Method for quantifying the concentration of an analyte in a sample
Hydrogel microspheres randomly distribute analytes across compartments for enzyme amplification, addressing the need for precise volume measurements in digital PCR, enabling efficient and versatile analyte quantification without microfluidics.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- BLINK AG
- Filing Date
- 2024-03-28
- Publication Date
- 2026-05-11
AI Technical Summary
Existing digital PCR methods require precise measurement of compartment volumes and sample volumes, are complex, and need microfluidic devices, limiting their applicability and ease of use.
A method involving hydrogel microspheres that randomly distribute analytes across a predefined number of reaction compartments, allowing enzyme amplification to generate detectable signals without requiring precise volume measurements, enabling compartment and sample volume independence.
Enables accurate quantification of analytes without precise volume measurements, simplifying the process and allowing use of entire sample volumes without microfluidic devices, suitable for various sample volumes and types.
Smart Images

Figure 2026514412000013 
Figure 2026514412000014 
Figure 2026514412000015
Abstract
Description
[Technical Field]
[0001] Field of Invention This invention relates to the concentration of the analyte in the sample. s A method for quantifying c, particularly the concentration of target nucleic acid in a sample. s The present invention relates to a method for quantifying [amount]. Furthermore, the present invention relates to a principle by which, by binding the analyte / target, the analyte / target in a sample of known volume is randomly distributed across a predetermined number of pre-fabricated reaction compartments. This invention relates to the concentration of analytes in a sample, particularly the concentration of target nucleic acids. s A default number N used in a method for quantifying B The invention also relates to aqueous suspensions of hydrogel microspheres. Furthermore, the invention relates to macroparticles for use in such methods. Finally, the invention relates to a predetermined number N B This also relates to a method for generating aqueous suspensions of hydrogel microspheres. [Background technology]
[0002] Background of the Invention Digital detection assays, such as digital PCR (dPCR) assays, offer specificity, sensitivity, and accuracy in targeted analyses, including nucleic acid analysis. Compared to bulk methods, digital assays such as dPCR offer the advantage of absolute quantification without the use of calibration curves. For this purpose, the assay mix, for example, an amplification mix containing the reagents and analytes / targets necessary for target detection, is divided into thousands of compartments. One example is dispensing a liquid across multiple wells on a solid substrate. Another approach is the preparation of aqueous microdroplets in an immiscible liquid, as disclosed, for example, in Hindson et al., 2011, Anal. Chem., 83, 22, pp. 8604-8610, for dPCR. In such conventional dPCR, the quantification of the target is based on the detection of PCR-positive compartments with known volumes.
[0003] Hydrogels have been used to encapsulate cells in dPCR (Geng et al., 2014, Anal. Chem. 86, 703-712) and to generate beads immobilized with amplification products for post-PCR analysis (Leng et al., 2010, Lab Chip. 10, 2481-2843). To overcome the inherent need for complex, expensive, and error-prone microfluidics, hydrogel beads have also been successfully used in particle template emulsification, where they function as mechanical templates for droplet formation in fluorocarbon oil (Loncarevic et al., 2021, Plos One, 16, e0242529). In the approach used by Loncarevic et al. (2021, ibid.), hydrogel beads are used to compartmentalize the sample, but binding of the analyte to / on the hydrogel beads, or binding or concentration, does not substantially occur. In the method described by Loncarevic et al. (2021), the hydrogel beads merely divide the sample, the analyte is randomly distributed between the beads, a large amount of sample remains "unused," and the analyte is not quantitatively incorporated into the hydrogel beads. Furthermore, the methodology of Loncarevic et al. (2021) requires knowledge of the volume of the hydrogel beads, its volume variation, and correction for such volume variation. Therefore, there remains a need in this field to promote and provide digital assays that are compartment volume independent for quantification and do not require microfluidic devices such as dPCR. There is also a need in this field to provide digital assay methodologies, such as dPCR methodologies, that are sample volume independent and provide target quantification without accurately measuring the volume of the reaction / amplification compartment. In addition, there is a need to provide digital assay methodologies, such as dPCR methodologies, that are easy to implement and can handle a wide variety of sample volumes. [Overview of the project]
[0004] All these objectives are to determine the concentration of the analyte in the sample. sis solved by a method of quantification, said method comprising: a) providing, in any order, an aqueous sample containing or suspected of containing an analyte and a predefined number N B of reaction compartments, said reaction compartments containing a material capable of binding to said analyte; b) exposing the predefined number N B of reaction compartments to the aqueous sample in a manner that results in a random distribution of the analyte across said predefined number N B of reaction compartments, such that said reaction compartments take up the aqueous sample and, if present in said aqueous sample, bind said analyte, preferably all of said analyte, thereby resulting in at least some of the predefined number N B of reaction compartments associating with or containing the analyte contained in the aqueous sample provided in step a); c) optionally, if flow and / or exchange of the aqueous sample between different reaction compartments obtained from step b) is still possible and / or occurs after step b): isolating the reaction compartments obtained from step b) from each other such that flow and / or exchange of the aqueous sample between different reaction compartments is no longer possible and no longer occurs; d) performing an enzyme amplification protocol within said reaction compartments, said enzyme amplification protocol generating a first optically detectable signal in reaction compartments associating with or containing the analyte, and said enzyme amplification protocol generating a second optically detectable signal in reaction compartments not associating with or not containing the analyte; e) detecting said first and second optically detectable signals, thereby determining the number N posand the number N of reaction compartments with a second optically detectable signal (= "negative" reaction compartments). neg The process of determining the total number of reaction compartments detected here N=N pos +N neg ; f) formula
number
[0005] In particular, in one embodiment, the present invention relates to the concentration of the analyte in the sample c s Regarding a method for quantifying, the method is: a) Aqueous samples containing or suspected to contain the analyte, and a predetermined number N B A step of providing an aqueous suspension of hydrogel microspheres in any order, wherein the hydrogel microspheres comprise a material capable of binding with the analyte; b) The predetermined number N BA step of exposing hydrogel microspheres to an aqueous sample and mixing the aqueous sample with the suspension of the hydrogel microspheres so that the hydrogel microspheres can take up the aqueous sample and bind to the analytes, preferably all of the analytes, if present in the aqueous sample; thereby at least some hydrogel microspheres associating with or containing the analytes contained in the aqueous sample provided in step a); c) Transfer the hydrogel microspheres to a liquid phase immiscible with water and aqueous solutions, such as an oil phase, thereby introducing the predetermined number N into the water-immiscible phase. B A process for generating a suspension of hydrogel microspheres, wherein the hydrogel microspheres are isolated from each other by a liquid phase immiscible with water so that the flow and / or exchange of aqueous samples between different hydrogel microspheres is no longer possible and does not occur; d) A step of performing an enzyme amplification protocol on the hydrogel microsphere, wherein the enzyme amplification protocol generates a first optically detectable signal in the hydrogel microsphere associated with or containing the analyte; and the enzyme amplification protocol generates a second optically detectable signal in the hydrogel microsphere not associated with or containing the analyte; e) By detecting the first and second optically detectable signals, the number of hydrogel microspheres having the first optically detectable signal (= "positive" hydrogel microspheres) is determined. pos And the number of hydrogel microspheres N that have a second optically detectable signal (= "negative" hydrogel microspheres) neg The process of determining the total number of hydrogel microspheres detected here N=N pos +N neg ; f) Concentration of the analyte in the sample c s to formula
number
[0006] In one embodiment, the analyte is: a) Target nucleic acid; the enzyme amplification protocol is a targeted amplification reaction; or b) Target protein; the enzyme amplification protocol is a signal amplification reaction; or c) Biological cells, viral particles, or extracellular vesicles (each containing various types of nucleic acids within the cell, viral particle, or extracellular vesicle); the enzyme amplification protocol is a targeted amplification reaction. That is the case.
[0007] In one embodiment, the analyte is: a) Target nucleic acid; the enzyme amplification protocol is a nucleic acid amplification protocol that, if associated with or contained in any of the hydrogel microspheres, results in specific amplification of the target nucleic acid, and if the hydrogel microspheres contain or are associated with the amplified target nucleic acid, results in the generation of a first optically detectable signal in the hydrogel microsphere; or b) Target protein; the enzyme amplification protocol is a signal amplification reaction involving the formation of an analyte-specific immune complex on or in the hydrogel microspheres, where a chromogenic enzyme is attached to the analyte-specific immune complex, and through the action of the chromogenic enzyme, the enzyme amplification reaction further involves the accumulation of an optically detectable product, resulting in the generation of a first optically detectable signal in the hydrogel microspheres, where the hydrogel microspheres contain or are associated with the analyte; or c) Target protein; the enzyme amplification protocol is a signal amplification reaction involving the formation of an analyte-specific immune complex on or within the hydrogel microspheres, where the hydrogel microspheres are associated with or contain the analyte; where the nucleic acid label is attached to the analyte-specific immune complex, the enzyme amplification reaction further involves specific nucleic acid amplification of the nucleic acid label, resulting in the accumulation of the amplified nucleic acid label and the generation of a first optically detectable signal within the hydrogel microspheres, where the hydrogel microspheres contain or are associated with the analyte; or d) Biological cells, viral particles, or extracellular vesicles (each containing various types of nucleic acids within the cell, viral particle, or extracellular vesicle); the enzyme amplification protocol is a nucleic acid amplification protocol that results in specific amplification of one or more types of nucleic acids contained within the biological cell, viral particle, or extracellular vesicle when the biological cell, viral particle, or extracellular vesicle is associated with or contained by any of the hydrogel microspheres, and is a nucleic acid amplification protocol that results in the generation of a first optically detectable signal within the hydrogel microsphere when the hydrogel microsphere contains or is associated with a biological cell, viral particle, or extracellular vesicle.
[0008] In one embodiment, the material that can be bound to the analyte is: a) When the analyte is a nucleic acid and the material capable of binding to the analyte binds nonspecifically to the nucleic acid, cationic polymers, cationic oligomers, cationic monomers, and silica; b) If the analyte is a nucleic acid and the material capable of binding to the analyte specifically binds to a particular nucleic acid, such as a target nucleic acid, then an oligonucleotide; where the oligonucleotide is complementary to a given nucleic acid analyte; c) If the analyte is a protein, biological cell, viral particle, or extracellular vesicle, and the material that can bind to the analyte specifically binds to a specific protein, such as a target protein, or specifically binds to a label, tag, prosthetic group, or other component that associates with the analyte, or to an antibody, antibody fragment, or other component that associates with an antibody that specifically binds to the analyte, antibody, antibody fragment, and protein receptor Selected from.
[0009] In one embodiment, the analyte is a nucleic acid, and the material capable of binding to the analyte binds nonspecifically to the nucleic acid; the material capable of binding nonspecifically to the nucleic acid is: Polymer backbone to which chitosan and its derivatives, gelatin and its derivatives, poly(ethyleneimine), poly(2-dimethyl(aminoethyl) methacrylate), poly(lysine), poly(histidine), poly(arginine), and basic amino acids are attached or incorporated as parts of such backbone; oligopeptides containing or consisting of basic amino acids such as histidine, lysine, and arginine; and monomers selected from basic amino acids such as histidine, lysine, and arginine. Selected from.
[0010] In a particularly preferred embodiment, the material capable of binding (non-specifically) to an analyte, such as nucleic acid, is chitosan or a chitosan derivative. Furthermore, in a particularly preferred embodiment, the material capable of binding (non-specifically) to an analyte, such as nucleic acid, is not gelatin.
[0011] In one embodiment, a predetermined number N of the hydrogel microspheres B The range is from 1,000 to 1,000,000, preferably from 5,000 to 500,000, more preferably from 5,000 to 100,000, even more preferably from 5,000 to 50,000, and even more preferably from 5,000 to 20,000.
[0012] In one embodiment, the hydrogel microspheres include magnetic particles that enable mechanical handling and migration of the hydrogel microspheres.
[0013] In one embodiment, the method includes an additional step b * ) including step b * ) is performed after step b) and before step c): b * ) The predetermined number N B A process of washing hydrogel microspheres by exposing them to a washing buffer.
[0014] In one embodiment, the method includes an additional step b ** ) including step b ** )teeth -After step b) and before step c), -In addition to step b, according to the prior embodiment (claim 9) * ) When implementing b ** ) is process b * This is performed after step c) and before step c): b ** ) The predetermined number N B A step of treating hydrogel microspheres by exposing them to a solution for carrying out the enzyme amplification reaction, the solution being (i) buffer, mono-nucleoside-triphosphate, amplification enzyme, nucleic acid dye for detection of amplified nucleic acid, optionally one or more amplification primers or one or more sets of amplification primers, and optionally a molecular probe such as a TaqMan probe or molecular beacon if not already contained in the hydrogel microsphere; or (ii) Buffer solution, an analyte-specific antibody or antibody fragment to which a label has been attached, and a detection reagent for detecting the label; or (iii) buffer solution, analyte-specific antibody or antibody fragment, detection antibody for analyte detection conjugated to the analyte-specific antibody or antibody fragment, detection antibody to which the label is attached, and detection reagent for label detection; Here, in (ii) and (iii), the label is either a nucleic acid tag or a chromogenic enzyme; and -If the label is a nucleic acid tag, the detection reagent is a solution containing a mono-nucleoside-triphosphate, an amplification enzyme, a nucleic acid dye for detecting the amplified nucleic acid, optionally one or more amplification primers or one or more sets of amplification primers, and optionally a molecular probe such as a TaqMan probe or molecular beacon if not already contained in the hydrogel microsphere; and -If the label is a chromogenic enzyme, the detection reagent is a solution containing the substrate for the chromogenic enzyme. Includes.
[0015] In one embodiment, in step e), the first optically detectable signal generated in the hydrogel microspheres, and optionally the second optically detectable signal, are also detected via the first channel, preferably the fluorescence channel, where optionally, the total number N of detected microspheres is further determined by optical imaging via the second channel.
[0016] In one embodiment, the hydrogel microspheres have an average diameter in the range of 10 μm to 500 μm, preferably 20 μm to 500 μm, more preferably 20 μm to 200 μm, more preferably 20 μm to 100 μm, and even more preferably 40 μm to 100 μm.
[0017] In a further embodiment, the present invention relates to the concentration of the target nucleic acid in the sample c s Regarding methods for quantifying, the said method is: a) Aqueous samples containing or suspected to contain target nucleic acids, and a predetermined number N B A step of providing an aqueous suspension of hydrogel microspheres in any order, wherein the hydrogel microspheres include a material that can bind nonspecifically to a nucleic acid such as the target nucleic acid, or a material that can bind specifically to the target nucleic acid; b) The predetermined number N B A step of exposing hydrogel microspheres to an aqueous sample and mixing the aqueous sample with the suspension of the hydrogel microspheres so that the hydrogel microspheres can take up the aqueous sample and bind to the target nucleic acid, preferably all of the target nucleic acid, present in the aqueous sample; thereby associating with or containing the target nucleic acid contained in the aqueous sample provided in step a), the predetermined number N B This yields at least some hydrogel microspheres; c) Transfer the hydrogel microspheres to a liquid phase immiscible with water and aqueous solutions, such as an oil phase, thereby introducing the predetermined number N into the water-immiscible phase. B The process of generating a suspension of hydrogel microspheres, wherein the hydrogel microspheres are isolated from each other by a liquid phase immiscible with water, so that the flow and / or exchange of aqueous samples between different hydrogel microspheres is no longer possible and does not occur; d) A step of performing a nucleic acid amplification protocol on the hydrogel microspheres specific to the target nucleic acid; wherein the nucleic acid amplification protocol results in specific amplification of the target nucleic acid if associated with or contained in any of the hydrogel microspheres, and results in the generation of a first optically detectable signal in the hydrogel microspheres if the hydrogel microspheres contain or are associated with the amplified target nucleic acid; wherein the nucleic acid amplification protocol does not result in amplification of the target nucleic acid, but results in the generation of a second optically detectable signal in the hydrogel microspheres if the hydrogel microspheres are not associated with and do not contain the amplified target nucleic acid; e) By detecting the first and second optically detectable signals, the number of hydrogel microspheres having the first optically detectable signal (= "positive" hydrogel microspheres) is determined. pos and the number N of hydrogel microspheres having a second optically detectable signal (= "negative" hydrogel microspheres). neg The process of determining the total number of microspheres detected here N=N pos +N neg ; f) The concentration of the target nucleic acid in the aqueous sample c s to formula
number
[0018] As outlined in the preceding paragraph, the concentration of the target nucleic acid in the sample c s This particular method for quantifying the concentration of the analyte in the sample is described herein. s This could also be one embodiment of a (general) method for quantifying [something].
