
[0217] In some embodiments, the RNA-guided DNA-binding agent comprises (eg, is or comprises) one or more heterologous functional domains.
[0218] In some embodiments, the heterologous functional domain can facilitate the transport of the RNA-guided DNA binding agent into the cell nucleus. For example, the heterologous functional domain can be a nuclear localization signal (NLS). In some embodiments, the RNA-guided DNA binding agent can be fused to one to five NLSs. In some embodiments, the RNA-guided DNA binding agent can be fused to one, two, or three NLSs. In some embodiments, the RNA-guided DNA binding agent can be fused to two NLSs. In some embodiments, the RNA-guided DNA binding agent can be fused to one NLS. When one NLS is used, the NLS can be linked at the N-terminus or C-terminus of the RNA-guided DNA binding agent sequence. In some embodiments, the NLS is not linked to the C-terminus. In some embodiments, the NLS is inserted within the sequence of the RNA-guided DNA binding agent. In certain circumstances, at least two NLSs contained in the RNA-guided DNA binding agent are the same (e.g., two SV40 NLSs). In certain embodiments, at least two different NLSs are present in the RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent is fused to two SV40 NLS sequences linked at the C-terminus. In some embodiments, the RNA-guided DNA binding agent can be fused to two NLSs, one linked at the N-terminus and the other linked at the C-terminus. In some embodiments, the RNA-guided DNA binding agent can be fused to three NLSs. In some embodiments, the RNA-guided DNA binding agent does not need to be fused to an NLS. In some embodiments, the NLS can be a single-part sequence, such as the SV40 NLS, PKKKRKV (SEQ ID NO: 1013) or PKKKRRV (SEQ ID NO: 1014). In some embodiments, the NLS can be a bipartite sequence, such as the nucleoplasmin NLS, KRPAATKKAGQAKKKK (SEQ ID NO: 1015). In some embodiments, a single PKKKRKV NLS (SEQ ID NO: 1013) can be linked at the C-terminus of the RNA-guided DNA binding agent. One or more linkers are optionally included in the fusion site.
[0219] In some embodiments, the heterologous functional domain can modify the intracellular half-life of the RNA-guided DNA binding agent. In some embodiments, the heterologous functional domain can increase the half-life of the RNA-guided DNA binding agent. In some embodiments, the heterologous functional domain can decrease the half-life of the RNA-guided DNA binding agent. In some embodiments, the heterologous functional domain can increase the stability of the RNA-guided DNA binding agent. In some embodiments, the heterologous functional domain can decrease the stability of the RNA-guided DNA binding agent. In some embodiments, the heterologous functional domain can act as a signal peptide for protein degradation. In some embodiments, the protein degradation can be mediated by proteolytic enzymes, such as, for example, proteasomes, lysosomal proteases, or calpain proteases. In some embodiments, the heterologous functional domain can comprise a PEST sequence. In some embodiments, the RNA-guided DNA binding agent can be modified by adding ubiquitin or polyubiquitin chains. In some embodiments, the ubiquitin can be a ubiquitin-like protein (UBL). Non-limiting examples of ubiquitin-like proteins include small ubiquitin-like modifier (SUMO), ubiquitin cross-reactive protein (UCRP, also known as interferon-stimulated gene-15 (ISG15)), ubiquitin-related modifier 1 (URM1), developmentally downregulated protein-8 expressed in neural precursor cells (NEDD8, also called Rub1 in S. cerevisiae), human leukocyte antigen F-related (FAT10), autophagy-8 (ATG8) and autophagy-12 (ATG12), Fau ubiquitin-like protein (FUB1), membrane-anchored UBL (MUB), ubiquitin-fold modifier-1 (UFM1), and ubiquitin-like protein-5 (UBL5).
[0220] In some embodiments, the heterologous functional domain may be a marker domain. Non-limiting examples of marker domains include fluorescent proteins, purification tags, epitope tags, and reporter gene sequences. In some embodiments, the marker domain may be a fluorescent protein. Non-limiting examples of suitable fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, sfGFP, EGFP, Emerald, Azami Green, Monomeric Azami Green, CopGFP, AceGFP, ZsGreen1), yellow fluorescent proteins (e.g., YFP, EYFP, Citrine, Venus, YPet, PhiYFP, ZsYellow1), blue fluorescent proteins (e.g., EBFP, EBFP2, Azurite, mKalamal, GFPuv, Sapphire, T-sapphire), cyan fluorescent proteins (e.g., ECFP, Cerulean, CyPet, AmCyan1, Midoriishi-Cyan), red fluorescent proteins (e.g., mKate, mKate2, mPlum, DsRed), and the like. Monomeric fluorescent proteins include, but are not limited to, fluorescent proteins (e.g., mono, mCherry, mRFP1, DsRed-Express, DsRed2, DsRed-Monomer, HcRed-Tandem, HcRed1, AsRed2, eqFP611, mRasberry, mStrawberry, JRed), orange fluorescent protein (mOrange, mKO, Kusabira-Orange, Monomeric Kusabira-Orange, mTangerine, tdTomato), and any other suitable fluorescent protein. In another embodiment, the marker domain can be a purification tag or an epitope tag.Non-limiting exemplary tags include glutathione-S-transferase (GST), chitin-binding protein (CBP), maltose-binding protein (MBP), thioredoxin (TRX), poly(NANP), tandem affinity purification (TAP) tag, myc, AcV5, AU1, AU5, E, ECS, E2, FLAG, HA, nus, Softag 1, Softag 3, Strep, SBP, Glu-Glu, HSV, KT3, S, S1, T7, V5, VSV-G, 6xHis, 8xHis, biotin carboxyl carrier protein (BCCP), poly-His, and calmodulin. Non-limiting exemplary reporter genes include glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT), β-galactosidase, β-glucuronidase, luciferase, and fluorescent proteins.
[0221] In further embodiments, the heterologous functional domain may be an effector domain. When an RNA-guided DNA binding agent is guided to its target sequence, for example, when a Cas nuclease is guided to the target sequence by gRNA, the effector domain may modify or affect the target sequence. In some embodiments, the effector domain may be selected from a nucleic acid binding domain, a nuclease domain (e.g., a non-Cas nuclease domain), an epigenetic modification domain, a transcription activation domain, or a transcription repressor domain. In some embodiments, the heterologous functional domain is a nuclease such as FokI nuclease. See, for example, U.S. Patent No. 9,023,649. In some embodiments, the heterologous functional domain is a transcription activator or a transcription repressor. See, for example, Qi et al., "Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression," Cell 152:1173-83 (2013); Perez-Pinera et al., "RNA-guided gene activation by CRISPR-Cas9-based transcription factors," Nat. Methods 10:973-6 (2013); Mali et al., "CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering," Nat. Biotechnol. 31:833-8 (2013); and Gilbert et al., "CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes," Cell 154:442-51 (2013). Thus, RNA-guided DNA binders essentially become transcription factors that can be induced to bind to desired target sequences using guide RNAs.In some embodiments, the heterologous functional domain is a deaminase, such as a cytidine deaminase or an adenine deaminase, hi certain embodiments, the heterologous functional domain is a C to T base converter (cytidine deaminase), such as an apolipoprotein B mRNA editing enzyme (APOBEC) deaminase.
[0222] Determining gRNA efficacy In some embodiments, the efficacy of the gRNA is determined when it is delivered or expressed together with other components that form RNPs. In some embodiments, the gRNA is expressed together with an RNA-guided DNA binder, such as a Cas protein, e.g., Cas9. In some embodiments, the gRNA is delivered or expressed into a cell line that already stably expresses an RNA-guided DNA nuclease, such as a Cas nuclease or nickase, e.g., a Cas9 nuclease or nickase. In some embodiments, the gRNA is delivered to cells as part of an RNP. In some embodiments, the gRNA is delivered to cells together with an mRNA encoding an RNA-guided DNA nuclease, such as a Cas nuclease or nickase, e.g., a Cas9 nuclease or nickase.
[0223] As described herein, the use of the RNA-guided DNA-binding nucleases and guide RNAs disclosed herein can cause double-strand breaks in DNA that can result in errors in the form of insertion / deletion (indel) mutations upon repair by the cellular machinery. Many mutations resulting from indels alter the reading frame or introduce premature stop codons, thus producing non-functional proteins. In some embodiments, the efficacy of a particular gRNA is determined based on an in vitro model. In some embodiments, the in vitro model is HEK293 cells stably expressing Cas9 (HEK293_Cas9). In some embodiments, the in vitro model is a primary cell line, e.g., a primary liver cell line, e.g., primary hepatocytes. In some embodiments, the primary hepatocytes are primary human hepatocytes. Regarding the use of primary cells, commercially available primary cells can be used to increase consistency between experiments. In some embodiments, the number of off-target sites at which deletions or insertions occur in an in vitro model (e.g., in primary hepatocytes) is determined, for example, by analyzing genomic DNA from cells transfected in vitro with Cas9 mRNA and guide RNA. In some embodiments, such determination involves analyzing genomic DNA from cells transfected in vitro with Cas9 mRNA, guide RNA, and donor oligonucleotides. Exemplary procedures for such determination are provided in the Examples, in which HEK293 cells or primary hepatocytes are used.
[0224] In some embodiments, the efficacy of a particular gRNA is determined across multiple in vitro cell models in the gRNA selection process. In some embodiments, cell line comparisons of selected gRNAs and data are performed. In some embodiments, cross-screening across multiple cell models is performed.
