DNA compositions containing modified uracil

Abstract

The present disclosure provides, for example, double-stranded DNA (dsDNA) molecules comprising chemically modified uridine nucleotides. In some embodiments, the dsDNA molecules comprise a therapeutic payload sequence. In some embodiments, the dsDNA molecules are resistant to endonuclease digestion and / or immune sensor recognition and support expression of the therapeutic payload encoded in the dsDNA molecule. The present disclosure also provides pharmaceutical compositions comprising, for example, dsDNA molecules comprising chemically modified uridine nucleotides.

Description

[Technical Field]

[0001] Related Applications This application claims priority to U.S. Patent Application No. 63 / 485,793, filed February 17, 2023, U.S. Patent Application No. 63 / 587,561, filed October 3, 2023, and U.S. Patent Application No. 63 / 594,802, filed October 31, 2023, the entire contents of each of which are incorporated herein by reference.

[0002] Sequence Listing This application has been submitted electronically in XML format and contains a Sequence Listing, which is incorporated herein by reference in its entirety. The XML copy, created on February 6, 2024, is named F2128-7008WO_SL.xml and is 100,759 bytes in size. [Background technology]

[0003] Novel treatment modalities are needed to address unmet medical needs. Summary of the Invention [Means for solving the problem]

[0004] Described herein are pharmaceutical DNA compositions, constructs, preparations that include chemically modified nucleotides, methods of using and making such compositions, constructs and preparations.

[0005] Enumerated Embodiments 1. A double-stranded DNA (dsDNA) molecule containing a chemically modified uridine nucleotide having a substitution other than a hydrogen or methyl group at carbon 5 of uridine. 2. The chemically modified uridine nucleotide has the formula I: [ka] (Wherein R1 is -(CH2) mOH (where m = 1 to 10), -halogen, -(CH2) n -CHO (where n = 0 to 10), -(CH2) p COOH (wherein p=0-10), -aminoallyl, -S-(C1-C6)alkyl, and -propargylamino. 2. The dsDNA molecule of embodiment 1, comprising the structure: 3. A promoter sequence and a therapeutic payload sequence operably linked to the promoter sequence; Formula I: [ka] (Wherein R1 is -(CH2) m OH (where m = 1 to 10), -halogen, -(CH2) n -CHO (where n = 0 to 10), -(CH2) p COOH (wherein p=0-10), -aminoallyl, -S-(C1-C6)alkyl, and -propargylamino. and a chemically modified uridine nucleotide located in the therapeutic payload sequence, comprising the structure: A double-stranded DNA (dsDNA) molecule containing 4. R1 is -(CH2) m OH (where m=1 to 6), -halogen, -(CH2) n -CHO (where n = 0 to 6), -(CH2) p 4. The dsDNA molecule of embodiment 2 or 3, wherein the alkyl group is selected from the group consisting of COOH (wherein p=0-6), -aminoallyl, -S-(C1-C3)alkyl, and -propargylamino. 5. The dsDNA molecule of any of embodiments 2-4, wherein R1 is selected from the group consisting of -(CH2)OH, -I, -Br, -CHO, -COOH, -aminoallyl, -S-methyl, and -propargylamino. 6. The dsDNA molecule of any of embodiments 1-5, wherein the chemically modified uridine nucleotide comprises 5-hydroxymethyluridine, 5-aminoallyluridine, 5-bromouridine, 5-iodouridine, 5-propargylaminouridine, 5-formyluridine, 5-carboxyuridine, or 5-methylthiouridine. 7. The dsDNA molecule of any of embodiments 1-6, wherein the chemically modified uridine nucleotide comprises 5-hydroxymethyluridine. 8. A double-stranded DNA (dsDNA) molecule comprising a chemically modified uridine nucleotide, wherein the chemically modified uridine nucleotide comprises 5-hydroxymethyluridine. 9. The dsDNA molecule of any of embodiments 1-6, wherein the chemically modified uridine nucleotide comprises 5-aminoallyl uridine. 10. A double-stranded DNA (dsDNA) molecule comprising a chemically modified uridine nucleotide, wherein the chemically modified uridine nucleotide comprises 5-aminoallyl uridine. 11. The dsDNA molecule of any of embodiments 1-6, wherein the chemically modified uridine nucleotide comprises 5-bromouridine. 12. A double-stranded DNA (dsDNA) molecule comprising a chemically modified uridine nucleotide, wherein the chemically modified uridine nucleotide comprises 5-bromouridine. 13. The dsDNA molecule of any of embodiments 1-6, wherein the chemically modified uridine nucleotide comprises 5-iodouridine. 14. A double-stranded DNA (dsDNA) molecule comprising a chemically modified uridine nucleotide, wherein the chemically modified uridine nucleotide comprises 5-iodouridine. 15. The dsDNA molecule of any of embodiments 1-6, wherein the chemically modified uridine nucleotide comprises 5-propargylaminouridine. 16. A double-stranded DNA (dsDNA) molecule comprising a chemically modified uridine nucleotide, wherein the chemically modified uridine nucleotide comprises 5-propargylaminouridine. 17. The dsDNA molecule of any of embodiments 1-6, wherein the chemically modified uridine nucleotide comprises 5-formyluridine. 18. A double-stranded DNA (dsDNA) molecule comprising a chemically modified uridine nucleotide, wherein the chemically modified uridine nucleotide comprises 5-formyluridine. 19. The dsDNA molecule of any of embodiments 1-6, wherein the chemically modified uridine nucleotide comprises 5-carboxyuridine. 20. A double-stranded DNA (dsDNA) molecule comprising a chemically modified uridine nucleotide, wherein the chemically modified uridine nucleotide comprises 5-carboxyuridine. 21. The dsDNA molecule of any of embodiments 1-6, wherein the chemically modified uridine nucleotide comprises 5-methylthiouridine. 22. A double-stranded DNA (dsDNA) molecule comprising a chemically modified uridine nucleotide, wherein the chemically modified uridine nucleotide comprises 5-methylthiouridine. 23. A promoter sequence and a therapeutic payload sequence operably linked to the promoter sequence; a chemically modified uridine nucleotide that is 5-formyluridine located in the therapeutic payload sequence; A double-stranded DNA (dsDNA) molecule comprising: 24. The dsDNA molecule of any of embodiments 1-23, which is circular or linear. 25. The dsDNA molecule of any of embodiments 1-24, which is linear. 26. The dsDNA molecule of embodiment 25, which is closed-end linear. 27. A double-stranded DNA (dsDNA) molecule comprising a chemically modified uridine nucleotide selected from 5-hydroxymethyluridine, 5-propargylaminouridine, 5-carboxyuridine, 5-methylthiouridine, or 5-formyluridine, wherein the double-stranded DNA (dsDNA) molecule is a closed-end linear DNA. 28. The dsDNA molecule of any of the preceding embodiments, wherein at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, or at least 75% of the uridine and thymidine positions in the dsDNA molecule comprise chemically modified uridine nucleotides. 29. The dsDNA molecule of any of the preceding embodiments, wherein between 1% and 75% (e.g., between 1 and 5%, 5 and 10%, 10 and 15%, 15 and 20%, 20 and 25%, 25 and 30%, 30 and 35%, 35 and 40%, 40 and 45%, 45 and 50%, 50 and 55%, 55 and 60%, 60 and 65%, 65 and 70%, or 70 and 75%) of the uridine and thymidine positions in the dsDNA molecule comprise chemically modified uridine nucleotides. 30. The dsDNA molecule of any of embodiments 1-29, wherein at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, at least 75%, or at least 90% of the uridine and thymidine positions in the dsDNA molecule comprise chemically modified uridine nucleotides. 31. A double-stranded DNA (dsDNA) molecule comprising chemically modified uridine nucleotides, wherein at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, at least 75%, or at least 90% of the uridine and thymidine positions in the dsDNA molecule comprise chemically modified uridine nucleotides. 32. The dsDNA molecule of any of embodiments 1-31, wherein between 1% and 100% (e.g., 1-5%, 5-10%, 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, 45-50%, 50%-55%, 55-60%, 60-65%, 65-70%, 70-75%, 75-80%, 80-85%, 85-90%, 90-95%, or 95%-100%) of the uridine and thymidine positions in the dsDNA molecule comprise chemically modified uridine nucleotides. 33. A double-stranded DNA (dsDNA) molecule containing chemically modified uridine nucleotides, wherein 1% to 100% (e.g., 1 to 5%, 5 to 10%, 10 to 15%, 15 to 20%, 20 to 25%, 25 to 30%, 30 to 35%, 35 to 40%, 40 to 45%, 45 to 50%, 50% to 55%, 55 to 60%, 60 to 65%, 65 to 70%, 70 to 75%, 75 to 80%, 80 to 85%, 85 to 90%, 90 to 95%, or 95 to 100%) of the uridine and thymidine positions in the dsDNA molecule contain chemically modified uridine nucleotides. 34. The dsDNA molecule of any of embodiments 1-8 or 24-33, wherein 1% to 100% (e.g., 1-5%, 5-10%, 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, 45-50%, 50%-55%, 55-60%, 60-65%, 65-70%, 70-75%, 75-80%, 80-85%, 85-90%, 90-95%, or 95-100%) of the uridine and thymidine positions in the dsDNA molecule comprise chemically modified uridine nucleotides, and the chemically modified uridine nucleotides comprise 5-hydroxymethyluridine. 35. The dsDNA molecule of any of embodiments 1-8 or 24-33, wherein at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, at least 75%, or at least 90% of the uridine and thymidine positions in the dsDNA molecule comprise chemically modified uridine nucleotides, wherein the chemically modified uridine nucleotides comprise 5-hydroxymethyluridine. 36. The dsDNA molecule of any of embodiments 1-6, 9, 10, 24-26, or 28-33, wherein 1% to 100% (e.g., 1-5%, 5-10%, 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, 45-50%, 50-55%, 55-60%, 60-65%, 65-70%, 70-75%, 75-80%, 80-85%, 85-90%, 90-95%, or 95-100%) of the uridine and thymidine positions in the dsDNA molecule comprise chemically modified uridine nucleotides, and the chemically modified uridine nucleotides comprise 5-aminoallyl uridine. 37. The dsDNA molecule of any of embodiments 1-6, 9, 10, 24-26, or 28-33, wherein at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, at least 75%, or at least 90% of the uridine and thymidine positions in the dsDNA molecule comprise chemically modified uridine nucleotides, wherein the chemically modified uridine nucleotides comprise 5-aminoallyl uridine. 38. The dsDNA molecule of any of embodiments 1-6, 11, 12, 24-26, or 28-33, wherein 1% to 100% (e.g., 1-5%, 5-10%, 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, 45-50%, 50%-55%, 55-60%, 60-65%, 65-70%, 70-75%, 75-80%, 80-85%, 85-90%, 90-95%, or 95-100%) of the uridine and thymidine positions in the dsDNA molecule comprise chemically modified uridine nucleotides, and the chemically modified uridine nucleotides comprise 5-bromouridine. 39. The dsDNA molecule of any of embodiments 1-6, 9, 10, 24-26, or 28-33, wherein at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, at least 75%, or at least 90% of the uridine and thymidine positions in the dsDNA molecule comprise chemically modified uridine nucleotides, and the chemically modified uridine nucleotides comprise 5-bromouridine. 40. The dsDNA molecule of any of embodiments 1-6, 13, 14, 24-26, or 28-33, wherein 1% to 100% (e.g., 1-5%, 5-10%, 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, 45-50%, 50-55%, 55-60%, 60-65%, 65-70%, 70-75%, 75-80%, 80-85%, 85-90%, 90-95%, or 95-100%) of the uridine and thymidine positions in the dsDNA molecule comprise chemically modified uridine nucleotides, and the chemically modified uridine nucleotides comprise 5-iodouridine. 41. The dsDNA molecule of any of embodiments 1-6, 13, 14, 24-26, or 28-33, wherein at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, at least 75%, or at least 90% of the uridine and thymidine positions in the dsDNA molecule comprise chemically modified uridine nucleotides, and the chemically modified uridine nucleotides comprise 5-iodouridine. 42. The dsDNA molecule of any of embodiments 1-6, 15, 16, or 24-33, wherein 1% to 100% (e.g., 1-5%, 5-10%, 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, 45-50%, 50%-55%, 55-60%, 60-65%, 65-70%, 70-75%, 75-80%, 80-85%, 85-90%, 90-95%, or 95-100%) of the uridine and thymidine positions in the dsDNA molecule comprise chemically modified uridine nucleotides, and the chemically modified uridine nucleotides comprise 5-propargylaminouridine. 43. The dsDNA molecule of any of embodiments 1-6, 15, 16, or 24-33, wherein at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, at least 75%, or at least 90% of the uridine and thymidine positions in the dsDNA molecule comprise chemically modified uridine nucleotides, wherein the chemically modified uridine nucleotides comprise 5-propargylaminouridine. 44. The dsDNA molecule of any of embodiments 1-6, 17, 18, or 23-33, wherein 1% to 100% (e.g., 1-5%, 5-10%, 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, 45-50%, 50%-55%, 55-60%, 60-65%, 65-70%, 70-75%, 75-80%, 80-85%, 85-90%, 90-95%, or 95-100%) of the uridine and thymidine positions in the dsDNA molecule comprise chemically modified uridine nucleotides, and the chemically modified uridine nucleotides comprise 5-formyluridine. 45. The dsDNA molecule of any of embodiments 1-6, 17, 18, or 23-33, wherein at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, at least 75%, or at least 90% of the uridine and thymidine positions in the dsDNA molecule comprise chemically modified uridine nucleotides, wherein the chemically modified uridine nucleotides comprise 5-formyluridine. 46. ​​The dsDNA molecule of any of embodiments 1-6, 19, 20, or 24-33, wherein 1% to 100% (e.g., 1-5%, 5-10%, 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, 45-50%, 50%-55%, 55-60%, 60-65%, 65-70%, 70-75%, 75-80%, 80-85%, 85-90%, 90-95%, or 95-100%) of the uridine and thymidine positions in the dsDNA molecule comprise chemically modified uridine nucleotides, and the chemically modified uridine nucleotides comprise 5-carboxyuridine. 47. The dsDNA molecule of any of embodiments 1-6, 19, 20, or 24-33, wherein at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, at least 75%, or at least 90% of the uridine and thymidine positions in the dsDNA molecule comprise chemically modified uridine nucleotides, wherein the chemically modified uridine nucleotides comprise 5-carboxyuridine. 48. The dsDNA molecule of any of the preceding embodiments, comprising a contiguous region of 200 nucleotides, wherein at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, at least 75%, or at least 90% of the uridine and thymidine positions in the contiguous region comprise chemically modified uridine nucleotides. 49. The dsDNA molecule of any of the preceding embodiments, comprising a contiguous region of 500 nucleotides, wherein at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, at least 75%, or at least 90% of the uridine and thymidine positions in the contiguous region comprise chemically modified uridine nucleotides. 50. The dsDNA molecule of any of the preceding embodiments, comprising a contiguous region of 1000 nucleotides, wherein at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, at least 75%, or at least 90% of the uridine and thymidine positions in the contiguous region comprise chemically modified uridine nucleotides. 51. The dsDNA molecule of any of the preceding embodiments, wherein 1% to 100% (e.g., 1-5%, 5-10%, 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, 45-50%, 50%-55%, 55-60%, 60-65%, 65-70%, 70-75%, 75-80%, 80-85%, 85-90%, 90-95%, or 95-100%) of the uridine and thymidine positions in the contiguous region comprise chemically modified uridine nucleotides. 52. The dsDNA molecule of any of the preceding embodiments, wherein between 1% and 100% (e.g., 1-5%, 5-10%, 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, 45-50%, 50%-55%, 55-60%, 60-65%, 65-70%, 70-75%, 75-80%, 80-85%, 85-90%, 90-95%, or 95-100%) of the uridine and thymidine positions in the contiguous region comprise chemically modified uridine nucleotides. 53. The dsDNA molecule of any of the preceding embodiments, comprising a 1000 nucleotide contiguous region in which 1% to 100% (e.g., 1-5%, 5-10%, 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, 45-50%, 50%-55%, 55-60%, 60-65%, 65-70%, 70-75%, 75-80%, 80-85%, 85-90%, 90-95%, or 95-100%) of the uridine and thymidine positions in the contiguous region comprise chemically modified uridine nucleotides. 54. The dsDNA molecule of any of embodiments 1 to 8 or 24 to 35, comprising a sense strand and an antisense strand, wherein 1% to 100% (e.g., 1 to 5%, 5 to 10%, 10 to 15%, 15 to 20%, 20 to 25%, 25 to 30%, 30 to 35%, 35 to 40%, 40 to 45%, 45 to 50%, 50% to 55%, 55 to 60%, 60 to 65%, 65 to 70%, 70 to 75%, 75 to 80%, 80 to 85%, 85 to 90%, 90 to 95%, or 95 to 100%) of the uridine and thymidine positions in the sense strand of the dsDNA molecule comprise chemically modified uridine nucleotides, and the chemically modified uridine nucleotides comprise 5-hydroxymethyluridine. 55. The dsDNA molecule of any of embodiments 1-8, 24-35 or 54, comprising a sense strand and an antisense strand, wherein at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, at least 75%, or at least 90% of the uridine and thymidine positions in the sense strand of the dsDNA molecule comprise chemically modified uridine nucleotides, wherein the chemically modified uridine nucleotides comprise 5-hydroxymethyluridine. 56. The dsDNA molecule of any of embodiments 1-6, 17, 18, 23-33, 44, or 45, comprising a sense strand and an antisense strand, wherein 1% to 25% (e.g., 1-5%, 5-10%, 10-15%, 15-20%, or 20-25%) of the uridine and thymidine positions in the sense strand of the dsDNA molecule comprise chemically modified uridine nucleotides, and the chemically modified uridine nucleotides comprise 5-formyluridine. 57. The dsDNA molecule of any of embodiments 1-6, 17, 18, 23-33, 44, 45, or 56, comprising a sense strand and an antisense strand, wherein at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, or at least 25% of the uridine and thymidine positions in the sense strand of the dsDNA molecule comprise chemically modified uridine nucleotides, and the chemically modified uridine nucleotides comprise 5-formyluridine. 58. The dsDNA molecule of any of embodiments 1-6, 21, 22, or 24-26, comprising a sense strand and an antisense strand, wherein 1% to 100% (e.g., 1-5%, 5-10%, 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, 45-50%, 50%-55%, 55-60%, 60-65%, 65-70%, 70-75%, 75-80%, 80-85%, 85-90%, 90-95%, or 95-100%) of the uridine and thymidine positions in the sense strand of the dsDNA molecule comprise chemically modified uridine nucleotides, and the chemically modified uridine nucleotides comprise 5-methylthiouridine. 59. The dsDNA molecule of any of embodiments 1-6, 21, 22, or 24-26, comprising a sense strand and an antisense strand, wherein at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, at least 75%, or at least 90% of the uridine and thymidine positions in the sense strand of the dsDNA molecule comprise chemically modified uridine nucleotides, wherein the chemically modified uridine nucleotides comprise 5-methylthiouridine. 60. The dsDNA molecule of any of the preceding embodiments, comprising a sense strand and an antisense strand, wherein the antisense strand contains fewer chemically modified uridine nucleotides than the sense strand contains. 61. The dsDNA molecule of any of the preceding embodiments, comprising a sense strand and an antisense strand, wherein the antisense strand is substantially free of chemically modified uridine nucleotides. 62. The dsDNA molecule of any of the preceding embodiments, further comprising a second chemically modified uridine nucleotide. 63.i) the chemically modified uridine nucleotide comprises 5-hydroxymethyluridine and the second chemically modified uridine nucleotide comprises 5-aminoallyluridine; or ii) the chemically modified uridine nucleotide comprises 5-hydroxymethyluridine and the second chemically modified uridine nucleotide comprises 5-bromouridine; or iii) the chemically modified uridine nucleotide comprises 5-hydroxymethyluridine and the second chemically modified uridine nucleotide comprises 5-iodouridine; or iv) the chemically modified uridine nucleotide comprises 5-hydroxymethyluridine and the second chemically modified uridine nucleotide comprises 5-propargylaminouridine; or v) the chemically modified uridine nucleotide comprises 5-hydroxymethyluridine and the second chemically modified uridine nucleotide comprises 5-formyluridine; or vi) the chemically modified uridine nucleotide comprises 5-hydroxymethyluridine and the second chemically modified uridine nucleotide comprises 5-carboxyuridine; or vii) the chemically modified uridine nucleotide comprises 5-aminoallyl uridine and the second chemically modified uridine nucleotide comprises 5-bromouridine; or viii) the chemically modified uridine nucleotide comprises 5-aminoallyl uridine and the second chemically modified uridine nucleotide comprises 5-iodouridine; or ix) the chemically modified uridine nucleotide comprises 5-aminoallyl uridine and the second chemically modified uridine nucleotide comprises 5-propargylamino uridine; or x) the chemically modified uridine nucleotide comprises 5-aminoallyl uridine and the second chemically modified uridine nucleotide comprises 5-formyl uridine; or xi) the chemically modified uridine nucleotide comprises 5-aminoallyl uridine and the second chemically modified uridine nucleotide comprises 5-carboxyuridine; or xii) the chemically modified uridine nucleotide comprises 5-bromouridine and the second chemically modified uridine nucleotide comprises 5-iodouridine; or xiii) the chemically modified uridine nucleotide comprises 5-bromouridine and the second chemically modified uridine nucleotide comprises 5-propargylaminouridine; or xiv) the chemically modified uridine nucleotide comprises 5-bromouridine and the second chemically modified uridine nucleotide comprises 5-formyluridine; or xv) the chemically modified uridine nucleotide comprises 5-bromouridine and the second chemically modified uridine nucleotide comprises 5-carboxyuridine; or xvi) the chemically modified uridine nucleotide comprises 5-iodouridine and the second chemically modified uridine nucleotide comprises 5-propargylaminouridine; or xvii) the chemically modified uridine nucleotide comprises 5-iodouridine and the second chemically modified uridine nucleotide comprises 5-formyluridine; or xviii) the chemically modified uridine nucleotide comprises 5-iodouridine and the second chemically modified uridine nucleotide comprises 5-carboxyuridine; or xix) the chemically modified uridine nucleotide comprises 5-propargylaminouridine and the second chemically modified uridine nucleotide comprises 5-formyluridine; or xx) the chemically modified uridine nucleotide comprises 5-propargylaminouridine and the second chemically modified uridine nucleotide comprises 5-carboxyuridine; or xxi) the chemically modified uridine nucleotide comprises 5-formyluridine and the second chemically modified uridine nucleotide comprises 5-carboxyuridine; or xxii) the chemically modified uridine nucleotide comprises 5-methylthiouridine and the second chemically modified uridine nucleotide comprises 5-hydroxymethyluridine; or xxiii) the chemically modified uridine nucleotide comprises 5-methylthiouridine and the second chemically modified uridine nucleotide comprises 5-aminoallyluridine; or xxiv) the chemically modified uridine nucleotide comprises 5-methylthiouridine and the second chemically modified uridine nucleotide comprises 5-methylthiouridine; or xxv) the chemically modified uridine nucleotide comprises 5-methylthiouridine and the second chemically modified uridine nucleotide comprises 5-iodouridine; or xxvi) the chemically modified uridine nucleotide comprises 5-methylthiouridine and the second chemically modified uridine nucleotide comprises 5-propargylaminouridine; or xxvii) the chemically modified uridine nucleotide comprises 5-methylthiouridine and the second chemically modified uridine nucleotide comprises 5-formyluridine; or xxviii) The dsDNA molecule of embodiment 62, wherein the chemically modified uridine nucleotide comprises 5-methylthiouridine, and the second chemically modified uridine nucleotide comprises 5-carboxyuridine. 64. The dsDNA molecule of any of the preceding embodiments, wherein at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% of the sugars in the dsDNA molecule are deoxyribose sugars. 65. The dsDNA molecule of any of the preceding embodiments, wherein at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% of the sugars of the chemically modified uridine nucleotides of the dsDNA molecule are deoxyribose sugars. 66. The dsDNA molecule of any of the preceding embodiments, wherein every position in the dsDNA molecule comprises a deoxyribose sugar. 67. The dsDNA molecule of any of the preceding embodiments, comprising chemical modifications of phosphate groups. 68. The dsDNA molecule of any of the preceding embodiments, comprising a chemical modification of the sugar, for example, 2'-deoxy-2'-fluoro (2'-F) nucleotides or 2'-O-methyl (2'-O-Me) nucleotides. 69.i) a promoter sequence (optionally, the promoter sequence is in the double-stranded region); ii) a payload sequence (e.g., a therapeutic payload sequence) operably linked to a promoter sequence; iii) heterologous functional sequences, such as nuclear targeting sequences or regulatory sequences; iv) maintenance sequences, and / or v) Replication origin point

[0023] The dsDNA molecule of any of the preceding embodiments, comprising one or more of: 70.i, ii and iii, i, ii and iv, i, ii and v, i, ii, iii and iv, i, ii, iii and v, i, ii, iv and v, or i, ii, iii, iv and v 70. The dsDNA molecule of embodiment 69, comprising: 71.i) heterologous functional sequences, such as nuclear targeting sequences or regulatory sequences; ii) a maintenance sequence, or iii) Replication origin point

[0023] The dsDNA molecule of any of the preceding embodiments, comprising one, two or all of: 72. The dsDNA molecule of any of the preceding embodiments, comprising a therapeutic payload sequence. 73. The dsDNA molecule of embodiment 72, wherein the chemically modified uridine nucleotide is located in the sense strand of the therapeutic payload sequence. 74. Linear and a) upstream exonuclease-resistant DNA end forms, b) a double-stranded region, and c) downstream exonuclease-resistant DNA end forms

