Non-human animal model for retinal vascular disease, method for producing same, and method for screening drug for treating or preventing retinal vascular disease

Abstract

To provide a non-human animal model of a retinal vascular disease capable of satisfactorily giving a symptom similar to the human retinal vascular disease such as the human diabetic retinopathy and other and its making method, particularly, provide the non-human animal model suitable for establishment of a treatment, prevention and diagnosis method to the retinal edema becoming the factors of high visual disorder and its making method, and furthermore, provide a screening method of a medical agent for treatment and prevention of the retinal vascular disease using the non-human animal model.SOLUTION: A non-human animal model of a retinal vascular disease is provided that expresses a constant activation type Akt, a making method of the non-human animal model of the retinal vascular disease is provided that expresses the constant activation type Akt, and a screening method of the medical agent for the treatment or prevention of the retinal vascular disease is provided that uses the non-human animal model of the retinal vascular disease expressing the constant activation type Akt.SELECTED DRAWING: Figure 1

Description

[Technical field]

[0001] The present invention relates to a non-human animal model for retinal vascular disease, such as diabetic retinopathy, a method for producing a non-human animal model for retinal vascular disease, and a method for screening a drug for treating or preventing retinal vascular disease. This relates to a method for [Background technology]

[0002] Retinal vascular disease is a general term for eye diseases caused by pathological changes in at least some of the blood vessels of the retina, such as bleeding, exudation, aneurysm, edema, ischemia, infarction, etc. Representative cases of retinal vascular disease include diabetic retinopathy, retinopathy of prematurity, and retinal vein occlusion, and also includes Coats' disease, etc.

[0003] Chronic complications seen in diabetes are caused by microvascular disorders such as arterioles and capillaries, leading to retinopathy, nephropathy, and neuropathy. In particular, diabetic retinopathy is a disease caused by microvascular disorders of the retina due to sustained hyperglycemic conditions, and can lead to blindness in middle age. A meta-study based on 35 studies from around the world that reported on the prevalence of diabetic retinopathy reported that one in three diabetic patients has some kind of retinopathy, and one in eight to nine has retinopathy that is at risk of threatening vision.

[0004] Risk factors for retinal vein occlusion include high blood pressure and arteriosclerosis, and it is a relatively common disease with a prevalence of 2% in people over 40. Although it rarely leads to blindness, it can cause reduced vision accompanied by distortion of vision and significantly reduce the quality of vision.

[0005] Retinopathy of prematurity is the leading cause of childhood blindness, with over 50,000 people believed to be blind worldwide. In Japan, it is the leading cause of blindness in schools for the blind, and the number of severe cases is increasing with improvements in neonatal medical care.

[0006] In retinal vascular diseases such as diabetic retinopathy, retinal ischemia due to vascular occlusion and retinal edema due to increased vascular permeability are the causes of visual impairment. The ischemic retina becomes hypoxic and produces vascular endothelial growth factor (hereinafter abbreviated as "VEGF"), which induces angiogenesis, but pathological neovessels are formed by escaping from the retina, so this does not lead to improvement of ischemia. Furthermore, neovessels are fragile and easily bleed, and in addition, contraction of the membranous tissue around the blood vessels causes retinal detachment and blindness. On the other hand, retinal edema occurs due to increased vascular permeability caused by vascular dilation and vascular aneurysms secondary to retinal vascular occlusion and inflammation, resulting in retinal edema. Although retinal edema does not cause blindness, it shows a severe decrease in visual acuity, and if it continues for a long time, photoreceptors and retinal nerve cells will undergo irreversible degeneration, and visual acuity will not be restored even if the edema is resolved.

[0007] As treatments for ischemia (and subsequent intraocular hemorrhage and retinal detachment) in retinal vascular disease, surgical treatments such as photocoagulation and vitreous surgery, and drug treatments such as anti-VEGF drugs that inhibit VEGF protein are known. These treatments aim to inhibit pathological angiogenesis in retinal ischemia and do not improve ischemia, but they have been shown to be effective in stopping the progression and preventing blindness. On the other hand, treatments for retinal edema are centered on anti-VEGF drugs, which have been approved in recent years. The inhibitory effect of anti-VEGF drugs on increased permeability is temporary, and recurrences occur repeatedly, so very expensive drugs must be administered continuously into the eye. Considering that the number of people with diabetic maculopathy in Japan is approximately 1.1 million, further increases in medical costs are inevitable in the future. In addition, the effect of improving vision is not sufficient, and the development of new therapeutic drugs is required.

[0008] In diabetic nephropathy, persistent hyperglycemic conditions harden the small blood vessels in the glomeruli, leading to impaired renal function. In advanced cases, an ischemic state accelerates kidney hardening, leading to renal failure. Treatment of diabetic nephropathy focuses on strict control of blood sugar and blood pressure, and treatment with angiotensin-converting enzyme inhibitors and angiotensin II receptor blockers has been shown to be somewhat effective, but does not cure diabetic nephropathy permanently. When renal failure is reached, treatment is switched to dialysis.

[0009] Attempts have been made to use non-human disease model animals in the development of treatments, prevention methods, and diagnostic methods for diseases, and in the analysis of pathology, etc. For example, it has been reported that spontaneously developing diabetic model animals, genetically modified model animals, and model animals in which disease is induced by drugs, etc. have been produced as non-human diabetic model animals. In addition, a non-human model animal has been reported in which retinal ischemia is artificially induced by hyperoxia to form abnormal neovascularization (Non-Patent Document 1). [Prior art documents] [Non-patent literature]

[0010] [Non-Patent Document 1] LE Smith et al., “Oxygen-induced retinopathy in the mouse”, Investigative Ophthalmology & Visual Science January 1994, Vol.35, 101-111 Summary of the Invention [Problem to be solved by the invention]

[0011] There are no established methods for treating or preventing retinal vascular diseases, including diabetic retinopathy, and diabetic nephropathy, and the establishment of such methods is an urgent issue. One of the reasons why it is difficult to establish effective methods for treating and preventing these diseases is the lack of suitable non-human model animals. Non-human model animals reported to date do not exhibit symptoms similar to those of human retinal vascular diseases, including human diabetic retinopathy, or human diabetic nephropathy. In particular, there have been no reports of non-human model animals for the type of retinal vascular disease that causes retinal edema due to increased vascular permeability.

[0012] Therefore, the present invention aims to provide a non-human model animal of retinal vascular disease that can effectively exhibit symptoms similar to those of human retinal vascular disease, including human diabetic retinopathy, and a method for producing the same. That is, the present invention aims to provide a non-human model animal of retinal vascular disease that can be used to develop treatments, preventions, and diagnostic methods for retinal vascular disease, and to elucidate the onset mechanism and pathology of retinal vascular disease, and a method for producing the same. In particular, the present invention aims to provide a non-human model animal that is suitable for establishing treatments, preventions, and diagnostic methods for retinal edema, which is a cause of severe visual impairment, and a method for producing the same. Furthermore, the present invention aims to provide a method for screening drugs for treating and preventing retinal vascular disease using the non-human model animal. [Means for solving the problem]

[0013] As a result of extensive research aimed at solving the above problems, the present inventors focused on the Akt protein, a serine / threonine kinase, in order to induce symptoms similar to those of human retinal vascular disease in non-human animals. By continuously activating Akt in developing retinal blood vessels, enlargement of blood vessel diameter accompanied by aneurysmal changes, delayed blood vessel elongation, and enhanced vascular permeability were observed. Based on these findings, the present inventors succeeded in producing a non-human model animal exhibiting symptoms similar to those of human retinal vascular disease, and thus completed the present invention.

[0014] That is, in order to achieve the above object, the present invention provides the following configurations and methods [1] to

[10] .

[0015] [1] A non-human animal model of retinal vascular disease that expresses constitutively activated Akt. [2] The non-human animal model of retinal vascular disease according to [1] above, wherein the constitutively activated Akt is constitutively activated Akt-Mer. [3] The non-human animal model of retinal vascular disease according to [1] above, wherein the constitutively activated Akt is a constitutively activated Akt whose expression is under the control of the Cre-LoxP system. [4] The non-human animal model of retinal vascular disease according to any one of [1] to [3] above, wherein the retinal vascular disease is diabetic retinopathy. [5] The retinal vascular disease according to any one of [1] to [4], wherein the retinal vascular disease exhibits at least one symptom selected from retinal edema, retinal hemorrhage, retinal capillary aneurysm, and retinal vascular dilation. Non-human animal models of disease.

[0016] According to the above configurations [1] to [5], a non-human model animal of retinal vascular disease exhibiting symptoms similar to those of human retinal vascular disease, including human diabetic retinopathy, can be provided. The non-human model animal of retinal vascular disease of this configuration has retinal hemorrhage and microaneurysm structures similar to those of pathological specimens of human diabetic retinopathy, and can provide a non-human model animal capable of reproducing symptoms of retinal edema due to increased vascular permeability, for which there is currently no effective treatment. Therefore, the non-human model animal of retinal vascular disease of this configuration can be suitably used as a research material for searching for treatments, prevention methods, and diagnostic methods for retinal vascular disease, and for analyzing pathology. Furthermore, since the severity of the non-human model animal of retinal vascular disease of this configuration can be controlled, treatments, prevention methods, and diagnostic methods according to the progression of symptoms can be searched for, and the non-human model animal of retinal vascular disease of this configuration can be suitably used as a research material for analyzing pathology, such as onset and progression.

[0017] In particular, according to the above configurations [2] and [3], the Akt activity of the constitutively active Akt can be controlled by 4-hydroxytamoxifen and Cre recombinase, respectively. Therefore, a non-human model animal exhibiting symptoms similar to those of a desired human retinal vascular disease can be provided by simple artificial manipulation. Since the severity of retinal vascular disease can be controlled, a non-human model animal of retinal vascular disease can be provided that can be particularly suitably used as a research material for searching for treatments, preventions, and diagnostic methods according to the progression of symptoms, and for analyzing pathologies such as onset and progression. In addition, according to the above configuration [4], a non-human model animal can be provided that can be particularly suitably used as a research material for searching for treatments, preventions, and diagnostic methods for diabetic retinopathy, and for analyzing pathologies. According to the above configuration [5], a non-human model animal exhibiting symptoms specific to retinal vascular disease can be provided. In particular, a non-human model animal that can reproduce the symptoms of retinal edema due to increased vascular permeability, for which there is currently no effective treatment, can be provided.

[0018] [6] A method for producing a non-human animal model of retinal vascular disease, comprising: A step of producing a transgenic non-human animal into which a construct containing DNA encoding a constitutively active Akt has been introduced so that Akt activity can be controlled by artificial manipulation; Inducing a retinal vascular disease by controlling the Akt activity of the constitutively activated Akt; The present invention relates to a method for producing a non-human animal model of retinal vascular disease, comprising the steps of: [7] The method for producing a non-human model animal of retinal vascular disease according to [6] above, wherein the constitutively activated Akt is constitutively activated Akt-Mer, and the Akt activity of the constitutively activated Akt is controlled by administering 4-hydroxytamoxifen to the transgenic non-human animal. [8] The method for producing a non-human animal model of retinal vascular disease according to [7] above, comprising administering 5 to 50 μg / g body weight / day of 4-hydroxytamoxifen during any period from 1 to 14 days after birth. [9] The constitutively activated Akt is a constitutively activated Akt whose expression is under the control of the Cre-LoxP system; The transgenic non-human animal is produced by introducing a construct in which DNA encoding the constitutively activated Akt is arranged in a state in which expression of the constitutively activated Akt is inhibited by the intervention of a LoxP sequence, The method for producing a non-human model animal of retinal vascular disease according to [6] above, wherein the Akt activity of the constitutively activated Akt is controlled by mating the transgenic non-human animal with a transgenic non-human animal that expresses Cre recombinase in a vascular-specific or time-specific manner, and obtaining offspring that can express or induce activity of Cre recombinase in a vascular-specific or time-specific manner in cells containing the construct.

[0019] According to the above methods [6] to [8], a non-human model animal exhibiting symptoms similar to those of human retinal vascular disease, including human diabetic retinopathy, can be produced. The non-human model animal produced by this method has retinal hemorrhage and microaneurysm structures similar to those of pathological specimens of human diabetic retinopathy, and in particular, can reproduce the symptoms of retinal edema due to increased vascular permeability, for which there is currently no effective treatment. In addition, the non-human model animal of retinal vascular disease produced by this method can exhibit symptoms of human retinal vascular disease in an extremely short time by controlling the Akt activity of constitutively activated Akt. Therefore, this method can be suitably used in the fields of searching for treatments, prevention methods, and diagnostic methods for retinal vascular disease, and analyzing pathology. Furthermore, since the severity of the non-human model animal produced by this method can be controlled by artificially manipulating the state of Akt activity in constitutively activated Akt, it can be very suitably used as a research material for searching for treatments, prevention methods, and diagnostic methods according to the progression of symptoms, and analyzing pathology, especially the onset and progression processes.

[0020] In particular, according to the above methods [7] to [9], the Akt activity of constitutively active Akt can be controlled by 4-hydroxytamoxifen and Cre recombinase, respectively. Therefore, a non-human model animal exhibiting symptoms similar to those of a desired human retinal vascular disease can be produced by simple artificial manipulation. In addition, since the severity of retinal vascular disease can be controlled, the method can be particularly suitably used as a research material for searching for treatments, prevention methods, and diagnostic methods according to the progression of symptoms, and for analyzing pathological conditions such as the onset and progression of the disease.