[0019] In a further embodiment, the present invention relates to the concentration of an analyte, preferably a target nucleic acid, in a sample according to the present invention. s A default number N used in a method for quantifying B The present invention also relates to aqueous suspensions of hydrogel microspheres, wherein the aqueous suspension is an aqueous solvent and a predetermined number N B The system includes hydrogel microspheres, where the hydrogel microspheres include a material capable of binding to the analyte, preferably a material capable of binding to nucleic acids.
[0020] In one embodiment of the suspension, the predetermined number N of hydrogel microspheres BThe range is from 1,000 to 1,000,000, preferably from 5,000 to 500,000, more preferably from 5,000 to 100,000, even more preferably from 5,000 to 50,000, and even more preferably from 5,000 to 20,000.
[0021] In a further embodiment, the present invention relates to the concentration of an analyte in a sample according to the present invention, preferably a target nucleic acid, c s The same applies to macroparticles used in a method for quantifying, the method being defined herein, wherein the macroparticles are a matrix and a predetermined number N of macroparticles embedded in the matrix. B The hydrogel microspheres are contained, where the macroparticles are dried, preferably freeze-dried.
[0022] In one embodiment, the macroparticles are solid particles. In a preferred embodiment, the macroparticles are the predetermined number N B These are isolated, independent particles that enable the transport and / or storage of hydrogel microspheres.
[0023] In one embodiment of the macroparticles, the predetermined number N of hydrogel microspheres B The range is from 1,000 to 1,000,000, preferably from 5,000 to 500,000, more preferably from 5,000 to 100,000, even more preferably from 5,000 to 50,000, and even more preferably from 5,000 to 20,000.
[0024] In one embodiment of the macroparticles, the matrix comprises or consists of a material which is an excipient for a drying process, particularly freeze-drying.
[0025] In one embodiment, the hydrogel microspheres embedded in the matrix of the macroparticles do not contain gelatin.
[0026] In one embodiment of the macroparticles, the excipient for drying, particularly freeze-drying, is selected from saccharides such as trehalose, sucrose, mannitol, glucose, fructose, lactose, mannitol, inositol, hydroxypropyl-β-cyclodextrin and combinations thereof; polymers such as polyethylene glycol (PEG), polyvinylpyrrolidone (PVP), dextran, and gelatin; amino acids such as arginine, histidine, and glycine; and any combination thereof.
[0027] In one embodiment of the macroparticles, the macroparticles are substantially spherical, spherical, droplet-shaped, ellipsoidal, or other circular in shape, and have an average diameter ranging from 1 mm to 50 mm, preferably from 2 mm to 20 mm, more preferably from 2 mm to 15 mm, and even more preferably from 2 mm to 10 mm, and even more preferably from 2 mm to 5 mm.
[0028] The object of the present invention can also be solved by a method for generating macroparticles according to the present invention, the method being: a) A default number N as defined herein B A suspension of hydrogel microspheres, preferably a predetermined number N B A step of providing an aqueous suspension of hydrogel microspheres, an aqueous solvent, and at least one matrix material as defined herein in any order; b) Adding at least one matrix material to the aqueous solvent, thereby dissolving the matrix material in the aqueous solvent, and a predetermined number N of solutions of the matrix material. B The suspension of the hydrogel microspheres is mixed, preferably with an aqueous suspension, thereby forming the suspension of the hydrogel microspheres in the aqueous solvent; c) A step of generating droplets of the suspension formed in step b), wherein such droplets have a predetermined size and volume, and such droplets are dispensed into a water-immiscible liquid phase, such as an oil phase, at a temperature in the range of -100°C to -10°C, preferably -90°C to -20°C, more preferably -80°C to -30°C; thereby enabling the droplets to be frozen; d) Separating the frozen droplets from the water-immiscible liquid phase and drying them, preferably freeze-drying them, thereby yielding substantially spherical, spherical, droplet-shaped, ellipsoidal, or other circular macroparticles according to the present invention. Includes.
[0029] In one embodiment of a method for generating macroparticles, a predetermined number N is provided in step a). B The aqueous solvent, which may be part of the suspension of the hydrogel microspheres, is the same aqueous solvent provided separately in step a), and is subsequently used in step b) to dissolve the at least one matrix material.
[0030] In one embodiment of the method for generating macroparticles according to the present invention, the matrix material may be provided in step a) together with the aqueous solvent, i.e., as an aqueous solution of the matrix material dissolved in the aqueous solvent, or instead (instead of being provided separately from the aqueous solvent in step a) (e.g., as a solid); and in step b), it is no longer necessary to dissolve the matrix material in the aqueous solvent, but simply with the aqueous solution of the matrix material already provided in step a) and a predetermined number N B The process includes mixing the hydrogel microspheres with the suspension, preferably the aqueous suspension, thereby forming the suspension of the hydrogel microspheres in the aqueous solvent.
[0031] According to this embodiment, a method for generating macroparticles according to the present invention is: a) A default number N as defined herein BA suspension of hydrogel microspheres, preferably a predetermined number N B A step of providing an aqueous suspension of hydrogel microspheres and an aqueous solution of at least one matrix material as defined herein, dissolved in an aqueous solvent, in any order; b) The aqueous solution of at least one matrix material is divided into a predetermined number N B A step of mixing the suspension of the hydrogel microspheres, preferably with an aqueous suspension, thereby forming the suspension of the hydrogel microspheres in the aqueous solvent; c) A step of generating droplets of the suspension formed in step b), such droplets having a predetermined size and volume, and dispensing such droplets into a water-immiscible liquid phase, such as an oil phase, at a temperature in the range of -100°C to -10°C, preferably -90°C to -20°C, more preferably -80°C to -30°C; thereby enabling the droplets to be frozen; d) Separating the frozen droplets from the water-immiscible liquid phase and drying them, preferably freeze-drying them, thereby yielding substantially spherical, spherical, droplet-shaped, ellipsoidal, or other circular macroparticles according to the present invention. Includes.
[0032] In a particular embodiment of a prior embodiment of a method for generating macroparticles, a predetermined number N is provided in step a). B The aqueous solvent which is part of, or may be part of, the suspension of the hydrogel microspheres is the same aqueous solvent which forms part of, or part of, the aqueous solution of the at least one matrix material dissolved therein.
[0033] In a further embodiment, the present invention relates to a predetermined number N as defined herein. B The present invention relates to a method for producing an aqueous suspension of hydrogel microspheres, wherein the method is: a) A step of providing macroparticles as defined herein and a step of dissolving such macroparticles in an aqueous solvent, in accordance with the present invention; or a * ) step of providing the hydrogel microspheres of the default number N defined in this specification in a dry form, and step of suspending them in an aqueous solvent B in a dry form, and the step of suspending them in an aqueous solvent comprising.
[0034] In a further aspect, the present invention, in accordance with the present invention, the default number N defined herein B also relates to a kit for generating an aqueous suspension of hydrogel microspheres of, said kit comprising the following components: a) macro particles in accordance with the present invention, defined herein; or a * ) the default number N of hydrogel microspheres in dry form defined herein B ; and b) water or an aqueous solution or an aqueous solvent for dissolving said macro particles and / or suspending said hydrogel microspheres; wherein said kit further comprises a container, vessel, frame, or scaffold in which said components a) or a * ) and b) are preferably integrated but separated, more preferably in a configuration where they are mixable.
[0035] Detailed Description of the Invention The inventors have surprisingly found that digital amplification reactions, such as digital PCR, can be performed without the need for precise measurement of the volume of the compartments used during such digital amplification. Instead, only the number of compartments used for amplification needs to be known. Similarly, according to the present invention, there is no need to adjust the sample volume or sample concentration before performing quantitative measurements. The present invention provides a simple methodology for performing digital amplification reactions and concentration of target analytes from different samples or sample volumes without the need to precisely weigh the volume of the amplification compartments. Furthermore, unlike classical digital amplification methods, the present invention allows the use of the entire sample volume (e.g., obtained from a nucleic acid elution protocol) without the need to adjust such sample volume or analyte concentration beforehand. The methodology according to the present invention can be implemented rapidly, does not require advanced microfluidic devices or instruments, and can be easily integrated into existing laboratory hardware or automated processes.
[0036] While digital PCR is sometimes referred to as an example of a targeted amplification reaction in this specification, it is clear that the methodology according to the present invention also includes and refers to signal amplification reactions frequently used in, for example, enzyme immunoassays.
[0037] Furthermore, it should be noted that aspects of the present invention can be carried out using any type of reaction compartment that can take in a liquid sample from a sample, is equipped with a material capable of binding to an analyte, and contains said material, such material being, for example, in the form of a binding member. Such a reaction compartment suitable for the present invention is provided that is suitable for carrying out an enzymatic or chemical reaction (e.g., an enzymatic amplification reaction) and also has a capacity suitable for detecting an analyte pre-bound by said material (e.g., said binding member).
[0038] Accordingly, as used herein, the term “reaction compartment” includes and provides a volume suitable for taking in, and preferably containing, an aqueous sample (or a portion thereof), which contains, or is considered to contain, an analyte; here, any entity in such volume of the reaction compartment from which an enzymatic or chemical detection reaction, such as an enzymatic amplification reaction, for detecting the analyte can be carried out (subsequently). The volume and dimensions of such a suitable reaction compartment are not important in the process of determining the concentration of the analyte according to the present invention (as is evident from the formula used according to the present invention, a predetermined number N of analytes exposed to the aqueous sample). B (Only important) Typically, preferred dimensions of the “reaction compartment” according to embodiments of the present invention are selected to be in the micrometer range, for example, the longest dimension is <1 mm, preferably ≤500 μm, more preferably ≤300 μm, even more preferably ≤200 μm, even more preferably ≤150 μm, and even more preferably ≤100 μm. Such reaction compartments, e.g., hydrogel microspheres (e.g., nanoreactor beads or nanoreactor microspheres), have reaction capacities in the nanoliter range and are therefore sometimes simply referred to as “nanoractors.” For example, hydrogel microspheres with average diameters of 500 micrometers, 100 micrometers, and 20 micrometers have capacities of 65 nanoliters, 0.5 nanoliters, and 0.004 nanoliters, respectively.
[0039] An example of a “reaction compartment” according to an embodiment of the present invention is: - Wells, chambers, channels, recesses, grooves, or trenches on a solid substrate; - Preferably a vessel, container, or pot having dimensions in the micrometer range; - Solid particles having an externally accessible internal volume; for example, those having interstitial pore spaces or a single internal volume accessible from the outside; - A projection or protrusion fixed on a solid substrate (e.g., a "spot" on the substrate), such projection or protrusion having a pore space that allows for the intake of an aqueous sample; -Porous particles, for example, hydrogel particles having pores that allow them to take in aqueous samples. That is the case.
[0040] In embodiments of the present invention, it is important that the reaction compartment comprises, i.e., contains, a material capable of binding to the analyte. In other words, in embodiments of the present invention, the reaction compartment is not inert to the analyte and has an affinity for the analyte. Such “analyte-binding material” may be able to bind to the analyte by, for example, the structure and / or chemical properties of the material itself, and may be able to form one or more binding interactions with the analyte; or the analyte-binding material may be able to bind to the analyte by containing one or more binding members, which may be chemical groups or structures or entities having an affinity for the analyte (provided that the rest of the material constituting the reaction compartment is inert to the analyte). An example of the structure or properties of a material capable of forming one or more binding interactions with the analyte is a polymer that forms part of the reaction compartment and has a charge opposite to that of the analyte in question. For example, if the analyte is a nucleic acid, the material capable of forming one or more binding interactions with such nucleic acid may be a polymer that carries one or more positive charges, or can be induced to carry one or more positive charges, preferably a cationic polymer or a cationizable polymer.
[0041] Examples of materials that include one or more binding members can be chemically inert materials, such as neutral charged polymers that further include one or more chemical groups having a specific affinity for the analyte of interest. For example, if the analyte is a nucleic acid, the material that includes one or more chemical groups having a specific affinity for the analyte of interest can be a chemically inert and / or neutral charged polymer that includes one or more oligonucleotides that specifically bind to the nucleic acid analyte of interest. This is because, for example, such one or more oligonucleotides have a nucleotide sequence complementary to the nucleotide sequence of the analyte of interest. In this example, such oligonucleotides serve as "binding members". In other words, as used herein, a "binding member" is intended to be used as a group or entity specifically designed for binding to an analyte, and / or an entity that enables or facilitates binding to an analyte.
[0042] According to an embodiment of the present invention, the reaction compartment / hydrogel microsphere containing a material capable of binding to an analyte quantitatively binds such an analyte. As used herein, the term "quantitatively binds an analyte" preferably means that the ability of the reaction compartment / hydrogel microsphere to bind the analyte (in the case of specific binding) is known or established, or that the ability of the reaction compartment / hydrogel microsphere to bind molecules of the same chemical species as the analyte (e.g., nucleic acid or protein) (in the case of non-specific binding) is known or established. Thereby, the user has the advantage of being able to select an appropriate predetermined number N B of reaction compartments / hydrogel microspheres suitable or potentially suitable for each sample for which the concentration of the analyte is to be quantified.
[0043] When implementing an embodiment of the method for quantification according to the present invention, in a method that results in a random distribution of the analyte across the reaction compartments of the predetermined number N [[ID=eleven]] B the aqueous sample is added with the predetermined number N BBy exposing the reaction compartment, the predetermined number N B The reaction compartment takes in the aqueous sample and allows the analytes, preferably all of them, present in the aqueous sample to bind together, thereby associating with or containing the analytes contained in the aqueous sample, the predetermined number N B It is observed that at least some reaction compartments are brought forth within the reaction compartment.
[0044] The aforementioned predetermined number N B It should be noted that the random distribution of the analyte across the reaction compartments can be achieved in various ways depending on the type of reaction compartment used. For example, if the reaction compartments are wells or recesses on a solid substrate, the random distribution of the analyte (and aqueous sample) can be achieved by completely immersing the substrate in the aqueous sample and ensuring that the aqueous sample flows and distributes randomly across the substrate, thereby allowing each reaction compartment to be exposed to the aqueous sample with equal probability.
[0045] However, if the reaction compartment consists of particles that are not fixed to a substrate, i.e., particles that can be freely dispersed in a liquid volume, such as small particles, vessels, and especially porous particles, such as hydrogel particles or hydrogel microspheres having pores that allow them to take in an aqueous sample, or solid particles with an externally accessible volume; for example, interstitial pore spaces or particles with a single internal volume that is externally accessible, then the aqueous suspension of the (porous) particles can be mixed with the aqueous sample to achieve a random distribution of the analyte (and aqueous sample), thereby exposing all the (porous) particles to the aqueous sample (and the analyte, if present).
[0046] In embodiments where the reaction compartment consists of porous particles, it should be noted that such particles typically have pore spaces, also referred to as "interstitial pore spaces," that are accessible from the outside of the particle and allow for the intake of liquid, such as an aqueous sample, from around the particle by capillary action. When these particles are dry and exposed to and come into contact with water, an aqueous solution, or an aqueous sample, they absorb or reabsorb the liquid like a sponge. If they are already wet and already contain liquid, for example, provided in an aqueous suspension, the particles (as part of the suspension) can be mixed with the aqueous sample to expose them to the aqueous sample, which still contains, or is thought to contain, the analyte. Because the pore spaces are accessible from the outside of the particle, such exposure allows the particle to take in the aqueous sample, and the analyte if it is present in the sample. Taking hydrogel microspheres as an example, the hydrogel that forms part of these particles is typically, preferably, porous. When such hydrogel microspheres are exposed to an aqueous sample containing, or suspected to contain, an exchange of liquid occurs between the hydrogel microspheres and the pore spaces of the hydrogel microspheres, resulting in the incorporation of the aqueous sample and, if present, the analyte into the porous hydrogel microspheres.