[0023] The dsDNA molecule of any of the preceding embodiments, comprising: 75. The dsDNA molecule of any of the preceding embodiments, comprising a nuclear targeting sequence comprising a CT3 sequence (e.g., a sequence of AATTCTCCTCCCCACCTTCCCCACCCTCCCCA (SEQ ID NO: 55)), or a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. 76. The dsDNA molecule of any of the preceding embodiments, comprising a nuclear targeting sequence that binds to an hnRNPK protein (e.g., a human hnRNPK protein). 77. The dsDNA molecule of any of the preceding embodiments, comprising a payload sequence, wherein the payload sequence encodes a polypeptide (e.g., a protein). 78. The DNA molecule of any of the preceding embodiments, comprising a therapeutic payload sequence, wherein at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, at least 75%, at least 90%, or at least 95% of the uridine and thymidine positions in the therapeutic payload sequence comprise chemically modified uridine nucleotides. 79. The dsDNA molecule of any of the preceding embodiments, comprising a therapeutic payload sequence, wherein 1% to 100% (e.g., 1-5%, 5-10%, 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, 45-50%, 50%-55%, 55-60%, 60-65%, 65-70%, 70-75%, 75-80%, 80-85%, 85-90%, 90-95%, or 95% to 100%) of the uridine and thymidine positions in the therapeutic payload sequence comprise chemically modified uridine nucleotides. 80. The DNA molecule of any of the preceding embodiments, comprising a payload sequence, wherein the payload sequence encodes an RNA (e.g., an mRNA, tRNA, lncRNA, miRNA, rRNA, snRNA, microRNA, siRNA, piRNA, snoRNA, snRNA, exRNA, scaRNA, Y RNA, or hnRNA), and optionally the payload sequence encodes a functional RNA (e.g., an miRNA, siRNA, or tRNA). 81. The dsDNA molecule of any of embodiments 1-80, which does not comprise a sequence encoding an RNA. 82. The dsDNA molecule of any of the preceding embodiments, which is capable of being replicated (e.g., by a DNA polymerase that is native to the cell containing the dsDNA molecule). 83. The dsDNA molecule of any of embodiments 1-81, which cannot be replicated. 84. The dsDNA molecule of any of the preceding embodiments, which is linear and can be circularized. 85. The dsDNA molecule of any of embodiments 1-83, which is linear and cannot be circularized. 86. The dsDNA molecule of any of the preceding embodiments, wherein the dsDNA molecule or a portion thereof is capable of being integrated into a genome. 87. The dsDNA molecule of any of embodiments 1-85, wherein the dsDNA molecule or part thereof cannot be integrated into the genome. 88. The dsDNA molecule of any of the preceding embodiments, which can be concatemerized. 89. The dsDNA molecule of any of embodiments 1-87, which cannot be concatemerized. 90. The dsDNA molecule of any of the preceding embodiments, comprising a payload sequence, wherein the payload sequence is heterologous to the target cell. 91. The dsDNA molecule of any of the preceding embodiments, comprising a sense strand and an antisense strand. 92. The dsDNA molecule of embodiment 91, wherein the antisense strand comprises one or more chemically modified nucleotides. 93. The dsDNA molecule of embodiment 91 or 92, wherein the sense strand does not contain any chemically modified nucleotides. 94. The dsDNA molecule of embodiment 91 or 92, wherein the sense strand comprises one or more chemically modified nucleotides. 95. The dsDNA molecule of any of the preceding embodiments, further comprising one or more chemically modified nucleotides comprising a modification in the backbone, sugar, or nucleobase. 96. The dsDNA molecule of embodiment 95, wherein one or more of the chemically modified nucleotides are conjugated to a peptide or protein. 97. The dsDNA molecule of embodiment 95 or 96, wherein one or more of the chemically modified nucleotides comprises a phosphorothioate bond. 98. The dsDNA molecule of any of embodiments 95-97, wherein each of the first and second strands of the dsDNA molecule comprises one or more chemically modified nucleotides. 99. The dsDNA molecule of any of embodiments 95-98, wherein each of the first strand and the second strand of the dsDNA molecule comprises one or more phosphorothioate linkages. 100. at least 15 nucleotides, at least 30 nucleotides, at least 50 nucleotides, at least 75 nucleotides, 100 nucleotides, at least 200 nucleotides, at least 300 nucleotides, at least 500 nucleotides, at least 750 nucleotides, at least 1,000 nucleotides, at least 2,000 nucleotides, at least 3,000 nucleotides, at least 4,000 nucleotides, at least 5,000 nucleotides, at least 6,000 nucleotides, at least 7,000 nucleotides, at least 8,000 nucleotides dsDNA molecule of any of the preceding embodiments, having at least 9,000 nucleotides, at least 10,000 nucleotides, at least 11,000 nucleotides, at least 12,000 nucleotides, at least 15,000 nucleotides, at least 20,000 nucleotides, at least 25,000 nucleotides, at least 30,000 nucleotides, at least 35,000 nucleotides, at least 40,000 nucleotides, at least 45,000 nucleotides, at least 50,000 nucleotides, at least 60,000 nucleotides or more. 101. 20-1000 nucleotides, 20-50 nucleotides, 100-500 nucleotides, 500-50,000 nucleotides, 1,000-50,000 nucleotides, 2,000-40,000 nucleotides, 5,000-50,000 nucleotides, 500-50,000 nucleotides, 500-25,000 nucleotides, 1,000-20,000 nucleotides, 1,000-10,000 nucleotides, 10,000-60,000 nucleotides, 1,000-20,000 nucleotides, 1,000-40,000 nucleotides dsDNA molecule of any of the preceding embodiments, having nucleotides, 500 to 1000 nucleotides, 1000 to 2,000 nucleotides, 2,000 to 3,000 nucleotides, 3,000 to 4,000 nucleotides, 4,000 to 5,000 nucleotides, 5,000 to 6,000 nucleotides, 6,000 to 7,000 nucleotides, 7,000 to 8,000 nucleotides, 8,000 to 9,000 nucleotides, 9,000 to 10,000 nucleotides, 10,000 to 11,000 nucleotides or 11,000 to 12,000 nucleotides. 102. For example, when contacted with HEKa cells in an assay as described herein, (i) a reduction in a measure of interferon signaling relative to a control DNA molecule, e.g., at least a 2-, 4-, 6-, 7-, or 8-fold reduction, where the measure of interferon signaling is the average fold change in IFNβ mRNA and CXCL10 mRNA relative to a control DNA molecule; or (ii) a reduction in a measure of inflammatory cytokine signaling relative to a control DNA molecule, e.g., at least a 2-, 4-, 5-, or 6-fold reduction, wherein the measure of inflammatory cytokine signaling is the average fold change in IL6 mRNA and TNFα mRNA relative to a control DNA molecule. wherein the control DNA molecule comprises the same sequence, strandedness, and cyclic or linear characteristics as the dsDNA molecule, but contains unmodified thymidine nucleotides in place of chemically modified uridine nucleotides. 103. For example, when contacted with HEKa cells in an assay as described herein, (i) a reduction in a measure of interferon signaling relative to a control DNA molecule, e.g., at least a 20-, 40-, 50-, or 60-fold reduction, where the measure of interferon signaling is the average fold change in IFNβ mRNA and CXCL10 mRNA relative to a control DNA molecule; or (ii) a reduction in a measure of inflammatory cytokine signaling relative to a control DNA molecule, e.g., at least a 5-, 10-, 12-, or 15-fold reduction, wherein the measure of inflammatory cytokine signaling is the average fold change in IL6 mRNA and TNFα mRNA relative to a control DNA molecule. wherein the control DNA molecule comprises the same sequence, strandedness, and cyclic or linear characteristics as the dsDNA molecule, but contains unmodified thymidine nucleotides in place of chemically modified uridine nucleotides. 104. For example, when contacted with HEKa cells in an assay as described herein, a reduced level of CXCL10 mRNA compared to a control DNA molecule (e.g., at least 55%, at least 50%, at least 40%, at least 30%, at least 20%, or at least 10% reduced); or a lower level of IL6 mRNA compared to a control DNA molecule (e.g., at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, or at least 10% lower); a lower level of interferon beta (IFNB) mRNA (e.g., at least 25%, at least 20%, at least 15%, or at least 10% lower) compared to a control DNA molecule; a lower level of interferon lambda (IFNL) mRNA (e.g., at least 35%, at least 30%, at least 20%, or at least 10% lower) compared to a control DNA molecule wherein the control DNA molecule comprises the same sequence, strandedness, and cyclic or linear characteristics as the dsDNA molecule, but contains unmodified thymidine nucleotides in place of chemically modified uridine nucleotides. 105. The dsDNA molecule of any of the preceding embodiments, which encodes a protein and which, when contacted with U937 cells, e.g., in an assay as described herein, results in expression at a level that is at least 50%, at least 60%, at least 70%, at least 75%, at least 100%, at least 125%, at least 150%, at least 175%, at least 180%, at least 185%, or at least 190% of that of control DNA, wherein the control DNA molecule contains the same sequence, strandedness, and circular or linear characteristics as the dsDNA molecule, but contains unmodified thymidine nucleotides in place of chemically modified uridine nucleotides. 106. The dsDNA molecule of any of the preceding embodiments, which comprises a therapeutic payload sequence and, when contacted with U937 cells, results in expression of the therapeutic payload sequence at a level that is at least 50%, at least 60%, at least 70%, at least 75%, at least 100%, at least 125%, at least 150%, at least 175%, at least 180%, at least 185%, or at least 190% of the expression of the therapeutic payload sequence of the control DNA, wherein the control DNA molecule comprises the same sequence, strandedness, and cyclic or linear characteristics as the dsDNA molecule, but contains unmodified thymidine nucleotides in place of chemically modified uridine nucleotides. 107. The dsDNA molecule of any of the preceding embodiments, which encodes a protein and which, when contacted with THP-1 cells, e.g., in an assay as described herein, results in expression at a level that is at least 50%, at least 75%, at least 80%, at least 90%, or at least 95% of that of control DNA, wherein the control DNA molecule contains the same sequence, strandedness, and circular or linear characteristics as the dsDNA molecule, but contains unmodified thymidine nucleotides in place of chemically modified uridine nucleotides. 108. The dsDNA molecule of any of the preceding embodiments, which comprises a therapeutic payload sequence and, when contacted with THP-1 cells, results in expression of the therapeutic payload sequence at a level that is at least 50%, at least 75%, at least 80%, at least 90%, or at least 95% of the expression of the therapeutic payload sequence of the control DNA, wherein the control DNA molecule comprises the same sequence, strandedness, and cyclic or linear characteristics as the dsDNA molecule, but contains unmodified thymidine nucleotides in place of chemically modified uridine nucleotides. 109. The dsDNA molecule of any of the preceding embodiments, which encodes a protein and which, when contacted with HEKa cells, e.g., in an assay as described herein, results in expression at a level that is at least 50%, at least 75%, at least 80%, at least 90%, at least 95%, at least 100%, at least 125%, or at least 150% of that of control DNA, wherein the control DNA molecule contains the same sequence, strandedness, and circular or linear characteristics as the dsDNA molecule, but contains unmodified thymidine nucleotides in place of chemically modified uridine nucleotides. 110. The dsDNA molecule of any of the preceding embodiments, which is a TDSC. 111.TDSC a) upstream exonuclease-resistant DNA end forms, b) a double-stranded region, and c) downstream exonuclease-resistant DNA end forms 111. The dsDNA molecule of embodiment 110, comprising: 112. The dsDNA molecule of embodiment 111, wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form are open-ended. 113. The dsDNA molecule of embodiment 111 or 112, wherein the upstream DNA end form comprises a Y-adapter arrangement, and the downstream DNA end form comprises a Y-adapter arrangement. 114. The dsDNA molecule of embodiment 111 or 112, wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form are blunt ends or sticky ends. 115. The dsDNA molecule of any of embodiments 111, 112, or 114, wherein the upstream DNA end form is double-stranded and blunt-ended and comprises a phosphorothioate modification on each strand, and the downstream DNA end form is double-stranded and blunt-ended and comprises a phosphorothioate modification on each strand. 116. The dsDNA molecule of embodiment 111, wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form are closed ends. 117. The dsDNA molecule of embodiment 111, wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form comprise a loop. 118. The dsDNA molecule of any of embodiments 111, 116 or 117, wherein the upstream DNA end form is a closed end, and the downstream DNA end form is a closed end. 119. The dsDNA molecule of any of embodiments 111-118, wherein the upstream DNA end form (e.g., the upstream exonuclease-resistant DNA end form) comprises one or more chemically modified nucleotides. 120. The dsDNA molecule of any of embodiments 111-119, wherein the downstream DNA end form (e.g., downstream exonuclease-resistant DNA end form) comprises one or more chemically modified nucleotides. 121. The dsDNA molecule of any of embodiments 111-120, wherein the upstream exonuclease-resistant DNA end form comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 phosphorothioate bonds (e.g., between 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 terminal nucleotides of the upstream exonuclease-resistant DNA end form, e.g., in the first strand, the second strand, or both the first and second strands). 122. The dsDNA molecule of any of embodiments 111-121, wherein the upstream exonuclease-resistant DNA end form comprises at least three phosphorothioate bonds (e.g., between 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 terminal nucleotides of the upstream exonuclease-resistant DNA end form, e.g., in the first strand, the second strand, or both the first and second strands). 123. The dsDNA molecule of any of embodiments 111-122, wherein the upstream exonuclease-resistant DNA end form comprises at least six phosphorothioate bonds (e.g., between 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 terminal nucleotides of the upstream exonuclease-resistant DNA end form, e.g., in the first strand, the second strand, or both the first and second strands). 124. The dsDNA molecule of any of embodiments 111-123, wherein the downstream exonuclease-resistant DNA end form comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 phosphorothioate bonds (e.g., between 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 terminal nucleotides of the downstream exonuclease-resistant DNA end form, e.g., in the first strand, the second strand, or both the first and second strands). 125. The dsDNA molecule of any of embodiments 111-124, wherein the downstream exonuclease-resistant DNA end form comprises at least three phosphorothioate bonds (e.g., between 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 terminal nucleotides of the downstream exonuclease-resistant DNA end form, e.g., in the first strand, the second strand, or both the first and second strands). 126. The dsDNA molecule of any of embodiments 111-125, wherein the downstream exonuclease-resistant DNA end form comprises at least six phosphorothioate bonds (e.g., between 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 terminal nucleotides of the downstream exonuclease-resistant DNA end form, e.g., in the first strand, the second strand, or both the first and second strands). 127. The dsDNA molecule of any of embodiments 111-126, wherein the upstream and downstream exonuclease-resistant DNA end forms each comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 phosphorothioate bonds (e.g., between 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 terminal nucleotides of the upstream and downstream exonuclease-resistant DNA end forms, e.g., in the first strand, the second strand, or both the first and second strands). 128. The dsDNA molecule of any of embodiments 111-127, wherein the upstream and downstream exonuclease-resistant DNA end forms each comprise at least three phosphorothioate bonds (e.g., between 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 terminal nucleotides of the upstream and downstream exonuclease-resistant DNA end forms, e.g., in the first strand, the second strand, or both the first and second strands). 129. The dsDNA molecule of any of embodiments 111-128, wherein the upstream and downstream exonuclease-resistant DNA end forms each comprise at least six phosphorothioate bonds (e.g., between 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 terminal nucleotides of the upstream and downstream exonuclease-resistant DNA end forms, e.g., in the first strand, the second strand, or both the first and second strands). 130. The dsDNA molecule of embodiment 111, wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form comprise a Y-adapter arrangement. 131. The dsDNA molecule of embodiment 130, wherein all nucleotides in the Y-adaptor are chemically modified nucleotides. 132. The dsDNA molecule of any of embodiments 111-131, wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form comprise one or more of a nuclear targeting sequence, a maintenance sequence, and a sequence that binds to an endogenous polypeptide in the target cell. 133. One or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form have the following characteristics: i) does not contain the nucleic acid sequences TATCAGCACACAATTGCCCATTATACGC (SEQ ID NO: 56) and GCGTATAATGGGCAATTGTGTGCTGATA (SEQ ID NO: 57) or nucleic acid sequences having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity thereto and / or the nucleic acid sequences TATCAGCACACAATAGTCCATTATACGC (SEQ ID NO: 58) and GCGTATAATGGACTATTGTGTGCTGATA (SEQ ID NO: 59); ii) every nucleotide in the TDSC binds to another nucleotide in the TDSC; iii) the upstream exonuclease-resistant DNA end forms a loop size less than about 28 or 56 nucleotides in length or greater than about 28 or 56 nucleotides in length; or iv) the downstream exonuclease-resistant DNA end forms a loop size less than about 28 or 56 nucleotides in length or greater than about 28 or 56 nucleotides in length; 133. The dsDNA molecule of any of embodiments 111 to 132, having one or more of: 134. The dsDNA molecule of any of embodiments 111-133, wherein the upstream exonuclease-resistant DNA end form is resistant to endonuclease digestion. 135. The dsDNA molecule of any of embodiments 111-134, wherein the upstream exonuclease-resistant DNA end form is resistant to immunosensor recognition. 136. The dsDNA molecule of any of embodiments 111-135, wherein the downstream exonuclease-resistant DNA end forms is resistant to endonuclease digestion. 137. The dsDNA molecule of any of embodiments 111-136, wherein the downstream exonuclease-resistant DNA end forms are resistant to immunosensor recognition. 138. The dsDNA molecule of any of embodiments 111-137, wherein the double-stranded region is resistant to endonuclease digestion. 139. The dsDNA molecule of any of embodiments 111-138, wherein the double-stranded region is resistant to immunosensor recognition. 140. The dsDNA molecule of any of embodiments 111-139, wherein the upstream DNA end form and the downstream DNA end form have the same nucleotide sequence. 141. The dsDNA molecule of any of embodiments 111-139, wherein the upstream DNA end form and the downstream DNA end form have different nucleotide sequences. 142. The dsDNA molecule of any of embodiments 111-141, wherein the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form have the same structure. 143. The dsDNA molecule of any of embodiments 111-141, wherein the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form have different structures. 144. The dsDNA molecule of embodiment 111, wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form are open ends (e.g., blunt ends, sticky ends, or Y-adapters). 145. The dsDNA molecule of embodiment 111, wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form are closed ends (e.g., hairpins). 146. The dsDNA molecule of embodiment 145, wherein the closed end comprises one or more (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, or 50) nucleotides that are not hybridized (e.g., are not part of the double-stranded region). 147. The dsDNA molecule of embodiment 145, wherein the closed end does not contain any unhybridized nucleotides (e.g., all nucleotides of the closed end are hybridized to another nucleotide). 148. The dsDNA molecule of any of embodiments 111-147, wherein the upstream DNA end form, the downstream DNA end form, or both, comprises at least one chemically modified nucleotide. 149. The dsDNA molecule of any of embodiments 111 to 148, wherein both the upstream DNA end form and the downstream DNA end form comprise at least one chemically modified nucleotide on the sense strand and at least one chemically modified nucleotide on the antisense strand. 150. The dsDNA molecule of any of embodiments 111-149, wherein both the upstream DNA end form and the downstream DNA end form comprise chemically modified nucleotides at all sense strand positions and at all antisense strand positions. 151. The dsDNA molecule of any of embodiments 111-150, wherein the upstream DNA end form, the downstream DNA end form, or both, comprises an inverted terminal repeat (ITR), and optionally, the dsDNA does not comprise chemically modified nucleotides. 152. The dsDNA molecule of any of embodiments 111-151, wherein the upstream DNA end form, the downstream DNA end form, or both, comprises a protelomerase sequence, and optionally, the dsDNA does not comprise chemically modified nucleotides. 153. The dsDNA molecule of embodiment 152, wherein one or more of the protelomerase sequences comprises (e.g., in the 5' to 3' direction) the nucleic acid sequences TATCAGCACACAATTGCCCATTATACGC (SEQ ID NO: 56) and GCGTATAATGGGCAATTGTGTGCTGATA (SEQ ID NO: 57), or a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. 154. The dsDNA molecule of embodiment 152 or 153, wherein one or more of the protelomerase sequences comprises (e.g., in the 5' to 3' direction) the nucleic acid sequences TATCAGCACACAATAGTCCATTATACGC (SEQ ID NO: 58) and GCGTATAATGGACTATTGTGTGCTGATA (SEQ ID NO: 59), or a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. 155. The dsDNA molecule of any of embodiments 152-154, wherein one or more of the protelomerase sequences comprises (e.g., in the 5' to 3' direction) the nucleic acid sequences ACCTATTTCAGCATACTACGC (SEQ ID NO: 60) and GCGTAGTATGCTGAAATAGGT (SEQ ID NO: 61), or a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. 156. The dsDNA molecule of any of embodiments 152-155, wherein one or more of the protelomerase sequences comprises (e.g., in the 5' to 3' direction) the nucleic acid sequences ACCTATTTCAGCATACTACGC (SEQ ID NO: 60) and GCGTAGTATGCTGAAATAGGT (SEQ ID NO: 61), or a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. 157. The dsDNA molecule of any of embodiments 152-156, wherein one or more of the protelomerase sequences comprises (e.g., in the 5' to 3' direction) the nucleic acid sequence CACACAATTGCCCATTATACGCGCGTATAATGGGCAATTGTGTG (SEQ ID NO: 62), or a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. 158. One or more of the protelomerase sequences may comprise (e.g., in the 5' to 3' direction) the nucleic acid sequence: (i) TAAATATAATTTAA (SEQ ID NO: 63) and TTAAATTATATTTA (SEQ ID NO: 64), (ii) AATATATAATCTAA (SEQ ID NO: 65) and TTAGATTATATATT (SEQ ID NO: 66); (iii) TATTTATTATCTTT (SEQ ID NO: 67) and AAAGATAATAAATA (SEQ ID NO: 68); (iv) ATATAATTTTTAATTAGTATAGAATATGTTAA (SEQ ID NO: 69) and TTAACATACTCTATACTAATTAAAAATTATAT (SEQ ID NO: 70), (v) TATAATTTGATATTAGTACAAATCCC (SEQ ID NO: 71) and GGGATTTGTACTAATATCAAATTATA (SEQ ID NO: 72), (vi) ATATAATATTTATTTAGTACAAAGTTC (SEQ ID NO: 73) and GAACTTTGTACTAAATAAATATTATAT (SEQ ID NO: 74), (vii) ATATAATTTTTTATTAGTATAGAGTAT (SEQ ID NO: 75) and ATACTCTATACTAATAAAAAATTATAT (SEQ ID NO: 76), or (viii) TAAATATAATTTAA (SEQ ID NO: 63) and TTAAATTATATTTA (SEQ ID NO: 64), or Nucleic acid sequences having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity thereto 158. The dsDNA molecule of any of embodiments 152 to 157, comprising: 159. One or more of the protelomerase sequences may comprise (e.g., in the 5' to 3' direction) the nucleic acid sequence: (i) TAGTATAAAAAACTGT (SEQ ID NO: 77) and ACAGTTTTTTATACTA (SEQ ID NO: 78); (ii) TAGTATACAAAAGATT (SEQ ID NO: 79) and AATCTTTGTATACTA (SEQ ID NO: 80); (iii) TAGTATATATATCTCT (SEQ ID NO: 81) and AGAGATATATATACTA (SEQ ID NO: 82), or (iv) TAGTATAAAAAAAATT (SEQ ID NO: 83) and AATTTTTTTATACTA (SEQ ID NO: 84), or Nucleic acid sequences with at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity thereto 159. The dsDNA molecule of embodiment 158, further comprising: 160. The dsDNA molecule of any of embodiments 152-159, wherein the protelomerase sequence is generated by TelN protelomerase, ResT protelomerase, Tel PY54 protelomerase, or TelK protelomerase digestion. 161. The dsDNA molecule of any of embodiments 152-159, wherein the protelomerase sequence is not generated by TelN protelomerase digestion. 162. The dsDNA molecule of any of embodiments 152-159, wherein the protelomerase sequence is not generated by Tel PY54 protelomerase digestion. 163. The dsDNA molecule of any of embodiments 152-159, wherein the protelomerase sequence is not generated by TelK protelomerase digestion. 164. The dsDNA molecule of any of embodiments 152-159, wherein the protelomerase sequence is not generated by ResT protelomerase digestion. 165. The dsDNA molecule of any of embodiments 152-164, wherein the protelomerase sequence is about 28 or 56 nucleotides in length. 166. The dsDNA molecule of any of embodiments 152-165, wherein the protelomerase sequence is less than 28 (e.g., less than 15, 20, 25, 26, 27, or 28) nucleotides in length. 167. The dsDNA molecule of any of embodiments 152-166, wherein the protelomerase sequence is from about 28 (e.g., 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35) nucleotides in length to about 56 (e.g., 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60) nucleotides in length. 168. The dsDNA molecule of any of embodiments 152-167, wherein the protelomerase sequence is more than about 56 (e.g., more than 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 65, 70, 75, 80, 90, or 100) nucleotides in length. 169. The dsDNA molecule of embodiment 111, wherein the upstream DNA end form, the downstream DNA end form, or both, comprises a Y-adaptor. 170. The dsDNA molecule of embodiment 152, wherein the protelomerase sequence is generated from a first protelomerase recognition sequence (PRS) and a second PRS that are recognized by TelN protelomerase or ResT protelomerase. 171. The dsDNA molecule of embodiment 152, wherein the protelomerase sequence is generated from a first protelomerase recognition sequence (PRS) and a second PRS recognized by Tel PY54 protelomerase or TelK protelomerase. 172. The dsDNA molecule of any of embodiments 111-171, wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form comprise at least one chemically modified nucleotide (e.g., comprise a chemical modification on all sense strand nucleotides and all antisense strand nucleotides). 173. The dsDNA molecule of any of embodiments 111-172, wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form comprise one or more chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides). 174. The dsDNA molecule of any of embodiments 111-173, wherein the double-stranded region comprises one or more chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides). 175. The dsDNA molecule of any of embodiments 111 to 174, wherein the double-stranded region encodes a payload sequence and the antisense strand for the payload sequence comprises one or more chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides). 176. The dsDNA molecule of any of embodiments 111 to 175, wherein the double-stranded region encodes a payload sequence, and the sense strand for the payload sequence comprises one or more chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides). 177. The dsDNA molecule of any of the preceding embodiments, which was not produced by nick translation. 178. The dsDNA molecule of any of the preceding embodiments, which was not produced in a microorganism. 179. The dsDNA molecule of any of the preceding embodiments, produced in a cell-free system. 180. The dsDNA molecule of any of the preceding embodiments, produced by PCR. 181. The dsDNA molecule of any of the preceding embodiments, which does not encode a viral protein. 182. The dsDNA molecule of any of the preceding embodiments, which encodes only mammalian proteins, e.g., human proteins. 183. A pharmaceutical composition comprising the dsDNA molecule of any of the preceding embodiments. 184. The pharmaceutical composition of embodiment 183, wherein the dsDNA molecule lacks material parts of a vector backbone, eg lacks a vector backbone or does not contain a non-human (eg bacterial) origin of replication. 185. The pharmaceutical composition of embodiment 183 or 184, wherein the dsDNA molecule is not encapsidated. 186. The pharmaceutical composition of any of embodiments 183-185, wherein the dsDNA molecule does not contain a viral packaging signal. 187. The pharmaceutical composition of any of embodiments 183-186, wherein the dsDNA molecule does not comprise viral ITRs. 188. The pharmaceutical composition of any of embodiments 183-187, which is essentially free of viral proteins. 189. The pharmaceutical composition of any of embodiments 183-188, which is essentially free of RNA. 190. The pharmaceutical composition of any of embodiments 183-189, which is essentially free of single-stranded DNA. 191. The pharmaceutical composition of any of embodiments 183-190, which is essentially free of DNA fragments. 192. The pharmaceutical composition of any of embodiments 183-191, which is essentially free of open-ended double-stranded DNA. 193. The pharmaceutical composition of any of embodiments 183-192, which is essentially free of microorganisms. 194. The pharmaceutical composition of any of embodiments 183-193, which is essentially free of bacterial proteins. 195. The pharmaceutical composition of any of embodiments 183-194, which is essentially free of bacterial DNA. 196. The pharmaceutical composition of any of embodiments 183-195, comprising a plurality of dsDNA molecules, wherein all dsDNA molecules in the pharmaceutical composition have substantially the same length of nucleotides (e.g., all dsDNA molecules in the pharmaceutical composition have the same length of nucleotides). 197. The pharmaceutical composition of any of embodiments 183-196, comprising a plurality of dsDNA molecules, wherein at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the dsDNA molecules in the pharmaceutical composition have the same length of nucleotides. 198. The pharmaceutical composition of any of embodiments 183 to 197, comprising a plurality of dsDNA molecules, wherein the dsDNA molecules comprise therapeutic payload sequences, and wherein the therapeutic payload sequences of the dsDNA molecules in the pharmaceutical composition have substantially the same length of nucleotides (e.g., the therapeutic payload sequences of the dsDNA molecules in the pharmaceutical composition have the same length of nucleotides). 199. The pharmaceutical composition of any of embodiments 183-198, comprising a plurality of dsDNA molecules, wherein all dsDNA molecules in the pharmaceutical composition have a length between 100, 200, 500 or 1000 nucleotides from each other. 200. The pharmaceutical composition of any of embodiments 183-199, comprising a plurality of dsDNA molecules, wherein all of the dsDNA molecules in the pharmaceutical composition have a length of 500-1000, 1000-2000, 2000-3000, 3000-4000, 4000-5000, 5000-6000, 6000-7000, 7000-8000, 8000-9000, 9000-10000, 10000-11000, or 11000-12000 nucleotides. 201. The pharmaceutical composition of any of embodiments 183-200, comprising a plurality of dsDNA molecules, wherein all dsDNA molecules in the pharmaceutical composition encode substantially the same effector (e.g., all dsDNA molecules in the pharmaceutical composition encode the same effector). 202. The pharmaceutical composition of any of embodiments 183-201, comprising a plurality of dsDNA molecules, wherein all of the dsDNA molecules in the pharmaceutical composition have substantially the same sequence (e.g., all of the dsDNA molecules in the pharmaceutical composition have the same sequence). 203. The pharmaceutical composition of any of embodiments 183-202, wherein the dsDNA molecule is comprised in a lipid nanoparticle (LNP). 204. The pharmaceutical composition of any of embodiments 183-203, further comprising an electroporation buffer. 205. The pharmaceutical composition of any of embodiments 183-204, further comprising a transfection reagent. 206. A pharmaceutical composition comprising a plurality of dsDNA molecules according to any of embodiments 1-182. 207. The plural is a) a first subpopulation of dsDNA molecules according to any of embodiments 1 to 182, wherein all dsDNA molecules in the first subpopulation have the same DNA sequence; and b) at least one additional dsDNA molecule according to any of embodiments 1 to 182, wherein the additional dsDNA molecule has a different DNA sequence than the dsDNA molecules in the first subpopulation. 207. The pharmaceutical composition of embodiment 206, comprising: 208. The pharmaceutical composition of embodiment 207, wherein the first subpopulation of dsDNA molecules has a desired DNA sequence. 209. The pharmaceutical composition of embodiment 208, wherein the additional dsDNA molecule has one or more errors relative to the desired DNA sequence. 210. The pharmaceutical composition of embodiment 209, wherein the one or more errors comprise one or more of a substitution, insertion or deletion. 211. The pharmaceutical composition of any of embodiments 207-210, wherein at least 20% or at least 30% of the dsDNA molecules in the pharmaceutical composition are part of the first subpopulation. 212. The pharmaceutical composition of any of embodiments 207-211, wherein 10% to 15%, 15% to 20%, 20% to 25%, or 25% to 30% of the dsDNA molecules in the pharmaceutical composition are part of the first subpopulation. 213. The pharmaceutical composition of any of embodiments 206-212, wherein the dsDNA molecules of the plurality comprise an amplicon region beginning with an initiation codon for the encoded polypeptide of the dsDNA molecule and spanning at least 200 base pairs, at least 210 base pairs, at least 220 base pairs, at least 230 base pairs, at least 240 base pairs, or at least 250 base pairs in the direction of transcription. 214. The pharmaceutical composition of any of embodiments 206-213, wherein the dsDNA molecules of the plurality comprise an amplicon region beginning with an initiation codon for the encoded polypeptide of the dsDNA molecule and spanning from 200 base pairs to 210 base pairs, from 210 base pairs to 220 base pairs, from 220 base pairs to 230 base pairs, from 230 base pairs to 240 base pairs, or from 240 base pairs to 250 base pairs in the direction of transcription. 215. The pharmaceutical composition of any of embodiments 206-214, wherein the dsDNA molecules of the plurality comprise an amplicon region beginning with the initiation codon for the encoded polypeptide of the dsDNA molecule and spanning 230 base pairs in the direction of transcription. 216. The plural is a) a first subpopulation of dsDNA molecules according to any of embodiments 1 to 182, wherein each amplicon region in the first subpopulation has the same DNA sequence; and b) at least one additional dsDNA molecule according to any of embodiments 1 to 182, wherein the amplicon region of the additional dsDNA molecule has a different DNA sequence than the amplicon region in the first subpopulation. 216. The pharmaceutical composition of any of embodiments 213-215, comprising: 217. The pharmaceutical composition of embodiment 216, wherein the amplicon region of the first subpopulation of dsDNA molecules has a desired DNA sequence. 218. The pharmaceutical composition of embodiment 217, wherein the amplicon region of the additional dsDNA molecule has one or more errors relative to the desired DNA sequence. 219. The pharmaceutical composition of embodiment 218, wherein the one or more errors comprise one or more of a substitution, insertion or deletion. 220. The pharmaceutical composition of any of embodiments 216-219, wherein at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, or at least 85% of the dsDNA molecules in the pharmaceutical composition are part of the first subpopulation. 221. The pharmaceutical composition of any of embodiments 216-220, wherein 20% to 30%, 30% to 40%, 40% to 50%, 50% to 60%, 60% to 70%, 70% to 75%, 75% to 80%, or 80% to 85% of the dsDNA molecules in the pharmaceutical composition are part of the first subpopulation. 222. The pharmaceutical composition of any of embodiments 208-221, wherein the dsDNA molecules in the pharmaceutical composition have an average of less than 6, less than 5, less than 4, less than 3, less than 2, less than 1, or less than 0.76 substitutions per kilobase relative to the desired DNA sequence. 223. The pharmaceutical composition of any of embodiments 208-222, wherein the dsDNA molecules in the pharmaceutical composition have an average of 0.5 to 1, 1 to 3, or 3 to 6 substitutions per kilobase relative to the desired DNA sequence. 224. The pharmaceutical composition of any of embodiments 208-223, wherein the dsDNA molecules in the pharmaceutical composition have an average of less than 0.05, less than 0.04, or less than 0.03 insertions per kilobase relative to the desired DNA sequence. 225. The pharmaceutical composition of any of embodiments 208-224, wherein the dsDNA molecules in the pharmaceutical composition have an average of 0.01-0.1, such as 0.01-0.05 or 0.05-0.1, insertions per kilobase relative to the desired DNA sequence. 226. The pharmaceutical composition of any of embodiments 208-225, wherein the dsDNA molecules in the pharmaceutical composition have an average of less than 0.2, less than 0.17, less than 0.15, or less than 0.14 deletions per kilobase relative to the desired DNA sequence. 227. The pharmaceutical composition of any of embodiments 208-226, wherein the dsDNA molecules in the pharmaceutical composition have an average of 0.1 to 0.2, such as 0.1 to 0.15 or 0.15 to 0.2 deletions per kilobase relative to the desired DNA sequence. 228. The pharmaceutical composition of any of embodiments 208-227, wherein the dsDNA molecules in the pharmaceutical composition have an average of less than 7, less than 6, less than 5, less than 4, less than 3, less than 2, less than 1, or less than 0.93 errors per kilobase relative to the desired DNA sequence. 229. The pharmaceutical composition of any of embodiments 208-228, wherein the dsDNA molecules in the pharmaceutical composition have an average of 0.5 to 1, 1 to 3, 3 to 5, or 5 to 7 errors per kilobase relative to the desired DNA sequence. 230. The pharmaceutical composition of any of embodiments 208-229, wherein the dsDNA molecules in the pharmaceutical composition have an average of less than 15, less than 10, less than 5, less than 3, less than 2, or less than 1.65 mismatches per dsDNA molecule to the desired DNA sequence. 231. The pharmaceutical composition of any of embodiments 208-230, wherein the dsDNA molecules in the pharmaceutical composition have an average of 1-2, 2-5, 5-10, or 10-15 mismatches per dsDNA molecule to the desired DNA sequence. 232. The pharmaceutical composition of any of embodiments 208-231, wherein the dsDNA molecules in the pharmaceutical composition have an average of less than 0.1, less than 0.08, less than 0.07, or less than 0.06 insertions per dsDNA molecule relative to the desired DNA sequence. 233. The pharmaceutical composition of any of embodiments 208 to 232, wherein the dsDNA molecules in the pharmaceutical composition have an average of 0.01 to 0.1, such as 0.01 to 0.05, 0.05 to 0.1, or 0.05 to 0.07 insertions per dsDNA molecule relative to the desired DNA sequence. 234. The pharmaceutical composition of any of embodiments 208-233, wherein the dsDNA molecules in the pharmaceutical composition have an average of less than 0.4, less than 0.37, less than 0.35, or less than 0.31 deletions per dsDNA molecule relative to the desired DNA sequence. 235. The pharmaceutical composition of any of embodiments 208-234, wherein the dsDNA molecules in the pharmaceutical composition have an average of 0.1-0.5, such as 0.1-0.3, 0.3-0.5, 0.2-0.4, or 0.3-0.4 deletions per dsDNA molecule relative to the desired DNA sequence. 236. The pharmaceutical composition of any of embodiments 208-235, wherein the dsDNA molecules in the pharmaceutical composition have an average of less than 15, less than 10, less than 5, less than 3, or less than 2.02 errors per dsDNA molecule relative to the desired DNA sequence. 237. The pharmaceutical composition of any of embodiments 208-236, wherein the dsDNA molecules in the pharmaceutical composition have an average of 2-5, 5-10, or 10-15 errors per dsDNA molecule relative to the desired DNA sequence. 238. The pharmaceutical composition of any of embodiments 208-237, wherein in the amplicon region, on average at least 98%, at least 98.371%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.887% of positions that are adenine in the desired DNA sequence are adenine in the dsDNA molecules in the pharmaceutical composition. 239. The pharmaceutical composition of any of embodiments 208-238, wherein in the amplicon region, an average of 98% to 99.89%, such as 98% to 99%, 99% to 99.89%, 99.5% to 99.89%, 99.7% to 99.89%, or 99.8% to 99.89%, of the positions that are adenine in the desired DNA sequence are adenine in the dsDNA molecules in the pharmaceutical composition. 240. The pharmaceutical composition of any of embodiments 208-239, wherein in the amplicon region, an average of less than 0.01%, less than 0.007%, less than 0.005%, or less than 0.002% of positions that are adenine in the desired DNA sequence are cytosine in the dsDNA molecules in the pharmaceutical composition. 241. The pharmaceutical composition of any of embodiments 208-240, wherein in the amplicon region, an average of 0.0015% to 0.01%, e.g., 0.0015% to 0.007%, 0.007% to 0.01%, 0.0015% to 0.005%, or 0.002% to 0.007% of positions that are adenines in the desired DNA sequence are cytosines in the dsDNA molecules in the pharmaceutical composition. 242. The pharmaceutical composition of any of embodiments 208-241, wherein in the amplicon region, an average of less than 0.5%, less than 0.427%, less than 0.4%, less than 0.2%, less than 0.1%, less than 0.08%, or less than 0.077% of positions that are adenine in the desired DNA sequence are guanine in the dsDNA molecules in the pharmaceutical composition. 243. The pharmaceutical composition of any of embodiments 208-242, wherein in the amplicon region, an average of 0.07% to 0.5%, e.g., 0.07% to 0.2%, 0.2% to 0.5%, 0.07% to 0.4%, 0.07% to 0.1%, 0.07% to 0.08%, or 0.077% to 0.427% of positions that are adenine in the desired DNA sequence are guanine in the dsDNA molecules in the pharmaceutical composition. 244. The pharmaceutical composition of any of embodiments 208-243, wherein in the amplicon region, an average of less than 2%, less than 1.2%, less than 1.178%, less than 1%, less than 0.5%, less than 0.1%, less than 0.05%, or less than 0.02% of positions that are adenine in the desired DNA sequence are thymine or chemically modified uridine nucleotides in the dsDNA molecules in the pharmaceutical composition. 245. The pharmaceutical composition of any of embodiments 208-244, wherein in the amplicon region, an average of 0.015% to 2%, e.g., 0.015% to 0.5%, 0.5% to 1%, 1% to 1.5%, 1.5% to 2%, 0.015% to 1.2%, 0.015% to 1%, 0.015% to 0.05%, 0.015% to 0.02%, or 0.02 to 1.178% of the positions that are adenines in the desired DNA sequence are thymine or chemically modified uridine nucleotides in the dsDNA molecules in the pharmaceutical composition. 246. The pharmaceutical composition of any of embodiments 208-245, wherein in the amplicon region, an average of less than 0.02%, less than 0.015%, less than 0.012%, or less than 0.011% of positions that are adenine in the desired DNA sequence are deleted in the dsDNA molecules in the pharmaceutical composition. 247. The pharmaceutical composition of any of embodiments 208-246, wherein in the amplicon region, an average of 0.01% to 0.02%, for example 0.01% to 0.015%, 0.015% to 0.02%, or 0.011% to 0.015% of positions that are adenine in the desired DNA sequence are deleted in the dsDNA molecules in the pharmaceutical composition. 248. The pharmaceutical composition of any of embodiments 208-247, wherein in the amplicon region, an average of less than 0.01%, less than 0.005%, less than 0.003%, less than 0.0025%, or less than 0.002% of positions that are adenines in the desired DNA sequence contain one or more inserted nucleotides 5' or 3' of the adenines in the dsDNA molecules in the pharmaceutical composition. 249. The pharmaceutical composition of any of embodiments 208-248, wherein in the amplicon region, an average of 0.0015% to 0.01%, e.g., 0.0015% to 0.005%, 0.005% to 0.01%, 0.0015% to 0.003%, or 0.0015% to 0.0025% of the positions that are adenines in the desired DNA sequence contain one or more inserted nucleotides 5' or 3' of the adenines in the dsDNA molecules in the pharmaceutical composition. 250. The pharmaceutical composition of any of embodiments 208-249, wherein in the amplicon region, an average of at least 98%, at least 99%, at least 99.5%, at least 99.7%, at least 99.753%, at least 99.9%, at least 99.91%, or at least 99.918% of the positions that are cytosine in the desired DNA sequence are cytosine in the dsDNA molecules in the pharmaceutical composition. 251. The pharmaceutical composition of any of embodiments 208-250, wherein in the amplicon region, an average of 98% to 99.92%, such as 98% to 99%, 99% to 99.92%, 99.5% to 99.92%, 99.7% to 99.92%, 99.91% to 99.92%, or 99.753% to 99.918% of the positions that are cytosine in the desired DNA sequence are cytosine in the dsDNA molecules in the pharmaceutical composition. 252. The pharmaceutical composition of any of embodiments 208-251, wherein in the amplicon region, an average of less than 0.05%, less than 0.04%, less than 0.03%, less than 0.02%, less than 0.018%, or less than 0.016% of positions that are cytosines in the desired DNA sequence are adenines in the dsDNA molecules in the pharmaceutical composition. 253. The pharmaceutical composition of any of embodiments 208-252, wherein in the amplicon region, an average of 0.015% to 0.05%, e.g., 0.015% to 0.03%, 0.03% to 0.05%, 0.015% to 0.04%, 0.015% to 0.02%, 0.015% to 0.018%, or 0.016% to 0.03% of positions that are cytosines in the desired DNA sequence are adenines in the dsDNA molecules in the pharmaceutical composition. 254. The pharmaceutical composition of any of embodiments 208-253, wherein in the amplicon region, an average of less than 0.01%, less than 0.009%, less than 0.008%, or less than 0.007% of positions that are cytosines in the desired DNA sequence are guanines in the dsDNA molecules in the pharmaceutical composition. 255. The pharmaceutical composition of any of embodiments 208-254, wherein in the amplicon region, an average of 0.006% to 0.01%, e.g., 0.006% to 0.008%, 0.008% to 0.01%, 0.006% to 0.009%, or 0.007% to 0.008% of positions that are cytosines in the desired DNA sequence are guanines in the dsDNA molecules in the pharmaceutical composition. 256. The pharmaceutical composition of any of embodiments 208-255, wherein in the amplicon region, an average of less than 0.5%, less than 0.2%, less than 0.191%, less than 0.15%, less than 0.1%, less than 0.05%, or less than 0.042% of positions that are cytosines in the desired DNA sequence are thymine or chemically modified uridine nucleotides in the dsDNA molecules in the pharmaceutical composition. 257. The pharmaceutical composition of any of embodiments 208-256, wherein in the amplicon region, an average of 0.04% to 0.5%, e.g., 0.04% to 0.2%, 0.2% to 0.5%, 0.04% to 0.15%, 0.04% to 0.1%, 0.04% to 0.05%, or 0.042% to 0.191% of the positions that are cytosines in the desired DNA sequence are thymine or chemically modified uridine nucleotides in the dsDNA molecules in the pharmaceutical composition. 258. The pharmaceutical composition of any of embodiments 208-257, wherein in the amplicon region, an average of less than 0.05%, less than 0.02%, less than 0.015%, less than 0.014%, or less than 0.013% of positions that are cytosine in the desired DNA sequence are deleted in the dsDNA molecules in the pharmaceutical composition. 259. The pharmaceutical composition of any of embodiments 208 to 258, wherein in the amplicon region, an average of 0.0125 to 0.05%, such as 0.0125% to 0.02%, 0.02% to 0.05%, or 0.013% to 0.015% of the positions that are cytosines in the desired DNA sequence are deleted in the dsDNA molecules in the pharmaceutical composition. 260. The pharmaceutical composition of any of embodiments 208-259, wherein in the amplicon region, an average of less than 0.01%, less than 0.005%, less than 0.003%, less than 0.0025%, or less than 0.002% of positions that are cytosines in the desired DNA sequence contain one or more inserted nucleotides 5' or 3' of the cytosines in the dsDNA molecules in the pharmaceutical composition. 261. The pharmaceutical composition of any of embodiments 208-260, wherein in the amplicon region, an average of 0.0015% to 0.01%, e.g., 0.0015% to 0.005%, 0.005% to 0.01%, 0.0015% to 0.003%, or 0.0015% to 0.0025% of the positions that are cytosines in the desired DNA sequence contain one or more inserted nucleotides 5' or 3' of the cytosines in the dsDNA molecules in the pharmaceutical composition. 262. The pharmaceutical composition of any of embodiments 208-261, wherein in the amplicon region, on average at least 98%, at least 99%, at least 99.5%, at least 99.7%, at least 99.778%, at least 99.8%, at least 99.9%, or at least 99.91% of the positions that are guanine in the desired DNA sequence are guanine in the dsDNA molecules in the pharmaceutical composition. 263. The pharmaceutical composition of any of embodiments 208-262, wherein in the amplicon region, on average 98% to 99.92%, such as 98% to 99%, 99% to 99.92%, 99.5% to 99.92%, 99.7% to 99.92%, 99.8% to 99.92%, 99.9% to 99.92%, or 99.778% to 99.91% of the positions that are guanine in the desired DNA sequence are guanine in the dsDNA molecules in the pharmaceutical composition. 264. The pharmaceutical composition of any of embodiments 208-263, wherein in the amplicon region, an average of less than 0.5%, less than 0.2%, less than 0.18%, less than 0.165%, less than 1%, less than 0.75%, less than 0.05%, or less than 0.046% of positions that are guanine in the desired DNA sequence are adenine in the dsDNA molecules in the pharmaceutical composition. 265. The pharmaceutical composition of any of embodiments 208-264, wherein in the amplicon region, an average of 0.04% to 0.5%, e.g., 0.04% to 0.2%, 0.2% to 0.5%, 0.04% to 0.18%, 0.04% to 0.05%, or 0.046% to 0.165% of positions that are adenine in the desired DNA sequence are adenine in the dsDNA molecules in the pharmaceutical composition. 266. The pharmaceutical composition of any of embodiments 208-265, wherein in the amplicon region, an average of less than 0.05, less than 0.02%, less than 0.01%, or less than 0.009% of positions that are guanine in the desired DNA sequence are cytosine in the dsDNA molecules in the pharmaceutical composition. 267. The pharmaceutical composition of any of embodiments 208 to 266, wherein in the amplicon region, an average of 0.0085% to 0.05%, such as 0.0085% to 0.02%, 0.02% to 0.05%, 0.0085% to 0.01%, or 0.009% to 0.01% of positions that are guanine in the desired DNA sequence are cytosine in the dsDNA molecules in the pharmaceutical composition. 268. The pharmaceutical composition of any of embodiments 208-267, wherein in the amplicon region, an average of less than 0.05%, less than 0.02%, less than 0.019%, less than 0.015%, or less than 0.011% of positions that are guanine in the desired DNA sequence are thymine or chemically modified uridine nucleotides in the dsDNA molecules in the pharmaceutical composition. 269. The pharmaceutical composition of any of embodiments 208-268, wherein in the amplicon region, an average of 0.01% to 0.05%, for example 0.01% to 0.03%, 0.03% to 0.05%, 0.01% to 0.02%, or 0.011% to 0.019% of positions that are guanines in the desired DNA sequence are thymine or chemically modified uridine nucleotides in the dsDNA molecules in the pharmaceutical composition. 270. The pharmaceutical composition of any of embodiments 208-269, wherein in the amplicon region, an average of less than 0.05%, less than 0.03%, less than 0.022%, less than 0.02%, or less than 0.19% of positions that are guanine in the desired DNA sequence are deleted in the dsDNA molecules in the pharmaceutical composition. 271. The pharmaceutical composition of any of embodiments 208-270, wherein in the amplicon region, an average of 0.015% to 0.05%, e.g., 0.015% to 0.03%, 0.03% to 0.05%, 0.015% to 0.02%, or 0.019% to 0.022% of positions that are guanine in the desired DNA sequence are deleted in the dsDNA molecules in the pharmaceutical composition. 272. The pharmaceutical composition of any of embodiments 208-271, wherein in the amplicon region, an average of less than 0.01%, less than 0.007%, less than 0.005%, or less than 0.004% of positions that are guanine in the desired DNA sequence contain one or more inserted nucleotides 5' or 3' of the guanine in the dsDNA molecules in the pharmaceutical composition. 273. The pharmaceutical composition of any of embodiments 208-272, wherein in the amplicon region, an average of 0.0035% to 0.01%, e.g., 0.0035% to 0.007%, 0.007% to 0.01%, or 0.0035% to 0.005% of the positions that are guanines in the desired DNA sequence contain one or more inserted nucleotides 5' or 3' of the guanines in the dsDNA molecules in the pharmaceutical composition. 274. The pharmaceutical composition of any of embodiments 208-273, wherein in the amplicon region, on average at least at least 98%, at least 98.5%, at least 98.511%, at least 99%, at least 99.5%, at least 99.9% or at least 99.904% of the positions that are thymine or chemically modified uridine nucleotides in the desired DNA sequence are thymine or chemically modified uridine nucleotides in the dsDNA molecules in the pharmaceutical composition. 275. The pharmaceutical composition of any of embodiments 208-274, wherein in the amplicon region, an average of 98% to 99.91%, for example 98% to 99%, 99% to 99.91%, 98.5% to 99.91%, 99.5% to 99.1%, or 98.511% to 99.904% of the positions that are thymine or chemically modified uridine nucleotides in the desired DNA sequence are thymine or chemically modified uridine nucleotides in the dsDNA molecules in the pharmaceutical composition. 276. The pharmaceutical composition of any of embodiments 208-275, wherein in the amplicon region, an average of less than 2%, less than 1.5%, less than 1.023%, less than 1%, less than 0.05%, less than 0.03%, or less than 0.023% of positions in the desired DNA sequence that are thymine or chemically modified uridine nucleotides are adenine in the dsDNA molecules in the pharmaceutical composition. 277. The pharmaceutical composition of any of embodiments 208-276, wherein in the amplicon region, an average of 0.02% to 2%, e.g., 0.02% to 1%, 1% to 2%, 0.02% to 1.5%, 0.02% to 0.05%, 0.02% to 0.03%, or 0.023% to 1.203% of positions that are thymine or chemically modified uridine nucleotides in the desired DNA sequence are adenine in the dsDNA molecules in the pharmaceutical composition. 278. The pharmaceutical composition of any of embodiments 208-277, wherein in the amplicon region, an average of less than 1%, less than 0.5%, less than 0.422%, less than 0.1%, less than 0.05%, or less than 0.047% of positions in the desired DNA sequence that are thymine or chemically modified uridine nucleotides are cytosine in the dsDNA molecules in the pharmaceutical composition. 279. The pharmaceutical composition of any of embodiments 208-278, wherein in the amplicon region, an average of 0.045% to 1%, e.g., 0.045% to 0.5%, 0.5% to 1%, 0.045% to 0.1%, 0.045% to 0.05%, or 0.047% to 0.422% of positions that are thymine or chemically modified uridine nucleotides in the desired DNA sequence are cytosine in the dsDNA molecules in the pharmaceutical composition. 280. The pharmaceutical composition of any of embodiments 208-279, wherein in the amplicon region, an average of less than 0.1%, less than 0.05%, less than 0.02%, less than 0.016%, less than 0.015%, or less than 0.013% of positions in the desired DNA sequence that are thymine or chemically modified uridine nucleotides are guanine in the dsDNA molecules in the pharmaceutical composition. 281. The pharmaceutical composition of any of embodiments 208-280, wherein in the amplicon region, an average of 0.012% to 0.1%, e.g., 0.012% to 0.05%, 0.05% to 0.1%, 0.012% to 0.02%, 0.012% to 0.015%, 0.012% to 0.013%, or 0.013% to 0.016% of the positions that are thymine or chemically modified uridine nucleotides in the desired DNA sequence are guanine in the dsDNA molecules in the pharmaceutical composition. 282. The pharmaceutical composition of any of embodiments 208-281, wherein in the amplicon region, an average of less than 0.1%, less than 0.05%, less than 0.02%, less than 0.016%, less than 0.015%, or less than 0.01% of the positions in the desired DNA sequence that are thymine or chemically modified uridine nucleotides are deleted in the dsDNA molecules in the pharmaceutical composition. 283. The pharmaceutical composition of any of embodiments 208-282, wherein in the amplicon region, an average of 0.009% to 0.1%, e.g., 0.009% to 0.05%, 0.05% to 0.1%, 0.009% to 0.02%, 0.009% to 0.01%, or 0.01% to 0.016% of the positions that are thymine or chemically modified uridine nucleotides in the desired DNA sequence are deleted in the dsDNA molecules in the pharmaceutical composition. 284. The pharmaceutical composition of any of embodiments 208-283, wherein in the amplicon region, an average of less than 0.01%, less than 0.005%, less than 0.003%, less than 0.0025%, or less than 0.002% of the positions in the desired DNA sequence that are thymine or chemically modified uridine nucleotides contain one or more inserted nucleotides 5' or 3' to the thymine or chemically modified uridine nucleotides in the dsDNA molecules in the pharmaceutical composition. 285. The pharmaceutical composition of any of embodiments 208-284, wherein in the amplicon region, an average of 0.0015% to 0.01%, e.g., 0.0015% to 0.005%, 0.005% to 0.01%, 0.0015% to 0.003%, or 0.0015% to 0.0025% of the positions that are thymine or chemically modified uridine nucleotides in the desired DNA sequence contain one or more inserted nucleotides 5' or 3' of the thymine or chemically modified uridine nucleotides in the dsDNA molecules in the pharmaceutical composition. 286. When multiple dsDNA molecules are introduced into a cell, the cell transcribes the dsDNA molecules to produce multiple RNA molecules, and the multiple RNA molecules are a) a first subpopulation of RNA molecules, wherein all of the RNA molecules in the first subpopulation have the same RNA sequence; and b) at least one additional RNA molecule, the additional RNA molecule having an RNA sequence that differs from the RNA molecules in the first subpopulation; 286. The pharmaceutical composition of embodiments 206 to 285, comprising: 287. The pharmaceutical composition of embodiment 286, wherein the first subpopulation of RNA molecules has a desired RNA sequence. 288. The pharmaceutical composition of embodiment 287, wherein the additional RNA molecule has one or more errors relative to the desired RNA sequence. 289. The pharmaceutical composition of embodiment 288, wherein the one or more errors comprise one or more of a substitution, insertion, or deletion. 290. The pharmaceutical composition of any of embodiments 286-289, wherein at least 20% or at least 30% of the RNA molecules in the plurality are part of the first subpopulation. 291. The pharmaceutical composition of any of embodiments 286-290, wherein 10% to 15%, 15% to 20%, 20% to 25%, or 25% to 30% of the RNA molecules in the pharmaceutical composition are part of the first subpopulation. 292. The pharmaceutical composition of any of embodiments 206-291, wherein when the plurality of dsDNA molecules are introduced into a cell, the cell transcribes the dsDNA molecules to produce a plurality of RNA molecules, and the plurality of RNA molecules comprises an amplicon region beginning with an initiation codon for an encoded polypeptide of the dsDNA molecule and spanning at least 200 base pairs, at least 210 base pairs, at least 220 base pairs, at least 230 base pairs, at least 240 base pairs, or at least 250 base pairs in the direction of transcription. 293. The pharmaceutical composition of any of embodiments 206-292, wherein when the plurality of dsDNA molecules are introduced into a cell, the cell transcribes the dsDNA molecules to produce a plurality of RNA molecules, the plurality of RNA molecules beginning with an initiation codon for an encoded polypeptide of the dsDNA molecule and comprising an amplicon region spanning from 200 base pairs to 210 base pairs, from 210 base pairs to 220 base pairs, from 220 base pairs to 230 base pairs, from 230 base pairs to 240 base pairs, or from 240 base pairs to 250 base pairs in the direction of transcription. 294. The pharmaceutical composition of any of embodiments 206 to 293, wherein when the multiple dsDNA molecules are introduced into a cell, the cell transcribes the dsDNA molecules to produce multiple RNA molecules, and the multiple RNA molecules include an amplicon region beginning with the initiation codon for the encoded polypeptide of the dsDNA molecule and spanning 230 base pairs in the direction of transcription. 295.The multiple RNA molecules are a) a first subpopulation of RNA molecules, each amplicon region in the first subpopulation having the same RNA sequence; and b) at least one additional RNA molecule, wherein the amplicon region of the additional RNA molecule has a different RNA sequence than the amplicon region in the first subpopulation; 295. The pharmaceutical composition of any of embodiments 292-294, comprising: 296. The pharmaceutical composition of embodiment 295, wherein the amplicon region of the first subpopulation of RNA molecules has a desired RNA sequence. 297. The pharmaceutical composition of embodiment 296, wherein the amplicon region of the additional RNA molecule has one or more errors relative to the desired RNA sequence. 298. The pharmaceutical composition of embodiment 297, wherein the one or more errors comprise one or more of a substitution, insertion or deletion. 299. The pharmaceutical composition of any of embodiments 295-298, wherein at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75% or at least 80% of the RNA molecules are part of the first subpopulation. 300. The pharmaceutical composition of any of embodiments 295-299, wherein 10% to 20%, 20% to 30%, 30% to 40%, 40% to 50%, 50% to 60%, 60% to 70%, 70% to 75%, or 75% to 80% of the RNA molecules are part of the first subpopulation. 301. The pharmaceutical composition of any of embodiments 287-300, wherein the RNA molecules in the plurality have an average of fewer than 10, fewer than 9, fewer than 8, fewer than 7, fewer than 6, fewer than 5, fewer than 4, fewer than 3, fewer than 2, or fewer than 0.94 substitutions per kilobase relative to the desired RNA sequence. 302. The pharmaceutical composition of any of embodiments 287-301, wherein the RNA molecules in the plurality have an average of 0.93 to 10, such as 0.93 to 1, 1 to 3, 3 to 5, 5 to 7, 7 to 9, 0.93 to 3, or 0.94 to 9.15 substitutions per kilobase relative to the desired RNA sequence. 303. The pharmaceutical composition of any of embodiments 287-302, wherein the RNA molecules in the plurality have an average of less than 1, less than 0.5, less than 0.2, less than 0.13, less than 0.1, less than 0.09, or less than 0.08 insertions per kilobase relative to the desired RNA sequence. 304. The pharmaceutical composition of any of embodiments 287-303, wherein the RNA molecules in the plurality have an average of 0.07 to 1, such as 0.07 to 0.1, 0.1 to 0.5, 0.5 to 1, or 0.07 to 0.15, insertions per kilobase relative to the desired RNA sequence. 305. The pharmaceutical composition of any of embodiments 287-304, wherein the RNA molecules in the plurality have an average of less than 1, less than 0.5, less than 0.4, less than 0.31, less than 0.3, less than 0.25, or less than 0.2 deletions per kilobase relative to the desired RNA sequence. 306. The pharmaceutical composition of any of embodiments 287-305, wherein the RNA molecules in the plurality have an average of 0.19 to 1, such as 0.19 to 0.3, 0.3 to 0.5, 0.5 to 1, 0.19 to 0.5, 0.19 to 0.35, or 0.2 to 0.31 deletions per kilobase relative to the desired RNA sequence. 307. The pharmaceutical composition of any of embodiments 287-306, wherein the RNA molecules in the plurality have an average of less than 10, less than 9.95, less than 9, less than 7, less than 5, less than 3, less than 2, less than 1.5, or less than 1.22 errors per kilobase relative to the desired RNA sequence. 308. The pharmaceutical composition of any of embodiments 287-307, wherein the RNA molecules in the plurality have an average of 1.2 to 10, such as 1.2 to 3, 3 to 5, 5 to 7, 7 to 10, 1.2 to 5, or 1.22 to 9.95 errors per kilobase relative to the desired RNA sequence. 309. The pharmaceutical composition of any of embodiments 287-308, wherein the RNA molecules in the plurality have an average of fewer than 20, fewer than 15, fewer than 10, fewer than 5, fewer than 4, fewer than 3, fewer than 2.5, or fewer than 2.04 mismatches per RNA molecule to the desired RNA sequence. 310. The pharmaceutical composition of any of embodiments 287-309, wherein the RNA molecules in the plurality have an average of 2 to 20, such as 2 to 5, 5 to 10, 10 to 15, 15 to 20, 2 to 3, or 2.04 to 19.89, mismatches per RNA molecule to the desired RNA sequence. 311. The pharmaceutical composition of any of embodiments 287-310, wherein the RNA molecules in the plurality have an average of less than 1, less than 0.5, less than 0.4, less than 0.3, less than 0.29, less than 0.2, or less than 0.17 insertions per RNA molecule relative to the desired RNA sequence. 312. The pharmaceutical composition of any of embodiments 287-311, wherein the RNA molecules in the plurality have an average of 0.16 to 1, such as 0.16 to 0.5, 0.5 to 1, 0.16 to 0.3, or 0.17 to 0.29 insertions per RNA molecule relative to the desired RNA sequence. 313. The pharmaceutical composition of any of embodiments 287-312, wherein the RNA molecules in the plurality have an average of less than 1, less than 0.8, less than 0.7, less than 0.68, less than 0.5, or less than 0.44 deletions per RNA molecule relative to the desired RNA sequence. 314. The pharmaceutical composition of any of embodiments 287-313, wherein the RNA molecules in the plurality have an average of 0.43 to 1, such as 0.43 to 0.8, 0.8 to 1, 0.43 to 0.5, or 0.44 to 0.68 deletions per RNA molecule relative to the desired RNA sequence. 315. The pharmaceutical composition of any of embodiments 287-314, wherein the RNA molecules in the plurality have an average of less than 21, less than 20.86, less than 15, less than 10, less than 5, less than 3, or less than 2.65 errors per RNA molecule relative to the desired RNA sequence. 316. The pharmaceutical composition of any of embodiments 287-315, wherein the RNA molecules in the plurality have an average of 2.64 to 21, such as 2.64 to 5, 5 to 10, 10 to 15, 15 to 21, or 2.65 to 20.86 errors per RNA molecule relative to the desired RNA sequence. 317. The pharmaceutical composition of any of embodiments 286-316, wherein the cells are HEKa cells. 318. The pharmaceutical composition of any of embodiments 206-317, wherein at least 80% of the dsDNA molecules of the plurality have chemically modified uridine nucleotides in at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, at least 75%, or at least 90% of the uridine and thymidine positions in the dsDNA molecules. 319. The pharmaceutical composition of any of embodiments 206-318, wherein at least 80% of the dsDNA molecules of the plurality have chemically modified uridine nucleotides at 1% to 100% (e.g., 1-5%, 5-10%, 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, 45-50%, 50%-55%, 55-60%, 60-65%, 65-70%, 70-75%, 75-80%, 80-85%, 85-90%, 90-95%, or 95% to 100%) of the uridine and thymidine positions in the dsDNA molecules. 320. The pharmaceutical composition of any of embodiments 206-319, wherein at least 50% of the dsDNA molecules of the plurality have chemically modified uridine nucleotides in at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, at least 75%, or at least 90% of the uridine and thymidine positions in the dsDNA molecules. 321. The pharmaceutical composition of any of embodiments 206-320, wherein at least 50% of the dsDNA molecules of the plurality have chemically modified uridine nucleotides at 1% to 100% (e.g., 1-5%, 5-10%, 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, 45-50%, 50%-55%, 55-60%, 60-65%, 65-70%, 70-75%, 75-80%, 80-85%, 85-90%, 90-95%, or 95% to 100%) of the uridine and thymidine positions in the dsDNA molecules. 322. The pharmaceutical composition of any of embodiments 206-321, wherein at least 90% of the dsDNA molecules of the plurality have chemically modified uridine nucleotides in at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, at least 75%, or at least 90% of the uridine and thymidine positions in the dsDNA molecules. 323. The pharmaceutical composition of any of embodiments 206-322, wherein at least 90% of the dsDNA molecules of the plurality have chemically modified uridine nucleotides at 1% to 100% (e.g., 1-5%, 5-10%, 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, 45-50%, 50%-55%, 55-60%, 60-65%, 65-70%, 70-75%, 75-80%, 80-85%, 85-90%, 90-95%, or 95% to 100%) of the uridine and thymidine positions in the dsDNA molecules. 324. A method for expressing a heterologous payload in a target cell, comprising: (i) introducing into a target cell the dsDNA molecule of any of embodiments 1 to 182, wherein the dsDNA molecule encodes a heterologous payload; (ii) maintaining (e.g., incubating) the cells under conditions suitable for expression of the heterologous payload from the dsDNA molecule; thereby expressing the heterologous payload in the target cell. 325. A method for expressing a therapeutic payload in a target cell, comprising: (i) introducing the dsDNA molecule of any of embodiments 1 to 182 into a target cell, wherein the dsDNA molecule comprises a therapeutic payload sequence; (ii) maintaining (e.g., incubating) the cells under conditions suitable for expression of the therapeutic payload from the therapeutic payload sequence of the dsDNA molecule; thereby expressing the therapeutic payload in the target cells. 326. A method for delivering a heterologous payload to a target cell, comprising introducing into the target cell a dsDNA molecule of any of embodiments 1 to 182, wherein the double-stranded region of the dsDNA molecule comprises a sequence encoding the heterologous payload, thereby delivering the heterologous payload to the target cell. 327. A method for delivering a therapeutic payload to a target cell, comprising introducing into the target cell a dsDNA molecule of any of embodiments 1-182, wherein the dsDNA molecule comprises a therapeutic payload sequence encoding the therapeutic payload, thereby delivering the therapeutic payload to the target cell. 328. A method for modulating (e.g., increasing or decreasing) a biological activity in a target cell, comprising: (i) introducing into a target cell the dsDNA molecule of any of embodiments 1 to 182, wherein the dsDNA molecule encodes a heterologous payload that modulates a biological activity in the target cell; (ii) maintaining (e.g., incubating) the cells under conditions suitable for expression of the heterologous payload from the dsDNA molecule; thereby modulating biological activity in the target cell. 329. The method of embodiment 328, wherein the heterologous payload increases biological activity in the target cell. 330. The method of embodiment 328, wherein the heterologous payload reduces biological activity in the target cell. 331. A method for modulating (e.g., increasing or decreasing) a biological activity in a target cell, comprising: (i) introducing the dsDNA molecule of any of embodiments 1 to 182 into a target cell, wherein the dsDNA molecule comprises a therapeutic payload sequence encoding a therapeutic payload that modulates biological activity in the target cell; (ii) maintaining (e.g., incubating) the cells under conditions suitable for expression of the therapeutic payload from the dsDNA molecule; thereby modulating biological activity in the target cell. 332. The method of embodiment 331, wherein the therapeutic payload increases biological activity in the target cell. 333. The method of embodiment 331, wherein the therapeutic payload reduces biological activity in the target cell. 334. The method of any of embodiments 328-333, wherein the biological activity comprises cell proliferation, cell metabolism, cell signaling, cell migration, differentiation, interaction, division, transport, homeostasis, osmosis or diffusion. 335. The method of any of embodiments 324-334, wherein the cell is an animal cell, such as a mammalian cell, such as a human cell. 336. The method of any of embodiments 324-335, which is carried out ex vivo or in vivo. 337. A method for treating a cell, tissue or subject in need thereof, comprising administering to the cell, tissue or subject a dsDNA molecule of any of embodiments 1-182 or a pharmaceutical composition of any of embodiments 183-323, wherein the double-stranded region of the dsDNA molecule encodes a heterologous payload, thereby treating the cell, tissue or subject. 338. A method for providing treatment to a cell, tissue or subject in need thereof, comprising administering to the cell, tissue or subject a dsDNA molecule of any of embodiments 1-182 or a pharmaceutical composition of any of embodiments 183-323, thereby treating the cell, tissue or subject. 339. A method for producing or manufacturing a double-stranded DNA (dsDNA) molecule, comprising: (a) providing a composition comprising a DNA template (e.g., a plasmid), a forward primer, a reverse primer, a DNA polymerase, unmodified deoxyribose nucleotides, and chemically modified uridine nucleotides having a substitution other than a hydrogen or methyl group at carbon 5 of uridine; (b) performing a polymerase chain reaction on the composition of (a); 183, thereby generating or manufacturing a dsDNA molecule, optionally the dsDNA molecule being the dsDNA molecule of any of embodiments 1-182. 340. The method of embodiment 339, further comprising purifying the dsDNA molecules, for example, the purification comprising the use of a DNA purification column or agarose gel purification. 341. The method of embodiment 339 or 340, wherein the DNA polymerase comprises KOD polymerase, KOD Xtreme polymerase, Deep Vent polymerase or KOD Multi&Epi (KME) polymerase. 342. The method of any of embodiments 339-341, wherein the unmodified deoxyribose nucleotides comprise dATP, dCTP, dTTP and / or dGTP. 343. The method of any of embodiments 339 to 342, wherein in the composition of (a), the percentage of uridine and thymidine nucleotides that are chemically modified uridine nucleotides is 10% to 20%, 20% to 30%, 30% to 40%, 40% to 50%, 50% to 60%, 60% to 70%, 70% to 80%, 80% to 90%, or 90% to 100%. 344. The method of any of embodiments 339-343, wherein the forward primer, the reverse primer, or both, contain a protelomerase recognition sequence, such as a TelN protelomerase recognition sequence. 345. (e.g., after step (b)) (c) incubating the dsDNA molecule with a protelomerase, e.g., TelN protelomerase; The method of any of embodiments 339 to 344, further comprising: 346. The method of any of embodiments 339-345, wherein the forward primer, the reverse primer, or both, contain a restriction enzyme recognition sequence. 347. (i) Incubating a dsDNA molecule with a restriction enzyme that cleaves the restriction enzyme recognition sequence, thereby producing a cleaved dsDNA molecule; (ii) incubating the cleaved dsDNA molecules with a DNA ligase, such as T3 DNA ligase, thereby generating ligated dsDNA molecules; and / or (iii) optionally, incubating the ligated dsDNA molecules with an exonuclease, e.g., T5 exonuclease; 347. The method of embodiment 346, further comprising: 348.(d) Ligating a dsDNA molecule into a hairpin DNA molecule containing a loop region and a double-stranded region containing one or more chemically modified nucleotides. The method of any of embodiments 339 to 347, further comprising: 349. The method of any of embodiments 339 to 348, further comprising ligating the dsDNA molecule to a self-annealed DNA molecule comprising a first region and a second region, the first region hybridizing to the second region. 350. The method of embodiment 349, wherein the self-annealing DNA molecule further comprises a loop between the first region and the second region. 351. The method of embodiment 350, wherein the loop comprises a heterologous functional sequence, such as a nuclear targeting sequence (e.g., a CT3 sequence) or a regulatory sequence. 352. The method of embodiment 349, wherein the self-annealed DNA molecule does not contain any unhybridized nucleotides (e.g., every nucleotide of the self-annealed DNA molecule is hybridized to another nucleotide). 353. The method of any of embodiments 348-352, further comprising ligating a second hairpin DNA molecule to the dsDNA molecule, wherein the second hairpin DNA molecule comprises a loop region and a double-stranded region, and optionally, the second hairpin DNA molecule comprises one or more chemically modified nucleotides in either or both of the loop region or the double-stranded region. 354. A method for producing or manufacturing a TDSC, comprising: a) providing a dsDNA molecule produced by the method of any of embodiments 339 to 353, wherein the dsDNA molecule comprises a closed end; b) incubating the TDSC with a double-stranded DNA exonuclease, such as exonuclease III, for example 1 μL of exonuclease III per 5 μg of DNA in 50 μL, for example as described in Example 2, at 37° C. for 1 hour; c) optionally purifying the TDSC treated in step b), for example by silica membrane column, for example as described in Example 2. thereby producing or manufacturing a TDSC. 355. A dsDNA molecule produced by the method of any of embodiments 339 to 354.