[0021]

[10] A method for screening a drug for treating or preventing a retinal vascular disease, comprising: A step of administering a test substance to a non-human animal model of retinal vascular disease according to any one of [1] to [5] above; A method for screening a drug for treating or preventing a retinal vascular disease, comprising a step of determining the therapeutic or preventive effect of the test substance.

[0022] According to the method of

[10] above, a screening method for therapeutic and preventive drugs for retinal vascular disease using a non-human model animal exhibiting symptoms similar to those of human retinal vascular disease can be provided. Since a non-human model animal exhibiting symptoms similar to those of human retinal vascular disease is used, the therapeutic and preventive effects of the test substance can be determined with high reliability. In addition, since the severity of retinal vascular disease can be controlled by controlling the Akt activity of constitutively active Akt, therapeutic and preventive drugs according to symptoms can be developed. Furthermore, it can be suitably used for the development of therapeutic and preventive drugs for retinal vascular disease that causes retinal edema due to increased vascular permeability, for which there is currently no effective treatment. Therefore, this screening method is expected to make a significant contribution to the development of therapeutic and preventive technologies for retinal vascular disease. [Brief description of the drawings]

[0023] [Figure 1] FIG. 1 is a schematic diagram showing the construction of a transgenic non-human animal expressing a constitutively active Akt-Mer, as examined in Example 1. [Diagram 2]FIG. 2 is a schematic diagram showing the construction of a constitutively active Akt-Mer expression vector examined in Example 1. [Diagram 3] 1 is a Western blot showing the results of confirming Akt activity in the retina examined in Example 2. [Figure 4] 1 shows optical microscope images of the retina, illustrating the results of the effect of sustained Akt activation on the retina examined in Example 3. [Diagram 5] 1 shows whole-mount immunostained images of the retina, illustrating the results of the effect of sustained Akt activation on retinal neovascularization examined in Example 4. [Figure 6] FIG. 5 is an enlarged view of FIG. 5 showing whole-mount immunostained images of the retina, illustrating the effect of sustained activation of Akt on the morphology of retinal capillaries examined in Example 4. [Figure 7] 1 shows graphs of the measurement results of blood vessel elongation (mm), arterial diameter (μm), and venous diameter (μm), illustrating the effect of sustained Akt activation on retinal capillary shape examined in Example 4. [Figure 8] 13 shows retinal whole-mount immunostaining images showing the results of the effect of sustained activation (hypoactivation) of Akt on retinal capillary morphology examined in Example 5. [Figure 9] 13 is a graph showing the results of measuring the number of microaneurysms per retina, illustrating the effect of sustained activation (hypoactivation) of Akt on the shape of retinal capillaries examined in Example 5. [Figure 10] 1 shows retinal whole-mount immunostained images showing the effect of sustained (hypo) activation of Akt on retinal capillary morphology examined in Example 5, and a comparison with a pathological specimen of human diabetic retinopathy. [Figure 11] 13 shows stereomicroscope images of the retina, illustrating the results of the effect of sustained activation of Akt on retinal vascular permeability examined in Example 6. [Figure 12] 13 is a graph showing the results of measuring the fluorescence intensity of Evans Blue leaked from retinal blood vessels, illustrating the effect of sustained Akt activation on retinal vascular permeability examined in Example 6. [Figure 13]13 shows microscopic images of the retina, illustrating the results of the effect of sustained activation of Akt on the retinal surface, examined in Example 7. [Figure 14] 13 shows whole-mount immunostained images of retina, showing the results of the causal analysis (vascular endothelial cells and astrocytes) of vascular morphological abnormalities caused by sustained activation of Akt examined in Example 8. [Figure 15] 1 shows a Western blot and a graph showing the results of an analysis of factors (VEGF expression level) causing vascular morphological abnormalities due to sustained activation of Akt, examined in Example 9. [Figure 16] 13 shows whole-mount immunostained images of the retina, showing the results of the effect of long-term sustained activation of Akt on the retina, examined in Example 10. [Figure 17] 13 shows whole-mount immunostained images of the retina, showing the results of the effects of the activity and duration of sustained Akt activation on the retina, examined in Example 11. [Figure 18] 13 is a graph showing the results of measuring the number of microaneurysms per retina, illustrating the effects of the degree and duration of sustained Akt activation on the retina examined in Example 11. [Figure 19] 13 is a whole mount immunostained image of the retina after drug administration, showing the results of the use in screening of drugs for the treatment or prevention of retinal vascular disease, as examined in Example 12. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0024] Hereinafter, embodiments of the present invention will be described in detail. However, the present invention is not limited to the embodiments described below.

[0025] [Non-human animal models] (Non-human animal model of retinal vascular disease) The non-human animal model according to the present embodiment relates to a non-human animal model of retinal vascular disease that exhibits the pathology of retinal vascular disease. The non-human animal model of retinal vascular disease according to the present embodiment expresses constitutively activated Akt.

[0026] In the non-human animal model of retinal vascular disease according to the present embodiment, the animal is a mammal other than human, and the species is not particularly limited. For example, rodents such as mice, guinea pigs, hamsters, and rats, rabbits, dogs, cats, monkeys, sheep, pigs, cows, and horses can be mentioned, and preferably mice.

[0027] In the non-human animal model of retinal vascular disease according to the present embodiment, retinal vascular disease is a general term for eye diseases caused by pathological changes in retinal blood vessels, such as bleeding, exudation, aneurysm, edema, ischemia, and infarction, which occur in at least some blood vessels of the retina. Representative cases of retinal vascular disease include diabetic retinopathy, retinopathy of prematurity, and retinal vein occlusion, and also include Coats' disease. The non-human animal model of retinal vascular disease according to the present embodiment is intended to cover any of these conditions.

[0028] Diabetic retinopathy is one of the complications of diabetes, and is a disease caused by retinal microvascular disorder due to sustained hyperglycemic state. Diabetic retinopathy can be classified into three stages, for example, simple retinopathy, preproliferative retinopathy, and proliferative retinopathy, depending on the severity, and which stage is the subject of the non-human animal model of retinal vascular disease according to the present embodiment. In simple retinopathy, the walls of microvascular vessels are damaged, resulting in capillary aneurysms and punctate retinal hemorrhages. In detail, in the retinal microvascular vessels, the degeneration of vascular endothelial cells, the shedding and degeneration of pericytes, and the thickening of the basement membrane weaken the walls of the vessels, which leads to the formation of microvascular aneurysms and their rupture, resulting in punctate hemorrhages. In preproliferative retinopathy, a part of the microvascular vessels is blocked, resulting in an ischemic area. In proliferative retinopathy, new blood vessels appear to compensate for the ischemic state of the retina, and the new blood vessels extend to the surface of the retina and the vitreous body. Because new blood vessels are immature, they are fragile and easily rupture, causing bleeding, and also the formation of a fibrous proliferative membrane called proliferative tissue, which pulls on the surrounding retina and causes retinal detachment. Regardless of the severity, increased capillary permeability due to the formation of retinal capillary aneurysms etc. causes plasma components to accumulate in the retina, resulting in retinal edema.

[0029] Retinal vein occlusion is a disease caused by the blockage of the retinal vein, and includes central retinal vein occlusion caused by the blockage of the central retinal vein and branch retinal vein occlusion caused by the blockage of a vein on the peripheral side of the central retinal vein, and both are the subjects of the non-human animal model of retinal vascular disease according to this embodiment. In the early stage of onset, retinal hemorrhage and edema occur due to an increase in venous perfusion pressure and stagnation of blood flow. In the chronic stage, the peripheral capillaries of the blocked vein become dilated, tortuous, and aneurysms are formed, and retinal edema persists. When the vein is severely blocked, retinal ischemia is observed, and pathological neovascularization is induced as in other retinal vascular diseases, progressing to retinal detachment.

[0030] Retinopathy of prematurity is a disease caused by the immaturity of retinal blood vessels seen in low birth weight infants and premature infants born at less than 37 weeks of gestation. It is classified into type I, which progresses slowly, and type II, which progresses rapidly. Type I is classified into five stages according to severity. The non-human model animal of retinal vascular disease according to this embodiment is applicable to both. Type I is classified into five stages according to severity, and in the first stage, a tissue called a border is formed at the tip of the blood vessel in the process of elongating from the optic disc to the periphery, and in the second stage, vascular proliferation with fibrous components occurs and the thickness of the border increases. In the third stage, the fibrovascular proliferation tissue protrudes and elongates toward the vitreous side. In the fourth and fifth stages, the contraction of the increased fibrovascular proliferation tissue on the vitreous side pulls the surrounding retina and causes retinal detachment. In all stages, the expansion of retinal veins and tortuosity of arteries are considered to be signs of deterioration. In type II, the expansion and tortuosity of retinal blood vessels are remarkable, and retinal detachment occurs rapidly without gradual progression.

[0031] Fundus findings of such retinal vascular diseases include, for example, capillary microaneurysms, localized hemorrhages such as retinal dots, patches, and stripes, hard exudates, retinal edema, retinal thickening, soft exudates, venous abnormalities, intraretinal microvascular abnormalities, retinal and supra-papillary neovascularization, preretinal and vitreous hemorrhage, fibrovascular proliferative membranes, and retinal detachment.

[0032] The non-human animal model of retinal vascular disease according to this embodiment exhibits one or more of the above symptoms. For example, the non-human animal model of retinal vascular disease according to this embodiment can be confirmed by a stereomicroscope or a fluorescent microscope for retinal edema, retinal hemorrhage, retinal capillary aneurysm, and retinal vascular dilation. Preferably, retinal vascular abnormalities can be confirmed as fluorescent microscopic images of vascular endothelial cells stained by immunostaining or the like. For example, it is characterized by the formation of 50 or more, particularly preferably 80 or more, microaneurysms per retina, and a vascular diameter that is 1.5 times, particularly preferably 2 times, or more than normal retinal blood vessels. In addition, it is preferable to confirm retinal edema, etc. by measuring pigment extravasation or retinal thickness. For example, it is characterized by a retinal thickness that is 1.2 times, particularly preferably 1.5 times, or more than normal retinal thickness.

[0033] Akt, also known as protein kinase B, is a serine / threonine kinase having a PH (Plekstrin Homology) domain at the N-terminus, and is known as an important intracellular signal transduction factor. Akt is activated in a PI3 kinase-dependent manner and phosphorylates various intracellular substrates. The present inventors have reported a technique for maintaining the pluripotency of stem cells and differentiating them as desired by controlling Akt activity (kinase activity) (see JP 2005-304487 A).

[0034] Akt is ubiquitous in all higher animal cells. For example, Akt is a conserved protein from yeast to nematodes, Drosophila, and mammals (for yeast, see Fabrizio P. et al., Science 2001 Apr 13:292(5515):288-290. Epub 2001 Apr 05; for nematodes, see Paradis S. et al., Genes Dev. 1998 Aug 15:12(16):2488-98; for Drosophila, see Staveley BE. et al., Curr. Biol. 1998 May 7:8(10):599-602). In addition, mammalian Akt is ubiquitously expressed in various tissues (see Altomare DA et al., Oncogene 11:1055-1060, Altomare, DA et al., Oncogene 116:2407-2411, Brodbeck D. et al., J. Biol. Chem. 274:9133-9136, Nakatani K. et al., Biochem. Biophys. Res. Commun. 257:906-910).

[0035] The constitutively activated Akt expressed in the non-human animal model of retinal vascular disease according to the present embodiment is not particularly limited as long as the Akt activity is constitutively activated. The constitutively activated Akt may be derived from any higher animal. The constitutively activated Akt may be derived from the same species as the non-human animal to which it is introduced or may be derived from a different species. Preferably, it is derived from human.

[0036] There are three known isoforms of human Akt, Akt-1, Akt-2, and Akt-3, and the homology of their amino acid sequences is very high. Examples of wild-type human Akt include human wild-type Akt-1 (Accession No. AH011307 or NM_001014432) encoded by the nucleotide sequence shown in SEQ ID NO: 3 or SEQ ID NO: 5 and consisting of the amino acid sequence shown in SEQ ID NO: 4 or SEQ ID NO: 6. Examples of wild-type human Akt include human wild-type Akt-2 (Accession No. NM_001626) encoded by the nucleotide sequence shown in SEQ ID NO: 7 and consisting of the amino acid sequence shown in SEQ ID NO: 8, and human wild-type Akt-3 (Accession No. NM_181690) encoded by the nucleotide sequence shown in SEQ ID NO: 9 and consisting of the amino acid sequence shown in SEQ ID NO: 10. However, Akt is not limited to this, and includes an amino acid sequence that has at least a certain percentage of sequence identity to the above-mentioned amino acid sequence, or an amino acid sequence that has at least one modification such as deletion, substitution, or addition of one or several amino acids in the above-mentioned amino acid sequence, and has the properties of Akt described above.