[0225] In some embodiments, the efficacy of the guide RNA is measured by the percentage of indels or genetic modifications in PCSK9. In some embodiments, the efficacy of the guide RNA is measured by the percentage of indels or genetic modifications at the PCSK9 locus. In some embodiments, the efficacy of the guide RNA is measured by the percentage of indels or genetic modifications in PCSK9 at the genomic coordinates in Table 1. In some embodiments, the percentage of PCSK9 editing is compared to the percentage of indels or genetic modifications required to achieve a reduction, e.g., knockdown, of PCSK9 protein product. In some embodiments, the efficacy of the guide RNA is measured by a reduction in PCSK9 protein expression. In embodiments, the reduction in PCSK9 protein expression is measured by ELISA, e.g., as described herein.
[0226] In some embodiments, expression of PCSK9 protein is reduced in a cell population using the methods and compositions disclosed herein, hi some embodiments, the level of the protein, as determined, for example, by ELISA, is reduced by at least 55%, 60%, 65%, 70%, 75%, preferably at least 80%, 85%, 90%, or 95%, compared to a control population of unmodified cells.
[0227] An "unmodified cell" (or "plurality of unmodified cells") refers to a control cell (or plural control cells) of the same type of cell in an experiment or test, where the "unmodified" control cell is not contacted with a PCSK9 guide. Thus, the unmodified cell (or plural unmodified cells) can be a cell that is not contacted with a guide RNA or a cell that is contacted with a guide RNA that does not target PCSK9.
[0228] In some embodiments, the efficacy of a guide RNA is measured by the number or frequency of indels or genetic modifications at off-target sequences within the genome of a target cell type, such as primary hepatocytes. In some embodiments, effective guide RNAs are provided that produce indels at a very low frequency (e.g., less than 5%) at off-target sites relative to the frequency of indels produced in the cell population or at the target site. Thus, the present disclosure provides guide RNAs that produce no off-target indels or less than 5% off-target indels relative to the frequency of indels produced in the cell population or at the target site in a target cell type (e.g., primary hepatocytes). In some embodiments, the present disclosure provides guide RNAs that produce no off-target indels relative to control cells in a target cell type (e.g., primary hepatocytes). In some embodiments, guide RNAs are provided that produce indels at fewer than five off-target sites, e.g., as assessed by one or more methods described herein. In some embodiments, guide RNAs are provided that create indels at no more than 4, no more than 3, no more than 2, or no more than 1 off-target site, e.g., as assessed by one or more methods described herein. In some embodiments, the off-target site(s) are not found in protein-coding regions of the target cell (e.g., hepatocyte) genome.
[0229] In some embodiments, the efficacy of a guide RNA is measured in vivo, e.g., in an animal or animal model having a DNA sequence susceptible to cleavage by a nuclease targeted by the guide RNA, i.e., a DNA sequence sufficiently complementary to the target sequence within the guide RNA proximal to the guide and cognate PAM for the nuclease. In some embodiments, the animal has an endogenous DNA sequence susceptible to cleavage by a nuclease targeted by the guide RNA. In some embodiments, the animal model is a transgenic model, e.g., a mouse model having an inserted DNA sequence susceptible to cleavage by a nuclease targeted by the guide RNA, e.g., a mouse having an inserted human DNA sequence, e.g., a transgenic mouse into which a human PCSK9 sequence has been inserted. The inserted sequence may or may not include one or more intronic or regulatory sequences, e.g., 3'UTR, 5'UTR, present in the human gene in its natural context. In some embodiments, the human DNA sequence may replace a homologous endogenous DNA sequence, e.g., a mouse PCSK9 gene is replaced by a human PCSK9 gene. In certain embodiments, the human gene is present in a mouse in the context of human liver cells, for example, a mouse with a humanized liver available from PhoenixBio.
[0230] In some embodiments, the animal model is a rodent.In some embodiments, the rodent is a mouse or a rat.In some embodiments, the animal model is an animal that expresses human PCSK9, for example, a mouse that expresses human PCSK9 from an expression construct, for example, a viral vector, or a transgenic mouse that expresses human PCSK9.In some embodiments, the animal model is a high-fat-fed animal or a hyperlipidemic animal, optionally an animal that expresses human PCSK9, for example, a human PCSK9-expressing mouse.
[0231] In some embodiments, detection of gene editing events, such as the formation of insertion / deletion ("indel") mutations in target DNA or insertion or homology-directed repair (HDR) events, utilizes linear amplification with tagged primers and isolation of the tagged amplification products (hereinafter referred to as "LAM-PCR" or "Linear Amplification (LA)" method). In some embodiments, the efficacy of the guide RNA is measured by the level of a functional protein complex comprising the expressed protein product of the gene. In some embodiments, the efficacy of the guide RNA is measured by ELISA.
[0232] Genetic modification for inhibition of target gene expression An engineered cell or population of cells includes, for example, a genetic modification of an endogenous nucleic acid sequence encoding PCSK9.
[0233] In some embodiments, the engineered cells or cell populations comprise a genetic modification of the PCSK9 gene, as assessed by sequencing, e.g., NGS, such that at least 50%, 55%, 60%, 65%, 70%, 75%, and preferably at least 80%, 85%, or 90% of the cells comprise an insertion, deletion, or substitution in the endogenous PCSK9 sequence. In some embodiments, at least 50% of the cells in the population comprise a modification selected from an insertion, deletion, and substitution in the endogenous PCSK9 sequence. In some embodiments, at least 80% of the cells in the population comprise a modification selected from an insertion, deletion, and substitution in the endogenous PCSK9 sequence. In some embodiments, at least 85% of the cells in the population comprise a modification selected from an insertion, deletion, and substitution in the endogenous PCSK9 sequence. In some embodiments, at least 90% of the cells in the population comprise a modification selected from an insertion, deletion, and substitution in the endogenous PCSK9 sequence. In some embodiments, the cells in the population comprise hepatocytes in the liver. In some embodiments, PCSK9 expression is reduced by at least 50%, 55%, 60%, 65%, 70%, 75%, preferably at least 80%, 85%, or 90% relative to a suitable control (e.g., a control in which the PCSK9 gene is not modified). In some embodiments, PCSK9 expression is reduced by at least 70% or to below the limit of detection of the assay compared to a suitable control, e.g., one in which the PCSK9 gene is not modified. In some embodiments, PCSK9 expression is reduced by at least 75% or to below the limit of detection of the assay compared to a suitable control, e.g., one in which the PCSK9 gene is not modified. In some embodiments, PCSK9 expression is reduced by at least 80% or to below the limit of detection of the assay compared to a suitable control, e.g., one in which the PCSK9 gene is not modified. In some embodiments, PCSK9 expression is reduced by at least 85% or to below the limit of detection of the assay compared to a suitable control, e.g., one in which the PCSK9 gene is not modified. In some embodiments, expression of PCSK9 is reduced by at least 90% compared to a suitable control, eg, one in which the PCSK9 gene is not modified, or to below the detection limit of the assay.In some embodiments, expression of PCSK9 is reduced by 95% or less compared to a suitable control, e.g., one in which the PCSK9 gene is not modified. Assays for PCSK9 protein and mRNA expression are known in the art.
[0234] It is understood that in some embodiments, expression levels may be inhibited in one, but not all, tissues in which the target gene is expressed in vivo. For example, many genes are primarily expressed in the liver, but may also be expressed in other tissues. In certain embodiments, the level of expression inhibition may be with respect to a specific tissue or cell type, but not systemic expression (e.g., inhibition of liver expression rather than systemic expression). In certain embodiments, surrogate markers may be used to monitor changes in expression. For example, many proteins produced in the liver are secreted into the circulation. Thus, the level of expression inhibition may be determined by or correlated with a decrease in the level of the protein in the blood. In certain embodiments, inhibition of expression in the liver may result in changes in metabolites or other biomarkers in bodily fluids, such as blood or urine. Changes in metabolite levels may correlate with the level of expression inhibition. Such correlations may be useful, for example, to monitor the level of expression inhibition in lieu of serial biopsies, which are often impractical for monitoring in human subjects or animal models. The level of inhibition of protein expression, or the absolute level, in the blood or serum following treatment with an agent that reduces protein expression in the liver correlates with treatment outcome.
[0235] In some embodiments, target genes are genetically modified using guide RNAs with RNA-guided DNA binding agents, resulting in the inhibition of expression in cells. In some embodiments, disclosed herein are cells engineered by, for example, using guide RNAs with RNA-guided DNA binding agents (e.g., CRISPR / Cas systems) to induce breaks (e.g., double-strand breaks (DSBs) or single-strand breaks (nicks)) in target genes of cells. This method can be used in vitro, for example, for screening guides, or in vivo, for example, to provide therapeutic benefits.
[0236] In some embodiments, the guide RNA mediates target-specific cleavage by an RNA-guided DNA-binding agent (e.g., a Cas nuclease, e.g., a SpyCas9 nuclease) at a site described herein within the target gene. It will be understood that in some embodiments, the guide RNA comprises a guide sequence that binds to or is capable of binding to said region.
[0237] III. METHODS AND USES, INCLUDING THERAPEUTIC METHODS AND USES, OF GENOME-EDITING AGENTS The gRNAs and related methods and compositions disclosed herein are useful for generating genome editing therapeutics.
