Recombinant collagen for skin soothing and repair and uses thereof

Abstract

To provide a recombinant collagen for soothing and repairing skin and application thereof.SOLUTION: A nucleotide sequence for coding the recombinant collagen for soothing and repairing skin comprises a sequence as shown in SEQ ID NO: 1. The amino acid sequence coded by the SEQ ID NO: 1 comprises amino acids at 950-1075 sites of type I collagen, amino acids at 594-729 sites of type III collagen and amino acids at 1193-1199 sites of type III collagen. The recombinant collagen has the effects of moisturizing, supplementing skin collagen, promoting cell proliferation, resisting oxidation, resisting aging, and the like, and has good histocompatibility, skin permeability, and safety.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to the technical field of skin care, specifically to recombinant collagen and its uses for skin soothing and repair. [Background technology]

[0002] When the environment inside and outside the skin cells changes, the skin's defense and repair mechanisms cannot adapt to the changes, causing skin damage and aging due to the accumulation of damage. Studies have shown that radicals are one of the important factors that cause aging in the human body. Various radicals, such as superoxide anion radicals, hydroxyl radicals, and DPPH radicals, exist in the human body, and radicals can cause cell and tissue decomposition and metabolic function decline. In addition to normal metabolism, the concentration of radicals in the human body is also affected by factors such as drought, pollution, exercise level, and mental state. Therefore, skin care products containing antioxidant ingredients can be used to remove excess radicals, delay body degeneration, and inhibit skin aging.

[0003] Schizophyllan is a naturally occurring β-D-glucan from Schizophyllum commune, which consists of a main chain of β-D-pyran type glucose residues with (1-3)-linkage and a side chain of pyran type glucose residues with (1-6)-linkage, and has the ability of oxidation resistance and radiation resistance. Schizophyllan can suppress the generation of radicals by inhibiting the cellular oxidative enzyme system and inducing complexation of oxidized transition metal ions, and exerts the effect of radiation resistance by means of radical scavenging, regulating gene expression, and protein synthesis, and can extend the apoptosis time of cells damaged by radiation and inhibit lipid peroxidation.

[0004] Collagen is a biopolymer and the main component of animal connective tissues. It is also the functional protein with the highest content and widest distribution in the mammalian body, accounting for 25-30% of the total protein. Collagen has good biocompatibility, biodegradability and bioactivity, and is therefore widely used in the fields of food, medicine, tissue engineering, etc. Collagen includes type I collagen molecules, type III collagen molecules, type IV collagen molecules, type XI collagen molecules, etc., and has the effects of moisturizing and hydrating the skin, promoting cell proliferation, and reinforcing the cell barrier.

[0005] CN113057932A discloses a collagen skin care product for improving skin wrinkles. This collagen skin care product for improving skin wrinkles contains, by weight, 5-15 parts of active plants, 10-15 parts of glycerin, 1-2 parts of butylene glycol, 7-13 parts of active additives, 5-10 parts of collagen, and 30-40 parts of deionized water as raw materials, which are prepared by grinding, mixing, foaming stirring, secondary mixing, sterilization, adding collagen, and final mixing. The invention adopts skin care product production equipment during preparation, which improves production and is convenient to collect, and the final skin care product has collagen activity and activity to promote collagen production, which can effectively improve the problem of wrinkles appearing due to skin aging with age.

[0006] CN102670477A discloses a collagen skin care product that has good therapeutic effect, no side effects, and improves skin defects. The skin care product contains, by weight, 10-30 parts of seaweed (high in plant collagen), 10-30 parts of honey, and 1-5 parts of vitamin E.

[0007] Therefore, skin care products with multiple effects such as anti-oxidation, anti-aging, repair and moisturizing activity are available. It has become extremely rewarding to explore compositions to enhance the repair of skin damage from multiple angles. Summary of the Invention [Problem to be solved by the invention]

[0008] In view of the deficiencies of the prior art, the present invention aims to provide a recombinant collagen and its uses, in particular for the soothing and repair of skin. [Means for solving the problem]

[0009] To achieve the objective, the present invention adopts the following technical solutions:

[0010] In a first aspect, the present invention provides a recombinant collagen for skin soothing and repair, wherein a nucleotide sequence encoding the recombinant collagen for skin soothing and repair comprises the sequence shown in SEQ ID NO:1.

[0011] The nucleotide sequence represented by SEQ ID NO:1 is as follows:

[0012] GGGCCTCAAGGTATTGCTGGACAGCGTGGTGTGGTCGGCCTGCCTGGTCAGAGAGGAGAGAGAGGCTTCCCTGGTCTTCCTGGCCCCTCTGGTGAACCTGGCAAACAAGGTCCCTCTGGAGCAAGTGGTGAACGTGGTCCCCCTGGTCCCATGGGCCCCCCTGGATTGGCTGGACCCCCTGGTGAATCTGGACGTGAGGGGGCTCCTGGTGCCGAAGGTTCCCCTGGACGAGACGGTTCTCCTGGCGCCAAGGGTGACCGTGGTGAGACCGGCCCCGCTGGACCCCCTGGTGCTCCTGGTGCTCCTGGTGCCCCTGGCCCCGTTGGCCCTGCTGGCAAGAGTGGTGATCGTGGTGAGACTGGTCCTGCTGGTCCCGCCGGAGAACGAGGTGGCCCTGGAGGACCTGGCCCTCAGGGTCCTCCTGGAAAGAATGGTGAAACTGGACCTCAGGGACCCCCAGGGCCTACTGGGCCTGGTGGTGACAAAGGAGACACAGGACCCCCTGGTCCACAAGGATTACAAGGCTTGCCTGGTACAGGTGGTCCTCCAGGAGAAAATGGAAAACCTGGGGAACCAGGTCCAAAGGGTGATGCCGGTGCACCTGGAGCTCCAGGAGGCAAGGGTGATGCTGGTGCCCCTGGTGAACGTGGACCTCCTGGATTGGCAGGGGCCCCAGGACTTAGAGGTGGAGCTGGTCCCCCTGGTCCCGAAGGAGGAAAGGGTGCTGCTGGTCCTCCTGGGCCACCTGGTGCTGCTGGTACTCCTGGTCTGCAAGGAATGCCTGGACCTGGTCCTTGCTGTGGTGGTTAA

[0013] In the present invention, a novel recombinant collagen sequence is creatively discovered. The nucleotide sequence encoding the recombinant collagen for skin soothing and repairing comprises the sequence shown in SEQ ID NO:1, and the amino acid sequence encoded by SEQ ID NO:1 comprises amino acids 950-1075 of type I collagen, amino acids 594-729 and 1193-1199 of type III collagen. The recombinant collagen has effects such as moisturizing, supplementing collagen to the skin, promoting cell proliferation, anti-oxidation, anti-aging, etc., and also has good tissue compatibility, skin permeability and safety.

[0014] In a second aspect, the present invention provides a method for producing a composition comprising: The present invention provides a composition having a soothing and repairing effect, comprising the recombinant collagen for soothing and repairing skin according to the first aspect and schizophyllan.

[0015] The composition having soothing and repairing effects according to the present invention comprises the recombinant collagen for soothing and repairing the skin described in the first embodiment and schizophyllan, and the two components are used in combination to have a synergistic effect in terms of moisturizing, anti-oxidation, promoting cell proliferation, and improving the repair of skin damage.

[0016] Preferably, the composition having a soothing and restorative effect comprises, in parts by weight: Contains 0.01-0.5 parts of recombinant collagen for skin soothing and repair and 0.1-5 parts of schizophyllan.

[0017] The part by mass of the recombinant collagen for skin soothing and repair can be selected from 0.01 parts, 0.1 parts, 0.2 parts, 0.3 parts, 0.4 parts, 0.5 parts, and the like.

[0018] The part by mass of the schizophyllan can be selected from 0.1 parts, 1 parts, 2 parts, 3 parts, 4 parts, 5 parts, and the like.

[0019] Any specific point value within each of the above numerical ranges can be selected, and the description thereof will be omitted here.

[0020] When the composition having soothing and repairing effects of the present invention contains, by mass, 0.01 to 0.5 parts of recombinant collagen for soothing and repairing the skin and 0.1 to 5 parts of schizophyllan, the repairing effect on skin damage is even better when the two are used in combination.

[0021] Preferably, the soothing and restorative composition further comprises a moisturizer.

[0022] Preferably, the moisturizer includes one or a combination of at least two of glycerin, 1,3-butanediol, sodium hyaluronate, sodium acetylated hyaluronate, hydrolyzed sodium hyaluronate, or ceramide 3. The combination of at least two includes a combination of glycerin and 1,3-butanediol, a combination of 1,3-butanediol and sodium hyaluronate, or a combination of sodium hyaluronate and sodium acetylated hyaluronate, and any other combination form can be selected, and the description thereof will be omitted here.

[0023] Preferably, the humectant is glycerin.

[0024] When the moisturizer of the present invention specifically contains glycerin, the combination of recombinant collagen and schizophyllan for skin soothing and repair can be further used in combination with glycerin to exert a stronger synergistic effect in terms of moisturization.

[0025] Preferably, the composition having a soothing and restorative effect comprises, in parts by weight: The composition comprises 0.01 to 0.5 parts of the recombinant collagen for skin soothing and repair according to the first aspect, 0.1 to 5 parts of schizophyllan, and 5 to 50 parts of glycerin.

[0026] The mass part of the recombinant collagen for skin soothing and repair can be selected from 0.01 parts, 0.1 parts, 0.2 parts, 0.3 parts, 0.4 parts, 0.5 parts, and the like.

[0027] The part by mass of the schizophyllan can be selected from 0.1 parts, 1 parts, 2 parts, 3 parts, 4 parts, 5 parts, and the like.

[0028] The mass part of glycerin can be selected from 5 parts, 10 parts, 15 parts, 20 parts, 25 parts, 30 parts, 35 parts, 40 parts, 45 parts, 50 parts, and the like.

[0029] Any specific point value within each of the above numerical ranges can be selected, and the description thereof will be omitted here.

[0030] Preferably, the method for preparing schizophyllan comprises: The method includes fermenting and culturing Schizophyllum commune in a medium containing kudzu root, removing proteins from the fermentation culture liquid by the Sevag method, and then adding an ethanol solution to precipitate polysaccharides in the fermentation culture liquid, thereby preparing the schizophyllan.

