Novel CD19-targeted polypeptides and CD19-targeted immunotherapy
Novel antibodies with specific CDR sequences enhance CD19-targeted therapies by improving binding affinity and specificity, addressing limitations in existing treatments for B-cell cancers and autoimmune diseases.
Patent Information
- Application Number
- JP2025528506
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-04-28
- Filing Date
- 2024-04-26
- Publication Date
- 2026-03-04
AI Technical Summary
Existing CD19-targeted therapies face limitations in efficacy and specificity, particularly in the treatment of B-cell cancers and autoimmune diseases, necessitating the development of novel immunotherapies that can effectively target CD19 without causing unwanted immune responses.
Development of antibodies or antigen-binding fragments with specific amino acid sequences in their complementarity-determining regions (CDRs) that bind to human CD19, including heavy and light chain variable regions with varying degrees of sequence identity, to enhance therapeutic efficacy and specificity.
The novel antibodies or antigen-binding fragments demonstrate enhanced binding affinity and specificity to CD19, potentially improving treatment outcomes for B-cell cancers and autoimmune diseases by selectively targeting B cells.
Smart Images

Figure 2026507388000044 
Figure 2026507388000045 
Figure 2026507388000046
Abstract
Description
[Technical Field]
[0001] REFERENCE TO RELATED APPLICATIONS This application claims priority under 35 U.S.C. § 119(e) to U.S. Provisional Patent Application No. 63 / 499,055, filed April 28, 2023, which is incorporated herein by reference in its entirety. [Background technology]
[0002] CD19, a cell surface molecule on B lymphocytes, is strongly and stably expressed on most B-cell cancers, making it a clinically important target for the treatment of acute leukemia and lymphoma. While the success of CD19-directed therapy has been demonstrated by the number of FDA-approved CD19-targeted antibodies and chimeric antigen receptor (CAR) T-cell therapies, several challenges remain that limit the efficacy of existing therapies. CD19-targeted CAR T cells have also shown promising results in the suppression of "unwanted immune responses" in autoantibody-mediated autoimmune diseases, such as systemic lupus erythematosus and other autoimmune diseases, and for the prevention of alloantibody-mediated solid organ transplant incompatibility due to the presence of donor-specific HLA antibodies. In both cases, CD19-targeted CAR T cells act to deplete B cells that produce pathogenic antibody proteins. Summary of the Invention [Problem to be solved by the invention]
[0003] There is a need in the art for the development of novel CD19-targeted immunotherapies. [Means for solving the problem]
[0004] The present disclosure addresses the above needs in various aspects. In one aspect, the present invention provides an antibody or antigen-binding fragment thereof that specifically binds to human CD19, comprising: (a) a heavy chain complementarity-determining region 1 (HCDR1) comprising the amino acid sequence set forth in SEQ ID NO: 87, 92, 97, 102, 106, 111, 116, 121, 126, 130, 134, 137, 142, 145, 150, 155, 163, 168, 173, 177, 182, 187, 191, 195, 206, 211, 218, 223, 231, 236, 240, or 244; (b) a heavy chain complementarity-determining region 2 (HCDR2) comprising the amino acid sequence set forth in SEQ ID NO: 88, 93, 98, 103, 107, 112, 117, 122, 131, 135, 138, 143, 146, 151, 156, 160, 164, 169, 174, 178, 183, 188, 192, 196, 207, 215, 219, 224, 227, 232, or 237; (c) a heavy chain complementarity-determining region 3 (HCDR3) comprising the amino acid sequence set forth in SEQ ID NO: 89, 94, 99, 104, 108, 113, 118, 123, 127, 132, 136, 139, 144, 147, 152, 157, 161, 170, 175, 179, 184, 189, 193, 197, 208, 212, 216, 220, 225, 228, 233, 238, 241, or 245; (d) a light chain complementarity-determining region 1 (LCDR1) comprising the amino acid sequence set forth in SEQ ID NO: 90, 95, 100, 109, 114, 119, 124, 128, 140, 148, 153, 158, 166, 171, 180, 185, 200, 203, 209, 213, 221, 229, 234, 242, or 246; (e) a light chain complementarity-determining region 2 (LCDR2) comprising the amino acid sequence set forth in SEQ ID NO: ADS, AND, ANI, EAS, GNS, GNT, GSH, GSS, GYN, KDT, LVS, NND, QVS, RDT, SDG, SNK, SSS, or SVS; or (f) a light chain complementarity-determining region 3 (LCDR3) comprising the amino acid sequence set forth in SEQ ID NO: 91, 96, 101, 105, 110, 115, 120, 125, 129, 133, 141, 149, 154, 159, 162, 165, 167, 172, 176, 181, 186, 190, 194, 198, 199, 201, 202, 204, 205, 210, 214, 217, 222, 226, 230, 235, 239, 243, or 247. The present invention also includes an antibody or antigen-binding fragment thereof comprising:
[0005] In certain embodiments, HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 are (a) each comprising the amino acid sequence set forth in SEQ ID NOs: 87, 88, 89, 90, and 91, wherein LCDR2 comprises the amino acid sequence GNS; (b) comprising the respective amino acid sequences set forth in SEQ ID NOs: 92, 93, 94, 95, and 96, wherein LCDR2 comprises the amino acid sequence AND; (c) comprising the respective amino acid sequences set forth in SEQ ID NOs: 97, 98, 99, 100, and 101, wherein LCDR2 comprises the amino acid sequence ANI; (d) comprising the respective amino acid sequences set forth in SEQ ID NOs: 102, 103, 104, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; (e) comprising the amino acid sequences set forth in SEQ ID NOs: 106, 107, 108, 109, and 110, respectively, wherein LCDR2 comprises the amino acid sequence SDG; (f) comprising the respective amino acid sequences set forth in SEQ ID NOs: 111, 112, 113, 114, and 115, wherein LCDR2 comprises the amino acid sequence GSS; (g) comprising the respective amino acid sequences set forth in SEQ ID NOs: 116, 117, 118, 119, and 120, wherein LCDR2 comprises the amino acid sequence GNT; (h) comprising each of the amino acid sequences set forth in SEQ ID NOs: 121, 122, 123, 124, and 125, wherein LCDR2 comprises the amino acid sequence GYN; (i) comprising the respective amino acid sequences set forth in SEQ ID NOs: 126, 117, 127, 128, and 129, wherein LCDR2 comprises the amino acid sequence GNS; (j) comprising the amino acid sequences set forth in SEQ ID NOs: 130, 131, 132, 100, and 133, respectively, wherein LCDR2 comprises the amino acid sequence ANI; (k) each of the amino acid sequences set forth in SEQ ID NOs: 134, 135, 136, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; (l) each of the amino acid sequences set forth in SEQ ID NOs: 137, 138, 139, 140, and 141, wherein LCDR2 comprises the amino acid sequence ADS; (m) comprising the respective amino acid sequences set forth in SEQ ID NOs: 142, 143, 144, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; (n) comprising the respective amino acid sequences set forth in SEQ ID NOs: 145, 146, 147, 148, and 149, wherein LCDR2 comprises the amino acid sequence GNS; (o) comprising each of the amino acid sequences set forth in SEQ ID NOs: 150, 151, 152, 153, and 154, wherein LCDR2 comprises the amino acid sequence GNS; (p) comprising the amino acid sequences set forth in SEQ ID NOs: 155, 156, 157, 158, and 159, respectively, wherein LCDR2 comprises the amino acid sequence GSH; (q) comprising each of the amino acid sequences set forth in SEQ ID NOs: 121, 160, 161, 128, and 162, wherein LCDR2 comprises the amino acid sequence GNS; (r) comprising the respective amino acid sequences set forth in SEQ ID NOs: 163, 164, 123, 124, and 165, wherein LCDR2 comprises the amino acid sequence GYN; (s) each comprising the amino acid sequence set forth in SEQ ID NOs: 106, 107, 108, 166, and 167, wherein LCDR2 comprises the amino acid sequence SDG; (t) comprising the respective amino acid sequences set forth in SEQ ID NOs: 168, 169, 170, 171, and 172, wherein LCDR2 comprises the amino acid sequence KDT; (u) comprising each of the amino acid sequences set forth in SEQ ID NOs: 173, 174, 175, 171, and 176, wherein LCDR2 comprises the amino acid sequence KDT; (v) comprising the respective amino acid sequences set forth in SEQ ID NOs: 177, 178, 179, 180, and 181, wherein LCDR2 comprises the amino acid sequence SSS; (w) comprising the amino acid sequences set forth in SEQ ID NOs: 182, 183, 184, 185, and 186, respectively, wherein LCDR2 comprises the amino acid sequence LVS; (x) comprising each of the amino acid sequences set forth in SEQ ID NOs: 187, 188, 189, 100, and 190, wherein LCDR2 comprises the amino acid sequence ANI; (y) comprises each of the amino acid sequences set forth in SEQ ID NOs: 191, 192, 193, 185, and 194, wherein LCDR2 comprises the amino acid sequence QVS; (z) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 198, wherein LCDR2 comprises the amino acid sequence KDT; (aa) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 199, wherein LCDR2 comprises the amino acid sequence KDT; (bb) comprising each of the amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 200, and 201, wherein LCDR2 comprises the amino acid sequence RDT; (cc) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 200, and 202, wherein LCDR2 comprises the amino acid sequence KDT; (dd) comprising each of the amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 190, wherein LCDR2 comprises the amino acid sequence KDT; (ee) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 203, and 204, wherein LCDR2 comprises the amino acid sequence RDT; (ff) comprising the amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 205, respectively, wherein LCDR2 comprises the amino acid sequence KDT; (gg) comprising the amino acid sequences set forth in SEQ ID NOs: 206, 207, 208, 209, and 210, respectively, wherein LCDR2 comprises the amino acid sequence SVS; (hh) comprising the amino acid sequences set forth in SEQ ID NOs: 211, 112, 113, 114, and 115, respectively, wherein LCDR2 comprises the amino acid sequence GSS; (ii) comprising the respective amino acid sequences set forth in SEQ ID NOs: 168, 117, 212, 213, and 214, wherein LCDR2 comprises the amino acid sequence KDT; (jj) comprising each of the amino acid sequences set forth in SEQ ID NOs: 121, 215, 216, 166, and 217, wherein LCDR2 comprises the amino acid sequence SDG; (kk) comprising the respective amino acid sequences set forth in SEQ ID NOs: 218, 219, 220, 221, and 222, wherein LCDR2 comprises the amino acid sequence RDT; (ll) comprising the respective amino acid sequences set forth in SEQ ID NOs: 223, 224, 225, 213, and 226, wherein LCDR2 comprises the amino acid sequence KDT; (mm) comprising the respective amino acid sequences set forth in SEQ ID NOs: 121, 227, 228, 229, and 230, wherein LCDR2 comprises the amino acid sequence SDG; (nn) comprising the respective amino acid sequences set forth in SEQ ID NOs: 231, 232, 233, 234, and 235, wherein LCDR2 comprises the amino acid sequence NND; (oo) comprising the respective amino acid sequences set forth in SEQ ID NOs: 236, 237, 238, 171, and 239, wherein LCDR2 comprises the amino acid sequence KDT; (pp) comprising each of the amino acid sequences set forth in SEQ ID NOs: 240, 143, 241, 242, and 243, wherein LCDR2 comprises the amino acid sequence SNK; or (qq) Comprises the amino acid sequences set forth in SEQ ID NOs: 244, 138, 245, 246, and 247, respectively, and LCDR2 comprises the amino acid sequence EAS.
[0006] In certain embodiments, the antibody or antigen-binding fragment thereof (a) a heavy chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, or 99% identity to the amino acid sequence set forth in SEQ ID NOs: 314 to 356; and / or (b) a light chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequences set forth in SEQ ID NOs: 271 to 313; Includes:
[0007] In certain embodiments, the antibody or antigen-binding fragment thereof (a) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 314, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 271; (b) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 315, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 272; (c) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 316, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 273; (d) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 317, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 274; (e) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 318, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 275; (f) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 319, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 276; (g) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 320, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 277; (h) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 321, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 278; (i) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 322, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 279; (j) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 323, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 280; (k) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 324, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 281; (l) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 325, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 282; (m) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 326, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 283; (n) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 327, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 284; (o) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 328, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 285; (p) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 329, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 286; (q) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 330, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 287; (r) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 331, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 288; (s) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 332, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 289; (t) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 333, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 290; (u) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 334, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 291; (v) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 335, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 292; (w) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 336, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 293; (x) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 337, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 294; (y) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 338, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 295; (z) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 339, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 296; (aa) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 340, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 297; (bb) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 341, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 298; (cc) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 342, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 299; (dd) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 343, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 300; (ee) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 344, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 301; (ff) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 345, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 302; (gg) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 346, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 303; (hh) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 347, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 304; (ii) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 348, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 305; (jj) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 349, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 306; (kk) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 350, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 307; (ll) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 351, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 308; (mm) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 352, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 309; (nn) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 353, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 310; (oo) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 354, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 311; (pp) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 355, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 312, or (qq) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 356, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 313 Includes:
[0008] In another aspect, the present invention provides an antibody or antigen-binding fragment thereof that specifically binds to human CD19, comprising: (a) a heavy chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, or 99% identity to the amino acid sequence set forth in SEQ ID NOs: 314 to 356; and (b) a light chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequences set forth in SEQ ID NOs: 271 to 313; The present invention also includes an antibody or antigen-binding fragment thereof comprising:
[0009] In certain embodiments, the antibody or antigen-binding fragment thereof (a) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 314, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 271; (b) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 315, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 272; (c) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 316, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 273; (d) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 317, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 274; (e) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 318, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 275; (f) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 319, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 276; (g) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 320, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 277; (h) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 321, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 278; (i) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 322, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 279; (j) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 323, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 280; (k) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 324, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 281; (l) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 325, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 282; (m) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 326, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 283; (n) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 327, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 284; (o) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 328, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 285; (p) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 329, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 286; (q) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 330, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 287; (r) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 331, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 288; (s) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 332, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 289; (t) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 333, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 290; (u) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 334, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 291; (v) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 335, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 292; (w) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 336, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 293; (x) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 337, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 294; (y) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 338, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 295; (z) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 339, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 296; (aa) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 340, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 297; (bb) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 341, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 298; (cc) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 342, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 299; (dd) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 343, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 300; (ee) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 344, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 301; (ff) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 345, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 302; (gg) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 346, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 303; (hh) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 347, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 304; (ii) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 348, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 305; (jj) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 349, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 306; (kk) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 350, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 307; (ll) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 351, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 308; (mm) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 352, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 309; (nn) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 353, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 310; (oo) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 354, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 311; (pp) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 355, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 312, or (qq) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 356, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 313 Includes:
[0010] In another embodiment, the present invention comprises an antibody or antigen-binding fragment thereof that specifically binds to CD19, wherein the antibody or antigen-binding fragment thereof is: (a) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NOs: 314 to 356, and (b) a light chain variable region comprising the amino acid sequences shown in SEQ ID NOs: 271 to 313; Includes:
[0011] In certain embodiments, the antibody or antigen-binding fragment thereof is selected from the group consisting of a full-length antibody, a Fab, a single-chain variable fragment (scFv), a sc(Fv)2, a dsFv, a Fab, a Fab', a (Fab')2, and a diabody.
[0012] In certain embodiments, the antigen-binding fragment comprises an scFv.
[0013] In another aspect, the present invention provides a single chain variable fragment (scFv) that specifically binds to human CD19, comprising: (a) a heavy chain variable region comprising HCDR1, HCDR2, and HCDR3, wherein HCDR1 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 87, 92, 97, 102, 106, 111, 116, 121, 126, 130, 134, 137, 142, 145, 150, 155, 163, 168, 173, 177, 182, 187, 191, 195, 206, 211, 218, 223, 231, 236, 240, and 244; and HCDR2 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 88, 93, 98, 103, 107, 112, 117, 122, 131, 135, 138, 143, 146, 151, 156, a heavy chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 160, 164, 169, 174, 178, 183, 188, 192, 196, 207, 215, 219, 224, 227, 232, and 237; and HCDR3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 89, 94, 99, 104, 108, 113, 118, 123, 127, 132, 136, 139, 144, 147, 152, 157, 161, 170, 175, 179, 184, 189, 193, 197, 208, 212, 216, 220, 225, 228, 233, 238, 241, and 245; and (b) a light chain variable region comprising LCDR1, LCDR2, and LCDR3, wherein LCDR1 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 90, 95, 100, 109, 114, 119, 124, 128, 140, 148, 153, 158, 166, 171, 180, 185, 200, 203, 209, 213, 221, 229, 234, 242, and 246; and LCDR2 comprises an amino acid sequence selected from the group consisting of ADS, AND, ANI, EAS, GNS, GNT, GSH, GSS, GYN, KDT, LVS, NND, QVS, RDT, S DG, SNK, SSS, and SVS; and LCDR3 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 91, 96, 101, 105, 110, 115, 120, 125, 129, 133, 141, 149, 154, 159, 162, 165, 167, 172, 176, 181, 186, 190, 194, 198, 199, 201, 202, 204, 205, 210, 214, 217, 222, 226, 230, 235, 239, 243, and 247. and scFv, in which the heavy chain variable region and the light chain variable region are connected by a linker.
[0014] In certain embodiments, HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 are (a) each comprising the amino acid sequence set forth in SEQ ID NOs: 87, 88, 89, 90, and 91, wherein LCDR2 comprises the amino acid sequence GNS; (b) comprising the respective amino acid sequences set forth in SEQ ID NOs: 92, 93, 94, 95, and 96, wherein LCDR2 comprises the amino acid sequence AND; (c) comprising the respective amino acid sequences set forth in SEQ ID NOs: 97, 98, 99, 100, and 101, wherein LCDR2 comprises the amino acid sequence ANI; (d) comprising the respective amino acid sequences set forth in SEQ ID NOs: 102, 103, 104, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; (e) comprising the amino acid sequences set forth in SEQ ID NOs: 106, 107, 108, 109, and 110, respectively, wherein LCDR2 comprises the amino acid sequence SDG; (f) comprising the respective amino acid sequences set forth in SEQ ID NOs: 111, 112, 113, 114, and 115, wherein LCDR2 comprises the amino acid sequence GSS; (g) comprising the respective amino acid sequences set forth in SEQ ID NOs: 116, 117, 118, 119, and 120, wherein LCDR2 comprises the amino acid sequence GNT; (h) comprising each of the amino acid sequences set forth in SEQ ID NOs: 121, 122, 123, 124, and 125, wherein LCDR2 comprises the amino acid sequence GYN; (i) comprising the respective amino acid sequences set forth in SEQ ID NOs: 126, 117, 127, 128, and 129, wherein LCDR2 comprises the amino acid sequence GNS; (j) comprising the amino acid sequences set forth in SEQ ID NOs: 130, 131, 132, 100, and 133, respectively, wherein LCDR2 comprises the amino acid sequence ANI; (k) each of the amino acid sequences set forth in SEQ ID NOs: 134, 135, 136, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; (l) each of the amino acid sequences set forth in SEQ ID NOs: 137, 138, 139, 140, and 141, wherein LCDR2 comprises the amino acid sequence ADS; (m) comprising the respective amino acid sequences set forth in SEQ ID NOs: 142, 143, 144, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; (n) comprising the respective amino acid sequences set forth in SEQ ID NOs: 145, 146, 147, 148, and 149, wherein LCDR2 comprises the amino acid sequence GNS; (o) comprising each of the amino acid sequences set forth in SEQ ID NOs: 150, 151, 152, 153, and 154, wherein LCDR2 comprises the amino acid sequence GNS; (p) comprising the amino acid sequences set forth in SEQ ID NOs: 155, 156, 157, 158, and 159, respectively, wherein LCDR2 comprises the amino acid sequence GSH; (q) comprising each of the amino acid sequences set forth in SEQ ID NOs: 121, 160, 161, 128, and 162, wherein LCDR2 comprises the amino acid sequence GNS; (r) comprising the respective amino acid sequences set forth in SEQ ID NOs: 163, 164, 123, 124, and 165, wherein LCDR2 comprises the amino acid sequence GYN; (s) each comprising the amino acid sequence set forth in SEQ ID NOs: 106, 107, 108, 166, and 167, wherein LCDR2 comprises the amino acid sequence SDG; (t) comprising the respective amino acid sequences set forth in SEQ ID NOs: 168, 169, 170, 171, and 172, wherein LCDR2 comprises the amino acid sequence KDT; (u) comprising each of the amino acid sequences set forth in SEQ ID NOs: 173, 174, 175, 171, and 176, wherein LCDR2 comprises the amino acid sequence KDT; (v) comprising the respective amino acid sequences set forth in SEQ ID NOs: 177, 178, 179, 180, and 181, wherein LCDR2 comprises the amino acid sequence SSS; (w) comprising the amino acid sequences set forth in SEQ ID NOs: 182, 183, 184, 185, and 186, respectively, wherein LCDR2 comprises the amino acid sequence LVS; (x) comprising each of the amino acid sequences set forth in SEQ ID NOs: 187, 188, 189, 100, and 190, wherein LCDR2 comprises the amino acid sequence ANI; (y) comprises each of the amino acid sequences set forth in SEQ ID NOs: 191, 192, 193, 185, and 194, wherein LCDR2 comprises the amino acid sequence QVS; (z) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 198, wherein LCDR2 comprises the amino acid sequence KDT; (aa) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 199, wherein LCDR2 comprises the amino acid sequence KDT; (bb) comprising each of the amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 200, and 201, wherein LCDR2 comprises the amino acid sequence RDT; (cc) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 200, and 202, wherein LCDR2 comprises the amino acid sequence KDT; (dd) comprising each of the amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 190, wherein LCDR2 comprises the amino acid sequence KDT; (ee) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 203, and 204, wherein LCDR2 comprises the amino acid sequence RDT; (ff) comprising the amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 205, respectively, wherein LCDR2 comprises the amino acid sequence KDT; (gg) comprising the amino acid sequences set forth in SEQ ID NOs: 206, 207, 208, 209, and 210, respectively, wherein LCDR2 comprises the amino acid sequence SVS; (hh) comprising the amino acid sequences set forth in SEQ ID NOs: 211, 112, 113, 114, and 115, respectively, wherein LCDR2 comprises the amino acid sequence GSS; (ii) comprising the respective amino acid sequences set forth in SEQ ID NOs: 168, 117, 212, 213, and 214, wherein LCDR2 comprises the amino acid sequence KDT; (jj) comprising each of the amino acid sequences set forth in SEQ ID NOs: 121, 215, 216, 166, and 217, wherein LCDR2 comprises the amino acid sequence SDG; (kk) comprising the respective amino acid sequences set forth in SEQ ID NOs: 218, 219, 220, 221, and 222, wherein LCDR2 comprises the amino acid sequence RDT; (ll) comprising the respective amino acid sequences set forth in SEQ ID NOs: 223, 224, 225, 213, and 226, wherein LCDR2 comprises the amino acid sequence KDT; (mm) comprising the respective amino acid sequences set forth in SEQ ID NOs: 121, 227, 228, 229, and 230, wherein LCDR2 comprises the amino acid sequence SDG; (nn) comprising the respective amino acid sequences set forth in SEQ ID NOs: 231, 232, 233, 234, and 235, wherein LCDR2 comprises the amino acid sequence NND; (oo) comprising the respective amino acid sequences set forth in SEQ ID NOs: 236, 237, 238, 171, and 239, wherein LCDR2 comprises the amino acid sequence KDT; (pp) comprising each of the amino acid sequences set forth in SEQ ID NOs: 240, 143, 241, 242, and 243, wherein LCDR2 comprises the amino acid sequence SNK; or (qq) Comprises the amino acid sequences set forth in SEQ ID NOs: 244, 138, 245, 246, and 247, respectively, and LCDR2 comprises the amino acid sequence EAS.
[0015] In another aspect, the present invention provides a single chain variable fragment (scFv) that specifically binds to CD19, comprising: (a) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NOs: 314 to 356; and (b) a light chain variable region comprising the amino acid sequences shown in SEQ ID NOs: 271 to 313; and scFv, in which the heavy chain variable region and the light chain variable region are connected by a linker.
[0016] In certain embodiments, the scFv comprises: (a) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 314, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 271; (b) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 315, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 272; (c) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 316, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 273; (d) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 317, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 274; (e) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 318, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 275; (f) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 319, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 276; (g) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 320, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 277; (h) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 321, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 278; (i) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 322, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 279; (j) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 323, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 280; (k) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 324, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 281; (l) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 325, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 282; (m) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 326, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 283; (n) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 327, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 284; (o) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 328, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 285; (p) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 329, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 286; (q) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 330, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 287; (r) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 331, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 288; (s) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 332, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 289; (t) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 333, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 290; (u) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 334, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 291; (v) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 335, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 292; (w) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 336, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 293; (x) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 337, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 294; (y) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 338, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 295; (z) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 339, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 296; (aa) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 340, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 297; (bb) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 341, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 298; (cc) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 342, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 299; (dd) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 343, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 300; (ee) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 344, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 301; (ff) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 345, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 302; (gg) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 346, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 303; (hh) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 347, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 304; (ii) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 348, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 305; (jj) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 349, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 306; (kk) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 350, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 307; (ll) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 351, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 308; (mm) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 352, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 309; (nn) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 353, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 310; (oo) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 354, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 311; (pp) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 355, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 312, or (qq) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 356, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 313 Includes:
[0017] In another aspect, the present invention encompasses single-chain variable fragments (scFv) that specifically bind to CD19, the scFv comprising the amino acid sequences set forth in SEQ ID NOs: 44-86.
[0018] In another aspect, the invention includes a chimeric antigen receptor (CAR) comprising an scFv of any one of the embodiments or aspects disclosed herein.
[0019] In another aspect, the present invention provides a chimeric antigen receptor (CAR) comprising an antigen binding domain specific for human CD19 (hCD19), a transmembrane domain, and an intracellular signaling domain, (a) a heavy chain variable region comprising a heavy chain complementarity determining region 1 (HCDR1), HCDR2, and HCDR3, wherein HCDR1 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 87, 92, 97, 102, 106, 111, 116, 121, 126, 130, 134, 137, 142, 145, 150, 155, 163, 168, 173, 177, 182, 187, 191, 195, 206, 211, 218, 223, 231, 236, 240, and 244; and HCDR2 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 88, 93, 98, 103, 107, 112, 117, 122, 131, 135, 138, 143, 146, 150, 155, 163, 168, 173, 177, 182, 187, 191, 195, 206, 211, 218, 223, 231, 236, 240, and 244; a heavy chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 1, 156, 160, 164, 169, 174, 178, 183, 188, 192, 196, 207, 215, 219, 224, 227, 232, and 237; and HCDR3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 89, 94, 99, 104, 108, 113, 118, 123, 127, 132, 136, 139, 144, 147, 152, 157, 161, 170, 175, 179, 184, 189, 193, 197, 208, 212, 216, 220, 225, 228, 233, 238, 241, and 245; and (b) a light chain variable region comprising a light chain complementarity determining region 1 (LCDR1), an LCDR2, and an LCDR3, wherein LCDR1 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 90, 95, 100, 109, 114, 119, 124, 128, 140, 148, 153, 158, 166, 171, 180, 185, 200, 203, 209, 213, 221, 229, 234, 242, and 246; and LCDR2 comprises an amino acid sequence selected from the group consisting of ADS, AND, ANI, EAS, GNS, GNT, GSH, GSS, GYN, KDT, LVS, NND, QVS. , RDT, SDG, SNK, SSS, and SVS; and LCDR3 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 91, 96, 101, 105, 110, 115, 120, 125, 129, 133, 141, 149, 154, 159, 162, 165, 167, 172, 176, 181, 186, 190, 194, 198, 199, 201, 202, 204, 205, 210, 214, 217, 222, 226, 230, 235, 239, 243, and 247. Including, including CAR.
[0020] In certain embodiments, HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, and LCDR3 are (a) each comprising the amino acid sequence set forth in SEQ ID NOs: 87, 88, 89, 90, and 91, wherein LCDR2 comprises the amino acid sequence GNS; (b) comprising the respective amino acid sequences set forth in SEQ ID NOs: 92, 93, 94, 95, and 96, wherein LCDR2 comprises the amino acid sequence AND; (c) comprising the respective amino acid sequences set forth in SEQ ID NOs: 97, 98, 99, 100, and 101, wherein LCDR2 comprises the amino acid sequence ANI; (d) comprising the respective amino acid sequences set forth in SEQ ID NOs: 102, 103, 104, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; (e) comprising the amino acid sequences set forth in SEQ ID NOs: 106, 107, 108, 109, and 110, respectively, wherein LCDR2 comprises the amino acid sequence SDG; (f) comprising the respective amino acid sequences set forth in SEQ ID NOs: 111, 112, 113, 114, and 115, wherein LCDR2 comprises the amino acid sequence GSS; (g) comprising the respective amino acid sequences set forth in SEQ ID NOs: 116, 117, 118, 119, and 120, wherein LCDR2 comprises the amino acid sequence GNT; (h) comprising each of the amino acid sequences set forth in SEQ ID NOs: 121, 122, 123, 124, and 125, wherein LCDR2 comprises the amino acid sequence GYN; (i) comprising the respective amino acid sequences set forth in SEQ ID NOs: 126, 117, 127, 128, and 129, wherein LCDR2 comprises the amino acid sequence GNS; (j) comprising the amino acid sequences set forth in SEQ ID NOs: 130, 131, 132, 100, and 133, respectively, wherein LCDR2 comprises the amino acid sequence ANI; (k) each of the amino acid sequences set forth in SEQ ID NOs: 134, 135, 136, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; (l) each of the amino acid sequences set forth in SEQ ID NOs: 137, 138, 139, 140, and 141, wherein LCDR2 comprises the amino acid sequence ADS; (m) comprising the respective amino acid sequences set forth in SEQ ID NOs: 142, 143, 144, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; (n) comprising the respective amino acid sequences set forth in SEQ ID NOs: 145, 146, 147, 148, and 149, wherein LCDR2 comprises the amino acid sequence GNS; (o) comprising each of the amino acid sequences set forth in SEQ ID NOs: 150, 151, 152, 153, and 154, wherein LCDR2 comprises the amino acid sequence GNS; (p) comprising the amino acid sequences set forth in SEQ ID NOs: 155, 156, 157, 158, and 159, respectively, wherein LCDR2 comprises the amino acid sequence GSH; (q) comprising each of the amino acid sequences set forth in SEQ ID NOs: 121, 160, 161, 128, and 162, wherein LCDR2 comprises the amino acid sequence GNS; (r) comprising the respective amino acid sequences set forth in SEQ ID NOs: 163, 164, 123, 124, and 165, wherein LCDR2 comprises the amino acid sequence GYN; (s) each comprising the amino acid sequence set forth in SEQ ID NOs: 106, 107, 108, 166, and 167, wherein LCDR2 comprises the amino acid sequence SDG; (t) comprising the respective amino acid sequences set forth in SEQ ID NOs: 168, 169, 170, 171, and 172, wherein LCDR2 comprises the amino acid sequence KDT; (u) comprising each of the amino acid sequences set forth in SEQ ID NOs: 173, 174, 175, 171, and 176, wherein LCDR2 comprises the amino acid sequence KDT; (v) comprising the respective amino acid sequences set forth in SEQ ID NOs: 177, 178, 179, 180, and 181, wherein LCDR2 comprises the amino acid sequence SSS; (w) comprising the amino acid sequences set forth in SEQ ID NOs: 182, 183, 184, 185, and 186, respectively, wherein LCDR2 comprises the amino acid sequence LVS; (x) comprising each of the amino acid sequences set forth in SEQ ID NOs: 187, 188, 189, 100, and 190, wherein LCDR2 comprises the amino acid sequence ANI; (y) comprises each of the amino acid sequences set forth in SEQ ID NOs: 191, 192, 193, 185, and 194, wherein LCDR2 comprises the amino acid sequence QVS; (z) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 198, wherein LCDR2 comprises the amino acid sequence KDT; (aa) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 199, wherein LCDR2 comprises the amino acid sequence KDT; (bb) comprising each of the amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 200, and 201, wherein LCDR2 comprises the amino acid sequence RDT; (cc) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 200, and 202, wherein LCDR2 comprises the amino acid sequence KDT; (dd) comprising each of the amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 190, wherein LCDR2 comprises the amino acid sequence KDT; (ee) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 203, and 204, wherein LCDR2 comprises the amino acid sequence RDT; (ff) comprising the amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 205, respectively, wherein LCDR2 comprises the amino acid sequence KDT; (gg) comprising the amino acid sequences set forth in SEQ ID NOs: 206, 207, 208, 209, and 210, respectively, wherein LCDR2 comprises the amino acid sequence SVS; (hh) comprising the amino acid sequences set forth in SEQ ID NOs: 211, 112, 113, 114, and 115, respectively, wherein LCDR2 comprises the amino acid sequence GSS; (ii) comprising the respective amino acid sequences set forth in SEQ ID NOs: 168, 117, 212, 213, and 214, wherein LCDR2 comprises the amino acid sequence KDT; (jj) comprising each of the amino acid sequences set forth in SEQ ID NOs: 121, 215, 216, 166, and 217, wherein LCDR2 comprises the amino acid sequence SDG; (kk) comprising the respective amino acid sequences set forth in SEQ ID NOs: 218, 219, 220, 221, and 222, wherein LCDR2 comprises the amino acid sequence RDT; (ll) comprising the respective amino acid sequences set forth in SEQ ID NOs: 223, 224, 225, 213, and 226, wherein LCDR2 comprises the amino acid sequence KDT; (mm) comprising the respective amino acid sequences set forth in SEQ ID NOs: 121, 227, 228, 229, and 230, wherein LCDR2 comprises the amino acid sequence SDG; (nn) comprising the respective amino acid sequences set forth in SEQ ID NOs: 231, 232, 233, 234, and 235, wherein LCDR2 comprises the amino acid sequence NND; (oo) comprising the respective amino acid sequences set forth in SEQ ID NOs: 236, 237, 238, 171, and 239, wherein LCDR2 comprises the amino acid sequence KDT; (pp) comprising each of the amino acid sequences set forth in SEQ ID NOs: 240, 143, 241, 242, and 243, wherein LCDR2 comprises the amino acid sequence SNK; or (qq) Comprises the amino acid sequences set forth in SEQ ID NOs: 244, 138, 245, 246, and 247, respectively, and LCDR2 comprises the amino acid sequence EAS.
[0021] In certain embodiments, the antigen binding domain comprises: (a) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 314, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 271; (b) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 315, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 272; (c) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 316, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 273; (d) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 317, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 274; (e) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 318, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 275; (f) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 319, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 276; (g) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 320, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 277; (h) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 321, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 278; (i) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 322, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 279; (j) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 323, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 280; (k) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 324, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 281; (l) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 325, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 282; (m) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 326, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 283; (n) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 327, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 284; (o) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 328, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 285; (p) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 329, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 286; (q) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 330, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 287; (r) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 331, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 288; (s) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 332, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 289; (t) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 333, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 290; (u) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 334, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 291; (v) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 335, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 292; (w) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 336, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 293; (x) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 337, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 294; (y) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 338, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 295; (z) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 339, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 296; (aa) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 340, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 297; (bb) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 341, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 298; (cc) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 342, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 299; (dd) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 343, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 300; (ee) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 344, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 301; (ff) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 345, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 302; (gg) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 346, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 303; (hh) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 347, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 304; (ii) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 348, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 305; (jj) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 349, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 306; (kk) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 350, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 307; (ll) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 351, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 308; (mm) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 352, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 309; (nn) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 353, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 310; (oo) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 354, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 311; (pp) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 355, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 312, or (qq) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 356, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 313 Includes:
[0022] In certain embodiments, the antigen-binding domain comprises a heavy chain variable region comprising an amino acid sequence having at least 95% to 99% identity to any of the amino acid sequences of the heavy chain variable regions set forth in SEQ ID NOs: 314 to 356.