[0238] In some embodiments, a gRNA containing a guide sequence from Table 1 induces a DSB together with an RNA-guided DNA nuclease, such as a Cas nuclease, and non-homologous end joining (NHEJ) during repair causes modifications, e.g., mutations, in, for example, the PCSK9 gene. In some embodiments, NHEJ causes deletion or insertion of nucleotide(s), inducing a frameshift or nonsense mutation in the PCSK9 gene. In some embodiments, a gRNA containing a guide sequence targeting a target genomic sequence is also delivered to a cell, together with or separately from an RNA-guided DNA nuclease, such as a Cas nuclease, to effect genetic modification of the target genomic sequence and inhibit expression of a full-length expression product from the target gene. In some embodiments, the gRNA is an sgRNA.
[0239] In some embodiments, the guide RNAs, compositions, and formulations are used to produce cells, e.g., liver cells, e.g., hepatocytes, in vivo, having a genetic modification in the PCSK9 gene. In some embodiments, the cells are in a subject.
[0240] In some embodiments, the subject is a mammal. In some embodiments, the subject is a human. In some embodiments, the subject is a non-human primate.
[0241] In some embodiments, the subject has or is at risk of having a PCSK9-related disease or condition. As used herein, "PCSK9-related disease or condition" or "PCSK9-related disease or condition" is intended to include any disease or condition associated with the expression or activity of the PCSK9 gene or protein. Such diseases or conditions may be caused, for example, by overproduction of PCSK9 protein, by PCSK9 gene mutations, by abnormal cleavage of PCSK9 protein, or by abnormal interactions between PCSK9 and other proteins or other endogenous or exogenous substances. Exemplary PCSK9-related diseases include lipidemia, e.g., hyperlipidemia, and other forms of lipid imbalance, such as hypercholesterolemia and hypertriglyceridemia, as well as pathologies associated with these disorders, e.g., heart and circulatory disease. In some embodiments, the PCSK9-related disease or condition is selected from the group consisting of cardiovascular disease or chronic liver injury. In some embodiments, PCSK9-associated diseases or conditions include, but are not limited to, hypercholesterolemia (e.g., total blood cholesterol levels >190 mg / dl, or LDL-cholesterol levels >100 mg / dl), familial hypercholesterolemia (FH), autosomal dominant hypercholesterolemia (ADH), autosomal recessive hypercholesterolemia (ARH), hyperlipidemia, hypertriglyceridemia, coronary artery disease, stroke, myocardial infarction, obesity, xanthomas, atherosclerosis, aortic stenosis, fatty liver, hypertension, type 2 diabetes, and insulin resistance.
[0242] Familial hypercholesterolemia (FH) is characterized by significantly elevated LDL cholesterol (LDL-C) levels (e.g., >190 mg / dL in adults and >160 mg / dL in children), which leads to atherosclerotic plaque deposition in the coronary arteries and proximal aorta at an early age and increases the risk of cardiovascular disease, which may manifest as angina, myocardial infarction, or stroke. FH is a familial genetic disorder caused by pathogenic mutations in one of three genes (APOB, LDLR, and PCSK9). Patients may be heterozygous or homozygous for the mutation.
[0243] Autosomal dominant hypercholesterolemia (ADH) and autosomal recessive hypercholesterolemia (ARH) are other forms of hypercholesterolemia, also characterized by excessive blood cholesterol levels (Cohen, JC, (2003) Curr. Opin. Lipidol. 14, 121-127). ADH results from a defect in LDL uptake by the liver, which can be caused by mutations in the LDLR that prevent LDL uptake or by mutations in apolipoprotein B, a protein on LDL that is involved in binding of LDL to the LDLR. ARH is caused by mutations in the ARH protein, which is required for endocytosis of the LDLR-LDL complex through interaction with clathrin.
[0244] It is understood that a subject with a PCSK9-related disease may be treated with one or more additional therapeutic agents within the standard of care for treating a lipid disorder or a condition associated with a lipid disorder, e.g., cardiovascular disease, e.g., hypertension, type 2 diabetes, or insulin resistance. In some embodiments, the subject is treated with the additional agent until a decrease in serum PCSK9 levels is observed. In some embodiments, the subject is treated with the additional agent until a change in a sign or symptom associated with a PCSK9-related disease is observed (e.g., a decrease in blood pressure before cessation of treatment with one or more agents to reduce hypertension, or a normalization of blood glucose or blood glucose control before cessation of treatment with one or more agents to normalize blood glucose or blood glucose control). In some embodiments, the subject is treated with one or more PCSK9 inhibitors. In some embodiments, the subject is treated with one or more anti-PCSK9 monoclonal antibodies. In some embodiments, the subject is treated with evolocumab. In some embodiments, the subject is treated with alirocumab. In some embodiments, the subject is treated with butrisiran.
[0245] Examples of additional therapeutic agents include those known to treat lipid disorders such as hypercholesterolemia, atherosclerosis, or dyslipidemia. For example, gRNAs featured in the present invention can be administered with, for example, an HMG-CoA reductase inhibitor (e.g., statin), a fibrate, a bile acid sequestrant, niacin, an antiplatelet agent, an angiotensin-converting enzyme inhibitor, an angiotensin II receptor antagonist (e.g., losartan potassium), an acyl-CoA cholesterol acetyltransferase (ACAT) inhibitor, a cholesterol absorption inhibitor, a cholesterol ester transfer protein (CETP) inhibitor, a microsomal triglyceride transfer protein (MTTP) inhibitor, a cholesterol modulator, a bile acid modulator, a peroxisome proliferator-activated receptor (PPAR) agonist, a glycoprotein IIb / IIIa inhibitor, aspirin or an aspirin-like compound, an IB AT inhibitor, a squalene synthase inhibitor, or a monocyte chemoattractant protein (MCP)-I inhibitor. Exemplary HMG-CoA reductase inhibitors include atorvastatin, pravastatin, simvastatin, lovastatin, fluvastatin, cerivastatin, rosuvastatin, and pitivastatin. Exemplary fibrates include, for example, bezafibrate, clofibrate, fenofibrate, gemfibrozil, and ciprofibrate. Exemplary bile acid sequestrants include, for example, cholestyramine, colestipol, and colesevelam. Exemplary niacin treatments include, for example, immediate-release and extended-release formulations. Exemplary antiplatelet agents include, for example, aspirin, clopidogrel, and ticlopidine. Exemplary angiotensin-converting enzyme inhibitors include, for example, ramipril and enalapril. Exemplary acyl-CoA cholesterol acetyltransferase (AC AT) inhibitors include, for example, avasimibe and eflutimibe. Exemplary cholesterol absorption inhibitors include, for example, ezetimibe and pamaqueside. Exemplary CETP inhibitors include, for example, torcetrapib, JTT-705, and CETi-I.Exemplary microsomal triglyceride transfer protein (MTTP) inhibitors include, for example, implitapide, R-103757, and CP-346086.
[0246] Exemplary bile acid modulators include, for example, HBS-107 (Hisamitsu / Banyu), Btg-511 (British Technology Group), BARI-1453 (Aventis), S-8921 (Shionogi), SD-5613 (Pfizer), and AZD-7806 (AstraZeneca). Exemplary peroxisome proliferator-activated receptor (PPAR) agonists include, for example, tesaglitazoI and netoglitazone. Exemplary glycoprotein Ilb / IIIa inhibitors include, for example, roxifiban, gantofiban, and chromafiban. The anti-atherosclerotic agent BO-653 (Chugai Pharmaceutical) and the nicotinic acid derivative niclin are also suitable for administration in combination with the gRNAs featured in the present invention. Exemplary combination therapies suitable for administration with a gRNA targeting PCSK9 include, for example, advicol, amlodipine / atorvastatin, and ezetimibe / simvastatin. Drugs for treating hypercholesterolemia that are suitable for administration in combination with a gRNA targeting PCSK9 include, for example, lovastatin, amlodipine besylate, atorvastatin, rosuvastatin, fluvastatin, niacin, pravastatin, fenofibrate, ezetimibe, simvastatin, colesevelam, and ezetimibe.
[0247] In some embodiments, the method includes instructing an end user, e.g., a healthcare provider, a subject, to administer an additional agent, such as those provided above, in conjunction with administration of the gRNA provided herein. In some embodiments, the additional agent, i.e., one or more additional agents, are administered in conjunction with the gRNA before, during, or after administration of the gRNA, e.g., until a desired clinical outcome is achieved, e.g., a reduction in blood pressure or serum cholesterol or lipids; normalization of blood glucose.
[0248] In one embodiment, the invention provides a method of treating a patient by selecting the patient based on the patient's need for LDL lowering, LDL lowering without HDL lowering, ApoB lowering, or total cholesterol lowering. The method includes administering a gRNA to the patient in an amount sufficient to lower the patient's LDL or ApoB levels, e.g., without substantially lowering HDL levels.
[0249] Genetic predisposition is involved in the development of target gene-related diseases, such as hyperlipidemia. However, for most variants detected during molecular screening of patients with clinical familial hypercholesterolemia (FH), the lack of functional evidence can make a definitive diagnosis difficult (see, e.g., Di Costanzo et al. (2021) J Clin Lipidol, 15:822-831). Therefore, patients in need of gRNAs can be identified by referring to family history or by screening for one or more genetic markers or variants, typically in conjunction with or prompted by signs of hyperlipidemia. Examples of genes involved in hyperlipidemia include, but are not limited to, LDL receptor (LDLR), apolipoproteins (ApoA1, ApoB, ApoE, etc.), cholesteryl ester transfer protein (CETP), lipoprotein lipase (LPL), hepatocyte lipase (LIPC), endothelial lipase (EL), and lecithin xolesteryl acyltransferase (LCAT). Population-based genomic studies, such as the UK Biobank, are expected to further define genetic markers associated with familial hypercholesterolemia and other hyperlipidemias.