[0031] The schizophyllan according to the present invention is prepared by fermenting Schizophyllum commune in a medium containing kudzu root. The prepared schizophyllan has more significant effects in terms of oxidation resistance, cell repair, moisturizing, and immune regulation. Therefore, when schizophyllan prepared by adding kudzu root to a medium is used to prepare a composition having the sedative and repairing effects, it further enhances the oxidation resistance, repair, and moisturizing effects of the composition.

[0032] In a third aspect, the present invention provides a covering having a soothing and restorative effect, the covering having a soothing and restorative effect comprising: The composition includes a microcapsule material and the composition having a soothing and restorative effect according to the second embodiment, which is coated inside the microcapsule material.

[0033] The coating having soothing and repairing effects according to the present invention is obtained by coating the outside of the composition having soothing and repairing effects described in the second embodiment with a microcapsule material. After coating, the composition having soothing and repairing effects has a stronger penetrating effect, and when applied to skin tissue, the effects of moisturizing, oxidation resistance, soothing and repairing effects that have already been exerted are further reinforced.

[0034] Preferably, the microencapsulation material comprises a polyglyceryl nonionic surfactant.

[0035] Preferably, the polyglyceryl nonionic surfactant comprises one or a combination of at least two of polyglycerin-10 diisostearate, polyglycerin-10 laurate, or polyglycerin-10 oleate. The combination of at least two includes a combination of polyglycerin-10 diisostearate and polyglycerin-10 laurate, a combination of polyglycerin-10 laurate or polyglycerin-10 oleate, or a combination of polyglycerin-10 diisostearate and polyglycerin-10 oleate, and any other combination form may be selected, and will not be described here.

[0036] In a fourth aspect, the present invention provides a method for preparing a soothing and restorative coating according to the third aspect, said method comprising the steps of: (1) mixing a polyglyceryl nonionic surfactant with the soothing and restorative composition according to the second aspect; and step (2) of subjecting the mixture prepared in step (1) to a coating-assisted process to prepare the coating having the soothing and repairing effect, the coating-assisted process including a high-voltage pulsed electric field-assisted process and / or an ultrasonic-assisted process.

[0037] The method for preparing a coating having soothing and healing effects according to the present invention can be prepared by simply mixing the active ingredient with the microcapsule material under the action of coating-assisted processing. This method has a simple preparation process and is easy to scale up industrially.

[0038] Preferably, the coating assisted treatment in step (2) is a high voltage pulsed electric field assisted treatment.

[0039] Preferably, the high-voltage pulse electric field assisted treatment has an electric field strength of 0.5 to 2 kV / cm, a number of pulse treatments of 10 to 60, and a material conductivity of 2000 to 6000 μS / cm.

[0040] A specific value of the 0.5 to 2 kV / cm range may be selected from 0.5 kV / cm, 0.7 kV / cm, 0.9 kV / cm, 1.1 kV / cm, 1.3 kV / cm, 1.5 kV / cm, 1.7 kV / cm, 1.9 kV / cm, 2 kV / cm, etc.

[0041] A specific value of the 10 to 60 numbers may be selected from 10, 20, 30, 40, 50, 60, and the like.

[0042] A specific value of the 2000 to 6000 μS / cm may be selected from 2000 μS / cm, 3000 μS / cm, 4000 μS / cm, 5000 μS / cm, 6000 μS / cm, and the like.

[0043] Any specific point value within each of the above numerical ranges can be selected, and the description thereof will be omitted here.

[0044] In a fifth aspect, the present invention provides the use of a recombinant collagen as defined in the first aspect, a composition having soothing and restorative effects as defined in the second aspect or a coating having soothing and restorative effects as defined in the third aspect in the preparation of a skin care product. Effect of the Invention

[0045] Compared with the prior art, the present invention has the following beneficial effects:

[0046] 1. In the present invention, the nucleotide sequence encoding the recombinant collagen for skin soothing and repairing comprises the sequence shown in SEQ ID NO:1, and the amino acid sequence encoded by SEQ ID NO:1 comprises type I collagen amino acids 950 to 1075, type III collagen amino acids 594 to 729 and 1193 to 1199. The recombinant collagen has effects such as moisturizing, collagen supplementation for skin, promotion of cell proliferation, oxidation resistance, and anti-aging, and also has good tissue compatibility, skin permeability and safety.

[0047] 2. The composition having soothing and repairing effects according to the present invention comprises the recombinant collagen for soothing and repairing the skin described in the first embodiment and schizophyllan, and the two components are used in combination to have a synergistic effect in terms of moisturizing, anti-oxidation, promoting cell proliferation, and repairing skin damage.

[0048] 3. The coating having soothing and repairing effects according to the present invention is obtained by coating the outside of the composition having soothing and repairing effects described in the second embodiment with a microcapsule material. After coating, the composition having soothing and repairing effects has a stronger penetrating effect, and when applied to skin tissue, the effects of moisturizing, oxidation resistance, soothing and repairing effects that have already been exerted are further reinforced.