[0037] Activation of Akt-1 requires phosphorylation at two sites, threonine at position 308 (Thr-308) and serine at position 473 (Ser-473), activation of Akt-2 requires phosphorylation at two sites, threonine at position 309 (Thr-309) and serine at position 474 (Ser-474), and activation of Akt-3 requires phosphorylation at two sites, threonine at position 305 (Thr-305) and serine at position 472 (Ser-472). Phosphorylation in these Akt family members is controlled downstream of PI3 kinase. In detail, Akt is translocated to the cell membrane when the PH domain of Akt binds to PI(3,4,5)P3 etc. produced by PI3 kinase. In the vicinity of the cell membrane, Akt is activated by phosphorylation at the above-mentioned sites by PDK1 and the mTORC2 complex.

[0038] Constitutively active Akt includes those phosphorylated at the above-mentioned activation-related sites, such as wild-type human Akt-1 constitutively phosphorylated at Thr-308 and Ser-473, wild-type human Akt-2 constitutively phosphorylated at Thr-309 and Ser-474, and wild-type Akt-3 constitutively phosphorylated at Thr-305 and Ser-472. In Akt-1, the amino acid residues to be phosphorylated are preferably the Thr residue at position 308 and the Ser residue at position 473 when SEQ ID NO: 4 or SEQ ID NO: 6 is used as a reference sequence, and the same applies to the amino acid residues to be phosphorylated in Akt-2 and Akt-3.

[0039] Examples of the constitutively activated Akt include Akt having a membrane localization signal sequence added to the N-terminus or C-terminus. Preferred examples of the constitutively activated Akt include Akt having a deleted N-terminal PH domain and a myristination signal added to the N-terminus instead of the wild-type Akt, and Akt having a myristination signal added to the N-terminus of the wild-type Akt. The myristination signal causes Akt to be constitutively membrane-bound and constitutively phosphorylated by a kinase present in the cell membrane, resulting in an activated state of Akt activity (kinase activity). The myristination signal sequence preferably contains a Met-Gly-Xaa-Xaa-Xaa-Ser / Ala / Thr / Phe-Xaa-Xaa-Xaa motif (Xaa is any amino acid) (SEQ ID NO: 11) from the N-terminus (see Utsumi T. et al., The Journal of Biological Chemistry 276(13):10505-10513, etc.). Examples of myristination signal sequences that can be used include, but are not limited to, the N-terminal myristination signal sequences derived from c-Src (MGSSKSKPKDPSQR (SEQ ID NO: 12) and MGSSKSKPKDPSQRRRRIRT (SEQ ID NO: 13)).

[0040] Furthermore, it may be a constitutively active Akt mutant such as a mutant in which glutamic acid at position 40 (Glu-40) of wild-type human Akt-1 is replaced with lysine (Lys) (hereinafter, sometimes abbreviated as "E40K-Akt-1") or a mutant in which glutamic acid at position 17 (Glu-17) of wild-type human Akt-1 is replaced with lysine (Lys) (hereinafter, sometimes abbreviated as "E17K-Akt-1"). Similarly, wild-type human Akt-2 and wild-type human Akt-3 having the above-mentioned substitutions E40K and E17K can also be included in the Akt mutant. Such mutants can be obtained by screening nature or by using gene cloning techniques. For example, they can be obtained by using known mutagenesis techniques, and can be performed by inserting a mutation site into a nucleic acid molecule encoding wild-type Akt. There is no particular limitation on the method for inserting a mutation site, and a mutagenesis technique for producing mutant proteins known in the art can be used. For example, known techniques for introducing mutations, such as site-directed mutagenesis, PCR mutagenesis in which mutations are introduced using PCR or the like, or transposon insertion mutagenesis, may be used. Alternatively, a commercially available mutagenesis kit (e.g., QuikChange (registered trademark) Site-directed Mutagenesis Kit (Stratagene)) may be used.

[0041] In Akt-1, the amino acid residues to be substituted are preferably the Glu residue at the position corresponding to position 40 and the Glu residue at the position corresponding to position 17 when SEQ ID NO: 4 or SEQ ID NO: 6 is used as the reference sequence. The substitution positions can be determined based on the alignment of the amino acid sequence of Akt-1 having a different sequence with the amino acid sequence of Akt-1 disclosed in SEQ ID NO: 4 or SEQ ID NO: 6. The amino acid residues to be substituted in Akt-2 and Akt-3 can be determined in the same manner using SEQ ID NO: 8 and SEQ ID NO: 10 as the reference sequences. Therefore, the constitutively activated Akt mutant also includes an amino acid sequence having at least a certain degree of sequence identity with the above-mentioned amino acid sequence, as long as the amino acid substitution occurs at the above-mentioned substitution position, or an amino acid sequence having at least one modification such as deletion, substitution, or addition of one or several amino acids in the above-mentioned amino acid sequence, and having the above-mentioned properties of the constitutively activated Akt.

[0042] The constitutively activated Akt includes, for example, a protein encoded by a nucleic acid molecule consisting of the base sequence shown in SEQ ID NO: 1, the amino acid sequence of which is shown in SEQ ID NO: 2. However, the constitutively activated Akt is not limited thereto, and also includes an amino acid sequence having at least a certain degree of sequence identity with the amino acid sequence shown in SEQ ID NO: 2, or an amino acid sequence having at least one modification such as deletion, substitution, or addition of one or several amino acids in the amino acid sequence shown in SEQ ID NO: 2, and having the above-mentioned properties of the constitutively activated Akt.

[0043] Here, at least a certain percentage of sequence identity preferably means retaining 70, 75, 80, or 85% or more sequence identity, more preferably 90% or more sequence identity, and particularly preferably 95, 96, 97, 98, or 99% or more sequence identity.

[0044] Such variants can be obtained by screening nature or by using gene cloning techniques. In addition, when modifying an amino acid sequence, a person skilled in the art can easily predict modifications that maintain the above-mentioned properties. Specifically, for example, in the case of amino acid substitution, an amino acid can be substituted with an amino acid that has similar properties to the amino acid before substitution in terms of polarity, charge, hydrophilicity, or hydrophobicity from the viewpoint of maintaining the protein structure. Such substitutions are well known to those skilled in the art as conservative substitutions. Specific examples include alanine, valine, leucine, isoleucine, proline, methionine, phenylalanine, and tryptophan, which are all classified as nonpolar amino acids and therefore have similar properties to each other. In addition, examples of uncharged amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. In addition, examples of acidic amino acids include aspartic acid and glutamic acid. In addition, examples of basic amino acids include lysine, arginine, and histidine. Amino acid substitutions within each of these groups are acceptable as they maintain the function of the protein.

[0045] The constitutively activated Akt expressed in the non-human animal model of retinal vascular disease according to the present embodiment is preferably one whose Akt kinase activity can be controlled by artificial manipulation. Examples of the constitutively activated Akt whose Akt activity can be controlled by artificial manipulation include, for example, a fusion protein in which the constitutively activated Akt and a protein whose Akt activity can be regulated by an ex vivo stimulus are linked in frame, a constitutively activated Akt is co-expressed with a protein whose Akt activity can be regulated by an ex vivo stimulus, and a constitutively activated Akt is encoded by a DNA containing a sequence that can freely control the expression of the constitutively activated Akt-encoding DNA by the action of a site-specific recombinant protein or the like, but are not limited thereto. The constitutively activated Akt is preferably an activated Akt-Mer described later, and a constitutively activated Akt whose expression is under the control of the Cre-LoxP system.

[0046] Constitutively active Akt-Mer, an example of constitutively active Akt, is a fusion protein in which constitutively active Akt and modified estrogen receptor (Mer) are linked in frame, but also includes a fusion protein in which a tag sequence is inserted between constitutively active Akt and Mer. Examples of tag sequences include, but are not limited to, HA, which utilizes the peptide sequence of the glycoprotein hemagglutinin present on the surface of influenza viruses.

[0047] Mer is a modified estrogen receptor that does not bind to endogenous estrogen but binds to 4-hydroxytamoxifen (hereinafter abbreviated as "4-OHT"), an artificially synthesized estrogen derivative. In the absence of 4-OHT, Mer is bound to heat shock protein (hereinafter abbreviated as "Hsp") 90, and the active site of Mer is masked by Hsp90, making it inactive. However, in the presence of 4-OHT, the masking by Hsp is released, and constitutively active Akt is activated. In this way, by linking Mer, the Akt activity of constitutively active Akt can be freely controlled by 4-OHT.

[0048] An example of Mer is one encoded by the nucleotide sequence of SEQ ID NO: 14, the amino acid sequence of which is shown in SEQ ID NO: 15. However, Mer is not limited thereto, and also includes a protein having an amino acid sequence having at least a certain percentage of sequence identity to the amino acid sequence shown in SEQ ID NO: 15, or an amino acid sequence having at least one modification such as deletion, substitution, or addition of one or several amino acids in the amino acid sequence shown in SEQ ID NO: 15, and having the properties of Mer. Here, at least a certain percentage of sequence identity means maintaining preferably 70, 75, 85, or 80% or more sequence identity, more preferably 90% or more sequence identity, and particularly preferably 95, 96, 97, 98, or 99% or more sequence identity.

[0049] By configuring in this manner, the non-human model animal of retinal vascular disease of this embodiment expresses constitutively active Akt-Mer, and the Akt activity of constitutively active Akt becomes activated in the presence of 4-OHT, thereby exhibiting symptoms similar to those of the human retinal vascular disease described above.

[0050] As an example of the constitutively activated Akt, the expression of which is under the control of the Cre-LoxP system, for example, there may be mentioned a DNA encoding the constitutively activated Akt, in which a Cre recognition sequence such as a LoxP sequence is arranged in the same direction or in the opposite direction upstream and downstream of the DNA encoding the constitutively activated Akt. Further, there may be mentioned a DNA encoding the constitutively activated Akt, in which a Cre recognition sequence such as a LoxP sequence is arranged in the same direction with a transcription termination sequence or the like sandwiched therebetween, a promoter sequence is arranged upstream of the sequence, and a DNA encoding the constitutively activated Akt is arranged downstream of the sequence.

[0051] The DNA encoding the constitutively activated Akt is not particularly limited as long as it is a DNA encoding a constitutively activated Akt having the above-mentioned properties. For example, there is a DNA having a base sequence shown in SEQ ID NO: 1 encoding a constitutively activated Akt in which the PH domain of wild-type Akt is deleted and a myristination signal is added to the N-terminus instead, and a DNA encoding the amino acid sequence shown in SEQ ID NO: 2, which is the amino acid sequence of the constitutively activated Akt. However, there is no limitation thereto, and the DNA encoding the constitutively activated Akt includes a base sequence having at least a certain degree of sequence identity with the base sequence shown in SEQ ID NO: 1, a base sequence having at least one modification such as deletion, substitution, or addition of one or several bases in the base sequence shown in SEQ ID NO: 1, or a base sequence having a base sequence that hybridizes under stringent conditions to a base sequence complementary to the base sequence shown in SEQ ID NO: 1, as long as it encodes a protein having the above-mentioned properties of the activated Akt.

[0052] Here, at least a certain percentage of sequence identity preferably means retaining 70, 75, 85, or 85% or more sequence identity, more preferably 90% or more sequence identity, and particularly preferably 95, 96, 97, 98, or 99% or more sequence identity.

[0053] Furthermore, stringent conditions include, for example, the following hybridization and washing conditions. Hybridization conditions Hybridization overnight (16 hours or more) at 65°C in hybridization solution (100 mM Tris-HCl pH 8.0, 1 M NaCl, 10 mM EDTA, 0.2 mM bovine serum albumin, 0.2% Ficoll 400, 0.2% polyvinylpyrrolidone, 100 μg / ml salmon sperm DNA). Washing conditions Wash twice with washing solution (0.2×SSC (6.67 mM NaCl, 6.67 mM trisodium citrate dihydrate pH 7.0, 0.1% SDS)) at 65° C. for 30 minutes.

[0054] The Cre / LoxP system is a site-specific recombination reaction system that occurs when bacteriophage P1 Cre recombinase (hereinafter abbreviated as "Cre") acts on a specific DNA sequence called the LoxP sequence described above. Here, Cre is a site-specific DNA recombinase enzyme that is a member of the phage λ integrase family.

[0055] An example of the LoxP sequence is ataacttcgtataatgtatgctatacgaagttat (SEQ ID NO: 16). The sequence shown in SEQ ID NO: 16, which is an example of the LoxP sequence, consists of 34 bp, has 13 bp inverted repeats (Cre binding domains) at both ends, and has an 8 bp region between them. In order for the recognition by Cre and the site-specific homologous recombination reaction described below to occur, it is considered sufficient that 8 to 10 bases in each of the 13 bp Cre binding domains in the LoxP sequence match those in the sequence shown in SEQ ID NO: 16. In addition, the 8 bp region sandwiched between the Cre binding domains is also required to have at least a certain percentage of sequence identity with the sequence shown in SEQ ID NO: 16.

[0056] Therefore, the LoxP sequence is not limited to the sequence shown in SEQ ID NO: 16, but may be any sequence in which at least 8 to 10 bases match in the 13 bp at both ends of the base sequence shown in SEQ ID NO: 16, and the 8 bp region between the Cre binding domains has at least a certain degree of sequence identity, or in which one or several bases are deleted or substituted in the base sequence shown in SEQ ID NO: 16. or those having at least one additional modification, as long as they have the properties of the LoxP sequence described below. Here, "at least a certain percentage of sequence identity" preferably means that the sequence identity is 70, 80, or 90% or more.