[0006] definition As used herein, the term "aminoallyl" refers to a group of the formula (-[CH=CH] n CH2NH2) where n=1-10 (e.g., 1-5, such as 1).

[0007] As used herein, the term "amplicon region" refers to a specific contiguous region of a DNA or RNA molecule. In some embodiments, the amplicon region can be used as a template for PCR using a first PCR primer and a second PCR primer that flank the amplicon region. For clarity, in such cases, the region of the PCR template to which the first and second PCR primers bind is not included in the amplicon region. The length of an amplicon is typically given in base pairs, but the amplicon region can be found in a single-stranded or double-stranded nucleic acid molecule. Thus, an amplicon region that is 200 base pairs in length can be used to refer to a 200-base pair double-stranded region or a 200-nucleotide single-stranded region.

[0008] As used herein, the term "antibody" refers to a molecule that specifically binds to or is immunologically reactive with a particular antigen and comprises at least the variable domain of a heavy chain, typically comprising at least the variable domains of an immunoglobulin heavy and light chains. Antibodies and antigen-binding fragments, variants, or derivatives thereof include, but are not limited to, polyclonal, monoclonal, multispecific, human, humanized, primatized, or chimeric antibodies, heteroconjugate antibodies (e.g., bispecific, trispecific, and tetraspecific antibodies, diabodies, triabodies, and tetrabodies), single domain antibodies (sdAbs), epitope-binding fragments such as Fab, Fab', and F(ab').sub.2, Fd, Fv, single-chain Fvs (scFvs), rIgG, single-chain antibodies, disulfide-linked Fvs (sdFvs), nanobodies, fragments comprising either a VL or VH domain, fragments produced by a Fab expression library, and anti-idiotypic (anti-Id) antibodies. Antibodies described herein can be of any type (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2), or subclass of immunoglobulin molecule. Furthermore, unless otherwise indicated, the term "monoclonal antibody" (mAb) is meant to include both intact molecules and antibody fragments (such as, for example, Fab and F(ab')2 fragments) that are capable of specifically binding to a target protein. Fab and F(ab')2 fragments lack the Fc fragment of an intact antibody.

[0009] As used herein, the term "carrier" refers to a compound, composition, reagent, or molecule that facilitates or promotes the transport or delivery of a composition (e.g., a dsDNA molecule described herein) into a cell. For example, a carrier can be a partially or completely encapsulating agent.

[0010] As used herein, the term "chemically modified nucleotide," as used herein with respect to DNA, refers to a nucleotide that contains one or more structural differences compared to standard deoxyribonucleotides (i.e., G, T, C, and A). A chemically modified nucleotide can have a chemically modified nucleobase (compared to a standard nucleotide), a chemically modified sugar, a chemically modified phosphodiester linkage, or a combination thereof. No particular production process is implied; for example, a chemically modified nucleotide can be produced directly by chemical synthesis or by covalently modifying a standard nucleotide.

[0011] As used herein, the term "chemically modified uridine nucleotide," as used herein with respect to DNA, refers to a chemically modified nucleotide in which the nucleobase comprises a monocyclic six-membered ring in which carbon 4 is covalently linked to oxygen via a double bond, and the nucleobase of the chemically modified uridine nucleotide comprises one or more structural differences compared to standard uracil and thymine nucleobases. In some embodiments, the C-5 position of the nucleobase may have a substitution other than H or a methyl group. For example, the C-5 position of the nucleobase may be -(CH2) m OH (where m = 1 to 10), -halogen, -(CH2) n -CHO (where n = 0 to 10), -(CH2) p They may have COOH (where p=0-10), -aminoallyl, -S-(C1-C6)alkyl, or -propargylamino substitutions. In some embodiments, the chemically modified uridine nucleotide further comprises a chemical modification on the sugar or phosphodiester linkage. No particular production process is implied.

[0012] As used herein, the term "closed end" refers to a portion of a DNA molecule located at one end of a double-stranded region in which all nucleotides within the portion of the DNA molecule are covalently linked to adjacent nucleotides on either side. In some embodiments, the closed end may include a loop containing one or more nucleotides that are not hybridized to another nucleotide. In some embodiments, all nucleotides at the closed end are hybridized to another nucleotide. In some embodiments, the dsDNA molecule includes a first closed end (e.g., upstream of the heterologous entity sequence) and a second closed end (e.g., downstream of the heterologous entity sequence).

[0013] As used herein, the term "open end" refers to a portion of a DNA molecule located at one end of a double-stranded region in which at least one nucleotide (the "terminal nucleotide") is covalently linked to exactly one other nucleotide. In some embodiments, the terminal nucleotide comprises a free 5' phosphate. In some embodiments, the terminal nucleotide comprises a free 3' OH. In some embodiments, in a dsDNA molecule comprising a first DNA strand and a second DNA strand, the open end comprises a first terminal nucleotide on the first DNA strand and a second terminal nucleotide on the second DNA strand. In some embodiments, the dsDNA molecule comprises a first open end (e.g., upstream of a heterologous entity sequence) and a second open end (e.g., downstream of a heterologous entity sequence). In some embodiments, the open end comprises a blunt end, a sticky end, or a Y-adapter.

[0014] As used herein, the term "desired DNA sequence" refers to a DNA sequence that a user intends to generate. In some embodiments, the desired DNA sequence is the sequence of the amplicon region in a PCR template. As will be clear from the context, in some embodiments (e.g., when all dsDNA molecules in a subpopulation have the same DNA sequence, which is the desired DNA sequence), the DNA molecule has the desired DNA sequence throughout its entire length. In other embodiments, the DNA molecule may have the desired DNA sequence in a specific region of the DNA molecule (e.g., the amplicon region), and may have one or more errors outside of that region.