[0047] According to an important aspect of the present invention, a predetermined number N as defined herein B The use of reaction compartments, and sample volume, reaction compartments associated with or containing the analyte (default number N) B The number of reaction compartments (after exposure to the aqueous sample), and the number of reaction compartments (similarly, a predetermined number N) that do not associate with the analyte or do not contain the analyte. B The use of information about the number of reaction compartments after exposure to the aqueous sample is as follows:
number
[0048] Knowledge of other factors such as the volume of the reaction compartment or changes in its volume is not required. Furthermore, the present invention handles a wide range of sample volumes, including the volume V of a sample containing or believed to contain the analyte. S This should be ensured and known. Therefore, the present invention is extremely versatile and suitable for exposure to a predetermined number N of samples to be tested. B By selecting the reaction compartment, it can be applied to almost any sample and sample volume. Therefore, embodiments of the present invention are - Combining analytes from aqueous samples; - To provide a reaction chamber with the capacity to carry out the chemical / enzymatic detection of analytes bound by enzymatic amplification reactions; - To provide and retain reagents in such a reaction chamber that enable the carrying out of analyte-specific enzyme amplification reactions; - After the reaction compartments are isolated from each other, release such reagents and allow them to form a solution for carrying out the enzyme amplification reaction (if they are not yet in the form of such a solution), - Performing enzyme amplification reactions in the reaction compartment. We handle all reaction compartments that are capable and appropriate.
[0049] As used herein, the term “microsphere” refers to a spherical body, or a substantially spherical, spherical, droplet-shaped, ellipsoidal, or other circular body, such as an oval body, having an average diameter in the range of 10 μm to 500 μm, preferably 20 μm to 500 μm, more preferably 20 μm to 200 μm, more preferably 20 μm to 100 μm, and even more preferably 40 μm to 100 μm. As used herein, the term “hydrogel microsphere” refers to a microsphere that forms a hydrogel, particularly a porous hydrogel, when in contact with, exposed to, or containing an aqueous solution. Such hydrogel microspheres are “porous” in that they have pores that allow them to take in an aqueous sample, preferably by capillary force. In one embodiment, the average pore size of such hydrogel microspheres is <100 nm, preferably <50 nm, more preferably <25 nm, more preferably <15 nm, and even more preferably <10 nm.
[0050] Suitable examples of hydrogel microspheres that may be used in the context of the present invention are the hydrogel microspheres disclosed in International Patent Application PCT / EP2022 / 080978. These specific examples of hydrogel microspheres are microspheres comprising agarose as a first material capable of forming a porous hydrogel, and crosslinked chitosan as a second material that forms a network within the porous hydrogel formed by the first material. However, as described herein, hydrogel microspheres according to the present invention may be made from different materials, insofar as they include materials capable of forming a hydrogel and capable of binding analytes.
[0051] In one embodiment, the material that can be bonded to the analyte is: a) When the analyte is a nucleic acid, and the material capable of binding to the analyte binds nonspecifically to the nucleic acid, cationic polymers, cationic oligomers, cationic monomers, and silica; b) If the analyte is a nucleic acid, and the material capable of binding to the analyte specifically binds to a particular nucleic acid, such as a target nucleic acid, then an oligonucleotide; where the oligonucleotide is complementary to a given nucleic acid analyte; c) If the analyte is a protein, biological cell, viral particle, or extracellular vesicle, and the material that can bind to the analyte specifically binds to a particular protein, such as a target protein, or specifically binds to a label, tag, prosthetic group, or other component that associates with the analyte, or to an antibody, antibody fragment, or other component that associates with an antibody that specifically binds to the analyte, antibody, antibody fragment, and protein receptor Selected from.
[0052] Regarding a), the term "cationic" also means entities that can be converted into cationic entities, such as polymers and other molecules, that is, entities that exhibit cationic behavior under certain conditions and are therefore "cationically ionizable," or entities that can be induced to become cationic under certain conditions. In embodiments, when the material that can bind to the analyte is cationic, the binding of the analyte is mediated by charge; that is, the binding occurs primarily through electrostatic interactions. For example, when the analyte has a negative charge, as in the case of nucleic acids, there is an interaction between entities with opposite charges, i.e., between negatively charged nucleic acids and cationic or cationic substances. In this case, the binding is nonspecific (or general), meaning that the material that can bind to the analyte will bind to any nucleic acids present in the sample.
[0053] Regarding b), this is an example where the binding is mediated by hydrogen bonds between complementary nucleic acids. In this case, the binding is analyte-specific, meaning that the material capable of binding to the analyte specifically binds to the analyte in question, but does not bind to other molecules of the same chemical species, such as other nucleic acid molecules with nucleotide sequences different from those of the analyte in question.
[0054] Regarding c), this is an example where the bonding is specific to the analyte and is mediated by various forces such as electrostatic attraction, hydrogen bonding, van der Waals forces, hydrophobic interactions, and any combination of these forces / bonds.
[0055] In one embodiment, the material capable of binding to the analyte binds non-specifically to the analyte. This means that such a material not only binds to the analyte but also to other molecules of the same chemical species as the analyte (e.g., nucleic acids, proteins, etc.).
[0056] In another embodiment, the material that can bind to the analyte specifically binds to the analyte; that is, such material binds primarily to the analyte or only to the analyte but not to other molecules of the same chemical species as the analyte (e.g., nucleic acids) (in any case, not to other molecules of different chemical species).
[0057] According to embodiments of the present invention, it is preferable that the analyte-binding material, regardless of whether the binding to the analyte is specific or nonspecific, can concentrate and / or increase the concentration of the analyte from an aqueous sample. Therefore, it is preferable that the reaction compartment / hydrogel microsphere containing the analyte-binding material can deplete the aqueous sample of all analytes that were present in the sample. In one embodiment, the reaction compartment / hydrogel microsphere containing the analyte-binding material can capture all of the analyte from an aqueous sample.
[0058] In one embodiment, the predetermined number N of reaction compartments / hydrogel microspheres B The reaction compartment / hydrogel microsphere is selected so that it can deplete the aqueous sample of all analytes that were present in the sample and / or capture all analytes from the aqueous sample. Typically, the reaction compartment / hydrogel microsphere according to the present invention represents a high-capacity binding matrix for capturing analytes from an aqueous sample, which means that it can deplete the sample of all analytes that were previously present in the sample.
[0059] In a preferred embodiment, the analyte is a nucleic acid, the material capable of binding to the analyte binds nonspecifically to the nucleic acid; and the material capable of binding nonspecifically to the nucleic acid is: Selected from chitosan and its derivatives, gelatin and its derivatives, polymer backbones to which poly(ethyleneimine), poly(2-dimethyl(aminoethyl) methacrylate), poly(lysine), poly(histidine), poly(arginine), and basic amino acids are attached or incorporated as parts of such backbone; oligopeptides containing or consisting of basic amino acids such as histidine, lysine, and arginine; and monomers selected from basic amino acids such as histidine, lysine, and arginine.
[0060] In a particularly preferred embodiment, the material capable of (non-specifically) binding an analyte, such as nucleic acid, is chitosan or a chitosan derivative.
[0061] Similarly, in a particularly preferred embodiment, the material capable of (non-specifically) binding an analyte, such as nucleic acid, is not gelatin.
[0062] It should be noted that, as used herein, the terms “peptide” or “oligopeptide” refer to polymers / oligomers in which amino acids are linked to one another via peptide bonds. In one embodiment, such peptide bonds are only those peptide bonds formed between a carboxyl group on the α-carbon of one amino acid residue and an amine-nitrogen on the α-carbon of the next amino acid residue, i.e., peptide bonds that form a classical peptide / protein backbone through a condensation reaction involving functional groups (amino group and carboxyl group) attached to the α-carbon of each amino acid residue. Such a type of peptide bond is a classical peptide bond and may also be referred to as a “eu-peptide bond.” In another embodiment, the terms “peptide” or “oligopeptide” as used herein may also refer to a polymer / oligomer of amino acids in which some or all of the amino acids are linked to one another via peptide bonds formed through a condensation reaction involving functional groups that are part of the side chain of the amino acids (rather than functional groups attached to each α-carbon of each amino acid residue). Such a type of peptide bond may also be referred to as an “isopeptide bond,” meaning that at least one of the functional group partners involved is part of the side chain of an amino acid residue. For example, the ε-amino group of lysine can form a peptide bond with the α-carboxyl group or γ-carboxyl group of glutamic acid. Both of these peptide bonds would be recognized as "isopeptide bonds."
[0063] As used herein, the terms “reaction compartment / hydrogel microsphere” and “reaction compartment(plural) / hydrogel microsphere(plural)” generally refer to “reaction compartment” or “reaction compartment(plural)” as defined herein, and in particular refer to “hydrogel microsphere” or “hydrogel microsphere(plural)” as preferred embodiments as defined herein.
[0064] As used herein, the term “analyte” refers to the nucleic acid, protein, biological cell, or virus of interest that is to be detected and quantified in a sample. However, if the analyte is a biological cell of interest, it should be noted that such a cell may contain specific proteins or nucleic acids that can be used for detection purposes and that can function as a representative analyte of such a biological cell. Similarly, a virus of interest may contain proteins or nucleic acids that can be used for detection purposes and that can function as a representative analyte of such virus.
[0065] As used herein, the terms "target nucleic acid" or "target protein" refer to the nucleic acid or protein that is the analyte, respectively, and their concentrations will be quantified in the sample.
[0066] The term "default number N" B The "reaction compartment / hydrogel microspheres" refers to an absolute number indicating the total number of hydrogel microspheres provided in step a) of the quantitative method according to the present invention. Such number indicates the concentration c of the analyte in the sample according to the present invention. s It is important to note that "default" means that the exact number of reaction compartments / hydrogel microspheres provided in step a) of the method for quantifying is known and / or adjusted to a known value.
[0067] The reaction compartment / hydrogel microsphere according to the present invention contains a material capable of binding to the analyte, so that when mixed with an aqueous sample containing or suspected to contain the analyte in step b) of the concentration determination method, the reaction compartment / hydrogel microsphere can bind to the analyte. As a result of this mixing step, the reaction compartment / hydrogel microsphere according to the present invention is exposed to the sample and, if present, the analyte, and consequently associates with or contains the analyte.
[0068] As used herein, the expression “reaction compartment / microsphere is associated with or contains the analyte” refers to a scenario in which the reaction compartment / microsphere has the analyte in its spatially adjacent location, and / or incorporates and / or binds such analyte. Subsequently, if such reaction compartment / hydrogel microsphere, which is associated with or contains the analyte, moves to a phase immiscible with water, such analyte cannot be dissociated from the reaction compartment / hydrogel microsphere. In preferred embodiments, the terms “associated with or containing the analyte” are used synonymously with the terms “bound to the analyte” or “bound to the analyte.” In one embodiment, the terms “associated with or containing the analyte” are used synonymously with the terms “the analyte is concentrated in its spatially adjacent location, and / or incorporates and / or binds such analyte.”
[0069] As used herein, the term "associate analyte" refers to a scenario in which the analyte in question is associated with a reaction compartment / hydrogel microsphere according to the present invention, thereby becoming concentrated or highly concentrated. This is distinct from a scenario in which the analyte in question is merely incorporated into the volume of the reaction compartment / hydrogel microsphere according to the present invention, and the reaction compartment / hydrogel microsphere does not exert any affinity, association force, or attraction to the analyte in question. Furthermore, this is not limited to cases where an aqueous sample is a predetermined number N. B This is also distinguished from scenarios where the reaction compartment / hydrogel microspheres are simply separated, and the reaction compartment / hydrogel microspheres do not exert affinity, association, or attraction to the analyte in question.
[0070] Typically, in a scenario where the analyte of interest is associated with a reaction compartment / hydrogel microsphere, thereby becoming concentrated and / or highly concentrated, such association of the analyte with the reaction compartment / hydrogel microsphere occurs through one or more electrostatic interactions, hydrogen bonding, van der Waals forces, hydrophobic interactions, and a combination thereof. In preferred embodiments, bonding occurs through electrostatic interactions / bonding and / or hydrogen bonding. In particularly preferred embodiments, such association or "bonding" may occur to such an extent that the analyte is concentrated by the reaction compartment / hydrogel microsphere, and all of the analyte present in the aqueous sample is bonded to the reaction compartment / hydrogel microsphere.
[0071] As used herein, the terms “signal or target amplification reaction” refer to a chemical or biochemical detection reaction in which either the signal used to detect the analyte is amplified, or the target (i.e., the analyte) to be detected and / or quantified is first amplified and then detected. Typical examples of target amplification reactions are nucleic acid amplification reactions such as polymerase chain reaction (PCR). Typical examples of signal amplification reactions are immunochemical reactions such as immunoassays, which involve the formation of analyte-specific immune complexes that are subsequently detected.
[0072] According to embodiments of the present invention, the enzyme amplification protocol is carried out within a reaction compartment, generating a first optically detectable signal in reaction compartments associated with or containing the analyte, while generating a second optically detectable signal in reaction compartments not associated with or containing the analyte. These means of first and second optically detectable signals allow for the determination and distinction of different sets of reaction compartments having, showing, or displaying such first or second optically detectable signals, respectively. These two sets of reaction compartments having first or second optically detectable signals may also be referred to herein as “positive reaction compartments” and “negative compartments,” respectively, and they differ in that a “positive reaction compartment” is a reaction compartment associated with or containing the analyte, while a “negative reaction compartment” is a reaction compartment not associated with or containing the analyte. The total number of detected reaction compartments is the total number of positive and negative reaction compartments, i.e., N=N pos +N neg That is the case.
[0073] As used herein, the term “first optically detectable signal” refers to a signal that can be observed by a suitable detection means (e.g., a photodetector or optical channel, e.g., a fluorescence channel) and is specific to and indicates a “positive reaction compartment,” i.e., a reaction compartment associated with or containing an analyte. Such a “first optically detectable signal” is characterized and defined by its intensity and wavelength. These intensities and wavelengths may be specific intensity values and / or wavelength values, respectively, or they may be defined intensity ranges and wavelength ranges, respectively. If such a “first optically detectable signal” is characterized and defined by defined intensity ranges and wavelength ranges, such ranges are preferably narrow.
[0074] As used herein, the term “second optically detectable signal” refers to a signal observable by a suitable detection means (e.g., a photodetector or optical channel, e.g., a fluorescence channel), for example, the same detector used for detecting the first optically detectable signal. Such “second optically detectable signal” is specific to and refers to the “negative reaction compartment,” i.e., the reaction compartment that does not associate with or contain the analyte.
[0075] Such “second optically detectable signal” is characterized and defined primarily by the fact that such second optically detectable signal differs from the first optically detectable signal in terms of intensity and / or wavelength (thus enabling the distinction between “positive” and “negative” reaction compartments characterized by such “first” and “second” optically detectable signals, respectively). Thus, such “second optically detectable signal” has different intensity values or ranges, or different wavelength values or ranges, or both, compared to the first optically detectable signal. The fundamental idea is that the classification and distinction of reaction compartments can enable the determination of whether each reaction compartment is a “positive reaction compartment” if it associates with or contains an analyte; or a “negative reaction compartment” if it does not associate with or contains an analyte.
[0076] In a preferred embodiment, the term “second optically detectable signal” as used herein is synonymous with and can be used as synonymous with “an optically detectable signal different from the first optically detectable signal.” In a particularly preferred embodiment, the term “second optically detectable signal” as used herein is synonymous with and can be used as synonymous with “the absence of the first optically detectable signal,” i.e., such “second optically detectable signal” is characterized by the absence of the “first optically detectable signal.” In such an embodiment, the “first optically detectable signal” is the only suitable light signal to be detected, i.e., the “optically detectable signal,” and the “second optically detectable signal” is simply “the absence of an optically detectable signal.”
[0077] As described above, according to a preferred embodiment of the present invention, the concentration c of the analyte in the sample s Step d) of the method for quantifying is: d) A step of carrying out an enzyme amplification protocol in the reaction compartment, wherein the enzyme amplification protocol generates a first optically detectable signal in the reaction compartment that is associated with or contains the analyte; and the enzyme amplification protocol does not generate a first optically detectable signal in the reaction compartment that is not associated with or contains the analyte.
[0078] Concentration of analyte c in the sample s In a particularly preferred embodiment of the method for quantifying, step d) is: d) A step of carrying out an enzyme amplification protocol in the reaction compartment, wherein the enzyme amplification protocol generates an optically detectable signal in the reaction compartment that is associated with or contains the analyte; and the enzyme amplification protocol does not generate an optically detectable signal in the reaction compartment that is not associated with or contains the analyte.
[0079] In any of the above embodiments, the preferred reaction compartment is a hydrogel microsphere.