[0250] A healthcare provider, such as a doctor, nurse, or geneticist, can investigate family history before prescribing or administering a gRNA agent of the present invention. Additionally, tests may be performed to determine genotype or phenotype. For example, before a PCSK9 gRNA is administered to a patient, DNA testing may be performed on a sample from the patient, such as a blood sample, to identify the PCSK9 genotype or phenotype. Both pathogenic and benign PCSK9 variants can be found in the NCBI SNP database, for example, at www.ncbi.nlm.nih.gov / snp / ?LinkName=gene_snp&from_uid=255738. In another embodiment, tests are performed to identify associated genotypes or phenotypes, such as the LDLR genotype. Examples of genetic variants of the LDLR gene can be found in the art, for example, in the following publications, which are incorporated by reference: Costanza et al. (2005) Am J Epidemiol. 15; 161(8): 714-24; Yamada et al. (2008) J Med Genet. Jan; 45(1): 22-8, Epub 2007 Aug 31; and Boes et al. (2009) Exp. Gerontol 44: 136-160, Epub 2008 Nov 17.
[0251] Delivery of gRNA compositions Lipid nanoparticles (LNPs) are well-known vehicles for the delivery of nucleotide and protein cargoes and can be used to deliver the guide RNAs and compositions disclosed herein in vivo and in vitro. In some embodiments, LNPs deliver nucleic acid cargo, protein cargo, or a combination of nucleic acid and protein cargo.
[0252] In some embodiments, methods are provided for delivering any one of the cells or cell populations disclosed herein to a subject, wherein the gRNA is delivered in vivo via LNPs. In some embodiments, the gRNA / LNP also associates with Cas9 or an mRNA encoding Cas9.
[0253] In some embodiments, a composition is provided comprising any one of the gRNAs disclosed herein and a LNP. In some embodiments, the composition further comprises Cas9 or an mRNA encoding Cas9.
[0254] In some embodiments, the LNPs associated with the gRNAs disclosed herein are for use in preparing a medicament for treating a disease or disorder.
[0255] In some embodiments, a method for in vivo delivery of any one of the gRNAs disclosed herein is provided, wherein the gRNA is associated with a LNP. In some embodiments, the gRNA is not associated with a LNP. In some embodiments, the gRNA / LNP or gRNA is also associated with Cas9 or an mRNA encoding Cas9.
[0256] In some embodiments, the guide RNA compositions described herein, alone or encoded on one or more vectors, are formulated in or administered via lipid nanoparticles (LNPs). See, e.g., WO2017 / 173054 and WO2021 / 222287 (the entire contents of each of which are incorporated herein by reference).
[0257] In some embodiments, a DNA or RNA vector is provided that encodes any of the guide RNAs comprising any one or more of the guide sequences described herein. In some embodiments, in addition to the guide RNA sequence, the vector further comprises a nucleic acid that does not encode a guide RNA. The nucleic acid that does not encode a guide RNA includes, but is not limited to, a promoter, an enhancer, a regulatory sequence, and a nucleic acid that encodes an RNA-guided DNA-binding nuclease (which can be a nuclease such as Cas9). In some embodiments, the vector comprises one or more nucleotide sequences encoding a crRNA, a trRNA, or a crRNA and a trRNA. In some embodiments, the vector comprises one or more nucleotide sequences encoding an sgRNA and an mRNA that encodes an RNA-guided DNA-binding nuclease, which can be a Cas nuclease, such as a Cas9 nuclease, such as SpyCas9 cleavase. In some embodiments, the vector comprises one or more nucleotide sequences encoding a crRNA, a trRNA, and an mRNA that encodes an RNA-guided DNA-binding nuclease (which can be a Cas protein, such as Cas9). In one embodiment, Cas9 is derived from Streptococcus pyogenes (i.e., Spy Cas9). In some embodiments, the nucleotide sequence encoding the crRNA, trRNA, or crRNA and trRNA (which may also be an sgRNA) comprises or consists of guide sequences flanking all or part of repeat sequences derived from a naturally occurring CRISPR / Cas system. A nucleic acid comprising or consisting of a crRNA, trRNA, or crRNA and trRNA may further comprise a vector sequence comprising or consisting of a nucleic acid not found in conjunction with the crRNA, trRNA, or crRNA and trRNA in nature.
[0258] In some embodiments, components can be introduced into cells as naked nucleic acid, as nucleic acid complexed with an agent such as liposomes or poloxamers, or delivered by viral vectors (e.g., adenovirus, AAV, herpesvirus, retrovirus, lentivirus). Methods and compositions for non-viral delivery of nucleic acids include electroporation, lipofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, LNPs, polycation or lipid:nucleic acid conjugates, naked nucleic acid (e.g., naked DNA / RNA), artificial virions, and drug-enhanced uptake of DNA. Sonoporation, for example, using the Sonitron 2000 system (Rich-Mar), can also be used to deliver nucleic acids.
[0259] This description and exemplary embodiments should not be construed as limiting. For purposes of this specification and the appended claims, unless otherwise expressly stated, all numerical values expressing quantities, percentages, or ratios, as well as other numerical values used in the specification and claims, unless already so modified, should be understood to be modified in all instances by the term "about." Accordingly, unless otherwise indicated, the numerical parameters set forth in the following specification and appended claims are approximations and may vary depending upon the desired properties sought to be achieved and the tolerances accepted in the art. There is no intention to limit the application of the doctrine of equivalents to the scope of the claims, and at the very least, each numerical parameter should be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. [Example]
[0260] IV. Working Examples The following examples are provided to illustrate certain disclosed embodiments and should not be construed in any way as limiting the scope of the disclosure.
[0261] Example 1. Materials and Methods In vitro transcription ("IVT") of nuclease mRNA Capped and polyadenylated mRNA containing N1-methylpseudo-U was generated by in vitro transcription using conventional methods. Typically, a DNA plasmid containing a T7 promoter, transcription sequence, and polyadenylation region was linearized with XbaI according to the manufacturer's protocol. XbaI was inactivated by heating. The linearized plasmid was purified from enzymes and buffer salts. An IVT reaction to generate modified mRNA was performed by incubating 50 ng / μL of linearized plasmid; 2–5 mM each of GTP, ATP, CTP, and N1-methylpseudo-UTP (Trilink); 10–25 mM ARCA (Trilink); 5 U / μL T7 RNA polymerase; 1 U / μL mouse RNase inhibitor (NEB); 0.004 U / μL inorganic E. coli pyrophosphatase (NEB); and 1x reaction buffer at 37°C. TURBO DNase (Thermo Fisher) was added to a final concentration of 0.01 U / μL, and the reaction was incubated at 37°C to remove the DNA template.
[0262] mRNA was purified using the MegaClear Transcription Cleanup Kit (Thermo Fisher) or the RNeasy Maxi Kit (Qiagen) according to the manufacturer's protocol. Alternatively, mRNA was purified using a precipitation protocol (occasionally followed by HPLC-based purification). Briefly, after DNase digestion, mRNA was purified using LiCl, ammonium acetate, and sodium acetate precipitations. For HPLC-purified mRNA, after LiCl precipitation and reconstitution, mRNA was purified by RP-IP HPLC (see, e.g., Kariko, et al. Nucleic Acids Research, 2011, Vol. 39, No. 21 el42). Fractions selected for pooling were combined and desalted by sodium acetate / ethanol precipitation as described above. In a further alternative method, mRNA was purified by LiCl precipitation followed by further purification by tangential flow filtration. RNA concentrations were determined by measuring light absorbance at 260 nm (Nanodrop), and transcripts were analyzed by capillary electrophoresis with a Bioanalyzer (Agilent).
[0263] Streptococcus pyogenes ("Spy") Cas9 mRNA was generated from plasmid DNA encoding open reading frames according to SEQ ID NOs: 1003, 1006, and 1009 (see sequences in Table 23). When the sequences cited in this paragraph are referred to below in reference to RNA, it is understood that T should be replaced with U (which may be a modified nucleoside as described above). Messenger RNAs used in the examples include a 5' cap and a 3' polyadenylation sequence, e.g., up to 100 nt. Guide RNAs were chemically synthesized by commercial vendors or using standard in vitro synthesis techniques using modified nucleotides.
[0264] Preparation of LNP formulations containing sgRNA and Cas9 mRNA Generally, lipid nanoparticle components were dissolved in 100% ethanol at various molar ratios. RNA cargo (e.g., Cas9 mRNA and sgRNA) was dissolved in 25 mM citric acid, 100 mM NaCl, pH 5.0, to a concentration of approximately 0.45 mg / mL of RNA cargo. The LNP used was the ionized lipid ((9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyloctadeca-9,12-dienoate, also known as 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl(9Z,12Z)-octadeca-9,12 The LNPs contained lipid A, cholesterol, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), and 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol 2000 (PEG2K-DMG) (e.g., catalog number GM-020, NOF, Tokyo, Japan) in a molar ratio of 50% lipid A, 38% cholesterol, 9% DSPC, and 3% PEG2k-DMG. The LNPs were formulated with a lipid amine to RNA phosphate (N:P) molar ratio of approximately 6 and a gRNA to mRNA weight ratio of 1:2. The LNPs used contain a single RNA species, such as Cas9 mRNA or sgRNA. LNPs are similarly prepared using a mixture of Cas9 mRNA and guide RNA.