[0015] As used herein, the term "desired RNA sequence" refers to the RNA sequence that the user intends to generate. In some embodiments, the desired RNA sequence is a sequence that is generated by error-free transcription of a desired DNA sequence. As will be clear from the context, in some embodiments, the RNA molecule has the desired RNA sequence throughout its entire length, while in other embodiments, the RNA molecule may have the desired RNA sequence in a specific region (e.g., amplicon region) of the RNA molecule, and may have one or more errors outside of that region.

[0016] As used herein, the term "DNA" refers to any compound and / or substance that comprises at least two (e.g., at least 10, at least 20, at least 50, at least 100) covalently linked deoxyribonucleotides. In some embodiments, the DNA is a single oligonucleotide strand, while in other embodiments, the DNA comprises multiple oligonucleotide strands, and in still other embodiments, the DNA is part of an oligonucleotide strand. In some embodiments, the DNA is a compound and / or substance that is or can be incorporated into an oligonucleotide strand via a phosphodiester bond. In some embodiments, the DNA comprises only standard nucleotides. In some embodiments, the DNA comprises one or more chemically modified nucleotides. In some embodiments, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% of the sugars of the DNA are deoxyribose sugars. In some embodiments, the DNA has been prepared by one or more of isolation from a natural source, enzymatic synthesis (in vivo or in vitro) by polymerization based on a complementary template, reproduction in a recombinant cell or system, and chemical synthesis.

[0017] As used herein, the term "DNA end form" refers to a structure comprising DNA located at the end of a dsDNA molecule (e.g., TDSC). In some embodiments, the DNA end form comprises a closed end. In other embodiments, the DNA end form comprises an open end. In some embodiments, the DNA end form comprises a hairpin, a loop, a Y-adapter, a blunt end, or a sticky end. The DNA end form may comprise one or both of a single-stranded region and a double-stranded region. The DNA end form may comprise standard nucleotides, chemically modified nucleotides, or a combination thereof. In some embodiments, the DNA end form comprises 3 to 100 nucleotides. In some embodiments, the dsDNA molecule comprises a first DNA end form at a first end and a second DNA end form at a second end. In some embodiments, the first DNA end form and the second DNA end form of the dsDNA molecule are the same type. In some embodiments, the first DNA end form and the second DNA end form of the dsDNA molecule are different types.

[0018] As used herein with respect to nucleic acid sequences, the term "error" refers to a difference in the nucleotide sequence in a nucleic acid sequence relative to a desired RNA or DNA sequence. In some embodiments, the error is a substitution, insertion, or deletion. In some embodiments, the error may be introduced by PCR. In some embodiments, the error may be introduced by a polymerase, such as a DNA polymerase or an RNA polymerase. For the avoidance of doubt, the replacement of a standard thymine with a chemically modified uridine nucleotide is not considered an error.

[0019] As used herein, the term "exonuclease resistant," when used to describe DNA, means that the DNA is resistant to the exonuclease assay described in Example 2 if it contains closed ends, and is resistant to the exonuclease assay described in Example 3 if it contains open ends (e.g., two open ends).

[0020] As used herein, the term "heterologous," when used to describe a first element in relation to a second element, means that the first and second elements are not naturally occurring in the described arrangement. For example, a heterologous polypeptide, nucleic acid molecule, construct, or sequence refers to (a) a polypeptide, nucleic acid molecule, or portion of a polypeptide or nucleic acid molecule sequence that is not native to the cell in which it is expressed, (b) a polypeptide or nucleic acid molecule, or portion of a polypeptide or nucleic acid molecule, that has been modified or mutated relative to its native state, or (c) a polypeptide or nucleic acid molecule that has altered expression compared to native expression levels under similar conditions. For example, heterologous regulatory sequences (e.g., promoters, enhancers) can be used to regulate the expression of a gene or nucleic acid molecule in a manner different from the manner in which the gene or nucleic acid molecule is normally expressed in nature. In another example, a heterologous domain of a polypeptide or nucleic acid sequence (e.g., a DNA-binding domain of a polypeptide or a nucleic acid encoding a DNA-binding domain of a polypeptide) can be positioned relative to other domains or can be of a different sequence or from a different source relative to other domains or portions of a polypeptide or its encoding nucleic acid. In certain embodiments, a heterologous nucleic acid molecule may be present in the native host cell genome, but may have an altered expression level or a different sequence, or both. In other embodiments, a heterologous nucleic acid molecule may not be endogenous to the host cell or host genome, but may instead be introduced into the host cell by transformation (e.g., transfection, electroporation); the added molecule may be integrated into the host genome or may exist as extrachromosomal genetic material transiently (e.g., mRNA) or metastable for more than one generation (e.g., episomal viral vectors, plasmids, or other self-replicating vectors).

[0021] As used herein, the term "heterologous functional sequence" refers to a nucleic acid sequence that is heterologous to an adjacent (e.g., directly adjacent) nucleic acid sequence and has one or more biological functions. In some embodiments, the biological function includes targeting to an organelle, e.g., nuclear targeting. In some embodiments, the heterologous functional sequence includes a nuclear targeting sequence or a regulatory sequence.

[0022] As used herein, the terms "increase" and "reduce" refer to modulation that results in a greater or lesser amount of a measure of function, expression, or activity, respectively, compared to a reference. For example, after administration of a dsDNA molecule in the methods described herein, the amount of a measure described herein (e.g., the level of gene expression or a marker of innate immunity) can be increased or decreased by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% or more in a subject relative to the amount of the marker before administration or relative to administration of a control dsDNA molecule, such as a dsDNA molecule containing chemically modified nucleotides, compared to a control dsDNA molecule containing only unmodified nucleotides. Generally, the measure is measured after administration at a time when the administration has had the recited effect, for example, at least 1 day, 1 week, 1 month, 3 months, or 6 months after the treatment regimen has begun.

[0023] As used herein, the term "linear" with respect to dsDNA molecules (e.g., TDSC) described herein means a nucleic acid comprising two DNA strands or portions of strands that hybridize to each other (thereby forming a double-stranded region), the structure comprising two ends. The ends may be closed or open. The two strands that hybridize to each other may be partially or fully complementary. In some embodiments, a linear dsDNA molecule consists of a single strand of DNA that is circular under denaturing conditions; under physiological conditions, a first portion of the strand hybridizes to a second portion of the strand (thereby forming a double-stranded region), and the linear dsDNA molecule comprises a first closed end comprising a first loop and a second closed end comprising a second loop.

[0024] As used herein, the term "loop" refers to a single-stranded nucleic acid sequence that is connected at both ends by a double-stranded region called a "stem" to form a "stem-loop."

[0025] As used herein, the term "maintenance sequence" refers to a DNA sequence or motif that allows or promotes the retention of a DNA molecule in the nucleus through cell division. Maintenance sequences typically interact with proteins that promote chromatin looping, thereby allowing DNA replication and / or transcription in the nucleus. An example of a maintenance sequence is a scaffold / matrix attachment region (S / MAR element).

[0026] As used herein, a "nuclear targeting sequence" is a DNA sequence that allows or facilitates DNA entry into the nucleus of a target cell.

[0027] As used herein, a "pharmaceutical composition" or "medicament" is a composition or formulation indicated for animal, e.g., human, or veterinary medical use, e.g., prophylactic or therapeutic use in non-human animals or humans. A medicament comprises an active agent having a biological effect on a cell or tissue of a subject, e.g., having pharmacological activity or an effect in the mitigation, treatment, or prevention of disease, in combination with a pharmaceutically acceptable excipient or diluent. Pharmaceutical composition also refers to a finished dosage form or formulation of a prophylactic or therapeutic composition.

[0028] As used herein, the terms "peptide," "polypeptide," and "protein" are used interchangeably and refer to compounds comprising amino acid residues covalently linked by peptide bonds or by means other than peptide bonds. A protein or peptide must contain at least two amino acids, and there is no limit to the maximum number of amino acids that a protein or peptide sequence may comprise. A polypeptide includes any peptide or protein comprising two or more amino acids joined to each other by peptide bonds or by means other than peptide bonds. As used herein, the term refers to both short chains, e.g., commonly referred to in the art as peptides, oligopeptides, and oligomers, and longer chains, of which there are many varieties, commonly referred to in the art as proteins. In some embodiments, a polypeptide comprises non-standard amino acid residues.

[0029] As used herein, the term "propargylamino" refers to the functional group -C≡CCH2NH2.

[0030] As used herein, the term "protelomerase sequence" refers to a nucleotide sequence that can be generated by a protelomerase that links a first protelomerase recognition sequence (PRS) to a second PRS. In some embodiments, the protelomerase sequence is generated by a process that includes a protelomerase, while in other embodiments, the protelomerase sequence is generated by a process that does not include a protelomerase (e.g., by solid-phase synthesis).

[0031] As used herein, the "sense strand" of a dsDNA is the strand that has the same sequence as an mRNA or pre-mRNA encoding a functional protein and does not function as a template for transcription. The "antisense strand" of a dsDNA is the strand that has a sequence complementary to an mRNA or pre-mRNA encoding a functional protein and / or can function as a template for transcription.

[0032] As used herein, the term "double-stranded DNA molecule" or dsDNA molecule refers to a DNA composition comprising two complementary strands of deoxyribonucleotides that base-pair with each other. The two complementary strands may be perfectly complementary or may have one or more mismatches, e.g., forming a bulge. Either of the two strands may, in some embodiments, have a self-complementary pairing region that forms an intramolecular / intrastrand double-stranded motif in a folded configuration, e.g., a hairpin loop, junction, bulge, or internal loop. In some embodiments, the dsDNA molecule is circular or linear. In some embodiments, the dsDNA molecule contains one or two closed ends. In some embodiments, the two complementary strands of deoxyribonucleotides (e.g., in a closed-ended dsDNA molecule) are covalently linked. In some embodiments, the dsDNA molecule is a TDSC.

[0033] As used herein, the term "therapeutic double-stranded construct" ("TDSC") refers to a linear construct comprising DNA, wherein the construct is at least partially double-stranded. A TDSC does not comprise a plasmid backbone sequence (e.g., does not comprise a bacterial origin of replication). A TDSC does not comprise a viral capsid or viral envelope. In some embodiments, a TDSC comprises closed or open ends (e.g., blunt or sticky ends). In some embodiments, a TDSC is suitable for administration to a human subject.

[0034] As used herein, the term "terminal nucleotide" refers to a nucleotide that is covalently linked to exactly one other nucleotide. In some embodiments, the terminal nucleotide comprises a free 5' phosphate. In some embodiments, the terminal nucleotide comprises a free 3' OH.

[0035] As used herein, "treatment" or "treating" refers to the medical management of a subject with the intent to improve, ameliorate, stabilize (i.e., not worsen), prevent, or cure a disease, condition, or disorder. The term includes active treatment (treatment directed at ameliorating the disease, condition, or disorder), causal treatment (treatment directed at the cause of the associated disease, condition, or disorder), symptomatic treatment (treatment designed to relieve symptoms), preventative treatment (treatment directed at minimizing or partially or completely preventing the occurrence of the associated disease, condition, or disorder), and supportive treatment (treatment used to complement another therapy). Treatment also includes the reduction in the extent of the disease or condition, whether detectable or undetectable, preventing the spread of the disease or condition, slowing or slowing the progression of the disease or condition, and the improvement or palliation and remission (whether partial or total) of the disease or condition. "Ameliorating" or "alleviating" a disease or condition means lessening the severity and / or undesirable clinical symptoms of the disease, disorder or condition and / or slowing or prolonging its progression over time compared to the severity or course of time in the absence of treatment. "Treatment" can also mean prolonging survival as compared to expected survival in the absence of treatment. Those in need of treatment include those already with the condition or disorder as well as those prone to the condition or disorder or those in whom the condition or disorder is to be prevented.

[0036] As used herein, the term "Y-adapter" refers to a nucleic acid structure comprising a first nucleic acid region and a second nucleic acid region that are complementary (e.g., fully complementary) to each other, and the first and second regions can hybridize to form a double-stranded region. The first nucleic acid region is covalently linked to a third nucleic acid region, and the second nucleic acid region is covalently linked to a fourth nucleic acid region, and the third and fourth nucleic acid regions are not substantially complementary to each other, and the third and fourth regions can be single-stranded. The first nucleic acid region is 3' of the third nucleic acid region, and the second nucleic acid region is 5' of the fourth nucleic acid region. As a result, the third and fourth regions can be located on the same side of the double-stranded region. The Y-adapter can be part of a dsDNA molecule. [Brief explanation of the drawings]

[0037] [Figure 1-1] (FIGS. 1A-1B) A series of diagrams illustrating exemplary covalently closed DNA end configurations that may be included (e.g., at one or both ends of a dsDNA molecule) in a dsDNA molecule, e.g., a therapeutic double-stranded construct (TDSC), as described herein. In (A), an exemplary dsDNA molecule, e.g., a TDSC, is shown that does not include a loop end (e.g., a protelomerase sequence), an inverted terminal repeat (ITR), or a hairpin at its terminus, which may be composed of unmodified nucleotides (white symbols) or may include chemically modified nucleotides (gray symbols). Chemically modified nucleotides may include, for example, nucleotides modified at the backbone, sugar, or base, or nucleotides conjugated to a peptide or protein. In some examples, both DNA strands are unmodified. In some examples, both DNA strands are chemically modified. In some examples, the antisense strand is chemically modified. In some examples, the sense strand is chemically modified. Solid boxes represent dsDNA molecules that are covalently closed at the ends with hairpins, e.g., linear covalently closed dsDNA molecules with terminal morphologies containing phosphorothioate modifications. Dashed boxes represent dsDNA molecules that are covalently closed without looped ends, e.g., linear covalently closed dsDNA molecules with Tel N-terminal morphologies. [Figure 1-2] Same as above. [Figure 2]

[0023] Figure 1 is a series of diagrams illustrating double-stranded DNA constructs comprising exemplary dsDNA molecules, e.g., TDSCs, comprising exemplary DNA end forms that are not covalently closed (e.g., at one or both ends). Such exemplary dsDNA molecules, e.g., TDSCs, can include Y-ends (e.g., Y-adapters, e.g., as described herein). DNA end forms, in some instances, can be composed of unmodified nucleotides (white symbols). In some instances, DNA end forms include chemically modified nucleotides (gray symbols). Chemically modified nucleotides can include, for example, nucleotides modified at the backbone, sugar, or base, or nucleotides conjugated to peptides or proteins. In some instances, both DNA strands are unmodified. In some instances, both DNA strands are chemically modified. In some instances, the antisense strand is chemically modified. In some instances, the sense strand is chemically modified. An exemplary DNA construct lacking a DNA end form or chemical modification (i.e., an unmodified double-stranded DNA molecule) is also shown in the upper right. [Figure 3] Figure 1 shows gel electrophoresis images of PCR products from reactions using KOD Xtreme Polymerase and varying amounts of 5-hydroxymethyl-dUTP and unmodified dTTP. For example, 25% incorporation represents a 1:3 ratio of 5-hydroxymethyl-dUTP to unmodified dTTP in the PCR reaction. The dashed box indicates the desired product. [Figure 4] 4 shows the generation of covalently closed linear dsDNA molecules having terminal morphologies containing phosphorothioate modifications. Figure 4 discloses SEQ ID NOS: 115-116, respectively, in the order listed. [Figure 5] 5 shows the generation of covalently closed linear dsDNA molecules with Tel N-terminal conformation. Figure 5 discloses SEQ ID NOS: 117-118, 59 and 58, respectively, in the order listed. [Figure 6] FIG. 1 shows a circular dsDNA molecule with or without chemical modifications. [Figure 7]7 shows an exemplary method for generating circular dsDNA molecules. Linear dsDNA molecules can be contacted with a restriction enzyme (e.g., KpnI) to create compatible sticky ends, which can then be linked together by ligation to generate circular dsDNA. Figure 7 discloses SEQ ID NOs: 119, 121, 120, and 122, respectively, in the order listed. [Figure 8] (Figures 8-9) Fragment analyzer traces of circular dsDNA produced in reactions using 25% 5-hydroxymethyluridine (Figure 8) or 75% 5-hydroxymethyluridine (Figure 9). [Figure 9] Same as above. [Figure 10] (Figures 10-11) Fragment analyzer traces of linear, covalently closed dsDNA molecules with end morphologies containing phosphorothioate modifications generated in reactions using 25% 5-hydroxymethyluridine (Figure 10) or 75% 5-hydroxymethyluridine (Figure 11). [Figure 11] Same as above. [Figure 12] (Figures 12-13) Fragment analyzer traces of linear, covalently closed dsDNA molecules with Tel N-terminal morphology produced in reactions using 25% 5-hydroxymethyluridine (Figure 12) or 75% 5-hydroxymethyluridine (Figure 13). [Figure 13] Same as above. [Figure 14] Graph showing the percentage of U937, THP-1, and HEKa cells expressing mCherry after lipofection with circular dsDNA constructs containing 5-hydroxymethyluridine modifications compared to cells lipofected with unmodified dsDNA constructs. [Figure 15]Figure 4 is a scatter plot showing the innate immune response of HEKa cells to linear, covalently closed dsDNA molecules containing six phosphorothioate modifications at each end and containing 5-hydroxymethyluridine, 5-formyluridine, or other modifications, as shown in Figure 4, or dsDNA molecules containing unmodified thymine instead of modified uridine. The x-axis represents the reduction in interferon signaling, as defined as the reduction in the mean fold change of the markers IFNB and CXCL10, for dsDNA containing unmodified thymine instead of modified uridine. The y-axis represents the reduction in inflammatory cytokine signaling, as defined as the reduction in the mean fold change of the markers IL6 and TNFa, for dsDNA containing unmodified thymine instead of modified uridine. Dashed ovals represent other dsDNA chemical modifications (n ​​= 42). [Figure 16] Figure 4 shows scatter plots of innate immune responses and reporter gene expression for linear, covalently closed dsDNA molecules containing six phosphorothioate modifications at each end and containing 5-hydroxymethyluridine, 5-formyluridine, and other chemical modifications, as shown in Figure 4. The x-axis represents the reduction in innate immune signaling, as defined as the reduction in the mean fold change of the markers IFNB, CXCL10, IL6, and TNFα, relative to dsDNA containing unmodified thymine instead of modified uridine. The y-axis represents relative reporter gene expression, as defined as the percentage of mCherry+ cells relative to control dsDNA containing unmodified thymine instead of modified uridine. Dashed ovals represent other dsDNA chemical modifications (n=38). [Figure 17] 1 is a gel electrophoresis image showing DNA products generated by PCR using 100% 5-hydroxymethyl-dUTP substitution for dTTP in the PCR reaction (indicated by "M") or unmodified dTTP (i.e., 0% 5-hydroxymethyl-dUTP) in the PCR reaction (indicated by "U"). [Figure 18](Figures 18A-18C) Graphs showing mCherry expression in HEKa cells transfected with circular dsDNA constructs generated in reactions using unmodified dTTP (Unmod), 75% 5-hydroxymethyluridine (HMU75), or 100% 5-hydroxymethyluridine (HMU100). Figure 18A shows the percentage of mCherry+ cells, Figure 18B shows the mean fluorescence intensity (MFI) of expression in mCherry+ cells, and Figure 18C shows the total fluorescence intensity of mCherry+ cells relative to background. [Figure 19] (Figures 19A-19D) Graphs showing the innate immune response of circular dsDNA constructs generated in reactions using unmodified dTTP (Unmod), 75% 5-hydroxymethyluridine (HMU75), or 100% 5-hydroxymethyluridine (HMU100). Expression of CXCL10 (Figure 19A), interferon beta (IFNB, Figure 19B), IL6 (Figure 19C), and interferon lambda (IFNL, Figure 19D) relative to background is shown. [Figure 20] This is a pair of graphs showing the function (here, the ability to produce a protein, in this case mCherry) of semi-modified dsDNA molecules produced in reactions using 100% 5-hydroxymethyluridine (5hmU100), 100% 5-methylthiouridine (5mtU100), or 25% 5-formyluridine (5fU25) and circular dsDNA (cdsDNA) molecules produced in reactions using 75% 5-hydroxymethyluridine (5hmU75) or 100% 5-hydroxymethyluridine (5hmU100). Function was measured as total fluorescence over background (left panel) or % mCherry+ cells (right panel). [Figure 21]20 and 21 are a pair of graphs showing the immune stealth properties of semi-modified dsDNA molecules produced in reactions using 100% 5-hydroxymethyluridine (5hmU100), 100% 5-methylthiouridine (5mtU100), or 25% 5-formyluridine (5fU25), and circular dsDNA molecules produced in reactions using 75% 5-hydroxymethyluridine (5hmU75) or 100% 5-hydroxymethyluridine (5hmU100), based on IL6 levels (left panel) or CXCL10 levels (right panel). In Figures 20 and 21, P6 unmodified refers to closed-end dsDNA that has phosphorothioates but lacks modified nucleobases. DETAILED DESCRIPTION OF THE INVENTION

[0038] The present disclosure relates to compositions and methods for providing an effector, e.g., a therapeutic effector, to a cell, tissue, or subject, e.g., in vivo or in vitro. The effector can be a DNA sequence, a polypeptide, e.g., a therapeutic protein, or RNA, e.g., a regulatory RNA or mRNA.

[0039] Chemically modified nucleotides The dsDNA molecule described herein can comprise chemically modified nucleotide, such as chemically modified uridine nucleotide.Without being bound by theory, in some embodiments, the chemically modified uridine nucleotide described herein supports the expression of genes on dsDNA molecule, while increasing the " stealth " of dsDNA molecule against immune response.Exemplary chemically modified uridine nucleotide is provided below.

[0040] The nucleobase comprised by 5-hydroxymethyluridine is shown below as Formula II. [ka]

[0041] The nucleobase comprised by 5-aminoallyl uridine is shown below as Formula III. [ka]

[0042] The nucleobase comprised by 5-bromouridine is shown below as Formula IV. [ka]

[0043] The nucleobase comprised by 5-iodouridine is shown below as Formula V. [ka]

[0044] The nucleobase comprised by 5-propargylaminouridine is shown below as Formula VI. [ka]

[0045] The nucleobase comprised by 5-formyluridine is shown below as Formula VII. [ka]

[0046] The nucleobase comprised by 5-carboxyuridine is shown below as Formula VIII. [ka]

[0047] The nucleobase comprised by 5-methylthiouridine is shown below as Formula IX. [ka]

[0048] The dsDNA molecules described herein may have chemical modifications of the nucleobase, sugar, and / or phosphate backbone (e.g., as shown in Figures 1A-2). Without wishing to be bound by theory, such modifications may be useful to protect the DNA from degradation (e.g., from exonucleases) or from the immune system of the host tissue or subject. Generally, chemically modified nucleotides have the same base-pairing specificity as unmodified nucleotides; for example, a chemically modified adenine "A" can base pair with a thymine "T." In certain embodiments, a chemical modification (e.g., one or more modifications) is present in each of the sugar and internucleoside linkage.

[0049] In some embodiments, the dsDNA molecule comprises at least one chemical modification. Examples of chemical modifications to DNA useful in the methods described herein include, for example, 5-hydroxymethyluridine (5-hydroxymethyl-2'-deoxyuridine, 5hmU), 5-aminoallyluridine (5-aminoallyl-2'-deoxyuridine), 5-bromouridine (5-bromo-2'-deoxyuridine), 5-iodouridine (5-iodo-2'-deoxyuridine), 5-propargylaminouridine (5-propargylamino-2'-deoxyuridine), 5-formyluridine (5-formyl-2'-deoxyuridine, 5-fU), 5-carboxyuridine (5-carboxy-2'-deoxyuridine), or 5-methylthiouridine (5-methylthio-2'-deoxyuridine, 5mtU).

[0050] Examples of chemical modifications to DNA useful in the methods described herein include, for example, phosphorothioate or S and R phosphorothioate linkages. See, e.g., Pu et al. 2020. An in-vitro DNA phosphorothioate modification reaction. Mol Microbiol. 113:452-463; Zheng & Sheng. 2021.

[0051] In some embodiments, the dsDNA molecules described herein may contain phosphorothioate-modified nucleotides. In some embodiments, the DNA terminal forms (e.g., exonuclease-resistant DNA terminal forms) described herein may contain phosphorothioate-modified nucleotides. In some embodiments, the dsDNA molecules described herein may contain S and R phosphorothioate-modified nucleotide linkages. In one embodiment, the phosphorothioate linkages are prepared according to Iwamoto et al., 2017, Nature Biotechnology, Volume 35:845-851. Briefly, nucleoside 3'-oxazaphospholidine derivative monomers undergo stereocontrolled oligonucleotide synthesis involving repeated capping and sulfuration to generate stereocontrolled phosphorothioate linkages. The final sample is analyzed by reverse-phase high-performance liquid chromatography (RP-HPLC) and ultra-performance liquid chromatography mass spectrometry (UPLC / MS) to determine the stereochemistry of the modification. Nucleic acids containing phosphorothioate linkages are also commercially available.

[0052] In embodiments, a dsDNA molecule described herein, or one strand of a dsDNA molecule (e.g., the sense strand or the antisense strand), contains 1 to 100% chemically modified nucleotides, 1% to 90% chemically modified nucleotides, 1% to 80% chemically modified nucleotides, 1% to 70% chemically modified nucleotides, 1% to 60% chemically modified nucleotides, 1% to 50% chemically modified nucleotides, 1% to 40% chemically modified nucleotides, 1% to 30% chemically modified nucleotides, 1% to 20% chemically modified nucleotides, 1% to 15% chemically modified nucleotides, 1% to 10% chemically modified nucleotides, 20% to 90% chemically modified nucleotides, or 20% to 80% chemically modified nucleotides. In embodiments, a dsDNA molecule described herein or one strand of a dsDNA molecule (e.g., the sense strand or the antisense strand) contains at least 1% chemically modified nucleotides, at least 5% chemically modified nucleotides, at least 10% chemically modified nucleotides, at least 15% chemically modified nucleotides, at least 20% chemically modified nucleotides, at least 25% chemically modified nucleotides, at least 30% chemically modified nucleotides, at least 40% chemically modified nucleotides, at least 50% chemically modified nucleotides, at least 60% chemically modified nucleotides, at least 70% chemically modified nucleotides, at least 80% chemically modified nucleotides, at least 85% chemically modified nucleotides, at least 90% chemically modified nucleotides, at least 92% chemically modified nucleotides, at least 95% chemically modified nucleotides, or at least 97% chemically modified nucleotides. In embodiments, a dsDNA molecule described herein, or one strand of a dsDNA molecule (e.g., the sense strand or the antisense strand), contains 0-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, or 10%-50% of uridine and thymidine nucleotides that are chemically modified.

[0053] In embodiments, chemically modified nucleotides, such as the modifications described herein, can be introduced in the dsDNA molecules described herein throughout the sequence, within certain elements of the sequence, such as elements described herein, at the 5' or 3' end, and / or between the last 10, 8, 6, 5, 4, 3, or 2 nucleotides at the 5' or 3' end.

[0054] In some embodiments, the dsDNA molecule as described herein comprises chemically modified nucleotides on only one strand (for example, as shown in Figure 1A).In some embodiments, the dsDNA molecule as described herein comprises chemically modified nucleotides on the antisense strand.In some embodiments, the dsDNA molecule as described herein comprises chemically modified nucleotides on the sense strand.

[0055] In some embodiments, a dsDNA molecule as described herein comprises chemically modified nucleotides on both strands (e.g., as shown in Figures 1A and 2). In certain embodiments, both strands comprise chemical modifications at the same position (e.g., a chemically modified nucleotide on one strand is base-paired with a chemically modified nucleotide on the opposite strand, and / or a chemically unmodified nucleotide on one strand is base-paired with a chemically unmodified nucleotide on the opposite strand). In embodiments, both strands are entirely composed of chemically modified nucleotides. In other embodiments, the two strands of a dsDNA molecule as described herein comprise different chemical modification patterns (e.g., one or more chemically modified nucleotides on one strand are base-paired with a chemically unmodified nucleotide on the other strand). In embodiments, a dsDNA molecule as described herein comprises one or more double-stranded regions in which both strands are chemically modified and / or one or more double-stranded regions in which neither strand is chemically modified. In embodiments, a dsDNA molecule as described herein comprises one or more double-stranded regions in which one strand is chemically modified and the other is not.

[0056] In embodiments, a dsDNA molecule as described herein comprises one or more DNA end forms (e.g., exonuclease-resistant DNA end forms, e.g., covalently closed or non-covalently closed DNA end forms as described herein), each comprising one or more chemically modified nucleotides (e.g., on one or both strands of the DNA end form). In embodiments, a dsDNA molecule comprises a double-stranded region flanked by non-covalently closed exonuclease-resistant DNA end forms comprising chemically modified nucleotides, e.g., as described herein (e.g., in Figure 2).

[0057] In embodiments, the dsDNA molecules described herein have one or more chemical modifications that disrupt the ability of some parts of the dsDNA molecule to form double-stranded structures, for example, the dsDNA molecules described herein have one or more chemical modifications on the nucleotides present in the region of intramolecular complementarity.In embodiments, the dsDNA molecules described herein have one or more chemical modifications that disrupt the base pairing of the region of intramolecular complementarity with the unmodified sequence of the dsDNA molecule.In some embodiments, the chemically modified nucleotides used herein have a reduced tendency to base pair with the chemically modified nucleotide compared to the tendency of the unmodified nucleotide to base pair with the unmodified nucleotide.In some embodiments, the chemically modified nucleotides used herein have an increased tendency to base pair with the unmodified nucleotide compared to the modified nucleotide.

[0058] In some embodiments, the chemically modified dsDNA molecules described herein exhibit reduced recognition by DNA sensors in a host tissue or subject compared to an unmodified dsDNA molecule of the same sequence, e.g., at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or more reduced recognition by DNA sensors in a host tissue or subject compared to an unmodified dsDNA molecule of the same sequence. In some embodiments, the chemically modified dsDNA molecules described herein exhibit reduced degradation by DNA nucleases compared to an unmodified dsDNA molecule of the same sequence, e.g., at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or more reduced recognition by DNA nucleases in a host tissue or subject compared to an unmodified dsDNA molecule. In some embodiments, the chemically modified dsDNA molecules described herein exhibit a reduction in activation of the innate immune system in a target / host tissue or subject compared to an unmodified dsDNA molecule of the same sequence, e.g., at least a 10%, at least a 20%, at least a 30%, at least a 40%, at least a 50%, at least a 60%, at least a 70%, at least a 80%, at least a 90%, at least a 95% or greater reduction in activation of the innate immune system in a target / host tissue or subject compared to an unmodified dsDNA molecule of the same sequence.

[0059] In some embodiments, dsDNA molecules comprising chemically modified nucleotides described herein exhibit any of the following properties in a target / host tissue or subject compared to dsDNA of the same sequence without chemically modified nucleotides (unmodified dsDNA): increased integration of the exogenous construct in the genome of the target cell, increased retention in the target cell through replication, decreased secondary or tertiary structure formation, decreased interaction with innate immune sensors, decreased interaction with nucleases, enhanced stability, enhanced lifespan, decreased toxicity, enhanced delivery, increased expression, increased transport across membranes, or increased binding to DNA-binding moieties such as nuclear DNA-binding proteins, transcription factors, chaperones, DNA polymerases, etc. In embodiments, any of the above-listed properties is modulated by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or more in a target / host tissue or subject compared to unmodified dsDNA of the same sequence.

[0060] DNA construct elements The dsDNA molecules or nucleic acids comprising the dsDNA described herein contain sufficient elements to deliver an effector sequence to a target cell, tissue, or subject. In some embodiments, the effector sequence is a DNA sequence. In some embodiments, the dsDNA molecule drives expression of the effector, and includes, for example, a promoter and a sequence encoding an RNA or polypeptide, such as a therapeutic RNA or polypeptide. In some embodiments, the DNA constructs described herein further contain one or both of a nuclear targeting sequence and a maintenance sequence. While many of the embodiments herein refer to TDSCs, it is understood that, where applicable, embodiments referring to TDSCs can also be applied to nucleic acids comprising dsDNA.

[0061] Exonuclease-resistant DNA end forms The dsDNA molecules described herein comprise a DNA end form at each end of the double-stranded DNA molecule. In some instances, the DNA end forms described herein may comprise a closed end, where every nucleotide of the DNA end form is covalently linked to two other nucleotides of the DNA end form. In other instances, the DNA end forms described herein comprise an open end comprising at least one nucleotide covalently linked to only one other nucleotide of the DNA end form. DNA end forms are generally exonuclease resistant. In some instances, DNA end forms comprising a closed end (e.g., a covalently closed end) are resistant to the exonuclease assay described in Example 2. In some instances, DNA end forms comprising an open end (e.g., a Y adapter, a blunt end, or a sticky end, as described herein) are resistant to the exonuclease assay described in Example 3.

[0062] hairpin In some embodiments, the exonuclease-resistant DNA end form comprises a DNA hairpin. A hairpin generally comprises a single-stranded loop region covalently linked to a double-stranded stalk region at both the 5' and 3' ends. In certain embodiments, the single-stranded loop region comprises one or more nucleotides (e.g., 1-2, 2-5, 5-10, 10-15, 15-20, 20-25, 25-30, 30-35, or 35-40 nucleotides) that are not hybridized to another nucleotide. An exemplary hairpin structure and an exemplary dsDNA molecule comprising a hairpin are shown in Figure 1A.

[0063] In certain embodiments, the single-stranded loop region comprises one or more functional elements (e.g., a nuclear localization sequence (e.g., a CT3 ssDNA sequence) or a regulatory sequence). In embodiments, the functional element contained in the single-stranded loop region is heterologous to one or more other elements of the DNA end form and / or dsDNA molecule comprising the DNA end form. In certain embodiments, the single-stranded loop region of the hairpin loop is less than about 5, 10, 15, 20, 25, 26, 27, 28, 29, or 30 nucleotides in length.

[0064] In embodiments, the hairpin is comprised in a dsDNA molecule having a doggybone conformation. In embodiments, the hairpin comprises a protelomerase sequence (e.g., as described herein). In embodiments, the protelomerase sequence is generated by TelN protelomerase, ResT protelomerase, PY54 protelomerase, or TelK protelomerase digestion. In embodiments, the protelomerase sequence is less than about 15, 20, 25, 26, 27, 28, 29, or 30 nucleotides in length. In embodiments, the protelomerase sequence is about 28 (e.g., 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35) nucleotides in length to about 56 (e.g., 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60) nucleotides in length. In embodiments, the protelomerase sequence is greater than about 56 (e.g., greater than 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 65, 70, 75, 80, 90, or 100) nucleotides in length.

[0065] The hairpin can be attached to one or both ends of the double-stranded DNA molecule, for example, by ligation (e.g., as described herein). In some embodiments, a dsDNA molecule as described herein comprises a DNA hairpin loop at one or both ends. In some embodiments, the upstream exonuclease-resistant DNA end form of a dsDNA molecule as described herein comprises a DNA hairpin loop. In some embodiments, the downstream exonuclease-resistant DNA end form of a dsDNA molecule as described herein comprises a DNA hairpin loop.

[0066] In certain embodiments, the DNA hairpin loop comprises one or more unmodified nucleotides. In embodiments, the DNA hairpin loop is entirely composed of unmodified nucleotides. In certain embodiments, the DNA hairpin loop comprises one or more chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides as described herein). In embodiments, the DNA hairpin loop is entirely composed of chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides as described herein).