[0049] 4. The method for preparing a coating having soothing and healing effects according to the present invention can be prepared by simply mixing the active ingredient with the microcapsule material under the action of coating-assisted processing, and the preparation process of this method is simple, facilitating industrial expansion. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0050] The technical solution of the present invention will be further described below by means of specific embodiments. Those skilled in the art should understand that such examples are merely for understanding the present invention, and should not be regarded as specifically limiting the present invention.

[0051] In the present invention, the implementation process, conditions, reagents, test methods, etc. are all common knowledge and common general knowledge in this field, except for those intentionally mentioned below, and are not particularly limited. For the test methods in each example where no specific conditions are specified, they are usually in accordance with conventional conditions or conditions recommended by the manufacturer.

[0052] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In case of conflict, however, the present invention, including definitions, will control.

[0053] The pET-28a(+) vector in the following test was purchased from MACKLIN. Schizophyllum commune is Schizophyllum commune GIM 5.43 strain purchased from Guangdong Provincial Institute of Microbiology. BL21(DE3) chemically competent cells were purchased from MERCK, with the model number CMC0014-4X40UL.

[0054] [Preparation Example 1] This preparation example provides a recombinant collagen freeze-dried powder for skin soothing and repair. The preparation method of the recombinant collagen freeze-dried powder for skin soothing and repair includes the following steps:

[0055] (1) Construction of recombinant plasmid: According to the nucleotide sequence shown in SEQ ID NO:1 above, the pET-28a(+) vector was selected for the E. coli host as the expression carrier, and sent to a sequencing company for synthesis to prepare the recombinant collagen expression vector pET-28a-1.

[0056] (2) Construction of recombinant fermentation strain: The pET-28a-1 expression vector was transformed into E. coli (BL21(DE3)) competent cells by chemical transformation. After transformation, a single positive clone was selected from the plate colony by agarose gel electrophoresis, and the selected single positive clone was transferred to 2 mL of LB medium and cultured at 37°C and 200 rpm for 12 hours. The cultured bacterial solution was diluted 1-fold with 50% glycerol by volume, dispensed into cryopreservation tubes, and frozen and stored at -80°C to prepare a recombinant collagen fermentation strain.

[0057] (3) Fermentation culture of recombinant fermentation strain: 10μL of LB recombinant collagen fermentation culture was applied to a solid LB plate and cultured in an incubator at 37℃ for 12h, after which a monoclone was selected and inoculated into 50mL of LB liquid medium containing 50μg / mL kanamycin, placed on a shaker and cultured at 37℃ and 200rpm for 14h. Then, inoculated into 200mL of LB liquid medium containing 50μg / mL kanamycin at a ratio of 1:100, cultured at 37℃ until the OD of the culture reached 0.6, then added IPTG to a final concentration of 1mM and continued to culture for 4h. Then, centrifuged at 4℃ and 4000rpm for 15min to collect the cells.

[0058] (4) Purification of recombinant collagen: The bacterial cells were ultrasonically crushed and then centrifuged. The precipitate was washed with TritonX-100 washing solution, and centrifuged again to remove the supernatant. 6M guanidine hydrochloride was added to the precipitate, the pH was adjusted to 8, and the precipitate was fully dissolved. The solution was then passed through a nickel affinity chromatography resin and eluted sequentially using imidazole solutions with a concentration gradient of 20mM, 50mM, 100mM, 200mM, and 500mM. The eluate was concentrated using a protein concentration column, and the concentrate was collected and dialyzed overnight (dialysis bag, RC membrane, 14KD, flat width 44mm (Seiko F600112)). The protein concentration was then detected using a BCA kit, and the mixture was uniformly mixed with an aqueous mannitol solution at a volume concentration of 5% per 5mg of protein at a ratio of 0.5mL. The mixture was then freeze-dried to remove the protein. The recombinant collagen lyophilized powder was prepared by pre-freezing at -40°C for 10 min and finally lyophilization at -35°C.

[0059] [Preparation Example 2] This preparation example provides schizophyllan. The method for preparing the schizophyllan is as follows.

[0060] (1) Preparation of Schizophyllum commune fermentation product: Schizophyllum commune was inoculated into the fermentation medium with 5% bacterial inoculum and fermented at 28°C and 160 rpm. After fermentation for 120 h, the fermentation product was centrifuged to remove the fungus and kudzu root powder to obtain the fermentation product. The fermentation medium consisted of 0.6% kudzu root powder, 0.3% yeast extract, 0.05% magnesium sulfate, 0.1% potassium dihydrogen phosphate, 3% glucose, and the remaining amount was water.

[0061] (2) Preparation of schizophyllan: The fermentation product was diluted by adding an equal volume of distilled water. After dilution, 0.5% volume fraction of activated carbon was added, and the mixture was decolorized in a water bath at 80°C for 40 minutes, centrifuged, and the filtrate was sieved through a 400 mesh sieve to remove the activated carbon, obtaining a clear and transparent fermentation liquid. Proteins were eluted from the fermentation liquid five times by the Sevag method. Polysaccharides in the fermentation liquid were then precipitated with three volumes of 95% ethanol. After washing, distilled water was added to redissolve the product, and the mixture was dialyzed against running water and distilled water for 24 hours. The dialyzate was concentrated and freeze-dried to prepare the schizophyllan.