[0265] LNPs were prepared using a cross-flow technique by impingement jet mixing of lipids in ethanol with two volumes of RNA solution and one volume of water. First, lipid-containing ethanol was mixed with two volumes of RNA solution through a mixing cross. Next, a fourth stream of water was mixed with the outlet stream from the cross via an in-line T-junction (see Figure 2 in WO2016010840). The LNPs were held at room temperature for 1 hour and further diluted with water (approximately 1:1 v / v). The diluted LNPs were buffer-exchanged into 50 mM Tris, 45 mM NaCl, 5% (w / v) sucrose, pH 7.5 (TSS) and optionally concentrated by methods known in the art. The resulting mixture was then filtered using a 0.2 μm sterile filter. The final LNPs were characterized to determine encapsulation efficiency, polydispersity index, and mean particle size. The final LNPs were stored at 4°C or -80°C until further use.
[0266] Hepatocyte preparation Primary human hepatocytes (PHH) and primary cynomolgus monkey hepatocytes (PCH) were prepared as follows: Cells were thawed, resuspended in 50 mL of cryopreserved hepatocyte recovery medium (CHRM) (Invitrogen, CM7000), and centrifuged. Cells were resuspended in hepatocyte medium containing plating supplements such as William's E Medium Plating Supplements (Gibco, catalog A13450) containing fetal bovine serum (FBS). Cells were pelleted by centrifugation, resuspended in medium, and seeded onto Bio-coat collagen I-coated 96-well plates (Corning #354407). The seeded cells were allowed to adhere for 4–6 hours in a tissue culture incubator at 37°C and 5% CO2. After incubation, cells were checked for monolayer formation, washed once, and plated in 100 μL of Hepatocyte Maintenance Medium: William's E Medium (Gibco, Cat. A12176-01) plus supplement pack (Gibco, Cat. CM3000).
[0267] DNA isolation Cells were harvested 72 hours after transfection. DNA was extracted from each well of a 96-well plate using 50 μL / well of QuickExtract DNA Extraction Solution (Epicentre, Cat. No. QE09050) or Quick Extract (Lucigen, Cat. No. SS000035-D2) according to the manufacturer's protocol. Alternatively, DNA was isolated by methods known in the art.
[0268] Next-generation sequencing ("NGS") and editing efficiency analysis To quantitatively determine the editing efficiency at the target location in the genome, sequencing was used to identify the presence of insertions and deletions introduced by gene editing. PCR primers were designed around the target site in the gene of interest (e.g., PCSK9) to amplify the genomic region of interest. The primer sequences were designed according to standards in this field.
[0269] An additional PCR was performed according to the manufacturer's (Illumina) protocol, and sequencing chemistry was added. The amplicons were sequenced on an Illumina MiSeq instrument. After removing low quality scores, the reads were aligned to a reference genome (e.g., hg38). The resulting file containing the reads was mapped to the reference genome (BAM file), reads overlapping the target region of interest were selected, and the number of reads containing insertions or deletions ("indels") relative to the number of wild-type reads was calculated.
[0270] The editing rate (e.g., "editing efficiency," "editing rate," or "indel rate") is defined as the total number of sequence reads containing insertions or deletions ("indels") divided by the total number of sequence reads containing wild-type insertions or deletions.
[0271] Example 2 - In vitro editing in primary hepatocytes sgRNAs targeting the human PCSK9 gene with various targeting sequences were designed and lipofected into primary human hepatocytes (PHH) cells, as shown in Table 1. Cas9 mRNA and gRNA were lipofected using a premixed lipid formulation. The lipofection reagent contained the ionizable lipid ((9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also known as 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl(9Z,12Z)-octadeca-9,12-dienoate) (also referred to herein as lipid A), cholesterol, DSPC, and PEG2k-DMG in the following molar ratios: 50% lipid A, 38% cholesterol, 9% DSPC, and 3% PEG2k-DMG, respectively. This mixture was reconstituted in 100% ethanol and then mixed with RNA cargo (e.g., Cas9 mRNA (SEQ ID NO: 1002) and gRNA) at a lipid amine to RNA phosphate (N:P) molar ratio of approximately 6 to generate a lipid-nucleic acid mixture. The mRNA containing the Cas9 ORF in Table 23 was generated by in vitro transcription (IVT) using a 2-hour IVT reaction time and purifying the mRNA by LiCl precipitation followed by tangential flow filtration, as described in WO2019 / 067910 (see, e.g., ¶354).
[0272] PHH (Gibco, Lot No. 9396) cells were used and seeded at 40,000 and 33,000 cells / well, respectively. Lipofection samples were prepared using an N:P molar ratio of approximately 7 and a gRNA:mRNA weight ratio of 6.5:1. Cells were incubated at 37°C and 5% CO2 for 24 hours before treatment with the lipid-nucleic acid mixture. The lipid-nucleic acid mixture was incubated in medium containing 10% fetal bovine serum (FBS) at 37°C for 10 minutes. After incubation, the lipid-nucleic acid mixture containing 50 ng of Cas9 mRNA was added to the cells. Cells were lysed 72 hours after treatment for NGS analysis as described in Example 1. Average editing results with standard deviations (SD) are shown in Table 5 for PHH. Samples were tested in duplicate. [Table 9]
[0273] Example 3. In vitro editing of primary hepatocytes using a dilution curve Guide RNAs targeting PCSK9 were tested for editing efficacy in primary human hepatocytes (PHH) (Gibco, lot: Hu8381).
[0274] Example 3.1 Cell Preparation PHHs were thawed and resuspended in hepatocyte thawing medium containing dexamethasone plus cocktail supplement (Gibco, catalog A15563, lot 2019842) and plating supplement (William's E medium (Gibco, catalog A12176-01)) containing FBS-containing plating supplement (Gibco, catalog A13450, lot 1970698), followed by centrifugation. The supernatant was discarded, and the pelleted cells were resuspended in hepatocyte plating medium and supplement pack (Invitrogen, catalog A1217601 and Gibco, catalog CM3000). Cells were counted and plated at a density of 33,000 cells / well onto Bio-coat collagen I-coated 96-well plates (Thermo Fisher, catalog 877272). The plated cells were left to adhere for 4–6 hours in a tissue culture incubator at 37°C and 5% CO2. After incubation, cells were checked for monolayer formation and washed once with Hepatocyte Maintenance Medium (Invitrogen, Cat. A1217601 and Gibco, Cat. CM4000).
[0275] Example 3.2 LNP Treatment LNPs were prepared generally as described in Example 1. LNPs contained a molar ratio of 50% lipid A, 38% cholesterol, 9% DSPC, and 3% PEG2k-DMG. LNPs were formulated with a lipid amine to RNA phosphate (N:P) molar ratio of approximately 6 and a gRNA to mRNA (SEQ ID NO: 1002) weight ratio of 1:2. Each LNP was applied to cells using an 8-point, 3-fold dilution curve starting at 300 ng mRNA / 100 μl, as shown in Table 6. [Table 10]
[0276] When treated with LNP, cells were incubated in William's E medium (Gibco, A1217601) containing maintenance supplements and 3% fetal bovine serum at 37°C for 24 hours. After 72 hours, cells were harvested and analyzed by NGS as described in Example 1. EC50 values and mean editing results are shown in Table 7. The dose-response curve is plotted in Figure 1. [Table 11]
[0277] Example 3.3 Proprotein Convertase 9 (PCSK9) ELISA Analysis Used in PHH Seeded cells were cultured in Cellartis Power Primary HEP medium (Takara, Y20020) for approximately 10 days. The medium was changed every other day. Tissue culture medium was collected 48 hours after the final medium change on day 10. Secreted PCSK9 serum levels were determined using a human proprotein convertase 9 (PCSK9) DuoSet ELISA kit (R&D systems, catalog DY3888) with a capture antibody at a final concentration of 2 μg / ml according to the manufacturer's protocol. Plates were read on a Clariostar plate reader at an absorbance of 450 nm with wavelength correction at 570 nm. Serum PCSK9 levels were calculated using a four-parameter logistic curve fit to the standard curve. The dose-response curve for PCSK9 protein (pg / ml) reduction is shown in Figure 2, and the data are presented in Table 8. The final maximum protein reduction is shown in Table 9. Samples were tested in triplicate. Percent protein knockdown (%KD) values were determined relative to the untreated control group. [Table 12] [Table 13]
[0278] Example 4. In vivo editing in mouse liver using lipid nanoparticles (LNPs) The LNPs used in all in vivo studies were formulated as described in Example 1. The transport and storage solution (TSS) used in LNP preparation was administered in the experiments as a vehicle-only negative control. The nucleotide sequences of the sgRNAs contained in the LNPs each target a different sequence within the PCSK9 gene, as shown in Table 2.