[0057] When two LoxP sequences are positioned side by side in the same direction, they are recognized by Cre, and the sequence between the LoxP sequences is excised. On the other hand, when they are positioned side by side in the opposite direction, they are recognized by Cre, and the sequence between the LoxP sequences is inverted with respect to the sequence outside the LoxP sequences. In other words, Cre is an enzyme that recognizes a LoxP sequence, catalyzes the excision of the sequence between the LoxP sequences when the two LoxP sequences are positioned in the same direction, and catalyzes the reaction of inverting the sequence between the LoxP sequences when the two LoxP sequences are positioned in the opposite direction. An example of Cre is one encoded by the base sequence of SEQ ID NO: 17, and its amino acid sequence is shown in SEQ ID NO: 18. However, Cre is not limited thereto, and includes a protein having an amino acid sequence having at least a certain percentage of sequence identity with the amino acid sequence shown in SEQ ID NO: 18, or an amino acid sequence having at least one modification such as deletion, substitution, or addition of one or several amino acids in the amino acid sequence shown in SEQ ID NO: 18, and having the properties of Cre. Here, at least a certain percentage of sequence identity preferably means retaining 70, 75, 85, or 85% or more sequence identity, more preferably 90% or more sequence identity, and particularly preferably 95, 96, 97, 98, or 99% or more sequence identity.

[0058] By configuring in this way, the non-human model animal of retinal vascular disease according to this embodiment can control the Akt activity of the constitutively activated Akt by utilizing the site-specific recombination reaction by the Cre / LoxP system, and the constitutively activated Akt is activated, thereby exhibiting the above-mentioned symptoms of retinal vascular disease. Specifically, when two LoxP sequences are arranged in the same direction, the base sequence encoding the constitutively activated Akt arranged in the order is maintained in an activated state in the absence of Cre, and in the presence of Cre, the base sequence encoding the constitutively activated Akt is excised and the constitutively activated Akt is in an inactive state. On the other hand, when two LoxP sequences are arranged in the opposite direction, the base sequence encoding the constitutively activated Akt is arranged in an inverted position, so that the constitutively activated Akt is maintained in an inactive state in the absence of Cre, and in the presence of Cre, the base sequence encoding the constitutively activated Akt is inverted and the constitutively activated Akt is maintained in an activated state.

[0059] In addition, as an example of constitutively activated Akt, the expression of which is under the control of the Cre-LoxP system, a constitutively activated Akt is preferably encoded by arranging LoxP sequences in the same direction upstream and downstream of a base sequence that suppresses the expression of DNA encoding constitutively activated Akt, such as a transcription termination sequence, a promoter sequence that induces constitutive expression of DNA encoding constitutively activated Akt upstream of the upstream LoxP sequence, and DNA encoding constitutively activated Akt downstream of the downstream LoxP sequence. By arranging in this manner, the base sequence that suppresses the expression of DNA encoding constitutively activated Akt is excised by recognition of the LoxP sequence by Cre, and the DNA encoding constitutively activated Akt is placed under the control of the promoter sequence. As a result, the DNA encoding constitutively activated Akt is expressed, and constitutively activated Akt is maintained in an activated state, and the non-human model animal of retinal vascular disease according to this embodiment exhibits the above-mentioned symptoms of retinal vascular disease.

[0060] Furthermore, in addition to the Cre / LoxP system, other site-specific DNA recombinases such as the Flp / FRT system or Rox / Dre system can also be used in combination with other site-specific DNA recombinase recognition sequences.

[0061] The non-human animal model of retinal vascular disease of this embodiment exhibits symptoms similar to those of human retinal vascular disease, including human diabetic retinopathy. The structure of retinal hemorrhage and microaneurysm is similar to that of pathological specimens of human diabetic retinopathy, and in particular, a non-human animal model can be provided that can reproduce the symptoms of retinal edema due to increased vascular permeability, for which there is currently no effective treatment. Therefore, the non-human animal model of retinal vascular disease of this embodiment can be suitably used as a research material for exploring treatments, prevention methods, and diagnostic methods for retinal vascular disease, and analyzing pathology, etc. Furthermore, since the non-human animal model of retinal vascular disease of this embodiment can control the severity, it is possible to explore treatments, prevention methods, and diagnostic methods according to the progression of symptoms, and in particular, it can be suitably used as a research material for analyzing pathology, such as the onset process and progression process.

[0062] (Non-human animal model of diabetic nephropathy) The non-human animal model according to the present embodiment relates to a non-human animal model of diabetic nephropathy that exhibits symptoms of diabetic nephropathy. The non-human animal model of diabetic nephropathy according to the present embodiment expresses constitutively activated Akt.

[0063] Diabetic nephropathy is a complication of diabetes and is a disease caused by microvascular damage in the glomeruli of the kidney due to persistent hyperglycemic conditions. Sustained hyperglycemic conditions cause sclerosing lesions in the capillaries that make up the glomeruli, which then become destroyed or blocked, preventing the glomeruli from fulfilling their original role of filtering waste products, leading to impaired renal function. Examples of histological findings of diabetic nephropathy include glomerular basement membrane thickening, diffuse lesions, nodular lesions, exudative lesions due to mesangial expansion, microstructural breakdown of mesangium such as melting and microaneurysms, glomerular hypertrophy, proliferation of small blood vessels at the glomerular hilus, global, ischemic, and segmental glomerular sclerosis, glomerular changes such as changes in glomerular epithelial cells and endothelial cells, changes in tubules and tubular interstitium such as thickening of tubular basement membrane, tubular atrophy, expansion and fibrosis of tubular interstitium, and cell infiltration, changes in juxtaglomerular apparatus such as expansion and T cell infiltration, and microvascularization of vascular poles. Examples of clinical findings include microalbuminuria and overt albuminuria, persistent proteinuria, edema, hypertension, and renal failure. The non-human model animal of diabetic nephropathy according to this embodiment shows one or more of the above histological or clinical findings.

[0064] The non-human animal and the constitutively activated Akt in the non-human animal model of diabetic nephropathy of this embodiment are as described in the section on the non-human animal model of retinal vascular disease of this embodiment.

[0065] The non-human diabetic nephropathy model animal of this embodiment exhibits symptoms similar to those of human diabetic nephropathy and can be suitably used as research material for the discovery of treatments, preventions, and diagnostic methods for diabetic nephropathy, as well as for analysis of the pathology.

[0066] [Method for producing non-human animal models] (Method for producing non-human animal models of retinal vascular disease) The method for producing a non-human model animal according to the present embodiment relates to a method for producing a non-human model animal of retinal vascular disease that exhibits symptoms similar to those of human retinal vascular disease. The method for producing a non-human model animal of retinal vascular disease according to the present embodiment includes a step of producing a transgenic non-human animal into which a construct containing DNA encoding a constitutively active Akt is introduced so that Akt activity can be controlled by artificial manipulation (a step of producing a transgenic non-human animal), and a step of inducing a retinal vascular disease by controlling the Akt activity of the constitutively active Akt (a step of inducing a retinal vascular disease). Each step will be described in detail below.

[0067] -Transgenic non-human animal production process In transgenic animals expressing constitutively active Akt, a construct containing DNA encoding constitutively active Akt is introduced so that Akt activity can be controlled by artificial manipulation.

[0068] The term "transgenic non-human animal" refers to a non-human animal that carries a foreign gene at the individual level by artificially introducing a foreign gene at an early stage of development, and its progeny that carries the foreign gene. The type of non-human animal used in the method for producing a non-human model animal of retinal vascular disease according to this embodiment is as described in the section on non-human model animals of this embodiment.

[0069] The DNA encoding the constitutively activated Akt is as described in the section on the non-human animal model of retinal vascular disease according to the present embodiment, and examples thereof include DNA having the nucleotide sequence shown in SEQ ID NO: 1, which encodes a constitutively activated Akt in which the PH domain of wild-type Akt has been deleted and a myristinylation signal has been added to the N-terminus instead, and DNA encoding the amino acid sequence of the constitutively activated Akt shown in SEQ ID NO: 2. However, the DNA is not limited thereto, and includes DNA having a nucleotide sequence having at least a certain percentage of sequence identity with the nucleotide sequence shown in SEQ ID NO: 1, a nucleotide sequence having at least one modification in the nucleotide sequence shown in SEQ ID NO: 1, such as deletion, substitution, or addition of one or several nucleotides, or a nucleotide sequence that hybridizes under stringent conditions to a nucleotide sequence complementary to the nucleotide sequence shown in SEQ ID NO: 1, as long as it encodes a protein having the properties of the constitutively activated Akt described in the section on the non-human animal model of retinal vascular disease according to the present embodiment.

[0070] A construct containing a DNA encoding a constitutively activated Akt may contain a known base sequence necessary for the functional expression of the DNA encoding a constitutively activated Akt. Examples of such sequences include a promoter sequence, a leader sequence, and a signal sequence. Examples of promoter sequences include an EF1α promoter, a CAG promoter, an SRα promoter, an SV40 promoter, an LTR promoter, a CMV (cytomegalovirus) promoter, an RSV (Rous sarcoma virus) promoter, a MoMuLV (moloney murine leukemia virus) LTR, and an HSV-TK (herpes simplex virus thymidine kinase) promoter. Among these, an EF1α promoter, a CAG promoter, a MoMuLV LTR, a CMV promoter, and an SRα promoter are preferred.

[0071] A construct containing a DNA encoding a constitutively active Akt may contain, in addition to a promoter, an enhancer, a polyA addition signal, a selection marker gene, an SV40 replication origin, etc. Examples of the selection marker gene include a dihydrofolate reductase gene, a neomycin resistance gene, and a puromycin resistance gene.

[0072] The construct containing the DNA encoding the constitutively activated Akt may contain a reporter gene for confirming the expression of the constitutively activated Akt. The reporter gene is not particularly limited, and any known reporter gene can be used as long as it can confirm the expression of the constitutively activated Akt. Examples of the reporter gene include a fluorescent protein gene, a luciferase gene, and a β-galactosidase gene. A fluorescent protein gene is preferable, and a modified form of GFP such as green fluorescent protein (hereinafter abbreviated as "GFP") and enhanced green fluorescent protein (hereinafter abbreviated as "EGFP") can be used. Furthermore, the reporter gene may be linked to the DNA encoding the constitutively activated Akt via an IRES (internal ribosome entry site), a sequence encoding a self-cleaving peptide, or the like.

[0073] For the introduction of the construct, for example, an expression vector incorporating the construct is constructed. Here, the vector that can be used is one that can introduce a construct containing DNA encoding constitutively activated Akt into a target host and can express constitutively activated Akt in the host. Therefore, the vector contains at least one restriction enzyme site sequence into which a construct containing DNA encoding constitutively activated Akt can be inserted. In addition, it is preferable that the vector has a drug resistance marker or the like for confirming the introduction of the construct. Examples of such vectors include, but are not limited to, pCMV-Tag, pAdEasy, pCMVLacI, etc.

[0074] In the process of producing a transgenic non-human animal, a construct containing DNA encoding a constitutively activated Akt is introduced into the non-human animal so that Akt activity can be controlled by artificial manipulation. This allows the Akt activity of the constitutively activated Akt to be freely controlled by artificial manipulation. In this way, examples of introducing a construct containing DNA encoding a constitutively activated Akt so that Akt activity can be controlled by artificial manipulation include introducing a construct containing a chimeric DNA in which DNA encoding a constitutively activated Akt and DNA encoding a protein capable of freely regulating the Akt activity by an ex vivo stimulus are linked in frame, co-introducing a construct containing DNA encoding a constitutively activated Akt and a construct containing DNA encoding a protein capable of freely regulating the Akt activity of the constitutively activated Akt by an ex vivo stimulus, and introducing a construct containing DNA encoding a constitutively activated Akt and a sequence capable of freely controlling the expression of DNA encoding a constitutively activated Akt by the action of a site-specific recombinant protein or the like. Preferred examples include introducing a construct containing a chimeric DNA encoding a constitutively active Akt-Mer, and introducing a construct containing a DNA encoding a constitutively active Akt whose expression is under the control of the Cre-LoxP system.

[0075] Constitutively active Akt-Mer is a fusion protein of constitutively active Akt and Mer, as described in the section on the non-human animal model of retinal vascular disease according to this embodiment. Examples of DNA encoding Mer include DNA having the nucleotide sequence shown in SEQ ID NO: 14, and DNA encoding the amino acid sequence of SEQ ID NO: 15. However, the DNA is not limited thereto, and includes DNA having a nucleotide sequence having at least a certain degree of sequence identity with the nucleotide sequence shown in SEQ ID NO: 14, a nucleotide sequence having at least one modification in the nucleotide sequence shown in SEQ ID NO: 14, such as deletion, substitution, or addition of one or several nucleotides, or a nucleotide sequence that hybridizes under stringent conditions to a nucleotide sequence complementary to the nucleotide sequence shown in SEQ ID NO: 14, as long as it encodes a DNA having the above-mentioned properties of Mer. Here, "at least a certain percentage of sequence identity" means preferably 70, 75, 85, or 85% or more sequence identity, more preferably 90% or more sequence identity, and particularly preferably 95, 96, 97, 98, or 99% or more sequence identity. The stringent conditions are as described above.