[0080] In a preferred embodiment of the present invention, an enzyme amplification protocol is implemented that generates a first optically detectable signal in hydrogel microspheres associated with or containing an analyte, while generating a second optically detectable signal (in the case of no optically detectable signal or a signal different from the first optically detectable signal (i.e., a signal different from the first optically detectable signal)) in hydrogel microspheres not associated with or containing an analyte. Such optically detectable signal means allow for the determination of a large number of hydrogel microspheres associated with or containing an analyte, while also allowing for the determination of a further large number of hydrogel microspheres not associated with or containing an analyte. These two sets of hydrogel microspheres, each with and without the first and second optically detectable signals, for example, the presence or absence of an optically detectable signal, may also be referred to herein as “positive” hydrogel microspheres and “negative” hydrogel microspheres, respectively. The total number of detected microspheres is the total number of positive and negative hydrogel microspheres, i.e., N=N pos +N neg Therefore, according to the present invention, the concentration c of the analyte in the sample s is an expression
number
[0081] Therefore, according to the present invention, there is no need to adjust the sample concentration or sample volume for the quantification of the analyte concentration in the sample. As long as the sample volume to be used is known, the method of the present invention can handle virtually any sample volume. Similarly, unlike classical digital amplification methodologies of the prior art, there is no need to know the volume of individual reaction compartments (e.g., hydrogel microspheres) for the quantification of the analyte concentration in the sample according to the present invention. Similarly, unlike classical digital amplification methodologies of the prior art, where volume variations must be known, considered, and / or corrected, there is no need to know, consider, or correct for volume variations of individual reaction compartments (e.g., hydrogel microspheres) for the quantification of the analyte concentration in the sample according to the present invention. Rather, according to embodiments of the present invention, it is only necessary to observe the number of reaction compartments (e.g., hydrogel microspheres) that have or do not have a first optically detectable signal ("positive" and "negative" reaction compartments, e.g., hydrogel microspheres). From such determination of positive and negative reaction compartments (e.g., hydrogel microspheres), the total number of detected reaction compartments (e.g., hydrogel microspheres) can be calculated. This can be expressed in the aforementioned formula by adding a predetermined number N of reaction compartments (e.g., hydrogel microspheres) exposed to the sample. BBy substituting this along with the sample volume used in each experiment, it becomes possible to easily determine the accurate concentration of the analyte in the sample. In this way, the highly efficient binding and concentration of the analyte allows for the simple quantification and lossless analysis of analytes contained in samples of different volumes. Since this is completely independent of sample volume, the quantification method according to the present invention can be used with any sample volume, as long as the sample volume is known.
[0082] As can be seen from the above formula, the actual lambda ("λ") is the negative natural logarithm of the ratio of negative reaction compartments / hydrogel microspheres to the total number of detected reaction compartments / hydrogel microspheres. Such an actual lambda can be interpreted as the average number of analyte molecules per reaction compartment / hydrogel microsphere.
[0083] According to the present invention, the reaction compartment / hydrogel microsphere comprises a material capable of binding to the analyte. In this context, the binding of the analyte to the reaction compartment / hydrogel microsphere may be specific or nonspecific. For example, if the analyte is a nucleic acid, and the material capable of binding to the analyte binds nonspecifically to the nucleic acid, such material capable of binding to the analyte may be a cationic polymer, a cationic oligomer, a cationic polymer, a cationizable polymer, or silica. Examples of these are shown below. In a preferred embodiment, the material capable of binding to the analyte is not gelatin. In yet another preferred embodiment, the reaction compartment / hydrogel microsphere does not contain gelatin.
[0084] However, if the material capable of binding to the analyte specifically binds to the analyte, and the analyte is a nucleic acid, then the material capable of binding to the analyte may be, for example, an oligonucleotide complementary to the nucleic acid in question, i.e., the target nucleic acid (or target analyte).
[0085] If the analyte is a protein, and a material capable of binding to the analyte specifically binds to it, then such material capable of specifically binding to the analyte may typically be an antibody, an antibody fragment, or a protein receptor that specifically binds to the analyte.
[0086] As used herein, the term "analyte binding" refers to a scenario in which the analyte in question is associated with the reaction compartment / hydrogel microsphere according to the present invention, thereby becoming concentrated and / or highly concentrated. This is distinct from a scenario in which the analyte in question is merely incorporated into the volume of the reaction compartment / hydrogel microsphere according to the present invention, and the reaction compartment / hydrogel microsphere does not exert any affinity, association force, or attraction to the analyte in question. Furthermore, this is not limited to cases where an aqueous sample is a predetermined number N. B This is also distinguished from scenarios where the reaction compartment / hydrogel microspheres are simply separated, and the reaction compartment / hydrogel microspheres do not exert affinity, association, or attraction to the analyte in question.
[0087] Typically, when an analyte of interest is associated with a reaction compartment / hydrogel microsphere according to the present invention, thereby becoming concentrated and / or highly concentrated, such association between the analyte and the reaction compartment / hydrogel microsphere occurs by one or more of the following: electrostatic interactions, hydrogen bonding, van der Waals forces, hydrophobic interactions, and combinations thereof. In preferred embodiments, bonding occurs by electrostatic interactions / bonding and / or hydrogen bonding. In particularly preferred embodiments, such association or "bonding" may occur to such an extent that the analyte is concentrated and / or highly concentrated by the reaction compartment / hydrogel microsphere, and all of the analyte present in the aqueous sample may bond to the reaction compartment / hydrogel microsphere.
[0088] As used herein, the term "chromogenic enzyme" refers to an enzyme capable of transforming a chromogenic substrate to produce an optically detectable signal, such as a color signal or a fluorescent signal. To produce such an optically detectable signal, a chromogenic enzyme typically acts on a chromogenic substrate, which is processed, for example, cleaved, by the action of the chromogenic enzyme, and the reaction products of such processing are optically detectable because they have a specific color or fluorescence formed during the processing. Examples of frequently used chromogenic enzymes include horseradish peroxidase, calf intestinal alkaline phosphatase, and β-galactosidase. A chromogenic enzyme can act on a chromogenic substrate, and upon action by such an enzyme, an optically detectable product, such as a colored or fluorescent product, accumulates, resulting in the production of an optically detectable signal. As used herein, the term “chromogenic enzyme” explicitly includes the possibility that the signal produced therefrom may be a fluorescent signal (produced by excitation at a specific wavelength (range) as well as a visually detectable color signal) and therefore detectable by a fluorescent channel; in this case, such a “chromogenic enzyme” may also be called a “fluorescent enzyme.” Whether a visually detectable signal or a fluorescent signal is produced depends on the selection of the substrate acted upon by such enzyme; and such substrate may be “chromogenic” in the strict sense (i.e., producing a visually detectable (colored) product or signal) or “fluorescent” (i.e., producing a fluorescent product or signal detectable by fluorescence upon excitation at a specific wavelength (range)).
[0089] In embodiments of the present invention, the reaction compartment / hydrogel microsphere includes magnetic particles that enable mechanical handling and migration of the reaction compartment / hydrogel microsphere. In one embodiment, such magnetic particles have a size in the range of 50 nm to 10 μm, preferably 100 nm to 5 μm, more preferably 1 μm to 5 μm, and even more preferably 1 μm to 3 μm.
[0090] As used herein, the term “magnetic particle” refers to a particle exhibiting magnetic behavior, thereby enabling such particle to be attracted to a magnet. As used in the context of the present invention, the magnetic particle is a particle contained in and / or incorporated into a reaction compartment / hydrogel microsphere according to the present invention. In one embodiment, such magnetic particle is a ferromagnetic particle. In another embodiment, such magnetic particle is a paramagnetic particle. In yet another embodiment, such magnetic particle is a ferrimagnetic particle. In yet another embodiment, such magnetic particle is a superparamagnetic particle. In a preferred embodiment, such magnetic particle is a ferromagnetic or paramagnetic particle. However, as used herein, the term “magnetic particle” excludes diamagnetic particles. As used herein, the “magnetic particle” preferably has a size and average diameter, or average length in one direction, that enables such magnetic particle to be incorporated into a hydrogel microsphere according to the present invention. Preferably, the magnetic particles used herein have a size and average diameter or average length in one direction in the range of 50 nm to 10 μm, preferably 100 nm to 5 μm, more preferably 1 μm to 5 μm, and even more preferably 1 μm to 3 μm. Preferably, the size and average diameter or average length in one direction of the magnetic particles are selected to enable the incorporation of such magnetic particles into hydrogel microspheres according to the present invention.
[0091] In a preferred embodiment, the reaction compartment / hydrogel microsphere according to the present invention is a porous hydrogel microsphere having an average pore size of <100 nm, preferably <50 nm, more preferably <25 nm, even more preferably <15 nm, and even more preferably 10 nm.
[0092] Hydrogel microspheres according to embodiments of the present invention may be referred to herein as synonymous with “beads,” “nanoreactor beads,” “NRB,” or “nanoreactor.” Furthermore, if such hydrogel microspheres further contain magnetic particles (which enable easy and simple mechanical manipulation and migration of the hydrogel microspheres), they may be referred herein as “magnetic hydrogel microspheres,” “magnetic nanoreactor beads,” or “mNRB.”
[0093] According to the present invention, the concentration of the analyte c in the sample s According to an embodiment of the method for quantifying, the reaction compartment / hydrogel microsphere (micropshere) is a component for carrying out an enzyme amplification reaction, for example (i) buffer, mono-nucleoside-triphosphate, amplification enzyme, nucleic acid dye for detection of amplified nucleic acid, optionally one or more amplification primers or one or more sets of amplification primers, and optionally a TaqMan probe or molecular probe such as a molecular beacon; or (ii) a buffer, a labeled analyte-specific antibody or antibody fragment, and the detection reaction for detecting the label; or (iii) Buffer solution, analyte-specific antibody or antibody fragment, detection antibody for analyte detection conjugated to the analyte-specific antibody or antibody fragment, the detection antibody to which a label is attached, and the detection reagent for label detection. It may be provided in step a) in a form that already includes it.
[0094] In such embodiments, i.e., if the reaction compartment / hydrogel microsphere is provided in a form that already contains components for carrying out the enzyme amplification reaction in step a), they are provided in step b, for example, as described herein. ** By performing this procedure, there is no longer a need for post-treatment by exposing the affected area to the solution used to carry out the enzyme amplification reaction.
[0095] However, in other embodiments, these components for carrying out the enzyme amplification reaction are transferred to an aqueous liquid phase solution that is immiscible with water, i.e., an additional step b) is performed before step c), i.e., before step c) the reaction compartments / hydrogel microspheres are isolated from each other. ** ) It may be added later.
[0096] An embodiment of the present invention is step b, which is an additional cleaning step. * ) may also be provided, and in the cleaning process, the predetermined number N B The reaction compartment / hydrogel microspheres are washed with a suitable washing solution, such as a washing buffer, by exposing such reaction compartment / hydrogel microspheres to the washing buffer or wash buffer. Such washing step b * ) is performed and processing step b ** If necessary or intended to be done, then additional step b ** ) is process b * This is performed after step b. ** ) is the predetermined number N B The process involves treating the reaction compartment / hydrogel microsphere by exposing it to a solution containing the components necessary to carry out the enzyme amplification reaction. For example, such a solution for carrying out the enzyme amplification reaction may be: (i) buffer, mono-nucleoside-triphosphate, amplification enzyme, nucleic acid dye for detecting amplified nucleic acid, optionally one or more amplification primers or one or more sets of amplification primers if not already present in the hydrogel microsphere, and further optionally a molecular probe such as a TaqMan probe or molecular beacon; or (ii) Buffer solution, an analyte-specific antibody or antibody fragment to which a label has been attached, and a detection reagent for detecting the label; or (iii) buffer solution, analyte-specific antibody or antibody fragment, detection antibody for analyte detection conjugated to the analyte-specific antibody or antibody fragment, detection antibody to which the label is attached, and detection reagent for label detection; Here, in (ii) and (iii), the label is either a nucleic acid tag or a chromogenic enzyme; and -If the label is a nucleic acid tag, the detection reagent is a solution comprising a mono-nucleoside triphosphate, an amplification enzyme, a nucleic acid dye for detecting the amplified nucleic acid, optionally one or more amplification primers or one or more sets of amplification primers if they are not already present in the hydrogel microsphere, and further optionally a molecular probe such as a TaqMan probe or a molecular beacon; and, -If the label is a chromogenic enzyme, the detection reagent is a solution containing the substrate for the chromogenic enzyme. It may contain the following components.
[0097] In embodiments of the present invention, step e) the method includes detecting the first and second optically detectable signals generated in the reaction compartment / hydrogel microspheres via a first channel, which is preferably a fluorescence channel. Such first channel can also be used to determine the total number N of detected reaction compartments / hydrogel microspheres, enabling the detection of positive and negative reaction compartments / microspheres. Alternatively and / or optionally, the total number N may also be determined by optical imaging via a second channel distinct from the first channel. However, it should be noted that such a second channel is not essential.
[0098] In an embodiment of the present invention, the concentration c of the analyte in the sample s A method for quantifying the concentration of the target nucleic acid in the sample is to determine the concentration of c s It is particularly useful for quantifying [something].
[0099] A method specifically designed to quantify the concentration of a target nucleic acid in a sample is: a) Aqueous samples containing or suspected to contain target nucleic acids, and a predetermined number N BA step of providing an aqueous suspension of reaction compartments / hydrogel microspheres in any order, wherein the reaction compartments / hydrogel microspheres include a material that can nonspecifically bind to a nucleic acid such as the target nucleic acid, or a material that can specifically bind to the target nucleic acid; b) The predetermined number N B A step of exposing the reaction compartment / hydrogel microsphere to the aqueous sample and mixing the aqueous sample with the suspension of the reaction compartment / hydrogel microsphere so that the reaction compartment / hydrogel microsphere can take up the aqueous sample and, if present in the aqueous sample, bind the target nucleic acid, preferably all of the target nucleic acid; thereby enabling the target nucleic acid to be contained in the aqueous sample provided in step a) and associated with or containing the target nucleic acid, a predetermined number N B This results in at least some reaction compartments / hydrogel microspheres; c) Transfer the reaction compartment / hydrogel microspheres to a liquid phase immiscible with water and aqueous solutions, such as an oil phase, thereby introducing the predetermined number N into the water-immiscible phase. B A step of generating a suspension of reaction compartments / hydrogel microspheres, wherein the reaction compartments / hydrogel microspheres are isolated from each other by a liquid phase immiscible with water so that the flow and / or exchange of aqueous samples between different reaction compartments / hydrogel microspheres is no longer possible and does not occur; d) The step of carrying out a nucleic acid amplification protocol on a reaction compartment / hydrogel microsphere specific to the target nucleic acid; wherein, if associated with or contained in any of the reaction compartments / hydrogel microspheres, the nucleic acid amplification protocol results in specific amplification of the target nucleic acid, and if the reaction compartment / hydrogel microsphere contains or is associated with the amplified target nucleic acid, it results in the generation of a first optically detectable signal in the reaction compartment / hydrogel microsphere; and, if the reaction compartment / hydrogel microsphere is not associated with and does not contain the amplified target nucleic acid, the nucleic acid amplification protocol does not result in amplification of the target nucleic acid, but results in the generation of a second optically detectable signal in the reaction compartment / hydrogel microsphere; e) By detecting the first and second optically detectable signals, the number of reaction compartments / hydrogel microspheres (= "positive" reaction compartments / hydrogel microspheres) having the first optically detectable signal is determined. pos And the number N of reaction compartments / hydrogel microspheres having a second optically detectable signal (= "negative" reaction compartments / hydrogel microspheres) neg The process of determining the total number of reaction compartments / microspheres detected here N=N pos +N neg ; f) The concentration of the target nucleic acid in the aqueous sample c s to formula
number
[0100] The inventors have determined the concentration c of the analyte in the sample. s In a method for quantifying, the predetermined number N as defined herein. B We have found that aqueous suspensions of reaction compartments / hydrogel microspheres are particularly useful. In an embodiment of such aqueous suspension according to the present invention, the reaction compartments / hydrogel microspheres are the predetermined number N B The range is from 1,000 to 1,000,000, preferably from 5,000 to 500,000, more preferably from 5,000 to 100,000, even more preferably from 5,000 to 50,000, and even more preferably from 5,000 to 20,000.