[0067] In certain embodiments, the single-stranded loop region of the DNA hairpin loop comprises one or more chemically modified nucleotides (e.g., e.g., phosphorothioate-modified nucleotides as described herein). In embodiments, at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, or 99% of the nucleotides in the single-stranded loop region are chemically modified nucleotides (e.g., e.g., phosphorothioate-modified nucleotides as described herein). In embodiments, the single-stranded loop region of the DNA hairpin loop is entirely composed of chemically modified nucleotides (e.g., e.g., phosphorothioate-modified nucleotides as described herein). In certain embodiments, the single-stranded loop region of the DNA hairpin loop comprises one or more unmodified nucleotides. In embodiments, the single-stranded loop region of the DNA hairpin loop is entirely composed of unmodified nucleotides.

[0068] In certain embodiments, the double-stranded stalk region of the DNA hairpin loop comprises one or more unmodified nucleotides. In embodiments, the double-stranded stalk region of the DNA hairpin loop is composed entirely of unmodified nucleotides. In certain embodiments, the double-stranded stalk region of the DNA hairpin loop comprises one or more chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides, for example, as described herein). In embodiments, at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, or 99% of the nucleotides in the double-stranded stalk region are modified nucleotides (e.g., phosphorothioate-modified nucleotides, for example, as described herein). In embodiments, the double-stranded stalk region of the DNA hairpin loop is composed entirely of chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides, for example, as described herein).

[0069] In embodiments, the single-stranded loop region of the DNA hairpin loop comprises one or more chemically modified nucleotides (e.g., e.g., phosphorothioate-modified nucleotides as described herein), and the double-stranded stalk region comprises one or more unmodified nucleotides. In embodiments, at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, or 99% of the nucleotides in the single-stranded loop region are chemically modified nucleotides (e.g., e.g., phosphorothioate-modified nucleotides as described herein). In embodiments, the single-stranded loop region of the DNA hairpin loop is entirely composed of chemically modified nucleotides (e.g., e.g., phosphorothioate-modified nucleotides as described herein), and the double-stranded stalk region is entirely composed of unmodified nucleotides.

[0070] Y-adapter In some embodiments, the exonuclease-resistant DNA end configuration as described herein comprises a Y-adaptor. As described herein, a Y-adaptor generally comprises a pair of single-stranded DNA regions, each attached at one end to a strand of a double-stranded DNA region, thereby forming a "Y" shape (the base of the "Y" represents a double-stranded DNA region, and each of the top protrusions of the "Y" represents two single-stranded DNA regions). An exemplary Y-adaptor structure and an exemplary dsDNA molecule comprising a Y-adaptor are shown in FIG. 2.

[0071] In some embodiments, a Y-adapter is generated by attaching (e.g., via ligation) a hairpin loop comprising a single-stranded region comprising a cleavable portion to the ends of a double-stranded DNA region. The cleavable portion can then be cleaved to generate the two single-stranded DNA regions of the Y-adapter.

[0072] In certain embodiments, the single-stranded DNA region of the Y-adapter (e.g., one or both single-stranded DNA regions) comprises one or more chemically modified nucleotides (e.g., e.g., phosphorothioate-modified nucleotides as described herein). In embodiments, at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, or 99% of the nucleotides in the single-stranded DNA region are chemically modified nucleotides (e.g., e.g., phosphorothioate-modified nucleotides as described herein). In embodiments, the single-stranded DNA region of the Y-adapter (e.g., one or both single-stranded DNA regions) consists entirely of chemically modified nucleotides (e.g., e.g., phosphorothioate-modified nucleotides as described herein). In certain embodiments, the single-stranded DNA region of the Y-adapter (e.g., one or both single-stranded DNA regions) comprises one or more unmodified nucleotides.

[0073] In embodiments, the single-stranded DNA region of the Y-adapter (e.g., one or both single-stranded DNA regions) comprises one or more chemically modified nucleotides (e.g., e.g., phosphorothioate-modified nucleotides as described herein) and the double-stranded DNA region of the Y-adapter comprises one or more unmodified nucleotides. In embodiments, at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, or 99% of the nucleotides in the single-stranded DNA region or regions are chemically modified nucleotides (e.g., e.g., phosphorothioate-modified nucleotides as described herein). In embodiments, the single-stranded DNA region of the Y-adapter (e.g., one or both single-stranded DNA regions) consists entirely of chemically modified nucleotides (e.g., e.g., phosphorothioate-modified nucleotides as described herein) and the double-stranded DNA region of the Y-adapter consists entirely of unmodified nucleotides.

[0074] Non-looped closed DNA end forms In some embodiments, the dsDNA molecule as described herein comprises an exonuclease-resistant DNA end form that is covalently closed but does not contain a hairpin loop. For example, in certain embodiments, every nucleotide of the covalently closed DNA end form hybridizes to another nucleotide. In certain embodiments, the covalently closed DNA end form comprises a first region and a second region, the first region can hybridize in its entirety to the second region (e.g., the first region is complementary to the second region), and the 3' end of the first region is covalently linked to the 5' end of the second region. In embodiments, the covalently closed DNA end form as described herein can be attached to one end of the dsDNA molecule as described herein, for example, by ligation.

[0075] Open DNA end form In some embodiments, a dsDNA molecule as described herein comprises an exonuclease-resistant DNA end form that is not covalently closed. In certain embodiments, the DNA end form comprises a blunt end (e.g., a blunt end comprising one or more chemical modifications as described herein) or a sticky end (e.g., a sticky end comprising one or more chemical modifications as described herein).

[0076] In certain embodiments, open DNA end forms are generated by nuclease digestion of covalently closed DNA end forms, such as DNA hairpins. In embodiments, the DNA hairpins include a double-stranded stalk region containing a cleavable portion on each strand, and the DNA hairpins are then contacted with an enzyme capable of cleaving the cleavable portion. In embodiments, this results in the formation of sticky ends containing overhangs. In embodiments, the overhangs are digested with an enzyme (e.g., a single-strand-specific nuclease, such as mung bean nuclease) to form blunt ends.

[0077] In certain embodiments, a DNA end form comprising a blunt end comprises one or more chemically modified nucleotides (e.g., e.g., phosphorothioate-modified nucleotides, as described herein). In embodiments, at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, or 99% of the nucleotides in a DNA end form comprising a blunt end are chemically modified nucleotides (e.g., e.g., phosphorothioate-modified nucleotides, as described herein). In embodiments, a DNA end form comprising a blunt end consists entirely of chemically modified nucleotides (e.g., e.g., phosphorothioate-modified nucleotides, as described herein). In embodiments, the terminal base pair of a DNA end form comprising a blunt end comprises a chemically modified nucleotide (e.g., one or both nucleotides of the base pair are chemically modified), e.g., a phosphorothioate-modified nucleotide, as described herein. In embodiments, the terminal base pairs (e.g., 2, 3, 4, 5, or 6 base pairs) of the DNA terminal form comprise chemically modified nucleotides (e.g., one or both nucleotides of the base pair are chemically modified), e.g., phosphorothioate-modified nucleotides, e.g., as described herein. In some embodiments, the terminal three base pairs of the DNA terminal form comprise chemically modified nucleotides (e.g., one or both nucleotides of the base pair are chemically modified), e.g., phosphorothioate-modified nucleotides, e.g., as described herein. In some embodiments, the terminal six base pairs of the DNA terminal form comprise chemically modified nucleotides (e.g., one or both nucleotides of the base pair are chemically modified), e.g., phosphorothioate-modified nucleotides, e.g., as described herein.

[0078] In certain embodiments, a DNA end form comprising a sticky end comprises one or more chemically modified nucleotides (e.g., e.g., phosphorothioate-modified nucleotides as described herein). In embodiments, at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, or 99% of the nucleotides in a DNA end form comprising a sticky end are chemically modified nucleotides (e.g., e.g., phosphorothioate-modified nucleotides as described herein). In embodiments, a DNA end form comprising a sticky end consists entirely of chemically modified nucleotides (e.g., e.g., phosphorothioate-modified nucleotides as described herein). In embodiments, the terminal nucleotide of a DNA end form comprising a sticky end comprises a chemically modified nucleotide (e.g., one or both nucleotides of a base pair are chemically modified), e.g., a phosphorothioate-modified nucleotide as described herein. In embodiments, the overlapping regions of the DNA ends form sticky ends, for example, comprise one or more chemically modified nucleotides, such as phosphorothioate modified nucleotides, as described herein.

[0079] Inverted terminal repeats (ITR) In some embodiments, a dsDNA molecule as described herein comprises an exonuclease-resistant DNA end form comprising an inverted terminal repeat (ITR). In some embodiments, the ITR is an ITR from a virus, such as an adenovirus or an adeno-associated virus (AAV). In some embodiments, the ITR comprises a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with an ITR sequence from a virus, such as an adenovirus or an adeno-associated virus (AAV). In certain embodiments, the ITR comprises an origin of replication (e.g., a viral origin of replication). In embodiments, a dsDNA molecule as described herein comprises an exonuclease-resistant DNA end form comprising an ITR (e.g., as described herein) at each end. In some embodiments, the dsDNA molecule does not comprise an ITR.

[0080] Promoters and other regulatory sequences The dsDNA molecules described herein may contain a promoter (a DNA sequence to which RNA polymerase and transcription factors bind, directly or indirectly, to initiate transcription) operably linked to an effector sequence. The promoter may be naturally found operably linked to the effector sequence or may be heterologous to the effector sequence. The promoters described herein may be native to the target cell or tissue or heterologous to the target cell or tissue. The promoter may be constitutive, inducible, and / or tissue-specific.

[0081] Examples of constitutive promoters include the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer) (see, e.g., Boshart et al., Cell, 41:521-530 (1985)), the SV40 promoter, the dihydrofolate reductase promoter, the beta-actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EF1 alpha promoter.

[0082] Inducible promoters allow for the regulation of expression and can be regulated by exogenously supplied compounds, environmental factors such as temperature, or by the presence of specific physiological states, e.g., acute phase, a particular differentiation state of cells, or only in replicating cells. Inducible promoters and inducible systems are available from a variety of sources. Examples of inducible promoters regulated by an exogenously supplied promoter include the zinc-inducible sheep metallothionein (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system (WO 98 / 10088), the ecdysone insect promoter (No et al., Proc. Natl. Acad. Sci. USA, 93:3346-3351 (1996)), the tetracycline repression system (Gossen et al., Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992)), and the tetracycline inducibility system (Gossen et al., Science, 268:1766-1769 (1995), Harvey et al. al., Curr. Opin. Chem. Biol., 2:512-518 (1998)), the RU486 inducible system (Wang et al., Nat. Biotech., 15:239-243 (1997) and Wang et al., Gene Ther., 4:432-441 (1997)), and the rapamycin inducible system (Magari et al., J. Clin. Invest., 100:2865-2872 (1997)).

[0083] In some embodiments, the native promoter for the effector-encoding sequence can be used.

[0084] In some embodiments, the regulatory sequence confers tissue-specific gene expression capability. In some cases, the tissue-specific regulatory sequence binds to tissue-specific transcription factors that induce transcription in a tissue-specific manner. Such tissue-specific regulatory sequences (e.g., promoters, enhancers, etc.) are known in the art. Exemplary tissue-specific regulatory sequences include, but are not limited to, the following tissue-specific promoters: liver-specific thyroxine-binding globulin (TBG) promoter, insulin promoter, glucagon promoter, somatostatin promoter, pancreatic polypeptide (PPY) promoter, synapsin-1 (Syn) promoter, creatine kinase (MCK) promoter, mammalian desmin (DES) promoter, alpha-myosin heavy chain (a-MHC) promoter, or cardiac troponin T (cTnT) promoter.Other exemplary promoters include the beta-actin promoter, the hepatitis B virus core promoter (Sandig et al., Gene Ther., 3:1002-9 (1996)), the alpha-fetoprotein (AFP) promoter (Arbuthnot et al., Hum. Gene Ther., 7:1503-14 (1996)), the bone osteocalcin promoter (Stein et al., Mol. Biol. Rep., 24:185-96 (1997)), the bone sialoprotein promoter (Chen et al., J. Bone Miner. Res., 11:654-64 (1996)), the CD2 promoter (Hansal et al., J. Bone Miner. Res., 11:654-64 (1996)), among others known to those of skill in the art. et al., J. Immunol., 161:1063-8(1998), immunoglobulin heavy chain promoter, T cell receptor alpha chain promoter, neuronal promoters such as the neuron-specific enolase (NSE) promoter (Andersen et al., Cell. Mol. Neurobiol., 13:503-15(1993)), neurofilament light chain gene promoter (Piccioli et al., Proc. Natl. Acad. Sci. USA, 88:5611-5(1991)), and neuron-specific vgf gene promoter (Piccioli et al., Neuron, 15:373-84(1995)).

[0085] Examples of tissue / cell specific promoters are listed in Table 1.

[0086] [Table 1-1]

[0087] [Table 1-2]

[0088] The constructs described herein may also include other native or heterologous expression control elements, such as enhancer elements, polyadenylation sites or Kozak consensus sequences.

[0089] Effector Array The effector sequence of the dsDNA molecules described herein can be, for example, a functional DNA sequence, such as a therapeutically functional DNA sequence, a DNA sequence encoding a therapeutic peptide, polypeptide, or protein, or a DNA sequence encoding a therapeutic RNA (e.g., a non-coding RNA). In some embodiments, the therapeutic payload sequence is an effector sequence described herein.

[0090] The therapeutic payload sequence can be used to express a therapeutic payload encoded by the therapeutic payload sequence. The effector sequence can be used to express an effector encoded by the effector sequence. In some embodiments, the therapeutic payload is an effector described herein.

[0091] DNA effectors: A therapeutically functional DNA sequence can be a DNA sequence that comprises a DNA sequence that forms a functional structure, such as a DNA aptamer, a DNAzyme, or an allele-specific oligonucleotide (DNA ASO). A therapeutically functional DNA sequence may not have an operably linked promoter. In embodiments, the dsDNA molecules described herein can comprise one or more functional DNA sequences, such as two, three, four, five, six, or more sequences (which can be the same or different).

[0092] Polypeptide effectors: The DNA sequence encoding the therapeutic polypeptide may be a DNA sequence encoding one or more effectors that are peptides, proteins, or a combination thereof. For example, the DNA sequence encodes mRNA. The peptide or protein may be a DNA-binding protein, an RNA-binding protein, a transporter, a transcription factor, a translation factor, a ribosomal protein, a chromatin remodeling factor, an epigenetic modifier, an antigen, a hormone, an enzyme (nuclease, e.g., an endonuclease, e.g., a nuclease element of the CRISPR system, e.g., Cas9, dCas9, aCas9-nickase, Cpf / Cas12a, etc.), a Crispr ligase, e.g., a base editor or a prime editor, a mobile genetic element protein (e.g., a transposase, a retrotransposase, a recombinase, an integrase), The polypeptide may be an engineered conjugate such as a gene writer, polymerase, methylase, demethylase, acetylase, deacetylase, kinase, phosphatase, ligase, deubiquitinase, protease, integrase, recombinase, topoisomerase, gyrase, helicase, lysosomal acid hydrolase), antibody (e.g., an intact antibody, fragment thereof, or nanobody), signaling peptide, receptor ligand, receptor, coagulation factor, clotting factor, structural protein, caspase, membrane protein, mitochondrial protein, nuclear protein, centrin, darpin, or adnectin. See, e.g., Gebauer & Skerra. 2020. Annual Review of Pharmacology and Toxicology 60:1, 391-415.

[0093] In embodiments, the dsDNA molecules described herein can comprise one or more sequences encoding polypeptides, for example, 2, 3, 4, 5, 6 or more sequences encoding polypeptides.Each of the multiple sequences can encode the same or different proteins.For example, the dsDNA molecules described herein can comprise multiple sequences encoding multiple proteins, for example, multiple proteins in a biological pathway.

[0094] In some embodiments, a dsDNA molecule can contain multiple polypeptide-encoding sequences, e.g., two, three, four, five, six, or more polypeptide-encoding sequences, separated by a self-cleaving peptide, e.g., P2A, T2A, E2A, or F2A. The self-cleaving peptide can be 18-22 amino acids in length and induce ribosomal skipping during protein translation, such that two polypeptides can be encoded in the same transcript. Each of the polypeptides can encode the same or different proteins. In one embodiment, a dsDNA molecule can contain a promoter followed by a sequence encoding a first polypeptide of interest, a sequence encoding a 2A self-cleaving peptide, a sequence encoding a second polypeptide of interest, and a polyA site. In another embodiment, a dsDNA molecule can contain a promoter followed by a sequence encoding a first polypeptide of interest, a sequence encoding a first 2A self-cleaving peptide, a sequence encoding a second polypeptide of interest, a sequence encoding a second 2A self-cleaving peptide, a sequence encoding a third polypeptide of interest, and a polyA site.

[0095] In some embodiments, the effector comprises a cell membrane-permeable polypeptide. In some embodiments, the effector is a fusion protein comprising the cell membrane-permeable polypeptide and a second amino acid sequence.

[0096] RNA effectors: The effector sequence can be one or more of a DNA sequence encoding a non-coding RNA, such as a short interfering RNA (siRNA), a microRNA (miRNA), a long non-coding RNA, a piwi-interacting RNA (piRNA), a small nucleolar RNA (snoRNA), a small Cajal body-specific RNA (scaRNA), a transfer RNA (tRNA), a ribosomal RNA (rRNA), an RNA aptamer, and a small nuclear RNA (snRNA).

[0097] In some embodiments, the dsDNA molecules disclosed herein comprise one or more expression sequences encoding regulatory RNAs, e.g., RNAs that alter the expression of endogenous and / or foreign genes. In some embodiments, the dsDNA molecules or sequences disclosed herein may comprise sequences that are antisense to regulatory nucleic acids, such as non-coding RNAs, including, but not limited to, tRNA, lncRNA, miRNA, rRNA, snRNA, microRNA, siRNA, piRNA, snoRNA, snRNA, exRNA, scaRNA, Y RNA, and hnRNA. In one embodiment, the regulatory nucleic acid targets a host gene. Regulatory nucleic acids may include, but are not limited to, nucleic acids that hybridize to endogenous genes, nucleic acids that hybridize to foreign nucleic acids, such as antisense RNA, guide RNA, viral DNA or RNA, nucleic acids that hybridize to RNA, nucleic acids that disrupt gene transcription, nucleic acids that disrupt RNA translation, nucleic acids that stabilize or destabilize RNA, such as through targeting for degradation, and nucleic acids that regulate DNA or RNA binding factors. In one embodiment, the sequence is an miRNA. In some embodiments, the regulatory nucleic acid targets the sense strand of the host gene. In some embodiments, the regulatory nucleic acid targets the antisense strand of the host gene.

[0098] In some embodiments, the dsDNA molecule encodes a guide RNA. Guide RNA sequences are generally designed to have a length of 15 to 30 nucleotides (e.g., 17, 19, 20, 21, or 24 nucleotides) complementary to the targeted nucleic acid sequence and a region that promotes complex formation (e.g., with a tracrRNA or a nuclease). Custom gRNA generation devices and algorithms are commercially available for use in designing effective guide RNAs. Gene editing has also been achieved using chimeric "single guide RNAs" ("sgRNAs"), which are engineered (synthetic) single RNA molecules that mimic the naturally occurring crRNA-tracrRNA complex and contain both a tracrRNA (to bind a nuclease) and at least one crRNA (to guide the nuclease to the sequence targeted for editing). Chemically modified sgRNAs have also been demonstrated to be effective in genome editing. See, e.g., Hendel et al. (2015) Nature Biotechnol., 985-991. The gRNA can recognize a specific DNA sequence (e.g., a sequence adjacent to or within a gene promoter, enhancer, silencer, or repressor). In one embodiment, the gRNA is used as part of a CRISPR system for gene editing. For the purpose of gene editing, the dsDNA molecules or sequences disclosed herein can be designed to include one or more sequences encoding guide RNA sequences corresponding to the desired target DNA sequence. See, for example, Cong et al. (2013) Science, 339:819-823; Ran et al. (2013) Nature Protocols, 8:2281-2308.

[0099] The dsDNA molecules or sequences disclosed herein may encode specific regulatory nucleic acids that can inhibit gene expression through the biological process of RNA interference (RNAi). RNAi molecules typically contain 15 to 50 base pairs (e.g., about 18 to 25 base pairs) and comprise RNA or RNA-like structures with nucleobase sequences identical (complementary) or nearly identical (substantially complementary) to a coding sequence in a target gene expressed in a cell. Such RNAi molecules include, but are not limited to, short interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), partial duplexes and Dicer substrates (see U.S. Patent Nos. 8,084,599, 8,349,809, and 8,513,207), and RNA antisense oligonucleotides (RNA ASOs).

[0100] In one embodiment, a dsDNA molecule or sequence disclosed herein comprises a sequence comprising the sense strand of an IncRNA. In one embodiment, a dsDNA molecule or sequence disclosed herein comprises a sequence encoding the antisense strand of an IncRNA.

[0101] The dsDNA molecules or sequences disclosed herein may encode regulatory nucleic acids that are substantially complementary to a fragment or completely complementary to an endogenous gene or gene product (e.g., mRNA). The regulatory nucleic acid may be complementary to an intron-exon boundary, an inter-exon sequence, or a sequence adjacent to an exon, which prevents the maturation of newly generated nuclear RNA transcripts of a particular gene into mRNA for transcription. A regulatory nucleic acid that is complementary to a particular gene can hybridize with the mRNA for that gene and prevent its translation. An antisense regulatory nucleic acid can be DNA, RNA, or a derivative or hybrid thereof. In some embodiments, the regulatory nucleic acid contains a protein-binding site capable of binding to a protein involved in regulating the expression of an endogenous or foreign gene.

[0102] The length of a dsDNA molecule or sequence disclosed herein that can encode a regulatory nucleic acid that hybridizes to a transcript of interest can be, for example, about 5-30 nucleotides, about 10-30 nucleotides, or about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotides. The degree of identity of the regulatory nucleic acid to the targeted transcript should be at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%.

[0103] The dsDNA molecules or sequences disclosed herein can encode micro-RNA (miRNA) molecules identical to about 5 to about 30 contiguous nucleotides of a target gene. In some embodiments, the miRNA sequence targets an mRNA, begins with the dinucleotide AA, contains about 30-70% (about 30-60%, about 40-60%, or about 45%-55%) GC content, and does not share a high percentage of identity to any nucleotide sequence other than the target in the genome of the mammal into which it is introduced, as determined, for example, by a standard BLAST search. In some embodiments, the dsDNA molecules or sequences disclosed herein encode at least one miRNA, e.g., two, three, four, five, six, or more. In some embodiments, the dsDNA molecules or sequences disclosed herein comprise a sequence encoding an miRNA that has at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity with any one of the nucleotide sequences or sequences complementary to the target sequence. Lists of known miRNA sequences can be found in databases maintained by research institutions such as the Wellcome Trust Sanger Institute, the Penn Center for Bioinformatics, the Memorial Sloan Kettering Cancer Center, and the European Molecule Biology Laboratory, among others. Known effective siRNA sequences and their cognate binding sites are also well represented in the relevant literature. RNAi molecules are easily designed using techniques known in the art. In addition, computational tools exist that increase the likelihood of finding effective and specific sequence motifs (see, for example, Lagana et al., Methods Mol. Biol., 2015, 1269:393-412).

[0104] The dsDNA molecules or sequences disclosed herein can regulate the expression of RNA encoded by a gene. Because multiple genes may share a degree of sequence homology with each other, in some embodiments, the dsDNA molecules or sequences disclosed herein can be designed to target a class of genes with sufficient sequence homology. In some embodiments, the dsDNA molecules or sequences disclosed herein can contain sequences that are shared between different gene targets or that are complementary to sequences unique to a particular gene target. In some embodiments, the dsDNA molecules or sequences disclosed herein can be designed to target conserved regions of RNA sequences that share homology among several genes, thereby targeting several genes in a gene family (e.g., different gene isoforms, splice variants, mutant genes, etc.). In some embodiments, the dsDNA molecules or sequences disclosed herein can be designed to target sequences unique to a specific RNA sequence of a single gene.

[0105] In embodiments, the effector sequence encoding the regulatory RNA has a length of less than 5000 bps (e.g., less than about 5000 bps, 4000 bps, 3000 bps, 2000 bps, 1000 bps, 900 bps, 800 bps, 700 bps, 600 bps, 500 bps, 400 bps, 300 bps, 200 bps, 100 bps, 50 bps, 40 bps, 30 bps, 20 bps, 10 bps or less). In some embodiments, the effector sequences may, independently or in addition, be greater than 10 bps (e.g., at least about 10 bps, 20 bps, 30 bps, 40 bps, 50 bps, 60 bps, 70 bps, 80 bps, 90 bps, 100 bps, 200 bps, 300 bps, 400 bps, 500 bps, 600 bps, 700 bps, 800 bps, 900 bps, 1000 kb, 1.1 kb, 1.2 kb, 1.3 kb, 1.4 kb, 1.5 kb, 1.6 kb, kb, 4.1 kb, 4.2 kb, 4.3 kb, 4.4 kb, 4.5 kb, 4.6 kb, 4.7 kb, 4.8 kb, 4.9 kb, 5 kb or more).

[0106] In some embodiments, the dsDNA molecules or sequences disclosed herein comprise one or more of the features described herein above, such as one or more structural DNA sequences, sequences encoding one or more peptides or proteins, sequences encoding one or more regulatory elements, sequences encoding one or more regulatory nucleic acids, such as one or more non-coding RNAs, other expression sequences, and any combination of the foregoing. The constructs described herein may have one or more effector sequences, for example, two, three, four, five, or more effector sequences. In the case of multiple effector sequences in a single construct, the effector sequences may be the same or different. In some embodiments, the dsDNA molecule may comprise an effector sequence that is structural DNA and a second effector sequence that is a DNA sequence encoding a functional RNA or polypeptide.

[0107] In one embodiment, the dsDNA molecule comprises a therapeutically functional structural DNA sequence. In one embodiment, the dsDNA molecule comprises a promoter and a sequence encoding a therapeutic peptide, polypeptide, or protein as described herein. In one embodiment, the dsDNA molecule comprises a promoter and a sequence encoding a regulatory RNA as described herein.

[0108] In some embodiments, the effector sequence encoding a polypeptide or protein is codon-optimized, e.g., codon-optimized for expression in a mammal, e.g., a human. Generally, codon optimization refers to modifying a nucleic acid sequence for enhanced expression in a host cell of interest by replacing at least one codon (e.g., one or more, e.g., 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more codons, e.g., at least 1%, 5%, 10%, 20%, 25%, 50%, 60%, 70%, 80%, 90%, or 100%) of the native sequence with a codon that is more frequently or most frequently used in the genes of that host cell, while maintaining the native amino acid sequence. Codon usage tables are available, for example, at the "Codon Usage Database," available at http: / / www.kazusa.or.jp / codon / . These tables can be adapted in several ways. See, for example, Nakamura et al., 2000, Nucl. Acids Res. 28: 292. Computer algorithms are also available, such as Gene Forge, for codon-optimizing a particular sequence for expression in a particular host cell.

[0109] Nuclear targeting sequence (NTS) A dsDNA molecule or a nucleic acid comprising dsDNA (e.g., as disclosed herein) can contain a nuclear targeting sequence (NTS) that facilitates transport of DNA from the cytoplasm to the nucleus of a cell. The NTS contains binding sites for proteins (e.g., transcription factors, chaperones, etc.) that bind to importins, which transport cargo into the nucleus through the nuclear pore complex. In embodiments, the NTS can function generally (e.g., an SV40 enhancer NTS). In other embodiments, the NTS can be cell- or tissue-specific, for example, containing binding sites for transcription factors expressed in specific cell types that can target the dsDNA molecules described herein to the nucleus in a cell-specific manner (e.g., SRF, Nkx3). The NTS can be functional at multiple locations in the dsDNA molecules described herein, for example, before the promoter and / or after the effector sequence.

[0110] The NTS can be of viral or non-viral origin. NTSs are described, for example, in Le Guen et al. 2021. Nucleic Acids Vol. 24: 477-486. Examples of NTSs are disclosed in Table 2.

[0111] [Table 2]

[0112] In some embodiments, the NTS has a sequence according to Table 2 or a functional sequence having at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity thereto.

[0113] Nuclear import proteins In some embodiments, the dsDNA molecule can be transported into the nucleus by, for example, a nuclear transport protein. In some embodiments, the dsDNA molecule can be bound by a nuclear transport protein. In some embodiments, the dsDNA molecule contains a recognition sequence for the nuclear transport protein. In some embodiments, the exonuclease-resistant DNA end form (e.g., contained in the dsDNA molecule) contains a recognition sequence for the nuclear transport protein.

[0114] Exemplary translocation proteins include, for example, basic helix-loop-helix (bHLH) proteins, heterologous nuclear ribonucleoprotein (hnRNP) isoforms, or nuclear factor I (NFI) proteins. In some embodiments, the translocation protein comprises an importin.

[0115] In some embodiments, the translocation protein comprises a Ran-binding protein. In some embodiments, the translocation protein comprises a homeobox transcription factor. In some embodiments, the translocation factor specifically binds to an E-box, a DTS, a promoter, a telomere, an ATTT motif, a cell cycle regulatory unit (CCRU), a CT3 sequence, an S / MAR, a topoisomerase II consensus sequence, an ARS consensus sequence, 3NF, or a viral origin of replication.

[0116] Maintenance sequence The dsDNA molecules disclosed herein may contain maintenance sequences that support or enable sustained gene expression through successive rounds of cell division and / or progenitor differentiation in host cells for the dsDNA molecules of the invention. In embodiments, the maintenance sequence is a nuclear scaffold / matrix attachment region (S / MAR). S / MAR elements are diverse AT-rich sequences ranging from 60 to 500 bp that are conserved across species and are thought to anchor chromatin to nuclear matrix proteins during interphase (Bode et al. 2003. Chromosome Res 11, 435-445). S / MARs can be incorporated into the dsDNA molecules described herein to promote long-term transgene expression and extrachromosomal maintenance. In one embodiment, the maintenance sequence is human interferon-beta MAR (5'tataattcactggaatttttttgtgtgtatggtatgacatatgggttcccttttattttttacataaatatatttccctgtttttctaaaaaagaaaaagatcatcattttcccattgtaaaatgccatatttttttcataggtcacttacata-3' (SEQ ID NO: 39)) or a functional sequence having at least 80%, at least 90%, at least 95%, or at least 98% identity thereto. In embodiments, S / MARs useful in the constructs described herein can be found by searching MARome at http: / / bioinfo.net.in / MARome, also described by Narwade et al. 2019. Nucleic Acids Research. Volume 47, Issue 14:7247-7261.

[0117] In embodiments, the dsDNA molecules described herein can be replicated in mammalian cells, such as human cells. In some embodiments, the dsDNA molecules described herein are maintained in host cells, tissues, or subjects through at least one cell division. For example, the dsDNA molecules described herein are maintained in host cells, tissues, or subjects through at least 2, 3, 4, 5, 6, 7, 8, 10, 15, 20, 40, 50, or more cell divisions. In vitro, cell division can be tracked by flow cytometry or microscopy. In vivo, cell division can be tracked by intravital microscopy.

[0118] Other Elements The dsDNA molecules disclosed herein may also include effector sequences, e.g., other control elements operably linked to the effector-encoding sequence, in a manner that allows its transport, localization, transcription, translation, and / or expression in target cells, or that promote its degradation or suppression of expression in non-target cells. As used herein, "operably linked" sequences include both expression control sequences contiguous with the effector-encoding sequence and expression control sequences that act in trans or at a distance to control the effector-encoding sequence. The exact nature of the regulatory sequences required for gene expression in host cells may vary between species, tissues, or cell types, but generally may include 5' untranscribed and 5' untranslated sequences involved in initiation of transcription and translation, respectively, such as TATA boxes, capping sequences, CAAT sequences, enhancer elements, etc., as needed. Regulatory sequences may also include enhancer sequences or upstream activator sequences as needed. The constructs described herein may optionally include a 5' leader or signal sequence.

[0119] DNA construct structure In some embodiments, the dsDNA molecules disclosed herein are at least about 20 nucleotides, at least about 30 nucleotides, at least about 40 nucleotides, at least about 50 nucleotides, at least about 75 nucleotides, at least about 100 nucleotides, at least about 200 nucleotides, at least about 300 nucleotides, at least about 500 nucleotides, at least about 1000 nucleotides, at least about 2000 nucleotides, at least about 3000 nucleotides, at least about 4000 nucleotides, at least about 5000 nucleotides, at least about 6000 nucleotides, at least about 7000 nucleotides, at least about 8000 nucleotides, at least about 9000 nucleotides, at least about 10,000 nucleotides, at least about 11,000 nucleotides, at least about 12,000 nucleotides, at least about 20,000 nucleotides, at least about 30,000 nucleotides, at least about 40,000 nucleotides, or at least about 50,000 nucleotides in length. In some embodiments, the dsDNA molecules disclosed herein comprise 20-30, 30-40, 40-50, 50-75, 75-100, 100-200, 200-300, 300-500, 500-1000, 1000-2000, 2000-3000, 3000-4000, 4000-5000, 5000-6000 The length of a dsDNA molecule disclosed herein is 10,000, 6,000-7,000, 7,000-8,000, 8,000-9,000, 9,000-10,000, 10,000-11,000, 11,000-12,000, 10,000-20,000, 20,000-30,000, 30,000-40,000, or 40,000-50,000 nucleotides. In some embodiments, the size of a dsDNA molecule disclosed herein is sufficient to encode a useful polypeptide or RNA. When the length of a linear, closed-end dsDNA molecule is discussed herein, it is understood that the length refers to the number of nucleotides beginning at, including, the upstream end and ending at the downstream end. For example, a non-looped dsDNA molecule having 100 base pairs would have a length of 100 nucleotides.

[0120] In some embodiments, the dsDNA molecule comprises an exonuclease-resistant DNA end form (e.g., as described herein). In some embodiments, the DNA end form is at least 2, 3, 4, 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides in length. In some embodiments, the DNA end form is less than 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides in length. In some embodiments, the DNA end form is 2-5, 5-10, 10-15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-45, 45-50, 50-55, 55-60, 60-70, 70-80, 80-90, or 90-100 nucleotides in length.

[0121] In some embodiments, the dsDNA molecule comprises a double-stranded region encoding an effector (e.g., a polypeptide or RNA as described herein) located between two exonuclease-resistant DNA end forms, for example. In some embodiments, the double-stranded region is at least 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10,000, 20,000, 30,000, 40,000, or 50,000 nucleotides in length. In some embodiments, the double-stranded region is less than 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10,000, 20,000, 30,000, 40,000, or 50,000 nucleotides in length. In some embodiments, the double-stranded region has a length of 10 to 15, 15 to 20, 20 to 25, 25 to 30, 30 to 35, 35 to 40, 40 to 45, 45 to 50, 50 to 55, 55 to 60, 60 to 70, 70 to 80, 80 to 90, 90 to 100, 100 to 200, 200 to 300, 300 to 400, 400 to 500, 500 to 600, 600 to 700, 700 to 800, 800 to 900, The length is 900 to 1000, 1000 to 2000, 2000 to 3000, 3000 to 4000, 4000 to 5000, 5000 to 6000, 6000 to 7000, 7000 to 8000, 8000 to 9000, 9000 to 10,000, 10,000 to 20,000, 20,000 to 30,000, 30,000 to 40,000, or 40,000 to 50,000 nucleotides.