[0062] [Preparation Example 3] This preparation example provides schizophyllan. The preparation method of said schizophyllan is different from Preparation Example 2 only in that the fermentation medium does not contain pueraria root powder, and the other operations are all the same as Preparation Example 2.

[0063] [Example 1] This embodiment provides a coating having a soothing and restorative effect, and the method for preparing the coating is as follows:

[0064] (1) 1 part of polyglycerin-10 diisostearate, 0.5 parts of polyglycerin-10 laurate, 0.2 parts of the recombinant collagen prepared in Preparation Example 1, 0.3 parts of schizophyllan prepared in Preparation Example 2, and 15 parts of glycerin were mixed and water was added until the total volume reached 100 parts.

[0065] (2) The mixed solution was subjected to high-voltage pulse electric field assisted treatment. The parameters were electric field strength of 0.5 kV / cm, the number of pulse treatments was 10, and the material conductivity was 2000 μS / cm. After the treatment, a coating with the soothing and repairing effects was obtained.

[0066] [Example 2] This embodiment provides a coating having a soothing and restorative effect, and the method for preparing the coating is as follows:

[0067] (1) 1 part of polyglycerin-10 diisostearate, 0.5 parts of polyglycerin-10 laurate, 0.01 parts of the recombinant collagen prepared in Preparation Example 1, 5 parts of schizophyllan prepared in Preparation Example 2, and 50 parts of glycerin were mixed, and water was added until the total volume reached 100 parts.

[0068] (2) A high-voltage pulsed electric field assisted treatment was performed on the mixed solution. The parameters were: electric field strength 0.5 kV / cm, number of pulse treatments 20, and material conductivity 600. After the treatment, a coating having the above-mentioned soothing and repairing effects was obtained.

[0069] [Example 3] This embodiment provides a coating having a soothing and restorative effect, and the method for preparing the coating is as follows:

[0070] (1) 1 part of polyglycerin-10 diisostearate, 0.5 parts of polyglycerin-10 laurate, 0.5 parts of the recombinant collagen prepared in Preparation Example 1, 0.1 parts of schizophyllan prepared in Preparation Example 2, and 5 parts of glycerin were mixed, and water was added until the total volume reached 100 parts.

[0071] (2) The mixed solution was subjected to high-voltage pulse electric field assisted treatment. The parameters were electric field strength of 2 kV / cm, the number of pulse treatments was 60, and the conductivity of the material was 2000 μS / cm. After the treatment, a coating with the soothing and repairing effects was obtained.

[0072] [Example 4] This example provides a coating having a soothing and repairing effect. The preparation method of the coating is different from that of Example 1 only in that the preparation raw material does not contain glycerin, and the mass parts of glycerin are allocated to recombinant collagen and schizophyllan in a ratio, but the other operations are all the same as those of Example 1.

[0073] [Example 5] This example provides a coating having soothing and restorative effects. The preparation method of the coating is different from that of Example 1 only in that the schizophyllan prepared in Preparation Example 2 is replaced with the schizophyllan prepared in Preparation Example 3, and the other operations are all the same as those of Example 1.

[0074] [Example 6] This example provides a coating having soothing and repairing effects. The preparation method of the coating is different from that of Example 1 only in that 0.2 parts of the recombinant collagen prepared in Preparation Example 1 and 0.3 parts of the schizophyllan prepared in Preparation Example 2 are replaced with 0.5 parts of a mixture of recombinant collagen and schizophyllan (the ratio of recombinant collagen to schizophyllan in the mixture is 0.01:5.1), and all other operations are the same as those of Example 1.

[0075] [Example 7] This example provides a coating having soothing and repairing effects. The preparation method of the coating is different from that of Example 1 only in that 0.2 parts of the recombinant collagen prepared in Preparation Example 1 and 0.3 parts of the schizophyllan prepared in Preparation Example 2 are replaced with 0.5 parts of a mixture of recombinant collagen and schizophyllan (the ratio of recombinant collagen to schizophyllan in the mixture is 0.6:0.05), and all other operations are the same as those of Example 1.

[0076] [Comparative Example 1] This comparative example provides a coating having a soothing and repairing effect. The preparation method of the coating is different from that of Example 1 only in that the preparation raw material does not contain recombinant collagen and the mass part of recombinant collagen is allocated to schizophyllan, but the other operations are all the same as those of Example 1.

[0077] [Comparative Example 2] This comparative example provides a coating having a soothing and repairing effect. The preparation method of the coating is different from that of Example 1 only in that the preparation raw material does not contain schizophyllan and the mass part of schizophyllan is allocated to recombinant collagen, but the other operations are all the same as those of Example 1.

[0078] [Comparative Example 3] This comparative example provides a coating having a soothing and repairing effect. The preparation method of the coating is different from that of Example 1 only in that the preparation raw materials do not contain schizophyllan and recombinant collagen, and the parts by mass of schizophyllan and recombinant collagen are allocated to glycerin, but all other operations are the same as those of Example 1.

[0079] [Test Example 1] In this test example, the oxidation resistance of the coating having the soothing and repairing effect of each of the Examples and Comparative Examples was evaluated. The specific evaluation method was as follows.