[0076] Therefore, the DNA encoding the constitutively activated Akt-Mer is not particularly limited as long as it encodes the above-mentioned fusion protein of constitutively activated Akt and Mer in frame, and also includes a DNA in which a DNA encoding a tag sequence is inserted between the DNA encoding the constitutively activated Akt and the DNA encoding Mer.

[0077] Examples of DNA encoding constitutively activated Akt whose expression is under the control of the Cre-LoxP system include DNA in which LoxP sequences are arranged in the same or opposite directions upstream and downstream of the DNA encoding constitutively activated Akt described in the section on the non-human animal model of retinal vascular disease according to this embodiment, DNA in which LoxP sequences are arranged in the same direction upstream and downstream of a base sequence that suppresses the expression of the DNA encoding constitutively activated Akt, such as a transcription termination sequence, and a promoter sequence that induces the constitutive expression of the DNA encoding constitutively activated Akt is arranged upstream of the upstream LoxP sequence, and DNA encoding activated Akt is arranged downstream of the downstream LoxP sequence, etc. The base sequence of the DNA encoding constitutively activated Akt is as described above.

[0078] The method of introducing a construct into a non-human animal is not particularly limited as long as the desired construct can be stably introduced. For example, the method of introducing a construct containing DNA encoding a constitutively active Akt can be preferably a microinjection method, a retrovirus infection method, an adenovirus infection method, or the like.

[0079] In a commonly used microinjection method using mice, for example, fertilized eggs are collected from the oviduct of a female mouse that has been naturally mated or artificially inseminated, and a construct containing a desired DNA is injected into the male pronucleus of the fertilized egg using a microcapillary or the like. The form of the injected construct is not particularly limited, but it is preferable that it is linear or cyclic in terms of introduction efficiency. The injected fertilized egg is transferred to the oviduct of a pseudopregnant mouse (foster parent), and after a predetermined period of breeding, a baby mouse is obtained. It is confirmed whether or not the desired DNA has been incorporated into the chromosome of the baby mouse, and individuals into which the desired DNA has been incorporated are selected. In addition, it is also possible to obtain their offspring and establish a lineage. When the introduced construct contains a reporter sequence, the incorporation of DNA can be confirmed according to the type of reporter sequence. For example, when a fluorescent protein or the like is contained, it can be confirmed by observing the fluorescence of the tail of the baby mouse. It may also be performed by extracting DNA from the tail of the baby mouse or the like and performing DNA analysis by PCR, Southern hybridization, or the like.

[0080] In addition, as a method for introducing a construct containing DNA encoding a constitutively active Akt into a non-human animal so that Akt activity can be controlled by artificial manipulation, embryonic stem cells (hereinafter referred to as "ES cells") can also be used. When using embryonic stem cells, for example, a desired DNA can be introduced into an ES cell in advance, and the ES cell is then returned to a blastocyst, whereby a transgenic non-human animal can be similarly produced. The method for introducing a desired DNA into an ES cell is not particularly limited as long as the desired DNA can be stably introduced, and for example, electroporation, calcium phosphate, DEAE-dextran, lipofection, etc. can be used.

[0081] As a method for introducing a construct containing DNA encoding a constitutively activated Akt whose expression is under the control of the Cre-LoxP system and obtaining a transgenic non-human animal into which a constitutively activated Akt under the control of the Cre-LoxP system has been introduced, preferably, a construct containing a promoter sequence is introduced by homologous recombination into the ROSA26 locus (target locus) in an ES cell to produce an allele in which the constitutively activated Akt gene is not transcribed. Examples of the construct containing the promoter sequence include a promoter sequence, a Cre recognition sequence, a transcription termination sequence, a Cre recognition sequence, and a DNA encoding a constitutively activated Akt, which are sequentially arranged in the 5' to 3' direction. The promoter sequence may be any of those described above, and among them, a CAG promoter is preferred. The Cre recognition sequence is not particularly limited, and may be, for example, a conventionally known LoxP sequence. In addition, in order to confirm the introduction of the construct into the ES cell, it is preferable to have a sequence encoding a selection marker sandwiched between the Cre recognition sequences and upstream of the transcription termination sequence. The selection marker is not particularly limited, and for example, a drug resistance marker, a fluorescent protein marker, an enzyme marker, and a cell surface receptor marker can be used. The construct is introduced into ES cells based on a conventionally known method such as the electroporation method described above, and homologous recombination of a promoter region including a ROSA26 transcription start point in the genome of the ES cells is performed. Then, the introduced cells are cultured, and a selection marker expression strain is selected. The selection marker expression strain is a recombinant ES cell line having a mutant allele into which the construct has been introduced by homologous recombination. When the selection marker is, for example, a drug resistance marker, a drug resistance strain may be selected. In the recombinant ES cell line having the mutant allele, the constitutively active Akt gene is not transcribed due to the presence of a selection marker such as drug resistance or a transcription termination sequence in the construct introduced into the ROSA26 gene.Next, the resulting recombinant ES cell line is injected into a blastocyst, which is then returned to the uterus of a pseudopregnant non-human animal, and the resulting chimeric non-human animal is mated with a wild-type non-human animal to obtain a non-human animal having a mutant allele (F1, heterozygote). By mating these heterozygote non-human animals, a non-human animal having a homozygote mutant allele (F2, homozygote) can be obtained. The genotype of each non-human animal can be confirmed by a conventional method such as Southern blotting.

[0082] Induction of retinal vascular disease Retinal vascular disease is induced by artificially activating a constitutively active form of Akt introduced into a transgenic non-human animal, depending on the form of the constitutively active Akt introduced.

[0083] When the constitutively active Akt is constitutively active Akt-Mer, the activation state can be controlled by 4-OHT. Therefore, when 4-OHT is administered to a transgenic non-human animal expressing constitutively active Akt-Mer, the constitutively active Akt becomes active, and symptoms similar to those of human retinal vascular disease described in the non-human model animal of retinal vascular disease of this embodiment are induced.

[0084] The administration form of 4-OHT is not particularly limited as long as it induces the symptoms of retinal vascular disease, and can be appropriately set according to the type of non-human animal used and the severity of the retinal vascular disease to be induced. For example, intraperitoneal administration, oral administration, intravenous administration, intraarterial administration, intramuscular administration, subcutaneous administration, intradermal administration, intrarectal administration, intraocular administration, intratracheal administration, intranasal administration, oral administration, sublingual administration, intraventricular administration, intradural administration, epidural administration, enteral administration, transdermal administration, inhalation, etc. can be exemplified, but are not limited to these. Intraperitoneal administration is preferable.

[0085] The dosage, administration period, and administration frequency of 4-OHT are not particularly limited as long as the symptoms of retinal vascular disease are induced, and can be appropriately set according to the type of non-human animal used, the severity of the retinal vascular disease to be induced, the administration route, and the like. In addition, it may be administered continuously, intermittently, or multiple times, and in that case, the dosage of each administration may be the same or different. For example, it can be administered at 5 to 50 μg / g body weight / day during any period from 1 to 14 days after birth to a transgenic non-human animal expressing a constitutively activated Akt-Mer, and preferably at 10 to 100 μg / day x 3 days on 4 to 6 days after birth. The mouse used in the following examples weighs about 2 to 4 g at 7 days after birth. In addition, under the above-mentioned administration conditions, the symptoms of retinal vascular disease are prominently observed after 7 days after birth of a transgenic non-human animal expressing a constitutively activated Akt-Mer, but the number of days required for the induction of symptoms of retinal vascular disease can be controlled by appropriately changing the administration conditions.

[0086] For example, in the examples described below, 100 μg of 4-OHT was intraperitoneally administered once a day to a transgenic non-human animal expressing a constitutively activated Akt-Mer on days 4 to 6 after birth, and the retinal vascular morphology was observed on the 7th day after birth. Symptoms such as retinal hemorrhage, retinal swelling, and formation of significant microaneurysms were observed, and significant expansion of the entire retinal vascular was observed. In human diabetic retinopathy, retinal hemorrhage and edema are findings that occur regardless of the severity. When the dosage was 1 / 10, 10 μg, and the retinal vascular morphology was observed on the 7th day after birth, symptoms such as formation of microaneurysms were observed, although they were milder than those observed when 100 μg was administered. The observed microaneurysms were found to have multiple cell nuclei and were composed of clusters of endothelial cells, and are similar to pathological specimens of microaneurysms in human retinal vascular diseases such as human diabetic retinopathy that have been reported so far.

[0087] On the other hand, in animals that do not express constitutively active Akt-Mer, and in animals that express constitutively active Akt-Mer but have not been administered 4-OHT, no vascular abnormalities were observed compared to normal retinal blood vessels. Therefore, it was found that by artificially controlling Akt activity, it is possible to reproduce retinal vascular abnormalities similar to human retinal vascular diseases such as diabetic retinopathy in non-human model animals. Moreover, after administration of 4-OHT, symptoms similar to those of human retinal vascular diseases can be induced in an extremely short time.

[0088] In addition, the severity of retinal vascular disease can be controlled by adjusting the activation state of Akt through the dosage and administration period of 4-OHT, etc. By enhancing the activation state of Akt, a non-human model animal exhibiting prominent symptoms of retinal vascular disease can be provided, which can be particularly suitably used for research into the elucidation of the onset mechanism and pathology of retinal vascular disease. By reducing the activation state of Akt, the manifestation of symptoms of retinal vascular disease can be alleviated, and a non-human model animal exhibiting symptoms more similar to those of human retinal vascular disease can be provided. In particular, a non-human model animal exhibiting symptoms similar to those of human retinal vascular disease, which causes retinal edema due to increased vascular permeability, can be provided.

[0089] When the constitutively activated Akt is a constitutively activated Akt whose expression is under the control of the Cre-LoxP system, the Akt activity of the constitutively activated Akt can be controlled by Cre. The introduction of Cre into a transgenic non-human animal into which a constitutively activated Akt under the control of the Cre-LoxP system has been introduced is not particularly limited, and can be performed by mating with a Cre-expressing transgenic non-human animal into which a DNA encoding Cre has been introduced. For example, a transgenic non-human animal into which a constitutively activated Akt under the control of the Cre-LoxP system has been introduced as described above is mated with a female (or male) of a Cre-expressing transgenic non-human animal. Here, the Cre-expressing transgenic non-human animal can be prepared by utilizing a construct containing a DNA encoding Cre arranged downstream of an appropriate promoter sequence. When the fertilized egg obtained by the above-mentioned mating inherits a mutant allele from the mother, for example, in the cells of the embryo, a region including a transcription termination sequence (if a selection marker sequence is included, the selection marker sequence) sandwiched between Cre recognition sequences such as LoxP sequences is removed by the catalytic action of the expressed Cre. Since the transcription termination sequence that suppresses the transcription of the constitutively activated Akt gene is removed, the constitutively activated Akt gene is irreversibly converted into a mutant allele that is constitutively expressed by a promoter such as a CAG promoter.

[0090] As the Cre-expressing transgenic non-human animal, one that can control Cre expression in a tissue-specific and time-specific manner can be preferably used. For example, Cre can be controlled to be expressed tissue-specifically by introducing DNA encoding Cre under the control of a promoter (tissue-specific promoter) of a gene that is specifically expressed in a specific tissue. As the tissue-specific promoter, a promoter of a gene that is specifically expressed in vascular tissue, particularly in vascular endothelial cells, can be preferably used. Examples of the tissue-specific promoter include, but are not limited to, Tie-Cre non-human animals (mice) in which DNA encoding Cre has been introduced under the control of the Tie2 gene promoter, and VE-cad-Cre non-human animals (mice) in which DNA encoding Cre has been introduced under the control of the VE cadherin gene promoter. Here, the Tie2 gene encodes a tyrosine kinase receptor also known as TEK receptor tyrosine kinase, and is known to be specifically expressed in endothelial cells. VE cadherin is an adhesion molecule that belongs to the cadherin family, also known as cadherin 5 or CD144, and is known to be specifically expressed in endothelial cells. Cre expression can be controlled in a stage-specific manner by introducing DNA encoding Cre under the control of a promoter (stage-specific promoter) of a gene that is only activated when the non-human animal reaches a certain stage of development.

[0091] In addition, as the Cre-expressing transgenic non-human animal, one that can control the recognition of the Cre recognition sequence by Cre and the site-specific recombination reaction in an inducible manner by a stimulus such as an exogenous drug can also be preferably used. Preferably, a transgenic non-human animal that expresses tamoxifen-inducible Cre can be used, and for example, a CAG-MerCreMer non-human animal (mouse) in which a construct containing DNA encoding a fusion protein in which the ligand-binding domain of a mutant estrogen receptor (Mer described above) is fused to Cre at the N-terminus and C-terminus of the Cre under the control of a CAG promoter (see, for example, Egawa G. et al., J Invest Dermatol. 2009: 129(10):2386-95) can be used. Furthermore, Cre-expressing transgenic non-human animals into which a construct containing DNA encoding a fusion protein of Cre and a ligand-binding domain of a mutant estrogen receptor, such as CreER non-human animals (mouse), CreERT2 non-human animals (mouse), or Pdgfb-iCreER non-human animals (mouse) (see, for example, Claxton S. et al., Genesis. 2008: 46(2):74-80), has been introduced can be used. MerCreMer, CreER, and the like usually remain in the cytoplasm and do not migrate into the nucleus. However, in the presence of estrogen derivatives such as tamoxifen or tamoxifen derivatives, they bind to these and migrate into the nucleus, where they recognize Cre recognition sequences such as LoxP sequences and catalyze site-specific recombination reactions. By utilizing this property, the operation of the Cre-LoxP system can be controlled in a time-specific and tissue-specific manner.