[0279] Example 4.1 In vivo editing in a humanized PCSK9 mouse model Guide designs selected from Table 2 were tested for in vivo editing efficiency. Male and female transgenic mice containing the human PCSK9 gene sequence (hPCSK9) in their genomes were used for each study involving mice. hPCSK9 mice were generated on a hybrid C57B6 / 129 background, then backcrossed to B6 once and then outcrossed for cohort expansion. hPCSK9 mice had the mouse PCSK9 gene excised from their genome. Animals were approximately 6 weeks old and weighed before administration. LNP was administered via the lateral tail vein at 0.3 milligrams per kilogram of body weight (e.g., 0.3 mg / kg, or 0.3 mpk). Approximately 24 hours after administration, animals were observed for adverse reactions. 14 days after administration, animals were euthanized by exsanguination under isoflurane anesthesia and cervical dislocation. Blood was collected by cardiac puncture into serum separator tubes or tubes containing buffered sodium citrate for plasma, as described herein. For studies using in vivo editing, liver tissue was collected from the left median lobe of each animal for DNA extraction and analysis.
[0280] For in vivo studies, genomic DNA was extracted from 10 mg of liver tissue using a bead-based extraction kit, e.g., Zymo Quick-DNA96 Kit (Zymo Research, Catalog No. D3010), according to the manufacturer's protocol, including homogenizing the tissue in lysis buffer (approximately 600 μL / 10 mg tissue). All DNA samples were normalized to a concentration of 100 ng / μL for PCR and subsequent NGS analysis, as described in Example 1.
[0281] Example 4.2 PCSK9 ELISA Assay Used in Animal Studies Blood was collected and serum isolated as described above. Total PCSK9 serum levels were determined using a human PCSK9 ELISA kit (Abcam, catalog ab209884). Kit reagents and standards were prepared according to the manufacturer's protocol. Mouse serum was diluted 5-10 times. Both the standard curve dilutions (100 μL each) and diluted serum samples were added to each well of an ELISA plate pre-coated with the capture antibody. The plate was incubated at room temperature for 30 minutes and then washed. An enzyme-antibody conjugate (100 μL per well) was added for a 20-minute incubation. Unbound antibody conjugate was removed, and the plate was washed again before adding the chromogenic substrate solution. After incubating the plate for 10 minutes, 100 μL of stop solution, e.g., sulfuric acid (approximately 0.3 M), was added. The plate was read at 450 nm absorbance on a SpectraMax M5 or Clariostar plate reader. Serum hPCSK9 levels were calculated using SoftMax Pro software version 6.4.2 or Mars software version 3.31 using a four-parameter logistic curve fit from the standard curve. Final serum values were adjusted for assay dilution. Unless otherwise specified, percent protein knockdown (%KD) values were determined relative to controls, typically animals sham-treated with vehicle (TSS).
[0282] Example 4.3 In vivo editing and serum hPCSK9 knockdown LNPs were prepared generally as described in Example 1. LNP formulations were analyzed for mean particle size, polydispersity index (pdi), total RNA content, and RNA encapsulation efficiency as described in Example 1.
[0283] LNPs containing the sgRNAs shown in Table 10 were administered to transgenic hPCSK9 mice (n=4 for all groups) at a dose of 0.3 mg / kg animal weight as described above. The editing efficiency and percent hPCSK9 knockdown (%KD) for LNPs containing the indicated sgRNAs compared to the TSS vehicle-alone negative control are shown in Table 10, and the editing efficiency and hPCSK9 KD levels are shown in Figures 3A and 3B. [Table 14]
[0284] LNPs containing guides selected from Table 10, G016675, G016723, and G016704, were administered as described above to male and female transgenic hPCSK9 mice (n=2 males and n=2 females in each group) at 1 mg / kg, 0.3 mg / kg, and 0.1 mg / kg animal body weight. Table 11 shows the editing efficiency, hPCSK9 protein levels, and percent hPCSK9 knockdown, respectively, for LNPs containing the indicated sgRNAs compared to the TSS vehicle-alone negative control. The editing efficiency, hPCSK9 protein levels, and percent hPCSK9 KD levels are shown in Figures 4A-4C, respectively. [Table 15]
[0285] Example 5. Off-target analysis Example 5.1 Biochemical Off-Target Analysis Biochemical methods (see, e.g., Cameron et al., Nature Methods. 6, 600-606; 2017) were used to determine potential off-target genomic sites cleaved by Cas9 using specific guides targeting PCSK9. Single guide RNAs targeting human PCSK9 were screened using Coriell Institute genomic DNA reference material NA24385 along with two control guides with known off-target profiles. The number of potential off-target sites was detected in the biochemical assay using a guide concentration of 48 nM and a Cas9 protein concentration of 16 nM, and the results are shown in Table 12. [Table 16]
[0286] Example 5.2 Targeted sequencing to validate potential off-target sites The test guides were further evaluated for possible off-target indel formation after editing in cells using amplicon sequencing at potential off-target sites. Each potential off-target site for each guide was identified by the biochemical assays described above or by in silico prediction.
[0287] In this experiment, three sgRNAs targeting human PCSK9 were evaluated in triplicate. Primary human hepatocytes (PHH, Gibco, lot: Hu8284) were seeded and transfected with LNPs containing Cas9 mRNA and sgRNA. Each cell plate was treated with a single-dose transfection of 38.2 nM guide (equivalent to 250 ng of mRNA) to achieve the dose saturation required for further downstream off-target assays. DNA was isolated from cells by lysis and subjected to NGS. Some potential off-target sites failed quality metrics and are not counted toward the total "characterized sites" in Table 13. Repair constructs were validated by manual inspection at loci with statistically relevant indel rates at off-target cleavage sites. [Table 17]
[0288] Example 6. In vitro editing of primary hepatocytes using a dilution curve Guide RNAs targeting PCSK9 were tested for editing efficacy in primary cynomolgus monkey hepatocytes (PCH) (Gibco, lot: PCH-C423).
[0289] Example 6.1 Cell Preparation PCH were thawed and resuspended in hepatocyte thawing medium containing dexamethasone plus cocktail supplement (Gibco, catalog A15563, lot 2019842) and plating supplement (William's E medium (Gibco, catalog A12176-01)) containing FBS-containing plating supplement (Gibco, catalog A13450, lot 1970698), followed by centrifugation. The supernatant was discarded, and the pelleted cells were resuspended in hepatocyte plating medium and supplement pack (Invitrogen, catalog A1217601 and Gibco, catalog CM3000). Cells were counted and plated at a concentration of 40,000 cells / well onto Bio-coat collagen I-coated 96-well plates (Thermo Fisher, catalog 877272). The plated cells were left to adhere for 4–6 hours in a tissue culture incubator at 37°C and 5% CO2. After incubation, cells were checked for monolayer formation and washed once with Hepatocyte Maintenance Medium (Invitrogen, Cat. A1217601 and Gibco, Cat. CM4000).
[0290] Example 6.2 LNP Treatment LNPs were prepared generally as described in Example 1. LNPs contained a molar ratio of 50% lipid A, 38% cholesterol, 9% DSPC, and 3% PEG2k-DMG. LNPs were formulated with a lipid amine to RNA phosphate (N:P) molar ratio of approximately 6 and a gRNA to mRNA (SEQ ID NO: 1002) weight ratio of 1:2. Each LNP was applied to cells using an 8-point, 3-fold dilution curve starting at 200 ng mRNA / 100 μl, as shown in Table 14. [Table 18]
[0291] When treated with LNP, cells were incubated in William's E medium (Gibco, A1217601) containing maintenance supplements and 3% fetal bovine serum at 37°C for 24 hours. Samples were tested in duplicate. After 72 hours, cells were harvested and analyzed by NGS as described in Example 1. EC50 values and mean edit results are shown in Tables 15 and 16. Dose-response curves are plotted in Figures 5A and 5B. [Table 19] [Table 20]
[0292] Example 7. In vitro editing of primary human hepatocytes using a dilution curve Guide RNAs targeting PCSK9 were tested for editing efficacy in primary human hepatocytes (PHH) (Gibco / Thermo Fisher lot: HU8381).
[0293] Example 7.1 Cell Preparation PHHs were thawed and resuspended in hepatocyte thawing medium containing dexamethasone plus cocktail supplement (Gibco, catalog A15563, lot 2019842) and plating supplement (William's E medium (Gibco, catalog A12176-01)) containing FBS-containing plating supplement (Gibco, catalog A13450, lot 1970698), followed by centrifugation. The supernatant was discarded, and the pelleted cells were resuspended in hepatocyte plating medium and supplement pack (Invitrogen, catalog A1217601 and Gibco, catalog CM3000). Cells were counted and plated at a density of 40,000 cells / well onto Bio-coat collagen I-coated 96-well plates (Thermo Fisher, catalog 877272). The plated cells were left to adhere for 4–6 hours in a tissue culture incubator at 37°C and 5% CO2. After incubation, cells were checked for monolayer formation and washed once with Hepatocyte Maintenance Medium (Invitrogen, Cat. A1217601 and Gibco, Cat. CM4000).
[0294] Example 7.2 LNP Treatment LNPs were prepared generally as described in Example 1. LNPs contained a molar ratio of 50% lipid A, 38% cholesterol, 9% DSPC, and 3% PEG2k-DMG. LNPs were formulated with a lipid amine to RNA phosphate (N:P) molar ratio of approximately 6 and a gRNA to mRNA (SEQ ID NO: 1002) weight ratio of 1:2. Each LNP was applied to cells using an 8-point, 3-fold dilution curve starting at 200 ng mRNA / 100 μl, as shown in Table 17. [Table 21]
[0295] For LNP treatment, cells were incubated in William's E medium (Gibco, A1217601) containing maintenance supplements and 3% fetal bovine serum at 37°C for 24 hours. Samples were tested in duplicate. After 72 hours, cells were harvested and analyzed by NGS as described in Example 1. EC50 values and mean edit results are shown in Tables 18, 19, and 20. Dose-response curves are plotted in Figures 6A-6C. [Table 22] [Table 23] [Table 24]
[0296] Example 8. In vitro editing of primary human hepatocytes using a dilution curve Guide RNAs targeting PCSK9, synthesized in two different guide formats, were tested for editing efficacy in primary human hepatocytes (PHH) (Gibco / Thermo Fisher, lots: HU8300, HU8373A, HU8284).