[0080] The oxidation resistance of the examples and comparative examples was evaluated using the DPPH scavenging efficiency. The specific evaluation method is as follows. 0.5 g of the coated body was immersed in 4 mL of DPPH (100 μM, in 99 wt% ethanol) solution (a solution containing only DPPH was used as a control group) and incubated in the dark for 60 min. The absorbance value of the mixed solution at 517 nm was then measured using a UV-Vis spectrophotometer. The DPPH scavenging rate was calculated using the formula: DPPH scavenging rate = (absorbance of control group - absorbance of test group) / absorbance of control group x 100%, and the results are shown in Table 1.

[0081] [Table 1]

[0082] As can be seen from the data in Table 1, in comparison with Example 1, Comparative Example 1 and Comparative Example 2 lack one of the recombinant collagen and schizophyllan in the preparation raw materials, respectively, and the DPPH scavenging rate is lower than that of Example 1, so it was found that the two components, schizophyllan and recombinant collagen, work together to have an unexpected synergistic effect in scavenging DPPH. In Example 5, in comparison with Example 1, kudzu root powder is included in the fermentation medium, and the DPPH scavenging rate is lower than that of Example 1, so it was found that the addition of kudzu root powder reinforces the oxidation resistance performance of the schizophyllan product. In Examples 6 and 7, in comparison with Example 1, the ratio of recombinant collagen to schizophyllan by mass part is not within the range of (0.01-0.5):(0.1-5), and the DPPH scavenging rate is lower than that of Example 1, so it was found that the recombinant collagen It was found that when the mass ratio of gen and schizophyllan is in the range of (0.01-0.5):(0.1-5), the oxidation resistance performance is enhanced by using these two components in combination.

[0083] [Test Example 2] In this test example, the moisturizing effect of the covering having soothing and repairing effects of each of the Examples and Comparative Examples was evaluated. The specific evaluation method was as follows.

[0084] 100 volunteers aged 18-40 years with healthy skin were selected, half of whom were male and half were randomly divided into 10 groups, and the coverings having soothing and repairing effects according to the examples and comparative examples were used. After the volunteers washed their arms, they evenly applied the coverings to a test area of ​​2 cm in diameter on the inside of their arms at a dose of 2 mg / cm, and used them once a day for 30 consecutive days. The skin moisture content of the volunteers was measured before and after use using a skin test device (MC750, CK, Germany).

[0085] The skin moisture content of each subject was measured before use and after 30 days of continuous use. Each data point was measured three times, and the average value for each group was calculated. The rate of change in skin moisture content was calculated according to the formula: rate of change in skin moisture content = (skin moisture content after 30 days of use - skin moisture content before use) / skin moisture content before use x 100%, and the measurement results are shown in Table 2.

[0086] [Table 2]

[0087] As can be seen from the data in Table 2, in comparison with Example 1, Comparative Examples 1 and 2 lacked recombinant collagen and a type of schizophyllan in the preparation raw materials, respectively, and the rate of change in skin moisture content was lower than that of Example 1, demonstrating that the combination of the two components, schizophyllan and recombinant collagen, can reinforce the moisturizing effect of the coating. In comparison with Example 1, in Examples 4 and 3, the preparation raw materials for the coating having the soothing and repairing effects lacked glycerin or a combination of recombinant collagen and schizophyllan, respectively, and the rate of change in skin moisture content was both lower than that of Example 1, demonstrating that the combination of glycerin, recombinant It has been found that the combination of collagen, schizophyllan, and the like has an unexpected synergistic effect in improving skin moisturizing properties.

[0088] [Test Example 3] In this test example, the cell proliferation effect of the recombinant collagen of Preparation Example 1 and the coatings having soothing and repairing effects of the Examples and Comparative Examples was evaluated. The specific evaluation method was as follows.

[0089] HaCaT cells (human immortalized keratinocytes) in good growth state were taken, seeded on a 96-well plate and cultured for 17 h, then replaced with serum-free basic medium, and cultured for 7 h, after which the old medium was discarded and a medium containing 1% recombinant collagen aqueous solution or the coated body solution prepared in each Example or Comparative Example (the concentration of coated body in the medium is 2 μg / mL) was added. The blank was the same as the test group except that the medium did not contain coated body. After culturing for 48 h, the cell viability was detected by the CCK8 method (630 nm was used as the reference wavelength, and the absorbance value was measured at a wavelength of 450 nm), and measurements were performed three times per data, and the average value of each group was calculated. The relative cell proliferation rate was calculated according to the formula: relative cell proliferation rate = (absorbance of test group - absorbance of blank) / blank absorbance x 100%.

[0090] [Table 3]

[0091] As can be seen from the data in Table 3, the recombinant collagen of Preparation Example 1 has an excellent cell proliferation promoting effect. In addition, in Comparative Example 1 and Comparative Example 2, compared with Example 1, the preparation raw materials lack one of recombinant collagen and schizophyllan, respectively, and the relative cell proliferation rate is lower than that of Example 1, so it was found that the two components schizophyllan and recombinant collagen work together to have an unexpected synergistic effect in terms of promoting cell proliferation. In Example 5, compared with Example 1, the fermentation medium contains kudzu root powder, and the relative cell proliferation rate is lower than that of Example 1, so it was found that the addition of kudzu root powder reinforces the cell proliferation promoting ability of schizophyllan.