[0023] In certain embodiments, the antigen-binding domain comprises a heavy chain variable region comprising any one of the amino acid sequences of the heavy chain variable regions set forth in SEQ ID NOs: 314-356.
[0024] In a specific embodiment, the antigen-binding domain comprises a heavy chain variable region consisting of any one of the amino acid sequences of the heavy chain variable regions set forth in SEQ ID NOs: 314-356.
[0025] In certain embodiments, the antigen-binding domain comprises a light chain variable region comprising an amino acid sequence having at least 95 to 99% identity to any of the amino acid sequences of the light chain variable regions set forth in SEQ ID NOs: 271 to 313.
[0026] In certain embodiments, the antigen-binding domain comprises a light chain variable region comprising the amino acid sequence of any one of the light chain variable regions set forth in SEQ ID NOs: 271-313.
[0027] In a specific embodiment, the antigen-binding domain consists of a light chain variable region having any one of the amino acid sequences of the light chain variable regions set forth in SEQ ID NOs: 271 to 313.
[0028] In another aspect, the present invention includes a chimeric antigen receptor (CAR) comprising an antigen-binding domain, a transmembrane domain, and an intracellular domain, wherein the antigen-binding domain comprises a heavy chain variable region comprising any of the amino acid sequences set forth in SEQ ID NOs: 314 to 356, and a light chain variable region comprising any of the amino acid sequences set forth in SEQ ID NOs: 271 to 313.
[0029] In certain embodiments, the antigen binding domain comprises: (a) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 314, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 271; (b) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 315, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 272; (c) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 316, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 273; (d) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 317, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 274; (e) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 318, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 275; (f) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 319, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 276; (g) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 320, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 277; (h) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 321, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 278; (i) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 322, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 279; (j) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 323, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 280; (k) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 324, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 281; (l) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 325, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 282; (m) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 326, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 283; (n) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 327, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 284; (o) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 328, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 285; (p) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 329, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 286; (q) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 330, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 287; (r) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 331, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 288; (s) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 332, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 289; (t) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 333, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 290; (u) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 334, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 291; (v) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 335, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 292; (w) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 336, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 293; (x) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 337, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 294; (y) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 338, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 295; (z) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 339, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 296; (aa) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 340, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 297; (bb) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 341, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 298; (cc) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 342, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 299; (dd) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 343, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 300; (ee) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 344, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 301; (ff) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 345, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 302; (gg) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 346, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 303; (hh) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 347, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 304; (ii) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 348, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 305; (jj) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 349, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 306; (kk) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 350, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 307; (ll) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 351, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 308; (mm) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 352, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 309; (nn) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 353, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 310; (oo) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 354, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 311; (pp) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 355, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 312, or (qq) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 356, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 313 Includes:
[0030] In another aspect, the present invention includes a chimeric antigen receptor (CAR) comprising an antigen-binding domain, a transmembrane domain, and an intracellular signaling domain, wherein the antigen-binding domain comprises any one of the amino acid sequences set forth in SEQ ID NOs: 44 to 86.
[0031] In certain embodiments, the intracellular signaling domain is derived from a human NK cell receptor (NKR) and the CAR is an NKR-CAR.
[0032] In certain embodiments, the NKR domain is selected from the group consisting of an actKIR domain, an NCR domain, an SLAMF domain, an FcR domain, a CD16 domain, a CD64 domain, an actLy49 domain, and an inhLy49 domain.
[0033] In certain embodiments, the intracellular signaling domain is a KIR signaling domain selected from the group consisting of a KIR2DS2 signaling domain, a KIR2DS2 signaling domain, a KIR2DL3 signaling domain, a KIR2DL1 signaling domain, a KIR2DL2 signaling domain, a KIR2DL4 signaling domain, a KIR2DL5A signaling domain, a KIR2DL5B signaling domain, a KIR2DS1 signaling domain, a KIR2DS3 signaling domain, a KIR2DS4 signaling domain, a KIR2DS5 signaling domain, a KIR3DL1 signaling domain, a KIR3DS1 signaling domain, a KIR3DL2 signaling domain, a KIR3DL3 signaling domain, a KIR2DP1 signaling domain, and a KIR3DP1 signaling domain.
[0034] In certain embodiments, the transmembrane domain is a KIR transmembrane domain selected from the group consisting of KIR2DS2 transmembrane domain, KIR2DS2 transmembrane domain, KIR2DL3 transmembrane domain, KIR2DL1 transmembrane domain, KIR2DL2 transmembrane domain, KIR2DL4 transmembrane domain, KIR2DL5A transmembrane domain, KIR2DL5B transmembrane domain, KIR2DS1 transmembrane domain, KIR2DS3 transmembrane domain, KIR2DS4 transmembrane domain, KIR2DS5 transmembrane domain, KIR3DL1 transmembrane domain, KIR3DS1 transmembrane domain, KIR3DL2 transmembrane domain, KIR3DL3 transmembrane domain, KIR2DP1 transmembrane domain and KIR3DP1 transmembrane domain.
[0035] In certain embodiments, the transmembrane domain is capable of binding to the transmembrane domain of DAP12.
[0036] In a specific embodiment, the KIR signaling domain comprises the amino acid sequence set forth in SEQ ID NO:266.
[0037] In certain embodiments, the CAR comprises the amino acid sequence set forth in SEQ ID NOs: 370-412.
[0038] In another aspect, the present invention includes an NKR-CAR complex comprising an NK cell receptor (NKR)-CAR comprising an amino acid sequence set forth in any one of SEQ ID NOs: 370-412 and an adapter molecule.
[0039] In specific embodiments, the adapter molecule is DAP12 or FcεRγ.
[0040] In certain embodiments, the NKR-CAR interacts with an adaptor molecule when the antigen-binding domain of the NKR-CAR binds to human CD19.
[0041] In another aspect, the present invention provides a method for producing a (a) an antigen-binding domain that specifically binds to human CD19 (hCD19), and (b) the NKR transmembrane domain, or (c) NKR intracellular signaling domain Includes NKR-CAR, including one or both of the above.
[0042] In certain embodiments, the antigen binding domain comprises: (a) a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 87, 92, 97, 102, 106, 111, 116, 121, 126, 130, 134, 137, 142, 145, 150, 155, 163, 168, 173, 177, 182, 187, 191, 195, 206, 211, 218, 223, 231, 236, 240, and 244; and HCDR2 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 88, 93, 98, 103, 107, 112, 117, 122, 131, 135, 138, 143, 146, 151, 156, 163, 168, 173, 177, 182, 187, 191, 195, 206, 211, 218, 223, 231, 236, 240, and 244; a heavy chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 60, 164, 169, 174, 178, 183, 188, 192, 196, 207, 215, 219, 224, 227, 232, and 237; and HCDR3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 89, 94, 99, 104, 108, 113, 118, 123, 127, 132, 136, 139, 144, 147, 152, 157, 161, 170, 175, 179, 184, 189, 193, 197, 208, 212, 216, 220, 225, 228, 233, 238, 241, and 245; and (b) a light chain variable region comprising three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 90, 95, 100, 109, 114, 119, 124, 128, 140, 148, 153, 158, 166, 171, 180, 185, 200, 203, 209, 213, 221, 229, 234, 242, and 246; and LCDR2 comprises an amino acid sequence selected from the group consisting of ADS, AND, ANI, EAS, GNS, GNT, GSH, GSS, GYN, KDT, LVS, NND, QVS, RDT, SD G, SNK, SSS, and SVS; and LCDR3 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 91, 96, 101, 105, 110, 115, 120, 125, 129, 133, 141, 149, 154, 159, 162, 165, 167, 172, 176, 181, 186, 190, 194, 198, 199, 201, 202, 204, 205, 210, 214, 217, 222, 226, 230, 235, 239, 243, and 247. Includes:
[0043] In certain embodiments, HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 are (a) each comprising the amino acid sequence set forth in SEQ ID NOs: 87, 88, 89, 90, and 91, wherein LCDR2 comprises the amino acid sequence GNS; (b) comprising the respective amino acid sequences set forth in SEQ ID NOs: 92, 93, 94, 95, and 96, wherein LCDR2 comprises the amino acid sequence AND; (c) comprising the respective amino acid sequences set forth in SEQ ID NOs: 97, 98, 99, 100, and 101, wherein LCDR2 comprises the amino acid sequence ANI; (d) comprising the respective amino acid sequences set forth in SEQ ID NOs: 102, 103, 104, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; (e) comprising the amino acid sequences set forth in SEQ ID NOs: 106, 107, 108, 109, and 110, respectively, wherein LCDR2 comprises the amino acid sequence SDG; (f) comprising the respective amino acid sequences set forth in SEQ ID NOs: 111, 112, 113, 114, and 115, wherein LCDR2 comprises the amino acid sequence GSS; (g) comprising the respective amino acid sequences set forth in SEQ ID NOs: 116, 117, 118, 119, and 120, wherein LCDR2 comprises the amino acid sequence GNT; (h) comprising each of the amino acid sequences set forth in SEQ ID NOs: 121, 122, 123, 124, and 125, wherein LCDR2 comprises the amino acid sequence GYN; (i) comprising the respective amino acid sequences set forth in SEQ ID NOs: 126, 117, 127, 128, and 129, wherein LCDR2 comprises the amino acid sequence GNS; (j) comprising the amino acid sequences set forth in SEQ ID NOs: 130, 131, 132, 100, and 133, respectively, wherein LCDR2 comprises the amino acid sequence ANI; (k) each of the amino acid sequences set forth in SEQ ID NOs: 134, 135, 136, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; (l) each of the amino acid sequences set forth in SEQ ID NOs: 137, 138, 139, 140, and 141, wherein LCDR2 comprises the amino acid sequence ADS; (m) comprising the respective amino acid sequences set forth in SEQ ID NOs: 142, 143, 144, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; (n) comprising the respective amino acid sequences set forth in SEQ ID NOs: 145, 146, 147, 148, and 149, wherein LCDR2 comprises the amino acid sequence GNS; (o) comprising each of the amino acid sequences set forth in SEQ ID NOs: 150, 151, 152, 153, and 154, wherein LCDR2 comprises the amino acid sequence GNS; (p) comprising the amino acid sequences set forth in SEQ ID NOs: 155, 156, 157, 158, and 159, respectively, wherein LCDR2 comprises the amino acid sequence GSH; (q) comprising each of the amino acid sequences set forth in SEQ ID NOs: 121, 160, 161, 128, and 162, wherein LCDR2 comprises the amino acid sequence GNS; (r) comprising the respective amino acid sequences set forth in SEQ ID NOs: 163, 164, 123, 124, and 165, wherein LCDR2 comprises the amino acid sequence GYN; (s) each comprising the amino acid sequence set forth in SEQ ID NOs: 106, 107, 108, 166, and 167, wherein LCDR2 comprises the amino acid sequence SDG; (t) comprising the respective amino acid sequences set forth in SEQ ID NOs: 168, 169, 170, 171, and 172, wherein LCDR2 comprises the amino acid sequence KDT; (u) comprising each of the amino acid sequences set forth in SEQ ID NOs: 173, 174, 175, 171, and 176, wherein LCDR2 comprises the amino acid sequence KDT; (v) comprising the respective amino acid sequences set forth in SEQ ID NOs: 177, 178, 179, 180, and 181, wherein LCDR2 comprises the amino acid sequence SSS; (w) comprising the amino acid sequences set forth in SEQ ID NOs: 182, 183, 184, 185, and 186, respectively, wherein LCDR2 comprises the amino acid sequence LVS; (x) comprising each of the amino acid sequences set forth in SEQ ID NOs: 187, 188, 189, 100, and 190, wherein LCDR2 comprises the amino acid sequence ANI; (y) comprises each of the amino acid sequences set forth in SEQ ID NOs: 191, 192, 193, 185, and 194, wherein LCDR2 comprises the amino acid sequence QVS; (z) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 198, wherein LCDR2 comprises the amino acid sequence KDT; (aa) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 199, wherein LCDR2 comprises the amino acid sequence KDT; (bb) comprising each of the amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 200, and 201, wherein LCDR2 comprises the amino acid sequence RDT; (cc) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 200, and 202, wherein LCDR2 comprises the amino acid sequence KDT; (dd) comprising each of the amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 190, wherein LCDR2 comprises the amino acid sequence KDT; (ee) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 203, and 204, wherein LCDR2 comprises the amino acid sequence RDT; (ff) comprising the amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 205, respectively, wherein LCDR2 comprises the amino acid sequence KDT; (gg) comprising the amino acid sequences set forth in SEQ ID NOs: 206, 207, 208, 209, and 210, respectively, wherein LCDR2 comprises the amino acid sequence SVS; (hh) comprising the amino acid sequences set forth in SEQ ID NOs: 211, 112, 113, 114, and 115, respectively, wherein LCDR2 comprises the amino acid sequence GSS; (ii) comprising the respective amino acid sequences set forth in SEQ ID NOs: 168, 117, 212, 213, and 214, wherein LCDR2 comprises the amino acid sequence KDT; (jj) comprising each of the amino acid sequences set forth in SEQ ID NOs: 121, 215, 216, 166, and 217, wherein LCDR2 comprises the amino acid sequence SDG; (kk) comprising the respective amino acid sequences set forth in SEQ ID NOs: 218, 219, 220, 221, and 222, wherein LCDR2 comprises the amino acid sequence RDT; (ll) comprising the respective amino acid sequences set forth in SEQ ID NOs: 223, 224, 225, 213, and 226, wherein LCDR2 comprises the amino acid sequence KDT; (mm) comprising the respective amino acid sequences set forth in SEQ ID NOs: 121, 227, 228, 229, and 230, wherein LCDR2 comprises the amino acid sequence SDG; (nn) comprising the respective amino acid sequences set forth in SEQ ID NOs: 231, 232, 233, 234, and 235, wherein LCDR2 comprises the amino acid sequence NND; (oo) comprising the respective amino acid sequences set forth in SEQ ID NOs: 236, 237, 238, 171, and 239, wherein LCDR2 comprises the amino acid sequence KDT; (pp) comprising each of the amino acid sequences set forth in SEQ ID NOs: 240, 143, 241, 242, and 243, wherein LCDR2 comprises the amino acid sequence SNK; or (qq) Comprises the amino acid sequences set forth in SEQ ID NOs: 244, 138, 245, 246, and 247, respectively, and LCDR2 comprises the amino acid sequence EAS.
[0044] In certain embodiments, the antigen-binding domain comprises a heavy chain variable region comprising any of the amino acid sequences set forth in SEQ ID NOs: 314 to 356, and a light chain variable region comprising any of the amino acid sequences set forth in SEQ ID NOs: 271 to 313.
[0045] In certain embodiments, the antigen binding domain comprises: (a) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 314, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 271; (b) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 315, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 272; (c) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 316, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 273; (d) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 317, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 274; (e) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 318, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 275; (f) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 319, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 276; (g) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 320, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 277; (h) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 321, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 278; (i) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 322, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 279; (j) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 323, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 280; (k) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 324, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 281; (l) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 325, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 282; (m) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 326, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 283; (n) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 327, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 284; (o) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 328, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 285; (p) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 329, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 286; (q) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 330, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 287; (r) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 331, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 288; (s) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 332, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 289; (t) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 333, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 290; (u) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 334, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 291; (v) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 335, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 292; (w) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 336, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 293; (x) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 337, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 294; (y) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 338, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 295; (z) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 339, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 296; (aa) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 340, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 297; (bb) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 341, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 298; (cc) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 342, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 299; (dd) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 343, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 300; (ee) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 344, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 301; (ff) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 345, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 302; (gg) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 346, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 303; (hh) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 347, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 304; (ii) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 348, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 305; (jj) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 349, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 306; (kk) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 350, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 307; (ll) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 351, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 308; (mm) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 352, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 309; (nn) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 353, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 310; (oo) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 354, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 311; (pp) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 355, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 312, or (qq) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 356, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 313 Includes:
[0046] In certain embodiments, the NKR intracellular signaling domain is selected from the group consisting of an actKIR domain, an NCR domain, an SLAMF domain, an FcR domain, a CD16 domain, a CD64 domain, an actLy49 domain, and an inhLy49 domain.
[0047] In certain embodiments, the NKR-CAR is a KIR-CAR.
[0048] In certain embodiments, the intracellular signaling domain is a KIR signaling domain selected from the group consisting of a KIR2DS2 signaling domain, a KIR2DS2 signaling domain, a KIR2DL3 signaling domain, a KIR2DL1 signaling domain, a KIR2DL2 signaling domain, a KIR2DL4 signaling domain, a KIR2DL5A signaling domain, a KIR2DL5B signaling domain, a KIR2DS1 signaling domain, a KIR2DS3 signaling domain, a KIR2DS4 signaling domain, a KIR2DS5 signaling domain, a KIR3DL1 signaling domain, a KIR3DS1 signaling domain, a KIR3DL2 signaling domain, a KIR3DL3 signaling domain, a KIR2DP1 signaling domain, and a KIR3DP1 signaling domain.
[0049] In certain embodiments, the transmembrane domain is a KIR transmembrane domain selected from the group consisting of KIR2DS2 transmembrane domain, KIR2DS2 transmembrane domain, KIR2DL3 transmembrane domain, KIR2DL1 transmembrane domain, KIR2DL2 transmembrane domain, KIR2DL4 transmembrane domain, KIR2DL5A transmembrane domain, KIR2DL5B transmembrane domain, KIR2DS1 transmembrane domain, KIR2DS3 transmembrane domain, KIR2DS4 transmembrane domain, KIR2DS5 transmembrane domain, KIR3DL1 transmembrane domain, KIR3DS1 transmembrane domain, KIR3DL2 transmembrane domain, KIR3DL3 transmembrane domain, KIR2DP1 transmembrane domain and KIR3DP1 transmembrane domain.
[0050] In certain embodiments, the transmembrane domain is capable of binding to and / or activating DAP12 via the transmembrane domain of DAP12.
[0051] In a specific embodiment, the KIR signaling domain comprises the amino acid sequence set forth in SEQ ID NO:266.
[0052] In certain embodiments, the CAR comprises the amino acid sequence set forth in SEQ ID NOs: 370-412.
[0053] In another aspect, the present invention provides a method for producing a (a) a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 87, 92, 97, 102, 106, 111, 116, 121, 126, 130, 134, 137, 142, 145, 150, 155, 163, 168, 173, 177, 182, 187, 191, 195, 206, 211, 218, 223, 231, 236, 240, and 244; HCDR2 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 88, 93, 98, 103, 107, 112, 117, 122, 131, 135, 138, 143, 146, 151, 156, 160, 164, 169, 174, 178, 183, 188, 192, 196, 207, 215, 219, 224, 227, 232, and 237; and HCDR3 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 89, 94, 99, 104, 108, 113, 118, 123, 127, 132 , 136, 139, 144, 147, 152, 157, 161, 170, 175, 179, 184, 189, 193, 197, 208, 212, 216, 220, 225, 228, 233, 238, 241, and 245, and a light chain variable region comprising three light chain complementarity determining regions (LCDRs), wherein LCDR1 is selected from the group consisting of SEQ ID NOs: 90, 95, 100, 109, 114, 119, 124 , 128, 140, 148, 153, 158, 166, 171, 180, 185, 200, 203, 209, 213, 221, 229, 234, 242, and 246; and LCDR2 comprises an amino acid sequence selected from the group consisting of ADS, AND, ANI, EAS, GNS, GNT, GSH, GSS, GYN, KDT, LVS, NND, QVS, RDT, SDG, SNK, SSS, and SVS;an antigen-binding domain, wherein LCDR3 comprises a light chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 91, 96, 101, 105, 110, 115, 120, 125, 129, 133, 141, 149, 154, 159, 162, 165, 167, 172, 176, 181, 186, 190, 194, 198, 199, 201, 202, 204, 205, 210, 214, 217, 222, 226, 230, 235, 239, 243, and 247; (b) a transmembrane domain; and (c) KIR2DS2 intracellular signaling domain and chimeric antigen receptors (CARs), including:
[0054] In certain embodiments, HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 are (a) each comprising the amino acid sequence set forth in SEQ ID NOs: 87, 88, 89, 90, and 91, wherein LCDR2 comprises the amino acid sequence GNS; (b) comprising the respective amino acid sequences set forth in SEQ ID NOs: 92, 93, 94, 95, and 96, wherein LCDR2 comprises the amino acid sequence AND; (c) comprising the respective amino acid sequences set forth in SEQ ID NOs: 97, 98, 99, 100, and 101, wherein LCDR2 comprises the amino acid sequence ANI; (d) comprising the respective amino acid sequences set forth in SEQ ID NOs: 102, 103, 104, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; (e) comprising the amino acid sequences set forth in SEQ ID NOs: 106, 107, 108, 109, and 110, respectively, wherein LCDR2 comprises the amino acid sequence SDG; (f) comprising the respective amino acid sequences set forth in SEQ ID NOs: 111, 112, 113, 114, and 115, wherein LCDR2 comprises the amino acid sequence GSS; (g) comprising the respective amino acid sequences set forth in SEQ ID NOs: 116, 117, 118, 119, and 120, wherein LCDR2 comprises the amino acid sequence GNT; (h) comprising each of the amino acid sequences set forth in SEQ ID NOs: 121, 122, 123, 124, and 125, wherein LCDR2 comprises the amino acid sequence GYN; (i) comprising the respective amino acid sequences set forth in SEQ ID NOs: 126, 117, 127, 128, and 129, wherein LCDR2 comprises the amino acid sequence GNS; (j) comprising the amino acid sequences set forth in SEQ ID NOs: 130, 131, 132, 100, and 133, respectively, wherein LCDR2 comprises the amino acid sequence ANI; (k) each of the amino acid sequences set forth in SEQ ID NOs: 134, 135, 136, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; (l) each of the amino acid sequences set forth in SEQ ID NOs: 137, 138, 139, 140, and 141, wherein LCDR2 comprises the amino acid sequence ADS; (m) comprising the respective amino acid sequences set forth in SEQ ID NOs: 142, 143, 144, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; (n) comprising the respective amino acid sequences set forth in SEQ ID NOs: 145, 146, 147, 148, and 149, wherein LCDR2 comprises the amino acid sequence GNS; (o) comprising each of the amino acid sequences set forth in SEQ ID NOs: 150, 151, 152, 153, and 154, wherein LCDR2 comprises the amino acid sequence GNS; (p) comprising the amino acid sequences set forth in SEQ ID NOs: 155, 156, 157, 158, and 159, respectively, wherein LCDR2 comprises the amino acid sequence GSH; (q) comprising each of the amino acid sequences set forth in SEQ ID NOs: 121, 160, 161, 128, and 162, wherein LCDR2 comprises the amino acid sequence GNS; (r) comprising the respective amino acid sequences set forth in SEQ ID NOs: 163, 164, 123, 124, and 165, wherein LCDR2 comprises the amino acid sequence GYN; (s) each comprising the amino acid sequence set forth in SEQ ID NOs: 106, 107, 108, 166, and 167, wherein LCDR2 comprises the amino acid sequence SDG; (t) comprising the respective amino acid sequences set forth in SEQ ID NOs: 168, 169, 170, 171, and 172, wherein LCDR2 comprises the amino acid sequence KDT; (u) comprising each of the amino acid sequences set forth in SEQ ID NOs: 173, 174, 175, 171, and 176, wherein LCDR2 comprises the amino acid sequence KDT; (v) comprising the respective amino acid sequences set forth in SEQ ID NOs: 177, 178, 179, 180, and 181, wherein LCDR2 comprises the amino acid sequence SSS; (w) comprising the amino acid sequences set forth in SEQ ID NOs: 182, 183, 184, 185, and 186, respectively, wherein LCDR2 comprises the amino acid sequence LVS; (x) comprising each of the amino acid sequences set forth in SEQ ID NOs: 187, 188, 189, 100, and 190, wherein LCDR2 comprises the amino acid sequence ANI; (y) comprises each of the amino acid sequences set forth in SEQ ID NOs: 191, 192, 193, 185, and 194, wherein LCDR2 comprises the amino acid sequence QVS; (z) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 198, wherein LCDR2 comprises the amino acid sequence KDT; (aa) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 199, wherein LCDR2 comprises the amino acid sequence KDT; (bb) comprising each of the amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 200, and 201, wherein LCDR2 comprises the amino acid sequence RDT; (cc) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 200, and 202, wherein LCDR2 comprises the amino acid sequence KDT; (dd) comprising each of the amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 190, wherein LCDR2 comprises the amino acid sequence KDT; (ee) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 203, and 204, wherein LCDR2 comprises the amino acid sequence RDT; (ff) comprising the amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 205, respectively, wherein LCDR2 comprises the amino acid sequence KDT; (gg) comprising the amino acid sequences set forth in SEQ ID NOs: 206, 207, 208, 209, and 210, respectively, wherein LCDR2 comprises the amino acid sequence SVS; (hh) comprising the amino acid sequences set forth in SEQ ID NOs: 211, 112, 113, 114, and 115, respectively, wherein LCDR2 comprises the amino acid sequence GSS; (ii) comprising the respective amino acid sequences set forth in SEQ ID NOs: 168, 117, 212, 213, and 214, wherein LCDR2 comprises the amino acid sequence KDT; (jj) comprising each of the amino acid sequences set forth in SEQ ID NOs: 121, 215, 216, 166, and 217, wherein LCDR2 comprises the amino acid sequence SDG; (kk) comprising the respective amino acid sequences set forth in SEQ ID NOs: 218, 219, 220, 221, and 222, wherein LCDR2 comprises the amino acid sequence RDT; (ll) comprising the respective amino acid sequences set forth in SEQ ID NOs: 223, 224, 225, 213, and 226, wherein LCDR2 comprises the amino acid sequence KDT; (mm) comprising the respective amino acid sequences set forth in SEQ ID NOs: 121, 227, 228, 229, and 230, wherein LCDR2 comprises the amino acid sequence SDG; (nn) comprising the respective amino acid sequences set forth in SEQ ID NOs: 231, 232, 233, 234, and 235, wherein LCDR2 comprises the amino acid sequence NND; (oo) comprising the respective amino acid sequences set forth in SEQ ID NOs: 236, 237, 238, 171, and 239, wherein LCDR2 comprises the amino acid sequence KDT; (pp) comprising each of the amino acid sequences set forth in SEQ ID NOs: 240, 143, 241, 242, and 243, wherein LCDR2 comprises the amino acid sequence SNK; or (qq) Comprises the amino acid sequences set forth in SEQ ID NOs: 244, 138, 245, 246, and 247, respectively, and LCDR2 comprises the amino acid sequence EAS.
[0055] In another aspect, the present invention provides a method for producing a (a) an antigen-binding domain comprising a heavy chain variable region comprising any of the amino acid sequences set forth in SEQ ID NOs: 314 to 356; and a light chain variable region comprising any of the amino acid sequences set forth in SEQ ID NOs: 271 to 313; (b) a transmembrane domain; and (c) Chimeric antigen receptor (CAR) containing the KIR2DS2 intracellular signaling domain Includes:
[0056] In certain embodiments, the antigen binding domain comprises: (a) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 314, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 271; (b) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 315, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 272; (c) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 316, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 273; (d) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 317, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 274; (e) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 318, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 275; (f) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 319, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 276; (g) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 320, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 277; (h) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 321, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 278; (i) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 322, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 279; (j) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 323, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 280; (k) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 324, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 281; (l) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 325, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 282; (m) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 326, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 283; (n) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 327, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 284; (o) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 328, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 285; (p) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 329, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 286; (q) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 330, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 287; (r) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 331, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 288; (s) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 332, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 289; (t) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 333, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 290; (u) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 334, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 291; (v) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 335, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 292; (w) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 336, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 293; (x) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 337, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 294; (y) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 338, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 295; (z) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 339, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 296; (aa) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 340, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 297; (bb) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 341, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 298; (cc) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 342, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 299; (dd) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 343, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 300; (ee) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 344, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 301; (ff) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 345, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 302; (gg) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 346, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 303; (hh) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 347, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 304; (ii) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 348, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 305; (jj) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 349, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 306; (kk) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 350, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 307; (ll) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 351, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 308; (mm) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 352, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 309; (nn) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 353, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 310; (oo) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 354, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 311; (pp) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 355, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 312, or (qq) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 356, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 313 Includes:
[0057] In another aspect, the present invention provides a method for producing a (a) the CD8 leader amino acid sequence set forth in SEQ ID NO: 357; (b) scFv amino acid sequences shown in SEQ ID NOs: 44 to 86; (c) the myc tag amino acid sequence set forth in SEQ ID NO: 264; and (d) the transmembrane / KIR2DS2 signaling domain amino acid sequence set forth in SEQ ID NO: 266 and chimeric antigen receptors (CARs), including:
[0058] In certain embodiments, the CAR comprises the amino acid sequence set forth in SEQ ID NOs: 370-412.
[0059] In another aspect, the invention includes an isolated nucleic acid encoding the antibody or antigen-binding fragment thereof of any one of the embodiments disclosed herein.
[0060] In certain embodiments, the invention comprises an isolated nucleic acid encoding a CAR of any one of the aspects or embodiments disclosed herein, or an NKR-CAR of any one of the aspects or embodiments disclosed herein.
[0061] In other aspects, the invention includes isolated nucleic acids encoding antibodies or antigen-binding fragments thereof, including nucleic acids having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, or 99% identity to the polynucleotide sequences set forth in SEQ ID NOs: 1-43.
[0062] In another aspect, the invention includes an isolated nucleic acid encoding an antibody or antigen-binding fragment thereof comprising a polynucleotide sequence set forth in SEQ ID NOs: 1-43.
[0063] In certain embodiments, the antibody or antigen-binding fragment thereof is selected from the group consisting of a full-length antibody, a Fab, a single-chain variable fragment (scFv), a sc(Fv)2, a dsFv, a Fab, a Fab', a (Fab')2, and a diabody.
[0064] In another aspect, the invention includes isolated nucleic acids encoding single chain variable fragments (scFv) comprising the polynucleotide sequences set forth in SEQ ID NOs: 1-43.
[0065] In certain embodiments, the antibody or antigen-binding fragment thereof, scFv, or antigen-binding domain of the CAR or NKR-CAR specifically binds to human CD19.
[0066] In another aspect, the present invention provides an isolated nucleic acid encoding a chimeric antigen receptor (CAR) comprising an antigen binding domain, a transmembrane domain, and an intracellular signaling domain, wherein the antigen binding domain comprises: (a) a heavy chain variable region comprising a nucleic acid encoding any of the amino acid sequences set forth in SEQ ID NOs: 314 to 356; and (b) a light chain variable region comprising a nucleic acid encoding any one of the amino acid sequences set forth in SEQ ID NOs: 271 to 313; The present invention includes an isolated nucleic acid comprising:
[0067] In certain embodiments, the antigen binding domain comprises: (a) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 314, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 271; (b) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 315, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 272; (c) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 316, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 273; (d) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 317, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 274; (e) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 318, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 275; (f) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 319, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 276; (g) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 320, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 277; (h) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 321, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 278; (i) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 322, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 279; (j) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 323, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 280; (k) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 324, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 281; (l) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 325, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 282; (m) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 326, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 283; (n) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 327, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 284; (o) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 328, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 285; (p) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 329, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 286; (q) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 330, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 287; (r) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 331, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 288; (s) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 332, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 289; (t) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 333, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 290; (u) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 334, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 291; (v) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 335, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 292; (w) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 336, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 293; (x) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 337, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 294; (y) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 338, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 295; (z) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 339, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 296; (aa) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 340, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 297; (bb) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 341, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 298; (cc) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 342, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 299; (dd) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 343, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 300; (ee) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 344, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 301; (ff) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 345, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 302; (gg) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 346, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 303; (hh) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 347, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 304; (ii) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 348, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 305; (jj) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 349, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 306; (kk) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 350, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 307; (ll) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 351, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 308; (mm) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 352, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 309; (nn) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 353, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 310; (oo) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 354, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 311; (pp) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 355, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 312, or (qq) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 356, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 313 Includes:
[0068] In other aspects, the invention includes an isolated nucleic acid encoding a chimeric antigen receptor (CAR) comprising an antigen-binding domain, a transmembrane domain, and an intracellular signaling domain, wherein the antigen-binding domain is encoded by any one of the nucleotide polynucleotide sequences set forth in SEQ ID NOs: 1-43.
[0069] In certain embodiments, the intracellular signaling domain comprises an intracellular domain that includes one or more cytoplasmic signaling domains of a human NK cell KIR receptor.
[0070] In certain embodiments, the KIR signaling domain comprises a KIR2DS2 signaling domain.
[0071] In a specific embodiment, the KIR signaling domain is encoded by a polynucleotide sequence comprising the sequence set forth in SEQ ID NO:265.
[0072] In another aspect, the invention includes a vector comprising the isolated nucleic acid of any one of the aspects or embodiments disclosed herein.
[0073] In certain embodiments, the vector is an expression vector.
[0074] In certain embodiments, the vector is selected from the group consisting of a DNA vector, an RNA vector, a plasmid, a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, and a retroviral vector.
[0075] In another aspect, the invention includes a host cell comprising the isolated nucleic acid of any one of the aspects or embodiments disclosed herein, or the vector of any one of the aspects or embodiments disclosed herein.
[0076] In certain embodiments, the host cell is of eukaryotic or prokaryotic origin.
[0077] In certain embodiments, the host cell is of mammalian origin.
[0078] In certain embodiments, the host cell is of bacterial origin.
[0079] In a particular embodiment, the host cell is a Chinese hamster ovary cell.