[0101] Default number N B The reaction compartment / hydrogel microspheres are suspended in an aqueous suspension (the suspension is at the concentration of the analyte in the sample). s To produce a matrix and a predetermined number N of such macroparticles embedded in such matrix (which can be used in a method for quantifying) the inventors have made a matrix and such macroparticles embedded in such matrix BMacroparticles containing reaction compartments / hydrogel microspheres have also been devised. The macroparticles according to the present invention contain a desired number of reaction compartments / hydrogel microspheres, i.e., the predetermined number N B It can be used to conveniently provide reaction compartments / hydrogel microspheres. For this purpose, the macroparticles according to the present invention are dried, preferably freeze-dried. Furthermore, such macroparticles are preferably solid particles. In practice, such macroparticles according to the present invention are a defined number N B The reaction compartment / hydrogel microparticles function as a container, vessel, or package for storage and / or transport. In a preferred embodiment, the macroparticles are isolated, independent particles. Preferably, such isolated, independent macroparticles do not form part of a vessel such as a test tube, and / or are not contained within such a vessel. Preferably, such isolated, independent macroparticles are not part of a gel or other semi-solid or liquid entity. As used herein, the term “macroparticle” may be used synonymously with the term “pellet.” In one embodiment, the dimensions of such macroparticles (or “pellets”) according to the present invention are selected such that the average diameter is in the range of 1 mm to 50 mm, preferably 2 mm to 20 mm, more preferably 2 mm to 15 mm, and even more preferably 2 mm to 10 mm, and even more preferably 2 mm to 5 mm. The macroparticles according to the present invention are in a predetermined number N B Since it already contains reaction compartments / hydrogel microspheres, a predetermined number N according to the present invention B This invention enables the simple and easy generation of aqueous suspensions of reaction compartments / hydrogel microspheres. According to the present invention, a predetermined number N B The generation of aqueous suspensions of reaction compartments / hydrogel microspheres is achieved by using macroparticles according to the present invention, by a predetermined number of N BSuch aqueous suspension of the reaction compartment / hydrogel microspheres can be easily carried out at the time and place where it is required or planned. The macroparticles according to the present invention can be stored for a long period of time and place where the quantitative method according to the present invention is planned to be carried out (for example, a predetermined number N according to the present invention). B It can be used to generate aqueous suspensions of reaction compartments / hydrogel microspheres. In embodiments of the present invention, the matrix of the macroparticles comprises or consists of a material which is an excipient for a drying process, in particular lyophilization. In a particular embodiment, the excipient for drying, in particular lyophilization, is selected from saccharides such as trehalose, sucrose, mannitol, glucose, fructose, lactose, mannitol, inositol, hydroxypropyl-β-cyclodextrin and combinations thereof; polymers such as polyethylene glycol (PEG), polyvinylpyrrolidone (PVP), dextran, gelatin; amino acids such as arginine, histidine, and glycine, and combinations thereof. It is preferable that such matrix material is selected to be readily soluble in an aqueous solvent or solution while allowing stabilization during the drying process. By appropriately selecting such matrix material, the macroparticles according to the present invention can be stored for a long period of time and used as needed.
[0102] According to embodiments of the present invention, macroparticles are: a) The default number N as defined herein B A step of providing a reaction compartment / hydrogel microsphere suspension, an aqueous solvent, and at least one matrix material as defined herein, in any order; b) Adding at least one matrix material to the aqueous solvent, thereby dissolving the matrix material in the aqueous solvent, and a predetermined number N of the solutions of the matrix material. BA step of mixing the reaction compartment / hydrogel microsphere with the suspension, thereby forming the suspension of the reaction compartment / hydrogel microsphere in the aqueous solvent; c) A step of generating droplets of the suspension formed in step b), wherein such droplets have a predetermined size and volume, and such droplets are dispensed into a water-immiscible liquid phase, such as an oil phase, at a temperature in the range of -100°C to -10°C, preferably -90°C to -20°C, more preferably -80°C to -30°C; and the droplets are made freezable. d) A step of separating the frozen droplets from the water-immiscible liquid phase and drying them, preferably freeze-drying them, thereby yielding droplet-shaped macroparticles according to the present invention. It can be produced by a method that includes [a specific method].
[0103] Furthermore, according to an embodiment of the method for generating such macroparticles according to the present invention, the matrix material may be provided in step a) together with the aqueous solvent, that is, as a solution of the matrix material dissolved in the aqueous solvent (instead of being provided separately from the aqueous solvent in step a) (for example, as a solid); and in such an embodiment, in step b), it is no longer necessary to dissolve the matrix material in the aqueous solvent, and the aqueous solution of the matrix material already provided in step a) and a predetermined number N B It should be noted that the reaction compartment / hydrogel microsphere suspension, preferably the aqueous suspension, is simply mixed with the aqueous solvent, thereby forming the suspension of the reaction compartment / hydrogel microsphere in the aqueous solvent.
[0104] In embodiments of the method for generating macroparticles according to the present invention, in step c), the water-immiscible liquid phase is preferably an oil phase such as a halogenated hydrocarbon oil, for example, a hydrofluoroether (HFE) oil. An advantage of using such a halogenated hydrocarbon oil, unlike liquid nitrogen or other liquefied gases, is that it does not evaporate even when in contact with droplets of the hydrogel microsphere suspension in the aqueous solvent. In one embodiment, the water-immiscible liquid phase is an oil phase that remains liquid in the range of -100°C to -10°C, preferably -90°C to -20°C, and more preferably -80°C to -30°C. In particularly preferred embodiments, such a water-immiscible liquid phase, for example, the oil phase, has a pour point in the range of -50°C to -100°C or below. A suitable oil phase that can be used according to embodiments of the present invention is hydrofluoroether oil, available under the trademark name NOVEC 7500®.
[0105] As used herein, the term “macroparticle” refers to a matrix and a predetermined number N embedded in the matrix of such particles. B This refers to dried, preferably lyophilized, particles comprising reaction compartments / hydrogel microspheres. Unlike “microspheres” or “hydrogel microspheres” according to the present invention, “macroparticles” have dimensions in the mm range and therefore may include multiple “microspheres” or “hydrogel microspheres.” Macroparticles according to embodiments of the present invention preferably have an average diameter in the range of 1 mm to 50 mm, preferably 2 mm to 20 mm, more preferably 2 mm to 20 mm, and even more preferably 2 mm to 10 mm, and even more preferably 2 mm to 5 mm. In particularly preferred embodiments, such macroparticles are substantially spherical, spherical, droplet-shaped, ellipsoidal, or other circular in shape. Such “macroparticles” may also be referred to herein as “pellets.”
[0106] As used herein, the term "aqueous solvent" refers to water, which may contain additional components dissolved therein as needed, such as buffers or other solutes.
[0107] Further aspects of the present invention are illustrated and described by the following schemes, drawings, and embodiments. These are for illustrative purposes only and do not limit the present invention. The scope of protection of the present invention is limited only by the appended claims.
[0108] As used herein, terms such as “of this invention,” “according to the invention,” and “according to the invention” refer to all aspects and embodiments of the invention described and / or claimed herein. As used herein, the term “comprising” is construed to encompass both “including” and “consisting of,” both of which are clearly and expressly intended and therefore construed to encompass the individual disclosed embodiments according to the invention. As used herein, “and / or” is construed to mean a specific disclosure that includes both the presence and absence of the other for each of the two identified features or components. For example, “A” and / or “B” is construed to mean (i) A, (ii) B, and (iii) A and B, respectively, as if each were described separately herein. Where an indefinite or definite article is used to refer to a singular noun, e.g., “a,” “an,” or “the,” it also includes the plural form of that noun unless otherwise specified. Similarly, such disclosure shall also be interpreted as a specific disclosure of a single individual entity beginning with "a," "an," or "the."
[0109] Brief explanation of the drawing The present invention will be further described with reference to the following drawings. Here: [Brief explanation of the drawing]
[0110] [Figure 1]Figure 1 shows a schematic representation of a predetermined number of NB reaction compartments according to the present invention. Such reaction compartments are entities containing a material capable of binding to an analyte; each of these reaction compartments has a volume suitable for taking in, preferably containing, an aqueous sample (or a portion thereof); and in the volume of such reaction compartments, an enzymatic or chemical detection reaction, such as an enzymatic amplification reaction, for detecting the analyte can also be (subsequently) carried out. However, even if only a small portion of the aqueous sample is taken into the reaction compartment, if an analyte is present in the sample, it is preferable that the majority, preferably all, of it be bound by a material capable of binding and concentrating the analyte. The volume VS of the aqueous sample containing the analyte is indicated by a square frame surrounding the predetermined number of NB reaction compartments. The left panel shows the predetermined number of NB reaction compartments exposed to an aqueous sample of volume VS. In the left panel, the predetermined number of NB reaction compartments allow for taking in the aqueous sample and binding to the analyte, if present in the aqueous sample, preferably all of the analyte present in the aqueous sample. In this way, the reaction compartments of a predetermined number of NBs are exposed to the aqueous sample in such a manner that a random distribution of analytes is produced across the reaction compartments of the predetermined number of NBs, thereby resulting in at least some of the reaction compartments of the reaction compartments of the predetermined number of NBs being associated with or containing analytes contained in the aqueous sample. During such exposure, the reaction compartments of the predetermined number of NBs are randomly exposed to the aqueous sample, resulting in a random distribution of any analytes present in the sample. The right panel shows the reaction compartments of the predetermined number of NBs after the enzyme amplification protocol has been performed, with some reaction compartments producing a first optically detectable signal, and therefore these being "positive reaction compartments," and some reaction compartments producing a second optically detectable signal, and therefore these being "negative reaction compartments."In some embodiments, the generation of a first optically detectable signal in a "positive reaction compartment" can be considered equivalent to the generation of an optically detectable signal in such a "positive reaction compartment," resulting in such a "positive reaction compartment" appearing bright (when detected by a photodetector); and the generation of a second optically detectable signal in a "negative reaction compartment" can be considered equivalent to "no optically detectable signal" in such a "negative reaction compartment," resulting in such a "negative reaction compartment" appearing dark (when detected by a photodetector). [Figure 2] Figure 2 shows a scheme of a typical workflow for quantifying an analyte in a sample of known volume, accompanied by a predetermined number of reaction compartments (e.g., hydrogel nanoreactor beads) capable of binding the analyte. These reaction compartments are exposed to an aqueous sample containing or suspected to contain the analyte, and after one or more optional washing steps, the reaction compartments are incubated with a solution for carrying out the enzyme amplification defined herein (e.g., PCR master mix), also referred to herein as the “detection reagent.” The reaction compartments are then isolated from each other, the enzyme amplification reaction is carried out, and the positive and negative reaction compartments are detected. Subsequently, the concentration cs of the analyte in the sample is determined by applying the “formula” described herein. [Figure 3]Figure 3 illustrates a schematic scheme illustrating various schematic forms of antibody-based binding of an analyte, and the subsequent workflow for detecting the analyte-bound microsphere by nucleic acid amplification using a solution for performing enzymatic amplification as defined herein (also referred to herein as "PCR reagent"). More specifically, Figure 3a) shows an antibody-coated microsphere used to bind an analyte (A) to a detection antibody complex, thereby labeling the detection antibody with a nucleic acid tag. The detection antibody and the antibody on the microsphere form an analyte-specific immune complex together with the analyte. To detect the microsphere with the bound analyte, the nucleic acid tag is amplified, for example, by "PCR". Figure 3b) shows an antibody-coated hydrogel microsphere that can be used to capture biological cells from a sample. The nucleic acids (DNA or RNA) derived from such cells can then be detected by nucleic acid amplification. Figure 3c) shows a sandwich of two analyte-specific antibodies (analyte-specific immune complex) that can be formed in solution and subsequently bound to a hydrogel microsphere. One analyte-specific antibody is labeled with a nucleic acid tag, and the other analyte-specific antibody is labeled with another label (e.g., biotin) that is recognized by further antibodies or receptors attached to the hydrogel microsphere. The hydrogel microsphere is coated with a receptor or antibody specific to the label (e.g., biotin, "B") attached to one of the two antibodies forming the sandwich. [Figure 4] Figure 4 shows a schematic scheme illustrating two different forms of workflow: detection of hydrogel microspheres with bound analytes by nucleic acid binding and subsequent nucleic acid amplification. More specifically, Figure 4a) shows non-specific binding (general binding), where all nucleic acids in the sample are collected and concentrated on hydrogel microspheres that have been chemically functionalized to bind to nucleic acids, for example, by charge (e.g., protonated amino groups). In the figure, target nucleic acids are shown by solid lines, and other non-target nucleic acids are shown by dotted lines. Figure 4b) shows specific binding of target nucleic acids concentrated on hydrogel microspheres with specific complementary binding nucleic acids, such as nucleotides. [Figure 5] Figure 5 shows a schematic scheme illustrating the workflow for digital detection of an analyte by enzyme signal amplification following immunocomplex formation on hydrogel microspheres. In this representative figure herein, an enzyme label is attached to the detection antibody instead of a nucleic acid label. After a washing step as necessary, the hydrogel microspheres are incubated with a chromogenic enzyme substrate and suspended or transferred to an oil phase. The fluorescent product of the enzymatic action accumulates in the space provided by each hydrogel microsphere and can be detected. [Figure 6] Figure 6 shows a schematic flowchart of an embodiment of a method for quantifying the concentration cs of a target nucleic acid in a sample; [Figure 7] Figure 7 shows a more specific embodiment of the flowchart for a method of quantifying the concentration cs of a target nucleic acid in a sample; more specifically, Figures 7A-E show: A: A suspension with a known predetermined number of magnetic hydrogel microspheres is brought into contact with a known volume of sample containing purified DNA (e.g., cellular genomic DNA) in binding buffer; the formed suspension is incubated on a thermomixer at 40°C and 2,000 rpm for 10 minutes. B: The tube with the suspension is placed on a magnetic stand, the binding buffer is removed and replaced with wash buffer, and the tube is vortexed at room temperature. C: The tube is placed on a magnetic rack, the wash buffer is removed from the hydrogel microspheres, PCR mastermix is added to the microspheres, and the tube is vortexed briefly to equilibrate the mastermix solution with the wash buffer remaining inside and around the hydrogel microspheres. D: Oil is added to the tube; the tube is subjected to vigorous agitation (e.g., on a vertical mixer) to form an oil-in-water emulsion and microspheres in the oil suspension. E: Load the suspension into a well plate or transfer it to a PCR tube and subject it to thermal cycling conditions; after PCR, detect the fluorescence signal of each hydrogel microsphere. [Figure 8]Figure 8 shows a schematic representation of an embodiment of the method for producing macroparticles ("pellets") according to the present invention. Droplets are generated from a mixture of an aqueous suspension of hydrogel microspheres and a matrix material solution in an aqueous solvent, and the droplets are introduced into a cold oil phase that allows the droplets to freeze. These are then freeze-dried and recovered as macroparticles ("pellets") according to the present invention. [Figure 9] Figure 9 shows one embodiment of a schematic representation of macroparticles according to the present invention. The scale bar in the photograph illustrates the dimensions of the macroparticles. [Figure 10] Figure 10 shows a schematic representation of a flowchart embodiment of a method for generating a predetermined number of hydrogel microsphere suspensions NB; this can be used following a method for quantifying the concentration cs of an analyte in a sample ("hydrogel microsphere assay") according to embodiments of the present invention. [Figure 11] Figure 11 shows the formula for calculating the concentration of the target analyte according to an embodiment of the method of the present invention (right-hand box) and the formula conventionally used in dPCR (left-hand box). [Figure 12] Figure 12 shows fluorescence intensity plots and corresponding images of magnetic hydrogel microspheres ("magnetic nanoreactor beads" = "mNRB") in the experiment described in Example 5. Data are shown for five sample dilution levels (V1 to V5), and representative fluorescence images of magnetic hydrogel microspheres ("magnetic nanoreactor beads" = "mNRB") at different magnifications are shown. [Figure 13] Figure 13 shows the experimental results using the magnetic hydrogel microspheres ("magnetic nanoreactor beads" = "mNRB") described in Example 5. [Figure 14] Figure 14 shows the calculated sample concentrations for each individual measurement (12 repeated measurements) plotted against the predicted concentration values in the experiment described in Example 5.