[0122] The dsDNA molecules described herein can have a single-stranded structure below a threshold level.In one embodiment, the dsDNA molecules do not comprise a single-stranded region longer than 100, 80, 70, 60, 50, 40, 30, 20 or 10 bases, or more than 20, 18, 16, 14, 12, 10, 8, 7, 5, 4, 3, 2 or 1, for example, do not comprise a single-stranded region longer than 100, 80, 70, 60, 50, 40, 30, 20 or 10 bases.In one embodiment, the double-stranded region formed by the dsDNA molecules described herein is determined as described by Xayaphoummine et al.2005.Kinefold web server for RNA / DNA folding path and structure prediction including pseudoknots and knots.Nucleic Acids Research,Volume 33:W605-610. In one embodiment, the Kinefold website (http: / / kinefold.curie.fr / cgi-bin / form.pl) is used to predict the double-stranded regions of the constructs described herein using the following parameters: Sequence for folding: Enter and select "DNA sequence" Stochastic simulation: co-transcriptional fold, 3 ms Simulated molecular time: default Pseudoknots: Not allowed · Entanglement: Non-intersecting Random number seed: 11453

[0123] In some embodiments, the dsDNA forms described herein are asymmetrically modified, with one strand comprising chemically modified nucleobases and the other strand being substantially free of chemically modified nucleobases. In some embodiments, semi-modified DNA may be completely free of chemically modified nucleotides on the antisense strand, while in other embodiments, semi-modified DNA may comprise a small number of chemical modifications (backbone modifications, such as phosphorothioates) on the antisense strand. In some embodiments, semi-modified DNA molecules comprise chemically modified nucleotides (e.g., nucleotides comprising chemically modified nucleobases) on the sense strand. In some embodiments, semi-modified DNA molecules comprise chemically modified uridine nucleotides on the sense strand.

[0124] Generate In some embodiments, the dsDNA molecule as described herein is generated from a plasmid constructed to contain the desired elements described herein. The plasmid template can be constructed, for example, using Golden Gate cloning, which allows for the assembly of multiple DNA fragments in a defined linear order in a recipient vector using a one-pot assembly procedure. Golden Gate cloning is described in Marillonnet & Gruetzner, 2020, Synthetic DNA assembly using golden gate cloning and the hierarchical modular cloning pipeline, Current Protocols in Molecular Biology, 130: e115. In some embodiments, the plasmid template is linearized, for example, by digestion with a nuclease (e.g., a restriction endonuclease) or by PCR amplification of a linear nucleic acid sequence from the plasmid template.

[0125] In some embodiments, a dsDNA molecule containing a chemical modification on one strand is generated by amplification of one strand (e.g., from a plasmid template) using a dNTP mixture containing one or more chemically modified nucleotides and primers capable of amplifying one strand of the dsDNA molecule sequence. In certain embodiments, the opposite strand (e.g., an unmodified strand or a differently chemically modified strand, e.g., as described herein, e.g., in Figures 1A-2) is generated in a separate amplification reaction, e.g., using a dNTP mixture containing unmodified nucleotides or a different set of chemically modified nucleotides and primers capable of amplifying the opposite strand of the dsDNA molecule sequence.

[0126] In some embodiments, a dsDNA molecule containing the same chemical modification on both strands is generated by amplification of the dsDNA molecule strands (e.g., from a plasmid template) using a dNTP mixture containing one or more chemically modified nucleotides and primers capable of amplifying both strands of the dsDNA molecule sequence.

[0127] In some embodiments, exonuclease-resistant DNA end forms (e.g., as described herein) are introduced (e.g., attached) to one or both ends of a dsDNA molecule. In certain embodiments, the DNA end forms are attached to the ends of the dsDNA molecule by ligation. In embodiments, the final dsDNA molecule is generated by attaching (e.g., ligating) the DNA end forms (e.g., covalently closed DNA end forms) to the dsDNA molecule. In certain embodiments, the exonuclease resistance of the attached DNA end forms is confirmed by incubating the dsDNA molecule in the presence of an exonuclease (e.g., exonuclease III and / or mung bean nuclease), e.g., as described in Examples 2 and 3. In embodiments, the exonuclease resistance of the attached DNA end forms is confirmed by incubating the dsDNA molecule in the presence of exonuclease III, for example. In embodiments, the DNA end forms include blunt ends, sticky ends, or Y-adapters (e.g., as described herein), and the exonuclease resistance of the attached DNA end forms is confirmed by incubating the dsDNA molecules in the presence of Exonuclease III and (e.g., after, before, or simultaneously) Mung Bean Nuclease.

[0128] In certain embodiments, the DNA end form, in its initial form, is attached to the end of a dsDNA molecule (e.g., a non-covalently closed DNA end form can be attached to a dsDNA molecule as a hairpin). In a subsequent step, the initial form of the DNA end form can be further modified (e.g., cleaved) to generate the final DNA end form. For example, a non-covalently closed DNA end form can be generated, for example, by cleavage of the initial form with a nuclease. In some embodiments, an initial form comprising an overhang or sticky end can be converted to a blunt end by digestion with a single strand-specific nuclease, e.g., mung bean nuclease. In some embodiments, an initial form comprising a hairpin containing a cleavable moiety in its single-stranded loop region is converted to a Y-adapter by cleavage of the cleavable moiety.

[0129] In certain embodiments, the method further comprises formulating the enriched or purified dsDNA molecules for pharmaceutical use, e.g., formulating the dsDNA molecules with a pharmaceutically acceptable excipient and / or carrier, e.g., an LNP.

[0130] In some embodiments, the methods described herein include concentrating or purifying the dsDNA molecules. In some embodiments, concentrating or purifying includes substantially removing one or more impurities selected from endotoxins, mononucleotides, chemically modified mononucleotides, single-stranded DNA, DNA fragments or truncations, and proteins (e.g., enzymes, e.g., ligases, restriction enzymes) from the dsDNA molecules.

[0131] The dsDNA molecules may be enriched or purified from impurities or by-products selected from the group consisting of endotoxins, mononucleotides, chemically modified mononucleotides, single-stranded DNA, circular DNA, proteins (e.g., enzymes, such as ligases, restriction enzymes), and DNA fragments or truncations. In some embodiments, the purified dsDNA molecules are substantially free of process by-products and impurities, such as those described herein.

[0132] In embodiments, pharmaceutical compositions comprising the dsDNA molecules described herein are substantially free of impurities or process by-products selected from the group consisting of, for example, endotoxins, mononucleotides, chemically modified mononucleotides, DNA fragments or truncations, and proteins (e.g., enzymes, e.g., ligases, restriction enzymes). In some embodiments, the pharmaceutical composition is substantially free of circular DNA. In some embodiments, the pharmaceutical composition is substantially free of RNA. In some embodiments, the pharmaceutical composition is substantially free of single-stranded DNA (ssDNA). In some embodiments, the pharmaceutical composition is substantially free of DNA fragments. In some embodiments, the pharmaceutical composition is substantially free of open-ended double-stranded DNA. In some embodiments, the pharmaceutical composition is substantially free of microorganisms. In some embodiments, the pharmaceutical composition is substantially free of bacterial proteins. In some embodiments, the pharmaceutical composition is substantially free of bacterial DNA.

[0133] In some embodiments, all of the dsDNA molecules in a pharmaceutical composition have substantially the same nucleotide length (e.g., all of the dsDNA molecules in a pharmaceutical composition have the same nucleotide length). In some embodiments, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the dsDNA molecules in a pharmaceutical composition have the same nucleotide length. In some embodiments, the therapeutic payload sequences of the dsDNA molecules in a pharmaceutical composition have substantially the same nucleotide length (e.g., the therapeutic payload sequences of the dsDNA molecules in a pharmaceutical composition have the same nucleotide length). In some embodiments, all of the dsDNA molecules in a pharmaceutical composition are 100, 200, 500, or 1000 nucleotides in length relative to one another. In some embodiments, all of the dsDNA molecules in the pharmaceutical composition have a length of 500-1000, 1000-2000, 2000-3000, 3000-4000, 4000-5000, 5000-6000, 6000-7000, 7000-8000, 8000-9000, 9000-10000, 10000-11000, or 11000-12000 nucleotides. In some embodiments, all of the dsDNA molecules in the pharmaceutical composition encode substantially the same effector (e.g., all of the dsDNA molecules in the pharmaceutical composition encode the same effector). In some embodiments, all of the dsDNA molecules in the pharmaceutical composition have substantially the same sequence (e.g., all of the dsDNA molecules in the pharmaceutical composition have the same sequence).

[0134] In some embodiments, a pharmaceutical composition comprises a plurality of dsDNA molecules described herein, wherein each dsDNA molecule in the plurality comprises an amplicon region beginning with an initiation codon for the encoded polypeptide of the dsDNA molecule and spanning 200 to 210 base pairs, 210 to 220 base pairs, 220 to 230 base pairs, 230 to 240 base pairs, or 240 to 250 base pairs in the direction of transcription. In some embodiments, the pharmaceutical composition comprises a first subpopulation of dsDNA molecules, wherein each amplicon region in the first subpopulation has the same DNA sequence, e.g., a desired sequence, and at least one additional dsDNA molecule, wherein the amplicon region of the additional dsDNA molecule has a different DNA sequence from the amplicon region in the first subpopulation, e.g., the amplicon region of the additional dsDNA molecule has one or more errors relative to the desired DNA sequence. In some embodiments, at least 70%, 20% to 70%, or no more than 20% of the dsDNA molecules are part of the first subpopulation. In some embodiments, the dsDNA molecules in the pharmaceutical composition have an average of at least 5, 1 to 5, or less than 1 substitution per kilobase relative to the desired DNA sequence. In some embodiments, the dsDNA molecules in the pharmaceutical composition have an average of at least 0.1, 0.05 to 0.1, or less than 0.05 insertions per kilobase relative to the desired DNA sequence. In some embodiments, the dsDNA molecules in the pharmaceutical composition have an average of at least 0.25, 0.15 to 0.25, or less than 0.15 deletions per kilobase relative to the desired DNA sequence. In some embodiments, in the amplicon region, an average of at least 99.5%, 0.15% to 99.5%, or less than 0.15% of the positions in the desired DNA sequence that are adenine, cytosine, guanine, or thymine / uracil are the same nucleobase in the dsDNA molecules in the pharmaceutical composition.

[0135] In some embodiments, the pharmaceutical composition comprises a plurality of dsDNA molecules described herein. In some embodiments, when the plurality of dsDNA molecules are introduced into a cell, the cell transcribes the dsDNA molecules to produce a plurality of RNA molecules, wherein the plurality of RNA molecules comprises an amplicon region beginning with an initiation codon for a polypeptide encoded by the dsDNA molecule and spanning at least 200 base pairs, at least 210 base pairs, at least 220 base pairs, at least 230 base pairs, at least 240 base pairs, or at least 250 base pairs in the direction of transcription. In some embodiments, the plurality of RNA molecules comprises a first subpopulation of RNA molecules, wherein each amplicon region in the first subpopulation has the same RNA sequence, e.g., a desired RNA sequence, and at least one additional RNA molecule, wherein the amplicon region of the additional RNA molecule has an RNA sequence that is different from the amplicon region in the first subpopulation, e.g., the amplicon region of the additional RNA molecule has one or more errors relative to the desired RNA sequence. In some embodiments, at least 70%, 20% to 70%, or 20% or less of the RNA molecules are part of the first subpopulation. In some embodiments, the RNA molecules in the pharmaceutical composition have an average of at least 5, 1 to 5, or less than 1 substitution per kilobase relative to the desired RNA sequence. In some embodiments, the RNA molecules in the pharmaceutical composition have an average of at least 0.1, 0.05 to 0.1, or less than 0.05 insertions per kilobase relative to the desired RNA sequence. In some embodiments, the RNA molecules in the pharmaceutical composition have an average of at least 0.25, 0.15 to 0.25, or less than 0.15 deletions per kilobase relative to the desired RNA sequence.

[0136] In some embodiments, the pharmaceutical composition is substantially free of a given impurity or process by-product, e.g., the pharmaceutical composition is free of an impurity or process by-product.

[0137] In some embodiments, purification involves the reduction, eg, partial or complete reduction, of one or more contaminants.

[0138] In some embodiments, the dsDNA molecules are formulated in lipid-based carriers, such as lipid nanoparticles (LNPs), for example, as described in Example 1.

[0139] The dsDNA molecule may be sequenced to confirm the desired designed sequence. In embodiments, other structural analyses of the dsDNA molecule (e.g., restriction enzyme analysis) may be performed to confirm or verify its sequence.

[0140] The chemically modified dsDNA molecules described herein can be produced by several methods, including methods commonly used in the art. For example, chemically modified dsDNA molecules can be produced by performing a polymerase chain reaction on a DNA template in the presence of unmodified and chemically modified nucleotides and a suitable polymerase. Exemplary suitable polymerases are described in Examples 5 and 11 and include KOD polymerase (710864, ​​Sigma-Aldrich), KOD Xtreme polymerase (719753, Sigma-Aldrich), Deep Vent polymerase (M0258, NEB), and KOD Multi&Epi (KME) polymerase (TYB-KME-101, Diagnocine). A wide variety of polymerases are available, for example, from commercial sources. Various polymerases can be used as long as they incorporate chemically modified nucleotides with sufficiently high efficiency.

[0141] In some aspects, the present disclosure provides a method of making a chemically modified dsDNA molecule, comprising performing PCR on a DNA template using a polymerase selected from KOD polymerase (710864, ​​Sigma-Aldrich), KOD Xtreme polymerase (719753, Sigma-Aldrich), Deep Vent polymerase (M0258, NEB), and KOD Multi&Epi (KME) polymerase (TYB-KME-101, Diagnocine) in the presence of unmodified and chemically modified nucleotides. In some embodiments, the dNTPs in the PCR reaction are substantially free, e.g., free, of unmodified thymidine nucleotides.

[0142] Chemically modified dsDNA molecules can also be produced by methods that do not involve performing the polymerase chain reaction, for example, direct chemical synthesis can be used.

[0143] Chemically modified dsDNA molecules can be produced by providing dsDNA molecules and chemically modifying the nucleotides of dsDNA molecules.For example, dsDNA molecules can be contacted with enzymes to produce chemically modified dsDNA molecules.In some embodiments, enzymes convert unmodified nucleotides into chemically modified nucleotides.In some embodiments, enzymes convert chemically modified nucleotides into different modified nucleotides.

[0144] Pharmaceutical Composition The present disclosure includes dsDNA molecules and related compositions in combination with one or more pharmaceutically acceptable excipients and / or carriers.

[0145] The pharmaceutical compositions may optionally comprise one or more additional active substances, such as therapeutically and / or prophylactically active substances. Pharmaceutical compositions of the invention are generally sterile and / or pyrogen-free.

[0146] The dsDNA molecules described herein can be formulated without a carrier, e.g., the dsDNA molecules described herein can be administered to a host cell, tissue, or subject "naked." Naked formulations can include pharmaceutical excipients or diluents, but lack a carrier.

[0147] Pharmaceutically acceptable excipients or diluents may include inert substances that function as vehicles or mediums for the compositions described herein, such as any one of the inactive ingredients approved by the U.S. Food and Drug Administration (FDA) and listed in the inactive ingredient database incorporated herein by reference. Non-limiting examples of pharmaceutically acceptable excipients or diluents include solvents, aqueous solvents, non-aqueous solvents, isotonicity agents, dispersion media, cryoprotectants, diluents, suspending aids, surfactants, isotonicity agents, thickening agents, emulsifiers, preservatives, hyaluronidase, dispersing agents, preservatives, lubricants, granulating agents, disintegrating agents, binders, antioxidants, buffers (e.g., phosphate buffered saline (PBS)), lubricants, oils, and mixtures thereof.

[0148] General considerations in the formulation and / or manufacture of pharmaceutical products can be found, for example, in Remington: The Science and Practice of Pharmacy 21st ed., Lippincott Williams & Wilkins, 2005 (incorporated herein by reference).

[0149] Carrier The dsDNA molecules described herein can also be formulated with or included in a carrier.General considerations of carriers and pharmaceutical delivery can be found, for example, in Delivery Technologies for Biopharmaceuticals: Peptides, Proteins, Nucleic Acids and Vaccines (Lene Jorgensen and Hanne Morck Nielson, Eds.) Wiley; 1st edition (December 21, 2009) and Vargason et al. 2021. Nat Biomed Eng 5, 951-967.

[0150] Non-limiting examples of carriers include carbohydrate carriers (e.g., anhydride-modified phytoglycogen or glycogen-type materials, GalNAc), nanoparticles (e.g., nanoparticles encapsulating or covalently linked to dsDNA molecules, gold nanoparticles, silica nanoparticles), lipid particles (e.g., liposomes, lipid nanoparticles), cationic carriers (e.g., cationic lipopolymers or transfection reagents), fusosomes, anucleated cells (e.g., ex vivo differentiated reticulocytes), nucleated cells, exosomes, protein carriers (e.g., proteins covalently linked to dsDNA molecules), peptides (e.g., cell membrane-penetrating peptides), materials (e.g., graphene oxide), simple pure lipids (e.g., cholesterol), and DNA origami (e.g., DNA tetrahedra).

[0151] In one embodiment, the dsDNA molecule compositions, constructs, and systems described herein can be formulated into liposomes or other similar vesicles. Liposomes are spherical vesicular structures composed of a unilamellar or multilamellar lipid bilayer surrounding an internal aqueous compartment and a relatively impermeable outer lipophilic phospholipid bilayer. Liposomes can be anionic, neutral, or cationic. Liposomes are biocompatible, non-toxic, can deliver both hydrophilic and lipophilic drug molecules, can protect their cargo from degradation by plasma enzymes, and can transport cargo across biological membranes and the blood-brain barrier (BBB) ​​(see, for example, Spuch and Navarro, Journal of Drug Delivery, vol. 2011, article ID 469679, page 12, 2011. doi:10.1155 / 2011 / 469679 for a review).

[0152] Vesicles can be made from several different types of lipids, but phospholipids are most commonly used to produce liposomes as drug carriers.The method for preparing multilamellar vesicular lipids is known in the art (for example, see U.S. Patent No. 6,693,086, the teaching of which is incorporated herein by reference for the preparation of multilamellar vesicular lipids).Vesicle formation can occur spontaneously when lipid film is mixed with aqueous solution, but it can also be promoted by applying force in the form of shaking by using homogenizer, sonicator or extrusion device (for example, for review, see Spuch and Navarro, Journal of Drug Delivery, vol.2011, article ID 469679, page 12, 2011.doi:10.1155 / 2011 / 469679). Extruded lipids can be prepared by extrusion through size-reducing filters as described in Templeton et al., Nature Biotech, 15:647-652, 1997, the teachings of which regarding the preparation of extruded lipids are incorporated herein by reference.

[0153] Exosomes can be used as drug delivery vehicles for the compositions and systems described herein. For a review, see Ha et al. July 2016. Acta Pharmaceutica Sinica B. Volume 6, Issue 4, Pages 287-296; https: / / doi.org / 10.1016 / j.apsb.2016.02.001.

[0154] Ex vivo differentiated erythrocytes can also be used as carriers for the agents described herein (eg, dsDNA molecules). See, e.g., WO 2015073587; WO 2017123646; WO 2017123644; WO 2018102740; WO 2016183482; WO 2015153102; WO 2018151829; WO 2018009838; Shi et al. 2014. Proc Natl Acad Sci USA. 111(28):10131-10136; US Patent 9,644,180; Huang et al. 2017. Nature Communications 8:423; Shi et al. 2014. Proc Natl Acad Sci USA. 111(28):10131-10136.

[0155] For example, fusosome compositions as described in WO2018208728 can be used as carriers for delivering the dsDNA molecules described herein.

[0156] Lipid nanoparticles: Lipid nanoparticles (LNPs) are carriers made of ionizable lipids. LNPs are taken up by cells via endocytosis, and their properties allow endosomal escape and release of cargo into the cytoplasm of target cells. In addition to ionizable lipids, LNPs may contain helper lipids to promote cell binding, cholesterol to bridge gaps between lipids, and / or polyethylene glycol (PEG) to reduce opsonization by serum proteins and reticuloendothelial clearance. In some embodiments, lipid nanoparticles comprise one or more ionizable lipids, such as non-cationic lipids (e.g., neutral or anionic or zwitterionic lipids), one or more conjugated lipids (e.g., PEG-conjugated lipids or lipids conjugated to polymers described in Table 5 of WO2019217941, incorporated herein by reference in their entirety), one or more sterols (e.g., cholesterol), and optionally one or more targeting molecules (e.g., conjugated receptors, receptor ligands, antibodies), or combinations of the foregoing.

[0157] Lipids (e.g., lipid nanoparticles) that can be used in nanoparticle formation include, for example, those described in Table 4 of WO2019217941, which is incorporated by reference, e.g., lipid-containing nanoparticles can include one or more of the lipids in Table 4 of WO2019217941. Lipid nanoparticles can include additional elements such as polymers, such as the polymers described in Table 5 of WO2019217941, which is incorporated by reference.

[0158] In some embodiments, the conjugated lipid, if present, is PEG-diacylglycerol (DAG) (such as 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG)), PEG-dialkyloxypropyl (DAA), PEG-phospholipid, PEG-ceramide (Cer), PEGylated phosphatidylethanolamine (PEG-PE), PEG succinate diacylglycerol (PEGS-DAG) (4-O-(2',3'-di(tetradecanoyl)methyl)-2,3-dimethicone (2',3'-dimethicone)), or PEG-dialkyloxypropyl (DAA). The polyisoprene derivatives may include one or more of the following: N-(carbonyl-methoxypolyethylene glycol 2000)-1,2-distearoyl-sn-glycero-3-phosphoethanolamine sodium salt, ...

[0159] In some embodiments, sterols that may be incorporated into lipid nanoparticles include one or more cholesterol or cholesterol derivatives, such as those in WO 2009 / 127060 or U.S. Patent Application Publication No. 2010 / 0130588, which are incorporated by reference. Additional exemplary sterols include phytosterols, including those described in Eygeris et al. (2020), dx.doi.org / 10.1021 / acs.nanolett.0c01386, which are incorporated by reference herein.

[0160] In some embodiments, lipid particles comprise an ionizable lipid, a non-cationic lipid, a conjugated lipid that inhibits particle aggregation, and a sterol. The amounts of these components can be varied independently to achieve desired properties. For example, in some embodiments, the lipid particles comprise about 20 mol% to about 90 mol% of the total lipids (in other embodiments, it can be 20-70% (mol), 30-60% (mol), or 40-50% (mol), or about 50 mol% to about 90 mol% of the total lipids present in the lipid nanoparticles), about 5 mol% to about 30 mol% of the total lipids, about 0.5 mol% to about 20 mol% of the total lipids, and about 20 mol% to about 50 mol% of the total lipids. The ratio of total lipid to nucleic acid can be varied as needed. For example, the ratio of total lipid to nucleic acid (mass or weight) can be about 10:1 to about 30:1.

[0161] In some embodiments, the lipid to nucleic acid ratio (mass / mass ratio, w / w ratio) can range from about 1:1 to about 25:1, about 10:1 to about 14:1, about 3:1 to about 15:1, about 4:1 to about 10:1, about 5:1 to about 9:1, or about 6:1 to about 9:1. The amounts of lipid and nucleic acid can be adjusted to provide a desired N / P ratio, e.g., an N / P ratio of 3, 4, 5, 6, 7, 8, 9, 10, or greater. Generally, the overall lipid content of a lipid nanoparticle formulation can range from about 5 mg / mL to about 30 mg / mL.

[0162] Some non-limiting examples of lipid compounds that can be used (e.g., in combination with other lipid components) to form the compositions described herein, e.g., lipid nanoparticles for delivery of the nucleic acids described herein, include the following:

[0163] [ka] In some embodiments, LNPs comprising formula (i) are used to deliver the DNA compositions described herein to the liver and / or liver cells.

[0164] [ka] In some embodiments, LNPs comprising formula (ii) are used to deliver the DNA compositions described herein to the liver and / or hepatocytes.

[0165] [ka] In some embodiments, LNPs comprising formula (iii) are used to deliver the DNA compositions described herein to the liver and / or hepatocytes.

[0166] [ka] In some embodiments, LNPs comprising formula (v) are used to deliver the DNA compositions described herein to the liver and / or hepatocytes.

[0167] [ka] In some embodiments, LNPs comprising formula (vi) are used to deliver the DNA compositions described herein to the liver and / or hepatocytes.

[0168] [ka] In some embodiments, LNPs comprising formula vii or (viii) are used to deliver the DNA compositions described herein to the liver and / or hepatocytes.

[0169] [ka] In some embodiments, LNPs comprising formula (ix) are used to deliver the DNA compositions described herein to the liver and / or hepatocytes.

[0170] In some embodiments, LNPs comprising formula (x) are used to deliver the DNA compositions described herein to the liver and / or hepatocytes. [ka] During the ceremony, X 1 , O, NR 1 or a direct bond, X 2 is a C2-5 alkylene, and X 3 is C(=O) or a direct bond, and R 1 is H or Me, and R 3 is a Ci-3 alkyl, and R 2 is Ci-3 alkyl, or R 2 the nitrogen atom to which it is attached and X 2 together with 1 to 3 carbon atoms of X to form a 4-, 5-, or 6-membered ring, or 1 is NR 1 and R 1 and R 2 together with the nitrogen atom to which they are attached to form a 5- or 6-membered ring, or R 2 R 3 and together with the nitrogen atom to which they are attached form a 5-, 6- or 7-membered ring, and Y 1 is a C2-12 alkylene, and Y 2 teeth, [ka] n is selected from 0 to 3; R 4 is a Ci-15 alkyl, and Z 1 is a Ci-6 alkylene or a direct bond; Z 2 teeth, [ka] (either orientation) or absent, except that Z 1 If is a direct bond, then Z 2 is not assumed to exist, R 5is C5-9 alkyl or C6-10 alkoxy, and R 6 is C5-9 alkyl or C6-10 alkoxy, W is methylene or a direct bond, and R 7 is H or Me) or a salt thereof, with the proviso that R 3 and R 2 is a C2 alkyl, and X 1 is O and X 2 is a linear C3 alkylene, and X 3 is C(=O) and Y 1 is a linear Ce alkylene, and (Y 2 )nR 4 but, [ka] and R 4 is a linear C5 alkyl, and Z 1 is a C2 alkylene, and Z 2 is absent, W is methylene, and R 7 If H, then R 5 and R 6 is not a Cx alkoxy.

[0171] [ka] In some embodiments, LNPs comprising formula (xi) are used to deliver the DNA compositions described herein to the liver and / or hepatocytes.

[0172] In some embodiments, LNPs comprising formula (xii) are used to deliver the DNA compositions described herein to the liver and / or hepatocytes. [ka]

[0173] In some embodiments, the LNP comprises a compound of formula (xiii) and a compound of formula (xiv).

[0174] [ka] In some embodiments, an LNP comprising formula (xv) is used to deliver the DNA compositions described herein to the liver and / or hepatocytes.

[0175] [ka] In some embodiments, LNPs comprising a formulation of formula (xvi) are used to deliver the DNA compositions described herein to pulmonary endothelial cells.

[0176] In some embodiments, LNPs comprising a formulation of formula (xvii), (xviii), or (xix) are used to deliver the DNA compositions described herein to pulmonary endothelial cells. [ka]

[0177] In some embodiments, the lipid compounds used to form the compositions described herein, e.g., lipid nanoparticles for delivery of the nucleic acids described herein, are made by one of the following reactions: [ka]

[0178] In some embodiments, a composition (e.g., a nucleic acid or a protein) described herein is provided in an LNP comprising an ionizable lipid. In some embodiments, the ionizable lipid is, for example, 8-((2-hydroxyethyl)(6-oxo-6-(undecyloxy)hexyl)amino)heptadecan-9-yl octanoate (SM-102), as described in Example 1 of U.S. Pat. No. 9,867,888 (incorporated herein by reference in its entirety). In some embodiments, the ionizable lipid is, for example, 9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate (LP01), as synthesized in Example 13 of WO 2015 / 095340 (incorporated herein by reference in its entirety). In some embodiments, the ionizable lipid is di((Z)-non-2-en-1-yl)9-((4-dimethylamino)butanoyl)oxy)heptadecanedienoate (L319), e.g., as synthesized in Examples 7, 8, or 9 of U.S. Patent Application Publication No. 2012 / 0027803 (incorporated herein by reference in its entirety). In some embodiments, the ionizable lipid is 1,1'-((2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-1-yl)ethyl)azanediyl)bis(dodecan-2-ol) (C12-200), e.g., as synthesized in Examples 14 and 16 of WO 2010 / 053572 (incorporated herein by reference in its entirety).In some embodiments, the ionizable lipid is the imidazole cholesterol ester (ICE) lipid 3-(1H-imidazol-4-yl)propanoic acid (3S,10R,13R,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl, e.g., structure (I) from WO 2020 / 106946 (incorporated herein by reference in its entirety).

[0179] In some embodiments, the ionizable lipid may be a cationic lipid that is an ionizable cationic lipid, such as a cationic lipid that can exist in a positively charged or neutral form depending on the pH, or an amine-containing lipid that can be easily protonated. In some embodiments, the cationic lipid is, for example, a lipid that can be positively charged under physiological conditions. Exemplary cationic lipids include one or more amine groups with a positive charge. In some embodiments, the lipid particle comprises a cationic lipid in a formulation with one or more of neutral lipids, ionizable amine-containing lipids, biodegradable alkyne lipids, steroids, phospholipids including polyunsaturated lipids, structured lipids (e.g., sterols), PEG, cholesterol, and lipids conjugated to polymers. In some embodiments, the cationic lipid may be an ionizable cationic lipid. Exemplary cationic lipids as disclosed herein may have an effective pKa greater than 6.0. In embodiments, the lipid nanoparticle may comprise a second cationic lipid having an effective pKa different from that of the first cationic lipid (e.g., greater than that of the first). The lipid nanoparticles may comprise 40-60 mole percent of cationic lipids, neutral lipids, steroids, polymer-conjugated lipids, and therapeutic agents, such as nucleic acids described herein, encapsulated within or associated with the lipid nanoparticles. In some embodiments, the nucleic acid is combined with the cationic lipid. The nucleic acid may be adsorbed to the surface of the LNP, e.g., LNPs comprising cationic lipids. In some embodiments, the nucleic acid may be encapsulated within the LNP, e.g., LNPs comprising cationic lipids. In some embodiments, the lipid nanoparticles may comprise a targeting moiety, e.g., coated with a targeting agent. In embodiments, the LNP formulation is biodegradable.In some embodiments, lipid nanoparticles comprising one or more lipids described herein, e.g., formula (i), (ii), (ii), (vii) and / or (ix), encapsulate at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 92%, at least 95%, at least 97%, at least 98%, or 100% of the dsDNA molecules described herein.

[0180] Exemplary ionizable lipids that may be used in lipid nanoparticle formulations include, but are not limited to, those listed in Table 1 of International Publication No. WO 2019051289, which is incorporated herein by reference. Additional exemplary lipids include, but are not limited to, one or more of the following formulas: X of U.S. Patent Application Publication No. 2016 / 0311759, I of U.S. Patent Application Publication No. 20150376115 or in U.S. Patent Application Publication No. 2016 / 0376224, I, II, or III of U.S. Patent Application Publication No. 20160151284, I, IA, II, or IIA of U.S. Patent Application Publication No. 20170210967, and U.S. Patent Application Publication No. 20150140070. Ic of U.S. Patent Application Publication No. 2013 / 0178541 A, I of U.S. Patent Application Publication No. 2013 / 0303587 or I of U.S. Patent Application Publication No. 2013 / 0123338, I of U.S. Patent Application Publication No. 2015 / 0141678, II, III, IV or V of U.S. Patent Application Publication No. 2015 / 0239926, I of U.S. Patent Application Publication No. 2017 / 0119904, I or II of International Publication No. 2017 / 117528, U.S. Patent Application Publication No. 201 US Patent Application Publication No. 2013 / 0149894 A, US Patent Application Publication No. 2015 / 0057373 A, WO 2013 / 116126 A, US Patent Application Publication No. 2013 / 0090372 A, US Patent Application Publication No. 2013 / 0274523 A, US Patent Application Publication No. 2013 / 0274504 A, US Patent Application Publication No. 2013 / 0053572 A, WO 2013 / 016058 A, WO 2012 / 162210 A of the pamphlet of U.S. Patent Application Publication No. 2008 / 042973, I of U.S. Patent Application Publication No. 2012 / 01287670, I or II of U.S. Patent Application Publication No. 2014 / 0200257, I, II or III of U.S. Patent Application Publication No. 2015 / 0203446, I or III of U.S. Patent Application Publication No. 2015 / 0005363, I, IA, IB, IC, ID, II, IIA of U.S. Patent Application Publication No. 2014 / 0308304,IIB, IIC, IID or III-XXIV, I, IA, IB, IC, ID, II, IIA, IIB, IIC, IID or III-XXIV of U.S. Patent Application Publication No. 2013 / 0338210, I, II, III or IV of WO 2009 / 132131, A of U.S. Patent Application Publication No. 2012 / 01011478, I or XXXV of U.S. Patent Application Publication No. 2012 / 0027796, XIV or XVII of U.S. Patent Application Publication No. 2012 / 0058144, U.S. Patent Application Publication No. 2013 / 032326 XIV or XVII of U.S. Patent Application Publication No. 2011 / 0117125, I of U.S. Patent Application Publication No. 2011 / 0256175, I, II or III of U.S. Patent Application Publication No. 2012 / 0202871, I, II, III, IV, V, VI, VII, VIII, IX, X, XI, XII of U.S. Patent Application Publication No. 2011 / 0076335, I, II, III, IV, V, VI, VII, VIII, X, XII, XIII, XIV, XV or XVI of U.S. Patent Application Publication No. 2006 / 008378 I, I of U.S. Patent Application Publication No. 2013 / 0123338, I or XAYZ of U.S. Patent Application Publication No. 2015 / 0064242, XVI, XVII or XVIII of U.S. Patent Application Publication No. 2013 / 0022649, I, II or III of U.S. Patent Application Publication No. 2013 / 0116307, I, II or III of U.S. Patent Application Publication No. 2013 / 0116307, I or II of U.S. Patent Application Publication No. 2010 / 0062967, IX of U.S. Patent Application Publication No. 2013 / 0189351, IX of U.S. Patent Application Publication No. No. 2014 / 0039032, U.S. Patent Application Publication No. 2018 / 0028664, U.S. Patent Application Publication No. 2016 / 0317458, U.S. Patent Application Publication No. 2013 / 0195920, U.S. Patent Application Publication No. 5, 6 or 10, U.S. Patent Application Publication No. 2018 / 081480, U.S. Patent Application Publication No. 2020 / 081938, U.S. Patent Application Publication No. 2019 / 0136231,II of WO 2020 / 219876, 1 of U.S. Patent Application Publication No. 2012 / 0027803, OF-02 of U.S. Patent Application Publication No. 2019 / 0240349, 23 of U.S. Patent No. 10,086,013, cKK-E12 / A6 of Miao et al (2020), C12-200 of WO 2010 / 053572, 7C1 of Dahlman et al (2017), 304-O13 or 503-O13 of Whitehead et al, TS-P4C2 of U.S. Patent No. 9,708,628, I of WO 2020 / 106946, I of WO 2020 / 106946.