[0297] Example 8.1 Preparation of PHH Cells PHHs were thawed and resuspended in hepatocyte thawing medium containing dexamethasone plus cocktail supplement (Gibco, catalog A15563, lot 2019842) and plating supplement (William's E medium (Gibco, catalog A12176-01)) containing FBS-containing plating supplement (Gibco, catalog A13450, lot 1970698), followed by centrifugation. The supernatant was discarded, and the pelleted cells were resuspended in hepatocyte plating medium and supplement pack (Invitrogen, catalog A1217601 and Gibco, catalog CM3000). Cells were counted and plated at a density of 33,000 cells / well onto Bio-coat collagen I-coated 96-well plates (Thermo Fisher, catalog 877272). The plated cells were left to adhere for 4–6 hours in a tissue culture incubator at 37°C and 5% CO2. After incubation, cells were checked for monolayer formation and washed once with Hepatocyte Maintenance Medium (Invitrogen, Cat. A1217601 and Gibco, Cat. CM4000).
[0298] Example 8.2 LNP Processing and Editing LNPs were prepared generally as described in Example 1. LNPs contained a molar ratio of 50% lipid A, 38% cholesterol, 9% DSPC, and 3% PEG2k-DMG. LNPs were formulated with a lipid amine to RNA phosphate (N:P) molar ratio of approximately 6 and a gRNA to mRNA (SEQ ID NO: 1002) weight ratio of 1:2. Each LNP was applied to cells using a 12-point dose-response curve starting with an LNP dose of 450 ng total RNA by weight.
[0299] Upon treatment with LNP, cells were incubated in William's E medium (Gibco, A1217601) containing maintenance supplements and 3% fetal bovine serum at 37°C for 24 hours. Samples were tested in duplicate. After 72 hours, cells were harvested and analyzed by NGS as described in Example 1. Dose-response curves are plotted in Figures 7A-7C. EC50 values and mean percent editing results are shown in Tables 21A-21C. [Table 25] (*) Editing results were excluded from EC50 calculations because the percent editing was significantly lower (≥5% difference) than the dose that produced maximal editing. [Table 26] [Table 27]
[0300] Example 9. In vivo editing using two different guide formats in a humanized PCSK9 mouse model using lipid nanoparticles (LNPs) Modification guide designs selected from Table 2 were tested for in vivo editing efficiency. Male transgenic mice containing the human PCSK9 gene sequence (hPCSK9) in their genome were used for each mouse study. hPCSK9 mice were generated on a hybrid C57B6 / 129 background, then backcrossed to B6 once and then outcrossed for cohort expansion. hPCSK9 mice have the mouse PCSK9 gene excised from their genome. Animals were approximately 6 weeks old and weighed before administration. LNP was administered via the lateral tail vein at 0.1, 0.3, or 1 milligram per kilogram of body weight (e.g., 0.1 mg / kg, or 0.1 mpk), respectively. Approximately 24 hours after administration, animals were observed for adverse reactions. Seven days after administration, animals were euthanized by exsanguination under isoflurane anesthesia and cervical dislocation. Blood was collected by cardiac puncture into serum separator tubes or tubes containing buffered sodium citrate for plasma as described herein. For studies on in vivo editing, liver tissue was collected for DNA extraction and analysis.
[0301] For in vivo studies, genomic DNA was extracted from liver tissue using a bead-based extraction kit, e.g., Zymo Quick-DNA96 Kit (Zymo Research, Catalog No. D3010), according to the manufacturer's protocol, including homogenizing the tissue in lysis buffer (approximately 600 μL / 10 mg tissue). All DNA samples were normalized to a concentration of 100 ng / μL for PCR and subsequent NGS analysis, as described in Example 1.
[0302] Example 9.1 In vivo editing and serum hPCSK9 knockdown Blood was collected and serum isolated as described above. Total PCSK9 serum levels were determined using a human PCSK9 ELISA kit (Abcam, catalog ab209884). Kit reagents and standards were prepared according to the manufacturer's protocol. Mouse serum was diluted 5-10 times. Both the standard curve dilutions and diluted serum samples were added to each well of the ELISA plate. An antibody cocktail containing both capture and detection antibodies was added to all wells containing standards or samples. The plate was incubated with shaking at room temperature for 60 minutes and then washed. A color development solution was added to the plate, which was then incubated on a shaker plate in the dark for 10 minutes, followed by the addition of a stop solution (e.g., sulfuric acid, approximately 0.3 M). The plate was read at an absorbance of 450 nm on a SpectraMax M5 or Clariostar plate reader. Serum hPCSK9 levels were calculated using SoftMax Pro software version 6.4.2 or Mars software version 3.31 using a four-parameter logistic curve fit from the standard curve. Final serum values were adjusted for assay dilution. Percent protein knockdown (%KD) values were determined relative to pre-dose levels.
[0303] The average editing efficiency, hPCSK9 serum protein levels, and serum hPCSK9 knockdown rate (%KD) compared to pre-administration hPCSK9 protein levels are shown in Table 22. Liver editing, hPCSK9 protein levels, and hPCSK9 KD rate levels are shown in Figures 8A-8C, respectively. [Table 28]
[0304] In the table of sequences below, the terms "mA," "mC," "mU," or "mG" are used to indicate a nucleotide modified with 2'-O-Me. In the table below, each "N" is used independently to represent any nucleotide (e.g., A, U, T, C, G). In certain embodiments, the nucleotide is an unmodified RNA nucleotide residue, i.e., a ribose sugar and a phosphodiester backbone. In the table below, "*" is used to indicate a PS modification. In the present application, the terms A*, C*, U*, or G* may be used to indicate a nucleotide that is linked to the next (e.g., 3') nucleotide by a PS bond. When a DNA sequence (containing T) is referred to in reference to RNA, it is understood that T should be replaced with U (which may be modified or unmodified depending on the context), and vice versa. In the table below, single-letter amino acid abbreviations are used to indicate peptide sequences. [Table 29-1] [Table 29-2] [Table 29-3] [Table 29-4] [Table 29-5] [Table 29-6] [Table 29-7] [Table 29-8] Table 29-9 Table 29-10 Table 29-11 Table 29-12 Table 29-13 Table 29-14 Table 29-15 Table 29-16 Table 29-17
Claims
1. A. A targeting sequence comprising a sequence at least 95%, 90%, 85%, or 80% identical to or complementary to the nucleotide sequence of SEQ ID NO: 9, 1, 2, 7, 13-15, 17, 18, or 20; B. A targeting sequence comprising a sequence identical to or complementary to at least 17, 18, 19, or 20 consecutive nucleotides of the nucleotide sequence of SEQ ID NO: 9, 1, 2, 7, 13-15, 17, 18, or 20; or C. A targeting sequence comprising a targeting sequence identical to the nucleotide sequence of SEQ ID NO: 9, 1, 2, 7, 13-15, 17, 18, or 20; A guide RNA comprising:
2. 2. The guide of claim 1, comprising a sequence that is a targeting sequence identical to the nucleotide sequence of SEQ ID NO: 9, 14, or 18.
3. The guide RNA according to claim 1 or 2, A. A shortened hairpin 1 region, or a substituted and optionally shortened hairpin 1 region, 1. At least one of the following nucleotide pairs H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, or H1-4 and H1-9 is replaced with a Watson-Crick paired nucleotide in Hairpin 1, said Hairpin 1 region optionally comprising: a. One or two of H1-5 to H1-8; b. one, two, or three of the following nucleotide pairs: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, and H1-4 and H1-9; or c. 1 to 8 nucleotides of the hairpin 1 region; or 2. The shortened Hairpin 1 region is deleted by 4 to 8 nucleotides, preferably 4 to 6 nucleotides, and a. For exemplary SpyCas9 sgRNA-1, one or more of positions H1-1, H1-2, or H1-3 are deleted or substituted; or b. Relative to the exemplary SpyCas9 sgRNA-1, one or more of positions H1-6 through H1-10 are substituted; or 3. The shortened hairpin 1 region is missing 5-10 nucleotides, preferably 5-6 nucleotides, and is substituted at one or more of positions N18, H1-12, or n relative to the exemplary SpyCas9 sgRNA-1; the hairpin 1 region, or B. A shortened upper stem region, wherein the shortened upper stem region lacks 1 to 6 nucleotides, and for the exemplary SpyCas9 sgRNA-1, 6, 7, 8, 9, 10, or 11 nucleotides of the shortened upper stem region contain no more than four substitutions; or C. A substitution to an exemplary SpyCas9 sgRNA at any one or more of LS6, LS7, US3, US10, B3, N7, N15, N17, H2-2, and H2-14, wherein the substituted nucleotide is not a pyrimidine followed by an adenine or a pyrimidine followed by an adenine; or D. An exemplary SpyCas9 sgRNA-1 having an upper stem region, wherein the upper stem modification comprises a modification to any one or more of US1-US12 within the upper stem region; The guide RNA further comprises one or more of:
4. 4. The guide RNA of claim 3, wherein the guide RNA lacks 6 nucleotides in truncated hairpin 1.