[0111] Furthermore, the following examples are provided for illustrative purposes only, not to limit the present invention. [Examples]
[0112] Example 1 Preparation of crosslinked nanoreactor beads by linking molecules of a second polymer (e.g., chitosan) together. This example describes the preparation of typical reaction compartments / hydrogel microspheres / nanoreactor beads that can be used in combination with the present invention. These nanoreactor beads are also described in international patent application PCT / EP2022 / 080978.
[0113] Preparation of agarose suspensions using coating and paramagnetic particles Ingredient 1: SeaKem ME Agarose (Lonza) Component 2: 1 μm coated fluorescent particles (Thermo, λex=480 nm, λem=520 nm) Component 3: 1μm Magnefy COOH magnetic particles (Bangslabs)
[0114] Component 1 ("First Material", "First Polymer", e.g., agarose) is weighed and dissolved in nuclease-free water (Roth) to prepare a 1% (w / v) homogeneous solution. This is achieved by a short initial vortex (20', 2000 rpm) and heating at 95°C for 10 minutes at 1200 rpm using a thermomixer (Eppendorf). Unwanted impurities are removed using a 5 μm syringe filter (Whatman). The temperature is then lowered to 80°C to combine the agarose with the other components.
[0115] Preparation of component 1 begins with washing three times with 10 times the volume of nuclease-free water (Roth). This step removes undesirable impurities from the storage buffer. To prevent aggregation, the particles are sonicated at 23°C for 15 minutes.
[0116] Store all components in a polypropylene tube using a thermomixer (Eppendorf) at 80°C / 1200 rpm until further processing.
[0117] Typical final concentrations are as follows:
[0118] [Table 1]
[0119] Agarose can also be modified with fluorescent dyes. Typical protocols are listed below.
[0120] Agarose staining using Cy3 Materials used: Agarose (A9793; SeaKem ME) Cy3 mono-NHS ester (GE) 50 mM potassium phosphate buffer, pH 8.3
[0121] Prepare 5 ml of 1.5% agarose solution in 50 mM potassium phosphate buffer (pH 8.3). To do this, mix 75 mg of agarose with 5 ml of buffer and incubate at 90°C for 20 minutes. After cooling to room temperature and allowing the solution to solidify, mechanically crush the agarose and mix it with 1.6 mg of the dye solution dissolved in 50 mM potassium phosphate buffer (pH 8.3). The final volume of the staining solution is 10 ml. The incubation time for staining is 120 minutes. During this time, rotate the mixture on a 30 rpm rotary wheel at room temperature. Afterwards, wash the agarose several times with distilled water until no free dye remains in the supernatant. Finally, dry the agarose in a Speedvac to prepare it for bead preparation.
[0122] Production of monodisperse template nanoreactor beads Monodisperse template nanoreactor beads (= "microspheres") are produced on an improved μEncapsulator system (Dolomite microfluidics) in a one-step emulsion formation process using a simple flow focus device with the described components, agarose, chitosan, and coating particles and magnetic particles. Specifically, a standard fluorophilic bonding tip (100 μm) is used with a four-way linear connector and a tip interface H that interfaces the fluid connection between the tube and the tip. Two Mitos P-Pumps deliver the agarose / particle suspension and an emulsifier-containing carrier oil, such as PicoSurf (Sphere Fluidics, 2.5–5% in Novec 7500 (3M)).
[0123] This off-the-shelf system improves upon the conventional heating device that sits on a hot plate, maintaining the agarose / chitosan / particle suspension in a liquid state and allowing the drive fluid to be heated while ensuring a stable temperature when the carrier oil and component suspension come into contact at the tip joint. A heating cover over the agarose / chitosan / particle suspension reservoir prevents unwanted evaporation. A magnetic starburr is used to hold the suspension in place (controlled by the hot plate at 300-600 rpm).
[0124] For bead production, the heating device temperature is set to 75°C. The fluid line is primed at 2000 mbar for 1 minute using Flow Control Software. For stable droplet formation, the flow rate is adjusted to 10-50 μl / min. Parameters such as diameter are monitored using Dolomite Flow Control Advanced Software.
[0125] Monodisperse beads are collected through a 200 μm PTFE tube connected to the outlet of a microfluidic chip. The beads are cooled within the tube and eventually collected in a tube (e.g., 15 ml, BD), which is then placed on ice to initiate the solidification of the hybrid hydrogel. To prevent the loss of the aqueous phase of the beads at the oil-air boundary, the sample is overlaid with 500-1000 μl of nuclease-free water (Roth). The template nanoreactor beads are cooled to 4°C and allowed at least 1 hour to form a stable hybrid polymer scaffold.
[0126] Recovery of template nanoreactor beads from oil suspension The solidified template nanoreactor beads accumulate on top of the emulsion oil in the recovery tube. Carefully remove the PicoSurf oil with a pipette, taking care not to remove the beads. The PicoSurf residue is further diluted with solvent Novec 7500 (3M, 1:1 volume of recovered beads). Then, add 1H,1H,2H,2H-perfluorooctanol (PFO, Sigma, 1:4 volume of recovered beads) to break up the emulsion. Also add nuclease-free water (Roth, 3:1 volume of recovered beads). The beads now float in the aqueous phase. To accelerate this process, vortex the tube for 5 seconds and centrifuge at 2500 rpm for 5 seconds.
[0127] Finally, carefully collect the beads from the aqueous layer in the tube using a pipette and transfer them to a new tube. Repeating this process will remove any remaining fluorocarbon oil and surfactant. Wash the collected beads once with nuclease-free water (Roth, 3:1 volume of collected beads).
[0128] Generation of cross-linked nanoreactor beads by cross-linking of chitosan Prepare a 2% chitosan solution and roughly mix it with a suspension containing approximately 10,000 previously prepared template nanoreactor beads. Bis-N-succinimidyl-(pentaethylene glycol) ester (BIS-NHS-PEG; SIGMA-ALDRICH) is used as the crosslinking agent for the chitosan. Dissolve 1 mg of solid BIS-NHS-PEG in 1 mL of distilled water to prepare a linker solution, and add 250 μL of this solution to the suspension. Vortex the suspension. Allow the vortexed suspension to stand for 30 seconds. Add 20 mL of PicoSurf oil (Sphere Fluidics) to the suspension and immediately place it in a Bead Ruptor device (OMNI), shaking it three times for 5 seconds at 4 m / s. Then, place the bead-in-oil suspension in the refrigerator and allow it to stand overnight at 4°C. The crosslinked template nanoreactor beads are recovered from the PicoSurf oil according to the protocol described for the recovery of template nanoreactor beads.
[0129] When labeling chitosan itself with non-microparticle fluorescent dyes, typical protocols are listed below, but these may be performed before using such labeled chitosan in the cross-linked nanoreactor bead generation protocol described above:
[0130] Staining of chitosan using Cy5 Materials used: Chitosan HCl (Heppe Medical chitosan GmbH). Cy5 mono-NHS ester (GE) distilled water
[0131] Dissolve 1 g of chitosan HCl in distilled water to prepare a 2% solution. Dissolve 1.6 mg of Cy5 mono-NHS ester in 100 μl of distilled water and add it to the chitosan solution. After a short stirring, incubate the solution overnight at room temperature on a 30 rpm rotating wheel. Then, dialyze the solution against distilled water for a total of 48 hours, changing the water three times. After that, concentrate the stained chitosan polymer to a 2% solution using Speedvac.
[0132] Example 2 Preparation of crosslinked nanoreactor beads by linking primary and secondary polymer molecules This example describes the preparation of more representative reaction compartments / hydrogel microspheres / nanoreactor beads that can be used in combination with the present invention. These nanoreactor beads are also described in international patent application PCT / EP2022 / 080978.
[0133] The following embodiments demonstrate the production of hybrid hydrogel beads comprising an agarose scaffold and a capture matrix composed of a second material (a chitosan polymer applied as an ionizable capture matrix for nanoreactor beads). In these embodiments, the chitosan is crosslinked to the agarose matrix, and this crosslinking is achieved by binding the chitosan to a chemically activated agarose polymer containing the matrix of the pre-fabricated hydrogel beads. As a result, the chitosan molecules bind to the agarose molecules, forming bonds between different chitosan molecules. In addition to classical chitosan, various water-soluble derivatives are available and can be used interchangeably: - Chitosan HCl - Chitosan Glutamate (Glutamat) -Carboxymethyl chitosan - Chitosan lactate - Chitosan acetate (Heppe Medical Chitosan GmbH)
[0134] Production of monodisperse agarose beads Monodisperse beads composed of agarose are produced using an improved μEncapsulator system (Dolomite microfluidics). The solidified agarose beads are recovered from the emulsion oil. Excess emulsion oil is carefully removed with a pipette. After adding 1H,1H,2H,2H-perfluorooctanol and distilled water, the emulsion is crushed, and the beads are then transferred to the aqueous phase. After washing the agarose beads several times with distilled water, the beads are ready for further treatment with chitosan.
[0135] Reaction of activated agarose beads with cross-linked chitosan The vial containing 1,1'-carbonyldiimidazole (CDI; Sigma) as the coupling reagent should be allowed to return to room temperature before opening to prevent condensation. The reaction is carried out in two steps:
[0136] Step 1: Activation of the OH group of agarose Centrifuge the agarose bead suspension at 700 rpm for 1 minute and discard the supernatant. Dissolve the CDI in 2 mM HCl to obtain a 200 mM solution. Next, mix the beads with the CDI solution in a 1:1 ratio and react in 1 mM HCl. Incubate the reaction tube at room temperature on a 30 rpm rotating wheel for 10 minutes.
[0137] After the reaction, the beads are washed by centrifuging at 700 rpm for 2 minutes. The supernatant is removed, and the recovered beads are resuspended in an equal volume of distilled water and mixed. This washing procedure is repeated twice to prepare the activated beads for subsequent chitosan bonding.
[0138] The activation reaction should be carried out at a pH of less than 5.0. Alternatives to 1 mM HCl for pH adjustment include, for example: -20mM acetate buffer; pH 4.0 -20mM citrate buffer; pH4.0 -5 mM malonic acid; pH 3.0
[0139] Step 2: Coupling of chitosan to an activated agarose polymer containing pre-prepared precursor beads. Prepare a 1% chitosan solution with distilled water. In the second step, immediately mix the activated beads and the 1% chitosan solution in a 1:1 ratio. Incubate this mixture at room temperature on a rotating wheel at 30 rpm for 30 minutes. After the reaction, wash the beads by centrifuging at 700 rpm for 2 minutes. Remove the supernatant, resuspend the beads in an equal volume of distilled water, and mix. Repeat this washing procedure at least 10 times until no free chitosan remains in the supernatant.
[0140] The stability of cross-linked polymer beads is checked using chitosan stained with Cy5, after adding a high concentration (3.25 M) of chaotropic salt (e.g., guanidinium HCl).
[0141] Example 3 : Hydrogel microspheres ("nanoreactor beads") are generated for downstream processing. First, a suspension of nanoreactor beads is prepared in a medium suitable for freeze-drying. Such a suspension typically consists of 15-30% trehalose, 1.5-5% PEG 6000 or another suitable cryoprotectant such as Cavasol or sucrose, and nanoreactor beads. The suspension is prepared by adding an appropriate volume of an excipient-containing solution, adjusted to the appropriate concentration, to a volume of liquid containing a known number of magnetic nanoreactor beads, as described in patent application EP 21 206 745.8 (e.g., 1000 nanoreactor beads per μL). The suspension is incubated at room temperature for about 30 minutes with gentle stirring to ensure homogeneity of the different liquids.
[0142] To produce macro-particles (“pellets”), individual droplets of a pre-prepared suspension are dropped into cooled hydrofluoroether (HFE) oil (e.g., Novec 7500, 3M). For this purpose, the easily precipitating suspension is kept uniform by continuous stirring. Droplet formation can be accomplished in various ways, for example, using commercially available dispensers, pipettes, syringe pumps, or other droplet generating devices. The HFE oil used can be cooled to a temperature below -60 °C and higher than the pour point of the oil (e.g., using dry ice). In the case of Novec 7500, this is -110 °C. Preferably, a sieve is inserted into the oil, and after the droplets are frozen, they can be sieved out and transferred to a freeze-drying device.
[0143] Frozen droplets with a total volume of 20 μL (each containing 10,000 nano-reactor beads) are collected from the HFE oil using a cooled sieve and transferred to a freeze-drying device. There, it is dried, for example, at 0.2 mbar, -70 °C for 4 hours, and then further dried at 22 °C for 1 hour. [[ID=⑤]] [[ID=⑥]]
[0144] [[ID=⑦]] [[ID=⑧]]Subsequently, dry macro-particles (“pellets”) containing, for example, 10,000 nano-reactor beads are collected and stored in a sealed clean glass vial. [[ID=⑨]] [[ID=⑩]]
[0145] [[ID=⑪]] [[ID=⑫]] Example 4: [[ID=⑬]] [[ID=⑭]] Reconstruction of nanoreactor beads from freeze-dried macroparticles ("pellets") [[ID=⑮]] Place 1 macro particle (“pellet”) into a 2 ml Eppendorf tube. Add 200 μL of distilled water to the macro particle (“pellet”). Seal the tube and subject it to a Thermomixer device. Shake the tube at 40 °C and 2,000 rpm for 15 minutes. Then, transfer the tube to a magnet stand and remove the supernatant. In the case of non-magnetic nanoreactor beads, centrifugation or filtration can also be used to remove the supernatant. Add 20 μL of binding buffer (50 mM sodium malonate, pH 2.8, 0.1% PEG 6000) to the beads remaining in the tube. After briefly vortexing the tube, a 20 μL suspension containing 10,000 beads is prepared for proceeding to the binding step with the nucleic acid-containing sample. Beads reconstituted from such lyophilized macro particles (“pellets”) show performance equivalent to that of non-lyophilized beads in digital PCR assays.
[0146] Example 5: Pre-counted nanoreactor beads for precise concentration measurement (i.e., a predetermined number N) B Use of (having) Such reconstituted magnetic nanoreactor beads were processed for digital PCR on the BLINK X Product platform (BLINK, Jena, DE). An assay for quantification of the RPP30 target, a single-copy gene in human DNA, was used. In human DNA containing the target sequence derived from RPP30, we detected the target.
[0147] Human genomic DNA was quantified using primers and a probe specific to the human RPP30 gene (forward primer sequence (5’-3’): GCC AAA TTC TGC TCG TTG TTA G (SEQ ID NO: 1); reverse primer sequence (5’-3’): CTT CCC TCA CGG CATATA CTT C (SEQ ID NO: 2); probe sequence (5’-3’): Atto488- TCA CCA GCT GGA TGT CCA CAT TCA-BHQ-1) (SEQ ID NO: 3). The final concentrations of the primers and the probe were 0.9 μM and 0.25 μM, respectively.
[0148] DNA was isolated from human Buffy Coat using the Flexi-Gene DNA Kit (Qiagen) according to the manufacturer's instructions and stored at -20°C until use. On the day of the experiment, the DNA was thawed and the concentration of the material stock was measured by spectrophotometric method. Subsequently, 10-fold serial dilutions were performed in five steps, and the resulting DNA samples were subjected to a sample processing protocol using hydrogel microspheres ("nanoreactor beads").
[0149] For DNA binding, reconstituted magnetic hydrogel microspheres, i.e., hydrogel microspheres containing magnetic particles ("magnetic nanoreactor beads" or "mNRBs"), were incubated with a solution containing target DNA in binding buffer (50 mM sodium malonate, pH 2.8 and 0.1% PEG 6000) on a thermomixer (Eppendorf) at 30°C and 2000 rpm for 10 minutes. After setting the tubes on a magnetic stand, the supernatant was removed from the mNRBs and washed with 200 μl of washing buffer (12.5 mM sodium malonate, 0.001% tergitol). After setting the beads on a magnetic stand, the washing buffer was removed and the mNRBs were loaded with PCR reagents. The PCR reagent concentrations in the final mixture were 100 mM Tris-aminomethane, 22 mM potassium chloride, 22 mM ammonium chloride, 3 mM magnesium chloride, 0.2 U / μl Hot Start Taq DNA polymerase (biotechrabbit), 0.2 mM dNTP (biotechrabbit), 0.1% (w / v) BSA (Sigma), 0.9 μm primer, and 0.25 μM probe (Metabion). The beads were incubated with the PCR reagent on a thermomixer (Eppendorf) at 30°C and 1800 rpm for 5 minutes. Next, the supernatant was removed from the mNRB on a magnetic rack. To emulsify the mNRB, fluorocarbon oil containing 5% Pico-Surf (Sphere Fluidics) was added, and the mixture was heated three times for 5 seconds each on a Minilys homogenizer (Bertin Technologies) at level 2. Fresh oil was added to the mNRB three times to remove excess oil and microemulsification from the previous emulsification step. The emulsified mNRB was transferred in 3.5 μl portions to each well of a Blink X miniwell plate (Blink AG).