[0080] In another aspect, the present invention provides a modified immune cell or a precursor thereof comprising a chimeric antigen receptor (CAR) comprising an antigen binding domain, a transmembrane domain, and an intracellular domain, wherein the antigen binding domain is (a) a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs), wherein HCDR1 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 87, 92, 97, 102, 106, 111, 116, 121, 126, 130, 134, 137, 142, 145, 150, 155, 163, 168, 173, 177, 182, 187, 191, 195, 206, 211, 218, 223, 231, 236, 240, and 244; and HCDR2 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 88, 93, 98, 103, 107, 112, 117, 122, 131, 135, 138, 143, 146, 151, 156, 163, 168, 173, 177, 182, 187, 191, 195, 206, 211, 218, 223, 231, 236, 240, and 244; a heavy chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 60, 164, 169, 174, 178, 183, 188, 192, 196, 207, 215, 219, 224, 227, 232, and 237; and HCDR3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 89, 94, 99, 104, 108, 113, 118, 123, 127, 132, 136, 139, 144, 147, 152, 157, 161, 170, 175, 179, 184, 189, 193, 197, 208, 212, 216, 220, 225, 228, 233, 238, 241, and 245; and (b) a light chain variable region comprising three light chain complementarity determining regions (LCDRs), wherein LCDR1 comprises an amino acid sequence selected from SEQ ID NOs: 90, 95, 100, 109, 114, 119, 124, 128, 140, 148, 153, 158, 166, 171, 180, 185, 200, 203, 209, 213, 221, 229, 234, 242, and 246; and LCDR2 comprises an amino acid sequence selected from SEQ ID NOs: ADS, AND, ANI, EAS, GNS, GNT, GSH, GSS, GYN, KDT, LVS, NND, QVS, RDT, SD G, SNK, SSS, and SVS; and LCDR3 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 91, 96, 101, 105, 110, 115, 120, 125, 129, 133, 141, 149, 154, 159, 162, 165, 167, 172, 176, 181, 186, 190, 194, 198, 199, 201, 202, 204, 205, 210, 214, 217, 222, 226, 230, 235, 239, 243, and 247. The present invention includes modified immune cells or precursor cells thereof, comprising:
[0081] In certain embodiments, HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 are (a) each comprising the amino acid sequence set forth in SEQ ID NOs: 87, 88, 89, 90, and 91, wherein LCDR2 comprises the amino acid sequence GNS; (b) comprising the respective amino acid sequences set forth in SEQ ID NOs: 92, 93, 94, 95, and 96, wherein LCDR2 comprises the amino acid sequence AND; (c) comprising the respective amino acid sequences set forth in SEQ ID NOs: 97, 98, 99, 100, and 101, wherein LCDR2 comprises the amino acid sequence ANI; (d) comprising the respective amino acid sequences set forth in SEQ ID NOs: 102, 103, 104, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; (e) comprising the amino acid sequences set forth in SEQ ID NOs: 106, 107, 108, 109, and 110, respectively, wherein LCDR2 comprises the amino acid sequence SDG; (f) comprising the respective amino acid sequences set forth in SEQ ID NOs: 111, 112, 113, 114, and 115, wherein LCDR2 comprises the amino acid sequence GSS; (g) comprising the respective amino acid sequences set forth in SEQ ID NOs: 116, 117, 118, 119, and 120, wherein LCDR2 comprises the amino acid sequence GNT; (h) comprising each of the amino acid sequences set forth in SEQ ID NOs: 121, 122, 123, 124, and 125, wherein LCDR2 comprises the amino acid sequence GYN; (i) comprising the respective amino acid sequences set forth in SEQ ID NOs: 126, 117, 127, 128, and 129, wherein LCDR2 comprises the amino acid sequence GNS; (j) comprising the amino acid sequences set forth in SEQ ID NOs: 130, 131, 132, 100, and 133, respectively, wherein LCDR2 comprises the amino acid sequence ANI; (k) each of the amino acid sequences set forth in SEQ ID NOs: 134, 135, 136, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; (l) each of the amino acid sequences set forth in SEQ ID NOs: 137, 138, 139, 140, and 141, wherein LCDR2 comprises the amino acid sequence ADS; (m) comprising the respective amino acid sequences set forth in SEQ ID NOs: 142, 143, 144, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; (n) comprising the respective amino acid sequences set forth in SEQ ID NOs: 145, 146, 147, 148, and 149, wherein LCDR2 comprises the amino acid sequence GNS; (o) comprising each of the amino acid sequences set forth in SEQ ID NOs: 150, 151, 152, 153, and 154, wherein LCDR2 comprises the amino acid sequence GNS; (p) comprising the amino acid sequences set forth in SEQ ID NOs: 155, 156, 157, 158, and 159, respectively, wherein LCDR2 comprises the amino acid sequence GSH; (q) comprising each of the amino acid sequences set forth in SEQ ID NOs: 121, 160, 161, 128, and 162, wherein LCDR2 comprises the amino acid sequence GNS; (r) comprising the respective amino acid sequences set forth in SEQ ID NOs: 163, 164, 123, 124, and 165, wherein LCDR2 comprises the amino acid sequence GYN; (s) each comprising the amino acid sequence set forth in SEQ ID NOs: 106, 107, 108, 166, and 167, wherein LCDR2 comprises the amino acid sequence SDG; (t) comprising the respective amino acid sequences set forth in SEQ ID NOs: 168, 169, 170, 171, and 172, wherein LCDR2 comprises the amino acid sequence KDT; (u) comprising each of the amino acid sequences set forth in SEQ ID NOs: 173, 174, 175, 171, and 176, wherein LCDR2 comprises the amino acid sequence KDT; (v) comprising the respective amino acid sequences set forth in SEQ ID NOs: 177, 178, 179, 180, and 181, wherein LCDR2 comprises the amino acid sequence SSS; (w) comprising the amino acid sequences set forth in SEQ ID NOs: 182, 183, 184, 185, and 186, respectively, wherein LCDR2 comprises the amino acid sequence LVS; (x) comprising each of the amino acid sequences set forth in SEQ ID NOs: 187, 188, 189, 100, and 190, wherein LCDR2 comprises the amino acid sequence ANI; (y) comprises each of the amino acid sequences set forth in SEQ ID NOs: 191, 192, 193, 185, and 194, wherein LCDR2 comprises the amino acid sequence QVS; (z) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 198, wherein LCDR2 comprises the amino acid sequence KDT; (aa) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 199, wherein LCDR2 comprises the amino acid sequence KDT; (bb) comprising each of the amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 200, and 201, wherein LCDR2 comprises the amino acid sequence RDT; (cc) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 200, and 202, wherein LCDR2 comprises the amino acid sequence KDT; (dd) comprising each of the amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 190, wherein LCDR2 comprises the amino acid sequence KDT; (ee) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 203, and 204, wherein LCDR2 comprises the amino acid sequence RDT; (ff) comprising the amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 205, respectively, wherein LCDR2 comprises the amino acid sequence KDT; (gg) comprising the amino acid sequences set forth in SEQ ID NOs: 206, 207, 208, 209, and 210, respectively, wherein LCDR2 comprises the amino acid sequence SVS; (hh) comprising the amino acid sequences set forth in SEQ ID NOs: 211, 112, 113, 114, and 115, respectively, wherein LCDR2 comprises the amino acid sequence GSS; (ii) comprising the respective amino acid sequences set forth in SEQ ID NOs: 168, 117, 212, 213, and 214, wherein LCDR2 comprises the amino acid sequence KDT; (jj) comprising each of the amino acid sequences set forth in SEQ ID NOs: 121, 215, 216, 166, and 217, wherein LCDR2 comprises the amino acid sequence SDG; (kk) comprising the respective amino acid sequences set forth in SEQ ID NOs: 218, 219, 220, 221, and 222, wherein LCDR2 comprises the amino acid sequence RDT; (ll) comprising the respective amino acid sequences set forth in SEQ ID NOs: 223, 224, 225, 213, and 226, wherein LCDR2 comprises the amino acid sequence KDT; (mm) comprising the respective amino acid sequences set forth in SEQ ID NOs: 121, 227, 228, 229, and 230, wherein LCDR2 comprises the amino acid sequence SDG; (nn) comprising the respective amino acid sequences set forth in SEQ ID NOs: 231, 232, 233, 234, and 235, wherein LCDR2 comprises the amino acid sequence NND; (oo) comprising the respective amino acid sequences set forth in SEQ ID NOs: 236, 237, 238, 171, and 239, wherein LCDR2 comprises the amino acid sequence KDT; (pp) comprising each of the amino acid sequences set forth in SEQ ID NOs: 240, 143, 241, 242, and 243, wherein LCDR2 comprises the amino acid sequence SNK; or (qq) Comprises the amino acid sequences set forth in SEQ ID NOs: 244, 138, 245, 246, and 247, respectively, and LCDR2 comprises the amino acid sequence EAS.
[0082] In a specific embodiment, the CAR binds to human CD19.
[0083] In certain embodiments, the CAR comprises an antigen-binding domain selected from the group consisting of an antibody, an scFv, and a Fab.
[0084] In certain embodiments, the CAR comprises an intracellular domain comprising the cytoplasmic signaling domain of a human NK cell KIR receptor.
[0085] In certain embodiments, the KIR signaling domain comprises a KIR2DS2 signaling domain.
[0086] In certain embodiments, the modified cells are autologous cells.
[0087] In certain embodiments, the modified cells are allogeneic cells.
[0088] In certain embodiments, the modified cells are cells isolated from a human subject.
[0089] In certain embodiments, the modified cells are modified T cells.
[0090] In another aspect, the invention includes a pharmaceutical composition comprising the antibody or antigen-binding fragment thereof, scFv, CAR, NKR-CAR, isolated nucleic acid, vector, or modified immune cell of any one of the aspects or embodiments disclosed herein, or any combination thereof, and a pharmaceutically acceptable excipient, carrier, or diluent.
[0091] In another aspect, the invention includes a method of making an engineered immune cell or a progenitor thereof, comprising introducing into an immune cell or a progenitor thereof an isolated nucleic acid encoding a chimeric antigen receptor (CAR) of any one of the aspects or embodiments disclosed herein or an NKR-CAR of any one of the aspects or embodiments disclosed herein.
[0092] In certain embodiments, the modified immune cells are T cells.
[0093] In other aspects, the present invention includes a method of treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of modified immune cells disclosed herein, thereby treating the cancer.
[0094] In certain embodiments, the cancer is a hematological cancer.
[0095] In certain embodiments, the cancer is associated with expression of CD19.
[0096] In certain embodiments, CD19 is expressed on tumor cells.
[0097] In certain embodiments, the cancer is selected from the group consisting of Burkitt's lymphoma, chronic lymphocytic leukemia (CLL), acute lymphocytic leukemia (ALL), B-cell lymphoma, and B-cell leukemia.
[0098] In certain embodiments, the subject is a human.
[0099] In another aspect, the invention includes a method of treating an autoimmune disorder or disease in a subject in need thereof, comprising administering to the subject an effective amount of modified immune cells disclosed herein, thereby treating the autoimmune disorder.
[0100] In certain embodiments, the autoimmune disease is antibody-mediated.
[0101] In certain embodiments, administration of the modified immune cells depletes autoimmune B cells.
[0102] In certain embodiments, the autoimmune disorder is selected from the group consisting of rheumatoid arthritis, systemic lupus erythematosus (SLE), lupus nephritis (LN), idiopathic / autoimmune thrombocytopenic purpura (ITP), idiopathic thrombotic thrombocytopenic purpura (TTP), pemphigus-related disease, diabetes, sclerosis, myasthenia gravis, multiple sclerosis, vasculitis, and autoimmune hemolytic anemia.
[0103] In another aspect, the invention includes a method of treating an alloantibody-mediated disorder or disease in a subject in need thereof, comprising administering to the subject an effective amount of modified immune cells disclosed herein, thereby treating the alloantibody-mediated disorder or disease.
[0104] In certain embodiments, administration of the engineered immune cells depletes alloantibody-producing B cells.
[0105] In certain embodiments, the autoantibody-mediated disorder is selected from the group consisting of solid organ transplant immunoincompatibility, acute or delayed hemolytic reaction associated with enzyme replacement therapy or transfusion, and chronic alloantibody-mediated rejection (CAMR), organ transplant immunoincompatible hemophilia (hemophilia A or B), lysosomal storage disease (LSD), urea cycle disorder, adenosine deaminase deficiency, neuronal lipid storage disease (NCL), hyperammonemia, and chronic graft-versus-host disease (cGvHD).
[0106] In certain embodiments, the lysosomal storage disease is selected from the group consisting of glycogen storage disease, Gaucher disease, Niemann-Pick disease, Fabry disease, and mucopolysaccharidosis (MPS) I, MPS II, and MPS VI.
[0107] The following detailed description of the embodiments of the present disclosure will be better understood when read in conjunction with the accompanying drawings. For the purpose of illustrating the disclosure, there are shown in the drawings preferred embodiments of the invention. It should be understood, however, that the disclosure is not limited to the precise arrangements and arrangements of the embodiments shown in the drawings. [Brief explanation of the drawings]
[0108] [Figure 1] An overview of the anti-CD19 discovery campaign is shown. [Figure 2] Figure 2 (top) shows the enrichment assessment of anti-CD19 scFv. Figure 2 (bottom) shows the enrichment in phage capture starting from panning round 3. Figure 2 (bottom) shows an ELISA in which microplate wells were coated with human CD19 or a control (streptavidin alone or streptavidin loaded with a biotinylated anti-idiotypic antibody against biotinylated AviTag™-human BCMA or FMC63, a mouse anti-human CD19 antibody used in several FDA-approved CD19-targeted CAR-T therapies, including tisagenlecleucel). [Figure 3] Typical ELISA results for a cohort of mostly positive scFvs are shown (38 of 84 randomly selected clones are shown in this example). [Figure 4] Graphs showing results for scFv clones that were inhibited by FMC63 (e.g., scFv1, 4, 7, etc.), clones that appeared not to be completely inhibited (e.g., scFv20, 21, 22, etc.), and those that appeared to be partially inhibited (e.g., scFv31, 33, etc.). [Figure 5] Graph showing target-specific activation of CD19scFV-based CARs as measured by Jurkat-NFAT-GFP (JNG) reporter assay. [Figure 6]1 shows dot plots demonstrating target-specific activation of CD19scFv-based CARs by Jurkat-NFAT-GFP (JNG) reporter assay as assessed by flow cytometry. [Figure 7] 1 shows the expression of CD19scFv-based CAR constructs as measured by flow cytometry staining for the myc tag domain. [Figure 8] Figure 1 shows that two exemplary CD19-CARs are efficiently expressed in human T cells. [Figure 9] Figure 1 shows that T cells expressing CD19-CAR exhibit similar proliferation and expansion rates to each other and to other CAR constructs. [Figure 10] Figure 1 shows that in the presence of the cognate target antigen, CD19, scFv18 and 19 CAR-transduced T cells produce cytokines. [Figure 11] This shows that CD19scFvCAR-T cells kill CD19-expressing cell lines in an antigen-specific manner. [Figure 12] 1 shows that treatment of NALM6 tumor-bearing mice with CD19scFv18 and scFv19 CAR-T cells results in transient tumor regression. [Figure 13] 13 shows engraftment of human CAR-T cells in mice from the study in FIG. 12, 10 days after injection. [Figure 14] Figure 1 shows the growth rate of NALM6-CBG tumors implanted in NSG mice treated with different doses of FMC63-, scFv18-, and scFv19-based CAR-T cells. Tumor growth was assessed by in vivo imaging. DETAILED DESCRIPTION OF THE INVENTION
[0109] The present disclosure provides novel polypeptides (e.g., antigen-binding fragments, scFvs) that target CD19 (e.g., human CD19). The disclosed polypeptides exhibit high binding affinity and high specificity for human CD19 and can be used in various immunotherapies to treat CD19-associated diseases.
[0110] Binding polypeptides, antibodies, and scFvs targeting CD19 In several embodiments, disclosed herein are antibodies or antigen-binding fragments thereof (or "binding polypeptides," the terms are used interchangeably) characterized by specific functional features or properties of the antibody or antigen-binding fragment thereof. For example, the binding polypeptides and antibodies specifically bind to CD19, e.g., human CD19. The binding polypeptides and antibodies of the present disclosure can bind to human CD19 with high affinity.
[0111] The binding polypeptides and antibodies of the present disclosure can specifically recognize human CD19 protein expressed on cells. In some cases, the binding polypeptides and antibodies of the present invention do not cross-react with other surface molecules on such cells. In some cases, the cells are tumor cells (e.g., chronic lymphocytic leukemia (CLL), acute lymphocytic leukemia (ALL), B-cell lymphoma, and B-cell leukemia). In some cases, the cells are immune cells. In some cases, the immune cells include T cells (e.g., activated T cells), B cells, natural killer (NK) cells, regulatory T cells, macrophages, monocytes, or dendritic cells (DCs). In some cases, the immune cells include activated T cells. In some cases, the immune cells include tumor-infiltrating lymphocytes. In some cases, CD19 is expressed or overexpressed on tumor cells.
[0112] In certain aspects, the present disclosure provides an antibody or antigen-binding fragment thereof that specifically binds to human CD19. In some cases, the antibody or antigen-binding fragment thereof comprises heavy chain complementarity-determining region 1 (HCDR1). In some cases, the antibody or antigen-binding fragment thereof comprises heavy chain complementarity-determining region 2 (HCDR2). In some cases, the antibody or antigen-binding fragment thereof comprises heavy chain complementarity-determining region 3 (HCDR3). In some cases, the antibody or antigen-binding fragment thereof comprises light chain complementarity-determining region 1 (LCDR1). In some cases, the antibody or antigen-binding fragment thereof comprises light chain complementarity-determining region 2 (LCDR2). In some cases, the antibody or antigen-binding fragment thereof comprises light chain complementarity-determining region 3 (LCDR3). In some cases, the antibody or antigen-binding fragment thereof comprises an antigen-binding domain that specifically binds to human CD19. In certain embodiments, the antigen-binding domain comprises a heavy chain variable region comprising three heavy chain complementarity-determining regions (HCDRs) and a light chain variable region comprising three light chain complementarity-determining regions (LCDRs).
[0113] In certain embodiments, the present disclosure provides an antibody or antigen-binding fragment thereof that specifically binds to human CD19, comprising: (a) an HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 87, 92, 97, 102, 106, 111, 116, 121, 126, 130, 134, 137, 142, 145, 150, 155, 163, 168, 173, 177, 182, 187, 191, 195, 206, 211, 218, 223, 231, 236, 240, or 244; (b) an HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 88, 93, 98, 103, 107, 112, 117, 118, 121, 126, 130, 134, 137, 142, 145, 150, 155, 163, 168, 173, 177, 182, 187, 191, 195, 206, 211, 218, 223, 231, 236, 240, or 244; (c) an HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 89, 94, 99, 104, 108, 113, 118, 123, 127, 132, 136, 139, 144, 147, 152, 157, 161, 170, 175, 179, 184, 189, 193, 197, 208, 212, 216, 220, 222, 223, 224, 227, 223, or 225; (d) an HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 90, 95, 100, 109, 114, 119, 124, 128, 140, 148, 153, 158, 166, 171, 180, 185, 200, 203, 209, 213, 221, 229, 234, 242, or 246; (e) an LCDR1 comprising the amino acid sequence ADS, AND, ANI, EAS, GNS, GNT, GSH, GSS, GYN, KDT, LVS, NND, QVS, RDT. , SDG, SNK, SSS, or SVS; or (f) an LCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 91, 96, 101, 105, 110, 115, 120, 125, 129, 133, 141, 149, 154, 159, 162, 165, 167, 172, 176, 181, 186, 190, 194, 198, 199, 201, 202, 204, 205, 210, 214, 217, 222, 226, 230, 235, 239, 243, or 247.
[0114] In some embodiments, provided herein is an antibody or antigen-binding fragment thereof that binds to human CD19 and comprises HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3, comprising the respective amino acid sequences set forth in SEQ ID NOs: 87, 88, 89, 90, and 91, wherein LCDR2 comprises the amino acid sequence GNS; comprising the respective amino acid sequences set forth in SEQ ID NOs: 92, 93, 94, 95, and 96, and LCDR2 comprising the amino acid sequence AND; comprising the respective amino acid sequences set forth in SEQ ID NOs: 97, 98, 99, 100, and 101, wherein LCDR2 comprises the amino acid sequence ANI; comprising the respective amino acid sequences set forth in SEQ ID NOs: 102, 103, 104, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; comprising the respective amino acid sequences set forth in SEQ ID NOs: 106, 107, 108, 109, and 110, wherein LCDR2 comprises the amino acid sequence SDG; comprising the respective amino acid sequences set forth in SEQ ID NOs: 111, 112, 113, 114, and 115, wherein LCDR2 comprises the amino acid sequence GSS; comprising the respective amino acid sequences set forth in SEQ ID NOs: 116, 117, 118, 119, and 120, wherein LCDR2 comprises the amino acid sequence GNT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 121, 122, 123, 124, and 125, wherein LCDR2 comprises the amino acid sequence GYN; comprising the respective amino acid sequences set forth in SEQ ID NOs: 126, 117, 127, 128, and 129, wherein LCDR2 comprises the amino acid sequence GNS; comprising the respective amino acid sequences set forth in SEQ ID NOs: 130, 131, 132, 100, and 133, wherein LCDR2 comprises the amino acid sequence ANI; comprising the respective amino acid sequences set forth in SEQ ID NOs: 134, 135, 136, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; comprising the respective amino acid sequences set forth in SEQ ID NOs: 137, 138, 139, 140, and 141, wherein LCDR2 comprises the amino acid sequence ADS; comprising the respective amino acid sequences set forth in SEQ ID NOs: 142, 143, 144, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; comprising the respective amino acid sequences set forth in SEQ ID NOs: 145, 146, 147, 148, and 149, wherein LCDR2 comprises the amino acid sequence GNS; comprising the respective amino acid sequences set forth in SEQ ID NOs: 150, 151, 152, 153, and 154, wherein LCDR2 comprises the amino acid sequence GNS; comprising the respective amino acid sequences set forth in SEQ ID NOs: 155, 156, 157, 158, and 159, wherein LCDR2 comprises the amino acid sequence GSH; comprising the respective amino acid sequences set forth in SEQ ID NOs: 121, 160, 161, 128, and 162, wherein LCDR2 comprises the amino acid sequence GNS; comprising the respective amino acid sequences set forth in SEQ ID NOs: 163, 164, 123, 124, and 165, wherein LCDR2 comprises the amino acid sequence GYN; comprising the respective amino acid sequences set forth in SEQ ID NOs: 106, 107, 108, 166, and 167, wherein LCDR2 comprises the amino acid sequence SDG; comprising the respective amino acid sequences set forth in SEQ ID NOs: 168, 169, 170, 171, and 172, wherein LCDR2 comprises the amino acid sequence KDT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 173, 174, 175, 171, and 176, wherein LCDR2 comprises the amino acid sequence KDT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 177, 178, 179, 180, and 181, wherein LCDR2 comprises the amino acid sequence SSS; comprising the respective amino acid sequences set forth in SEQ ID NOs: 182, 183, 184, 185, and 186, wherein LCDR2 comprises the amino acid sequence LVS; comprising the respective amino acid sequences set forth in SEQ ID NOs: 187, 188, 189, 100, and 190, wherein LCDR2 comprises the amino acid sequence ANI; comprising the respective amino acid sequences set forth in SEQ ID NOs: 191, 192, 193, 185, and 194, wherein LCDR2 comprises the amino acid sequence QVS; comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 198, wherein LCDR2 comprises the amino acid sequence KDT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 199, wherein LCDR2 comprises the amino acid sequence KDT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 200, and 201, wherein LCDR2 comprises the amino acid sequence RDT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 200, and 202, wherein LCDR2 comprises the amino acid sequence KDT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 190, wherein LCDR2 comprises the amino acid sequence KDT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 203, and 204, wherein LCDR2 comprises the amino acid sequence RDT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 205, wherein LCDR2 comprises the amino acid sequence KDT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 206, 207, 208, 209, and 210, wherein LCDR2 comprises the amino acid sequence SVS; comprising the respective amino acid sequences set forth in SEQ ID NOs: 211, 112, 113, 114, and 115, wherein LCDR2 comprises the amino acid sequence GSS; comprising the respective amino acid sequences set forth in SEQ ID NOs: 168, 117, 212, 213, and 214, wherein LCDR2 comprises the amino acid sequence KDT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 121, 215, 216, 166, and 217, wherein LCDR2 comprises the amino acid sequence SDG; comprising the respective amino acid sequences set forth in SEQ ID NOs: 218, 219, 220, 221, and 222, wherein LCDR2 comprises the amino acid sequence RDT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 223, 224, 225, 213, and 226, wherein LCDR2 comprises the amino acid sequence KDT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 121, 227, 228, 229, and 230, wherein LCDR2 comprises the amino acid sequence SDG; comprising the respective amino acid sequences set forth in SEQ ID NOs: 231, 232, 233, 234, and 235, wherein LCDR2 comprises the amino acid sequence NND; comprising the respective amino acid sequences set forth in SEQ ID NOs: 236, 237, 238, 171, and 239, wherein LCDR2 comprises the amino acid sequence KDT; each comprising the amino acid sequence set forth in SEQ ID NOs: 240, 143, 241, 242, and 243, wherein LCDR2 comprises the amino acid sequence SNK; or Antibodies or antigen-binding fragments are provided that comprise the respective amino acid sequences set forth in SEQ ID NOs: 244, 138, 245, 246, and 247, wherein LCDR2 comprises the amino acid sequence EAS.
[0115] Disclosed herein, in some embodiments, is an antibody or antigen-binding fragment thereof that specifically binds to human CD19, the antibody or antigen-binding fragment comprising: (a) a heavy chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, or 99% identity to the amino acid sequence set forth in SEQ ID NOs: 314 to 356; and (b) a light chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, or 99% identity to the amino acid sequence set forth in SEQ ID NOs: 271 to 313.
[0116]
[0020] In some aspects, provided herein is a single-chain variable fragment (scFv) that specifically binds to human CD19, comprising: (a) a heavy chain variable region comprising a heavy chain complementarity determining region 1 (HCDR1), an HCDR2, and an HCDR3, wherein HCDR1 is selected from the group consisting of SEQ ID NOs: 87, 92, 97, 102, 106, 111, 116, 121, 126, 130, 134, 137, 142, 145, 150, 155, 163, 168, 173, 177, 182, 187, 191, 195, 206, 211, 218, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280 HCDR2 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 88, 93, 98, 103, 107, 112, 117, 122, 131, 135, 138, 143, 146, 151, 156, 160, 164, 169, 174, 178, 183, 188, 192, 196, 207, 215, 219, 224, 227, 232, and 237; HCDR3 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 89, 94, 99, 104, 106, 118, 120, 122, 131, 135, 138, 143, 146, 151, 156, 160, 164, 169, 174, 178, 183, 188, 192, 196, 207, 215, 219, 224, 227, 232, and 237; and (b) a heavy chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 90, 95, 100, 108, 113, 118, 123, 127, 132, 136, 139, 144, 147, 152, 157, 161, 170, 175, 179, 184, 189, 193, 197, 208, 212, 216, 220, 225, 228, 233, 238, 241, and 245; and (b) a light chain variable region comprising a light chain complementarity determining region 1 (LCDR1), LCDR2, and LCDR3, wherein LCDR1 is selected from the group consisting of SEQ ID NOs: 90, 95, 100, 102, 104, 106, 108, 113, 118, 123, 127, 132, 136, 139, 144, 147, 152, 157, 161, 170, 175, 179, 184, 189, 193, 197, 208, 212, 216, 220, 225, 228, 233, 238, 241, and 245. wherein LCDR2 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: ADS, AND, ANI, EAS, GNS, GNT, GSH, GSS, GYN, KDT, LVS, NND, QVS, RDT, SDG, SNK, SSS, and SVS;An scFv is provided, wherein LCDR3 comprises a light chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 91, 96, 101, 105, 110, 115, 120, 125, 129, 133, 141, 149, 154, 159, 162, 165, 167, 172, 176, 181, 186, 190, 194, 198, 199, 201, 202, 204, 205, 210, 214, 217, 222, 226, 230, 235, 239, 243, and 247, and the heavy and light chain variable regions are connected by a linker;
[0117] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 87, 88, 89, 90, and 91, and wherein LCDR2 comprises the amino acid sequence GNS.
[0118] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 92, 93, 94, 95, and 96, and LCDR2 comprising the amino acid sequence AND.
[0119] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 97, 98, 99, 100, and 101, and wherein LCDR2 comprises the amino acid sequence ANI.
[0120] Also provided is an scFv that binds to human CD19 and comprises HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 102, 103, 104, 100, and 105, and wherein LCDR2 comprises the amino acid sequence ANI.
[0121] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 106, 107, 108, 109, and 110, and wherein LCDR2 comprises the amino acid sequence SDG.
[0122] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 111, 112, 113, 114, and 115, and wherein LCDR2 comprises the amino acid sequence GSS.
[0123] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 116, 117, 118, 119, and 120, and wherein LCDR2 comprises the amino acid sequence GNT.
[0124] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 121, 122, 123, 124, and 125, and wherein LCDR2 comprises the amino acid sequence GYN.
[0125] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 126, 117, 127, 128, and 129, and wherein LCDR2 comprises the amino acid sequence GNS.
[0126] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 130, 131, 132, 100, and 133, and wherein LCDR2 comprises the amino acid sequence ANI.
[0127] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 134, 135, 136, 100, and 105, and wherein LCDR2 comprises the amino acid sequence ANI.
[0128] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 137, 138, 139, 140, and 141, and wherein LCDR2 comprises the amino acid sequence ADS.
[0129] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 142, 143, 144, 100, and 105, and wherein LCDR2 comprises the amino acid sequence ANI.
[0130] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 145, 146, 147, 148, and 149, and wherein LCDR2 comprises the amino acid sequence GNS.
[0131] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 150, 151, 152, 153, and 154, and wherein LCDR2 comprises the amino acid sequence GNS.
[0132] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 155, 156, 157, 158, and 159, and wherein LCDR2 comprises the amino acid sequence GSH.
[0133] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 121, 160, 161, 128, and 162, and wherein LCDR2 comprises the amino acid sequence GNS.
[0134] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 163, 164, 123, 124, and 165, and wherein LCDR2 comprises the amino acid sequence GYN.
[0135] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 106, 107, 108, 166, and 167, and wherein LCDR2 comprises the amino acid sequence SDG.
[0136] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 168, 169, 170, 171, and 172, and wherein LCDR2 comprises the amino acid sequence KDT.
[0137] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 173, 174, 175, 171, and 176, and wherein LCDR2 comprises the amino acid sequence KDT.
[0138] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 177, 178, 179, 180, and 181, and wherein LCDR2 comprises the amino acid sequence SSS.
[0139] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 182, 183, 184, 185, and 186, and wherein LCDR2 comprises the amino acid sequence LVS.
[0140] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 187, 188, 189, 100, and 190, and wherein LCDR2 comprises the amino acid sequence ANI.
[0141] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 191, 192, 193, 185, and 194, and wherein LCDR2 comprises the amino acid sequence QVS.
[0142] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 195, 196, 197, 171, and 198, and wherein LCDR2 comprises the amino acid sequence KDT.
[0143] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 195, 196, 197, 171, and 199, and wherein LCDR2 comprises the amino acid sequence KDT.
[0144] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 195, 196, 197, 200, and 201, and wherein LCDR2 comprises the amino acid sequence RDT.
[0145] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 195, 196, 197, 200, and 202, and wherein LCDR2 comprises the amino acid sequence KDT.
[0146] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 195, 196, 197, 171, and 190, and wherein LCDR2 comprises the amino acid sequence KDT.
[0147] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 195, 196, 197, 203, and 204, and wherein LCDR2 comprises the amino acid sequence RDT.
[0148] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 195, 196, 197, 171, and 205, and wherein LCDR2 comprises the amino acid sequence KDT.
[0149] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 206, 207, 208, 209, and 210, and wherein LCDR2 comprises the amino acid sequence SVS.
[0150] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 211, 112, 113, 114, and 115, and wherein LCDR2 comprises the amino acid sequence GSS.
[0151] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 168, 117, 212, 213, and 214, and wherein LCDR2 comprises the amino acid sequence KDT.
[0152] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 121, 215, 216, 166, and 217, and wherein LCDR2 comprises the amino acid sequence SDG.
[0153] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 218, 219, 220, 221, and 222, and wherein LCDR2 comprises the amino acid sequence RDT.
[0154] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 223, 224, 225, 213, and 226, and wherein LCDR2 comprises the amino acid sequence KDT.
[0155] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 121, 227, 228, 229, and 230, and wherein LCDR2 comprises the amino acid sequence SDG.
[0156] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 231, 232, 233, 234, and 235, and wherein LCDR2 comprises the amino acid sequence NND.
[0157] Also provided is an scFv that binds to human CD19, comprising CDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 236, 237, 238, 171, and 239, and wherein LCDR2 comprises the amino acid sequence KDT.
[0158] Also provided is an scFv that binds to human CD19, comprising CDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 240, 143, 241, 242, and 243, and wherein LCDR2 comprises the amino acid sequence SNK.
[0159] Also provided is an scFv that binds to human CD19, comprising HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 comprising SEQ ID NOs: 244, 138, 245, 246, and 247, and wherein LCDR2 comprises the amino acid sequence EAS.
[0160] In some aspects, provided herein are single-chain variable fragments (scFv) comprising: (a) a heavy chain variable region comprising the amino acid sequences set forth in SEQ ID NOs: 314 to 356; and (b) a light chain variable region comprising the amino acid sequences set forth in SEQ ID NOs: 271 to 313, wherein the heavy chain variable region and the light chain variable region are connected by a linker.
[0161] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:314 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:271.
[0162] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:315 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:272.
[0163] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:316 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:273.
[0164] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:317 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:274.
[0165] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:318 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:275.
[0166] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:319 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:276.
[0167] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:320 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:277.
[0168] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:321 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:278.
[0169] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:322 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:279.
[0170] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:323 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:280.
[0171] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:324 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:281.
[0172] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:325 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:282.
[0173] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:326 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:283.
[0174] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:327 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:284.
[0175] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:328 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:285.
[0176] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:329 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:286.
[0177] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:330 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:287.
[0178] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:331 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:288.
[0179] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:332 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:289.
[0180] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:333 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:290.
[0181] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:334 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:291.
[0182] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:335 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:292.
[0183] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:336 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:293.
[0184] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:337 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:294.
[0185] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:338 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:295.
[0186] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:339 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:296.
[0187] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:340 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:297.
[0188] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:341 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:298.
[0189] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:342 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:299.
[0190] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:343 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:300.
[0191] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:344 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:301.
[0192] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:345 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:302.
[0193] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:346 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:303.
[0194] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:347 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:304.
[0195] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:348 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:305.
[0196] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:349 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:306.
[0197] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:350 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:307.
[0198] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:351 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:308.
[0199] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:352 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:309.
[0200] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:353 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:310.
[0201] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:354 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:311.
[0202] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:355 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:312.
[0203] Also provided is an scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:356 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:313.
[0204] In some aspects, provided herein are scFvs that specifically bind to human CD19 and comprise the amino acid sequences set forth in SEQ ID NOs: 44-86.
[0205] Also provided are CARs, bispecific molecules, immunoconjugates, nucleic acids, vectors, host cells, kits, compositions for the human CD19-specific antibodies and antigen-binding fragments or scFvs described herein, as well as methods of making and using the same for treating cancer in a subject.
[0206] Tolerable mutations in CDR sequences are well known to those skilled in the art. For example, in some embodiments, the isolated binding polypeptide comprises an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any of the amino acid sequences ADS, AND, ANI, EAS, GNS, GNT, GSH, GSS, GYN, KDT, LVS, NND, QVS, RDT, SDG, SNK, SSS, or SVS, or the amino acid sequence set forth in SEQ ID NOs: 87-247. In some embodiments, the isolated binding polypeptide is an antibody or antigen-binding fragment thereof that specifically binds to human CD19.
[0207] In some embodiments, the isolated binding polypeptide binds to a CD19 protein, e.g., human CD19. In some embodiments, the binding polypeptide comprises an antibody or an antigen-binding fragment thereof. In some embodiments, the antigen-binding fragment is selected from the group consisting of a full-length antibody, a Fab, a single-chain variable fragment (scFv), a single-domain antibody, a sc(Fv)2, a dsFv, a Fab, a Fab', a (Fab')2, and a diabody. In some embodiments, the antibody or antigen-binding fragment is an scFv. In some embodiments, the antibody or antigen-binding fragment is a canine scFv.