[0092] Examples of DNA encoding Cre include, but are not limited to, DNA having the nucleotide sequence of SEQ ID NO: 17 and DNA encoding the amino acid sequence of SEQ ID NO: 18, which is the amino acid sequence of SEQ ID NO: 17, and DNA having at least a certain percentage of sequence identity to the nucleotide sequence of SEQ ID NO: 17, DNA having at least one modification in the nucleotide sequence of SEQ ID NO: 17, such as deletion, substitution, or addition of one or several nucleotides, or DNA having a nucleotide sequence that hybridizes under stringent conditions to a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 17, and having the properties of Cre. Here, at least a certain percentage of sequence identity means preferably 70, 75, 85, or 85% or more sequence identity, more preferably 90% or more sequence identity, and particularly preferably 95, 96, 97, 98, or 99% or more sequence identity.

[0093] Thus, when the constitutively activated Akt is a constitutively activated Akt whose expression is under the control of the Cre-LoxP system, the Akt activity of the constitutively activated Akt can be controlled preferably through mating with a Cre-expressing transgenic non-human animal. By controlling the expression and activity induction of Cre in a tissue-specific or time-specific manner, Akt activity can be suitably controlled, and the onset and severity of retinal vascular disease can be controlled. For example, when controlling the activity induction of Cre by an external stimulus such as a drug, the drug can be administered in the above-mentioned dosage form. The activation state of Akt can be regulated by the dosage and administration period of the drug, and the severity of retinal vascular disease can be controlled. Therefore, the dosage and administration period of the drug can be appropriately changed depending on the severity of the retinal vascular disease of interest and the type of drug to be administered.

[0094] The method for producing a non-human model animal of retinal vascular disease of this embodiment can provide a non-human model animal that exhibits symptoms similar to those of human retinal vascular disease, including human diabetic retinopathy. The non-human model animal produced by the method for producing a non-human model animal of retinal vascular disease of this embodiment has retinal hemorrhage and microaneurysm structures similar to those of pathological specimens of human diabetic retinopathy. In particular, a non-human model animal that can reproduce symptoms of retinal edema due to increased vascular permeability, for which there is currently no effective treatment, can be provided. In addition, the non-human model animal of retinal vascular disease of this embodiment can exhibit symptoms of human retinal vascular disease in an extremely short time by controlling the Akt activity of the constitutively activated Akt. Therefore, the method for producing a non-human model animal of retinal vascular disease of this embodiment can be suitably used in the fields of searching for treatments, prevention methods, and diagnostic methods for retinal vascular disease, and analysis of pathology. Furthermore, the non-human model animal produced by the method for producing a non-human model animal of retinal vascular disease of this embodiment can control the severity by artificially manipulating the Akt activation state of the constitutively activated Akt. Therefore, it is possible to provide a non-human model animal that can be extremely suitably used as a research material for searching for treatments, preventions, and diagnostic methods according to the progression of symptoms, and in particular for analyzing pathological conditions such as the onset and progression processes.

[0095] (Method for producing a non-human animal model of diabetic nephropathy) The method for producing a non-human model animal according to the present embodiment relates to a method for producing a non-human model animal of diabetic nephropathy that exhibits symptoms of human diabetic nephropathy. The method for producing a non-human model animal according to the present embodiment includes a step of producing a transgenic non-human animal into which a construct containing DNA encoding a constitutively activated Akt is introduced so that Akt activity can be controlled by artificial manipulation (a step of producing a transgenic non-human animal), and a step of inducing diabetic nephropathy by controlling the Akt activity of the constitutively activated Akt (a step of inducing diabetic nephropathy).

[0096] The transgenic non-human animal can be produced as described in the section on the method for producing a non-human model animal of retinal vascular disease of this embodiment. The diabetic nephropathy induction process can be performed in accordance with the induction process described in the section on the method for producing a non-human model animal of retinal vascular disease of this embodiment, and a symptom similar to human diabetic nephropathy described in the non-human model animal of diabetic nephropathy of this embodiment is induced.

[0097] The method for producing a non-human animal model of diabetic nephropathy of the present embodiment can provide a non-human animal model exhibiting symptoms similar to those of human diabetic nephropathy, and therefore can be suitably used in the fields of searching for therapeutic methods, preventive methods, and diagnostic methods for diabetic nephropathy, and analyzing the pathology, etc.

[0098] [Method of screening therapeutic or preventive drugs] (Method of screening for drugs for treating or preventing retinal vascular disease) The non-human animal model of retinal vascular disease of this embodiment can be suitably used in a screening method for drugs for treating or preventing retinal vascular disease, and this screening method is also included in the embodiments of the present invention.

[0099] The screening method for a drug for treating or preventing retinal vascular disease of this embodiment includes the steps of administering a test substance to a non-human model animal of retinal vascular disease of this embodiment, and determining the therapeutic or preventive effect of the test substance.

[0100] There is no particular limitation on the test substance as long as it is a substance that is expected to have a therapeutic or preventive effect on retinal vascular disease. Therefore, the test substance may be derived from a natural product or may be artificially synthesized. Specifically, examples include proteins including peptides, enzymes, and antibodies, nucleic acids including DNA, RNA, and iRNA, peptide nucleic acids, lipids, low-molecular and high-molecular compounds, cell or tissue extracts of animals and plants, cell culture supernatants, animal plasma and serum, microorganisms, viruses, etc., but are not limited to these. When an artificially synthesized substance is used as the test substance, a compound library or peptide library containing multiple test substances and prepared using combinatorial chemistry technology can also be used as the test substance. There is no particular limitation on the shape of the test substance. Therefore, the test substance may be administered in any of solid, semi-solid, and liquid forms, and can be appropriately set according to the type of test substance, the administration route and dosage, the administration period, etc.

[0101] The route of administration of the test substance is appropriately set according to the type of the test substance, and the administration period, dosage, etc., and is not particularly limited. For example, intraperitoneal administration, oral administration, intravenous administration, intraarterial administration, intramuscular administration, subcutaneous administration, intradermal administration, rectal administration, intraocular administration, intratracheal administration, intranasal administration, oral administration, sublingual administration, intracerebroventricular administration, intradural administration, epidural administration, enteral administration, transdermal administration, inhalation, etc. can be exemplified, but are not limited to these. The administration period and dosage are also appropriately set according to the type of the test substance and the administration route, and are not particularly limited.

[0102] The therapeutic or preventive effect of a test substance is determined by measuring changes in symptoms of retinal vascular disease in a non-human model animal to which the test substance is administered, evaluating whether or not the test substance shows a therapeutic or preventive effect, and determining the effectiveness of the test substance based on the evaluation results. In the evaluation, a control group to which the test substance is not administered can be compared with a test group to which the test substance is administered. This makes it easy to evaluate and improves the reliability of the evaluation. There is no particular limit to the number of individuals in the test group and the control group, but it is preferable to use a number that ensures the reliability of the evaluation.

[0103] As an indicator of the therapeutic or preventive effect of the test substance, any of the findings such as the shape of the retinal blood vessels and retinal thickness of the above-mentioned retinal vascular diseases can be used as an indicator, and not only a single finding but also a combination of multiple findings can be used as an indicator.

[0104] As a result of the evaluation, for example, if the test group shows a reduction or disappearance of symptoms of retinal vascular disease compared to the control, if the progression of symptoms is delayed, if symptoms do not become more severe, if the onset of retinal vascular disease is delayed, or if no onset is observed, the test substance is recognized as having a therapeutic effect and a preventive effect for retinal vascular disease. Such a test substance can be determined to be a candidate substance useful as a drug for treating or preventing retinal vascular disease.

[0105] The screening method for a drug for treating or preventing retinal vascular disease of this embodiment uses a non-human model animal that reproduces symptoms similar to those of human retinal vascular disease as the non-human model animal, so that the therapeutic effect and preventive effect of the test substance can be determined with high reliability. In addition, since the severity of retinal vascular disease can be controlled by controlling the Akt activity of constitutively active Akt, it is possible to develop therapeutic and preventive drugs according to symptoms. It can also be suitably used for the development of therapeutic and preventive drugs for retinal vascular disease that causes retinal edema due to increased vascular permeability, for which there is currently no effective treatment. Therefore, the screening method for a drug for treating or preventing retinal vascular disease of this embodiment is expected to make a great contribution to the development of therapeutic and preventive techniques for retinal vascular disease.

[0106] (Method of screening for drugs for treating or preventing diabetic nephropathy) The non-human animal model of diabetic nephropathy of this embodiment can be suitably used in a method for screening a drug for treating or preventing diabetic nephropathy, and the screening method is also included in the embodiments of the present invention. The screening method for a drug for treating or preventing diabetic nephropathy according to this embodiment can be performed in accordance with the screening method described in the section on the screening method for a drug for treating or preventing retinal vascular disease according to this embodiment. This makes it possible to search for candidate substances useful as drugs for treating or preventing diabetic nephropathy.

[0107] The method for screening a drug for treating or preventing diabetic nephropathy of this embodiment uses a non-human model animal that reproduces symptoms similar to those of human diabetic nephropathy as the non-human model animal, and therefore the therapeutic and preventive effects of the test substance can be determined with high reliability. Therefore, the method for screening a drug for treating or preventing diabetic nephropathy of this embodiment is expected to make a significant contribution to the development of techniques for treating and preventing diabetic nephropathy. EXAMPLES

[0108] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.

[0109] Example 1. Generation of transgenic mice expressing constitutively activated Akt-Mer In this example, the generation of transgenic mice expressing a constitutively active Akt-Mer capable of reversibly controlling Akt activity (hereinafter, sometimes referred to as "constitutively active Akt-Mer TG mice") was investigated.

[0110] (method) A gene expression plasmid (hereinafter referred to as "constitutively active Akt-Mer expression vector") was constructed in which the chimeric gene constitutively active Akt-Mer and IRES-EGFP (ribosome entry site within mRNA-enhanced green fluorescent protein: the base sequence is shown in SEQ ID NO: 19) were linked under the control of a CAG promoter (see JP 2005-304487 A). The constructed constitutively active Akt-Mer expression vector was injected into the pronuclei of fertilized eggs of BDF (registered trademark) 1 mice. Figure 1 shows the construction of constitutively active Akt-Mer TG mice, and Figure 2 shows a schematic diagram of the construction of the constitutively active Akt-Mer expression vector. .

[0111] Specifically, first, an EcoRI-SalI fragment (corresponding to the IRES-EGFP portion) derived from pMY-IRES-EGFP (described in Murata K, Kumagai H, Kawashima T, Tamitsu K, Irie M, Nakajima H, Suzu S, Shibuya M, Kamihira S, Nosaka T, Asano S, Kitamura T. The EMBO Journal Vol. 18, pp. 4754-4765, 1999) was inserted into the cloning site of the pCAG-neo vector (pCXN vector) (described in Niwa H, Yamamura K, Miyazaki J. Gene. 1991 Dec 15; 108(2): 193-199.) to prepare a vector (pCAG-neo-IRES-EGFP vector).

[0112] Next, pCS2 Akt active vector (Masuyama N, Oishi K, Mori Y, Ueno T, Takahama Y, Gotoh Y. J Biol Chem. 2001 Aug 31;276(35):32799-32805. Epub 2001 Jul 03.) was used as a template. 5'-cggaattcaccatggggagtagcaag-3' (SEQ ID NO: 20), 5'-cggaattcggatccagcgtaatctggaacatcgtatgggtaggccgtgctgctggccgag-3' (SEQ ID NO: 21) PCR was performed using the above primers to amplify a constitutively active Akt cDNA having an EcoRI site at the 5' end and a BamHI site at the 3' end and excluding the stop codon.

[0113] In addition, pCAG-MerCreMer vector (described in SCL / tal-1-dependent process determines a competence to select the definitive hematopoietic lineage prior to endothelial differentiation. Endoh M, Ogawa M, Orkin S, Nishikawa S. EMBO J. 2002 Dec 16;21(24):6700-6708) was used as a template. 5'- cgggatccggagatccacgaaatgaaatg-3' (SEQ ID NO: 22), 5'- cgggatccgtcgactcagatcgtgttggggaagcc-3' (SEQ ID NO: 23) PCR was performed using the above primers to amplify Mer cDNA (Mer) having a BamHI site at the 5' end that can be linked in frame to activated Mer and a SalI site at the 3' end.

[0114] Next, the two DNA fragments, constitutively active Akt cDNA and Mer cDNA, were cloned into the EcoRI-XhoI site of the pCAG-neo-IRES-EGFP vector to construct the constitutively active Akt-Mer expression vector pCAG-neo-myr-△PH-Akt-Mer-IRES-EGFP.