[0150] For amplification and detection, a BLINK X (BLINK AG) instrument was used. This instrument features a thermocycling module with a Peltier element and a fluorescence imaging module providing four channels of fluorescence detection. The system is designed to process mini-plates made of highly thermally conductive plastic. The plates are placed on a dedicated magnetic loading rack, and after filling and aligning the mNRB suspension on a self-assembled monolayer, they are filled with 960 μl of FC oil containing 0.5% Picosurf. The corresponding reaction-ready emulsified mNRB is pipetteed into each of the plate's six wells (120 μm deep, 7 mm in diameter). The mNRB is attracted to the bottom of the well by the magnetic force of the rack. The wells are isolated from each other by placing coverslips on the mini-plates. The mini-plates are closed with a transparent lid containing a gasket made of thermoplastic elastomer at the edge, allowing for proper melt sealing during subsequent heating exposure. The closed mini-plates are transferred to the thermocycling module and firmly pressed onto a 40 × 40 mm Peltier element for optimal thermal coupling. The module is inserted into the Blink X instrument and thermocycled according to the following temperature profile: initial system priming at 80°C for 120 seconds, initial denaturation at 94°C for 60 seconds, followed by 45 cycles of 2 seconds at 94°C and 2 seconds at 62°C. Endpoint fluorescence imaging is performed at 30°C. The mNRB is imaged using the Blink X instrument on a miniplate placed inside the thermocycling module. Four images are acquired for each well position on the miniplate in each detection channel. The acquired images are saved in bmp format as raw images and a composite overview image of the entire plate. Data analysis on the BLINK X platform involves two sequential analysis steps: image analysis and digital PCR analysis. Image analysis using an image segmentation algorithm recognizes beads using the concept of the maximum stable extreme region. A circle defining the outer edge of the bead is fitted based on specific regions where the fluorescence signal intensity increases. The representative fluorescence signal intensity of each bead is obtained from a fluorescence model assuming the bead is spherical.The size of the beads is calculated directly from the circumscribed circle representing the outer edge of the bead. Shape and size information is considered for further data processing to detect optical artifacts and apply valid / ineffective criteria to each detected NRB. Digital PCR analysis evaluates the estimated fluorescence signal of the beads in the detection channel. As a first step, a fluorescence intensity threshold is determined to distinguish between PCR-positive and PCR-negative beads. Herein, the mode of the fluorescence intensity distribution is determined by fitting one- and two-component Gaussian mixture models (GMMs) to the data and selecting the optimal model by comparing Bayesian Information Criterion (BIC) scores. In the case of a bimodal distribution, the intensity threshold is the location of the local minimum between the mean values of the GMM. Kernel density estimation is applied to curve smoothing and local minimum determination. After thresholding, Poisson statistics are used to determine the number of PCR-negative beads N out of a total number of beads N. neg The target per bead is evaluated based on the proportion of c in the sample. s The final quantitative value is calculated according to the following formula.
number
[0151] In this specification, the average number of targets per bead (λ) is defined as the number of negative beads detected N. neg This is determined by calculating the negative natural logarithm of the quotient N of the total number of beads detected. λ is the number of beads N applied to or exposed to the sample. B and volume V of the sample containing the target S By multiplying by the quotient, the target concentration (C) in the sample can be calculated. s ) is calculated.
[0152] Figure 12 shows representative images of fluorescence data and magnified areas collected for all thermocycle beads. Figure 12 shows data for five sample dilution levels (V1 to V5) and fluorescence images of hydrogel microspheres at different magnifications.
[0153] The results obtained were applied to the above formula for each sample. The calculation results are summarized in the table shown in Figure 13 and represented graphically in Figure 14. The table shows the dilution level of the sample used ("Dilution Level") and the average ratio of negative beads to detected beads ("Prop.Neg. Beads Average") (N neg / N), average number of beads used in the measurement ("No. beads N average"), average value of lambda ("lambda λ average"), average target concentration c s (“Target Conc.c s "Average", copy number per microliter (cp / μl), target concentration c s The mean of the common logarithm of ("Target Conc.c") s Log10 average), and target concentration c s The standard deviation of the common logarithm of ("Target Conc.c") s This indicates "Log10 Std").
[0154] In this specific experiment, a predetermined number N B(=90,400) hydrogel microspheres were used. Sensitivity is slightly reduced for highly diluted V5 samples. In this case, only 4 out of 12 repeated measurements yielded a non-zero result. This is because not all 90,400 mNRBs incubated and exposed with each sample diluent are ultimately transferred to mini-plate wells for PCR and imaging. The average number of beads per well (repeated measurements) used herein is approximately 3300. Therefore, the total number of beads analyzed per dilution level is 39,600, which represents 44% of the total number of mNRBs applied. Assuming an RPP30 concentration of 3.18 cp / μL in a true V5 sample, the expected number of targets per test repeated measurement using 3300 beads is only 1.9. Based on a Poisson distribution, the detection rate in this case cannot exceed 85%. Nevertheless, this method works across a very wide analyte concentration range, and even with highly diluted samples. The accuracy of the technically repeated measures is measured as the standard deviation at the target concentration after log10 transformation. Overall, this system agrees very well with the statistical expectations. Overall, the system shows extremely good agreement with the statistically expected values.
[0155] The lambda value obtained in mNRB is directly derived from the proportion of PCR-negative beads using Poisson statistics. As outlined herein, the actual lambda ("λ") is the negative natural logarithm of the ratio of negative hydrogel microspheres to the total number of detected hydrogel microspheres, as can be seen from the formulas described herein:
number
[0156] Such entity lambda can be interpreted as the average number of analyte molecules per hydrogel microsphere ("copy number per bead" or "cp / bead"). Therefore, the target concentration is determined based on the formula developed according to the present invention. Each sample is a default total of N BThe sample volume V of each dilution was incubated with 90,400 mNRBs. S The volume is 16 μL. Due to the remarkable binding capacity of mNRB, complete target capture can be assumed, and no adjustments are made for the possibility of target loss during washing and master mix loading. Therefore, the calculation was performed as follows: c s =((565 beads / (μL) x 160μL) / (16μL))xλ=((90400 beads) / (16μL))xλ
[0157] Figure 14 shows the concentration values obtained for each individual measurement plotted against the expected concentration, demonstrating excellent agreement between the expected and actual values when using the calculation method according to the present invention. In the figure, 12 repeated measurements are plotted for each dilution, except for the lowest dilution of the four repeated measurements (V5 in Figures 12 and 13).
[0158] Example 6: Embodiment: Digital Enzyme Immunoassay The methodology according to embodiments of the present invention can also be applied to quantify any soluble analytes by applying the formula of the present invention to any form of immunoassay performed on the hydrogel microspheres ("nanoreactor beads") described above and for the quantification of analytes in a sample. Such assays can be classified, for example, into the well-known category of immunoPCR ([1,2]). Conventionally, for quantification in such immunoPCR assays, conventional droplet volume-based digital PCR readout has sometimes been used ([3]). However, none of these employ a methodology that is independent of sample volume and does not require knowledge of the volume of the amplification compartment.
[0159] In this particular embodiment, the inventors describe the process of establishing a digital immunoassay for the detection of human cTnI, in combination with a newly developed quantitative approach. This is also schematically shown in Figure 3c). The DNA-labeled detection antibody and the biotin-labeled capture antibody form a sandwich complex with the antigen in solution. This complex is trapped in a known number of streptavidin-coated hydrogel microspheres ("nano reactor beads"). Unbound detection antibodies, i.e., DNA labels, are removed by an appropriate washing step. After incubation with a solution containing reagents for PCR amplification and detection, the nano reactor beads are suspended in oil, forming individual reaction compartments. The nano reactor beads are loaded into a Blink X (BLINK AG) well plate as described in European Patent Application No. EP22165559.0. The well plate is transferred to a Blink X device for thermocycling, fluorescence detection, and data analysis. The analyte concentration in the sample is determined by applying the processes described in the previous embodiments and this patent application.
[0160] Detected antibody The cTnI detection antibody (clone 3H9, SDIX) is labeled according to the manufacturer's protocol using the Thunder-Link® PLUS Oligo Conjugation System (Innova Bioscience) and then purified. The following sequence is conjugated to the antibody: 5’GCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCT3’ (SEQ ID NO: 4)
[0161] capture antibody : Clone TPC-110 (SDIX) is used as the capture antibody. This is labeled with biotin from Lightning link Streptavidin (Innova Bioscience) according to the manufacturer's protocol.
[0162] Preparation of hydrogel microspheres ("nanoreactor beads"): A suspension containing a specified number of nanoreactor beads in PBS buffer (e.g., 21,000 beads in a 40 μl volume) is mixed with 5 μl of a solution containing streptavidin (1 mg / mL) in PBS, and incubated on a thermomixer (Eppendorf) at 37°C and 2000 rpm for 15 minutes. The tube is then transferred to a magnetic stand (BLINK X processing rack, Blink AG), and the supernatant is replaced with 200 μl of pure PBS. This procedure is repeated twice.
[0163] Formation and capture of immune complexes Apply the following reaction mixture. Human plasma 80 μl TBS(K) pH 8,4 (20mM Tris, 50mM KCl pH 8,4), 0,5% TritonX-100, 10mg / ml BS 10 μl HBR-Plus (Scantibodies) 10 μl DNA label detection antibody xμl streptavidin-labeled capture antibody yμl
[0164] Optimization of antibody concentration: The optimal concentrations of the detection and capture antibodies are determined by conventional immunoPCR. The concentrations of the two antibodies were systematically varied, and immune complexes were generated using troponin-free plasma (negative control) and troponin-free plasma with a predetermined amount of spike troponin I. These complexes were captured on particles, washed, and subjected to conventional PCR. The optimal concentration of each antibody is indicated by the lowest detection limit and the widest measurement dynamic range.
[0165] Immune complex formation and capture: Using the two antibodies at the optimal concentrations determined above, prepare 100 μl of the reaction mixture (see above). Incubate this reaction mixture on an Eppendorf thermomixer at 37°C and 2000 rpm for 10 minutes.
[0166] In parallel, the pre-counted nanoreactor beads in PBS are placed on a magnetic rack and the supernatant is removed. The reaction mixture is added to the beads. After a short vortexing step, the suspension is incubated in a thermomixer at 25°C and 800 rpm for 5 minutes. During this time, the binding of the streptavidin-labeled capture antibody containing the immune complex to the nanoreactor is completed.
[0167] Subsequently, a washing process is performed five times using 500 μl of TBS(K) pH 8.4 (20 mM Tris, 50 mM KCl pH 8.4), 0.05% Triton X-100, and 1 mg / ml BSA, using a magnetic rack and vortexer.
[0168] Downstream processing: After removing the wash buffer, add 50 μL of PCR reaction mixture to the nanoreactor.
[0169] The mixture has the following composition: 500nM fw-primer (5' AGCTCTTGATCCGGCAAACA 3') (SEQ ID NO: 5) 500nM rev-primer (5' GCGTCAGACCCCGTAGAAAA 3') (SEQ ID NO: 6) SYBR (Registered Trademark) Green I nucleic acid gel stain (Sigma-Aldrich, #S9430) 1:25000 2 units TaqPolymerase 2x PCR buffer ([40 mM Tris HCl (pH 8.4), 100 mM KCl] PCR-grade water
[0170] The suspension was incubated with PCR reagent on a thermomixer (Eppendorf) at 30°C and 1800 rpm for 5 minutes. Next, the suspension was placed in a tube on a magnetic rack, and the supernatant was removed. For the oil suspension, fluorocarbon oil with 5% Pico-Surf (Sphere Fluidics) was added, and the tube was mixed three times for 5 seconds each on a Minilys homogenizer (Bertin Technologies) at level 2. Fresh oil was added to the nanoreactor three times to remove excess oil and microemulsion. 3.5 μl of emulsified NRB was transferred to 6 wells of a Blink X miniwell plate as described in European Patent Application No. EP22165559.0. PCR and fluorescence detection were performed according to the protocols of previous examples and embodiments.
[0171] It is clear that our approach for analyte quantification can also be applied to other forms of digital immunoassays. For example, formats such as SiMoA (single molecule array) [4,5] can be readily adapted to our approach by, for example, conjugating a first antibody to nanoreactor beads and a second antibody to a reporter enzyme (see also Figure 5). After forming an immunosandwich on the nanoreactor beads, the suspension is exposed to a fluorescent enzyme substrate, and then the beads are transferred to oil and incubated for fluorescence imaging. By applying the formula devised in this invention, accurate quantification of analytes in solution can be obtained.
[0172] [1] M. Spengler, M. Adler, C.M. Niemeyer, Highly sensitive ligand-binding assays in pre-clinical and clinical applications: immuno-PCR and other emerging techniques, Analyst. 140 (2015) 6175-6194. https: / / doi.org / 10.1039 / c5an00822k. [2] L. Chang, J. Li, L. Wang, Immuno-PCR: An ultrasensitive immunoassay for biomolecular detection, Anal Chim Acta. 910 (2016) 12-24. https: / / doi.org / 10.1016 / j.aca.2015.12.039. [3] H. Schroder, M. Grosche, M. Adler, M. Spengler, C.M. Niemeyer, Immuno-PCR with digital readout, Biochem Bioph Res Co. 488 (2017) 311-315. https: / / doi.org / 10.1016 / j.bbrc.2017.04.162. [4] D.M. Rissin, C.W. Kan, T.G. Campbell, S.C. Howes, D.R. Fournier, L. Song, T. Piech, P.P. Patel, L. Chang, A.J. Rivnak, E.P. Ferrell, J.D. Randall, G.K. Provuncher, D.R. Walt, D.C. Duffy, Single-Molecule enzyme-linked immunosorbent assay detects serum proteins at subfemtomolar concentrations, Nat Biotechnol. 28 (2010) 595-599. https: / / doi.org / 10.1038 / nbt.1641. [5] SM Schubert, LM Arendt, W. Zhou, S. Baig, SR Walter, RJ Buchsbaum, C. Kuperwasser, DR Walt, Ultra-sensitive protein detection via Single Molecule Arrays towards early stage cancer monitoring, Sci Rep-Uk. 5 (2015) 11034. https: / / doi.org / 10.1038 / srep11034.
[0173] The features of the present invention disclosed herein, in the claims, and / or in the accompanying drawings, individually and in any combination thereof, can serve as materials for realizing the invention in its various forms.
Claims
1. Concentration c of the analyte in the sample s A method for quantifying: a) Aqueous samples containing or suspected to contain the analyte, and a predetermined number N B A step of providing reaction compartments in any order, wherein the reaction compartments include a material that can bind to the analyte; b) The predetermined number N B The predetermined number N yields a random distribution of the analyte across the reaction compartment. B A step of exposing the reaction compartment to an aqueous sample, thereby enabling the reaction compartment to take in the aqueous sample and, if present in the aqueous sample, to bind the analytes, preferably all of the analytes, thereby associating with or containing the analytes contained in the aqueous sample provided in step a), the predetermined number N B This results in at least some reaction compartments of the reaction compartment; c) Optionally, if the flow and / or exchange of aqueous samples between different reaction compartments obtained from step b) is still possible and / or occurs after step b): a step of isolating the reaction compartments obtained from step b) so that the flow and / or exchange of aqueous samples between different reaction compartments is no longer possible and does not occur; d) A step of carrying out an enzyme amplification protocol in the reaction compartment, wherein the enzyme amplification protocol generates a first optically detectable signal in the reaction compartment associated with or containing the analyte; and the enzyme amplification protocol generates a second optically detectable signal in the reaction compartment not associated with or containing the analyte; e) By detecting the first and second optically detectable signals, the number of reaction compartments (= "positive" reaction compartments) having the first optically detectable signal is determined, respectively. pos and the number N of reaction compartments having a second optically detectable signal (= "negative" reaction compartments). neg The process of determining the total number of reaction compartments detected here. N=N pos +N neg ; f) Concentration of the analyte in the aqueous sample c s to formula [Math 1] The process of calculation according to (In the formula, c s = Concentration of analyte in aqueous sample N B = Default number of reaction compartments exposed to aqueous sample V S = Volume of aqueous sample containing or suspected to contain the analyte N neg = Number of reaction compartments with a detected second optically detectable signal (= "negative" reaction compartments) N = Total number of reaction compartments detected = N neg +N pos (In the formula, N pos (= Number of reaction compartments with the first optically detectable signal detected (= "positive" reaction compartments)) A method that includes this.