[0181] In some embodiments, the ionizable lipid is MC3 butanoic acid (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl-4-(dimethylamino) (DLin-MC3-DMA or MC3), for example, as described in Example 9 of WO2019051289A9 (incorporated herein by reference in its entirety). In some embodiments, the ionizable lipid is lipid ATX-002, for example, as described in Example 10 of WO2019051289A9 (incorporated herein by reference in its entirety). In some embodiments, the ionizable lipid is (13Z,16Z)-A,A-dimethyl-3-nonyldocosa-13,16-dien-1-amine (compound 32), e.g., as described in Example 11 of WO2019051289A9 (incorporated herein by reference in its entirety). In some embodiments, the ionizable lipid is compound 6 or compound 22, e.g., as described in Example 12 of WO2019051289A9 (incorporated herein by reference in its entirety).

[0182] Exemplary non-cationic lipids include distearoyl-sn-glycero-phosphoethanolamine, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidyl dioleoyl-phosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidylethanolamine (DSPE), monomethyl-phosphatidylethanolamine (e.g., 16-O-monomethyl PE), dimethyl-phosphatidylethanolamine (e.g., 16-O-dimethyl PE), 18 -l-transPE, l-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), hydrogenated soy phosphatidylcholine (HSPC), egg phosphatidylcholine (EPC), dioleoylphosphatidylserine (DOPS), sphingomyelin (SM), dimyristoylphosphatidylcholine (DMPC), dimyristoylphosphatidylglycerol (DMPG), distearoylphosphatidylglycerol (DSPG), diercoylphosphatidylcholine (DEPC), palmitoyloleoylphosphatidylethanolamine (PPE), These include, but are not limited to, sphatidylglycerol (POPG), dielaidoyl-phosphatidylethanolamine (DEPE), lecithin, phosphatidylethanolamine, lysolecithin, lysophosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, sphingomyelin, egg sphingomyelin (ESM), cephalin, cardiolipin, phosphatidic acid, cerebrosides, dicetyl phosphate, lysophosphatidylcholine, dilinoleoylphosphatidylcholine, or mixtures thereof.It is understood that other diacylphosphatidylcholine and diacylphosphatidylethanolamine phospholipids can also be used. The acyl groups in these lipids are preferably acyl groups derived from fatty acids having C10 to C24 carbon chains, such as lauroyl, myristoyl, paimitoyl, stearoyl, or oleoyl. Additional exemplary lipids include, but are not limited to, those described in Kim et al. (2020) dx.doi.org / 10.1021 / acs.nanolett.0c01386, which is incorporated herein by reference. Such lipids include, in some embodiments, plant lipids (e.g., DGTS) that have been found to improve liver transfection with mRNA.

[0183] Other examples of non-cationic lipids suitable for use in lipid nanoparticles include, but are not limited to, non-phospholipids such as stearylamine, dodeylamine, hexadecylamine, acetyl palmitate, glycerol ricinoleate, hexadecyl stereate, isopropyl myristate, amphoteric acrylic polymers, triethanolamine-lauryl sulfate, alkyl-aryl sulfate polyethyloxylated fatty acid amides, dioctadecyldimethylammonium bromide, ceramide, sphingomyelin, etc. Other non-cationic lipids are described in WO 2017 / 099823 or U.S. Patent Application Publication No. 2018 / 0028664, the contents of which are incorporated herein by reference in their entirety.

[0184] In some embodiments, the non-cationic lipid is oleic acid or a compound of Formula I, II, or IV of U.S. Patent Application Publication No. 2018 / 0028664, incorporated herein by reference in its entirety. The non-cationic lipid may comprise, for example, 0-30% (mol) of the total lipid present in the lipid nanoparticle. In some embodiments, the non-cationic lipid content is 5-20% (mol) or 10-15% (mol) of the total lipid present in the lipid nanoparticle. In embodiments, the molar ratio of ionizable lipid to neutral lipid ranges from about 2:1 to about 8:1 (e.g., about 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, or 8:1).

[0185] In some embodiments, the lipid nanoparticles do not include any phospholipids.

[0186] In some embodiments, the lipid nanoparticles can further comprise components such as sterols to provide membrane integrity. One exemplary sterol that can be used in the lipid nanoparticles is cholesterol and its derivatives. Non-limiting examples of cholesterol derivatives include polar analogs such as 5a-coiestanol, 53-coprostanol, coiesteryl-(2'-hydroxy)-ethyl ether, coiesteryl-(4'-hydroxy)-butyl ether, and 6-ketocholestanol; non-polar analogs such as 5a-cholestan, cholestenone, 5a-cholestanone, 5p-cholestanone, and cholesteryl decanoate; and mixtures thereof. In some embodiments, the cholesterol derivative is a polar analog, such as coiesteryl-(4'-hydroxy)-butyl ether. Exemplary cholesterol derivatives are described in PCT Publication WO 2009 / 127060 and U.S. Patent Application Publication No. 2010 / 0130588, each of which is incorporated herein by reference in its entirety.

[0187] In some embodiments, components that confer membrane integrity, such as sterols, can comprise 0-50% (mol) of the total lipids present in the lipid nanoparticles (e.g., 0-10%, 10-20%, 20-30%, 30-40%, or 40-50%). In some embodiments, such components comprise 20-50% (mol), 30-40% (mol) of the total lipid content of the lipid nanoparticles.

[0188] In some embodiments, the lipid nanoparticles may contain polyethylene glycol (PEG) or conjugated lipid molecules. These are generally used to inhibit aggregation and / or provide steric stabilization of the lipid nanoparticles. Exemplary conjugated lipids include, but are not limited to, PEG-lipid conjugates, polyoxazoline (POZ)-lipid conjugates, polyamide-lipid conjugates (such as ATTA-lipid conjugates), cationic-polymer lipid (CPL) conjugates, and mixtures thereof. In some embodiments, the conjugated lipid molecule is a PEG-lipid conjugate, such as a (methoxypolyethylene glycol)-conjugated lipid.

[0189] Exemplary PEG-lipid conjugates include PEG-diacylglycero (DAG) (such as 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG)), PEG-dialkyloxypropyl (DAA), PEG-phospholipid, PEG-ceramide (Cer), PEGylated phosphatidylethanolamine (PEG-PE), PEG diacylglycerol succinate (PEGS-DAG) (4-O-(2',3'-di(tetradecanoyloxy)propyl-l-O-(w-methacrylamide)), PEG-dialkyloxypropyl (DAA), PEG-phospholipid, PEG-ceramide (Cer), PEGylated phosphatidylethanolamine (PEG-PE), PEG diacylglycerol succinate (PEGS-DAG) (4-O-(2',3'-di(tetradecanoyloxy)propyl-l-O-(w-methacrylamide)), PEG-dialkyloxypropyl (DAA), PEG-phospholipid, PEG-ceramide (Cer), PEG-dialkyloxypropyl (DAG)), PEG-dialkyloxypropyl (DAG ...

[0033] Additional exemplary PEG-lipid conjugates include, but are not limited to, N-(carbonyl-methoxypolyethylene glycol 2000)-1,2-distearoyl-sn-glycero-3-phosphoethanolamine sodium salt, PEG-dialkoxypropylcarbamate, N-(carbonyl-methoxypolyethylene glycol 2000)-1,2-distearoyl-sn-glycero-3-phosphoethanolamine sodium salt, or mixtures thereof. Additional exemplary PEG-lipid conjugates are described, for example, in U.S. Patent No. 5,885,613, U.S. Patent No. 6,287,591, the entire contents of which are incorporated herein by reference in their entirety. No. 2003 / 0077829, U.S. Patent Application Publication No. 2003 / 0077829, U.S. Patent Application Publication No. 2005 / 0175682, U.S. Patent Application Publication No. 2008 / 0020058, U.S. Patent Application Publication No. 2011 / 0117125, U.S. Patent Application Publication No. 2010 / 0130588, U.S. Patent Application Publication No. 2016 / 0376224, U.S. Patent Application Publication No. 2017 / 0119904 and U.S. Patent Application Publication No. / 099823 In some embodiments, the PEG-lipid is a compound of Formula III, III-aI, III-a-2, III-b-1, III-b-2, or V of U.S. Patent Application Publication No. 2018 / 0028664, the contents of which are incorporated herein by reference in their entireties. In some embodiments, the PEG-lipid is of Formula II of U.S. Patent Application Publication No. 20150376115 or U.S. Patent Application Publication No. 2016 / 0376224, the contents of both of which are incorporated herein by reference in their entireties.In some embodiments, the PEG-DAA conjugate can be, for example, PEG-dilauryloxypropyl, PEG-dimyristyloxypropyl, PEG-dipalmitoyloxypropyl, or PEG-distearyloxypropyl. PEG-lipids include PEG-DMG, PEG-dilaurylglycerol, PEG-dipalmitoylglycerol, PEG-disterylglycerol, PEG-dilaurylglycamide, PEG-dimyristylglycamide, PEG-dipalmitoylglycamide, PEG-disterylglycamide, PEG-cholesterol (1-[8'-(cholest-5-ene-3[beta]-oxy)carboxamido-3',6'-dioxaotanyl]carbamoyl-[omega]-methyl-poly(ethylene glycol), PEG-DMB (3,4-diethylamino)methyl. The PEG-lipid may be one or more of: ladecoxylbenzyl-[omega]-methyl-poly(ethylene glycol) ether) and 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000]. In some embodiments, the PEG-lipid comprises PEG-DMG, 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000]. In some embodiments, the PEG-lipid comprises a structure selected from the following: [ka]

[0190] In some embodiments, lipids conjugated with molecules other than PEG can be used instead of PEG-lipids, for example, polyoxazoline (POZ)-lipid conjugates, polyamide-lipid conjugates (such as ATTA-lipid conjugates), and cationic-polymer lipid (GPL) conjugates can be used instead of or in addition to PEG-lipids.

[0191] Exemplary conjugated lipids, i.e., PEG-lipids, (POZ)-lipid conjugates, ATTA-lipid conjugates, and cationic polymer-lipids, are described in the PCT and LIS patent applications listed in Table 2 of WO2019051289A9, the entire contents of which are incorporated herein by reference in their entirety.

[0192] In some embodiments, PEG or conjugated lipids may comprise 0-20% (molar) of the total lipid present in the lipid nanoparticle. In some embodiments, the PEG or conjugated lipid content is 0.5-10% or 2-5% (molar) of the total lipid present in the lipid nanoparticle. The molar ratios of ionizable lipid, non-cationic lipid, sterol, and PEG / conjugated lipid may vary as needed. For example, lipid particles may comprise 30-70% ionizable lipid by molar or total weight of the composition, 0-60% cholesterol by molar or total weight of the composition, 0-30% non-cationic lipid by molar or total weight of the composition, and 1-10% conjugated lipid by molar or total weight of the composition. Preferably, the composition comprises 30-40% ionizable lipid by molar or total weight of the composition, 40-50% cholesterol by molar or total weight of the composition, and 10-20% non-cationic lipid by molar or total weight of the composition. In some other embodiments, the composition comprises 50-75% ionizable lipid by molar or total weight, 20-40% cholesterol by molar or total weight, 5-10% non-cationic lipid by molar or total weight, and 1-10% conjugated lipid by molar or total weight. The composition may comprise 60-70% ionizable lipid by molar or total weight, 25-35% cholesterol by molar or total weight, and 5-10% non-cationic lipid by molar or total weight. The composition may also comprise up to 90% ionizable lipid by molar or total weight and 2-15% non-cationic lipid by molar or total weight.Formulations may include, for example, 8-30% ionizable lipid by molar or total weight of the composition, 5-30% non-cationic lipid by molar or total weight of the composition and 0-20% cholesterol by molar or total weight of the composition, 4-25% ionizable lipid by molar or total weight of the composition, 4-25% non-cationic lipid by molar or total weight of the composition, 2-25% cholesterol by molar or total weight of the composition, 10-35% conjugated lipid by molar or total weight of the composition and 5% cholesterol by molar or total weight of the composition, or 10-35% conjugated lipid by molar or total weight of the composition. The lipid nanoparticle formulation may also comprise 2-30% ionizable lipid by total weight, 2-30% non-cationic lipid by molar or total weight, 1-15% cholesterol by molar or total weight, 2-35% conjugated lipid by molar or total weight, and 1-20% cholesterol by molar or total weight, or up to 90% ionizable lipid by molar or total weight, and 2-10% non-cationic lipid by molar or total weight, or 100% cationic lipid by molar or total weight. In some embodiments, the lipid particle formulation comprises ionizable lipid, phospholipid, cholesterol, and PEGylated lipid in a molar ratio of 50:10:38.5:1.5. In some other embodiments, the lipid particle formulation comprises ionizable lipid, cholesterol, and PEGylated lipid in a molar ratio of 60:38.5:1.5.

[0193] In some embodiments, the lipid particles comprise an ionizable lipid, a non-cationic lipid (e.g., a phospholipid), a sterol (e.g., cholesterol), and a PEGylated lipid, wherein the molar ratio of lipids ranges from 20-70 mole percent with respect to the ionizable lipid, with a target of 40-60; the molar percent of non-cationic lipid ranges from 0-30, with a target of 0-15; the molar percent of sterol ranges from 20-70, with a target of 30-50; and the molar percent of PEGylated lipid ranges from 1-6, with a target of 2-5.

[0194] In some embodiments, the lipid particles comprise ionizable lipid / non-cationic lipid / sterol / conjugated lipid in a molar ratio of 50:10:38.5:1.5.

[0195] In some aspects, the present disclosure provides lipid nanoparticle formulations comprising a phospholipid, a lecithin, a phosphatidylcholine, and a phosphatidylethanolamine.

[0196] In some embodiments, one or more additional compounds may also be included. These compounds may be administered separately, or the additional compounds may be included in the lipid nanoparticles of the present invention. In other words, the lipid nanoparticles may contain, in addition to the nucleic acid, other compounds or at least one second nucleic acid different from the first. Without limitation, the other additional compounds may be selected from the group consisting of small or large organic or inorganic molecules, monosaccharides, disaccharides, trisaccharides, oligosaccharides, polysaccharides, peptides, proteins, peptide analogs and derivatives thereof, peptidomimetics, nucleic acids, nucleic acid analogs and derivatives, extracts made from biological materials, or any combination thereof.

[0197] In some embodiments, LNPs are targeted to specific tissues by the addition of a targeting domain. For example, a biological ligand can be presented on the surface of the LNP to enhance interaction with cells that present the cognate receptor, thereby driving cell association with and cargo delivery to tissues that express the receptor. In some embodiments, the biological ligand can be a ligand that drives delivery to the liver; for example, LNPs that present GalNAc result in delivery of nucleic acid cargo to hepatocytes that present the asialoglycoprotein receptor (ASGPR). Akinc et al. Mol Ther 18(7):1357-1364 (2010) teaches the conjugation of a trivalent GalNAc ligand (GalNAc-PEG-DSG) to a PEG-lipid to obtain LNPs that rely on ASGPR for observable LNP cargo effects (see, e.g., Akinc et al. 2010, supra, Figure 6).Other ligand-presenting LNP formulations, for example incorporating folate, transferrin, or antibodies, are discussed in WO 2017223135, which is consistent with the references used therein, i.e., Kolhatkar et al., Curr Drug Discov Technol. 2011 8:197-206; Musacchio and Torchilin, Front Biosci. 2011 16:1388-1412; Yu et al., Mol Membr Biol. 2010 27:286-298; Patil et al., Crit Rev Ther Drug Carrier Syst. 2008 25:1-61; Benoit et al., Biomacromolecules. 2011 12:2708-2714; Zhao et al., Expert Opin Drug Deliv. 2008 5:309-319; Akinc et al. al.,Mol Ther.2010 18:1357-1364;Srinivasan et al.,Methods Mol Biol.2012 820:105-116;Ben-Arie et al.,Methods Mol Biol.2012 757:497-507;Peer 2010 J Control Release.20:63-68;Peer et al. al.,Proc Natl Acad Sci USA.2007 104:4095-4100;Kim et al.,Methods Mol Biol.2011 721:339-353;Subramanya et al.,Mol Ther.2010 18:2028-2037;Song et al.,Nat Biotechnol.2005 23:709-717;Peer et al., Science. 2008 319:627-630 and Peer and Lieberman, Gene Ther. 2011 18:1127-1133, which are incorporated herein by reference in their entireties.

[0198] In some embodiments, LNPs are selected for tissue-specific activity by the addition of selective organ targeting (SORT) molecules to formulations containing traditional components such as ionizable cationic lipids, amphipathic phospholipids, cholesterol, and poly(ethylene glycol) (PEG) lipids. The teachings of Cheng et al., Nat Nanotechnol 15(4):313-320 (2020), demonstrate that the addition of supplemental "SORT" components precisely alters in vivo RNA delivery profiles, mediating tissue-specific (e.g., lung, liver, spleen) gene delivery and editing depending on the percentage and biophysical properties of the SORT molecules.

[0199] In some embodiments, the LNPs comprise a biodegradable, ionizable lipid. In some embodiments, the LNPs comprise (9Z,l2Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,l2-dienoate, also known as (9Z,l2Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,l2Z)-octadeca-9,l2-dienoate or another ionizable lipid. See, e.g., the lipids in WO 2019 / 067992, WO 2017 / 173054, WO 2015 / 095340, and WO 2014 / 136086 and the references provided therein. In some embodiments, the terms cationic and ionizable in the context of LNP lipids are synonymous, e.g., ionizable lipids are cationic depending on the pH.

[0200] In some embodiments, the mean LNP diameter of an LNP formulation can be from 10 nm to 100 nm, for example, as measured by dynamic light scattering (DLS). In some embodiments, the mean LNP diameter of an LNP formulation can be from about 40 nm to about 150 nm, such as about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm. In some embodiments, the mean LNP diameter of an LNP formulation can be about 50 nm to about 100 nm, about 50 nm to about 90 nm, about 50 nm to about 80 nm, about 50 nm to about 70 nm, about 50 nm to about 60 nm, about 60 nm to about 100 nm, about 60 nm to about 90 nm, about 60 nm to about 80 nm, about 60 nm to about 70 nm, about 70 nm to about 100 nm, about 70 nm to about 90 nm, about 70 nm to about 80 nm, about 80 nm to about 100 nm, about 80 nm to about 90 nm, or about 90 nm to about 100 nm. In some embodiments, the mean LNP diameter of an LNP formulation can be about 70 nm to about 100 nm. In certain embodiments, the mean LNP diameter of an LNP formulation can be about 80 nm. In some embodiments, the mean LNP diameter of an LNP formulation can be about 100 nm. In some embodiments, the mean LNP diameter of the LNP formulation is in the range of about 1 mm to about 500 mm, about 5 mm to about 200 mm, about 10 mm to about 100 mm, about 20 mm to about 80 mm, about 25 mm to about 60 mm, about 30 mm to about 55 mm, about 35 mm to about 50 mm, or about 38 mm to about 42 mm.

[0201] LNPs may, in some instances, be relatively homogeneous. The polydispersity index may be used to indicate the uniformity of LNPs, e.g., the particle size distribution of lipid nanoparticles. A small polydispersity index (e.g., less than 0.3) generally indicates a narrow particle size distribution. LNPs may have a polydispersity index of about 0 to about 0.25, such as 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the polydispersity index of LNPs may be about 0.10 to about 0.20.

[0202] The zeta potential of LNPs can be used to indicate the electrokinetic potential of a composition. In some embodiments, the zeta potential can describe the surface charge of LNPs. Lipid nanoparticles with relatively low positive or negative charges are generally desirable because highly charged species can undesirably interact with cells, tissues, and other elements in the body. In some embodiments, the zeta potential of the LNP can be about -10 mV to about +20 mV, about -10 mV to about +15 mV, about -10 mV to about +10 mV, about -10 mV to about +5 mV, about -10 mV to about 0 mV, about -10 mV to about -5 mV, about -5 mV to about +20 mV, about -5 mV to about +15 mV, about -5 mV to about +10 mV, about -5 mV to about +5 mV, about -5 mV to about 0 mV, about 0 mV to about +20 mV, about 0 mV to about +15 mV, about 0 mV to about +10 mV, about 0 mV to about +5 mV, about +5 mV to about +20 mV, about +5 mV to about +15 mV, or about +5 mV to about +10 mV.

[0203] The efficiency of protein and / or nucleic acid encapsulation describes the amount of protein and / or nucleic acid encapsulated or otherwise associated with the prepared LNP relative to the initial amount provided. The encapsulation efficiency is desirably high (e.g., close to 100%). The encapsulation efficiency can be measured, for example, by comparing the amount of protein or nucleic acid in a solution containing lipid nanoparticles before and after disintegration of the lipid nanoparticles with one or more organic solvents or detergents. Anion exchange resins can be used to measure the amount of free protein or nucleic acid in solution. Fluorescence can be used to measure the amount of free protein and / or nucleic acid in solution. For the lipid nanoparticles described herein, the encapsulation efficiency of protein and / or nucleic acid can be at least 50%, e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency may be at least 80%. In some embodiments, the encapsulation efficiency may be at least 90%. In some embodiments, the encapsulation efficiency may be at least 95%.

[0204] LNPs can optionally include one or more coatings. In some embodiments, LNPs can be formulated in capsules, films, or tablets with a coating. Capsules, films, or tablets containing the compositions described herein can have any useful size, tensile strength, hardness, or density.

[0205] Additional exemplary lipids, formulations, methods, and LNP features are taught by WO2020061457, which is incorporated by reference in its entirety. See also Hou et al. Lipid nanoparticles for mRNA delivery. Nat Rev Mater (2021). https: / / doi.org / 10.1038 / s41578-021-00358-0.

[0206] In some embodiments, in vitro or ex vivo cell lipofection is performed using Lipofectamine MessengerMax (Thermo Fisher) or TransIT-mRNA transfection reagent (Mirus Bio). In certain embodiments, LNPs are formulated using GenVoy_ILM ionizable lipid mixture (Precision NanoSystems). In certain embodiments, LNPs are formulated using 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA) or dilinoleylmethyl-4-dimethylaminobutyrate (DLin-MC3-DMA or MC3) as taught in Jayaraman et al. Angew Chem Int Ed Engl 51(34):8529-8533 (2012), which is incorporated herein by reference in its entirety.

[0207] LNP formulations optimized for delivery of CRISPR-Cas systems, e.g., Cas9-gRNA RNP, gRNA, Cas9 mRNA, are described in WO2019067992 and WO2019067910, both of which are incorporated by reference.

[0208] Additional specific LNP formulations useful for delivery of nucleic acids are described in U.S. Pat. No. 8,158,601 and U.S. Pat. No. 8,168,775, both of which are incorporated by reference, and include the formulation used in Patisiran, sold under the name ONPATTRO.

[0209] The following embodiments are contemplated: A. Lipid nanoparticles (LNPs) comprising a dsDNA molecule, sequence or composition described herein. B. The LNP of embodiment A comprising a cationic lipid. C. The cationic lipid is [ka] The LNP of embodiment B, having a structure according to D. The LNP of any of embodiments A-C, further comprising one or more neutral lipids, such as DSPC, DPPC, DMPC, DOPC, POPC, DOPE, SM, a steroid, such as cholesterol, and / or one or more polymer-conjugated lipids, such as PEGylated lipids, such as PEG-DAG, PEG-PE, PEG-S-DAG, PEG-cer, or PEG dialkyoxypropylcarbamate.

[0210] In embodiments, LNP preparations containing the dsDNA molecules described herein can be targeted to desired cell types by surface decoration with targeting effectors. Such targeting effectors include, for example, cell-specific receptor ligands that bind to target cells, antibodies or other conjugates to target cells, centryins, cell membrane-permeable peptides, and peptides that enable endosomal escape (e.g., GALA, KALA). For a review, see, for example, Tables 1 and 2 in Tai & Gao. 2017. Adv Drug Deliv Rev. 110-111:157-168.

[0211] In embodiments, LNP preparations comprising the dsDNA molecules described herein can be co-administered with an adjuvant, e.g., can be co-delivered in the same preparation as the adjuvant.

[0212] Route of administration The dsDNA molecules described herein are introduced into a cell, tissue or subject by any suitable route.

[0213] Administration to target cells or tissues (e.g., ex vivo) can be by methods known in the art, such as transfection, e.g., transient or stable transfection, using reagents (e.g., liposomes, calcium phosphate) or physical means (e.g., electroporation, gene guns, microinjection, microfluidic shearing, cell squeezing). Other methods are described, for example, in Rad et al. 2021. Adv. Mater. 33:2005363, incorporated herein by reference.

[0214] Administration to a subject, e.g., a mammal, e.g., a human subject, can be by parenteral (e.g., intravenous, intramuscular, intraperitoneal, subcutaneous, or intracranial) routes, topical, transdermal, or transcutaneous administration. Other suitable routes include oral, rectal, transmucosal, intranasal, inhalation (e.g., by aerosol), buccal (e.g., sublingual), vaginal, intrathecal, intraocular, transdermal, intradermal, intrauterine (or intraovo), intrapleural, intracerebral, intraarticular, topical, and intralymphatic. Direct tissue or organ injection (e.g., into the liver, eye, skeletal muscle, cardiac muscle, diaphragm, muscle, or brain) is also included.

[0215] Applicable The dsDNA molecules described herein can be used in therapeutic or health care applications for subjects, e.g., humans or non-human animals. While the description of pharmaceutical compositions provided herein is primarily directed to pharmaceutical compositions suitable for administration to humans, those skilled in the art will understand that such compositions are generally suitable for administration to any other animal. The subject can be any animal, e.g., a mammal, e.g., a human or a non-human mammal. In embodiments, the subject is a vertebrate (e.g., a mammal, a bird, a fish, a reptile, or an amphibian). In embodiments, the subject is a human. In embodiments, the subject of the method is a non-human mammal. In embodiments, the subject is a non-human mammal, such as a non-human primate (e.g., a monkey, an ape), an ungulate (e.g., a cow, a buffalo, a sheep, a goat, a pig, a camel, a llama, an alpaca, a deer, a horse, a donkey), a carnivore (e.g., a dog, a cat), a rodent (e.g., a rat, a mouse), or a lagomorph (e.g., a rabbit). In embodiments, the subject is a bird, such as a member of the avian taxonomic group Galliformes (e.g., chickens, turkeys, pheasants, quails), Anseriformes (e.g., ducks, geese), Paleognathiformes (e.g., ostriches, emus), Columbidae (e.g., house pigeons, doves), or Psittaciformes (e.g., parrots). In embodiments, the subject is an invertebrate, such as an arthropod (e.g., insects, arachnids, crustaceans), nematodes, annelids, worms, or mollusks.

[0216] In some embodiments, the DNA described herein is provided at a dose of about 0.1 to 100 mg / kg of DNA.

[0217] In some embodiments, the dsDNA molecules described herein confer a biological effect of the effector, e.g., expression of a therapeutic polypeptide, on a host cell, tissue, or subject for at least 2, 3, 4, 5, 6 days or 1 week, at least 8, 9, 10, 12, 14 days or 2 weeks, at least 16, 18, 20 days or 3 weeks, at least 22, 24, 25, 27, 28 days or 1 month, at least 2 months, 3 months, 4 months, 5 months, 6 months or more, between 1 week and 6 months, between 1 month and 6 months, between 3 months and 6 months.

[0218] In some embodiments, the dsDNA molecules described herein confer an effector biological effect, e.g., expression of a therapeutic polypeptide, on a host cell, tissue, or subject for at least one cell division of the host cell.

[0219] In embodiments, the dsDNA molecules described herein can be used to deliver an effector, such as an effector described herein, to a cell, tissue, or subject.

[0220] In embodiments, the dsDNA molecules described herein can be used to modulate (e.g., increase or decrease) a biological parameter in a cell, tissue, or subject. The biological parameter can be an increase or decrease in gene expression of a gene of interest in a target cell, tissue, or subject.

[0221] In embodiments, the dsDNA molecules described herein can be used to treat a cell, tissue, or subject in need thereof by administering a dsDNA molecule described herein to such cell, tissue, or subject. In embodiments, the subject has or has been diagnosed with a condition that can be treated with a dsDNA-encoded effector.

[0222] In some embodiments, the present disclosure provides methods of modulating (e.g., increasing or decreasing) a biological activity in a target cell, the method comprising: (i) providing a target cell comprising a dsDNA molecule as described herein, where the dsDNA molecule encodes a heterologous payload that modulates the biological activity in the target cell; and (ii) maintaining (e.g., incubating) the cells under conditions suitable for expression of the heterologous payload from the dsDNA molecule, thereby modulating the biological activity in the target cell.

[0223] In embodiments, the dsDNA molecule delivers an effector to a cell selected from an immune cell (e.g., a T cell or a monocyte), a cancer cell (e.g., an osteosarcoma cell), a HEK293 cell, a hepatocyte, or an epithelial cell (e.g., a keratinocyte). [Example]

[0224] table of contents Example 1: Formulation of dsDNA molecules (e.g., TDSC) with LNPs Example 2: Determination of exonuclease resistance for dsDNA molecules containing closed ends Example 3: Determining exonuclease resistance for dsDNA molecules containing open ends (e.g., two open ends) Example 4: Design and construction of a plasmid template for the generation of double-stranded DNA (dsDNA) molecules Example 5: Generation of dsDNA molecules with chemical modifications Example 6: Evaluation of reporter gene expression in vitro Example 7: Evaluation of innate immune responses in cells in vitro Example 8: Quantification of DNA chemical modifications in vitro Example 9: Verification of chemically modified DNA sequences in cells Example 10: Design and construction of plasmid templates for the generation of double-stranded DNA (dsDNA) molecules Example 11: Generation of dsDNA molecules with chemical modifications Example 12: Evaluation of reporter gene expression in vitro Example 13: Evaluation of innate immune responses in cells in vitro Example 14: Evaluation of reporter gene expression in vitro Example 15: Evaluation of innate immune responses in cells in vitro Example 16: Evaluation of mutations during the production of dsDNA molecules

[0225] Example 1: Formulation of dsDNA molecules (e.g., TDSC) with LNPs This example describes how to formulate constructs made as described herein with lipid nanoparticles (LNPs).

[0226] The nucleic acid construct is combined with the lipid components via a microfluidic device according to the method of Chen et al. 2012. J Am Chem Soc. Volume 134, Issue 16:6948-6951. Briefly, the microfluidic device is fabricated from polydimethylsiloxane (PDMS) according to standard lithography procedures (McDonald & Whitesides. 2002. Accounts Chem Res Volume 35, Issue 7:491-499). The lipid components (typically containing cationic lipids, cholesterol, helper lipids, polyethylene glycol-modified lipids, and optional lipids that facilitate targeting moiety conjugation) are combined and solubilized in 90% ethanol. The nucleic acid construct is dissolved in a buffer solution. The nucleic acid solution, lipid solution, and phosphate buffered saline (PBS) are injected into the microfluidic device. Freshly prepared LNPs are dialyzed against PBS buffer using a membrane with a MWCO of 3.5 kD to remove ethanol and exchange the buffer.

[0227] LNPs are characterized for effective diameter, polydispersity, and zeta potential using dynamic light scattering (DLS) (ZetaPALS, Brookhaven Instruments, NY, 15 mW laser, incident beam 676 nm), and total nucleic acid concentration is determined by dissolving the particles and using the Quant-iT™ 1X dsDNA Assay Kit, high sensitivity (HS) and broad range (BR), according to the manufacturer's protocol (ThermoFisher Scientific, Q33232).

[0228] Example 2: Determination of exonuclease resistance for dsDNA molecules containing closed ends This example describes a method for testing whether a dsDNA molecule containing closed ends (e.g., an adapter-ligated linear dsDNA construct) is exonuclease III (M0206, New England Biolabs Inc.) resistant. The dsDNA molecule is tested next to a no-nuclease control. The no-nuclease control contains DNA with an identical sequence to the dsDNA molecule of interest, except that it has undergone an adapter ligation protocol used to add exonuclease-resistant DNA end forms to the dsDNA molecule; however, no adapter oligonucleotides are added to the mixture. 1 μL of exonuclease III (starting concentration of 100 units / μL) is added per 5 μg of DNA in 50 μL. The tube is mixed thoroughly and spun down. The tube is placed on a thermocycler at 37°C for 1 hour and heat inactivated at 70°C for 30 minutes.

[0229] Samples are purified using a Nucleospin® Gel and PCR Clean-up Kit (Cat. #740609, Macherey-Nagel) using a vacuum manifold according to the manufacturer's protocol. Briefly, the elution buffer is warmed to 70°C. 2x volume of NTI binding buffer is added to 1x volume of Exo III-treated DNA. The sample is mixed until evenly distributed and left at room temperature for 5 minutes. The column is secured on the vacuum manifold, the valve is opened, and the vacuum is turned on. 375 μL of the DNA-NTI mixture is added to 2x columns and allowed to pass completely through each column. 700 μL of NTC wash buffer is added twice. The column is removed from the vacuum manifold and placed in a collection tube. The assembly is centrifuged at 11,000 x g for 1 minute. The column is placed in a new low-binding microcentrifuge tube, 25 μL of pre-warmed buffer is added, and the assembly is incubated at 70°C for 5 minutes. The aggregate is centrifuged at 11,000 x g for 1 minute. The incubation and elution steps are repeated twice. The recovered DNA is quantified by dsDNA BR Qubit (Q32850, Thermo Fisher Scientific) on a Qubit 4 Fluorometer (Q33226, Thermo Fisher Scientific) according to the manufacturer's protocol.

[0230] Samples were loaded into individual wells of an E-Gel EX 1% agarose gel (G402021, Thermo Fisher Scientific) at 16 ng of DNA per well. Ladder (10488090, Thermo Fisher Scientific) was loaded into the gel in the leftmost lane at 2 μl. The gel was run through an E-Gel Power Snap electrophoresis system (G8100, G8200, Thermo Fisher Scientific) according to the manufacturer's protocol. After running the gel, exonuclease-resistant dsDNA molecules were visible at molecular weights corresponding to the full-length DNA and closing adapter sequences. A dsDNA molecule was considered exonuclease-resistant in this assay if at least 95% of the products appearing in the gel in that lane corresponded to full-length dsDNA molecules.

[0231] Example 3: Determining exonuclease resistance for dsDNA molecules containing open ends (e.g., two open ends) This example describes a method for testing whether a dsDNA molecule containing an open end (e.g., an adapter-ligated linear dsDNA construct) is exonuclease III (M0206, New England Biolabs Inc.) resistant. The dsDNA molecule is tested next to a no-nuclease control. The no-nuclease control contains DNA with an identical sequence to the dsDNA molecule of interest, except that it has undergone an adapter ligation protocol used to add exonuclease-resistant DNA end forms to the dsDNA molecule, but no adapter oligonucleotides are added to the mixture. Two units of exonuclease III per 200 ng of DNA (10 ng / ul) are added to a 20 ul reaction. The tube is mixed thoroughly and spun down. The tube is placed on a thermocycler at 37°C for 30 minutes.