[0208] In certain embodiments, a binding polypeptide comprises a heavy chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, or 99% identity to the amino acid sequence of a heavy chain variable region set forth in SEQ ID NOs: 314-356. In certain embodiments, a binding polypeptide comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NOs: 314-356. In certain embodiments, a binding polypeptide comprises a heavy chain variable region consisting of the amino acid sequence set forth in SEQ ID NOs: 314-356.
[0209] In certain embodiments, a binding polypeptide comprises a light chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequence set forth in SEQ ID NOs: 271-313. In certain embodiments, a binding polypeptide comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NOs: 271-313. In certain embodiments, a binding polypeptide consists of a light chain variable region comprising the amino acid sequence set forth in SEQ ID NOs: 271-313.
[0210] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:314 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:271.
[0211] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:315 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:272.
[0212] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:316 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:273.
[0213] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:317 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:274.
[0214] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:318 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:275.
[0215] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:319 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:276.
[0216] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:320 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:277.
[0217] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:321 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:278.
[0218] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:322 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:279.
[0219] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:323 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:280.
[0220] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:324 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:281.
[0221] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:325 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:282.
[0222] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:326 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:283.
[0223] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:327 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:284.
[0224] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:328 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:285.
[0225] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:329 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:286.
[0226] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:330 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:287.
[0227] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:331 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:288.
[0228] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:332 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:289.
[0229] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:333 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:290.
[0230] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:334 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:291.
[0231] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:335 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:292.
[0232] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:336 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:293.
[0233] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:337 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:294.
[0234] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:338 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:295.
[0235] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:339 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:296.
[0236] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:340 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:297.
[0237] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:341 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:298.
[0238] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:342 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:299.
[0239] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:343 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:300.
[0240] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:344 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:301.
[0241] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:345 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:302.
[0242] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:346 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:303.
[0243] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:347 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:304.
[0244] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:348 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:305.
[0245] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:349 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:306.
[0246] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:350 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:307.
[0247] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:351 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:308.
[0248] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:352 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:309.
[0249] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:353 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:310.
[0250] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:354 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:311.
[0251] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:355 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:312.
[0252] Also provided is an isolated binding polypeptide comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:356 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:313.
[0253] Antibodies of the present disclosure can be prepared using antibodies or fragments thereof having one or more of the VH and / or VL sequences disclosed herein as starting materials for engineering modified antibodies, which may have altered properties compared to the starting antibody. Antibodies can be engineered by modifying one or more amino acids within one or both variable regions (i.e., VH and / or VL), e.g., within one or more CDR regions and / or within one or more framework regions. Additionally, or alternatively, antibodies can be engineered by modifying residues within the constant region(s), e.g., to alter the effector function(s) of the antibody.
[0254] Also provided are canine antibodies or antigen-binding fragments thereof that specifically bind to human CD19. Canine antibodies or antigen-binding fragments thereof can be produced from a canine antibody phage display library. A method for producing canine antibodies or antigen-binding fragments thereof that specifically bind to hCD19 is shown in Example 1. In some cases, such canine antibodies comprise any antigen-binding fragment or binding peptide disclosed herein.
[0255] Also provided are single-chain variable regions (scFv) that specifically bind to human CD19. In some cases, the scFv comprises an antigen-binding domain. In some cases, specific binding of the antibody or antigen-binding fragment thereof to hCD19 inhibits hCD19 interaction.
[0256] As used herein, a "single-chain variable fragment" or "scFv" is a fusion protein in which the variable regions of the heavy (VH) and light (VL) chains of an immunoglobulin (e.g., murine, canine, or human) are covalently linked to form a VH:VL heterodimer. The heavy (VH) and light (VL) chains are either directly linked or linked via a peptide-encoded linker that connects the N-terminus of the VH to the C-terminus of the VL, or the C-terminus of the VH to the N-terminus of the VL. In some embodiments, the antigen-binding domain (e.g., a CD19-binding domain) comprises an scFv having, from the N-terminus to the C-terminus, the following configuration: VH-linker-VL. In some embodiments, the antigen-binding domain comprises an scFv having, from the N-terminus to the C-terminus, the following configuration: VL-linker-VH. Those skilled in the art will be able to select an appropriate configuration for use in the present disclosure.
[0257] Linkers are typically rich in glycine for flexibility and rich in serine or threonine for solubility. The linker can link the heavy and light chain variable regions of the extracellular antigen-binding domain. Non-limiting examples of linkers are disclosed in SheNet et al., Anal. Chem. 80(6):1910-1917 (2008) and WO 2014 / 087010, the contents of which are incorporated herein by reference in their entirety. Various linker sequences are known in the art, including, for example, glycine-serine (GS) linkers ((GS) n , (GSGGS) n (SEQ ID NO: 248), (GGGS) n (SEQ ID NO: 249), and (GGGGS) n(SEQ ID NO: 250), where N represents an integer of at least 1. Exemplary linker sequences may comprise amino acid sequences including, but not limited to, GGSG (SEQ ID NO: 251), GGSGG (SEQ ID NO: 252), GSGSG (SEQ ID NO: 253), GSGGG (SEQ ID NO: 254), GGGSG (SEQ ID NO: 255), GSSSG (SEQ ID NO: 256), GGGGS (SEQ ID NO: 257), GGGGSGGGGSGGGGS (SEQ ID NO: 258), GGGSSRSSSSGGGGSGGGG (SEQ ID NO: 259), SGGGGSGGGGS (SEQ ID NO: 260), and the like. Those skilled in the art will be able to select appropriate linker sequences for use in the present disclosure. In one embodiment, an scFv of the disclosure comprises a heavy chain variable region (VH) and a light chain variable region (VL), wherein the VH and VL are connected by a linker sequence having the amino acid sequence GGGSSRSSSSGGGGSGGGG (SEQ ID NO: 259), which may be encoded by the nucleic acid sequence GGCGGTGGTTCCTCTAGATCTTCCTCCTCTGGTGGCGGTGGCTCGGGCGGTGGTGGG (SEQ ID NO: 261), where the arginine residue R is present as a result of comprising the nucleotide sequence for the restriction endonuclease XbaI. Those skilled in the art will appreciate that the presence of restriction sites in the linker and flanking portions of the scFv construct is useful in performing heavy / light chain "swapping" experiments for antibody optimization, if desired.
[0258] Although the constant region has been removed and a linker has been introduced, the scFv protein retains the specificity of the original immunoglobulin. As described by Huston et al., single-chain Fv polypeptide antibodies can be expressed from nucleic acids containing sequences encoding VH and VL (Proc. Nat. Acad. sci. USA, 85:5879-5883, 1988). See also U.S. Patent Nos. 5,091,513, 5,132,405, and 4,956,778; and U.S. Patent Publication Nos. 20050196754 and 20050196754. Antagonist scFvs with inhibitory activity have been reported (see, e.g., Zhao et al., Hybridoma (Larchmt) 2008 27(6):455-51; Peter et al., J Cachexia Sarcopenia Muscle 2012 August 12; Shieh et al., J Imunol 2009 183(4):2277-85; Giomarelli et al., Thromb Haemost 2007 97(6):955-63; Fife et al., J CliNInvest 2006 116(8):2252-61; Brocks et al., Immunotechnology 1997 3(3):173-84; Moosmayer et al., Ther Immunol 1995 2(10:31-40)). Agonistic scFvs with stimulatory activity have been reported (see, e.g., Peter et al., J Biol Chem 2003 25278(38):36740-7; Xie et al., Nat Biotech 1997 15(8):768-71; Ledbetter et al., Crit Rev Immunol 1997 17(5-6):427-55; Ho et al., BioChim Biophys Acta 2003 1638(3):257-66).
[0259] In certain embodiments, the antigen-binding domain of an scFv comprises a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDRs) and a light chain variable region comprising three light chain complementarity determining regions (LCDRs). HCDR1 comprises the amino acid sequence (SEQ ID NO: 87, 92, 97, 102, 106, 111, 116, 121, 126, 130, 134, 137, 142, 145, 150, 155, 163, 168, 173, 177, 182, 187, 191, 195, 206, 211, 218, 223, 231, 236, 240, or 244), and / or HCDR2 comprises the amino acid sequence (SEQ ID NO: 88, 93, 98, 103, 107, 112, 117, 122, 131, 135, 138, 143, 146, 151, 156, 160, 164, 169, 174, 178, 183, 188, 192, 196, 207, 215, 219, 224, 227, 232, or 237), and / or HCDR3 comprises the amino acid sequence (SEQ ID NOs: 89, 94, 99, 104, 108, 113, 118, 123, 127, 132, 136, 139, 144, 147, 152, 157, 161, 170, 175, 179, 184, 189, 193, 197, 208, 212, 216, 220, 225, 228, 233, 238, 241, or 245), and / or LCDR1 comprises the amino acid sequence (SEQ ID NO: 90, 95, 100, 109, 114, 119, 124, 128, 140, 148, 153, 158, 166, 171, 180, 185, 200, 203, 209, 213, 221, 229, 234, 242, or 246), and / or LCDR2 comprises the amino acid sequence (ADS, AND, ANI, EAS, GNS, GNT, GSH, GSS, GYN, KDT, LVS). , NND, QVS, RDT, SDG, SNK, SSS, or SVS), and / or LCDR3 comprises the amino acid sequence (SEQ ID NO: 91, 96, 101, 105, 110, 115, 120, 125, 129, 133, 141, 149, 154, 159, 162, 165, 167, 172, 176, 181, 186, 190, 194, 198, 199, 201, 202, 204, 205, 210, 214, 217, 222, 226, 230, 235, 239, 243, or 247). The heavy chain variable region and the light chain variable region are connected by a linker.
[0260] Also provided are single-chain variable fragments (scFv) comprising a heavy chain variable region comprising the amino acid sequences shown in SEQ ID NOs: 314 to 356 and a light chain variable region comprising the amino acid sequences shown in SEQ ID NOs: 271 to 313. The heavy chain variable region and the light chain variable region are connected by a linker.
[0261] In another aspect, there are provided single-chain variable fragments (scFv) comprising the amino acid sequences shown in SEQ ID NOs: 44 to 86. In another aspect, there are provided single-chain variable fragments (scFv) consisting of the amino acid sequences shown in SEQ ID NOs: 44 to 86.
[0262] Tolerable mutations in scFv sequences are known to those skilled in the art. For example, in some embodiments, the scFv comprises an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any of the amino acid sequences set forth in SEQ ID NOs: 44-86.
[0263] Also provided are chimeric antigen receptor (CAR) constructs comprising an antigen-binding domain, a transmembrane domain, and an intracellular signaling domain. In certain embodiments, the antigen-binding domain comprises a single-chain variable fragment (scFv) comprising the amino acid sequence set forth in SEQ ID NOs: 44-86. In other aspects, the CAR comprises an antigen-binding domain comprising a single-chain variable fragment (scFv) consisting of the amino acid sequence set forth in SEQ ID NOs: 44-86.
[0264] [Table 1-1] [Table 1-2] Table 1-3 Table 1-4 Table 1-5 Table 1-6 Table 1-7 Table 1-8 Table 1-9 Table 1-10 Table 1-11 Table 1-12 Table 1-13 Table 1-14 Table 1-15 Table 1-16 Table 1-17 Table 1-18
[0265] Table 2-1 Table 2-2 Table 2-3 Table 2-4 Table 2-5 Table 2-6 Table 2-7
[0266] Table 3-1 Table 3-2 Table 3-3 Table 3-4 [Table 3-5]
[0267] CD19 targeting In some embodiments, the binding polypeptides, antibodies, or antigen-binding fragments thereof described in the present disclosure can bind to human CD19. Human CD19 antigen, also known as B lymphocyte surface antigen B4, B4, and CVID3, is a 95kD type I transmembrane glycoprotein and a member of the immunoglobulin gene superfamily. CD19 protein is encoded by the approximately 7kb CD19 gene located on the short arm of human chromosome 16. CD19 protein has two N-terminal extracellular Ig-like domains separated by non-Ig-like domains, a single hydrophilic transmembrane domain, and a large C-terminal cytoplasmic domain. CD19 does not share significant homology with other known human proteins.
[0268] CD19 expression is primarily restricted to B-cell lymphocytes and some follicular dendritic cells and is a reliable marker of pre-B cells and mature B cells. However, CD19 expression decreases during terminal B-cell differentiation into antibody-secreting plasma cells. CD19 plays two roles in B-cell activation: as an adaptor protein that recruits other cytoplasmic signaling proteins to the plasma membrane, and as a complex with multiple membrane proteins, including complement receptor type 2 (CD21) and tetraspanin (CD81), which together act to lower the activation threshold for antigen-induced B-cell activation.
[0269] Although not generally essential for carcinogenesis and tumor growth, CD19 expression is highly conserved in most B-cell tumors, including acute lymphocytic leukemia (ALL), chronic lymphocytic leukemia (CLL), and B-cell lymphomas, and is thought to contribute to overall lymphomagenesis signaling. Indeed, the majority of B-cell malignancies express normal to high levels of CD19. Due to its selective B-cell expression and close association with B-cell lymphomas and leukemias, CD19 has become a target for cancer immunotherapy aimed at treating these types of malignancies, including targeting with monoclonal antibodies, antibody-drug conjugates, immunotoxin conjugates, bispecific T-cell engagers (BiTEs), and chimeric antigen receptors (CARs), with varying degrees of clinical success.
[0270] CD19-targeted CAR-T cells have also shown promising results in the suppression of "unwanted immune responses" in autoantibody-mediated autoimmune diseases beyond cancer, for example, for the treatment of systemic lupus erythematosus and other autoimmune diseases and for the prevention of alloantibody-mediated solid organ transplant incompatibility due to the presence of donor-specific HLA antibodies. Regarding the latter application, clinical trials are currently underway using CD19-targeted CAR-T cells in combination with BCMA-targeted CAR-T cells to treat alloimmunized patients requiring kidney transplants by eliminating autoantibody-producing B cells and plasma cells, respectively.
[0271] The CD19-specific antibodies and antigen-binding fragments (e.g., scFvs) disclosed herein can be used to target CD19 expressed on autoantibody-producing B cells and a variety of malignant and pathogenic B cells, and function as B-cell-targeted immunotherapy.
[0272] Chimeric Antigen Receptor The present invention provides compositions and methods for engineered immune cells or their precursor cells, such as engineered T cells, comprising a chimeric antigen receptor (CAR) with affinity for human CD19. The CAR of the present invention comprises an antigen binding domain (e.g., a CD19-binding domain), a transmembrane domain, a costimulatory signaling domain, and an intracellular signaling domain. The CAR of the present invention may optionally comprise a hinge domain. Thus, the CAR of the present invention comprises an antigen binding domain (e.g., a CD19-binding domain), a hinge domain, a transmembrane domain, a costimulatory signaling domain, and an intracellular signaling domain. In some embodiments, each domain of the CAR of the present invention is separated by a linker.
[0273] The antigen-binding domain can be operably linked to other domains of the CAR, such as a transmembrane domain, a costimulatory signaling domain, or an intracellular signaling domain, each of which is described elsewhere herein, for expression within the cell. In one embodiment, a first nucleic acid sequence encoding the antigen-binding domain is operably linked to a second nucleic acid sequence encoding the transmembrane domain, and is further operably linked to a third nucleic acid sequence encoding the costimulatory signaling domain.
[0274] The antigen binding domains described herein, e.g., antibodies or antigen-binding fragments thereof, scFvs, etc., can be combined with any transmembrane domain, any costimulatory signaling domain, any intracellular signaling domain, or any other domain described herein that can be included in a CAR of the invention.
[0275] In one aspect, the invention comprises a chimeric antigen receptor (CAR) that specifically binds to CD19, wherein the CAR comprises a CD19-specific antigen-binding domain, optionally a hinge domain, a transmembrane domain, a costimulatory signaling domain, and an intracellular signaling domain.
[0276] In one aspect, the present invention comprises a chimeric antigen receptor (CAR) that specifically binds to CD19, wherein the CAR comprises a CD19-specific antigen-binding domain, optionally a hinge domain, a transmembrane domain, and an intracellular signaling domain.
[0277] In one exemplary embodiment, the present invention provides a chimeric antigen receptor (CAR) that specifically binds to CD19, wherein the CD19-specific antigen binding domain comprises a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises three heavy chain complementarity determining regions, and HCDR1 is selected from the group consisting of SEQ ID NOs: 87, 92, 97, 102, 106, 111, 116, 121, 126, 130, 134, 137, 142, 145, 150, 155, 163, 168, 173, 177, 182, 187, 190, 200, 201, 202, 203, 204, 205, 206, 207, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 91, 195, 206, 211, 218, 223, 231, 236, 240, and 244; HCDR2 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 8, 93, 98, 103, 107, 112, 117, 122, 131, 135, 138, 143, 146, 151, 156, 160, 164, 169, 174, 178, 183, 188, 192, 196, 207, 215, 219, 224, 227, 232, and 237; HCDR3 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 8, 93, 98, 103, 107, 112, 117, 122, 131, 135, 138, 143, 146, 151, 156, 160, 164, 169, 174, 178, 183, 188, 192, 196, 207, 215, 219, 224, 227, 232, and 237; HCDR4 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 8, 93, 98, 103, 107, 112, 117, 122, 131, 135, 138, 143, 146, 151, 156, 160, 164, 169, 174, 17 DR3 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 89, 94, 99, 104, 108, 113, 118, 123, 127, 132, 136, 139, 144, 147, 152, 157, 161, 170, 175, 179, 184, 189, 193, 197, 208, 212, 216, 220, 225, 228, 233, 238, 241, and 245; the VL domain comprises a light chain variable region comprising three light chain complementarity determining regions (LCDRs); and LCDR1 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 104, 108, 113, 118, 123, 127, 132, 136, 139, 144, 147, 152, 157, 161, 170, 175, 179, 184, 189, 193, 197, 208, 212, 216, 220, 225, 228, 233, 238, 241, and 245; 5, 100, 109, 114, 119, 124, 128, 140, 148, 153, 158, 166, 171, 180, 185, 200, 203, 209, 213, 221, 229, 234, 242, and 246; wherein LCDR2 comprises an amino acid sequence selected from the group consisting of ADS, AND, ANI, EAS, GNS, GNT, GSH, GSS, GYN, KDT, LVS, NND, QVS, RDT, SDG, SNK, SSS, and SVS;and a KIR2DS2 signaling domain, wherein the LCDR3 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 91, 96, 101, 105, 110, 115, 120, 125, 129, 133, 141, 149, 154, 159, 162, 165, 167, 172, 176, 181, 186, 190, 194, 198, 199, 201, 202, 204, 205, 210, 214, 217, 222, 226, 230, 235, 239, 243, and 247;
[0278] In some embodiments, the genetically modified immune cells (e.g., T cells) or progenitor cells thereof of the present invention comprise a chimeric antigen receptor (CAR) with affinity for human CD 19. In some embodiments, the genetically modified immune cells (e.g., T cells) or progenitor cells thereof of the present invention comprise a chimeric antigen receptor (CAR) with affinity for human CD 19.
[0279] In certain embodiments, the genetically modified cells are T cells.
[0280] Thus, as an exemplary embodiment, provided herein is a genetically modified T cell comprising a chimeric antigen receptor (CAR) that specifically binds to human CD19, the genetically modified T cell comprising a human CD19-specific antigen-binding domain, an optional hinge domain, a transmembrane domain, a costimulatory signaling domain, and an intracellular signaling domain.
[0281] In other exemplary embodiments, provided herein are genetically modified T cells comprising a chimeric antigen receptor (CAR) that specifically binds to human CD19, the genetically modified T cells comprising a human CD19-specific antigen-binding domain, an optional hinge domain, a transmembrane domain, and a KIR2DS2 signaling domain.
[0282] Thus, in one exemplary embodiment, the present invention provides a genetically modified T cell comprising a chimeric antigen receptor (CAR) that specifically binds to human CD19, wherein the CD19-specific antigen binding domain comprises a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises three heavy chain complementarity determining regions, and HCDR1 is selected from the group consisting of SEQ ID NOs: 87, 92, 97, 102, 106, 111, 116, 121, 126, 130, 134, 137, 142, 145, 150, 155, 163, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, HCDR2 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 8, 93, 98, 103, 107, 112, 117, 122, 131, 135, 138, 143, 146, 151, 156, 160, 164, 169, 174, 178, 183, 188, 192, 196, 207, 215, 219, 224, 227, 232, and 237. HCDR3 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 89, 94, 99, 104, 108, 113, 118, 123, 127, 132, 136, 139, 144, 147, 152, 157, 161, 170, 175, 179, 184, 189, 193, 197, 208, 212, 216, 220, 225, 228, 233, 238, 241, and 245; the VL domain comprises a light chain variable region comprising three light chain complementarity determining regions, and LCDR1 comprises SEQ ID NO: 9 wherein LCDR2 comprises an amino acid sequence selected from the group consisting of ADS, AND, ANI, EAS, GNS, GNT, GSH, GSS, GYN, KDT, LVS, NND, QVS, RDT, SDG, SNK, SSS, and SVS;and a KIR2DS2 signaling domain, wherein LCDR3 comprises an antigen-binding domain; a transmembrane domain; and a KIR2DS2 signaling domain, wherein LCDR3 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 91, 96, 101, 105, 110, 115, 120, 125, 129, 133, 141, 149, 154, 159, 162, 165, 167, 172, 176, 181, 186, 190, 194, 198, 199, 201, 202, 204, 205, 210, 214, 217, 222, 226, 230, 235, 239, 243, and 247.
[0283] In certain embodiments of the invention, the antigen-binding domain of the CAR is encoded by a nucleic acid sequence comprising the nucleotide sequence of SEQ ID NOs: 1 to 43. In certain embodiments of the invention, the antigen-binding domain of the CAR comprises the amino acid sequence of SEQ ID NOs: 44 to 86.
[0284] In some embodiments, the nucleic acid encoding the antigen binding domain of the CAR encodes CDR1, HCDR2, HCDR3, LCDR1, and LCDR3, wherein CDR1, HCDR2, HCDR3, LCDR1, and LCDR3 are comprising the respective amino acid sequences set forth in SEQ ID NOs: 87, 88, 89, 90, and 91, wherein LCDR2 comprises the amino acid sequence GNS; comprising the respective amino acid sequences set forth in SEQ ID NOs: 92, 93, 94, 95, and 96, and LCDR2 comprising the amino acid sequence AND; comprising the respective amino acid sequences set forth in SEQ ID NOs: 97, 98, 99, 100, and 101, wherein LCDR2 comprises the amino acid sequence ANI; comprising the respective amino acid sequences set forth in SEQ ID NOs: 102, 103, 104, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; comprising the respective amino acid sequences set forth in SEQ ID NOs: 106, 107, 108, 109, and 110, wherein LCDR2 comprises the amino acid sequence SDG; comprising the respective amino acid sequences set forth in SEQ ID NOs: 111, 112, 113, 114, and 115, wherein LCDR2 comprises the amino acid sequence GSS; comprising the respective amino acid sequences set forth in SEQ ID NOs: 116, 117, 118, 119, and 120, wherein LCDR2 comprises the amino acid sequence GNT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 121, 122, 123, 124, and 125, wherein LCDR2 comprises the amino acid sequence GYN; comprising the respective amino acid sequences set forth in SEQ ID NOs: 126, 117, 127, 128, and 129, wherein LCDR2 comprises the amino acid sequence GNS; comprising the respective amino acid sequences set forth in SEQ ID NOs: 130, 131, 132, 100, and 133, wherein LCDR2 comprises the amino acid sequence ANI; comprising the respective amino acid sequences set forth in SEQ ID NOs: 134, 135, 136, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; comprising the respective amino acid sequences set forth in SEQ ID NOs: 137, 138, 139, 140, and 141, wherein LCDR2 comprises the amino acid sequence ADS; comprising the respective amino acid sequences set forth in SEQ ID NOs: 142, 143, 144, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; comprising the respective amino acid sequences set forth in SEQ ID NOs: 145, 146, 147, 148, and 149, wherein LCDR2 comprises the amino acid sequence GNS; comprising the respective amino acid sequences set forth in SEQ ID NOs: 150, 151, 152, 153, and 154, wherein LCDR2 comprises the amino acid sequence GNS; comprising the respective amino acid sequences set forth in SEQ ID NOs: 155, 156, 157, 158, and 159, wherein LCDR2 comprises the amino acid sequence GSH; comprising the respective amino acid sequences set forth in SEQ ID NOs: 121, 160, 161, 128, and 162, wherein LCDR2 comprises the amino acid sequence GNS; comprising the respective amino acid sequences set forth in SEQ ID NOs: 163, 164, 123, 124, and 165, wherein LCDR2 comprises the amino acid sequence GYN; comprising the respective amino acid sequences set forth in SEQ ID NOs: 106, 107, 108, 166, and 167, wherein LCDR2 comprises the amino acid sequence SDG; comprising the respective amino acid sequences set forth in SEQ ID NOs: 168, 169, 170, 171, and 172, wherein LCDR2 comprises the amino acid sequence KDT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 173, 174, 175, 171, and 176, wherein LCDR2 comprises the amino acid sequence KDT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 177, 178, 179, 180, and 181, wherein LCDR2 comprises the amino acid sequence SSS; comprising the respective amino acid sequences set forth in SEQ ID NOs: 182, 183, 184, 185, and 186, wherein LCDR2 comprises the amino acid sequence LVS; comprising the respective amino acid sequences set forth in SEQ ID NOs: 187, 188, 189, 100, and 190, wherein LCDR2 comprises the amino acid sequence ANI; comprising the respective amino acid sequences set forth in SEQ ID NOs: 191, 192, 193, 185, and 194, wherein LCDR2 comprises the amino acid sequence QVS; comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 198, wherein LCDR2 comprises the amino acid sequence KDT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 199, wherein LCDR2 comprises the amino acid sequence KDT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 200, and 201, wherein LCDR2 comprises the amino acid sequence RDT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 200, and 202, wherein LCDR2 comprises the amino acid sequence KDT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 190, wherein LCDR2 comprises the amino acid sequence KDT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 203, and 204, wherein LCDR2 comprises the amino acid sequence RDT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 205, wherein LCDR2 comprises the amino acid sequence KDT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 206, 207, 208, 209, and 210, wherein LCDR2 comprises the amino acid sequence SVS; comprising the respective amino acid sequences set forth in SEQ ID NOs: 211, 112, 113, 114, and 115, wherein LCDR2 comprises the amino acid sequence GSS; comprising the respective amino acid sequences set forth in SEQ ID NOs: 168, 117, 212, 213, and 214, wherein LCDR2 comprises the amino acid sequence KDT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 121, 215, 216, 166, and 217, wherein LCDR2 comprises the amino acid sequence SDG; comprising the respective amino acid sequences set forth in SEQ ID NOs: 218, 219, 220, 221, and 222, wherein LCDR2 comprises the amino acid sequence RDT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 223, 224, 225, 213, and 226, wherein LCDR2 comprises the amino acid sequence KDT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 121, 227, 228, 229, and 230, wherein LCDR2 comprises the amino acid sequence SDG; comprising the respective amino acid sequences set forth in SEQ ID NOs: 231, 232, 233, 234, and 235, wherein LCDR2 comprises the amino acid sequence NND; comprising the respective amino acid sequences set forth in SEQ ID NOs: 236, 237, 238, 171, and 239, wherein LCDR2 comprises the amino acid sequence KDT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 240, 143, 241, 242, and 243, wherein LCDR2 comprises the amino acid sequence SNK; or They comprise the amino acid sequences set forth in SEQ ID NOs: 244, 138, 245, 246, and 247, respectively, and LCDR2 comprises the amino acid sequence EAS.
[0285] The sequences of the individual domains of CAR are listed in Table 4.
[0286] Thus, a subject CAR may be a CAR with affinity for CD19, comprising a CD19-binding domain comprising the amino acid sequence set forth in SEQ ID NO: 44-86. A subject CD19CAR may further comprise a leader sequence comprising the amino acid sequence set forth in SEQ ID NO: 357. A subject CD19CAR may further comprise a myc tag domain comprising the amino acid sequence set forth in SEQ ID NO: 264. A subject CD19CAR may further comprise a transmembrane and intracellular signaling domain comprising the amino acid sequence set forth in SEQ ID NO: 266.
[0287] NK cell receptor CAR In some embodiments, the presently disclosed invention provides CARs that share functional and structural properties with NK cell immune function receptors (or NKRs). NKRs and NKR-CARs are described, for example, in the following sections. As described below, various NKRs can serve as the basis for NKR-CARs.
[0288] NK cell immune function receptor (NKRS) and NK cells As disclosed herein, NK cell immune function receptor (or NKR) refers to an endogenous, naturally occurring transmembrane protein expressed on NK cells that can bind to ligands on antigen-presenting cells and regulate NK cell immune function responses, such as NK cell cytolytic activity or cytokine secretion. NK cells are mononuclear cells that differentiate from lymphoid precursor cells in the bone marrow and are typically identified by the expression of cluster determinants (CDs) CD16, CD56, and / or CD57 and the absence of α / β or γ / δ TCR complexes on the cell surface. Functionally, NK cells have the ability to bind and kill target cells that do not express "self" major histocompatibility complex (MHC) / human leukocyte antigen (HLA) proteins, as well as the ability to kill tumor cells or other diseased cells that express ligands that activate the NK receptor. NK cells are characterized by their ability to bind and kill five different tumor cell lines without the need for prior immunization or activation. NK cells can also release soluble proteins and cytokines that exert regulatory effects on the immune system and can undergo multiple cell divisions to produce daughter cells with biological properties similar to those of the parent cell. When activated by interferons or cytokines, NK cells mediate the lysis of tumor cells and intracellular pathogen-infected cells through a mechanism that requires direct physical contact between the NK cell and the target cell. Target cell lysis involves the release of cytotoxic granules from the NK cell onto the surface of the bound target cell, as well as the release of effector proteins, such as perforin and granzyme B, which penetrate the target cell membrane and induce apoptosis, or programmed cell death. Normal, healthy cells are protected from lysis by NK cells. NK cell activity is regulated by a complex mechanism that includes both stimulatory and inhibitory signals.
[0289] Briefly, the lytic activity of NK cells is controlled by various cell surface receptors that transmit positive or negative signals into the cell upon interaction with ligands on target cells. The balance of positive and negative signals transmitted through these receptors determines whether the target cell is lysed (killed) by the NK cell. NK cell stimulatory signals can be mediated by natural killer cytotoxicity receptors (NCRs), such as NKp30, NKp44, and NKp46, as well as NKG2C receptors, NKG2D receptors, certain activating killer cell immunoglobulin-like receptors (KIRs), and other activating NK receptors (Lanier, Annual Review of Immunology 2005;23:225-74). NK cell inhibitory signals may be mediated by receptors such as Ly49, CD94 / NKG2A, and certain inhibitory KIRs, which recognize major histocompatibility complex (MHC) class I molecules (Karre et al., Nature 1986;319:675-8; Ohl et al., Science 1989;246:666-8). These inhibitory receptors bind to polymorphic determinants of MHC class I molecules (including HLA class I) present on other cells and inhibit NK cell-mediated lysis.
[0290] KIR-CAR In certain embodiments, the present disclosure provides chimeric antigen receptor (CAR) molecules comprising an antigen-binding domain and a killer cell immunoglobulin-like receptor domain (KIR-CAR). In one embodiment, the KIR-CAR of the present invention is expressed on the surface of immune effector cells, such as T cells or NK cells.
[0291] KIRs, termed killer cell immunoglobulin-like receptors, have been characterized in humans and non-human primates and are polymorphic type 1 transmembrane molecules present on specific subsets of lymphocytes, such as NK cells and some T cells. KIRs interact with determinants in the α1 and α2 domains of MHC class I molecules, and as described below, different KIRs are stimulatory or inhibitory for NK cells.
[0292] The NKR-CARs described herein include KIR-CARs that share functional and structural properties with KIRs.
[0293] KIRs are a family of cell surface proteins found on NK cells that regulate the killing function of these cells by interacting with MHC class I molecules, which are expressed on all cell types. This interaction allows them to detect virus-infected or tumor cells. Most KIRs are inhibitory, meaning that MHC recognition suppresses the cytotoxic activity of NK cells that express them. Only a limited number of KIRs can activate cells. The KIR gene family contains at least 15 loci (KIR2DL1, KIR2DL2 / L3, KIR2DL4, KIR2DL5A, KIR2DL5B, KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS4, KIR2DS5, KIR3DL1 / Sl, KIR3DL2, KIR3DL3, and two pseudogenes, KIR2DP1 and KIR3DP1), which are encoded in a 100-200 Kb region of the leukocyte receptor complex (LRC) located on chromosome 19 (19q13.4). The LRC constitutes a large, 1 Mb dense cluster of rapidly evolving immune genes and includes genes encoding other cell surface molecules with characteristic Ig-like extracellular domains. Furthermore, the extended LRC includes genes encoding the transmembrane adaptor molecules DAP10 and DAP12.
[0294] KIR genes vary in length from 4 to 16 kb (full genome sequence) and can contain four to nine exons. Based on their structural characteristics, KIR genes are classified into three groups: (1) type I KIR2D genes, which encode proteins with two extracellular domains, D1 and D2; (2) structurally distinct type II KIR2D genes, which encode proteins with two extracellular domains, D0 and D2; and finally, (3) KIR3D genes, which encode proteins with three extracellular Ig-like domains (D0, D1, and D2). Type I KIR2D genes include the pseudogenes KIR2DP1, KIR2DL1-3, and KIR2DS1-5, which contain eight exons and pseudoexon 3. This pseudoexon is inactivated in type I KIR2D. In some cases, this is due to a nucleotide substitution located at the intron 2-exon 3 splice site, whose nucleotide sequence shows high identity to the KIR3D exon 3 sequence and contains a characteristic three-base pair deletion. In other cases, a premature stop codon causes differential splicing of exon 3. In the type I KIR2D gene cluster, KIR2DL1 and KIR2DL2 share a common deletion in exon 7, which distinguishes them from all other KIRs in this exon and results in a shorter exon 7 sequence. Similarly, in type I KIR2D, KIR2DL1-3 differ from KIR2DS1-5 only in the length of the cytoplasmic tail coding region of exon 9. The pseudogene structure of KIR2DP1 differs from that of KIR2DL1-3 in that the former has a shorter exon 4 sequence due to a single base pair deletion.
[0295] Type II KIR2D genes include KIR2DL4 and KIR2DL5. Unlike KIR3D and type I KIR2D, type II KIR2D is unique in that it lacks the region corresponding to exon 4 in all other KIRs. Furthermore, type II KIR2D genes differ from type I KIR2D genes in that the former contains a translated exon 3, whereas the latter contains a nontranslated pseudoexon 3 sequence. Within type II KIR2D genes, KIR2DL4 is further distinguished from KIR2DL5 (and other KIR genes) by the length of its exon 1 sequence. It was found that exon 1 in KIR2DL4 is six nucleotides longer than that present in other KIR genes and has a different start codon. This start codon is more consistent with the Kozak transcription initiation consensus sequence than the second potential start codon in KIR2DL4, which corresponds to the start codon present in other KIR genes.