2. Concentration c of the analyte in the sample s A method for quantifying, in particular: a) Aqueous samples containing or suspected to contain the analyte, and a predetermined number N B A step of providing an aqueous suspension of hydrogel microspheres in any order, wherein the hydrogel microspheres include a material capable of binding with the analyte; b) The predetermined number N B A step of exposing the hydrogel microspheres to the aqueous sample and mixing the aqueous sample with the suspension of the hydrogel microspheres, thereby enabling the hydrogel microspheres to take up the aqueous sample and, if present in the aqueous sample, bind to the analytes, preferably all of the analytes; thereby associating with or containing the analytes contained in the aqueous sample provided in step a), the predetermined number N B This yields at least some hydrogel microspheres; c) Transfer the hydrogel microspheres to a liquid phase immiscible with water and aqueous solutions, such as an oil phase, thereby introducing the predetermined number N into the water-immiscible phase. B A process for generating a suspension of hydrogel microspheres, wherein the hydrogel microspheres are isolated from each other by a liquid phase immiscible with water so that the flow and / or exchange of aqueous samples between different hydrogel microspheres is no longer possible and does not occur; d) A step of performing an enzyme amplification protocol on the hydrogel microsphere, wherein the enzyme amplification protocol generates a first optically detectable signal in the hydrogel microsphere associated with or containing the analyte; and the enzyme amplification protocol generates a second optically detectable signal in the hydrogel microsphere not associated with or containing the analyte; e) By detecting the first and second optically detectable signals, the number of hydrogel microspheres having the first optically detectable signal (= "positive" hydrogel microspheres) is determined. pos and the number N of hydrogel microspheres having a second optically detectable signal (= "negative" hydrogel microspheres). neg The process of determining the total number of hydrogel microspheres detected here N = N pos +N neg ; f) Concentration of the analyte in the sample c s to formula [Math 2] The process of calculation according to (In the formula, c s = Concentration of analyte in aqueous sample N B = A predetermined number of hydrogel microspheres exposed to an aqueous sample V S = Volume of aqueous sample containing or suspected to contain the analyte N neg = Number of hydrogel microspheres with a detected second optically detectable signal (= "negative" hydrogel microspheres) N = Total number of hydrogel microspheres detected = N neg +N pos (In the formula, N pos = Number of hydrogel microspheres with the first optically detectable signal (= "positive" hydrogel microspheres) The method according to claim 1, including the method described in claim 1.
3. The aforementioned analytes are: a) Target nucleic acid; and the enzyme amplification protocol is a target amplification reaction; or b) Target protein; and the enzyme amplification protocol is a signal amplification reaction; or c) Biological cells, viral particles, or extracellular vesicles, each containing various types of nucleic acids within the cell, viral particle, or extracellular vesicle; and the enzyme amplification protocol being a targeted amplification reaction. The method according to any one of claims 1 to 2.
4. The aforementioned analytes are: a) a target nucleic acid; and the enzyme amplification protocol is a nucleic acid amplification protocol which, if the target nucleic acid is associated with or contained in any of the hydrogel microspheres, results in specific amplification of the target nucleic acid, and if the hydrogel microspheres contain or are associated with the amplified target nucleic acid, results in the generation of a first optically detectable signal in the hydrogel microsphere; or b) Target protein; and the enzyme amplification protocol is a signal amplification reaction involving the formation of an analyte-specific immune complex on or within the hydrogel microsphere, if the hydrogel microsphere is associated with or contains the analyte; where a chromogenic enzyme is attached to the analyte-specific immune complex, the enzyme amplification reaction, through the action of the chromogenic enzyme, further involves the accumulation of an optically detectable product, resulting in the generation of a first optically detectable signal within the hydrogel microsphere, if the hydrogel microsphere contains or is associated with the analyte; or c) Target protein; and the enzyme amplification protocol is a signal amplification reaction involving the formation of an analyte-specific immune complex on or within the hydrogel microsphere, if the hydrogel microsphere is associated with or contains the analyte; where the nucleic acid label is attached to the analyte-specific immune complex, the enzyme amplification reaction further involves specific nucleic acid amplification of the nucleic acid label, resulting in the accumulation of the amplified nucleic acid label and the generation of a first optically detectable signal within the hydrogel microsphere, if the hydrogel microsphere contains or is associated with the analyte; or d) Biological cells, viral particles, or extracellular vesicles, each containing various types of nucleic acids within the cells, viral particles, or extracellular vesicles; and the enzyme amplification protocol is a nucleic acid amplification protocol that, if the biological cells, viral particles, or extracellular vesicles are associated with or contained by any of the hydrogel microspheres, results in the specific amplification of one or more types of nucleic acids contained within the biological cells, viral particles, or extracellular vesicles, and if the hydrogel microspheres contain or are associated with biological cells, viral particles, or extracellular vesicles, results in the generation of a first optically detectable signal within the hydrogel microspheres. The method according to any one of claims 1, 2 to 3.
5. Materials that can be bonded to the aforementioned analytes include: a) When the analyte is a nucleic acid, and the material capable of binding to the analyte binds nonspecifically to the nucleic acid, cationic polymers, cationic oligomers, cationic monomers, and silica; b) If the analyte is a nucleic acid, and the material capable of binding to the analyte specifically binds to a particular nucleic acid, such as a target nucleic acid, then an oligonucleotide; where the oligonucleotide is complementary to a given nucleic acid analyte; c) If the analyte is a protein, biological cell, viral particle, or extracellular vesicle, and the material capable of binding to the analyte specifically binds to a particular protein, such as a target protein, or specifically binds to a label, tag, prosthetic group, or other component associated with the analyte, or to an antibody, antibody fragment, or other component associated with an antibody that specifically binds to the analyte, the antibody, antibody fragment, and protein receptor, A method selected from any of claims 1, 2 to 4.
6. The analyte is nucleic acid, and a material capable of binding to the analyte binds nonspecifically to the nucleic acid; the material capable of binding nonspecifically to the nucleic acid is: Polymer backbones to which chitosan and its derivatives, gelatin and its derivatives, poly(ethyleneimine), poly(2-dimethyl(aminoethyl) methacrylate), poly(lysine), poly(histidine), poly(arginine), and basic amino acids are attached or incorporated as parts of such backbone; oligopeptides containing or consisting of basic amino acids such as histidine, lysine, and arginine; and monomers selected from basic amino acids such as histidine, lysine, and arginine. A method according to any one of claims 1, 2 to 5, particularly claim 5, selected from among them.
7. The predetermined number N of hydrogel microspheres B The method according to any one of claims 1, 2 to 6, wherein the range is 1,000 to 1,000,000, preferably 5,000 to 500,000, more preferably 5,000 to 100,000, even more preferably 5,000 to 50,000, and even more preferably 5,000 to 20,000.
8. The method according to any one of claims 1, 2 to 7, wherein the hydrogel microspheres include magnetic particles that enable mechanical handling and migration of the hydrogel microspheres.
9. The method is an additional step b performed after step b) and before step c). * ) including: b * ) is the predetermined number N B The method according to any one of claims 1, 2 to 8, comprising the step of washing the hydrogel microspheres by exposing them to a washing buffer.
10. The above method includes an additional step b ** ) including step b ** )but - After step b) and before step c), - In addition to step b according to claim 9 * When carrying out step b * This is performed after step c) and before step c): b ** ) is the predetermined number N B The process involves treating the hydrogel microspheres by exposing them to a solution for carrying out the enzyme amplification reaction. The aforementioned solution is (i) buffer, mono-nucleoside-triphosphate, amplification enzyme, nucleic acid dye for detecting amplified nucleic acid, optionally one or more amplification primers or one or more sets of amplification primers if not already present in the hydrogel microsphere, and optionally a molecular probe such as a TaqMan probe or molecular beacon; or (ii) Buffer solution, analyte-specific antibody or antibody fragment with label attached, and a detection reagent for detecting the label; or (iii) a buffer, an analyte-specific antibody or antibody fragment, a detection antibody for detecting an analyte that binds to the analyte-specific antibody or antibody fragment, a detection antibody to which the label is attached, and a detection reagent for detecting the label; Here, in (ii) and (iii), the label is either a nucleic acid tag or a chromogenic enzyme; - If the label is a nucleic acid tag, the detection reagent is a solution containing a mono-nucleoside-triphosphate, an amplification enzyme, a nucleic acid dye for detecting the amplified nucleic acid, optionally one or more amplification primers or one or more sets of amplification primers if they are not already present in the hydrogel microsphere, and optionally a molecular probe such as a TaqMan probe or molecular beacon; and, - If the label is a chromogenic enzyme, the detection reagent is a solution containing the substrate for the chromogenic enzyme. The method according to any one of claims 1, 2 to 9.
11. The method according to any one of claims 1, 2 to 10, wherein in step e), the first optically detectable signal generated in the hydrogel microspheres, and optionally the second optically detectable signal, are also detected via the first channel, preferably the fluorescence channel, and optionally, the total number N of detected microspheres is determined by optical imaging via the second channel.
12. The method according to any one of claims 1, 2 to 11, wherein the hydrogel microspheres have an average diameter in the range of 10 μm to 500 μm, preferably 20 μm to 500 μm, more preferably 20 μm to 200 μm, more preferably 20 μm to 100 μm, and even more preferably 40 μm to 100 μm.
13. Concentration of target nucleic acid c in the sample s A method for quantifying: a) Aqueous samples containing or suspected to contain target nucleic acids, and a predetermined number N B A step of providing an aqueous suspension of hydrogel microspheres in any order, wherein the hydrogel microspheres contain a material that can nonspecifically bind to a nucleic acid such as the target nucleic acid, or a material that specifically binds to the target nucleic acid; b) The predetermined number N B A step of exposing the hydrogel microspheres to an aqueous sample and mixing the aqueous sample with the suspension of the hydrogel microspheres, thereby enabling the hydrogel microspheres to take up the aqueous sample and bind the target nucleic acid, preferably all of the target nucleic acid, if present in the aqueous sample; thereby associating with or containing the target nucleic acid contained in the aqueous sample provided in step a), the predetermined number N B This yields at least some hydrogel microspheres; c) Transfer the hydrogel microspheres to a liquid phase immiscible with water and aqueous solutions, such as an oil phase, thereby introducing the predetermined number N into the water-immiscible phase. B A process for generating a suspension of hydrogel microspheres, wherein the hydrogel microspheres are isolated from each other by a liquid phase immiscible with water so that the flow and / or exchange of aqueous samples between different hydrogel microspheres is no longer possible and does not occur; d) A step of performing a nucleic acid amplification protocol on the hydrogel microspheres specific to the target nucleic acid; wherein the nucleic acid amplification protocol results in specific amplification of the target nucleic acid if the target acetate is associated with or included in any of the hydrogel microspheres, and results in the generation of a first optically detectable signal in the hydrogel microspheres if the hydrogel microspheres include or associate with the amplified target nucleic acid; wherein the nucleic acid amplification protocol does not result in amplification of the target nucleic acid and results in the generation of a second optically detectable signal in the hydrogel microspheres if the hydrogel microspheres are not associated with and do not include the amplified target nucleic acid; e) By detecting the first and second optically detectable signals, the number of hydrogel microspheres having the first optically detectable signal (= "positive" hydrogel microspheres) is determined. pos and the number N of hydrogel microspheres having a second optically detectable signal (= "negative" hydrogel microspheres). neg The process of determining the total number of microspheres detected here N = N pos +N neg ; f) The concentration of the target nucleic acid in the aqueous sample c s to formula [Math 3] The process of calculation according to (In the formula, c s = Concentration of target nucleic acid in aqueous sample N B = A predetermined number of hydrogel microspheres exposed to an aqueous sample V S = Volume of aqueous sample containing or suspected to contain the target nucleic acid N neg = Number of hydrogel microspheres with a detected second optically detectable signal (= "negative" hydrogel microspheres) N = Total number of hydrogel microspheres detected = N neg +N pos (In the formula, N pos = Number of hydrogel microspheres with the first optically detectable signal (= "positive" hydrogel microspheres) The method of any of the prior claims, including the method of any of the prior claims.
14. The analyte in the sample according to any one of claims 2 to 13, preferably the concentration c of the target nucleic acid s A default number N used in a method for quantifying B An aqueous suspension of hydrogel microspheres, wherein the aqueous suspension comprises an aqueous solvent and a predetermined number N B An aqueous suspension comprising hydrogel microspheres, wherein the hydrogel microspheres comprise a material capable of binding to an analyte, preferably a material capable of binding to nucleic acids.
15. The predetermined number N of hydrogel microspheres B The aqueous suspension according to claim 14, wherein the range is from 1,000 to 1,000,000, preferably from 5,000 to 500,000, more preferably from 5,000 to 100,000, even more preferably from 5,000 to 50,000, and even more preferably from 5,000 to 20,000.
16. The analyte in the sample according to any one of claims 1 to 13, preferably the concentration c of the target nucleic acid s Macroparticles for use in a method of quantifying, wherein the macroparticles are a matrix and a predetermined number N embedded in the matrix of the macroparticles B A macroparticle comprising hydrogel microspheres, wherein the macroparticles are dried, preferably freeze-dried.
17. The predetermined number N of hydrogel microspheres B The macroparticles according to claim 16, wherein the number of particles is in the range of 1,000 to 1,000,000, preferably in the range of 5,000 to 500,000, more preferably in the range of 5,000 to 100,000, even more preferably in the range of 5,000 to 50,000, and even more preferably in the range of 5,000 to 20,000.
18. The macroparticles according to any one of claims 16 and 17, wherein the matrix includes or consists of a material which is an excipient for a drying process, particularly freeze-drying.
19. The macroparticles according to claim 18, wherein the excipient for drying, particularly freeze-drying, is selected from saccharides such as trehalose, sucrose, mannitol, glucose, fructose, lactose, mannitol, inositol, hydroxypropyl-β-cyclodextrin and combinations thereof; polymers such as polyethylene glycol (PEG), polyvinylpyrrolidone (PVP), dextran, and gelatin; amino acids such as arginine, histidine, and glycine; and any combination thereof.
20. The macroparticles according to any one of claims 16 to 19, wherein the macroparticles are substantially spherical, spherical, droplet-shaped, ellipsoidal, or other circular in shape, and have an average diameter in the range of 1 mm to 50 mm, preferably 2 mm to 20 mm, more preferably 2 mm to 15 mm, even more preferably 2 mm to 10 mm, and even more preferably 2 mm to 5 mm.
21. A method for generating macroparticles according to any one of claims 16 to 20: a) A default number N defined in any of claims 2 to 13 B A step of providing a suspension of hydrogel microspheres, an aqueous solvent, and a matrix material defined in any order, at least one of claims 18 and 19; b) Adding at least one matrix material to the aqueous solvent, thereby dissolving the matrix material in the aqueous solvent, and a predetermined number N of solutions of the matrix material are obtained. B A step of mixing the hydrogel microspheres with the suspension, thereby forming the suspension of the hydrogel microspheres in the aqueous solvent; c) A step of generating droplets of the suspension formed in step b), wherein such droplets have a predetermined size and volume, and dispensing such droplets into a water-immiscible liquid phase, such as an oil phase, at a temperature in the range of -100°C to -10°C, preferably -90°C to -20°C, more preferably -80°C to -30°C; thereby enabling the droplets to be frozen; d) A step of separating the frozen droplets from the water-immiscible liquid phase and drying, preferably freeze-drying, thereby yielding substantially spherical, spherical, droplet-shaped, ellipsoidal, or other circular macroparticles as described in any of claims 16 to 20. Methods that include...
22. The default number N according to any one of claims 14 to 15 B A method for producing an aqueous suspension of hydrogel microspheres: a) Providing macroparticles according to any one of claims 16 to 20, and a step of dissolving such macroparticles in an aqueous solvent; or a * ) A predetermined number N as defined in any one of claims 2 to 13 B A process of providing hydrogel microspheres in a dry form and suspending them in an aqueous solvent. A method that includes this.