[0092] [Test Example 4] In this test example, the skin soothing and repair properties of the coverings having soothing and repair effects of each of the Examples and Comparative Examples were evaluated. The specific evaluation method was as follows.

[0093] (1) Sixty-six guinea pigs were taken, half of which were male and half of which were female. One day before the test, the hair on the right hind leg was shaved so that the hairless area was approximately 2 cm 2 The guinea pigs were randomly divided into 11 groups, each containing 6 guinea pigs, and were designated as Example groups 1 to 7, Comparative examples groups 1 to 3, and blank, respectively.

[0094] (2) For the guinea pigs in the Example groups 1 to 7, the Comparative Examples groups 1 to 3, and the blank, 0.05 g of the coating solution prepared in each of the Examples or Comparative Examples was applied to the hair-removed areas once per day for 2 consecutive days, and an equal amount of deionized water was applied to the blanks.

[0095] (3) On the third day of the test, 0.01% (w / v), 0.02% (w / v), 0.03% (w / v), 0.04% (w / v), 0.05% (w / v), 0.06% (w / v), 0.07% (w / v), 0.08% (w / v), 0.09% (w / v) and 0.1% (w / v) histamine phosphate solutions were prepared in saline. The depilated area on the sole of the right hind paw of each guinea pig was abraded with coarse sandpaper until the abrasion area was approximately 1 cm. 2 In addition, the corresponding coating solution was applied locally once, with the application amount being 0.05 g. For the blank, an equal amount of deionized water was applied, and 10 min later, 0.05 mL of 0.01% (w / v) histamine phosphate solution was dripped onto the scratched area. It was observed whether the guinea pig turned around and licked its right hind paw within 3 min. If it did not, 0.05 mL of 0.02% (w / v) histamine phosphate solution was dripped onto the scratched area, and it was observed whether the guinea pig turned around and licked its right hind paw within 3 min. In this way, the concentration was increased according to the above gradient every 3 min, and 0.05 mL of histamine phosphate solution was dripped onto the scratched area each time, until the guinea pig licked its right hind paw within 3 min. The cumulative total amount of histamine phosphate dripped at this time was taken as the itch threshold (μg), and the average itch threshold of the guinea pigs in the same group and the difference rate of the itch threshold were calculated. The difference rate of the itch threshold = (itch threshold of the test group - itch threshold of the blank) / itch threshold of the blank x 100%, and the results are shown in Table 4.

[0096] [Table 4]

[0097] As can be seen from the data in Table 4, the higher the itching threshold, the stronger the corresponding skin barrier action, i.e., the soothing and repairing ability of the cover solution. In Example 4 and Comparative Example 3, compared with Example 1, the preparation raw materials for the cover having the soothing and repairing effect lacked glycerin or a combination of recombinant collagen and schizophyllan, respectively, and the difference rates of the itching threshold were all lower than those of Example 1, indicating that the combination of glycerin, recombinant collagen, and schizophyllan has an unexpected synergistic effect in terms of skin soothing and repair. In Comparative Example 1 and Comparative Example 2, compared with Example 1, the preparation raw materials lacked one of recombinant collagen and schizophyllan, respectively, and the difference rates of the itching threshold were all lower than those of Example 1, indicating that the combination of the two components, schizophyllan and recombinant collagen, can improve the anti-itch and repairing effect of the cover. In Example 5, compared to Example 1, the fermentation medium contains kudzu root powder, and the difference rate of the itching threshold is lower than that of Example 1, which indicates that the addition of kudzu root powder can improve the oxidation resistance of the schizophyllan product and improve the barrier function of the skin.In Examples 6 and 7, compared to Example 1, the ratio of parts by mass of recombinant collagen to schizophyllan is not in the range of (0.01-0.5):(0.1-5), and the difference rate of the itching threshold is lower than that of Example 1, which indicates that when the ratio of parts by mass of recombinant collagen to schizophyllan is in the range of (0.01-0.5):(0.1-5), the use of the two components in combination provides a stronger skin soothing and repairing function.

[0098] [Test Example 5] The coating with soothing and repairing effects prepared in the examples was subjected to a safety evaluation. The specific evaluation method is as follows. The test was conducted according to the human skin patch test method in the human safety detection method in Chapter 7 of the 2015 edition of the Cosmetics Safety Technical Standards. (1) Female volunteers aged 18 to 60 years who met the test requirements were selected, with the exclusion criteria being: (a) those who had used antihistamines in the last week or immunosuppressants within the last month, (b) those who had used any anti-inflammatory drugs on the test site within the last two months, (c) subjects suffering from inflammatory skin diseases that were not clinically cured, and (d) those who had insulin-dependent diabetes mellitus. (e) patients with asthma or other chronic respiratory diseases being treated, (f) those who have received anti-cancer chemotherapy within the last 6 months, (g) patients with immunodeficiency or autoimmune diseases, (h) women who are breastfeeding or pregnant, (i) those who have had both breasts removed and both axillary lymph nodes removed, (n) those who judge that the test results are affected by scars, pigmentation, atrophy, erythema or other defects in the test area of ​​the skin, (o) those who have participated in other clinical trial studies, (p) those with extremely sensitive constitutions, (q) non-volunteers or those who cannot complete the prescribed content according to the test requirements. (2) There is one group for each example, and each group has 10 volunteers, with an area of ​​50 mm 2 A qualified patch test device with a depth of about 1 mm was selected, and the coating solution prepared in each example was put into the cell of the patch test device, with the amount used being about 0.025 g. Nothing was put into the control well as a blank. The low sensitizing tape for the patch test device to which the test sample was added was attached to the back or forearm of the subject, and was lightly pressed with the palm of the hand to make it evenly attached to the skin, and was maintained for 24 hours. (3) After removing the test sample patch test device, the skin reaction was observed 30 minutes (after the indentation disappeared), 24 hours and 48 hours according to the standards shown in Table 5. Evaluation was performed according to the standards shown in Table 5.