[0296] The KIR3D gene contains nine exons and includes the structurally related KIR3DL1, KIR3DS1, KIR3DL2, and KIR3DL3 genes. The KIR3DL2 nucleotide sequence is the longest of all KIR genes, spanning 16,256 bp in the whole genome sequence and 1,368 bp in the cDNA. Within the KIR3D group, four KIR genes differ in the length of the cytoplasmic tail-coding region in exon 9. The length of the cytoplasmic tail of KIR proteins can vary from 14 amino acid residues (some KIR3DS1 alleles) to 108 amino acid residues (KIR2DL4 proteins). Furthermore, KIR3DS1 differs from KIR3DL1 or KIR3DL2 by a shorter sequence in exon 8. KIR3DL3 differs from other KIR sequences by a complete deletion of exon 6. The most extreme KIR gene structural variation was observed in KIR3DP1. This gene fragment completely deletes exons 6–9 and, rarely, exon 2. The remaining gene portion (exons 1, 3, 4, and 5) shares high sequence identity with other KIR3D sequences, particularly the KIR3DL3 sequence.
[0297] KIR proteins contain a characteristic Ig-like domain in their extracellular regions, and some KIR proteins are involved in binding HLA class I ligands. They also contain transmembrane and cytoplasmic regions, which are functionally related because they determine the type of signal delivered to NK cells. KIR proteins may have two or three Ig-like domains (hence KIR2D or KIR3D) and short or long cytoplasmic tails (represented as KIR2DS or KIR2DL). Two-domain KIR proteins are further classified into two groups based on the origin of the membrane-distal Ig-like domain present. Type I KIR2D proteins (KIR2DL1, KIR2DL2, KIR2DL3, KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS4, and KIR2DS5) contain a membrane-distal Ig-like domain similar in origin to the D1 Ig-like domain of KIR3D but lack the D0 domain. This D1 Ig-like domain is primarily encoded by the fourth exon of the corresponding KIR gene. Type II KIR2D proteins, KIR2DL4 and KIR2DL5, have a membrane-distal Ig-like domain with a sequence similar to the D0 domain present in KIR3D proteins, but type II KIR2D lacks the D1 domain. The long cytoplasmic tail typically contains two immunotyrosine-based inhibitory motifs (ITIMs) that transmit inhibitory signals to NK cells. The short cytoplasmic tail contains cationic amino acid residues in the transmembrane region, which enable it to bind to the DAP12 signaling molecule, which generates activating signals. The exception to this is KIR2DL4, which contains only one N-terminal ITIM. Furthermore, KIR2DL4 also contains a charged residue (arginine) in the transmembrane domain, a feature that allows this receptor to exert both inhibitory and activating signals. KIRs regulate human NK cell responses by delivering inhibitory or activating signals upon recognition of MHC class I ligands on the surface of potential target cells.
[0298] KIR proteins vary in length from 306 to 456 amino acid residues. The difference in protein length is primarily due to the number of Ig-like domains present, but variations in the length of the cytoplasmic region also contribute. The leader peptide of most KIR proteins is 21 amino acid residues long. However, the KIR2DL4 protein has a different initiation codon, resulting in a corresponding longer leader peptide.
[0299] The length of the D0 Ig-like domain present in type II KIR2D and KIR3D proteins is approximately 96 amino acids. The D1 domain of type I KIR2D and KIR3D proteins is 102 amino acids, and the D2 domain of all KIR proteins is 98 amino acids. The length of the stem region varies from 24 amino acids present in most KIR proteins to 7 amino acids in the divergent KIR3DL3 protein. The transmembrane region is 20 amino acids long in most proteins, but is shortened by one residue in the KIR2DL1 and KIR2DL2 proteins due to a 3-base pair deletion in exon 7. Finally, the cytoplasmic region of KIR proteins shows greater length variation, from 23 amino acids in some KIR3DS1 alleles to 96 amino acids present in the KIR3DL2 protein.
[0300] The amino acid sequences of human KIR polypeptides (Homo sapiens) are available in the KIR NCBI database, e.g., under accession numbers NP_037421.2 (GI: 134268644), NP_703144.2 (GI: 46488946), NP_001229796.1 (GI: 338968852), NP_001229796.1 (GI: 338968852), NP_006728.2 (GI: 134268642), NP_065396.1 (GI: 11968154), NP_001018091.1 (GI: 66267727), and NP_00107700. 8.1(GI:134133244), NP_036444.1(GI:6912472), NP_055327.1(GI:7657277), NP_056952.2(GI:71143139), NP_036446.3(GI:116517309) , NP_001074239.1(GI:124107610), NP_002246.5(GI:124107606), NP_001074241.1(GI:124107604), NP_036445.1(GI:6912474).
[0301] KIR nomenclature is determined based on the number of extracellular domains (KIR2D and KIR3D have two and three extracellular Ig-domains, respectively) and whether the cytoplasmic tail is long (KIR2DL or KIR3DL) or short (KIR2DS or KIR3DS). The presence or absence of a particular KIR varies between individual NK cells within an NK cell population within the same individual. In humans, there is also a relatively high level of polymorphism in KIR genes, with certain KIR genes being present in some individuals but absent in all. The expression of KIR alleles on NK cells is stochastically regulated, meaning that in a given individual, a particular lymphocyte may express one, two, or more different KIRs, depending on that individual's genotype. Typically, NK cells from a single individual express different combinations of KIRs, providing a repertoire of NK cells with different specificities for MHC class I molecules. Specific KIR gene products trigger stimulation of lymphocyte activity upon binding to appropriate ligands. All activating KIRs have short cytoplasmic tails with charged transmembrane residues that associate with adaptor molecules containing immunoreceptor tyrosine-based activation motifs (ITAMs), which transmit stimulatory signals to NK cells. In contrast, inhibitory KIRs have long cytoplasmic tails containing immunoreceptor tyrosine-based inhibitory motifs (ITIMs), which transmit inhibitory signals to NK cells upon binding to MHC class I ligands. Known inhibitory KIRs include members of the KIR2DL and KIR3DL subfamilies. Two Ig domain inhibitory KIRs (KIR2DL) recognize HLA-C allotypes: KIR2DL2 (formerly p58.2) and its closely related allele gene product, KIR2DL3, recognize "group 1" HLA-C allotypes (including HLA-Cw1, -3, -7, and -8), whereas KIR2DL1 (p58.1) recognizes "group 2" HLA-C allotypes (e.g., HLA-Cw2, -4, -5, and -6). KIR2DL1 recognition is determined by the presence or absence of a lysine residue at position 80 of the HLA-C allele. Importantly, the majority of HLA-C alleles have either an Asn or Lys residue at position 80.Thus, KIR2DL1, -2, and -3 together recognize nearly all HLA-C allotypes present in humans. KIR3DL1 (p70), a KIR with three Ig domains, recognizes an epitope common to the HLA-Bw4 allele. Finally, KIR3DL2 (p140), a homodimer of molecules with three Ig domains, recognizes HLA-A3 and HLA-A11.
[0302] However, the present invention should not be limited to inhibitory KIRs that contain ITIM-containing cytoplasmic tails. Rather, any inhibitory protein that has a cytoplasmic domain associated with an inhibitory signal can be used to construct CARs of the present invention. Non-limiting examples of inhibitory proteins include, but are not limited to, CTLA-4, PD-1, etc. These proteins are known to inhibit the activation of T cells.
[0303] Thus, in some aspects, the disclosed invention provides a KIR-CAR comprising an extracellular domain containing a target-specific binding element (also referred to as an antigen-binding domain) fused to a KIR or a fragment thereof. In one embodiment, the KIR is an activating KIR containing a short cytoplasmic tail that associates with an adaptor molecule containing an immunoreceptor tyrosine-based activation motif (ITAM) that transmits stimulatory signals to NK cells (referred to elsewhere herein as an actKIR-CAR). In one embodiment, the KIR is an inhibitory KIR containing a long cytoplasmic tail that contains an immunoreceptor tyrosine-based inhibitory motif (ITIM) that transmits inhibitory signals (referred to hereinafter as an inhKIR-CAR). In some cases, it is desirable to remove the hinge region of the activating KIR when constructing an actKIR-CAR. This is because the present invention is based in part on the discovery that in activated KIR CARs in which the KIR2DS2 hinge was removed to generate KIR2S CARs, this KIRS2 CAR had enhanced cytolytic activity compared to actKIR-CARs containing full-length wild-type KIR2DS2.
[0304] In some embodiments, the KIR-CAR comprises an antigen-binding domain and a KIR transmembrane domain. In some embodiments, the KIR-CAR comprises an antigen-binding domain and a KIR intracellular domain, such as an inhKIR intracellular domain. As used herein, the term KIR D domain refers to the DO, D1, or D2 domain of a KIR. As used herein, the term KIR D domain refers to a polypeptide domain having structural and functional characteristics of a KIR D domain. As used herein, the term KIR D0 domain refers to the DO domain of a KIR. In some embodiments, the KIR D0 domain of a KIR-CAR has at least 70, 80, 85, 90, 95, or 99% homology to a reference sequence, e.g., a naturally occurring KIR D0 domain or a KIR D0 domain described herein. In some embodiments, the KIR D0 domain of a KIR-CAR differs from a reference sequence, e.g., a naturally occurring KIR D0 domain or a KIR D0 domain described herein, by no more than 15, 10, 5, 2, or 1% of residues. In some embodiments, the KIR D0 domain of the KIR-CAR differs from a reference sequence, e.g., a naturally occurring KIR D0 domain or a KIR D0 domain described herein, by no more than 5, 4, 3, 2, or 1 residue. In some embodiments, the KIR D0 domain of the KIR-CAR does not differ from or has 100% homology to a reference sequence, e.g., a naturally occurring KIR D0 domain or a KIR D0 domain described herein. As used herein, the term KIR D1 domain refers to a polypeptide domain having structural and functional characteristics of a KIR D1 domain. In one embodiment, the KIR D1 domain of the KIR-CAR has at least 70, 80, 85, 90, 95, or 99% homology to a reference sequence, e.g., a naturally occurring KIR D1 domain or a KIR D1 domain described herein. In some embodiments, the KIR D1 domain of the KIR-CAR differs from a reference sequence, e.g., a naturally occurring KIR D1 domain or a KIR D1 domain described herein, by no more than 15, 10, 5, 2, or 1% residues.In some embodiments, the KIR D1 domain of the KIR-CAR differs from a reference sequence, e.g., a naturally occurring KIR D0 domain or a KIR D1 domain described herein, by no more than 5, 4, 3, 2, or 1 residue. In some embodiments, the KIR D1 domain of the KIR-CAR does not differ from or has 100% homology to a reference sequence, e.g., a naturally occurring KIR D1 domain or a KIR D1 domain described herein.
[0305] As used herein, the term KIR D2 domain refers to a polypeptide domain having structural and functional characteristics of a KIR D2 domain. In one embodiment, the KIR D2 domain of a KIR-CAR has at least 70, 80, 85, 90, 95, or 99% homology to a reference sequence, e.g., a naturally occurring KIR D2 domain or a KIR D2 domain described herein. In one embodiment, the KIR D2 domain of a KIR-CAR differs from a reference sequence, e.g., a naturally occurring KIR D2 domain or a KIR D2 domain described herein, by no more than 15, 10, 5, 2, or 1% of residues. In some embodiments, the KIR D2 domain of a KIR-CAR differs from a reference sequence, e.g., a naturally occurring KIR D2 domain or a KIR D2 domain described herein, by no more than 5, 4, 3, 2, or 1 residue. In some embodiments, the KIR D2 domain of a KIR-CAR does not differ from or has 100% homology to a reference sequence, e.g., a naturally occurring KIR D2 domain or a KIR D2 domain described herein.
[0306] As used herein, the term KIR hinge or stem domain refers to a polypeptide domain having structural and functional characteristics of a KIR hinge or stem domain. In some embodiments, the KIR hinge or stem domain of a KIR-CAR has at least 70, 80, 85, 90, 95, or 99% homology to a reference sequence, e.g., a naturally occurring KIR hinge or stem domain or a KIR hinge or stem domain described herein. In some embodiments, the KIR hinge or stem domain of a KIR-CAR differs from a reference sequence, e.g., a naturally occurring KIR hinge or stem domain or a KIR hinge or stem domain described herein, by no more than 15, 10, 5, 2, or 1% of residues. In some embodiments, the KIR hinge or stem domain of a KIR-CAR differs from a reference sequence, e.g., a naturally occurring KIR hinge or stem domain or a KIR hinge or stem domain described herein, by no more than 5, 4, 3, 2, or 1 residue. In some embodiments, the KIR hinge or stem domain of the KIR-CAR does not differ from or has 100% homology to a reference sequence, e.g., a naturally occurring KIR hinge or stem domain, or a KIR hinge or stem domain described herein.
[0307] As used herein, the term "KIR transmembrane domain" refers to a polypeptide domain having structural and functional characteristics of a KIR transmembrane domain. In some embodiments, the KIR transmembrane domain of a KIR-CAR has at least 70, 80, 85, 90, 95, or 99% homology to a reference sequence, e.g., a naturally occurring KIR transmembrane domain or a KIR transmembrane domain described herein. In some embodiments, the KIR transmembrane domain of a KIR-CAR differs from a reference sequence, e.g., a naturally occurring KIR transmembrane domain or a KIR transmembrane domain described herein, by no more than 15, 10, 5, 2, or 1% of residues. In some embodiments, the KIR transmembrane domain of a KIR-CAR differs from a reference sequence, e.g., a naturally occurring KIR transmembrane domain or a KIR transmembrane domain described herein, by no more than 5, 4, 3, 2, or 1 residue. In some embodiments, the KIR transmembrane domain of the KIR-CAR does not differ from or has 100% homology to a reference sequence, e.g., a naturally occurring KIR transmembrane domain or a KIR transmembrane domain described herein.
[0308] As used herein, the term "KIR intracellular domain" refers to a polypeptide domain having structural and functional characteristics of the intracellular domain of a KIR. The KIR intracellular domain includes an inhibitory KIR intracellular domain (referred to herein as an inhKIR intracellular domain) and an activating KIR intracellular domain (referred to herein as an actKIR intracellular domain). In one embodiment, the inhKIR intracellular domain includes an ITIM sequence. In one embodiment, the KIR intracellular domain of a KIR-CAR has at least 70, 80, 85, 90, 95, or 99% homology to a reference sequence, e.g., a naturally occurring KIR intracellular domain or a KIR intracellular domain described herein. In some embodiments, the KIR-CAR differs from a reference sequence, e.g., a naturally occurring KIR intracellular domain or a KIR intracellular domain described herein, by no more than 15, 10, 5, 2, or 1% of residues. In some embodiments, the KIR intracellular domain of a KIR-CAR differs from a reference sequence, e.g., a naturally occurring KIR intracellular domain or a KIR intracellular domain described herein, by no more than 5, 4, 3, 2, or 1 residue. In some embodiments, the KIR intracellular domain of the KIR-CAR does not differ from or has 100% homology to a reference sequence, e.g., a naturally occurring KIR intracellular domain or a KIR intracellular domain described herein.
[0309] NCR The NKR-CARs described herein include NCR-CARs that share functional and structural properties with NCR.
[0310] Natural killer (NK) cells are specialized cytotoxic lymphocytes that destroy tumor and virus-infected cells. Unlike cytotoxic T lymphocytes, NK cells do not express antigen-specific receptors. Recognition of transformed cells occurs through the engagement of numerous cell surface receptors with target cell surface markers. NK cell surface receptors can be distinguished according to whether they activate or inhibit NK cell-mediated cytotoxicity. Numerous interactions between different receptors are thought to lead to the formation of a synapse between the NK cell and the target cell. The integration of activating and inhibitory signals at the synapse determines whether the NK cell exerts its cytolytic function against the target cell. Among these activating receptors, a family of Ig-like molecules is called natural cytotoxicity receptors (NCRs). These natural cytotoxicity receptors include NKp30, NKp44, and NKp46 molecules. NCRs are the primary activating receptors for NK cells in tumor cell recognition. All three NCRs are involved in the clearance of tumor and virus-infected cells. In the latter, antiviral activity is initiated by NKp44 interaction with influenza virus or Sendai virus hemagglutinin. NKp46 targets virus-infected cells by binding to influenza virus hemagglutinin or Sendai virus hemagglutinin-neuraminidase. In contrast, NKp30 binding to the human cytomegalovirus protein pp65 has been shown to inhibit NK cell-mediated cytotoxicity (e.g., Amon et al., Nat. Immunol. (2005) 6:515-523).
[0311] The amino acid sequence of the human NCR polypeptide (Homo sapiens) is available in the NCBI database, see, for example, accession numbers NP_004819.2 (GI:153945782), 014931.1 (GI:47605770), 095944.2 (GI:251757303), 076036.1 (GI:47605775), NP_001138939.1 (GI:224586865), and / or NP_001138938.1 (GI:224586860).
[0312] In one embodiment, the NCR-CAR comprises an antigen-binding domain and an NCR transmembrane domain. In some embodiments, the KIR-CAR comprises an antigen-binding domain and an NCR intracellular domain.
[0313] As used herein, the term "NCR extracellular domain" refers to a polypeptide domain having structural and functional characteristics of the extracellular domain of an NCR. In one embodiment, the NCR extracellular domain of an NCR-CAR has at least 70, 80, 85, 90, 95, or 99% homology with a reference sequence, such as a naturally occurring NCR extracellular domain or an NCR extracellular domain described herein. In some embodiments, the NCR extracellular domain of an NCR-CAR differs from a reference sequence, such as a naturally occurring NCR extracellular domain or an NCR extracellular domain described herein, by 15, 10, 5, 2, or 1% or less of the residues. In some embodiments, the NCR extracellular domain of an NCR-CAR differs from a reference sequence, such as a naturally occurring NCR extracellular domain or an NCR extracellular domain described herein, by 5, 4, 3, 2, or 1 or less of the residues. In some embodiments, the NCR extracellular domain of the NCR-CAR does not differ from or has 100% homology to a reference sequence, e.g., a naturally occurring NCR extracellular domain or an NCR extracellular domain described herein.
[0314] As used herein, the term NCR hinge or stem domain refers to a polypeptide domain having the structural and functional characteristics of the hinge or stem domain of an NCR. In one embodiment, the NCR hinge or stem domain of an NCR-CAR has at least 70, 80, 85, 90, 95, or 99% homology with a reference sequence, for example, a naturally occurring NCR hinge or stem domain or an NCR hinge or stem domain described herein. In some embodiments, the NCR hinge or stem domain of an NCR-CAR differs from a reference sequence, for example, a naturally occurring NCR hinge or stem domain or an NCR hinge or stem domain described herein, by 15, 10, 5, 2, or 1% or less of the residues. In some embodiments, the NCR hinge or stem domain of an NCR-CAR differs from a reference sequence, for example, a naturally occurring NCR hinge or stem domain or an NCR hinge or stem domain described herein, by 5, 4, 3, 2, or 1 or less of the residues. In embodiments, the NCR hinge or stem domain of the NCR-CAR does not differ from or has 100% homology to a reference sequence, e.g., a naturally occurring NCR hinge or stem domain, or an NCR hinge or stem domain described herein.
[0315] As used herein, the term NCR transmembrane domain refers to a polypeptide domain that has the structural and functional characteristics of an NCR transmembrane domain. In one embodiment, the NCR transmembrane domain of an NCR-CAR has at least 70, 80, 85, 90, 95, or 99% homology with a reference sequence, such as a naturally occurring NCR transmembrane domain or an NCR transmembrane domain described herein. In some embodiments, the NCR transmembrane domain of an NCR-CAR differs from a reference sequence, such as a naturally occurring NCR transmembrane domain or an NCR transmembrane domain described herein, by 15, 10, 5, 2, or 1% or less of residues. In some embodiments, the NCR transmembrane domain of an NCR-CAR differs from a reference sequence, such as a naturally occurring NCR transmembrane domain or an NCR transmembrane domain described herein, by 5, 4, 3, 2, or 1 or less of residues. In some embodiments, the NCR transmembrane domain of the NCR-CAR does not differ from or has 100% homology to a reference sequence, e.g., a naturally occurring NCR transmembrane domain or an NCR transmembrane domain described herein.
[0316] The term NCR intracellular domain, as used herein, refers to a polypeptide domain having structural and functional characteristics of the intracellular domain of an NCR. In some embodiments, the NCR intracellular domain of an NCR-CAR has at least 70, 80, 85, 90, 95, or 99% homology with a reference sequence, for example, a naturally occurring NCR intracellular domain or an NCR intracellular domain described herein. In some embodiments, the NCR intracellular domain of an NCR-CAR differs from a reference sequence, for example, a naturally occurring NCR intracellular domain or an NCR intracellular domain described herein, by 15, 10, 5, 2, or 1% or less of the residues. In some embodiments, the NCR intracellular domain of an NCR-CAR differs from a reference sequence, for example, a naturally occurring NCR intracellular domain or an NCR intracellular domain described herein, by 5, 4, 3, 2, or 1 or less of the residues. In some embodiments, the NCR intracellular domain of an NCR-CAR does not differ from or has 100% homology with a reference sequence, for example, a naturally occurring NCR intracellular domain or an NCR intracellular domain described herein.
[0317] SLAM receptor The NKR-CARs described herein include SLAMF-CARs that share functional and structural properties with SLAMFs.
[0318] The signaling lymphocyte activation molecule (SLAM) family of immune cell receptors is closely related to the CD2 family of the immunoglobulin (Ig) superfamily of molecules. The SLAM family (SLAMF) currently includes nine members, named SLAM, CD48, CD229, 2B4, CD84, NTB-A, CRACC, BLAME, and CD2F-10. Generally, SLAM molecules have two to four extracellular Ig domains, a transmembrane segment, and an intracellular tyrosine-rich region. These molecules show differential expression in various immune cell types. Some are self-ligands, and SLAM has been identified as the human measles virus receptor. Several small SH2-containing adaptor proteins are known to associate with the intracellular domains of SLAM family members and regulate receptor signaling, including SH2D1A (also known as SLAM-associated protein [SAP]) and SH2D1B (also known as EAT2). For example, in T cells and NK cells, activated SLAM family receptors become tyrosine phosphorylated and recruit the adaptor SAP, which then recruits the Src kinase Fyn. The subsequent signaling cascades influence the outcome of T cell-antigen-presenting cell and NK cell-target cell interactions.
[0319] Amino acid sequence of the human SLAM receptor polypeptide (Homo sapiens) sapiens) are available in the NCBI database, see, e.g., accession numbers NP_057466.1 (GI:7706529), NP_067004.3 (GI:19923572), NP_003028.1 (GI:4506969), NP_001171808.1 (GI:296434285), NP_001171643.1 (GI:296040491), NP_001769.2 (GI:21361571), NP_254273.2 (GI:226342990), NP_064510.1 (GI:9910342) and / or NP_002339.2 (GI:55925578).
[0320] In some embodiments, the SLAMF-CAR comprises an antigen-binding domain and an SLAMF transmembrane domain. In one embodiment, the SLAMF-CAR comprises an antigen-binding domain and an SLAMF intracellular domain.
[0321] As used herein, the term SLAMF extracellular domain refers to a polypeptide domain having structural and functional characteristics of the extracellular domain of an SLAMF. In one embodiment, the SLAMF extracellular domain of an SLAMF-CAR has at least 70, 80, 85, 90, 95, or 99% homology to a reference sequence, e.g., a naturally occurring SLAMF extracellular domain or an SLAMF extracellular domain described herein. In some embodiments, the SLAMF extracellular domain of an SLAMF-CAR differs from a reference sequence, e.g., a naturally occurring SLAMF extracellular domain or an SLAMF extracellular domain described herein, by no more than 15, 10, 5, 2, or 1 residue. In some embodiments, the SLAMF extracellular domain of an SLAMF-CAR differs from a reference sequence, e.g., a naturally occurring SLAMF extracellular domain or an SLAMF extracellular domain described herein, by no more than 5, 4, 3, 2, or 1 residue. In some embodiments, the SLAMF extracellular domain of an SLAMF-CAR does not differ from or has 100% homology to a reference sequence, e.g., a naturally occurring SLAMF extracellular domain or an SLAMF extracellular domain described herein. As used herein, the term SLAMF hinge or stem domain refers to a polypeptide domain having the structural and functional characteristics of an SLAMF hinge or stem domain. In one embodiment, the SLAMF hinge or stem domain of an SLAMF-CAR has at least 70, 80, 85, 90, 95, or 99% homology to a reference sequence, e.g., a naturally occurring SLAMF hinge or stem domain or an SLAMF hinge or stem domain described herein. In some embodiments, the SLAMF hinge or stem domain of an SLAMF-CAR differs by no more than 15, 10, 5, 2, or 1% of residues from a reference sequence, e.g., a naturally occurring SLAMF hinge or stem domain or an SLAMF hinge or stem domain described herein.In some embodiments, the SLAMF hinge or stem domain of an SLAMF-CAR differs from a reference sequence, e.g., a naturally occurring SLAMF hinge or stem domain, or an SLAMF hinge or stem domain described herein, by 5, 4, 3, 2, or 1 residue or less. In some embodiments, the SLAMF hinge or stem domain of an SLAMF-CAR does not differ from, or has 100% homology to, a reference sequence, e.g., a naturally occurring SLAMF hinge or stem domain, or an SLAMF hinge or stem domain described herein. As used herein, the term SLAMF transmembrane domain refers to a polypeptide domain that has the structural and functional characteristics of a SLAMF transmembrane domain. In one embodiment, the SLAMF transmembrane domain of an SLAMF-CAR has at least 70, 80, 85, 90, 95, or 99% homology to a reference sequence, e.g., a naturally occurring SLAMF transmembrane domain, or an SLAMF transmembrane domain described herein. In some embodiments, the SLAMF transmembrane domain of the SLAMF-CAR differs by no more than 15, 10, 5, 2, or 1% of residues from a reference sequence, e.g., a naturally occurring SLAMF transmembrane domain or an SLAMF transmembrane domain described herein. In some embodiments, the SLAMF transmembrane domain of the SLAMF-CAR differs by no more than 5, 4, 3, 2, or 1 residue from a reference sequence, e.g., a naturally occurring SLAMF transmembrane domain or an SLAMF transmembrane domain described herein. In some embodiments, the SLAMF transmembrane domain of the SLAMF-CAR does not differ from or has 100% homology to a reference sequence, e.g., a naturally occurring SLAMF transmembrane domain or an SLAMF transmembrane domain described herein.
[0322] As used herein, the term SLAMF intracellular domain refers to a polypeptide domain having structural and functional characteristics of the intracellular domain of an SLAMF. In one embodiment, the SLAMF intracellular domain of an SLAMF-CAR has at least 70, 80, 85, 90, 95, or 99% homology to a reference sequence, e.g., a naturally occurring SLAMF intracellular domain or an SLAMF intracellular domain described herein. In some embodiments, the SLAMF intracellular domain of an SLAMF-CAR differs from a reference sequence, e.g., a naturally occurring SLAMF intracellular domain or an SLAMF intracellular domain described herein, by no more than 15, 10, 5, 2, or 1 residue. In some embodiments, the SLAMF intracellular domain of an SLAMF-CAR differs from a reference sequence, e.g., a naturally occurring SLAMF intracellular domain or an SLAMF intracellular domain described herein, by no more than 5, 4, 3, 2, or 1 residue. In some embodiments, the SLAMF intracellular domain of the SLAMF-CAR does not differ from or has 100% homology to a reference sequence, e.g., a naturally occurring SLAMF intracellular domain or a SLAMF intracellular domain described herein.
[0323] Fc-binding receptors The NKR-CARs described herein include Fc receptor-based CARs (FcR-CARs), such as CD16-CARs and CD64-CARs, which share functional and structural properties with CD16 and CD64.
[0324] Upon activation, NK cells abundantly produce cytokines and chemokines and simultaneously exhibit potent cytolytic activity. NK cell activation can occur through direct binding of the NK cell receptor to ligands on target cells, as seen in direct tumor cell killing, or through crosslinking of the Fe receptor (CD16; FcyRIII) by binding to the Fe moiety of antibodies bound to antigen-bearing cells. This CD16 engagement (CD16 crosslinking) initiates NK cell responses through intracellular signals generated via one or both of the CD16-associated adaptor chains, FcRy and CD3. CD16 triggers phosphorylation of the y or s chain, which recruits the tyrosine kinases Syk and ZAP-70, initiating a signaling cascade that results in rapid and potent effector function. The most well-known effector function is the release of cytoplasmic granules containing toxic proteins, which kill nearby target cells through the process of antibody-dependent cellular cytotoxicity. CD16 crosslinking also triggers the production of cytokines and chemokines, which then activate and orchestrate a range of immune responses.
[0325] However, unlike T and B lymphocytes, NK cells are thought to have limited target recognition capabilities using genome-encoded activating receptors (Bottino et al., Curr Top Microbial Immunol. 298: 175-182 (2006); Stewart et al., Curr Top Micro biol Immunol. 298:1-21 (2006)). NK cells express the activating Fe receptor CD16, which broadens target recognition by recognizing IgG-coated target cells (Ravetch & Bolland, Annu Rev Immunol. 19:275-290 (2001); Lanier Nat. Immunol. 9(5):495-502 (2008); BrycesoNLong, Curr Opin Immunol. 20(3):344-352 (2008)). The expression and signaling activity of several NK cell-activating receptors require physically associated adaptors, which transmit signals via immunoreceptor tyrosine-based activation motifs (ITAMs). Among these adaptors, FcRy and CD3 (chains) can associate with CD16 and the natural cytotoxicity receptor (NCR) as either disulfide-linked homodimers or heterodimers, and these chains are thought to be expressed on all mature NK cells. The amino acid sequence of CD16 (Homo sapiens) is available in the NCBI database; see, for example, accession numbers NP_000560.5 (GI:50726979) and NP_001231682.1 (GI:348041254).
[0326] In some embodiments, the FcR-CAR comprises an antigen-binding domain and an FcR transmembrane domain. In some embodiments, the FcR-CAR comprises an antigen-binding domain and an FcR intracellular domain.
[0327] As used herein, the term CD16 extracellular domain refers to a polypeptide domain having the structural and functional characteristics of the extracellular domain of CD16. In some embodiments, the CD16 extracellular domain of a CD16-CAR has at least 70, 80, 85, 90, 95, or 99% homology with a reference sequence, for example, a naturally occurring CD16 extracellular domain or a CD16 extracellular domain described herein. In some embodiments, the CD16 extracellular domain of a CD16-CAR differs from a reference sequence, for example, a naturally occurring CD16 extracellular domain or a CD16 extracellular domain described herein, by 15, 10, 5, 2, or 1% or less of the residues. In some embodiments, the CD16 extracellular domain of a CD16-CAR differs from a reference sequence, for example, a naturally occurring CD16 extracellular domain or a CD16 extracellular domain described herein, by 5, 4, 3, 2, or 1 or less of the residues.
[0328] In some embodiments, the CD16 extracellular domain of the CD16-CAR does not differ from or has 100% homology to a reference sequence, e.g., a naturally occurring CD16 extracellular domain or a CD16 extracellular domain described herein.
[0329] As used herein, the term CD16 hinge or stem domain refers to a polypeptide domain that has the structural and functional characteristics of the hinge or stem domain of CD16. In one embodiment, the CD16 hinge or stem domain of CD16-CAR has at least 70, 80, 85, 90, 95, or 99% homology with a reference sequence, for example, a naturally occurring CD16 hinge or stem domain or a CD16 hinge or stem domain described herein. In some embodiments, the CD16 hinge or stem domain of CD16-CAR differs from a reference sequence, for example, a naturally occurring CD16 hinge or stem domain or a CD16 hinge or stem domain described herein, by 15, 10, 5, 2, or 1% or less of residues. In some embodiments, the CD16 hinge or stem domain of the CD16-CAR differs by no more than 5, 4, 3, 2, or 1 residue from a reference sequence, e.g., a naturally occurring CD16 hinge or stem domain, or a CD16 hinge or stem domain described herein. In some embodiments, the CD16 hinge or stem domain of the CD16-CAR does not differ from, or has 100% homology to, a reference sequence, e.g., a naturally occurring CD16 hinge or stem domain, or a CD16 hinge or stem domain described herein.
[0330] As used herein, the term CD16 transmembrane domain refers to a polypeptide domain having the structural and functional characteristics of the transmembrane domain of CD16. In one embodiment, the CD16 transmembrane domain of CD16-CAR has at least 70%, 80%, 85%, 90%, 95%, or 99% homology with a reference sequence, such as a naturally occurring CD16 transmembrane domain or a CD16 transmembrane domain described herein. In some embodiments, the CD16 transmembrane domain of CD16-CAR differs from a reference sequence, such as a naturally occurring CD16 transmembrane domain or a CD16 transmembrane domain described herein, by 15, 10, 5, 2, or 1% or less of the residues. In some embodiments, the CD16 transmembrane domain of CD16-CAR differs from a reference sequence, such as a naturally occurring CD16 transmembrane domain or a CD16 transmembrane domain described herein, by 5, 4, 3, 2, or 1 or less of the residues. In some embodiments, the CD16 transmembrane domain of the CD16-CAR does not differ from or has 100% homology to a reference sequence, e.g., a naturally occurring CD16 transmembrane domain or a CD16 transmembrane domain described herein.
[0331] As used herein, the term CD16 intracellular domain refers to a polypeptide domain having structural and functional characteristics of the intracellular domain of CD16. In embodiments, the CD16 intracellular domain of a CD16-CAR has at least 70%, 80%, 85, 90, 95, or 99% homology with a reference sequence, such as a naturally occurring CD16 intracellular domain or a CD16 intracellular domain described herein. In some embodiments, the CD16 intracellular domain of a CD16-CAR differs from a reference sequence, such as a naturally occurring CD16 intracellular domain or a CD16 intracellular domain described herein, by 15, 10, 5, 2, or 1% or less of the residues. In some embodiments, the CD16 intracellular domain of a CD16-CAR differs from a reference sequence, such as a naturally occurring CD16 intracellular domain or a CD16 intracellular domain described herein, by 5, 4, 3, 2, or 1 or less of the residues. In some embodiments, the CD16 intracellular domain of the CD16-CAR does not differ from or has 100% homology to a reference sequence, e.g., a naturally occurring CD16 intracellular domain or a CD16 intracellular domain described herein.
[0332] As used herein, the term CD64 extracellular domain refers to a polypeptide domain having structural and functional characteristics of the extracellular domain of CD64. In one embodiment, the CD64 extracellular domain of a CD64-CAR has at least 70%, 80%, 85%, 90%, 95%, or 99% homology with a reference sequence, such as a naturally occurring CD64 extracellular domain or a CD64 extracellular domain described herein. In some embodiments, the CD64 extracellular domain of a CD64-CAR differs from a reference sequence, such as a naturally occurring CD64 extracellular domain or a CD64 extracellular domain described herein, by 15, 10, 5, 2, or 1% or less of the residues. In some embodiments, the CD64 extracellular domain of a CD64-CAR differs from a reference sequence, such as a naturally occurring CD64 extracellular domain or a CD64 extracellular domain described herein, by 5, 4, 3, 2, or 1 or less of the residues. In some embodiments, the CD64 extracellular domain of the CD64-CAR does not differ from or has 100% homology to a reference sequence, e.g., a naturally occurring CD64 extracellular domain or a CD64 extracellular domain described herein.