[0115] Next, the constitutively active Akt-Mer expression vector was introduced into a mouse fertilized egg. The introduction can be performed using any method known in the art. For example, the constitutively active Akt-Mer expression vector linearized by digestion with the restriction enzyme PvuI is purified as necessary to obtain a target fragment, and the purified constitutively active Akt-Mer expression vector is inserted into the pronucleus of a fertilized egg of a BDF (registered trademark) 1 mouse by injection, and then transplanted into the oviduct of a surrogate mouse. The surrogate mouse is allowed to give birth naturally to obtain offspring. It is confirmed by the fluorescence of the tail of the offspring whether the constitutively active Akt-Mer expression vector has been appropriately introduced into the offspring, and a constitutively active Akt-Mer Tg mouse can be obtained.

[0116] Example 2. Confirmation of Akt activity in the retina Constitutively active Akt-Mer can control the activation state of Akt in the presence of 4-hydroxytamoxifen (hereinafter, abbreviated as "4-OHT"). Therefore, in this example, Akt activity in the retina of the constitutively active Akt-Mer Tg mouse prepared in Example 1 was confirmed.

[0117] (method) To the constitutively active Akt-Mer Tg mice prepared in Example 1, 10 μl of 10 μg / μl 4-OHT per day (total amount 100 μg / day × 3 days) was intraperitoneally administered from the 4th to 6th days after birth. Proteins were extracted from the retinas excised without perfusion fixation on the 7th day after birth, and Akt phosphorylation was confirmed using the Western blotting method. As a control, mice not administered 4-OHT were treated in the same manner to confirm Akt phosphorylation.

[0118] (result) The results are shown in Figure 3. In each panel of Figure 3, the upper band is derived from the introduced constitutively active Akt, and the lower band is derived from endogenous Akt. It was confirmed that Thr-308 and Ser-473 were strongly phosphorylated in the retina of the constitutively active Akt-Mer Tg mouse (Akt-Mer) compared to the control. This confirmed that constitutively active Akt was expressed, and it can be understood that Akt activity is continuously activated. On the other hand, it was also confirmed that endogenous Akt was expressed and partially phosphorylated in both the control and the constitutively active Akt-Mer Tg mouse.

[0119] Example 3. Effect of sustained Akt activation on the retina In this example, the effect of sustained activation of Akt on the retina was examined in the constitutively active Akt-Mer Tg mouse prepared in Example 1. Here, the effect on the retina was confirmed by observing the retina of the constitutively active Akt-Mer Tg mouse after sustained activation of Akt under an optical microscope.

[0120] (method) The constitutively activated Akt-Mer Tg mice prepared in Example 1 were intraperitoneally administered 10 μl of 10 μg / μl 4-OHT per day (total amount 100 μg / day × 3 days) from the 4th to 6th day after birth. After perfusion fixation from the heart using 4% paraformaldehyde (hereinafter abbreviated as "PFA") on the 7th day after birth, a retinal cup was made from the excised eyeball, and an optical microscope image of the retina was obtained using MZ16F (Leica). As a control, mice not administered 4-OHT were treated in the same manner and images were obtained.

[0121] (result) The results are shown in Figure 4. In the figure, the fine punctate changes in dark grey indicate hemorrhage. As a result, punctate retinal hemorrhage was observed in constitutively activated Akt-Mer Tg mice (Akt-Mer) in which Akt was sustainedly activated by administration of 4-OHT. Retinal hemorrhage is a finding that occurs regardless of the severity of human diabetic retinopathy. On the other hand, since no retinal hemorrhage was observed in the control mice, it can be understood that retinal hemorrhage is caused by sustained activation of Akt.

[0122] Example 4. Effect of sustained Akt activation on retinal neovascularization In this example, the effect of sustained Akt activation on retinal neovascularization was examined in the constitutively active Akt-Mer Tg mice prepared in Example 1. Here, the retinas of the constitutively active Akt-Mer Tg mice after sustained Akt activation were examined by whole-mount immunostaining.

[0123] (method) The constitutively activated Akt-Mer Tg mice prepared in Example 1 were intraperitoneally administered 10 μl of 10 μg / μl 4-OHT per day (total amount 100 μg / day × 3 days) from the 4th to 6th days after birth. After perfusion fixation from the heart using 4% PFA on the 7th day after birth, a retinal cup was created from the excised eyeball. Fluorescent immunostaining was performed using anti-PECAM-1 (platelet endothelial cell adhesion molecule-1: CD31) antibody to stain vascular endothelial cells. Images of the flat-mounted retina were then obtained using AxioObserver (Zeiss). As a control, mice not administered 4-OHT were treated in the same manner and images were obtained.

[0124] (result) The results are shown in Figure 5. Compared to the control, a dense vascular network was observed to be formed in the constitutively active Akt-Mer Tg mice (Akt-Mer) in which Akt was sustainedly activated by administration of 4-OHT.

[0125] To examine the retinal vascular morphology in detail, an enlarged image of Figure 5 is shown in Figure 6. In activated Akt-Mer Tg mice (Akt-Mer) in which Akt was continuously activated by administration of 4-OHT, blood vessels extend from the optic disc (bottom edge of image) to the periphery (top edge of image), but it can be confirmed that blood vessel elongation is delayed compared to controls. The diameter of both arteries, veins, and capillaries expanded, and significant expansion was observed throughout the retinal blood vessels, as well as the induction of the formation of capillary aneurysms with a lumpy structure. On the other hand, no such findings were observed in the controls.

[0126] Furthermore, to examine the retinal vascular morphology in detail, vascular elongation and vascular diameter were measured. In detail, vascular elongation was measured by measuring the distance from the optic disc edge to the tip of vascular elongation along the vein using Photoshop (registered trademark) CS5 software. Measurements were performed at four locations per retina and quantified. The arterial and venous diameters were measured by measuring the thickness of the artery and vein on a circle with a radius of 1500 μm centered on the optic disc using Photoshop (registered trademark) CS5 software (** < 0.01). The results are shown in Figure 7. In the constitutively active Akt-Mer Tg mouse (Akt-Mer) in which Akt was continuously activated by administration of 4-OHT, delayed vascular elongation and significant vascular expansion were observed. These results confirm the findings of the retinal images confirmed in Figure 6.

[0127] The results of this example confirmed that the findings of retinal vascular diseases such as microaneurysms, capillary dilation, and neovascularization, which are observed in retinal vascular diseases such as human diabetic retinopathy, are caused by sustained activation of Akt. This demonstrated that a non-human animal model exhibiting symptoms similar to those of human retinal vascular diseases such as human diabetic retinopathy can be constructed by sustained activation of Akt.

[0128] Example 5. Effect of sustained (low) activation of Akt on retinal vascular morphology In this example, we investigated the effect of sustained Akt activation on the morphology of retinal capillaries in the constitutively active Akt-Mer Tg mice prepared in Example 1. Here, as in the previous example, the retinas of the constitutively active Akt-Mer Tg mice after sustained Akt activation were examined by whole-mount immunostaining.

[0129] (method) To the constitutively activated Akt-Mer Tg mice prepared in Example 1, 10 μl of 1 μg / μl 4-OHT per day (total amount 10 μg / day × 3 days) was intraperitoneally administered from the 4th to 6th days after birth. This dosage is one tenth of the dosage in the previous example. On the 7th day after birth, the mice were perfused and fixed from the heart using 4% PFA, and then a retinal cup was created. Fluorescent immunostaining was performed using anti-PECAM-1 (CD31) antibody, and images of the flat-mounted retina were obtained using AxioObserver (Zeiss). As a control, mice not administered 4-OHT were treated in the same manner and images were obtained.

[0130] (result) The results are shown in Figure 8. In the constitutively active Akt-Mer Tg mice (Akt-Mer) in which Akt was continuously activated by administration of 4-OHT, it was found that the formation of microaneurysms was induced even by administration of a low concentration of 4-OHT, which was 1 / 10 of the dose used in the previous example. On the other hand, no such findings were observed in the control mice. In addition, the microaneurysms were smaller and fewer in number than those observed in the previous example, indicating that the severity of the retinal vascular disease that occurs can be controlled by the degree of Akt activation.

[0131] Furthermore, to examine the retinal vascular morphology in detail, the number of microaneurysms was counted. Specifically, the number of microaneurysms per retina was measured manually using images of flat-mounted retinas. The results are shown in Figure 9. Although few microaneurysms were observed in the control mice, a large number of microaneurysms, an average of 90 per retina, were observed in the constitutively active Akt-Mer Tg mice (Akt-Mer) in which Akt was sustainedly activated by administration of 4-OHT.

[0132] Next, to examine the structure of the microaneurysm in detail, double immunostaining was performed using anti-PECAM-1 (CD31) antibody as well as anti-ERG antibody. The vascular endothelial cells were stained with anti-PECAM-1 (CD31) antibody and the endothelial cell nuclei were stained with anti-ERG antibody. The results are shown in Figure 10. The upper image in Figure 10 shows images acquired with LSM710 (Zeiss), the left image shows the staining of microaneurysms in a constitutively activated Akt-Mer Tg mouse (Akt-Mer) with anti-PECAM-1 (CD31) antibody, the center image shows staining with anti-ERG antibody, and the right image shows the result of double staining with both, in which a light gray fluorescent stained area is observed. The lower image in Figure 10 shows a pathological specimen of a microaneurysm of human diabetic retinopathy (quoted from the Atlas of Ocular Histology and Pathology), for comparison, and in detail, it is an optical microscope image of a vascular network specimen treated with trypsin. As a result, it can be seen that the aneurysmal vascular structure observed in Figure 8 and other figures contains multiple endothelial cell nuclei and is composed of a cluster of endothelial cells. It can also be seen that this structure is similar to previously reported pathological specimens of capillary microaneurysms of human diabetic retinopathy (the dark gray areas observed in the aneurysmal vascular structure and other figures indicate a cluster of cell nuclei). This demonstrates that sustained activation of Akt can provide a non-human animal model that exhibits symptoms highly similar to those of human diabetic retinopathy.

[0133] Example 6. Effect of sustained Akt activation on retinal vascular permeability In this example, the effect of sustained activation of Akt on retinal vascular permeability was examined in the constitutively active Akt-Mer Tg mice prepared in Example 1. Here, pigment leakage in the retina of the constitutively active Akt-Mer Tg mice after sustained activation of Akt was confirmed by observation with a stereomicroscope.

[0134] (method) To the constitutively activated Akt-Mer Tg mice prepared in Example 1, 10 μl of 10 μg / μl 4-OHT per day (total amount 100 μg / day × 3 days) was intraperitoneally administered from the 4th to 6th days after birth. On the 7th day after birth, 20 μl of Evans blue was intraperitoneally administered, and 1 hour later, the eyeballs were perfused and fixed from the heart using 4% PFA, and images of the enucleated eyeballs were obtained using an MZ16F stereomicroscope (Leica). As a control, mice not administered 4-OHT were treated in the same manner and images were obtained.

[0135] (result) The results are shown in Figure 11. In the figure, the area enclosed by the solid line (black) shows the retina viewed from the vitreous side, and the area enclosed by the dotted line (white) shows the area where leakage of the blue pigment Evans blue was confirmed under an optical microscope. As a result, in constitutively active Akt-Mer Tg mice (Akt-Mer) in which Akt was administered 4-OHT to activate Akt sustainedly, extravasation of the pigment was observed, indicating increased vascular permeability. On the other hand, no increase in vascular permeability was observed in the control mice, indicating that the increase in vascular permeability was due to sustained activation of Akt.

[0136] Furthermore, to quantitatively evaluate vascular permeability, the fluorescence intensity of Evans blue leaked from retinal blood vessels was measured using an LSM710 confocal microscope (Zeiss) (*** < 0.001). The results are shown in Figure 12. As a result, it was found that the amount of dye extravasation was significantly higher in constitutively active Akt-Mer Tg mice (Akt-Mer) in which Akt was sustainedly activated by administration of 4-OHT than in controls.

[0137] Example 7. Effect of sustained Akt activation on the retinal surface In this example, the effect of sustained activation of Akt on the retinal surface layer of the retina was examined in the constitutively active Akt-Mer Tg mouse prepared in Example 1. Here, confirmation was made by observing images of retinal sections of the constitutively active Akt-Mer Tg mouse after sustained activation of Akt.

[0138] (method) The constitutively activated Akt-Mer Tg mice prepared in Example 1 were intraperitoneally administered 10 μl of 10 μg / μl 4-OHT per day (total amount 100 μg / day × 3 days) from the 4th to 6th day after birth. On the 7th day after birth, the eyes were perfused and fixed from the heart using 4% PFA, and then retinal frozen sections were prepared. The nuclei were visualized by Hoechst staining, and images were obtained using a microscope (Zeiss). As a control, mice not administered 4-OHT were treated in the same manner and images were obtained.

[0139] (result) The results are shown in Figure 13. In the constitutively active Akt-Mer Tg mice (Akt-Mer) in which Akt was sustainedly activated by administration of 4-OHT, significant swelling was observed throughout the retina, especially in the superficial layer where the vascular layer is located. On the other hand, no such findings were observed in the control mice, so it can be understood that the swelling in the superficial layer is due to the sustained activation of Akt.