[0099] [Table 5]

[0100] As can be seen from the results, the product prepared according to the present invention was safe, non-irritating and had higher use value.

[0101] The present invention has been described by the above examples to illustrate the preparation process of the present invention, but the applicant declares that the present invention is not limited to the above examples, that is, the present invention must not be carried out by the above examples. It is clear to those skilled in the art that any improvements to the present invention, equivalent replacement of each raw material of the product of the present invention, addition of auxiliary components, selection of specific embodiments, etc., are all within the protection scope and disclosure scope of the present invention.

[0102] Although the preferred embodiment of the present invention has been described in detail above, the present invention is not limited to the specific details of the above embodiment. Within the technical concept of the present invention, a number of simple modifications can be made to the technical solution of the present invention, and all of these simple modifications are covered by the present invention. It belongs to the scope of protection.

[0103] It should be noted that the specific technical features described in the above specific embodiments can be combined in any suitable manner unless they are contradictory, and in order to avoid unnecessary repetition, the present invention does not separately describe various possible combinations.

Claims

1. A composition for use in soothing and repairing skin, comprising recombinant collagen and schizophyllan, The nucleotide sequence encoding the recombinant collagen for skin soothing and repair is SEQ ID NO: The sequence shown in ID NO: 1 A composition having a soothing and restorative effect.

2. The composition having a soothing and restorative effect comprises: 0.01 to 0.5 parts of recombinant collagen for skin soothing and repair, and 0.1 to 5 parts of schizophyllan. A composition having a soothing and restorative effect according to claim 1.

3. The soothing and restorative composition further comprises a moisturizer. A composition having a soothing and restorative effect according to claim 1.

4. The moisturizing agent includes any one or a combination of at least two of glycerin, 1,3-butanediol, sodium hyaluronate, sodium acetylated hyaluronate, hydrolyzed sodium hyaluronate, or ceramide 3. A composition having a soothing and restorative effect according to claim 3.

5. The moisturizer is glycerin. A composition having a soothing and restorative effect as claimed in claim 4.

6. The soothing and restorative composition comprises, in parts by weight: A skin soothing and repairing composition, comprising 0.01 to 0.5 parts of recombinant collagen, 0.1 to 5 parts of schizophyllan, and 5 to 50 parts of glycerin. A composition having a soothing and restorative effect according to claim 1.

7. The method for preparing schizophyllan comprises the steps of: The method includes fermenting Schizophyllum commune in a medium containing kudzu root, removing proteins from the fermentation culture liquid by the Sevag method, adding an ethanol solution to precipitate polysaccharides in the fermentation culture liquid, and centrifuging the mixture to prepare the schizophyllan. A composition having a soothing and restorative effect according to claim 1.

8. A composition having a soothing and restorative effect according to any one of claims 1 to 7, comprising a microcapsule material and a composition having a soothing and restorative effect according to any one of claims 1 to 7, A coating having a soothing and restorative effect.

9. The preparation raw material of the microencapsulation material includes a polyglyceryl nonionic surfactant; 9. The soothing and restorative covering according to claim 8.

10. The polyglyceryl nonionic surfactant includes any one or a combination of at least two of polyglycerin-10 diisostearate, polyglycerin-10 laurate, or polyglycerin-10 oleate.

10. The soothing and restorative covering according to claim 9.

11. (1) mixing a polyglyceryl nonionic surfactant with a soothing and restorative composition according to any one of claims 1 to 7; Step (2) of subjecting the mixture prepared in step (1) to a coating-assisted treatment to prepare the coating having the soothing and repairing effect, the coating-assisted treatment including a high-voltage pulsed electric field-assisted treatment and / or an ultrasonic-assisted treatment; 9. A method for preparing a coating having a soothing and restorative effect according to claim 8.

12. The coating assisted process according to step (2) is a high voltage pulse electric field assisted process; A method for preparing a coating having a soothing and restorative effect according to claim 11.

13. The high voltage pulse electric field assisted treatment has an electric field strength of 0.5-2 kV / cm, a pulse treatment number of 10-60, and a material conductivity of 2000-6000 μS / cm; A method for preparing a coating having a soothing and restorative effect according to claim 11.

14. Use of a composition having soothing and restorative effects as described in claim 1 in the preparation of a skin care product.

15. Use of the coating having soothing and repairing effects described in claim 8 in the preparation of a skin care product.

Images