[0333] As used herein, the term CD64 transmembrane domain refers to a polypeptide domain that has the structural and functional characteristics of the transmembrane domain of CD64. In one embodiment, the CD64 transmembrane domain of CD64-CAR has at least 70%, 80%, 85, 90, 95, or 99% homology with a reference sequence, such as a naturally occurring CD64 transmembrane domain or a CD64 transmembrane domain described herein. In some embodiments, the CD64 transmembrane domain of CD64-CAR differs from a reference sequence, such as a naturally occurring CD64 transmembrane domain or a CD64 transmembrane domain described herein, by no more than 15, 10, 5, 2, or 1 residue. In some embodiments, the CD64 transmembrane domain of CD64-CAR differs from a reference sequence, such as a naturally occurring CD64 transmembrane domain or a CD64 transmembrane domain described herein, by no more than 5, 4, 3, 2, or 1 residue. In some embodiments, the CD64 transmembrane domain of the CD64-CAR does not differ from or has 100% homology to a reference sequence, e.g., a naturally occurring CD64 transmembrane domain or a CD64 transmembrane domain described herein.
[0334] As used herein, the term CD64 intracellular domain refers to a polypeptide domain having structural and functional characteristics of the intracellular domain of CD64. In one embodiment, the CD64 intracellular domain of a CD64-CAR has at least 70%, 80%, 85%, 90%, 95%, or 99% homology to a reference sequence, such as a naturally occurring CD64 intracellular domain or a CD64 intracellular domain described herein. In some embodiments, the CD64 intracellular domain of a CD64-CAR differs from a reference sequence, such as a naturally occurring CD64 intracellular domain or a CD64 intracellular domain described herein, by no more than 15, 10, 5, 2, or 1% of residues. In some embodiments, the CD64 intracellular domain of a CD64-CAR differs from a reference sequence, such as a naturally occurring CD64 intracellular domain or a CD64 intracellular domain described herein, by no more than 5, 4, 3, 2, or 1 residue. In some embodiments, the CD64 intracellular domain of the CD64-CAR does not differ from or has 100% homology to a reference sequence, e.g., a naturally occurring CD64 intracellular domain or a CD64 intracellular domain described herein.
[0335] Ly49 and related killer cell lectin-like receptors The NKR-CARs described herein include Ly49-CAR, which shares functional and structural properties with Ly49.
[0336] Ly49 receptors are derived from at least 23 genes (Ly49A-W) identified in mice. Despite their distinct structures (type II integral membrane proteins of the C-type lectin superfamily), these receptors share many common roles with KIRs in mouse NK and T cells, and, like human KIRs, contain a considerable degree of genetic diversity. The functional similarities between Ly49 and KIR receptors suggest that these receptors evolved independently but convergently to perform the same physiological functions in NK and T cells.
[0337] Similar to human KIRs, different Ly49 receptors recognize different MHC class I alleles and are differentially expressed on subsets of NK cells. The original prototypic Ly49 receptors, Ly49A and Ly49C, possess cytoplasmic domains with two immunotyrosine-based inhibitory motifs (ITIMs), similar to those of inhibitory KIRs, such as KIR2DL3. These domains have been identified to recruit the kinase SHP-1 and, similar to inhibitory KIRs, to limit the activation of NK and T cells. In addition to inhibitory Ly49 molecules, some family members, such as Ly49D and Ly49H, have lost the ITIM-containing domain and instead acquired the ability to interact with the signaling adaptor molecule DAP12, similar to human activating KIRs, such as KIR2DS2.
[0338] The amino acid sequences of Ly49 family members are available in the NCBI database, see, e.g., accession numbers AAF82184.1 (GI:9230810), AAF99547.1 (GI:9801837), NP_034778.2 (GI:133922593), NP_034779.1 (GI:6754462), NP_001095090.1 (GI:197333718), NP_034776.1 (GI:21327665), AAK1 1559.1 (GI:13021834) and / or NP_038822.3 (GI:9256549).
[0339] In some embodiments, the Ly49-CAR comprises an antigen-binding domain and a Ly49 transmembrane domain. In one embodiment, the Ly49-CAR comprises an antigen-binding domain and a Ly49 intracellular domain.
[0340] As used herein, the term Ly49 extracellular domain refers to a polypeptide domain having the structural and functional characteristics of the extracellular domain of Ly49. In some embodiments, the Ly49 extracellular domain of Ly49-CAR has at least 70, 80, 85, 90, 95, or 99% homology with a reference sequence, for example, a naturally occurring Ly49 extracellular domain or a Ly49 extracellular domain described herein. In some embodiments, the Ly49 extracellular domain of Ly49-CAR differs from a reference sequence, for example, a naturally occurring Ly49 extracellular domain or a Ly49 extracellular domain described herein, by 15, 10, 5, 2, or 1% or less of the residues. In some embodiments, the Ly49 extracellular domain of Ly49-CAR differs from a reference sequence, for example, a naturally occurring Ly49 extracellular domain or a Ly49 extracellular domain described herein, by 5, 4, 3, 2, or 1 or less of the residues. In some embodiments, the Ly49 extracellular domain of the Ly49-CAR does not differ from or has 100% homology to a reference sequence, e.g., a naturally occurring Ly49 extracellular domain or a Ly49 extracellular domain described herein.
[0341] As used herein, the term Ly49 hinge or stem domain refers to a polypeptide domain having the structural and functional characteristics of the hinge or stem domain of Ly49. In some embodiments, the Ly49 hinge or stem domain of Ly49-CAR has at least 70, 80, 85, 90, 95, or 99% homology with a reference sequence, for example, a naturally occurring Ly49 hinge or stem domain, or a Ly49 hinge or stem domain described herein. In some embodiments, the Ly49 hinge or stem domain of Ly49-CAR differs from a reference sequence, for example, a naturally occurring Ly49 hinge or stem domain, or a Ly49 hinge or stem domain described herein, by 15, 10, 5, 2, or 1% or less of the residues. In some embodiments, the Ly49 hinge or stem domain of Ly49-CAR differs by no more than 5, 4, 3, 2, or 1 residue from a reference sequence, e.g., a naturally occurring Ly49 hinge or stem domain, or a Ly49 hinge or stem domain described herein. In some embodiments, the Ly49 hinge or stem domain of Ly49-CAR does not differ from, or has 100% homology to, a reference sequence, e.g., a naturally occurring Ly49 hinge or stem domain, or a Ly49 hinge or stem domain described herein.
[0342] As used herein, the term Ly49 transmembrane domain refers to a polypeptide domain having structural and functional characteristics of the transmembrane domain of Ly49. In some embodiments, the Ly49 transmembrane domain of Ly49-CAR has at least 70, 80, 85, 90, 95, or 99% homology with a reference sequence, such as a naturally occurring Ly49 transmembrane domain or a Ly49 transmembrane domain described herein. In some embodiments, the Ly49 transmembrane domain of Ly49-CAR differs from a reference sequence, such as a naturally occurring Ly49 transmembrane domain or a Ly49 transmembrane domain described herein, by no more than 15, 10, 5, 2, or 1% of residues. In some embodiments, the Ly49 transmembrane domain of Ly49-CAR differs from a reference sequence, such as a naturally occurring Ly49 transmembrane domain or a Ly49 transmembrane domain described herein, by no more than 5, 4, 3, 2, or 1 residue. In some embodiments, the Ly49 transmembrane domain of Ly49-CAR does not differ from or has 100% homology to a reference sequence, e.g., a naturally occurring Ly49 transmembrane domain or a Ly49 transmembrane domain described herein.
[0343] As used herein, the term Ly49 intracellular domain refers to a polypeptide domain having structural and functional characteristics of the intracellular domain of Ly49. In some embodiments, the Ly49 intracellular domain of Ly49-CAR has at least 70, 80, 85, 90, 95, or 99% homology with a reference sequence, such as a naturally occurring Ly49 intracellular domain or a Ly49 intracellular domain described herein. In some embodiments, the Ly49 intracellular domain of LY49-CAR differs from a reference sequence, such as a naturally occurring Ly49 intracellular domain or a Ly49 intracellular domain described herein, by 15, 10, 5, 2, or 1% or less of the residues. In some embodiments, the Ly49 intracellular domain of Ly49-CAR differs from a reference sequence, such as a naturally occurring Ly49 intracellular domain or a Ly49 intracellular domain described herein, by 5, 4, 3, 2, or 1 or less of the residues. In some embodiments, the Ly49 intracellular domain of the Ly49-CAR does not differ from or has 100% homology to a reference sequence, such as a naturally occurring Ly49 intracellular domain or a Ly49 intracellular domain described herein.
[0344] Intracellular signaling domains or adaptor molecules Some NKR-CARs interact with other molecules, e.g., molecules that contain an intracellular signaling domain, e.g., an ITAM. In one embodiment, the intracellular signaling domain is DAP12.
[0345] DAP12 was named for its structural features and putative function. The specific cell surface receptor lacks intrinsic function and may interact with another protein partner, a hypothetical 12-kD protein. The signaling mechanism may involve ITAM signaling.
[0346] DAP12 was identified from sequence databases based on its hypothesized relationship to CD3 (see Olcese et al. (1997) J. Immunol. 158:5083-5086), the presence of ITAM sequences (see Thomas (1995) J. Exp. Med. 181:1953-1956), specific size predictions (see Olcese; and Takase et al. (1997) J. Immunol. 159:741-747), and other features. In particular, the transmembrane domain is hypothesized to contain charged residues that may form salt bridges with the corresponding transmembrane segments of its putative receptor partner, the KIR CD94 protein, and other putatively similar proteins. See Daeron et al. (1995) Immunity 3:635-646.
[0347] Indeed, many of the known KIR, MIR, ILT, and CD94 / NKG2 receptor molecules can actually function with accessory proteins that are part of the functional receptor complex. See Olcese et al. (1997) J. Immunol. 158:5083-5086; and Takase et al. (1997) J. Immunol. 159:741-747.
[0348] As used herein, the term DAP12 domain refers to a polypeptide domain having the structural and functional characteristics of the cytoplasmic domain of DAP12, which typically includes an ITAM domain. In one embodiment, the DAP12 domain of KIR-CAR has at least 70, 80, 85, 90, 95, or 99% homology with a reference sequence, such as naturally occurring DAP12 or DAP12 described herein. In some embodiments, the DAP12 domain of KIR-CAR differs from a reference sequence, such as naturally occurring DAP12 or DAP12 described herein, by 15, 10, 5, 2, or 1% or less of the residues. In some embodiments, the DAP12 domain of KIR-CAR differs from a reference sequence, such as naturally occurring DAP12 or DAP12 described herein, by 5, 4, 3, 2, or 1 or less of the residues. In some embodiments, the DAP12 domain of the KIR-CAR does not differ from or has 100% homology to a reference sequence, eg, a naturally occurring DAP12 or a DAP12 described herein.
[0349] DAP10 was identified in part by its homology with DAP12 and other features. In particular, DAP10 displays ITIM inhibitory motifs, in contrast to DAP12, which displays ITAM activating motifs. MDL-1 was identified by its functional relationship to DAP12.
[0350] For example, functional interactions between DAP12 or DAP10 and their co-receptors may allow for the exploitation of structural combinations in the receptors not normally found in truncated forms. Thus, mechanisms of signaling through co-receptor proteins such as DAP12 and DAP10 allow for interesting engineering of other KIR-like receptor complexes, e.g., with KIR, MIR, ILT, and CD94NKG2-type receptors. Truncated forms of the intact receptors can be constructed that interact with DAP12 or DAP10 to form functional signaling complexes.
[0351] antigen-binding domain The antigen-binding domain of a CAR is an extracellular region of the CAR that binds to a specific target antigen, such as a protein, carbohydrate, or glycolipid. In some embodiments, a CAR comprises an affinity for a target antigen (e.g., a tumor-associated antigen) on a target cell (e.g., a cancer cell). The target antigen can include any type of protein associated with the target cell or an epitope thereof. For example, a CAR can comprise an affinity for a target antigen on a target cell that indicates a specific state of the target cell.
[0352] In certain embodiments, the CAR of the present invention comprises an antigen-binding domain that binds to hCD19. In certain embodiments, the antigen-binding domain of the present invention comprises an antibody or fragment thereof that binds to an hCD19 molecule. In certain exemplary embodiments, the antigen-binding domain is an scFv antibody that binds to hCD19. The selection of the antigen-binding domain depends on the type and number of antigens present on the surface of the target cell. For example, the antigen-binding domain may be selected to recognize an antigen that acts as a cell surface marker on the target cell that is associated with a particular state of the target cell.
[0353] As described herein, a CAR of the present disclosure having affinity for a specific target antigen on a target cell can comprise a target-specific binding domain. In some embodiments, the target-specific binding domain is a human target-specific binding domain, e.g., the target-specific binding domain is of human origin. In an exemplary embodiment, a CAR of the present disclosure having affinity for hCD19 on a target cell can comprise an hCD19 binding domain. In some embodiments, the hCD19 binding domain is a canine hCD19 binding domain, e.g., the hCD19 binding domain is of canine origin. In some embodiments, the hCD19 binding domain is a humanized CD19 binding domain. In some embodiments, the hCD19 binding domain is a human-derived CD19 binding domain, e.g., the hCD19 binding domain is of human origin.
[0354] An antigen-binding domain includes any domain that binds to an antigen, including, but not limited to, monoclonal antibodies, polyclonal antibodies, synthetic antibodies, human antibodies, humanized antibodies, non-human antibodies, and any fragments thereof. Thus, in one embodiment, the antigen-binding domain portion comprises a mammalian antibody or a fragment thereof. In other embodiments, the antigen-binding domain of the CAR is selected from the group consisting of an anti-hCD19 antibody and a fragment thereof. In some embodiments, the antigen-binding domain is selected from the group consisting of an antibody, an antigen-binding fragment (Fab), and a single-chain variable fragment (scFv). In some embodiments, the hCD19-binding domain of the present invention is selected from the group consisting of an hCD19-specific antibody, an hCD19-specific Fab, and an hCD19-specific scFv. In one embodiment, the hCD19-binding domain is an hCD19-specific antibody. In one embodiment, the hCD19-binding domain is an hCD19-specific Fab. In one embodiment, the hCD19-binding domain is an hCD19-specific scFv.
[0355] As used herein, the term "single-chain variable fragment" or "scFv" refers to a fusion protein in which the variable regions of the heavy (VH) and light (VL) chains of an immunoglobulin (e.g., mouse or human) are covalently linked to form a VH:VL heterodimer. The heavy (VH) and light (VL) chains are either directly linked or linked via a peptide-encoded linker or spacer that connects the N-terminus of the VH to the C-terminus of the VL, or the C-terminus of the VH to the N-terminus of the VL. The terms "linker" and "spacer" are used interchangeably herein. In some embodiments, the antigen-binding domain (e.g., an hCD19-binding domain) comprises an scFv having, from the N-terminus to the C-terminus, the following structure: VH-linker-VL. In some embodiments, the antigen-binding domain (e.g., an hCD19-binding domain) comprises an scFv having, from the N-terminus to the C-terminus, the following structure: VL-linker-VH. Those skilled in the art will be able to select an appropriate structure for use in the present invention.
[0356] In some embodiments, the hCD19 binding domain is derived from an scFv specific for human CD19, as disclosed elsewhere herein. Thus, a CAR of the present disclosure comprises an hCD19 binding domain derived from an scFv disclosed elsewhere herein.
[0357] As used herein, "Fab" refers to the fragment of an antibody structure that binds to an antigen but is monovalent and lacks the Fc portion; for example, digestion of an antibody with the enzyme papain produces two Fab fragments and one Fc fragment (e.g., heavy chain (H) constant region; the Fc region that does not bind to antigen).
[0358] As used herein, "F(ab')2" refers to an antibody fragment produced by pepsin digestion of a whole IgG antibody, which fragment has two antigen-binding (ab') (bivalent) regions, each of which contains two separate amino acid chains: a portion of an H chain linked by an S-type disulfide bond for antigen binding, and a light (L) chain, with the remaining H chain portions linked to each other. The "F(ab')2" fragment can be split into two separate Fab' fragments.
[0359] In one embodiment, the hCD19-binding domain comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NOs: 271 to 313. The light chain variable region of the hCD19-binding domain comprises three light chain complementarity-determining regions (CDRs). As used herein, "complementarity-determining region" or "CDR" refers to the region of the variable chain of an antigen-binding molecule that binds to a specific antigen. Thus, the hCD19 binding domain is an LCDR1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 90, 95, 100, 109, 114, 119, 124, 128, 140, 148, 153, 158, 166, 171, 180, 185, 200, 203, 209, 213, 221, 229, 234, 242, and 246; ADS, AND, ANI, EAS, GNS, GNT, GSH, GSS, GYN, KDT, LVS, NND, QVS, RDT, SDG, SNK, SSS, and SVS. and an LCDR3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 91, 96, 101, 105, 110, 115, 120, 125, 129, 133, 141, 149, 154, 159, 162, 165, 167, 172, 176, 181, 186, 190, 194, 198, 199, 201, 202, 204, 205, 210, 214, 217, 222, 226, 230, 235, 239, 243, and 247.
[0360] In one embodiment, the hCD19 binding domain comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NOs: 314-356. The hCD19 binding domain comprises an hCDR1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 87, 92, 97, 102, 106, 111, 116, 121, 126, 130, 134, 137, 142, 145, 150, 155, 163, 168, 173, 177, 182, 187, 191, 195, 206, 211, 218, 223, 231, 236, 240, and 244; 183, 188, 192, 196, 207, 215, 219, 224, 227, 232, and 237; and HCDR3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 89, 94, 99, 104, 108, 113, 118, 123, 127, 132, 136, 139, 144, 147, 152, 157, 161, 170, 175, 179, 184, 189, 193, 197, 208, 212, 216, 220, 225, 228, 233, 238, 241, and 245.
[0361] In some embodiments, the hCD19 binding domain comprises HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3, wherein HCDR1, HCDR2, HCDR3, LCDR1, and LCDR are comprising the respective amino acid sequences set forth in SEQ ID NOs: 87, 88, 89, 90, and 91, wherein LCDR2 comprises the amino acid sequence GNS; comprising the respective amino acid sequences set forth in SEQ ID NOs: 92, 93, 94, 95, and 96, and LCDR2 comprising the amino acid sequence AND; comprising the respective amino acid sequences set forth in SEQ ID NOs: 97, 98, 99, 100, and 101, wherein LCDR2 comprises the amino acid sequence ANI; comprising the respective amino acid sequences set forth in SEQ ID NOs: 102, 103, 104, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; comprising the respective amino acid sequences set forth in SEQ ID NOs: 106, 107, 108, 109, and 110, wherein LCDR2 comprises the amino acid sequence SDG; comprising the respective amino acid sequences set forth in SEQ ID NOs: 111, 112, 113, 114, and 115, wherein LCDR2 comprises the amino acid sequence GSS; comprising the respective amino acid sequences set forth in SEQ ID NOs: 116, 117, 118, 119, and 120, wherein LCDR2 comprises the amino acid sequence GNT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 121, 122, 123, 124, and 125, wherein LCDR2 comprises the amino acid sequence GYN; comprising the respective amino acid sequences set forth in SEQ ID NOs: 126, 117, 127, 128, and 129, wherein LCDR2 comprises the amino acid sequence GNS; comprising the respective amino acid sequences set forth in SEQ ID NOs: 130, 131, 132, 100, and 133, wherein LCDR2 comprises the amino acid sequence ANI; comprising the respective amino acid sequences set forth in SEQ ID NOs: 134, 135, 136, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; comprising the respective amino acid sequences set forth in SEQ ID NOs: 137, 138, 139, 140, and 141, wherein LCDR2 comprises the amino acid sequence ADS; SEQ ID NOs: 142, 143, 144, 100, and 105, and wherein LCDR2 comprises the amino acid sequence ANI; SEQ ID NOs: 145, 146, 147, 148, and 149, and wherein LCDR2 comprises the amino acid sequence GNS; comprising the respective amino acid sequences set forth in SEQ ID NOs: 150, 151, 152, 153, and 154, wherein LCDR2 comprises the amino acid sequence GNS; comprising the respective amino acid sequences set forth in SEQ ID NOs: 155, 156, 157, 158, and 159, wherein LCDR2 comprises the amino acid sequence GSH; comprising the respective amino acid sequences set forth in SEQ ID NOs: 121, 160, 161, 128, and 162, wherein LCDR2 comprises the amino acid sequence GNS; comprising the respective amino acid sequences set forth in SEQ ID NOs: 163, 164, 123, 124, and 165, wherein LCDR2 comprises the amino acid sequence GYN; comprising the respective amino acid sequences set forth in SEQ ID NOs: 106, 107, 108, 166, and 167, wherein LCDR2 comprises the amino acid sequence SDG; comprising the respective amino acid sequences set forth in SEQ ID NOs: 168, 169, 170, 171, and 172, wherein LCDR2 comprises the amino acid sequence KDT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 173, 174, 175, 171, and 176, wherein LCDR2 comprises the amino acid sequence KDT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 177, 178, 179, 180, and 181, wherein LCDR2 comprises the amino acid sequence SSS; comprising the respective amino acid sequences set forth in SEQ ID NOs: 182, 183, 184, 185, and 186, wherein LCDR2 comprises the amino acid sequence LVS; comprising the respective amino acid sequences set forth in SEQ ID NOs: 187, 188, 189, 100, and 190, wherein LCDR2 comprises the amino acid sequence ANI; comprising the respective amino acid sequences set forth in SEQ ID NOs: 191, 192, 193, 185, and 194, wherein LCDR2 comprises the amino acid sequence QVS; comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 198, wherein LCDR2 comprises the amino acid sequence KDT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 199, wherein LCDR2 comprises the amino acid sequence KDT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 200, and 201, wherein LCDR2 comprises the amino acid sequence RDT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 200, and 202, wherein LCDR2 comprises the amino acid sequence KDT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 190, wherein LCDR2 comprises the amino acid sequence KDT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 203, and 204, wherein LCDR2 comprises the amino acid sequence RDT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 205, wherein LCDR2 comprises the amino acid sequence KDT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 206, 207, 208, 209, and 210, wherein LCDR2 comprises the amino acid sequence SVS; comprising the respective amino acid sequences set forth in SEQ ID NOs: 211, 112, 113, 114, and 115, wherein LCDR2 comprises the amino acid sequence GSS; comprising the respective amino acid sequences set forth in SEQ ID NOs: 168, 117, 212, 213, and 214, wherein LCDR2 comprises the amino acid sequence KDT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 121, 215, 216, 166, and 217, wherein LCDR2 comprises the amino acid sequence SDG; comprising the respective amino acid sequences set forth in SEQ ID NOs: 218, 219, 220, 221, and 222, wherein LCDR2 comprises the amino acid sequence RDT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 223, 224, 225, 213, and 226, wherein LCDR2 comprises the amino acid sequence KDT; comprising the respective amino acid sequences set forth in SEQ ID NOs: 121, 227, 228, 229, and 230, wherein LCDR2 comprises the amino acid sequence SDG; comprising the respective amino acid sequences set forth in SEQ ID NOs: 231, 232, 233, 234, and 235, wherein LCDR2 comprises the amino acid sequence NND; comprising the respective amino acid sequences set forth in SEQ ID NOs: 236, 237, 238, 171, and 239, wherein LCDR2 comprises the amino acid sequence KDT; each comprising the amino acid sequence set forth in SEQ ID NOs: 240, 143, 241, 242, and 243, wherein LCDR2 comprises the amino acid sequence SNK; or They comprise the amino acid sequences set forth in SEQ ID NOs: 244, 138, 245, 246, and 247, respectively, and LCDR2 comprises the amino acid sequence EAS.
[0362] In one embodiment, the hCD19 binding domain comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:314 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:271.
[0363] In one embodiment, the hCD19 binding domain comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:315 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:272.
[0364] In one embodiment, the hCD19 binding domain comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:316 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:273.
[0365] In one embodiment, the hCD19 binding domain comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:317 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:274.
[0366] In one embodiment, the hCD19 binding domain comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:318 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:275.
[0367] In one embodiment, the hCD19 binding domain comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:319 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:276.
[0368] In one embodiment, the hCD19 binding domain comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:320 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:277.
[0369] In one embodiment, the hCD19 binding domain comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:321 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:278.
[0370] In one embodiment, the hCD19 binding domain comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:322 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:279.
[0371] In one embodiment, the hCD19 binding domain comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:323 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:280.
[0372] In one embodiment, the hCD19 binding domain comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:324 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:281.
[0373] In one embodiment, the hCD19 binding domain comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:325 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:282.
[0374] In one embodiment, the hCD19 binding domain comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:326 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:283.
[0375] In one embodiment, the hCD19 binding domain comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:327 and a light chain variable region comprising the amino acid sequence ...
Claims
1. An antibody or antigen-binding fragment thereof that specifically binds to human CD19, (a) a heavy chain complementarity determining region 1 (HCDR1) comprising the amino acid sequence set forth in SEQ ID NO: 87, 92, 97, 102, 106, 111, 116, 121, 126, 130, 134, 137, 142, 145, 150, 155, 163, 168, 173, 177, 182, 187, 191, 195, 206, 211, 218, 223, 231, 236, 240, or 244; (b) a heavy chain complementarity determining region 2 (HCDR2) comprising the amino acid sequence set forth in SEQ ID NO: 88, 93, 98, 103, 107, 112, 117, 122, 131, 135, 138, 143, 146, 151, 156, 160, 164, 169, 174, 178, 183, 188, 192, 196, 207, 215, 219, 224, 227, 232, or 237; (c) a heavy chain complementarity-determining region 3 (HCDR3) comprising the amino acid sequence set forth in SEQ ID NO: 89, 94, 99, 104, 108, 113, 118, 123, 127, 132, 136, 139, 144, 147, 152, 157, 161, 170, 175, 179, 184, 189, 193, 197, 208, 212, 216, 220, 225, 228, 233, 238, 241, or 245; (d) a light chain complementarity-determining region 1 (LCDR1) comprising the amino acid sequence set forth in SEQ ID NO: 90, 95, 100, 109, 114, 119, 124, 128, 140, 148, 153, 158, 166, 171, 180, 185, 200, 203, 209, 213, 221, 229, 234, 242, or 246; (e) a light chain complementarity-determining region 2 (LCDR2) comprising the amino acid sequence set forth in SEQ ID NO: ADS, AND, ANI, EAS, GNS, GNT, GSH, GSS, GYN, KDT, LVS, NND, QVS, RDT, SDG, SNK, SSS, or SVS; and (f) a light chain complementarity-determining region 3 (LCDR3) comprising the amino acid sequence set forth in SEQ ID NO: 91, 96, 101, 105, 110, 115, 120, 125, 129, 133, 141, 149, 154, 159, 162, 165, 167, 172, 176, 181, 186, 190, 194, 198, 199, 201, 202, 204, 205, 210, 214, 217, 222, 226, 230, 235, 239, 243, or 247. An antibody or antigen-binding fragment thereof comprising:
2. HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 are (a) each comprising the amino acid sequence set forth in SEQ ID NOs: 87, 88, 89, 90, and 91, wherein LCDR2 comprises the amino acid sequence GNS; (b) each comprising the amino acid sequence set forth in SEQ ID NOs: 92, 93, 94, 95, and 96, wherein LCDR2 comprises the amino acid sequence AND; (c) each of the amino acid sequences set forth in SEQ ID NOs: 97, 98, 99, 100, and 101, wherein LCDR2 comprises the amino acid sequence ANI; (d) each comprising the amino acid sequence set forth in SEQ ID NOs: 102, 103, 104, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; (e) each of the amino acid sequences set forth in SEQ ID NOs: 106, 107, 108, 109, and 110, wherein LCDR2 comprises the amino acid sequence SDG; (f) each of the amino acid sequences set forth in SEQ ID NOs: 111, 112, 113, 114, and 115, wherein LCDR2 comprises the amino acid sequence GSS; (g) each of the amino acid sequences set forth in SEQ ID NOs: 116, 117, 118, 119, and 120, wherein LCDR2 comprises the amino acid sequence GNT; (h) each of the amino acid sequences set forth in SEQ ID NOs: 121, 122, 123, 124, and 125, wherein LCDR2 comprises the amino acid sequence GYN; (i) each comprising the amino acid sequence set forth in SEQ ID NOs: 126, 117, 127, 128, and 129, wherein LCDR2 comprises the amino acid sequence GNS; (j) each of the amino acid sequences set forth in SEQ ID NOs: 130, 131, 132, 100, and 133, wherein LCDR2 comprises the amino acid sequence ANI; (k) each of the amino acid sequences set forth in SEQ ID NOs: 134, 135, 136, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; (l) each of the amino acid sequences set forth in SEQ ID NOs: 137, 138, 139, 140, and 141, wherein LCDR2 comprises the amino acid sequence ADS; (m) each comprising the amino acid sequence set forth in SEQ ID NOs: 142, 143, 144, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; (n) each of the amino acid sequences set forth in SEQ ID NOs: 145, 146, 147, 148, and 149, wherein LCDR2 comprises the amino acid sequence GNS; (o) each comprising the amino acid sequence set forth in SEQ ID NOs: 150, 151, 152, 153, and 154, wherein LCDR2 comprises the amino acid sequence GNS; (p) each of the amino acid sequences set forth in SEQ ID NOs: 155, 156, 157, 158, and 159, wherein LCDR2 comprises the amino acid sequence GSH; (q) each comprising the amino acid sequence set forth in SEQ ID NOs: 121, 160, 161, 128, and 162, wherein LCDR2 comprises the amino acid sequence GNS; (r) comprising the respective amino acid sequences set forth in SEQ ID NOs: 163, 164, 123, 124, and 165, wherein LCDR2 comprises the amino acid sequence GYN; (s) each comprising the amino acid sequence set forth in SEQ ID NOs: 106, 107, 108, 166, and 167, wherein LCDR2 comprises the amino acid sequence SDG; (t) each of the amino acid sequences set forth in SEQ ID NOs: 168, 169, 170, 171, and 172, wherein LCDR2 comprises the amino acid sequence KDT; (u) each comprising the amino acid sequence set forth in SEQ ID NOs: 173, 174, 175, 171, and 176, wherein LCDR2 comprises the amino acid sequence KDT; (v) each of the amino acid sequences set forth in SEQ ID NOs: 177, 178, 179, 180, and 181, wherein LCDR2 comprises the amino acid sequence SSS; (w) each of the amino acid sequences set forth in SEQ ID NOs: 182, 183, 184, 185, and 186, wherein LCDR2 comprises the amino acid sequence LVS; (x) each of the amino acid sequences set forth in SEQ ID NOs: 187, 188, 189, 100, and 190, wherein LCDR2 comprises the amino acid sequence ANI; (y) each of the amino acid sequences set forth in SEQ ID NOs: 191, 192, 193, 185, and 194, wherein LCDR2 comprises the amino acid sequence QVS; (z) each of the amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 198, wherein LCDR2 comprises the amino acid sequence KDT; (aa) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 199, wherein LCDR2 comprises the amino acid sequence KDT; (bb) each comprising the amino acid sequence set forth in SEQ ID NOs: 195, 196, 197, 200, and 201, wherein LCDR2 comprises the amino acid sequence RDT; (cc) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 200, and 202, wherein LCDR2 comprises the amino acid sequence KDT; (dd) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 190, wherein LCDR2 comprises the amino acid sequence KDT; (ee) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 203, and 204, wherein LCDR2 comprises the amino acid sequence RDT; (ff) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 205, wherein LCDR2 comprises the amino acid sequence KDT; (gg) comprising the respective amino acid sequences set forth in SEQ ID NOs: 206, 207, 208, 209, and 210, wherein LCDR2 comprises the amino acid sequence SVS; (hh) comprising the amino acid sequence set forth in SEQ ID NOs: 211, 112, 113, 114, and 115, respectively, wherein LCDR2 comprises the amino acid sequence GSS; (ii) each comprising the amino acid sequence set forth in SEQ ID NOs: 168, 117, 212, 213, and 214, wherein LCDR2 comprises the amino acid sequence KDT; (jj) comprising each of the amino acid sequences set forth in SEQ ID NOs: 121, 215, 216, 166, and 217, wherein LCDR2 comprises the amino acid sequence SDG; (kk) comprising the respective amino acid sequences set forth in SEQ ID NOs: 218, 219, 220, 221, and 222, wherein LCDR2 comprises the amino acid sequence RDT; (ll) comprising the respective amino acid sequences set forth in SEQ ID NOs: 223, 224, 225, 213, and 226, wherein LCDR2 comprises the amino acid sequence KDT; (mm) comprising the respective amino acid sequences set forth in SEQ ID NOs: 121, 227, 228, 229, and 230, wherein LCDR2 comprises the amino acid sequence SDG; (nn) comprising the respective amino acid sequences set forth in SEQ ID NOs: 231, 232, 233, 234, and 235, wherein LCDR2 comprises the amino acid sequence NND; (oo) comprising the amino acid sequence set forth in SEQ ID NOs: 236, 237, 238, 171, and 239, respectively, wherein LCDR2 comprises the amino acid sequence KDT; (pp) comprising the respective amino acid sequences set forth in SEQ ID NOs: 240, 143, 241, 242, and 243, wherein LCDR2 comprises the amino acid sequence SNK; or (qq) The antibody or antigen-binding fragment thereof of claim 1, comprising each of the amino acid sequences set forth in SEQ ID NOs: 244, 138, 245, 246, and 247, and wherein LCDR2 comprises the amino acid sequence EAS.