5. 4. The guide RNA of claim 3, wherein the guide RNA lacks 8 nucleotides in truncated hairpin 1.
6. The guide RNA of any one of claims 3 to 5, wherein H-1 and H-3 are deleted.
7. The guide RNA of any one of claims 3 to 6, wherein the guide RNA further comprises a 3' tail.
8. 8. The guide RNA of claim 7, wherein the 3' tail is 1 to 4 nucleotides in length, optionally 1 nucleotide in length.
9. 9. The guide RNA of claim 3, wherein the guide RNA comprises an upper stem region comprising a modification in any one or more of US1 to US12 within the upper stem region.
10. 3. The guide RNA of claim 1 or 2, comprising a modified nucleotide sequence according to the pattern (mN*)3(N)13-17, where "m" indicates a 2'-O-methyl modification, * indicates a phosphorothioate linkage, and N indicates a 2'-OH and a phosphodiester linkage.
11. 2. The guide RNA of Claim 1, wherein the guide RNA comprises a modified nucleotide sequence selected from the sequences of Table 4A (SEQ ID NOs:501-512, optionally SEQ ID NO:507 or 512), and wherein the modified nucleotide sequence is 3' to the guide sequence.
12. 12. The guide RNA of claim 11, wherein the guide RNA is modified according to a nucleotide sequence pattern selected from the sequences of Table 4B (SEQ ID NOs: 601-612, optionally SEQ ID NO: 607 or 612), and wherein (mN*)3N17 refers to a targeting sequence of claim 1 or 2.
13. 13. The guide RNA of any one of claims 1 to 12, wherein the guide RNA comprises a nucleotide sequence selected from SEQ ID NOs: 121, 109, 101, 102, 107, 113-115, 117, 118, 120, 122, or 123 as shown in Table 2, optionally SEQ ID NOs: 109, 114, 118, 121, 122, or 123.
14. 14. The guide RNA of claim 13, wherein each nucleotide is any natural or unnatural nucleotide.
15. 15. The guide RNA of Claim 14, wherein the guide RNA comprises a modified nucleotide sequence selected from SEQ ID NOs: 221, 209, 201, 202, 207, 213-215, 217, 218, 220, 222, or 223, optionally SEQ ID NOs: 209, 214, 218, 221, 222, or 223, as provided in Table 2.
16. A composition comprising the guide RNA of any one of claims 1 to 15.
17. 17. The composition of claim 16, further comprising an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent.
18. 18. The composition of claim 17, wherein the nucleic acid encoding the RNA-guided DNA-binding agent comprises an mRNA comprising an open reading frame (ORF) encoding the RNA-guided DNA-binding agent.
19. 19. The composition of claim 17 or 18, wherein the RNA-guided DNA binding agent is a Cas9 nuclease.
20. 20. The composition of claim 19, wherein the Cas9 is S. pyogenes Cas9.
21. 21. The composition of claim 20, wherein the S. pyogenes Cas9 comprises an amino acid sequence having at least 90% identity to SEQ ID NO: 1001, 1004, 1007, or 1010, or an ORF encoding an S. pyogenes Cas9 having at least 90% identity to a sequence selected from SEQ ID NOs: 1003, 1006, and 1009.
22. 22. The composition of claim 21, wherein the ORF encoding the amino acid sequence has at least 95% identity to SEQ ID NO: 1003, 1006, or 1009.
23. The composition of any one of claims 19 to 22, wherein the nuclease has double-stranded endonuclease activity.
24. The composition of any one of claims 18 to 23, wherein the ORF is a modified ORF.
25. 22. The composition of claim 21, wherein the guide RNA comprises a targeting sequence identical to the nucleotide sequence of SEQ ID NO:9, and the S. pyogenes Cas9 comprises an amino acid sequence having at least 95% identity to SEQ ID NO:1001, wherein the S. pyogenes Cas9 nuclease has double-stranded endonuclease activity.
26. 22. The composition of claim 21, wherein the guide RNA comprises a targeting sequence comprising a sequence identical to the nucleotide sequence of SEQ ID NO:9, and the S. pyogenes Cas9 comprises an amino acid sequence comprising the amino acid sequence of SEQ ID NO:1001.
27. 22. The composition of claim 21, wherein the guide RNA comprises a targeting sequence comprising a sequence identical to the nucleotide sequence of SEQ ID NO:9, and wherein the S. pyogenes Cas9 ORF encodes an S. pyogenes Cas9 having at least 90% identity to a sequence selected from SEQ ID NO:1003, wherein the S. pyogenes Cas9 nuclease has double-stranded endonuclease activity.
28. The composition of any one of claims 25 to 27, wherein the ORF is a modified ORF.
29. The composition of any one of claims 25 to 28, wherein the guide RNA comprises the nucleotide sequence of SEQ ID NO: 121 or 109.
30. 29. The composition of any one of claims 25 to 28, wherein the guide RNA comprises the modified nucleotide sequence of SEQ ID NO: 221 or 209.
31. The composition of any one of claims 16 to 30, further comprising a pharmaceutical excipient.
32. 32. The composition of any one of claims 16 to 31, wherein the guide RNA is associated with a lipid nanoparticle (LNP).
33. 33. The composition of claim 32, wherein the LNP comprises a cationic lipid.
34. 34. The composition of claim 33, wherein the cationic lipid is (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also known as 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl(9Z,12Z)-octadeca-9,12-dienoate.
35. The composition of any one of claims 32 to 34, wherein the LNP comprises a helper lipid.
36. 36. The composition of claim 35, wherein the helper lipid is cholesterol.
37. The composition of any one of claims 32 to 36, wherein the LNP comprises a neutral lipid.
38. 38. The composition of claim 37, wherein the neutral lipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC).
39. The composition of any one of claims 32 to 38, wherein the LNP comprises a stealth lipid.
40. 40. The composition of claim 39, wherein the stealth lipid is 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (PEG2k-DMG).
41. 33. The composition of claim 32, wherein the LNPs comprise (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also known as 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl(9Z,12Z)-octadeca-9,12-dienoate, DSPC, cholesterol, and PEG2k-DMG.
42. A pharmaceutical composition comprising a guide RNA according to any one of claims 1 to 15 or a composition according to any one of claims 16 to 41.
43. A pharmaceutical composition comprising the guide RNA of any one of claims 1 to 15 or the composition of any one of claims 16 to 41, or use thereof, for inducing double-strand breaks or single-strand breaks in the PCSK9 gene in a cell, or for reducing the expression of the PCSK9 gene in a cell.
44. 44. The pharmaceutical composition or use of claim 43, wherein the cell is a liver cell.
45. 45. The pharmaceutical composition or use of claim 44, wherein the cell is in a subject.
46. A pharmaceutical composition comprising the guide RNA of any one of claims 1 to 15 or the composition of any one of claims 16 to 41, or use thereof, for treating a subject with a PCSK9-related disease.
47. A method for inducing double-strand breaks or single-strand breaks in a PCSK9 gene in a cell, or reducing the expression of PCSK9 protein in a cell, comprising contacting a cell with a guide RNA according to any one of claims 1 to 15, and an RNA-guided DNA-binding agent or a nucleic acid encoding the RNA-guided DNA-binding agent, or a composition according to any one of claims 16 to 41.
48. Use of a guide RNA according to any one of claims 1 to 15 or a composition according to any one of claims 16 to 41 in the preparation of a medicament for carrying out a method according to claim 47.
49. A human liver cell containing an indel within a nucleotide sequence selected from the genomic loci of Table 1.
50. 50. The human liver cell of claim 49, comprising an indel in a nucleotide sequence selected from a genomic locus selected from the genomic loci of SEQ ID NOs: 9, 1, 2, 7, 13-15, 17, 18, or 20.
51. 42. A method of modifying a genomic locus in a human liver cell, the method comprising contacting a human liver cell with a guide RNA according to any one of claims 1 to 15 and an RNA-guided DNA-binding agent, or a nucleic acid encoding the RNA-guided DNA-binding agent, or a composition according to any one of claims 16 to 41.
52. 52. The method of claim 51, wherein the method is performed in vivo.
53. 53. The pharmaceutical composition, method, or cell of any one of claims 44, 45, 49 to 52, wherein the liver cell is a hepatocyte.
54. 54. The pharmaceutical composition, method, or cell of claim 53, wherein the cell is in a subject having a PCSK9-related disease.
55. A method for treating a PCSK9-related disease in a subject, the method comprising administering to the subject the guide RNA and the RNA-guided DNA binding agent or the nucleic acid encoding the RNA-guided DNA binding agent according to any one of claims 1 to 15, or the composition according to any one of claims 16 to 41, or the pharmaceutical composition according to claim 42.
56. 56. The pharmaceutical composition, method, or cell of any one of claims 42 to 55, further comprising determining PCSK9 protein levels in a blood or serum sample from the subject.
57. Use of a guide RNA according to any one of claims 1 to 15, or a composition according to any one of claims 16 to 41, or a pharmaceutical composition according to claim 42 in the preparation of a medicament for carrying out a method according to any one of claims 47 or 51 to 56.
58. A kit comprising a guide RNA according to any one of claims 1 to 15, an RNA-guided DNA binder or a nucleic acid encoding an RNA-guided DNA binder, a composition according to any one of claims 16 to 41, or a pharmaceutical composition according to any one of claims 42 to 46.
59. A kit for use in or carrying out the method of any one of claims 47 or 51 to 56.