[0140] The results of Examples 6 and 7 show that sustained activation of Akt enhances retinal vascular permeability, resulting in retinal edema. Such retinal edema occurs regardless of the severity of human diabetic retinopathy, and few model animals reported to date have shown such an observation.

[0141] Example 8. Analysis of factors behind vascular morphological abnormalities caused by sustained activation of Akt (vascular endothelial cells and astrocytes) In this example, we investigated the cause of the abnormal vascular morphology caused by sustained Akt activation confirmed in the previous example. Here, we examined the retina of a constitutively active Akt-Mer Tg mouse after sustained Akt activation by whole-mount immunostaining.

[0142] (method) The constitutively activated Akt-Mer Tg mice prepared in Example 1 were intraperitoneally administered 10 μl of 10 μg / μl 4-OHT per day (total amount 100 μg / day × 3 days) from the 4th to 6th day after birth. After perfusion fixation from the heart using 4% PFA on the 7th day after birth, a retinal cup was created. Fluorescent immunostaining was performed using anti-PECAM-1 (CD31) antibody and anti-GFAP antibody, and images of the flat-mounted retina were obtained using LSM710 (Zeiss).

[0143] (result) The results are shown in Figure 14. The upper image in Figure 14 shows the results of double staining with anti-PECAM-1 (CD31) antibody and anti-GFAP antibody, and the lower image shows the results of staining with anti-PECAM-1 (CD31) antibody. As a result, in the retinal vascular network of constitutively activated Akt-Mer Tg mice (Akt-Mer) after sustained activation of Akt, no difference was observed in the morphology of astrocytes (GFAP), which serve as a scaffold for vascular elongation, compared to controls. Therefore, it can be understood that the abnormality in the vascular structure due to sustained activation of Akt confirmed in the previous example is due to abnormality in endothelial cells.

[0144] Example 9. Analysis of factors behind vascular morphological abnormalities caused by sustained activation of Akt (VEGF expression level) In this example, we investigated the cause of the abnormal vascular morphology caused by sustained Akt activation, as confirmed in the previous example. Here, we measured the VEGF expression level in the retina of constitutively active Akt-Mer Tg mice after sustained Akt activation.

[0145] (method) To the constitutively active Akt-Mer Tg mice prepared in Example 1, 10 μl of 10 μg / μl 4-OHT per day (total amount 100 μg / day × 3 days) was intraperitoneally administered from the 4th to 6th days after birth. RNA was extracted from the retina excised without perfusion fixation on the 7th day after birth, DNA was synthesized by reverse transcription, and the expression of the VEGF gene was analyzed by quantitative PCR. At this time, the expression of β-actin was also analyzed as a housekeeping gene. Similarly, mice not administered 4-OHT were treated in the same manner as a control and analyzed.

[0146] The primer sequences used here are as follows: For Vegf: 5'-tacacaattcagagcgatgtgtggt-3' (SEQ ID NO: 24) 5'-ctggttcctccaatgggatatcttc-3' (SEQ ID NO: 25) For β-actin: 5'-ggctgtaattcccctccatcg-3' (SEQ ID NO: 26) 5'-ccagttggtaacaatgccatgt-3' (SEQ ID NO: 27)

[0147] (result) The results are shown in Figure 15. This shows a graph measuring the expression level of the VEGF gene. In the constitutively activated Akt-Mer Tg mice (Akt-Mer) after sustained activation of Akt, no difference was observed in the expression of the VEGF gene compared to the control, indicating that the abnormality in vascular morphology is not a secondary change induced by excess VEGF.

[0148] Example 10. Effect of long-term activation of Akt on the retina In this example, we investigated the effect of long-term sustained activation of Akt on the morphology of retinal capillaries in the constitutively active Akt-Mer Tg mice prepared in Example 1. Here, we examined the retinas of constitutively active Akt-Mer Tg mice after Akt activation for a longer period than in the previous example by whole-mount immunostaining.

[0149] (method) The constitutively activated Akt-Mer Tg mice prepared in Example 1 were intraperitoneally administered 10 μl of 1 μg / μl 4-OHT per day (total amount 10 μg / day × 3 days) from the 4th to 6th day after birth, and on the 14th day after birth, fluorescent immunostaining was performed using anti-PECAM-1 (CD31) antibody to obtain images of flat-mounted retinas. Images obtained with an LSM710 (Zeiss) were color-coded by shade according to the depth in the Z direction. As a control, mice not administered 4-OHT were treated in the same manner to obtain images.

[0150] (result) The results are shown in Figure 16. On postnatal day 14, dilation of retinal vascular diameter and decreased vascular density were observed in constitutively activated Akt-Mer Tg mice (Akt-Mer) after sustained activation of Akt.

[0151] Example 11. Effects of the degree and duration of sustained Akt activation on the retina In this example, the influence of the activity and duration of sustained Akt activation on the morphology of retinal capillaries was examined in the constitutively active Akt-Mer Tg mice prepared in Example 1. Here, the activity and duration of sustained Akt activation were controlled by changing the dose and duration of 4-OHT, and morphological changes in the retinal blood vessels of the constitutively active Akt-Mer Tg mice were confirmed by whole-mount immunostaining of the retina.

[0152] (method) The constitutively activated Akt-Mer Tg mice prepared in Example 1 were intraperitoneally administered 10 μl of 4-OHT per day (total amount 100 μg / day x 3 days) from the 4th to 6th days of life, 10 μl of 4-OHT per day (total amount 10 μg / day x 3 days) from the 4th to 6th days of life, and 10 μl of 4-OHT per day (total amount 100 μg / day x 1 day) only on the 4th day of life. The mice were perfused and fixed from the heart using 4% PFA on the 7th day of life, and then a retinal cup was created. Subsequently, fluorescent immunostaining was performed using anti-PECAM-1 antibody. Images of flat-mounted retinas were obtained using AxioObserver (Zeiss), and the images obtained were compared between the groups. As a control, images were obtained by treating mice not administered 4-OHT in the same manner.

[0153] (result) The results are shown in Figure 17. It was confirmed that the degree of microaneurysms differed depending on the dose and administration period of 4-OHT.

[0154] Furthermore, the number of microaneurysms was counted to examine the retinal vascular morphology in detail. In detail, the number of microaneurysms was measured manually by counting the number of microaneurysms per retina using images of flat-mounted retinas. The results are shown in Figure 18. Note that the group that received 10 μl of 10 μg / μl 4-OHT per day (total amount 100 μg / day x 3 days) from the 4th to 6th day after birth had fused vascular aneurysms and could not be counted, so they were excluded from the quantification.

[0155] From the above results, it can be seen that the morphology of retinal capillaries changes depending on the activity level and duration of sustained Akt activation, and that based on the activation pattern such as the activity level and duration of sustained Akt activation, a desired retinal vascular morphology can be formed and the severity of retinal vascular disease can be controlled.

[0156] Example 12. Use in screening of drugs for treating or preventing retinal vascular disease In this example, we investigated the effect of an Akt inhibitor on retinal capillary morphological abnormalities formed by sustained activation of Akt in the constitutively active Akt-Mer Tg mice prepared in Example 1. Here, we confirmed the morphological changes in retinal blood vessels in constitutively active Akt-Mer Tg mice by administration of an Akt inhibitor using retinal whole-mount immunostaining.

[0157] (method) The constitutively active Akt-Mer Tg mice prepared in Example 1 were intraperitoneally administered 10 μl of 10 μg / μl 4-OHT per day (total amount 100 μg / day × 3 days) from the 4th to 6th day after birth. In addition, either mitomycin C, Akt inhibitor 1 (Triciribine), or Akt inhibitor 2 (GSK), which have cell proliferation inhibitory effects, was intraperitoneally administered 24 hours before retina harvest. After perfusion fixation from the heart using 4% PFA for the drug-administered group and drug-non-administered group (Akt-Mer), the retinas were harvested to create retinal cups. Fluorescent immunostaining was performed on the harvested retinas using anti-PECAM-1 antibodies. Images of flat-mounted retinas were obtained using AxioObserver (Zeiss), and the images obtained were compared between the groups. As a control, images were obtained from mice not administered 4-OHT by similar processing.

[0158] (result) The results are shown in Figure 19. The administration of an Akt inhibitor reduced the microaneurysms formed through sustained Akt activation and also eliminated vasodilation caused by sustained Akt activation. Therefore, it can be seen that the constitutively active Akt-Mer Tg mouse (Akt-Mer) model in which Akt is sustainedly activated can be used to evaluate the therapeutic effects of drugs on retinal vascular diseases. [Industrial Applicability]

[0159] The present invention can be used in the fields of medicine, biochemistry, and the like, and in particular can be used to develop treatments, preventions, and diagnostic methods for retinal vascular diseases, such as diabetic retinopathy, and diabetic nephropathy, as well as to analyze the pathology thereof.

Claims

1. A non-human model mammal for retinal vascular disease, comprising: The non-human model mammal has a genome including a nucleic acid sequence encoding a constitutively activated Akt mutant protein, The constitutively active Akt mutant protein is (i) has an E40K or E17K substitution mutation; or (ii) at the N-terminus, the pleckstrin homology (PH) domain is replaced with a myristoylation signal sequence; A transgenic non-human mammal into which a construct containing DNA encoding the constitutively activated Akt mutant protein has been introduced, wherein the DNA is contained in the construct such that the transition of the constitutively activated Akt mutant protein to an activated state is effected by artificial manipulation. By transitioning the constitutively activated Akt mutant protein to an activated state for any period between 1 and 6 days after birth, retinal vascular disease is induced, The retinal vascular disease is selected from diabetic retinopathy, retinopathy of prematurity, retinal vein occlusion, and Coats' disease; and A non-human model mammal for retinal vascular disease, wherein the retinal vascular disease exhibits at least one symptom selected from retinal edema, retinal hemorrhage, retinal capillary aneurysm, and retinal vascular dilation.

2. The non-human mammalian model of retinal vascular disease according to claim 1, wherein the constitutively active Akt mutant protein is a constitutively active Akt mutant protein-Mer.

3. The non-human model mammal of retinal vascular disease according to claim 1, wherein the constitutively active Akt mutant protein is a constitutively active Akt mutant protein whose expression is under the control of the Cre-LoxP system.

4. A method for producing a non-human mammalian model of retinal vascular disease, comprising: A process for producing a transgenic non-human mammalian animal into which a construct containing DNA encoding a constitutively activated Akt mutant protein has been introduced, wherein the DNA is contained in the construct such that transition of the constitutively activated Akt mutant protein to an activated state is effected by artificial manipulation; The DNA is (i) has an E40K or E17K substitution mutation; or (ii) encoding a constitutively active Akt mutant protein in which the pleckstrin homology (PH) domain is replaced with a myristoylation signal sequence at the N-terminus; The step of inducing a retinal vascular disease by transitioning the constitutively activated Akt mutant protein to an activated state for any period from 1 to 6 days after birth, wherein the retinal vascular disease is selected from diabetic retinopathy, retinopathy of prematurity, retinal vein occlusion, and Coats' disease; and A method for producing a non-human model mammal of a retinal vascular disease, wherein the retinal vascular disease exhibits at least one symptom selected from retinal edema, retinal hemorrhage, retinal capillary aneurysm, and retinal vascular dilation.

5. A method for producing a non-human model mammal of retinal vascular disease as described in claim 4, wherein the constitutively activated Akt mutant protein is a constitutively activated Akt mutant protein-Mer, and the transition of the constitutively activated Akt mutant protein to an activated state is carried out by administering 4-hydroxytamoxifen to the transgenic non-human mammal.

6. The method for producing a non-human mammalian model of retinal vascular disease according to claim 5, wherein the 4-hydroxytamoxifen is administered at 5 to 50 μg / g body weight / day for any period from 1 to 6 days after birth.

7. the constitutively active Akt mutant protein is a constitutively active Akt mutant protein whose expression is under the control of the Cre-LoxP system, The transgenic non-human mammal is produced by introducing a construct in which DNA encoding the constitutively activated Akt mutant protein is arranged in a state in which expression of the constitutively activated Akt mutant protein is inhibited by the intervention of a LoxP sequence, wherein the DNA is (i) has an E40K or E17K substitution mutation; or (ii) encoding a constitutively active Akt mutant protein in which the pleckstrin homology (PH) domain is replaced with a myristoylation signal sequence at the N-terminus; A method for producing a non-human model mammal of retinal vascular disease as described in claim 4, wherein the transition of the constitutively activated Akt mutant protein to an activated state is carried out by mating the transgenic non-human mammal with a transgenic non-human mammal that expresses Cre recombinase in a vascular-specific or time-specific manner, and obtaining offspring that can express or induce activity of Cre recombinase in a vascular-specific or time-specific manner in cells containing the construct.

8. A method for screening a drug for treating or preventing a retinal vascular disease, comprising: A step of administering a test substance to a non-human mammalian model of retinal vascular disease according to any one of claims 1 to 3; A step of determining the therapeutic or preventive effect of the test substance, wherein the retinal vascular disease is selected from diabetic retinopathy, retinopathy of prematurity, retinal vein occlusion, and Coats' disease; and A method for screening a drug for treating or preventing a retinal vascular disease, wherein the retinal vascular disease exhibits at least one symptom selected from retinal edema, retinal hemorrhage, retinal capillary microaneurysm, and retinal vascular dilation.

Images