3. (a) a heavy chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, or 99% identity to the amino acid sequence set forth in SEQ ID NOs: 314-356; and / or (b) a light chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequence set forth in SEQ ID NOs: 271 to 313; The antibody or antigen-binding fragment thereof of claim 1, comprising:
4. (a) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 314, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 271; (b) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 315, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 272; (c) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 316, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 273; (d) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 317, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 274; (e) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 318, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 275; (f) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 319, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 276; (g) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 320, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 277; (h) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 321, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 278; (i) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 322, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 279; (j) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 323, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 280; (k) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 324, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 281; (l) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 325, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 282; (m) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 326, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 283; (n) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 327, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 284; (o) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 328, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 285; (p) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 329, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 286; (q) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 330, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 287; (r) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 331, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 288; (s) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 332, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 289; (t) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 333, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 290; (u) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 334, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 291; (v) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 335, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 292; (w) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 336, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 293; (x) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 337, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 294; (y) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 338, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 295; (z) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 339, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 296; (aa) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 340, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 297; (bb) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 341, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 298; (cc) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 342, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 299; (dd) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 343, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 300; (ee) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 344, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 301; (ff) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 345, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 302; (gg) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 346, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 303; (hh) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 347, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 304; (ii) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 348, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 305; (jj) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 349, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 306; (kk) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 350, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 307; (ll) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 351, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 308; (mm) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 352, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 309; (nn) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 353, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 310; (oo) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 354, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 311; (pp) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 355, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 312; or (qq) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 356, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:
313. The antibody or antigen-binding fragment thereof of claim 1, comprising:
5. An antibody or antigen-binding fragment thereof that specifically binds to human CD19, (a) a heavy chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, or 99% identity to the amino acid sequence set forth in SEQ ID NOs: 314-356; and (b) a light chain variable region comprising an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequence set forth in SEQ ID NOs: 271 to 313; An antibody or antigen-binding fragment thereof comprising:
6. (a) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 314, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 271; (b) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 315, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 272; (c) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 316, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 273; (d) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 317, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 274; (e) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 318, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 275; (f) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 319, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 276; (g) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 320, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 277; (h) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 321, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 278; (i) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 322, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 279; (j) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 323, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 280; (k) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 324, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 281; (l) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 325, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 282; (m) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 326, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 283; (n) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 327, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 284; (o) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 328, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 285; (p) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 329, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 286; (q) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 330, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 287; (r) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 331, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 288; (s) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 332, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 289; (t) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 333, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 290; (u) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 334, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 291; (v) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 335, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 292; (w) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 336, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 293; (x) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 337, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 294; (y) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 338, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 295; (z) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 339, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 296; (aa) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 340, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 297; (bb) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 341, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 298; (cc) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 342, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 299; (dd) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 343, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 300; (ee) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 344, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 301; (ff) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 345, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 302; (gg) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 346, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 303; (hh) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 347, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 304; (ii) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 348, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 305; (jj) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 349, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 306; (kk) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 350, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 307; (ll) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 351, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 308; (mm) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 352, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 309; (nn) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 353, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 310; (oo) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 354, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 311; (pp) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 355, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 312; or (qq) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 356, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:
313. The antibody or antigen-binding fragment thereof of claim 5, comprising:
7. An antibody or antigen-binding fragment thereof that specifically binds to CD19, (a) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NOs: 314-356; and (b) a light chain variable region comprising the amino acid sequence set forth in SEQ ID NOs: 271 to 313; An antibody or antigen-binding fragment thereof comprising:
8. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 7, which is selected from the group consisting of a full-length antibody, a single-chain variable fragment (scFv), sc(Fv)2, dsFv, Fab, Fab', (Fab')2, and a diabody.
9. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 8, wherein the antigen-binding fragment comprises an scFv.
10. A single-chain variable fragment (scFv) that specifically binds to human CD19, (a) a heavy chain variable region comprising HCDR1, HCDR2, and HCDR3, wherein HCDR1 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 87, 92, 97, 102, 106, 111, 116, 121, 126, 130, 134, 137, 142, 145, 150, 155, 163, 168, 173, 177, 182, 187, 191, 195, 206, 211, 218, 223, 231, 236, 240, and 244; and HCDR2 comprises SEQ ID NOs: 88, 93, 98, 103, 107, 112, 117, 122, 131, 135, 138, 143, 146, 151, 156, a heavy chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 160, 164, 169, 174, 178, 183, 188, 192, 196, 207, 215, 219, 224, 227, 232, and 237; and HCDR3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 89, 94, 99, 104, 108, 113, 118, 123, 127, 132, 136, 139, 144, 147, 152, 157, 161, 170, 175, 179, 184, 189, 193, 197, 208, 212, 216, 220, 225, 228, 233, 238, 241, and 245; and (b) a light chain variable region comprising LCDR1, LCDR2, and LCDR3, wherein LCDR1 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 90, 95, 100, 109, 114, 119, 124, 128, 140, 148, 153, 158, 166, 171, 180, 185, 200, 203, 209, 213, 221, 229, 234, 242, and 246; and LCDR2 comprises ADS, AND, ANI, EAS, GNS, GNT, GSH, GSS, GYN, KDT, LVS, NND, QVS, RDT, S DG, SNK, SSS, and SVS; and LCDR3 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 91, 96, 101, 105, 110, 115, 120, 125, 129, 133, 141, 149, 154, 159, 162, 165, 167, 172, 176, 181, 186, 190, 194, 198, 199, 201, 202, 204, 205, 210, 214, 217, 222, 226, 230, 235, 239, 243, and 247. wherein the heavy chain variable region and the light chain variable region are connected by a linker.
11. HCDR1, HCDR2, HCDR3, LCDR1 and LCDR3 are (a) each of the amino acid sequences set forth in SEQ ID NOs: 87, 88, 89, 90, and 91, wherein LCDR2 comprises the amino acid sequence GNS; (b) each comprising the amino acid sequence set forth in SEQ ID NOs: 92, 93, 94, 95, and 96, wherein LCDR2 comprises the amino acid sequence AND; (c) each of the amino acid sequences set forth in SEQ ID NOs: 97, 98, 99, 100, and 101, wherein LCDR2 comprises the amino acid sequence ANI; (d) each comprising the amino acid sequence set forth in SEQ ID NOs: 102, 103, 104, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; (e) each of the amino acid sequences set forth in SEQ ID NOs: 106, 107, 108, 109, and 110, wherein LCDR2 comprises the amino acid sequence SDG; (f) each of the amino acid sequences set forth in SEQ ID NOs: 111, 112, 113, 114, and 115, wherein LCDR2 comprises the amino acid sequence GSS; (g) each of the amino acid sequences set forth in SEQ ID NOs: 116, 117, 118, 119, and 120, wherein LCDR2 comprises the amino acid sequence GNT; (h) each of the amino acid sequences set forth in SEQ ID NOs: 121, 122, 123, 124, and 125, wherein LCDR2 comprises the amino acid sequence GYN; (i) each comprising the amino acid sequence set forth in SEQ ID NOs: 126, 117, 127, 128, and 129, wherein LCDR2 comprises the amino acid sequence GNS; (j) each of the amino acid sequences set forth in SEQ ID NOs: 130, 131, 132, 100, and 133, wherein LCDR2 comprises the amino acid sequence ANI; (k) each of the amino acid sequences set forth in SEQ ID NOs: 134, 135, 136, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; (l) each of the amino acid sequences set forth in SEQ ID NOs: 137, 138, 139, 140, and 141, wherein LCDR2 comprises the amino acid sequence ADS; (m) each comprising the amino acid sequence set forth in SEQ ID NOs: 142, 143, 144, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; (n) each of the amino acid sequences set forth in SEQ ID NOs: 145, 146, 147, 148, and 149, wherein LCDR2 comprises the amino acid sequence GNS; (o) each comprising the amino acid sequence set forth in SEQ ID NOs: 150, 151, 152, 153, and 154, wherein LCDR2 comprises the amino acid sequence GNS; (p) each of the amino acid sequences set forth in SEQ ID NOs: 155, 156, 157, 158, and 159, wherein LCDR2 comprises the amino acid sequence GSH; (q) each comprising the amino acid sequence set forth in SEQ ID NOs: 121, 160, 161, 128, and 162, wherein LCDR2 comprises the amino acid sequence GNS; (r) comprising the respective amino acid sequences set forth in SEQ ID NOs: 163, 164, 123, 124, and 165, wherein LCDR2 comprises the amino acid sequence GYN; (s) each comprising the amino acid sequence set forth in SEQ ID NOs: 106, 107, 108, 166, and 167, wherein LCDR2 comprises the amino acid sequence SDG; (t) each of the amino acid sequences set forth in SEQ ID NOs: 168, 169, 170, 171, and 172, wherein LCDR2 comprises the amino acid sequence KDT; (u) each comprising the amino acid sequence set forth in SEQ ID NOs: 173, 174, 175, 171, and 176, wherein LCDR2 comprises the amino acid sequence KDT; (v) each of the amino acid sequences set forth in SEQ ID NOs: 177, 178, 179, 180, and 181, wherein LCDR2 comprises the amino acid sequence SSS; (w) each of the amino acid sequences set forth in SEQ ID NOs: 182, 183, 184, 185, and 186, wherein LCDR2 comprises the amino acid sequence LVS; (x) each of the amino acid sequences set forth in SEQ ID NOs: 187, 188, 189, 100, and 190, wherein LCDR2 comprises the amino acid sequence ANI; (y) each of the amino acid sequences set forth in SEQ ID NOs: 191, 192, 193, 185, and 194, wherein LCDR2 comprises the amino acid sequence QVS; (z) each of the amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 198, wherein LCDR2 comprises the amino acid sequence KDT; (aa) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 199, wherein LCDR2 comprises the amino acid sequence KDT; (bb) each comprising the amino acid sequence set forth in SEQ ID NOs: 195, 196, 197, 200, and 201, wherein LCDR2 comprises the amino acid sequence RDT; (cc) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 200, and 202, wherein LCDR2 comprises the amino acid sequence KDT; (dd) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 190, wherein LCDR2 comprises the amino acid sequence KDT; (ee) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 203, and 204, wherein LCDR2 comprises the amino acid sequence RDT; (ff) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 205, wherein LCDR2 comprises the amino acid sequence KDT; (gg) comprising the respective amino acid sequences set forth in SEQ ID NOs: 206, 207, 208, 209, and 210, wherein LCDR2 comprises the amino acid sequence SVS; (hh) comprising the amino acid sequence set forth in SEQ ID NOs: 211, 112, 113, 114, and 115, respectively, wherein LCDR2 comprises the amino acid sequence GSS; (ii) each comprising the amino acid sequence set forth in SEQ ID NOs: 168, 117, 212, 213, and 214, wherein LCDR2 comprises the amino acid sequence KDT; (jj) comprising each of the amino acid sequences set forth in SEQ ID NOs: 121, 215, 216, 166, and 217, wherein LCDR2 comprises the amino acid sequence SDG; (kk) comprising the respective amino acid sequences set forth in SEQ ID NOs: 218, 219, 220, 221, and 222, wherein LCDR2 comprises the amino acid sequence RDT; (ll) comprising the respective amino acid sequences set forth in SEQ ID NOs: 223, 224, 225, 213, and 226, wherein LCDR2 comprises the amino acid sequence KDT; (mm) comprising the respective amino acid sequences set forth in SEQ ID NOs: 121, 227, 228, 229, and 230, wherein LCDR2 comprises the amino acid sequence SDG; (nn) comprising the respective amino acid sequences set forth in SEQ ID NOs: 231, 232, 233, 234, and 235, wherein LCDR2 comprises the amino acid sequence NND; (oo) comprising the amino acid sequence set forth in SEQ ID NOs: 236, 237, 238, 171, and 239, respectively, wherein LCDR2 comprises the amino acid sequence KDT; (pp) each comprising the amino acid sequence set forth in SEQ ID NOs: 240, 143, 241, 242, and 243, wherein LCDR2 comprises the amino acid sequence SNK; or (qq) The scFv of claim 10, comprising the amino acid sequences set forth in SEQ ID NOs: 244, 138, 245, 246, and 247, respectively, and wherein LCDR2 comprises the amino acid sequence EAS.
12. A single chain variable fragment (scFv) that specifically binds to CD19, (a) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NOs: 314-356; and (b) a light chain variable region comprising the amino acid sequence set forth in SEQ ID NOs: 271 to 313; wherein the heavy chain variable region and the light chain variable region are connected by a linker.
13. (a) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 314, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 271; (b) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 315, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 272; (c) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 316, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 273; (d) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 317, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 274; (e) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 318, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 275; (f) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 319, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 276; (g) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 320, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 277; (h) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 321, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 278; (i) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 322, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 279; (j) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 323, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 280; (k) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 324, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 281; (l) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 325, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 282; (m) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 326, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 283; (n) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 327, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 284; (o) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 328, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 285; (p) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 329, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 286; (q) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 330, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 287; (r) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 331, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 288; (s) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 332, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 289; (t) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 333, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 290; (u) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 334, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 291; (v) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 335, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 292; (w) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 336, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 293; (x) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 337, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 294; (y) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 338, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 295; (z) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 339, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 296; (aa) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 340, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 297; (bb) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 341, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 298; (cc) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 342, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 299; (dd) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 343, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 300; (ee) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 344, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 301; (ff) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 345, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 302; (gg) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 346, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 303; (hh) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 347, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 304; (ii) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 348, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 305; (jj) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 349, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 306; (kk) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 350, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 307; (ll) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 351, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 308; (mm) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 352, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 309; (nn) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 353, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 310; (oo) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 354, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 311; (pp) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 355, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 312; or (qq) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 356, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:
313. The scFv of claim 12, comprising:
14. A single-chain variable fragment (scFv) that specifically binds to CD19, comprising the amino acid sequence set forth in SEQ ID NOs: 44-86.
15. A chimeric antigen receptor (CAR) comprising the scFv according to any one of claims 10 to 14.
16. A chimeric antigen receptor (CAR) comprising an antigen-binding domain specific for human CD19 (hCD19), a transmembrane domain, and an intracellular signaling domain, (a) a heavy chain variable region comprising a heavy chain complementarity determining region 1 (HCDR1), HCDR2, and HCDR3, wherein HCDR1 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 87, 92, 97, 102, 106, 111, 116, 121, 126, 130, 134, 137, 142, 145, 150, 155, 163, 168, 173, 177, 182, 187, 191, 195, 206, 211, 218, 223, 231, 236, 240, and 244; and HCDR2 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 88, 93, 98, 103, 107, 112, 117, 122, 131, 135, 138, 143, 146, 150, 155, 163, 168, 173, 177, 182, 187, 191, 195, 206, 211, 218, 223, 231, 236, 240, and 244; a heavy chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 1, 156, 160, 164, 169, 174, 178, 183, 188, 192, 196, 207, 215, 219, 224, 227, 232, and 237; and HCDR3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 89, 94, 99, 104, 108, 113, 118, 123, 127, 132, 136, 139, 144, 147, 152, 157, 161, 170, 175, 179, 184, 189, 193, 197, 208, 212, 216, 220, 225, 228, 233, 238, 241, and 245; and (b) a light chain variable region comprising a light chain complementarity determining region 1 (LCDR1), LCDR2, and LCDR3, wherein LCDR1 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 90, 95, 100, 109, 114, 119, 124, 128, 140, 148, 153, 158, 166, 171, 180, 185, 200, 203, 209, 213, 221, 229, 234, 242, and 246; and LCDR2 comprises an amino acid sequence selected from the group consisting of ADS, AND, ANI, EAS, GNS, GNT, GSH, GSS, GYN, KDT, LVS, NND, QVS. , RDT, SDG, SNK, SSS, and SVS; and LCDR3 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 91, 96, 101, 105, 110, 115, 120, 125, 129, 133, 141, 149, 154, 159, 162, 165, 167, 172, 176, 181, 186, 190, 194, 198, 199, 201, 202, 204, 205, 210, 214, 217, 222, 226, 230, 235, 239, 243, and 247. Including, CAR.
17. HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, and LCDR3 are (a) each comprising the amino acid sequence set forth in SEQ ID NOs: 87, 88, 89, 90, and 91, wherein LCDR2 comprises the amino acid sequence GNS; (b) each comprising the amino acid sequence set forth in SEQ ID NOs: 92, 93, 94, 95, and 96, wherein LCDR2 comprises the amino acid sequence AND; (c) each of the amino acid sequences set forth in SEQ ID NOs: 97, 98, 99, 100, and 101, wherein LCDR2 comprises the amino acid sequence ANI; (d) each comprising the amino acid sequence set forth in SEQ ID NOs: 102, 103, 104, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; (e) each of the amino acid sequences set forth in SEQ ID NOs: 106, 107, 108, 109, and 110, wherein LCDR2 comprises the amino acid sequence SDG; (f) each of the amino acid sequences set forth in SEQ ID NOs: 111, 112, 113, 114, and 115, wherein LCDR2 comprises the amino acid sequence GSS; (g) each of the amino acid sequences set forth in SEQ ID NOs: 116, 117, 118, 119, and 120, wherein LCDR2 comprises the amino acid sequence GNT; (h) each of the amino acid sequences set forth in SEQ ID NOs: 121, 122, 123, 124, and 125, wherein LCDR2 comprises the amino acid sequence GYN; (i) each comprising the amino acid sequence set forth in SEQ ID NOs: 126, 117, 127, 128, and 129, wherein LCDR2 comprises the amino acid sequence GNS; (j) each of the amino acid sequences set forth in SEQ ID NOs: 130, 131, 132, 100, and 133, wherein LCDR2 comprises the amino acid sequence ANI; (k) each of the amino acid sequences set forth in SEQ ID NOs: 134, 135, 136, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; (l) each of the amino acid sequences set forth in SEQ ID NOs: 137, 138, 139, 140, and 141, wherein LCDR2 comprises the amino acid sequence ADS; (m) each comprising the amino acid sequence set forth in SEQ ID NOs: 142, 143, 144, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; (n) each of the amino acid sequences set forth in SEQ ID NOs: 145, 146, 147, 148, and 149, wherein LCDR2 comprises the amino acid sequence GNS; (o) each comprising the amino acid sequence set forth in SEQ ID NOs: 150, 151, 152, 153, and 154, wherein LCDR2 comprises the amino acid sequence GNS; (p) each of the amino acid sequences set forth in SEQ ID NOs: 155, 156, 157, 158, and 159, wherein LCDR2 comprises the amino acid sequence GSH; (q) each comprising the amino acid sequence set forth in SEQ ID NOs: 121, 160, 161, 128, and 162, wherein LCDR2 comprises the amino acid sequence GNS; (r) comprising the respective amino acid sequences set forth in SEQ ID NOs: 163, 164, 123, 124, and 165, wherein LCDR2 comprises the amino acid sequence GYN; (s) each comprising the amino acid sequence set forth in SEQ ID NOs: 106, 107, 108, 166, and 167, wherein LCDR2 comprises the amino acid sequence SDG; (t) each of the amino acid sequences set forth in SEQ ID NOs: 168, 169, 170, 171, and 172, wherein LCDR2 comprises the amino acid sequence KDT; (u) each comprising the amino acid sequence set forth in SEQ ID NOs: 173, 174, 175, 171, and 176, wherein LCDR2 comprises the amino acid sequence KDT; (v) each of the amino acid sequences set forth in SEQ ID NOs: 177, 178, 179, 180, and 181, wherein LCDR2 comprises the amino acid sequence SSS; (w) each of the amino acid sequences set forth in SEQ ID NOs: 182, 183, 184, 185, and 186, wherein LCDR2 comprises the amino acid sequence LVS; (x) each of the amino acid sequences set forth in SEQ ID NOs: 187, 188, 189, 100, and 190, wherein LCDR2 comprises the amino acid sequence ANI; (y) each of the amino acid sequences set forth in SEQ ID NOs: 191, 192, 193, 185, and 194, wherein LCDR2 comprises the amino acid sequence QVS; (z) each of the amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 198, wherein LCDR2 comprises the amino acid sequence KDT; (aa) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 199, wherein LCDR2 comprises the amino acid sequence KDT; (bb) each comprising the amino acid sequence set forth in SEQ ID NOs: 195, 196, 197, 200, and 201, wherein LCDR2 comprises the amino acid sequence RDT; (cc) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 200, and 202, wherein LCDR2 comprises the amino acid sequence KDT; (dd) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 190, wherein LCDR2 comprises the amino acid sequence KDT; (ee) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 203, and 204, wherein LCDR2 comprises the amino acid sequence RDT; (ff) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 205, wherein LCDR2 comprises the amino acid sequence KDT; (gg) comprising the respective amino acid sequences set forth in SEQ ID NOs: 206, 207, 208, 209, and 210, wherein LCDR2 comprises the amino acid sequence SVS; (hh) comprising the amino acid sequence set forth in SEQ ID NOs: 211, 112, 113, 114, and 115, respectively, wherein LCDR2 comprises the amino acid sequence GSS; (ii) each comprising the amino acid sequence set forth in SEQ ID NOs: 168, 117, 212, 213, and 214, wherein LCDR2 comprises the amino acid sequence KDT; (jj) comprising each of the amino acid sequences set forth in SEQ ID NOs: 121, 215, 216, 166, and 217, wherein LCDR2 comprises the amino acid sequence SDG; (kk) comprising the respective amino acid sequences set forth in SEQ ID NOs: 218, 219, 220, 221, and 222, wherein LCDR2 comprises the amino acid sequence RDT; (ll) comprising the respective amino acid sequences set forth in SEQ ID NOs: 223, 224, 225, 213, and 226, wherein LCDR2 comprises the amino acid sequence KDT; (mm) comprising the respective amino acid sequences set forth in SEQ ID NOs: 121, 227, 228, 229, and 230, wherein LCDR2 comprises the amino acid sequence SDG; (nn) comprising the respective amino acid sequences set forth in SEQ ID NOs: 231, 232, 233, 234, and 235, wherein LCDR2 comprises the amino acid sequence NND; (oo) comprising the amino acid sequence set forth in SEQ ID NOs: 236, 237, 238, 171, and 239, respectively, wherein LCDR2 comprises the amino acid sequence KDT; (pp) comprising the respective amino acid sequences set forth in SEQ ID NOs: 240, 143, 241, 242, and 243, wherein LCDR2 comprises the amino acid sequence SNK; or (qq) The CAR of claim 16, comprising each of the amino acid sequences set forth in SEQ ID NOs: 244, 138, 245, 246, and 247, wherein LCDR2 comprises the amino acid sequence EAS.
18. the antigen-binding domain (a) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 314, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 271; (b) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 315, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 272; (c) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 316, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 273; (d) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 317, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 274; (e) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 318, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 275; (f) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 319, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 276; (g) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 320, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 277; (h) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 321, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 278; (i) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 322, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 279; (j) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 323, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 280; (k) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 324, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 281; (l) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 325, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 282; (m) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 326, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 283; (n) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 327, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 284; (o) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 328, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 285; (p) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 329, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 286; (q) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 330, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 287; (r) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 331, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 288; (s) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 332, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 289; (t) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 333, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 290; (u) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 334, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 291; (v) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 335, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 292; (w) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 336, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 293; (x) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 337, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 294; (y) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 338, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 295; (z) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 339, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 296; (aa) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 340, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 297; (bb) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 341, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 298; (cc) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 342, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 299; (dd) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 343, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 300; (ee) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 344, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 301; (ff) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 345, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 302; (gg) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 346, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 303; (hh) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 347, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 304; (ii) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 348, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 305; (jj) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 349, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 306; (kk) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 350, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 307; (ll) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 351, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 308; (mm) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 352, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 309; (nn) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 353, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 310; (oo) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 354, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 311; (pp) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 355, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 312; or (qq) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 356, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:
313. The CAR of claim 16, comprising:
19. The CAR according to claim 16, wherein the antigen-binding domain comprises a heavy chain variable region comprising an amino acid sequence having at least 95% to 99% identity to any of the amino acid sequences of heavy chain variable regions set forth in SEQ ID NOs: 314 to 356.
20. The CAR according to claim 16, wherein the antigen-binding domain comprises a heavy chain variable region comprising any one of the amino acid sequences of heavy chain variable regions set forth in SEQ ID NOs: 314 to 356.
21. The CAR according to claim 16, wherein the antigen-binding domain comprises a heavy chain variable region consisting of any one of the amino acid sequences of heavy chain variable regions set forth in SEQ ID NOs: 314 to 356.
22. The CAR according to claim 16, wherein the antigen-binding domain comprises a light chain variable region comprising an amino acid sequence having at least 95 to 99% identity to any of the amino acid sequences of light chain variable regions set forth in SEQ ID NOs: 271 to 313.
23. The CAR according to claim 16, wherein the antigen-binding domain comprises a light chain variable region comprising any one of the amino acid sequences of light chain variable regions set forth in SEQ ID NOs: 271 to 313.
24. The CAR according to claim 16, wherein the antigen-binding domain consists of a light chain variable region having an amino acid sequence of any one of the light chain variable regions set forth in SEQ ID NOs: 271 to 313.
25. A chimeric antigen receptor (CAR) comprising an antigen-binding domain, a transmembrane domain, and an intracellular domain, wherein the antigen-binding domain comprises a heavy chain variable region comprising any of the amino acid sequences set forth in SEQ ID NOs: 314 to 356, and a light chain variable region comprising any of the amino acid sequences set forth in SEQ ID NOs: 271 to 313.
26. the antigen-binding domain (a) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 314, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 271; (b) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 315, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 272; (c) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 316, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 273; (d) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 317, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 274; (e) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 318, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 275; (f) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 319, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 276; (g) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 320, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 277; (h) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 321, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 278; (i) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 322, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 279; (j) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 323, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 280; (k) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 324, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 281; (l) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 325, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 282; (m) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 326, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 283; (n) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 327, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 284; (o) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 328, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 285; (p) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 329, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 286; (q) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 330, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 287; (r) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 331, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 288; (s) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 332, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 289; (t) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 333, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 290; (u) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 334, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 291; (v) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 335, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:
292. (w) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 336, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 293; (x) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 337, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 294; (y) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 338, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 295; (z) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 339, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 296; (aa) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 340, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 297; (bb) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 341, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 298; (cc) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 342, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 299; (dd) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 343, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 300; (ee) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 344, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 301; (ff) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 345, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 302; (gg) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 346, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 303; (hh) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 347, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 304; (ii) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 348, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 305; (jj) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 349, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 306; (kk) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 350, and a light chain variable sequence comprising the amino acid sequence set forth in SEQ ID NO: 307; (ll) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 351, and a light chain variable sequence comprising the amino acid sequence set forth in SEQ ID NO: 308; (mm) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 352, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 309; (nn) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 353, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 310; (oo) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 354, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 311; (pp) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 355, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 312; or (qq) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 356, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:
313. The CAR of claim 25, comprising:
27. A chimeric antigen receptor (CAR) comprising an antigen-binding domain, a transmembrane domain, and an intracellular signaling domain, wherein the antigen-binding domain comprises any one of the amino acid sequences set forth in SEQ ID NOs: 44 to 86.
28. The CAR according to any one of claims 16 to 27, wherein the intracellular signaling domain is derived from a human NK cell receptor (NKR), and the CAR is an NKR-CAR.
29. The CAR of claim 28, wherein the NKR domain is selected from the group consisting of an actKIR domain, an NCR domain, an SLAMF domain, an FcR domain, a CD16 domain, a CD64 domain, an actLy49 domain, and an inhLy49 domain.
30. The CAR of claim 28, wherein the intracellular signaling domain is a KIR signaling domain selected from the group consisting of KIR2DS2 signaling domain, KIR2DS2 signaling domain, KIR2DL3 signaling domain, KIR2DL1 signaling domain, KIR2DL2 signaling domain, KIR2DL4 signaling domain, KIR2DL5A signaling domain, KIR2DL5B signaling domain, KIR2DS1 signaling domain, KIR2DS3 signaling domain, KIR2DS4 signaling domain, KIR2DS5 signaling domain, KIR3DL1 signaling domain, KIR3DS1 signaling domain, KIR3DL2 signaling domain, KIR3DL3 signaling domain, KIR2DP1 signaling domain, and KIR3DP1 signaling domain.
31. 29. The CAR of claim 28, wherein the transmembrane domain is a KIR transmembrane domain selected from the group consisting of KIR2DS2 transmembrane domain, KIR2DS2 transmembrane domain, KIR2DL3 transmembrane domain, KIR2DL1 transmembrane domain, KIR2DL2 transmembrane domain, KIR2DL4 transmembrane domain, KIR2DL5A transmembrane domain, KIR2DL5B transmembrane domain, KIR2DS1 transmembrane domain, KIR2DS3 transmembrane domain, KIR2DS4 transmembrane domain, KIR2DS5 transmembrane domain, KIR3DL1 transmembrane domain, KIR3DS1 transmembrane domain, KIR3DL2 transmembrane domain, KIR3DL3 transmembrane domain, KIR2DP1 transmembrane domain, and KIR3DP1 transmembrane domain.
32. The CAR of claim 28, wherein the transmembrane domain is capable of binding to the transmembrane domain of DAP12.
33. The CAR of any one of claims 28 to 32, wherein the KIR signaling domain comprises the amino acid sequence set forth in SEQ ID NO:
266.
34. The CAR according to any one of claims 28 to 32, comprising an amino acid sequence shown in SEQ ID NOs: 370 to 412.
35. An NK cell receptor (NKR)-CAR complex comprising an NKR-CAR having an amino acid sequence set forth in any one of SEQ ID NOs: 370 to 412 and an adaptor molecule.
36. The NKR-CAR complex of claim 29, wherein the adapter molecule is DAP12 or FcεRγ.
37. The NKR-CAR complex according to claim 29 or 30, wherein the NKR-CAR interacts with the adapter molecule when the antigen-binding domain of the NKR-CAR binds to human CD19.
38. (a) an antigen-binding domain that specifically binds to human CD19 (hCD19); and (b) an NKR transmembrane domain; and (c) NKR intracellular signaling domain NKR-CAR, comprising one or both of:
39. the antigen-binding domain (a) a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDR1, HCDR2, and HCDR3), wherein HCDR1 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 87, 92, 97, 102, 106, 111, 116, 121, 126, 130, 134, 137, 142, 145, 150, 155, 163, 168, 173, 177, 182, 187, 191, 195, 206, 211, 218, 223, 231, 236, 240, and 244; and HCDR2 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 88, 93, 98, 103, 107, 112, 117, 122, 131, 135, 138, 143, 146, 150, 155, 163, 168, 173, 177, 182, 187, 191, 195, 206, 211, 218, 223, 231, 236, 240, and 244; a heavy chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 51, 156, 160, 164, 169, 174, 178, 183, 188, 192, 196, 207, 215, 219, 224, 227, 232, and 237; and HCDR3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 89, 94, 99, 104, 108, 113, 118, 123, 127, 132, 136, 139, 144, 147, 152, 157, 161, 170, 175, 179, 184, 189, 193, 197, 208, 212, 216, 220, 225, 228, 233, 238, 241, and 245; and (b) a light chain variable region comprising three light chain complementarity determining regions (LCDR1, LCDR2, and LCDR3), wherein LCDR1 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 90, 95, 100, 109, 114, 119, 124, 128, 140, 148, 153, 158, 166, 171, 180, 185, 200, 203, 209, 213, 221, 229, 234, 242, and 246; and LCDR2 comprises an amino acid sequence selected from the group consisting of ADS, AND, ANI, EAS, GNS, GNT, GSH, GSS, GYN, KDT, LVS, NND, QV. the light chain variable region comprising an amino acid sequence selected from the group consisting of S, RDT, SDG, SNK, SSS, and SVS; and LCDR3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 91, 96, 101, 105, 110, 115, 120, 125, 129, 133, 141, 149, 154, 159, 162, 165, 167, 172, 176, 181, 186, 190, 194, 198, 199, 201, 202, 204, 205, 210, 214, 217, 222, 226, 230, 235, 239, 243, and 247. The NKR-CAR according to claim 38, comprising:
40. HCDR1, HCDR2, HCDR3, LCDR1 and LCDR3 are (a) each comprising the amino acid sequence set forth in SEQ ID NOs: 87, 88, 89, 90, and 91, wherein LCDR2 comprises the amino acid sequence GNS; (b) each comprising the amino acid sequence set forth in SEQ ID NOs: 92, 93, 94, 95, and 96, wherein LCDR2 comprises the amino acid sequence AND; (c) each of the amino acid sequences set forth in SEQ ID NOs: 97, 98, 99, 100, and 101, wherein LCDR2 comprises the amino acid sequence ANI; (d) each comprising the amino acid sequence set forth in SEQ ID NOs: 102, 103, 104, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; (e) each of the amino acid sequences set forth in SEQ ID NOs: 106, 107, 108, 109, and 110, wherein LCDR2 comprises the amino acid sequence SDG; (f) each of the amino acid sequences set forth in SEQ ID NOs: 111, 112, 113, 114, and 115, wherein LCDR2 comprises the amino acid sequence GSS; (g) each of the amino acid sequences set forth in SEQ ID NOs: 116, 117, 118, 119, and 120, wherein LCDR2 comprises the amino acid sequence GNT; (h) each of the amino acid sequences set forth in SEQ ID NOs: 121, 122, 123, 124, and 125, wherein LCDR2 comprises the amino acid sequence GYN; (i) each comprising the amino acid sequence set forth in SEQ ID NOs: 126, 117, 127, 128, and 129, wherein LCDR2 comprises the amino acid sequence GNS; (j) each of the amino acid sequences set forth in SEQ ID NOs: 130, 131, 132, 100, and 133, wherein LCDR2 comprises the amino acid sequence ANI; (k) each of the amino acid sequences set forth in SEQ ID NOs: 134, 135, 136, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; (l) each of the amino acid sequences set forth in SEQ ID NOs: 137, 138, 139, 140, and 141, wherein LCDR2 comprises the amino acid sequence ADS; (m) each comprising the amino acid sequence set forth in SEQ ID NOs: 142, 143, 144, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; (n) each of the amino acid sequences set forth in SEQ ID NOs: 145, 146, 147, 148, and 149, wherein LCDR2 comprises the amino acid sequence GNS; (o) each comprising the amino acid sequence set forth in SEQ ID NOs: 150, 151, 152, 153, and 154, wherein LCDR2 comprises the amino acid sequence GNS; (p) each of the amino acid sequences set forth in SEQ ID NOs: 155, 156, 157, 158, and 159, wherein LCDR2 comprises the amino acid sequence GSH; (q) each comprising the amino acid sequence set forth in SEQ ID NOs: 121, 160, 161, 128, and 162, wherein LCDR2 comprises the amino acid sequence GNS; (r) comprising the respective amino acid sequences set forth in SEQ ID NOs: 163, 164, 123, 124, and 165, wherein LCDR2 comprises the amino acid sequence GYN; (s) each comprising the amino acid sequence set forth in SEQ ID NOs: 106, 107, 108, 166, and 167, wherein LCDR2 comprises the amino acid sequence SDG; (t) each of the amino acid sequences set forth in SEQ ID NOs: 168, 169, 170, 171, and 172, wherein LCDR2 comprises the amino acid sequence KDT; (u) each comprising the amino acid sequence set forth in SEQ ID NOs: 173, 174, 175, 171, and 176, wherein LCDR2 comprises the amino acid sequence KDT; (v) each of the amino acid sequences set forth in SEQ ID NOs: 177, 178, 179, 180, and 181, wherein LCDR2 comprises the amino acid sequence SSS; (w) each of the amino acid sequences set forth in SEQ ID NOs: 182, 183, 184, 185, and 186, wherein LCDR2 comprises the amino acid sequence LVS; (x) each of the amino acid sequences set forth in SEQ ID NOs: 187, 188, 189, 100, and 190, wherein LCDR2 comprises the amino acid sequence ANI; (y) each of the amino acid sequences set forth in SEQ ID NOs: 191, 192, 193, 185, and 194, wherein LCDR2 comprises the amino acid sequence QVS; (z) each of the amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 198, wherein LCDR2 comprises the amino acid sequence KDT; (aa) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 199, wherein LCDR2 comprises the amino acid sequence KDT; (bb) each comprising the amino acid sequence set forth in SEQ ID NOs: 195, 196, 197, 200, and 201, wherein LCDR2 comprises the amino acid sequence RDT; (cc) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 200, and 202, wherein LCDR2 comprises the amino acid sequence KDT; (dd) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 190, wherein LCDR2 comprises the amino acid sequence KDT; (ee) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 203, and 204, wherein LCDR2 comprises the amino acid sequence RDT; (ff) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 205, wherein LCDR2 comprises the amino acid sequence KDT; (gg) comprising the respective amino acid sequences set forth in SEQ ID NOs: 206, 207, 208, 209, and 210, wherein LCDR2 comprises the amino acid sequence SVS; (hh) comprising the amino acid sequence set forth in SEQ ID NOs: 211, 112, 113, 114, and 115, respectively, wherein LCDR2 comprises the amino acid sequence GSS; (ii) each comprising the amino acid sequence set forth in SEQ ID NOs: 168, 117, 212, 213, and 214, wherein LCDR2 comprises the amino acid sequence KDT; (jj) comprising each of the amino acid sequences set forth in SEQ ID NOs: 121, 215, 216, 166, and 217, wherein LCDR2 comprises the amino acid sequence SDG; (kk) comprising the respective amino acid sequences set forth in SEQ ID NOs: 218, 219, 220, 221, and 222, wherein LCDR2 comprises the amino acid sequence RDT; (ll) comprising the respective amino acid sequences set forth in SEQ ID NOs: 223, 224, 225, 213, and 226, wherein LCDR2 comprises the amino acid sequence KDT; (mm) comprising the respective amino acid sequences set forth in SEQ ID NOs: 121, 227, 228, 229, and 230, wherein LCDR2 comprises the amino acid sequence SDG; (nn) comprising the respective amino acid sequences set forth in SEQ ID NOs: 231, 232, 233, 234, and 235, wherein LCDR2 comprises the amino acid sequence NND; (oo) comprising the amino acid sequence set forth in SEQ ID NOs: 236, 237, 238, 171, and 239, respectively, wherein LCDR2 comprises the amino acid sequence KDT; (pp) each comprising the amino acid sequence set forth in SEQ ID NOs: 240, 143, 241, 242, and 243, wherein LCDR2 comprises the amino acid sequence SNK; or (qq) The NKR-CAR according to claim 39, comprising each of the amino acid sequences shown in SEQ ID NOs: 244, 138, 245, 246, and 247, wherein LCDR2 comprises the amino acid sequence EAS.