[0232] Samples were loaded into individual wells of an E-Gel EX 1% agarose gel (G402021, Thermo Fisher Scientific) at 20 ng of DNA per well. Ladder (10488090, Thermo Fisher Scientific) was loaded at 2 μl onto the gel in the leftmost lane. The gel was run through an E-Gel Power Snap electrophoresis system (G8100, G8200, Thermo Fisher Scientific) according to the manufacturer's protocol. After running the gel, exonuclease-resistant dsDNA molecules were visible at molecular weights corresponding to the full-length DNA and closing adapter sequences. A dsDNA molecule was considered exonuclease-resistant in this assay if at least 95% of the products appearing in the gel in that lane corresponded to full-length dsDNA molecules.

[0233] Example 4: Design and construction of a plasmid template for the generation of double-stranded DNA (dsDNA) molecules This example describes the generation of a plasmid template for a dsDNA molecule. In this example, a construct template was designed with the following specific sequence components: Promoter Ef1a: [ka] Effector sequence encoding a model / marker protein (mCherry): [ka]

[0234] Optional: NTS: SV40 enhancer: 5'-cccaagaagaagaggaaagtc-3' (SEQ ID NO: 1) · Maintenance sequence: Human interferon-β MAR 5'tataattcactggaatttttttgtgtatggtatgacatatgggttcccttttattttttacatataaatatatttccctgtttttctaaaaaagaaaaagatcatcattttcccattgtaaaatgccatatttttttcataggtcacttacata3' (SEQ ID NO: 39) Second strand motif: AAV2 wild-type ITR 5'aggaaccccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcagctgcctgcagg-3' (SEQ ID NO: 26)

[0235] These elements were used to design a plasmid template using standard DNA design and manipulation software. Once designed, the plasmid was ordered from a commercial supplier (GenScript) for use as a template in PCR amplification.

[0236] Example 5: Generation of dsDNA molecules with chemical modifications This example demonstrates the preparation of dsDNA molecules containing uridine nucleotides with chemical modifications at the carbon-5 position (C-5 position), such as 5-hydroxymethyl-2'-deoxyuridine (5-hydroxymethyluridine).

[0237] Plasmid DNA (10 ng / 50 ul PCR reaction) was used as a template for PCR amplification using KOD polymerase (710864, ​​Sigma Aldrich) or KOD Xtreme (KODX) polymerase (719753, Sigma Aldrich). Other commercially available polymerases, such as Deep Vent, can also be used. The product versions used were purchased as components rather than in master mix format to ensure the correct ratio of modified nucleotides to standard dNTPs. PCR reaction conditions for each enzyme included the following: a. For KOD polymerase, a final concentration of 2 mM MgSO4. b. 100 mM unmodified dNTP solution set (N0446, New England Biolabs) at a final concentration of 200 μM. c. Modified deoxynucleoside triphosphates (e.g., including 5-hydroxymethyluridine, N-2059, Trilink Biotechnologies) were added in various ratios with their cognate dNTPs to a total of 200 μM. For chemically modified uridine nucleotides, the cognate dNTP is dTTP. Reactions designed for 25% incorporation are 50 μM chemically modified dUTP (e.g., including 5-hydroxymethyluridine) and 150 μM unmodified dTTP, while reactions designed for 75% incorporation are 150 μM chemically modified dUTP (e.g., including 5-hydroxymethyluridine) and 50 μM unmodified dTTP. d. Forward and reverse primers at a final concentration of 300 μM.

[0238] Thermal cycling was performed according to the manufacturer's protocol, except that the extension time was increased from 20–60 s per kilobase of amplicon (for KOD and KOD Xtreme polymerases, respectively) to 2–3 min per kilobase.

[0239] For the synthesis of linear covalently closed dsDNA molecules, primers contained either a phosphate group or a TelN recognition sequence for improved ligation efficiency.

[0240] For the synthesis of circular dsDNA molecules, in addition to containing sequences complementary to the plasmid, the primers contained additional sequences useful in downstream processes: a. nicking enzyme recognition sequence, b. A restriction enzyme recognition sequence (e.g., KpnI or NheI) used to generate sticky ends in DNA after restriction enzyme digestion and promote DNA circularization, and c. Additional bases that increase the efficiency of restriction enzyme digestion (e.g., 5'-CCGTGGTCCTTC-3') (SEQ ID NO: 40).

[0241] Figure 3 shows the successful incorporation of 5-hydroxymethyl-dUTP into PCR products over a range of input concentrations. The numbers shown in the legend to Figure 3 represent the percentage incorporation of chemically modified dUTP in the original PCR master mix. For example, 25% incorporation represents a 1:3 ratio of 5-hydroxymethyl-dUTP to unmodified dTTP in the PCR reaction. These results demonstrate that 5-hydroxymethyl-dUTP can be efficiently incorporated into PCR products over a wide range of ratios, including nearly complete replacement of unmodified nucleotides.

[0242] For all formats, PCR products were purified using standard DNA purification columns.

[0243] Figure 4 shows the generation of covalently closed linear dsDNA molecules with end morphology containing phosphorothioate modifications. For dsDNA molecules with end morphology containing phosphorothioate modifications, up to 10 μg of PCR DNA in 50 μL of NEBNext Ultra II End Repair / dA-Tailing Buffer (8 μL) and enzyme (3 μL) mixture (E7546L) was added per reaction and incubated first at 20°C for 30 minutes, followed by 65°C for 30 minutes. After a brief cooling period on ice, NEBNext Ultra II Ligation Module components were added, including ligation mix (30 μL), ligation enhancer (1 μL), and 3 μL of a 100 μM solution containing the phosphorothioated DNA adapters to be ligated. The reaction was incubated for >1 hour (typically overnight). The ligated PCR-adapter solution was then purified by Nucleospin Midi column and quantified by Nanodrop, and unligated PCR was removed by Exonuclease III (NEB M0206) at 37°C for 1 hour.

[0244] Figure 5 shows the generation of covalently closed linear dsDNA molecules with TelN-terminus morphology. For dsDNA molecules with TelN-terminus morphology, 1 μg of purified PCR product was incubated for 1 hour at 30°C in a 40 μL reaction containing 4 μL 10x ThermoPol buffer and 2 μL TelN protelomerase (M0651, New England Biolabs). The TelN-modified DNA was then purified using a Zymo DCC-100 column and quantified using Nanodrop, and PCR primer products without the TelN modification were removed using Exonuclease III (NEB M0206) at 37°C for 1 hour.

[0245] Figure 6 shows a diagram of a circular dsDNA molecule, and Figure 7 shows the production of a circular dsDNA molecule. To synthesize the circular dsDNA molecule, the purified PCR product was digested overnight using a restriction enzyme corresponding to the restriction enzyme recognition sequence, e.g., KpnI-HF-V2 (R3142, New England Biolabs). The DNA was then purified using a DNA purification column.

[0246] The digested DNA was circularized using T3 DNA ligase (M0317, New England Biolabs) at 26°C for 1 hour. Non-circularized DNA was digested by incubating the DNA with T5 exonuclease (M0663L, New England Biolabs) at 37°C for 1 hour. T5 exonuclease was used to digest linear dsDNA, not circular dsDNA. DNA was purified using a DNA purification column. Other similar methods, such as agarose gel purification, can also be used.

[0247] Analysis of the composition and purity of the resulting dsDNA molecules was performed on an Agilent 5300 Fragment Analyzer using the CRISPR Discovery Kit (DNF-930-K1000CP). Running gels with dsDNA inlet buffer and intercalating dye were prepared fresh daily, while marker trays with mineral oil overlay and capillary conditioning solution were prepared fresh monthly. Buffers were prepared according to the manufacturer's specifications. Circular dsDNA molecules were diluted in water to a final concentration of 100 pg / uL. For each sample well, 2 uL of DNA sample was added to 22 uL of dilution buffer (0.1X TE). Each sample was run with two to four replicates, with one well used for the MDK DNA ladder. Samples were analyzed by the instrument control software using the default settings for the CRISPR Discovery method (CRP-910-33).

[0248] Sample traces were analyzed using ProSize data analysis software v4.0.2.7. Peak analysis conditions for dsDNA were set to standard conditions: "Peak width (sec)" of 5, "Minimum peak length (RFU)" of 50, # of minimum points of 3, and "Minimum to Minimum Baseline?" was enabled. A manual baseline was set at -2 min from the lower marker and +2 min from the upper marker. Peaks were automatically detected by the software under these conditions, and peak widths were selected by the software unless manual adjustment was required due to broad peaks, peak shoulders, or multiple peaks within a narrow size range.

[0249] Figures 8-13 show fragment analyzer traces of dsDNA molecules with 5-hydroxymethyluridine modifications, while dsDNA molecules were generated in reactions designed for two different incorporation concentrations. Figures 8 and 9 show circular dsDNA molecules generated in reactions using 25% 5-hydroxymethyluridine (Figure 8) or 75% 5-hydroxymethyluridine (Figure 9) and purified as described above. Figures 10 and 11 show linear, covalently closed dsDNA molecules with terminal morphology containing phosphorothioate modifications generated in reactions using 25% 5-hydroxymethyluridine (Figure 10) or 75% 5-hydroxymethyluridine (Figure 11) and purified as described above. Figures 12 and 13 show linear, covalently closed dsDNA molecules with Tel N-terminal morphology generated in reactions using 25% 5-hydroxymethyluridine (Figure 12) or 75% 5-hydroxymethyluridine (Figure 13) and purified as described above. In each trace, a single peak (indicated by an arrow) is clearly visible. These results demonstrate that chemically modified deoxyuridine nucleotides (e.g., 5-hydroxymethyluridine) with a chemical modification at the C-5 position can be incorporated into and purified into multiple types of dsDNA molecules at multiple concentrations.

[0250] Example 6: Evaluation of reporter gene expression in vitro This example demonstrates the detection and quantification of gene expression using chemically modified dsDNA molecules in cultured cells.

[0251] Experimental dsDNA molecules and controls were administered via lipid transfection (lipofection). Lipofection of DNA was performed using Lipofectamine 3000 transfection reagent (#L3000001, ThermoFisher) in HEKa, HepG2, HEK293, THP-1, U937, and U2OS cells according to the manufacturer's instructions. A 1:2:3 ratio of DNA:P3000:Lipofectamine 3000 was used for all DNA constructs and controls. 10,000 cells were pre-seeded into each well of a 96-well plate one day before transfection. Transfection was performed when the cells reached approximately 80-90% confluence. For each well of a 96-well plate, 3X Lipofectamine 3000 was first diluted in 5 μL of Opti-MEM™ I Reduced Serum Medium (#31985070, ThermoFisher). DNA was diluted in 5 μL of Opti-MEM™ I Reduced Serum Medium with 2X P3000 reagent. Next, DNA was added to Lipofectamine 3000 containing Opti-MEM™ I Reduced Serum Medium and gently mixed by pipetting. After 15 minutes of incubation at room temperature, the DNA-Lipofectamine 3000 complex was added to the target cells in a dropwise manner along with complete culture medium in different areas of the well. The plate was gently shaken back and forth and side to side to ensure uniform distribution of the DNA-Lipofectamine 3000 complex. After transfection, the cells were incubated in a CO2 tissue culture incubator, and the culture medium was replaced 6–8 hours after transfection.

[0252] To determine the expression of the construct encoding the fluorescent reporter mCherry, cells were first washed with PBS and then subjected to flow cytometry analysis. All flow cytometry was performed on a Miltenyi MACSQuant VYB. For detection of mCherry signal, a yellow laser (561 nm wavelength) was used for excitation, and a 615 / 620 nm emission filter was used. 20,000 events were recorded for each sample, and data were analyzed using Flowjo V.9.0 software. Cells were first gated on FSC-A and SSC-A plots to remove cellular debris. Populations were further plotted on FSC-A and FSC-H plots to enclose single cell populations. Finally, a bivariate plot between fluorescent signal-expressing and non-expressing cells was used to determine the percentage of expressing cells. The distribution of expressing cells was used to determine the level of expression within each cell. Expression analysis was performed at multiple time points.

[0253] Figure 14 shows that dsDNA chemically modified with 5-hydroxymethyluridine supported reporter protein expression. In three separate cell types (U937, THP-1, and HEKa cells), the dsDNA retained functionality as defined by detectable expression of the reporter protein mCherry. In U937 and THP-1 cells, the circular dsDNA molecules generated in the 75% 5-hydroxymethyluridine reaction were approximately 95% and 193% functional (respectively) of the unmodified control dsDNA, as defined by the relative percentage of mCherry cells compared to the unmodified control dsDNA. These results demonstrate that dsDNA chemically modified with 5-hydroxymethyluridine can be transcribed in multiple cell lines, ultimately resulting in a protein product.

[0254] Example 7: Evaluation of innate immune responses in cells in vitro. This example demonstrates the effect of chemically modified dsDNA molecules on the innate immune response of cultured cells.

[0255] Experimental constructs were prepared as in Examples 4 and 5 above and subsequently administered to cells as in Example 6 above. qPCR was performed to determine RNA levels of the cytokines IFN-b, IL-6, TNF-a, and CXCL10 in cells lipofected with dsDNA. Briefly, the probe-primer sets used for qPCR were human IFN-b (forward sequence: CTTGGATTCCTACAAAGAAGCAGC (SEQ ID NO: 41), reverse sequence: TCCTCCTCTCTGGAACTGCTGCA (SEQ ID NO: 42), human IL-6 (forward sequence: AGACAGCCACTCACCTCTTCAG (SEQ ID NO: 43), reverse sequence: TTCTGCCAGTGCCTCTTTGCTG (SEQ ID NO: 44)), human TNF-a (forward sequence: CTCTTCTGCCTGCTGCACTTTG (SEQ ID NO: 47), reverse sequence: ATGGGGCTACAGGCTTGTCA CTC (SEQ ID NO: 48), human CXCL10 (forward sequence: GGTGAGAAGAGATGTCTGAATCC (SEQ ID NO: 49), reverse sequence: GTCCATCCTTGGAAGCACTGCA (SEQ ID NO: 50)), human CCL20 (forward sequence: AAGTTGTCTGTGTGCGCAAATCC (SEQ ID NO: 51), reverse sequence: CCATTCCAGAAAAGCCACAGTTTT (SEQ ID NO: 52)), human GAPDH (forward sequence: GTCTCCTCTGACTTCAACAGCG (SEQ ID NO: 53), reverse sequence: ACCACCCTGTTGCTGTAGCCAA (SEQ ID NO: 54)). Analysis was performed using a QuantStudio7 Flex real-time PCR system with SYBR Select Master Mix from Life Technologies Corporation. RNA expression was normalized to GAPDH and expressed as fold change relative to the relevant untreated control.

[0256] Figure 15 shows the innate immune response of HEKa cells to linear, covalently closed dsDNA molecules containing six phosphorothioate modifications at each end form and various modifications at the C-5 position of uridine, as shown in Figure 4. For each distinct chemically modified dsDNA, the innate immune response is visualized as a scatter plot, where the X-axis represents the reduction in interferon signaling, as defined as the reduction in the mean fold change of the markers IFNB and CXCL10, compared to dsDNA containing unmodified thymine in place of the modified uridine, and the Y-axis represents the reduction in inflammatory cytokine signaling, as defined as the reduction in the mean fold change of the markers IL6 and TNFa, compared to dsDNA containing unmodified thymine in place of the modified uridine. dsDNA containing 5-hydroxymethyluridine (generated in reactions using 75% 5-hydroxymethyluridine) and 5-formyluridine (generated in reactions using 25% 5-formyluridine) promoted the production of these markers to a significantly lesser extent than dsDNA containing unmodified thymine instead of modified uridine and dsDNA containing other specific chemical modifications (ovals, n = 42). These results demonstrate that incorporation of multiple specific chemical modifications at the C-5 position of uridine can reduce the innate immune response to DNA in immunocompetent cell lines.

[0257] Figure 16 shows the innate immune response and reporter gene expression of linear, covalently closed dsDNA molecules containing various chemical modifications, including six phosphorothioate modifications at each end as shown in Figure 4, including dsDNA molecules produced in reactions using 75% 5-hydroxymethyluridine and 25% 5-formyluridine. Each distinct chemically modified dsDNA is visualized as a point in a scatter plot, where the X-axis represents the reduction in innate immune signaling, as defined as the reduction in the mean fold change of the markers IFNB, CXCL10, IL6, and TNFα, compared to DNA containing unmodified thymine instead of the modified uridine, and the Y-axis represents the relative reporter gene expression, as defined as the percentage of mCherry+ cells, compared to control dsDNA containing unmodified thymine instead of the modified uridine. Incorporation of 5-hydroxymethyluridine or 5-formyluridine reduced cellular immune responses in HEKa cells while still retaining function compared with dsDNA containing unmodified thymine instead of the modified uridine and dsDNA containing other specific dsDNA chemical modifications (dashed oval, n = 38). These results demonstrate that incorporation of specific chemical modifications at the C-5 position of uridine, including 5-hydroxymethyluridine and 5-formyluridine, can reduce innate immune responses to DNA while enabling protein expression in immunocompetent cells.

[0258] Taken together, these results demonstrate that chemical modifications at the C-5 position of uridine, such as 5-hydroxymethyluridine and 5-formyluridine, can reduce the immunogenicity of dsDNA while retaining its ability to encode a functional protein product.

[0259] Example 8: Quantification of DNA chemical modifications in vitro This example describes the quantification of modified uridines within chemically modified dsDNA.

[0260] Purified dsDNA molecules bearing chemically modified uridine (e.g., 5-hydroxymethyluridine) are prepared from plasmid templates as described in Examples 4 and 5 above. The proportion of modified uridine is quantified by liquid chromatography coupled to tandem mass spectrometry (LC-MS / MS) as previously described for cytosine (Bachman et al., 2014, Nature Chemistry volume 6 issue 12 pages 1049-1055). Briefly, DNA is digested into nucleosides via incubation with DNA Degradase Plus (Zymo Research). After enzymatic digestion, LC-MS / MS analysis is performed on a mass spectrometer equipped with a liquid chromatography system. A calibration curve is generated using a mixture of synthetic standards in an appropriate molar concentration range. Samples and synthetic standards are spiked with an isotopically labeled mixture of deoxyuridine and its chemically modified derivatives as an internal standard. The mass spectrometer is operated in multiple reaction monitoring (MRM) mode. The ion source was electrospray in positive mode. Results are expressed as the ratio of modified uridine to unmodified thymidine.

[0261] Example 9: Verification of chemically modified DNA sequences in cells This example describes the sequence verification of chemically modified DNA delivered to cells.

[0262] Purified dsDNA constructs containing natural or chemically modified uridine (e.g., 5-hydroxymethyluridine) are prepared as described in Examples 4 and 5 and delivered to cells via lipofection as described in Example 6 above. After transfection, DNA and RNA are simultaneously extracted from the cells (AllPrep DNA / RNA Kit, Qiagen) and converted into libraries for next-generation sequencing (Illumina). Demultiplexed reads are mapped to the sequences of the chemically modified dsDNA constructs as described in Langmead and Salzberg, 2012, Nature Methods, volume 9, pages 357-359. Mutations are identified via standard variant calling programs.

[0263] Example 10: Design and construction of plasmid templates for the generation of double-stranded DNA (dsDNA) molecules This example describes the generation of a plasmid template for a dsDNA molecule. In this example, a construct template was designed with the following specific sequence components: Promoter Ef1a: [ka] Effector sequence encoding a model / marker protein (mCherry): [ka]

[0264] Optional: NTS: SV40 enhancer: 5'-GGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCA-3' (SEQ ID NO: 86) · Maintenance sequence: Human interferon-β MAR 5'tataattcactggaatttttttgtgtatggtatgacatatgggttcccttttattttttacatataaatatatttccctgtttttctaaaaaagaaaaagatcatcattttcccattgtaaaatgccatatttttttcataggtcacttacata3' (SEQ ID NO: 39) Second strand motif: AAV2 wild-type ITR 5'aggaaccccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcagctgcctgcagg-3' (SEQ ID NO: 26) Chimeric intron sequence 1 gtaagtatcaaggttacaagacaggtttaaggagaccaatagaaactgggcttgtcgagacagagaagactcttgcgtttctgataggcacctattggtcttactgacatccactttgcctttctctccacag (SEQ ID NO: 87) Chimeric intron (without Bsal site, mutations shown in bold) sequence 2 [ka] Chimeric intron (without Bsal site) sequence 3 gtaagtatcaaggttacaagacaggtttaaggagacaatagaaactgggcttgtcgagacagagaagactcttgcgtttctgataggcacctattggtcttactgacatccactttgcctttctctccacag (SEQ ID NO: 89) Chimeric intron (without Bsal site) sequence 4 gtaagtatcaaggttacaagacaggtttaaggaaccaatagaaactgggcttgtcgagacagagaagactcttgcgtttctgataggcacctattggtcttactgacatccactttgcctttctctccacag (SEQ ID NO: 90) Chimeric intron (without Bsal site) sequence 5 gtaagtatcaaggttacaagacaggtttaagggaccaatagaaactgggcttgtcgagacagagaagactcttgcgtttctgataggcacctattggtcttactgacatccactttgcctttctctccacag (SEQ ID NO: 91) Woodchuck hepatitis virus post-transcriptional regulatory elements [ka]

[0265] These elements were used to design a plasmid template using standard DNA design and manipulation software. Once designed, the plasmid was ordered from a commercial supplier (GenScript) for use as a template in PCR amplification.

[0266] Example 11: Generation of dsDNA molecules with chemical modifications This example demonstrates the preparation of dsDNA molecules containing uridine nucleotides with chemical modifications at the carbon-5 position (C-5 position), such as dsDNA molecules produced in a reaction with 100% incorporation of 5-hydroxymethyl-2'-deoxyuridine (5-hydroxymethyluridine).

[0267] For example, plasmid DNA (2 ng / 50 μl PCR reaction) produced as described in Example 10 was used as a template for PCR amplification using KOD Multi&Epi (KME) polymerase (TYB-KME-101, Diagnocine). Other commercially available polymerases, such as KOD polymerase (710864, ​​Sigma Aldrich), KOD Xtreme (KODX) polymerase (719753, Sigma Aldrich), can also be used. The product versions used were purchased as components rather than in master mix format to ensure the correct ratio of modified nucleotides to standard dNTPs. PCR reaction conditions for each enzyme included the following: e. For KOD polymerase, 2 mM final concentration of MgSO4 and 1x final concentration of reaction buffer. f. For KODX and KME polymerases, KODX buffer at 1x final concentration. g. 100 mM unmodified dNTP solution set (N0446, New England Biolabs) at a final concentration of 200 μM. h. Modified deoxynucleoside triphosphates (e.g., 5-hydroxymethyluridine, N-2059, Trilink Biotechnologies) were added in various ratios with their cognate dNTPs to a total of 200 μM. For chemically modified uridine nucleotides, the cognate dNTP was dTTP. Reactions designed for 25% incorporation were 50 μM chemically modified dUTP (e.g., containing 5-hydroxymethyluridine) and 150 μM unmodified dTTP, while 75% incorporation was 150 μM chemically modified dUTP (e.g., containing 5-hydroxymethyluridine) and 50 μM unmodified dTTP. 100% incorporation involved the complete replacement of the original dNTP with the modified dNTP (e.g., the complete replacement of dTTP with 5-hydroxymethyl-dUTP). i. Forward and reverse primers at a final concentration of 300 nM.

[0268] Thermal cycling was performed according to the manufacturer's protocol, except that the extension time was increased from 20–60 s per kilobase of amplicon to 2–3 min per kilobase.

[0269] For the synthesis of circular dsDNA molecules, in addition to containing sequences complementary to the plasmid, the primers contained additional sequences useful in downstream processes: a. nicking enzyme recognition sequence, b. A restriction enzyme recognition sequence (e.g., BsaI, R3733, New England Biolabs) used to generate sticky ends in DNA after restriction enzyme digestion, thereby facilitating DNA circularization, and c. Additional bases that increase the efficiency of restriction enzyme digestion (e.g., 5'-CCGTGGTCCTTC-3') (SEQ ID NO: 40).

[0270] Figure 17 shows successful PCR amplification of DNA products in which thymidine was completely replaced with 5-hydroxymethyluridine in the amplified sequence (i.e., 100% replacement of dTTP with 5-hydroxymethyl-dUTP in the PCR reaction). The relative positions of modified (M) and unmodified (U) DNA in the gel confirm that 100% incorporation of 5-hydroxymethyluridine did not affect the size of the amplified product, while the band intensity demonstrates efficient polymerization of the modified DNA. These results demonstrate that 5-hydroxymethyluridine can completely replace its cognate unmodified dNTP (i.e., dTTP) in DNA products generated by PCR under appropriate reaction conditions.

[0271] After amplification, PCR products were purified using a μPULSE tangential flow filtration system (Formulatrix) with a 100 kDa MWCO membrane tip and subsequently quantified by Nanodrop A260.

[0272] For the synthesis of circular dsDNA molecules, purified PCR products were digested overnight with a restriction enzyme corresponding to the restriction enzyme recognition sequence, e.g., BsaI. The digested DNA was circularized using T3 DNA ligase (M0317, New England Biolabs) at 26°C for 1 hour. The ligase was denatured by heating to 65°C for 15-45 minutes. Uncircularized DNA was digested by incubating the DNA with T5 ex...

Claims

1. a promoter sequence and a therapeutic payload sequence operably linked to the promoter sequence; a chemically modified uridine nucleotide that is 5-formyluridine located in the therapeutic payload sequence; A double-stranded DNA (dsDNA) molecule comprising:

2. 2. The dsDNA molecule of claim 1, wherein at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, or at least 75% of the uridine and thymidine positions in the dsDNA molecule comprise said chemically modified uridine nucleotides.

3. i) heterologous functional sequences, such as nuclear targeting sequences or regulatory sequences; ii) a maintenance sequence, or iii) Replication origin 3. The dsDNA molecule of claim 1, comprising one, two or all of:

4. 4. The dsDNA molecule of claim 1, wherein the chemically modified uridine nucleotide is located in the sense strand of the therapeutic payload sequence.

5. When contacted with HEKa cells, (i) a reduction in a measure of interferon signaling relative to a control DNA molecule, e.g., at least a 20-, 40-, 50-, or 60-fold reduction, wherein the measure of interferon signaling is the average fold change in IFNβ mRNA and CXCL10 mRNA relative to a control DNA molecule; or (ii) a reduction in a measure of inflammatory cytokine signaling relative to a control DNA molecule, e.g., at least a 5-, 10-, 12-, or 15-fold reduction, wherein the measure of inflammatory cytokine signaling is the average fold change in IL6 mRNA and TNFα mRNA relative to a control DNA molecule.

5. The dsDNA molecule of claim 1, wherein the control DNA molecule contains the same sequence, strandedness, and linearity as the dsDNA molecule, but contains unmodified thymidine nucleotides instead of the chemically modified uridine nucleotides.

6. A pharmaceutical composition comprising a dsDNA molecule according to any one of claims 1 to 5.

7. 1. A method for expressing a therapeutic payload in a target cell, comprising: (i) introducing a dsDNA molecule according to any one of claims 1 to 5 into a target cell; (ii) maintaining (e.g., incubating) the cells under conditions suitable for expression of a therapeutic payload from the therapeutic payload sequence of the dsDNA molecule; thereby expressing said therapeutic payload in said target cells.

8. A dsDNA molecule comprising a chemically modified uridine nucleotide having a substitution other than a hydrogen or methyl group at carbon 5 of uridine.

9. 9. The dsDNA molecule of claim 8, comprising a therapeutic payload sequence.

10. a promoter sequence and a therapeutic payload sequence operably linked to the promoter sequence; Formula I: 【Transformation 36】 (In the formula, R １ is -(CH ２ ) ｍ OH (where m=1 to 10), -halogen, -(CH ２ ) ｎ -CHO (where n=0 to 10), -(CH ２ ) ｐ COOH (wherein p=0-10), -aminoallyl, -S-(C1-C6)alkyl, and -propargylamino. a chemically modified uridine nucleotide located in said therapeutic payload sequence, said chemically modified uridine nucleotide comprising the structure A double-stranded DNA (dsDNA) molecule comprising:

11. R １ is -(CH ２ ) ｍ OH (where m=1 to 6), -halogen, -(CH ２ ) ｎ -CHO (where n=0 to 6), -(CH ２ ) ｐ 11. The dsDNA molecule of any one of claims 8 to 10, wherein the alkyl group is selected from the group consisting of COOH (wherein p=0-6), -aminoallyl, -S-(C1-C3)alkyl, and -propargylamino.

12. R １ is -(CH ２ 12. The dsDNA molecule of any one of claims 8 to 11, wherein the amino group is selected from the group consisting of -OH, -I, -Br, -CHO, -COOH, -aminoallyl, -S-methyl and -propargylamino.

13. 13. The dsDNA molecule of any one of claims 8 to 12, wherein the chemically modified uridine nucleotide comprises 5-hydroxymethyluridine, 5-aminoallyluridine, 5-bromouridine, 5-iodouridine, 5-propargylaminouridine, 5-formyluridine, 5-carboxyuridine, or 5-methylthiouridine.

14. The dsDNA molecule of any one of claims 8 to 13, which is circular or linear.

15. 15. The dsDNA molecule of any one of claims 8 to 14, which is closed-end linear.

16. 16. The dsDNA molecule of any one of claims 8 to 15, wherein at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 50%, or at least 75% of the uridine and thymidine positions in the dsDNA molecule comprise said chemically modified uridine nucleotides.

17. i) heterologous functional sequences, such as nuclear targeting sequences or regulatory sequences; ii) a maintenance sequence, or iii) Replication origin 17. The dsDNA molecule of any one of claims 8 to 16, comprising one, two or all of:

18. 18. The dsDNA molecule of any one of claims 9 to 17, wherein the chemically modified uridine nucleotides are located in the sense strand of the therapeutic payload sequence.

19. When contacted with HEKa cells, (i) a reduction in a measure of interferon signaling relative to a control DNA molecule, e.g., at least a 2-, 4-, 6-, 7-, or 8-fold reduction, wherein the measure of interferon signaling is the average fold change in IFNβ mRNA and CXCL10 mRNA relative to a control DNA molecule; or (ii) a reduction in a measure of inflammatory cytokine signaling relative to a control DNA molecule, e.g., at least a 2-, 4-, 5-, or 6-fold reduction, wherein the measure of inflammatory cytokine signaling is the average fold change in IL6 mRNA and TNFα mRNA relative to a control DNA molecule.

19. The dsDNA molecule of any one of claims 8 to 18, wherein the control DNA molecule contains the same sequence, strandedness, and cyclic or linear characteristics as the dsDNA molecule, but contains unmodified thymidine nucleotides instead of the chemically modified uridine nucleotides.

20. When contacted with HEKa cells, (i) a reduction in a measure of interferon signaling relative to a control DNA molecule, e.g., at least a 20-, 40-, 50-, or 60-fold reduction, wherein the measure of interferon signaling is the average fold change in IFNβ mRNA and CXCL10 mRNA relative to a control DNA molecule; or (ii) a reduction in a measure of inflammatory cytokine signaling relative to a control DNA molecule, e.g., at least a 5-, 10-, 12-, or 15-fold reduction, wherein the measure of inflammatory cytokine signaling is the average fold change in IL6 mRNA and TNFα mRNA relative to a control DNA molecule.

20. The dsDNA molecule of any one of claims 8 to 19, wherein the control DNA molecule contains the same sequence, strandedness, and cyclic or linear characteristics as the dsDNA molecule, but contains unmodified thymidine nucleotides instead of the chemically modified uridine nucleotides.

21. 21. The dsDNA molecule of any one of claims 9 to 20, which when contacted with U937 cells results in expression of said therapeutic payload sequence at a level that is at least 50%, at least 60%, at least 70%, at least 75%, at least 100%, at least 125%, at least 150%, at least 175%, at least 180%, at least 185%, or at least 190% of the expression of said therapeutic payload sequence of a control DNA, wherein said control DNA molecule contains the same sequence, strandedness, and cyclic or linear characteristics as said dsDNA molecule, but contains unmodified thymidine nucleotides in place of said chemically modified uridine nucleotides.

22. 22. The dsDNA molecule of any one of claims 9 to 21, which, when contacted with THP-1 cells, results in expression of said therapeutic payload sequence at a level that is at least 50%, at least 75%, at least 80%, at least 90%, or at least 95% of the expression of said therapeutic payload sequence of a control DNA, said control DNA molecule comprising the same sequence, strandedness, and circular or linear characteristics as said dsDNA molecule, but comprising unmodified thymidine nucleotides in place of said chemically modified uridine nucleotides.

23. It is linear, and a) upstream exonuclease-resistant DNA end forms; b) a double-stranded region, and c) downstream exonuclease-resistant DNA end forms 23. The dsDNA molecule according to any one of claims 8 to 22, comprising:

24. A dsDNA molecule comprising a chemically modified uridine nucleotide selected from 5-hydroxymethyluridine, 5-propargylaminouridine, 5-carboxyuridine, 5-methylthiouridine, or 5-formyluridine, wherein the dsDNA molecule is a closed-end linear DNA.

25. 25. The dsDNA molecule of claim 24, comprising a therapeutic payload sequence.

26. A pharmaceutical composition comprising a dsDNA molecule according to any one of claims 8 to 25.

27. 1. A method for making or producing a dsDNA molecule, comprising: (a) providing a composition comprising a DNA template, e.g., a plasmid, a forward primer, a reverse primer, a DNA polymerase, unmodified deoxyribose nucleotides, and chemically modified uridine nucleotides; (b) performing a polymerase chain reaction on the composition of (a); whereby said dsDNA molecule is made or produced, said dsDNA molecule being a dsDNA molecule according to any one of claims 8 to 25.

28. 28. A dsDNA molecule produced by the method of claim 27.

29. 1. A method for expressing a therapeutic payload in a target cell, comprising: (i) introducing the dsDNA of any one of claims 9 to 23, 25 or 28 into a target cell; (ii) maintaining (e.g., incubating) the cells under conditions suitable for expression of a therapeutic payload from the therapeutic payload sequence of the dsDNA molecule; thereby expressing said therapeutic payload in said target cells.

30. 1. A method of modulating (e.g., increasing or decreasing) a biological activity in a target cell, comprising: (i) introducing into a target cell the dsDNA molecule of any one of claims 9 to 23, 25 or 28, wherein the therapeutic payload sequence encodes a therapeutic payload that modulates a biological activity in the target cell; (ii) maintaining (e.g., incubating) the cells under conditions suitable for expression of the therapeutic payload from the dsDNA molecule; thereby modulating said biological activity in said target cell.

31. 29. A method of providing therapy to a cell, tissue or subject in need thereof, comprising administering to said cell, tissue or subject a dsDNA molecule of any one of claims 9 to 23, 25 or 28, thereby treating said cell, tissue or subject.

32. 30. A method of delivering a therapeutic payload to a target cell, comprising introducing into the target cell the dsDNA molecule of any one of claims 9 to 23, 25 or 28, wherein the therapeutic payload sequence encodes a therapeutic payload, thereby delivering the therapeutic payload to the target cell.

Images