41. The NKR-CAR according to claim 38, wherein the antigen-binding domain comprises: a heavy chain variable region comprising any of the amino acid sequences set forth in SEQ ID NOs: 314 to 356; and a light chain variable region comprising any of the amino acid sequences set forth in SEQ ID NOs: 271 to 313.
42. the antigen-binding domain (a) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 314, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 271; (b) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 315, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 272; (c) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 316, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 273; (d) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 317, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 274; (e) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 318, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 275; (f) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 319, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 276; (g) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 320, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 277; (h) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 321, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 278; (i) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 322, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 279; (j) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 323, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 280; (k) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 324, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 281; (l) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 325, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 282; (m) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 326, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 283; (n) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 327, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 284; (o) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 328, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 285; (p) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 329, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 286; (q) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 330, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 287; (r) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 331, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 288; (s) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 332, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 289; (t) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 333, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 290; (u) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 334, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 291; (v) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 335, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 292; (w) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 336, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 293; (x) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 337, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 294; (y) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 338, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 295; (z) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 339, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 296; (aa) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 340, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 297; (bb) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 341, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 298; (cc) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 342, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 299; (dd) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 343, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 300; (ee) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 344, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 301; (ff) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 345, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 302; (gg) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 346, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 303; (hh) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 347, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 304; (ii) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 348, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 305; (jj) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 349, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 306; (kk) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 350, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 307; (ll) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 351, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 308; (mm) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 352, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 309; (nn) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 353, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 310; (oo) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 354, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 311; (pp) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 355, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 312; or (qq) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 356, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:
313. The NKR-CAR according to claim 41, comprising:
43. The NKR-CAR according to claim 38, wherein the NKR intracellular signaling domain is selected from the group consisting of an actKIR domain, an NCR domain, an SLAMF domain, an FcR domain, a CD16 domain, a CD64 domain, an actLy49 domain, and an inhLy49 domain.
44. The NKR-CAR according to any one of claims 35 to 43, which is a KIR-CAR.
45. The NKR-CAR according to claim 38, wherein the intracellular signaling domain is a KIR signaling domain selected from the group consisting of a KIR2DS2 signaling domain, a KIR2DS2 signaling domain, a KIR2DL3 signaling domain, a KIR2DL1 signaling domain, a KIR2DL2 signaling domain, a KIR2DL4 signaling domain, a KIR2DL5A signaling domain, a KIR2DL5B signaling domain, a KIR2DS1 signaling domain, a KIR2DS3 signaling domain, a KIR2DS4 signaling domain, a KIR2DS5 signaling domain, a KIR3DL1 signaling domain, a KIR3DS1 signaling domain, a KIR3DL2 signaling domain, a KIR3DL3 signaling domain, a KIR2DP1 signaling domain, and a KIR3DP1 signaling domain.
46. The NKR-CAR according to claim 38, wherein the transmembrane domain is a KIR transmembrane domain selected from the group consisting of a KIR2DS2 transmembrane domain, a KIR2DS2 transmembrane domain, a KIR2DL3 transmembrane domain, a KIR2DL1 transmembrane domain, a KIR2DL2 transmembrane domain, a KIR2DL4 transmembrane domain, a KIR2DL5A transmembrane domain, a KIR2DL5B transmembrane domain, a KIR2DS1 transmembrane domain, a KIR2DS3 transmembrane domain, a KIR2DS4 transmembrane domain, a KIR2DS5 transmembrane domain, a KIR3DL1 transmembrane domain, a KIR3DS1 transmembrane domain, a KIR3DL2 transmembrane domain, a KIR3DL3 transmembrane domain, a KIR2DP1 transmembrane domain, and a KIR3DP1 transmembrane domain.
47. The NKR-CAR according to any one of claims 38 to 46, wherein the transmembrane domain is capable of binding to and / or activating DAP12 via the transmembrane domain of DAP12.
48. The NKR-CAR according to any one of claims 38 to 46, wherein the KIR signaling domain comprises the amino acid sequence set forth in SEQ ID NO:
266.
49. The NKR-CAR according to any one of claims 38 to 46, wherein the CAR comprises an amino acid sequence shown in SEQ ID NOs: 370 to 412.
50. (a) a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDR1, HCDR2, and HCDR3), wherein HCDR1 is an amino acid sequence selected from the group consisting of SEQ ID NOs: 87, 92, 97, 102, 106, 111, 116, 121, 126, 130, 134, 137, 142, 145, 150, 155, 163, 168, 173, 177, 182, 187, 191, 195, 206, 211, 218, 223, 231, 236, 240, and 244; HCDR2 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 88, 93, 98, 103, 107, 112, 117, 122, 131, 135, 138, 143, 146, 151, 156, 160, 164, 169, 174, 178, 183, 188, 192, 196, 207, 215, 219, 224, 227, 232, and 237; and HCDR3 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 89, 94, 99, 104, 108, 113, 118, 123, 127, 132 , 136, 139, 144, 147, 152, 157, 161, 170, 175, 179, 184, 189, 193, 197, 208, 212, 216, 220, 225, 228, 233, 238, 241, and 245; and a light chain variable region comprising three light chain complementarity determining regions (LCDR1, LCDR2, and LCDR3), wherein LCDR1 is selected from the group consisting of SEQ ID NOs: 90, 95, 100, 109, 114, , 119, 124, 128, 140, 148, 153, 158, 166, 171, 180, 185, 200, 203, 209, 213, 221, 229, 234, 242, and 246, and wherein LCDR2 comprises an amino acid sequence selected from the group consisting of ADS, AND, ANI, EAS, GNS, GNT, GSH, GSS, GYN, KDT, LVS, NND, QVS, RDT, SDG, SNK, SSS, and SVS;an antigen binding domain comprising a light chain variable region, wherein LCDR3 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 91, 96, 101, 105, 110, 115, 120, 125, 129, 133, 141, 149, 154, 159, 162, 165, 167, 172, 176, 181, 186, 190, 194, 198, 199, 201, 202, 204, 205, 210, 214, 217, 222, 226, 230, 235, 239, 243, and 247; (b) a transmembrane domain; and (c) KIR2DS2 intracellular signaling domain A chimeric antigen receptor (CAR) comprising:
51. HCDR1, HCDR2, HCDR3, LCDR1 and LCDR3 are (a) each of the amino acid sequences set forth in SEQ ID NOs: 87, 88, 89, 90, and 91, wherein LCDR2 comprises the amino acid sequence GNS; (b) each comprising the amino acid sequence set forth in SEQ ID NOs: 92, 93, 94, 95, and 96, wherein LCDR2 comprises the amino acid sequence AND; (c) each of the amino acid sequences set forth in SEQ ID NOs: 97, 98, 99, 100, and 101, wherein LCDR2 comprises the amino acid sequence ANI; (d) each comprising the amino acid sequence set forth in SEQ ID NOs: 102, 103, 104, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; (e) each of the amino acid sequences set forth in SEQ ID NOs: 106, 107, 108, 109, and 110, wherein LCDR2 comprises the amino acid sequence SDG; (f) each of the amino acid sequences set forth in SEQ ID NOs: 111, 112, 113, 114, and 115, wherein LCDR2 comprises the amino acid sequence GSS; (g) each of the amino acid sequences set forth in SEQ ID NOs: 116, 117, 118, 119, and 120, wherein LCDR2 comprises the amino acid sequence GNT; (h) each of the amino acid sequences set forth in SEQ ID NOs: 121, 122, 123, 124, and 125, wherein LCDR2 comprises the amino acid sequence GYN; (i) each comprising the amino acid sequence set forth in SEQ ID NOs: 126, 117, 127, 128, and 129, wherein LCDR2 comprises the amino acid sequence GNS; (j) each of the amino acid sequences set forth in SEQ ID NOs: 130, 131, 132, 100, and 133, wherein LCDR2 comprises the amino acid sequence ANI; (k) each of the amino acid sequences set forth in SEQ ID NOs: 134, 135, 136, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; (l) each of the amino acid sequences set forth in SEQ ID NOs: 137, 138, 139, 140, and 141, wherein LCDR2 comprises the amino acid sequence ADS; (m) each comprising the amino acid sequence set forth in SEQ ID NOs: 142, 143, 144, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; (n) each of the amino acid sequences set forth in SEQ ID NOs: 145, 146, 147, 148, and 149, wherein LCDR2 comprises the amino acid sequence GNS; (o) each comprising the amino acid sequence set forth in SEQ ID NOs: 150, 151, 152, 153, and 154, wherein LCDR2 comprises the amino acid sequence GNS; (p) each of the amino acid sequences set forth in SEQ ID NOs: 155, 156, 157, 158, and 159, wherein LCDR2 comprises the amino acid sequence GSH; (q) each comprising the amino acid sequence set forth in SEQ ID NOs: 121, 160, 161, 128, and 162, wherein LCDR2 comprises the amino acid sequence GNS; (r) comprising the respective amino acid sequences set forth in SEQ ID NOs: 163, 164, 123, 124, and 165, wherein LCDR2 comprises the amino acid sequence GYN; (s) each comprising the amino acid sequence set forth in SEQ ID NOs: 106, 107, 108, 166, and 167, wherein LCDR2 comprises the amino acid sequence SDG; (t) each of the amino acid sequences set forth in SEQ ID NOs: 168, 169, 170, 171, and 172, wherein LCDR2 comprises the amino acid sequence KDT; (u) each comprising the amino acid sequence set forth in SEQ ID NOs: 173, 174, 175, 171, and 176, wherein LCDR2 comprises the amino acid sequence KDT; (v) each of the amino acid sequences set forth in SEQ ID NOs: 177, 178, 179, 180, and 181, wherein LCDR2 comprises the amino acid sequence SSS; (w) each of the amino acid sequences set forth in SEQ ID NOs: 182, 183, 184, 185, and 186, wherein LCDR2 comprises the amino acid sequence LVS; (x) each of the amino acid sequences set forth in SEQ ID NOs: 187, 188, 189, 100, and 190, wherein LCDR2 comprises the amino acid sequence ANI; (y) each of the amino acid sequences set forth in SEQ ID NOs: 191, 192, 193, 185, and 194, wherein LCDR2 comprises the amino acid sequence QVS; (z) each of the amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 198, wherein LCDR2 comprises the amino acid sequence KDT; (aa) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 199, wherein LCDR2 comprises the amino acid sequence KDT; (bb) each comprising the amino acid sequence set forth in SEQ ID NOs: 195, 196, 197, 200, and 201, wherein LCDR2 comprises the amino acid sequence RDT; (cc) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 200, and 202, wherein LCDR2 comprises the amino acid sequence KDT; (dd) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 190, wherein LCDR2 comprises the amino acid sequence KDT; (ee) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 203, and 204, wherein LCDR2 comprises the amino acid sequence RDT; (ff) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 205, wherein LCDR2 comprises the amino acid sequence KDT; (gg) comprising the respective amino acid sequences set forth in SEQ ID NOs: 206, 207, 208, 209, and 210, wherein LCDR2 comprises the amino acid sequence SVS; (hh) comprising the amino acid sequence set forth in SEQ ID NOs: 211, 112, 113, 114, and 115, respectively, wherein LCDR2 comprises the amino acid sequence GSS; (ii) each comprising the amino acid sequence set forth in SEQ ID NOs: 168, 117, 212, 213, and 214, wherein LCDR2 comprises the amino acid sequence KDT; (jj) comprising each of the amino acid sequences set forth in SEQ ID NOs: 121, 215, 216, 166, and 217, wherein LCDR2 comprises the amino acid sequence SDG; (kk) comprising the respective amino acid sequences set forth in SEQ ID NOs: 218, 219, 220, 221, and 222, wherein LCDR2 comprises the amino acid sequence RDT; (ll) comprising the respective amino acid sequences set forth in SEQ ID NOs: 223, 224, 225, 213, and 226, wherein LCDR2 comprises the amino acid sequence KDT; (mm) comprising the respective amino acid sequences set forth in SEQ ID NOs: 121, 227, 228, 229, and 230, wherein LCDR2 comprises the amino acid sequence SDG; (nn) comprising the respective amino acid sequences set forth in SEQ ID NOs: 231, 232, 233, 234, and 235, wherein LCDR2 comprises the amino acid sequence NND; (oo) comprising the amino acid sequence set forth in SEQ ID NOs: 236, 237, 238, 171, and 239, respectively, wherein LCDR2 comprises the amino acid sequence KDT; (pp) comprising the respective amino acid sequences set forth in SEQ ID NOs: 240, 143, 241, 242, and 243, wherein LCDR2 comprises the amino acid sequence SNK; or (qq) The CAR of claim 50, comprising each of the amino acid sequences set forth in SEQ ID NOs: 244, 138, 245, 246, and 247, wherein LCDR2 comprises the amino acid sequence EAS.
52. (a) an antigen-binding domain comprising a heavy chain variable region comprising any of the amino acid sequences set forth in SEQ ID NOs: 314-356; and a light chain variable region comprising any of the amino acid sequences set forth in SEQ ID NOs: 271-313; (b) a transmembrane domain; and (c) KIR2DS2 intracellular signaling domain A chimeric antigen receptor (CAR) comprising:
53. the antigen-binding domain (a) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 314, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 271; (b) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 315, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 272; (c) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 316, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 273; (d) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 317, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 274; (e) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 318, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 275; (f) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 319, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 276; (g) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 320, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 277; (h) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 321, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 278; (i) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 322, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 279; (j) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 323, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 280; (k) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 324, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 281; (l) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 325, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 282; (m) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 326, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 283; (n) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 327, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 284; (o) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 328, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 285; (p) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 329, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 286; (q) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 330, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 287; (r) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 331, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 288; (s) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 332, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 289; (t) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 333, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 290; (u) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 334, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 291; (v) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 335, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 292; (w) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 336, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 293; (x) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 337, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 294; (y) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 338, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 295; (z) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 339, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 296; (aa) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 340, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 297; (bb) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 341, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 298; (cc) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 342, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 299; (dd) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 343, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 300; (ee) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 344, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 301; (ff) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 345, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 302; (gg) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 346, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 303; (hh) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 347, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 304; (ii) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 348, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 305; (jj) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 349, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 306; (kk) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 350, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 307; (ll) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 351, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 308; (mm) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 352, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 309; (nn) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 353, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 310; (oo) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 354, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 311; (pp) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 355, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 312; or (qq) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 356, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:
313. The CAR of claim 52, comprising:
54. (a) the CD8 leader amino acid sequence set forth in SEQ ID NO: 357; (b) scFv amino acid sequences shown in SEQ ID NOs: 44-86; (c) the myc tag amino acid sequence set forth in SEQ ID NO: 264; and (d) the transmembrane / KIR2DS2 signaling domain amino acid sequence set forth in SEQ ID NO: 266 A chimeric antigen receptor (CAR) comprising:
55. The CAR according to any one of claims 50 to 54, comprising an amino acid sequence shown in SEQ ID NOs: 370 to 412.
56. An isolated nucleic acid encoding the antibody or antigen-binding fragment thereof of any one of claims 1 to 9, or the scFv of any one of claims 10 to 14.
57. An isolated nucleic acid encoding the CAR according to any one of claims 15 to 32 and 50 to 55, or the NKR-CAR according to any one of claims 35 to 46.
58. An isolated nucleic acid encoding an antibody or antigen-binding fragment thereof, wherein the nucleic acid antibody or antigen-binding fragment thereof comprises a nucleic acid having at least 80%, 85%, 90%, 95%, 96%, 96%, 97%, 98%, 99% identity to a polynucleotide sequence set forth in SEQ ID NOs: 1-43.
59. An isolated nucleic acid encoding an antibody or antigen-binding fragment thereof, wherein said nucleic acid antibody or antigen-binding fragment thereof comprises a polynucleotide sequence set forth in SEQ ID NOs: 1-43.
60. 60. The isolated nucleic acid of claim 58 or 59, wherein the antibody or antigen-binding fragment thereof is selected from the group consisting of a full-length antibody, a single-chain variable fragment (scFv), sc(Fv)2, dsFv, Fab, Fab', (Fab')2, and a diabody.
61. An isolated nucleic acid encoding a single chain variable fragment (scFv) comprising the polynucleotide sequence set forth in SEQ ID NOs: 1-43.
62. The isolated nucleic acid of any one of claims 56 to 61, wherein the antibody or antigen-binding fragment thereof, or the scFv, or the antigen-binding domain of the CAR or NKR-CAR specifically binds to human CD19.
63. 1. An isolated nucleic acid encoding a chimeric antigen receptor (CAR) comprising an antigen-binding domain, a transmembrane domain, and an intracellular signaling domain, wherein the antigen-binding domain comprises: (a) a heavy chain variable region comprising a nucleic acid encoding any of the amino acid sequences set forth in SEQ ID NOs: 314-356; and (b) a light chain variable region comprising a nucleic acid encoding any of the amino acid sequences set forth in SEQ ID NOs: 271 to 313; An isolated nucleic acid comprising:
64. the antigen-binding domain (a) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 314, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 271; (b) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 315, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 272; (c) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 316, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 273; (d) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 317, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 274; (e) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 318, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 275; (f) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 319, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 276; (g) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 320, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 277; (h) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 321, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 278; (i) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 322, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 279; (j) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 323, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 280; (k) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 324, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 281; (l) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 325, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 282; (m) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 326, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 283; (n) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 327, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 284; (o) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 328, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 285; (p) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 329, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 286; (q) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 330, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 287; (r) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 331, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 288; (s) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 332, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 289; (t) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 333, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 290; (u) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 334, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 291; (v) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 335, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 292; (w) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 336, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 293; (x) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 337, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 294; (y) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 338, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 295; (z) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 339, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 296; (aa) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 340, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 297; (bb) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 341, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 298; (cc) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 342, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 299; (dd) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 343, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 300; (ee) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 344, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 301; (ff) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 345, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 302; (gg) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 346, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 303; (hh) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 347, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 304; (ii) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 348, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 305; (jj) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 349, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 306; (kk) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 350, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 307; (ll) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 351, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 308; (mm) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 352, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 309; (nn) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 353, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 310; (oo) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 354, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 311; (pp) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 355, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 312; or (qq) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 356, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:
313.
64. The isolated nucleic acid of claim 63, comprising:
65. An isolated nucleic acid encoding a chimeric antigen receptor (CAR) comprising an antigen-binding domain, a transmembrane domain, and an intracellular signaling domain, wherein the antigen-binding domain is encoded by any one of the polynucleotide sequences set forth in SEQ ID NOs: 1 to 43.
66. 66. The isolated nucleic acid of any one of claims 63 to 65, wherein the intracellular signaling domain comprises an intracellular domain that includes one or more cytoplasmic signaling domains of a human NK cell KIR receptor.
67. 67. The isolated nucleic acid of claim 66, wherein the KIR signaling domain comprises a KIR2DS2 signaling domain.
68. 68. The isolated nucleic acid of claim 67, wherein the KIR signaling domain is encoded by a polynucleotide sequence comprising the sequence set forth in SEQ ID NO:
265.
69. A vector comprising the isolated nucleic acid of any one of claims 56 to 68.
70. 70. The vector of claim 69, which is an expression vector.
71. 71. The vector of claim 69 or 70, which is selected from the group consisting of a DNA vector, an RNA vector, a plasmid, a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, and a retroviral vector.
72. A host cell comprising the isolated nucleic acid of any one of claims 56 to 68 or the vector of any one of claims 69 to 71.
73. 73. The host cell of claim 72, which is of eukaryotic or prokaryotic origin.
74. 73. The host cell of claim 72, which is derived from a mammal.
75. 73. The host cell of claim 72, which is of bacterial origin.
76. 73. The host cell of claim 72, which is a Chinese hamster ovary cell.
77. 1. An engineered immune cell or a precursor thereof comprising a chimeric antigen receptor (CAR) comprising an antigen-binding domain, a transmembrane domain, and an intracellular domain, wherein the antigen-binding domain comprises: (a) a heavy chain variable region comprising three heavy chain complementarity determining regions (HCDR1, HCDR2, and HCDR3), wherein HCDR1 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 87, 92, 97, 102, 106, 111, 116, 121, 126, 130, 134, 137, 142, 145, 150, 155, 163, 168, 173, 177, 182, 187, 191, 195, 206, 211, 218, 223, 231, 236, 240, and 244; and HCDR2 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 88, 93, 98, 103, 107, 112, 117, 122, 131, 135, 138, 143, 146, 150, 155, 163, 168, 173, 177, 182, 187, 191, 195, 206, 211, 218, 223, 231, 236, 240, and 244; a heavy chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 51, 156, 160, 164, 169, 174, 178, 183, 188, 192, 196, 207, 215, 219, 224, 227, 232, and 237; and HCDR3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 89, 94, 99, 104, 108, 113, 118, 123, 127, 132, 136, 139, 144, 147, 152, 157, 161, 170, 175, 179, 184, 189, 193, 197, 208, 212, 216, 220, 225, 228, 233, 238, 241, and 245; and (b) a light chain variable region comprising three light chain complementarity determining regions (LCDR1, LCDR2, and LCDR3), wherein LCDR1 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 90, 95, 100, 109, 114, 119, 124, 128, 140, 148, 153, 158, 166, 171, 180, 185, 200, 203, 209, 213, 221, 229, 234, 242, and 246; and LCDR2 comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: ADS, AND, ANI, EAS, GNS, GNT, GSH, GSS, GYN, KDT, LVS, NND, a light chain variable region comprising an amino acid sequence selected from the group consisting of QVS, RDT, SDG, SNK, SSS, and SVS; and an LCDR3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 91, 96, 101, 105, 110, 115, 120, 125, 129, 133, 141, 149, 154, 159, 162, 165, 167, 172, 176, 181, 186, 190, 194, 198, 199, 201, 202, 204, 205, 210, 214, 217, 222, 226, 230, 235, 239, 243, and 247.
1. A modified immune cell or a precursor thereof, comprising:
78. HCDR1, HCDR2, HCDR3, LCDR1, and LCDR3 are (a) each comprising the amino acid sequence set forth in SEQ ID NOs: 87, 88, 89, 90, and 91, wherein LCDR2 comprises the amino acid sequence GNS; (b) each comprising the amino acid sequence set forth in SEQ ID NOs: 92, 93, 94, 95, and 96, wherein LCDR2 comprises the amino acid sequence AND; (c) each of the amino acid sequences set forth in SEQ ID NOs: 97, 98, 99, 100, and 101, wherein LCDR2 comprises the amino acid sequence ANI; (d) each comprising the amino acid sequence set forth in SEQ ID NOs: 102, 103, 104, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; (e) each of the amino acid sequences set forth in SEQ ID NOs: 106, 107, 108, 109, and 110, wherein LCDR2 comprises the amino acid sequence SDG; (f) each of the amino acid sequences set forth in SEQ ID NOs: 111, 112, 113, 114, and 115, wherein LCDR2 comprises the amino acid sequence GSS; (g) each of the amino acid sequences set forth in SEQ ID NOs: 116, 117, 118, 119, and 120, wherein LCDR2 comprises the amino acid sequence GNT; (h) each of the amino acid sequences set forth in SEQ ID NOs: 121, 122, 123, 124, and 125, wherein LCDR2 comprises the amino acid sequence GYN; (i) each comprising the amino acid sequence set forth in SEQ ID NOs: 126, 117, 127, 128, and 129, wherein LCDR2 comprises the amino acid sequence GNS; (j) each of the amino acid sequences set forth in SEQ ID NOs: 130, 131, 132, 100, and 133, wherein LCDR2 comprises the amino acid sequence ANI; (k) each of the amino acid sequences set forth in SEQ ID NOs: 134, 135, 136, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; (l) each of the amino acid sequences set forth in SEQ ID NOs: 137, 138, 139, 140, and 141, wherein LCDR2 comprises the amino acid sequence ADS; (m) each comprising the amino acid sequence set forth in SEQ ID NOs: 142, 143, 144, 100, and 105, wherein LCDR2 comprises the amino acid sequence ANI; (n) each of the amino acid sequences set forth in SEQ ID NOs: 145, 146, 147, 148, and 149, wherein LCDR2 comprises the amino acid sequence GNS; (o) each comprising the amino acid sequence set forth in SEQ ID NOs: 150, 151, 152, 153, and 154, wherein LCDR2 comprises the amino acid sequence GNS; (p) each of the amino acid sequences set forth in SEQ ID NOs: 155, 156, 157, 158, and 159, wherein LCDR2 comprises the amino acid sequence GSH; (q) each comprising the amino acid sequence set forth in SEQ ID NOs: 121, 160, 161, 128, and 162, wherein LCDR2 comprises the amino acid sequence GNS; (r) comprising the respective amino acid sequences set forth in SEQ ID NOs: 163, 164, 123, 124, and 165, wherein LCDR2 comprises the amino acid sequence GYN; (s) each comprising the amino acid sequence set forth in SEQ ID NOs: 106, 107, 108, 166, and 167, wherein LCDR2 comprises the amino acid sequence SDG; (t) each of the amino acid sequences set forth in SEQ ID NOs: 168, 169, 170, 171, and 172, wherein LCDR2 comprises the amino acid sequence KDT; (u) each comprising the amino acid sequence set forth in SEQ ID NOs: 173, 174, 175, 171, and 176, wherein LCDR2 comprises the amino acid sequence KDT; (v) each of the amino acid sequences set forth in SEQ ID NOs: 177, 178, 179, 180, and 181, wherein LCDR2 comprises the amino acid sequence SSS; (w) each of the amino acid sequences set forth in SEQ ID NOs: 182, 183, 184, 185, and 186, wherein LCDR2 comprises the amino acid sequence LVS; (x) each of the amino acid sequences set forth in SEQ ID NOs: 187, 188, 189, 100, and 190, wherein LCDR2 comprises the amino acid sequence ANI; (y) each of the amino acid sequences set forth in SEQ ID NOs: 191, 192, 193, 185, and 194, wherein LCDR2 comprises the amino acid sequence QVS; (z) each of the amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 198, wherein LCDR2 comprises the amino acid sequence KDT; (aa) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 199, wherein LCDR2 comprises the amino acid sequence KDT; (bb) each comprising the amino acid sequence set forth in SEQ ID NOs: 195, 196, 197, 200, and 201, wherein LCDR2 comprises the amino acid sequence RDT; (cc) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 200, and 202, wherein LCDR2 comprises the amino acid sequence KDT; (dd) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 190, wherein LCDR2 comprises the amino acid sequence KDT; (ee) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 203, and 204, wherein LCDR2 comprises the amino acid sequence RDT; (ff) comprising the respective amino acid sequences set forth in SEQ ID NOs: 195, 196, 197, 171, and 205, wherein LCDR2 comprises the amino acid sequence KDT; (gg) comprising the respective amino acid sequences set forth in SEQ ID NOs: 206, 207, 208, 209, and 210, wherein LCDR2 comprises the amino acid sequence SVS; (hh) comprising the amino acid sequence set forth in SEQ ID NOs: 211, 112, 113, 114, and 115, respectively, wherein LCDR2 comprises the amino acid sequence GSS; (ii) each comprising the amino acid sequence set forth in SEQ ID NOs: 168, 117, 212, 213, and 214, wherein LCDR2 comprises the amino acid sequence KDT; (jj) comprising each of the amino acid sequences set forth in SEQ ID NOs: 121, 215, 216, 166, and 217, wherein LCDR2 comprises the amino acid sequence SDG; (kk) comprising the respective amino acid sequences set forth in SEQ ID NOs: 218, 219, 220, 221, and 222, wherein LCDR2 comprises the amino acid sequence RDT; (ll) comprising the respective amino acid sequences set forth in SEQ ID NOs: 223, 224, 225, 213, and 226, wherein LCDR2 comprises the amino acid sequence KDT; (mm) comprising the respective amino acid sequences set forth in SEQ ID NOs: 121, 227, 228, 229, and 230, wherein LCDR2 comprises the amino acid sequence SDG; (nn) comprising the respective amino acid sequences set forth in SEQ ID NOs: 231, 232, 233, 234, and 235, wherein LCDR2 comprises the amino acid sequence NND; (oo) comprising the amino acid sequence set forth in SEQ ID NOs: 236, 237, 238, 171, and 239, respectively, wherein LCDR2 comprises the amino acid sequence KDT; (pp) comprising the respective amino acid sequences set forth in SEQ ID NOs: 240, 143, 241, 242, and 243, wherein LCDR2 comprises the amino acid sequence SNK; or (qq) The modified immune cell of claim 77, comprising each of the amino acid sequences set forth in SEQ ID NOs: 244, 138, 245, 246, and 247, wherein LCDR2 comprises the amino acid sequence EAS.
79. 78. The modified immune cell of claim 77, wherein the CAR binds to human CD19.
80. 78. The modified immune cell of claim 77, wherein the CAR comprises an antigen-binding domain selected from the group consisting of an antibody, a scFv, and a Fab.
81. 78. The modified immune cell of claim 77, wherein the CAR comprises an intracellular domain comprising the cytoplasmic signaling domain of a human NK cell KIR receptor.
82. 82. The modified immune cell of claim 81 , wherein the KIR signaling domain comprises a KIR2DS2 signaling domain.
83. 78. The modified immune cell of claim 77, wherein the modified cell is an autologous cell.
84. 78. The modified immune cell of claim 77, wherein the modified cell is an allogeneic cell.
85. 78. The modified immune cell of claim 77, wherein the modified cell is a cell isolated from a human subject.
86. 78. The modified immune cell of claim 77, wherein the modified cell is a modified T cell.
87. 10. A pharmaceutical composition comprising: (a) an antibody or antigen-binding fragment thereof according to any one of claims 1 to 9, an scFv according to any one of claims 10 to 14, a CAR according to any one of claims 15 to 34 and 50 to 55, an NKR-CAR complex according to any one of claims 35 to 37, an NKR-CAR according to any one of claims 38 to 49, an isolated nucleic acid according to any one of claims 56 to 68, a vector according to any one of claims 69 to 71, or a modified immune cell according to any one of claims 77 to 86; and (b) a pharmaceutically acceptable excipient, carrier, or diluent.
88. 1. A method for producing an engineered immune cell or a progenitor cell thereof, the method comprising introducing into said immune cell or progenitor cell an isolated nucleic acid encoding the chimeric antigen receptor (CAR) of any one of claims 15 to 34 and 50 to 55, the NKR-CAR complex of any one of claims 35 to 37, or the NKR-CAR of any one of claims 38 to 49.
89. 89. The method of claim 88, wherein the modified immune cell is a T cell.
90. 90. A method of treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of the engineered immune cell of claims 77-86, or the engineered immune cell made by the method of any one of claims 88-89.
91. 91. The method of claim 90, wherein the cancer is a hematological cancer.
92. 91. The method of claim 90, wherein the cancer is associated with expression of CD19.
93. 93. The method of claim 92, wherein the CD19 is expressed on a tumor cell.
94. 91. The method of claim 90, wherein the cancer is selected from the group consisting of Burkitt's lymphoma, chronic lymphocytic leukemia (CLL), acute lymphocytic leukemia (ALL), B-cell lymphoma, and B-cell leukemia.
95. 91. The method of claim 90, wherein the subject is a human.
96. 90. A method of treating an autoimmune disorder or disease in a subject in need thereof, comprising administering to the subject an effective amount of the engineered immune cell of claims 77-86, or the engineered immune cell made by the method of any one of claims 88-89, thereby treating the autoimmune disorder.
97. 97. The method of claim 96, wherein the autoimmune disorder is antibody-mediated.
98. 97. The method of claim 96, wherein administration of said modified immune cells depletes autoimmune B cells.
99. 97. The method of claim 96, wherein the autoimmune disorder is selected from the group consisting of rheumatoid arthritis, systemic lupus erythematosus (SLE), lupus nephritis (LN), idiopathic / autoimmune thrombocytopenic purpura (ITP), idiopathic thrombotic thrombocytopenic purpura (TTP), pemphigus-related disorders, diabetes, scleroderma, myasthenia gravis, multiple sclerosis, vasculitis, and autoimmune hemolytic anemia.
100. 90. A method of treating an alloantibody-mediated disorder or disease in a subject in need thereof, comprising administering to the subject an effective amount of the modified immune cells of claims 77-86, or modified immune cells made by the method of any one of claims 88-89, thereby treating the alloantibody-mediated disorder or disease.
101. 101. The method of Claim 100, wherein administration of the modified immune cells depletes alloantibody-producing B cells.
102. The method of claim 100, wherein the alloantibody-mediated disorder is selected from the group consisting of solid organ transplant immunoincompatibility, acute or delayed hemolytic reaction associated with enzyme replacement therapy or transfusion, and chronic alloantibody-mediated rejection (CAMR), organ transplant immunoincompatibility hemophilia (hemophilia A or B), lysosomal storage disease (LSD), urea cycle disorder, adenosine deaminase deficiency, neuronal lipid storage disease (NCL), hyperammonemia, and chronic graft-versus-host disease (cGvHD).
103. 103. The method of claim 102, wherein the lysosomal storage disease is selected from the group consisting of glycogen storage disease, Gaucher disease, Niemann-Pick disease, Fabry disease, and mucopolysaccharidosis (MPS) I, MPS II, and MPS VI.
Citation Information
Patent Citations
Use of chimeric antigen receptor modified T cells to treat cancer
JP2014507118A
Targeting cytotoxic cells with chimeric receptors for adoptive immunotherapy
JP2017534261A
BCMA-targeting chimeric antigen receptors, CD19-targeting chimeric antigen receptors, and combination therapies
JP2021502979A
Chimeric antigen receptor t lymphocyte for treating tumors, preparation method therefor, and use thereof
US20210401890A1
Canine monoclonal antibodies against canine cytotoxic t lymphocyte associated protein 4 (CTLA-4)
WO2022226102A1