Method for detecting mutations and methylation of tumor-specific genes in ctDNA

Abstract

The present invention discloses a method for detecting tumor-specific gene mutations and methylation in ctDNA, which can simultaneously detect tumor-specific gene mutations (including multiple mutation types such as point mutations, indel mutations, and HBV integration) and / or methylation in ctDNA in a single sample. Not only does this method require a small amount of sample, but the MC library produced by this method can support 10-20 subsequent detections, and any detection result can reflect all mutations and methylation modifications in the region covered by the enzyme cleavage site in the original ctDNA specimen without compromising sensitivity and specificity. The present invention is clinically important for early tumor screening, disease tracking, efficacy evaluation, prognosis prediction, etc., and has great application value.

Description

[Technical field]

[0001] The present invention relates to the field of biomedicine, and in particular to a method for detecting mutations and methylation of tumor-specific genes in ctDNA. [Background technology]

[0002] Circulating tumor DNA (ctDNA) is derived from DNA fragments generated by apoptosis, necrosis or secretion of tumor cells, and contains the same gene mutations and apparent modifications as tumor tissue DNA, such as point mutations, gene rearrangements, fusions, copy number variations, methylation modifications, etc. Detection of ctDNA can be applied in various aspects such as early cancer screening, diagnosis and staging, targeted drug guidance, efficacy evaluation, and recurrence monitoring. The combination of both tumor-specific gene mutation and methylation information contained in ctDNA can help to improve the sensitivity and specificity of detection, which is of great significance for earlier cancer detection and early tumor screening.

[0003] Existing gene mutation detection and methylation detection are different technical means. ctDNA gene mutation detection is essentially detection of low-frequency mutations due to the limitation that the proportion of ctDNA in cfDNA is low. Conventional techniques are divided into two types: 1) PCR-based hotspot mutation detection methods can usually detect one or more hotspot mutations or known mutations, but cannot detect complex mutations such as gene fusions or unknown mutations, and have a relatively small coverage. 2) Capture sequencing: Suitable for detecting multiple targets, including complex mutations, but capture kits are generally expensive, complicated to operate, and time-consuming. When using, it is necessary to select an appropriate detection method based on the number and characteristics of the targets. The advantages of ctDNA methylation markers are that they are distributed as clusters, have higher specificity than gene mutations, have tissue specificity, can trace the origin of the tumor, have a large number of markers, and achieve higher sensitivity. The detection methods include the following: 1) Methylation PCR: DNA loss and reduced sequence diversity due to the bisulfite conversion step make this method difficult to achieve multiplex target detection. 2) Methylation capture based on probe hybridization: It can cover 8%-13% of CpG sites and detect a large number of markers simultaneously, but the starting amount of ctDNA is limited, and the abundance of genomic sequences decreases after bisulfite treatment, so the specificity of the probe is difficult to guarantee. 3) Reduced representation bisulfite sequencing (RRBS) by MspI enzyme digestion, in which the target CpG site is determined by the enzyme digestion site "CCGG", which accounts for about 8-10% of CpG sites, and the recognition of methylated C bases also depends on conversion by bisulfite. The methylation sites detected by RRBS are concentrated in CpG islands and promoter regions, and are low-cost. The above three methods have limited coverage sites in methylation PCR, methylation capture can cover more sites and is more stable than RRBS data, RRBS is the lowest cost and can cover a large number of methylation sites, and the selection should be based on the number and characteristics of the targets.

[0004] Currently, there is no simple, low-cost and reliable means to simultaneously detect two important tumor-specific markers, gene mutations and methylation, in ctDNA. The main challenges are: 1) The amount of ctDNA samples obtained from a single blood draw is limited and can usually only support 1-2 detections, so ctDNA clinical detection is usually single-platform and disposable, making it difficult to simultaneously perform mutation detection and methylation detection using one sample, especially the methylation detection technology based on bisulfite conversion, which results in a lot of DNA loss during processing. 2) The bisulfite conversion step of the methylation detection technique results in a large portion of the DNA sequence being uninformative, and the loss of information contained in this portion of the DNA may lead to a reduced sensitivity in detecting low-frequency mutations. 3) In clinical detection, the purpose and plan of subsequent detection must often be determined based on the initial detection results, which requires re-drawing blood during subsequent detection, resulting in a longer detection cycle.In addition, ctDNA-related clinical detection and research often require the comparison of the merits and demerits of multiple technologies, which requires several times the normal amount of blood samples, which is usually not acceptable to patients. 4) Whether using PCR or capture methods, noise mutations that occur during the amplification process can seriously interfere with the detection of low-frequency ctDNA mutations, resulting in false-positive results and misleading patient diagnosis and treatment. 5) The content of ctDNA mutations is low, and contamination is likely to occur during the operation process, resulting in false positive results. Summary of the Invention

[0005] An object of the present invention is to simultaneously detect mutations and / or methylation of multiple tumor-specific genes in ctDNA.

[0006] First, the present invention provides a method for constructing a sequencing library, comprising the steps of: (1) preparing a DNA sample and enzymatically cleaving it with a methylation-sensitive restriction endonuclease; Step (2) of sequentially performing end repair and 3'-A tailing on the DNA sample enzymatically cleaved in step (1); and (3) linking the DNA sample treated in step (2) with the linkers in the linker mixture and carrying out PCR amplification to obtain a library. the linker mixture consists of n linkers, Each linker is a partial double-stranded structure formed by one upstream primer A and one downstream primer A, the upstream primer A has a sequencing linker A, a random tag, an anchor sequence A, and a base T located at the end (e.g., the 3' end), the downstream primer A has an anchor sequence B and a sequencing linker B, and the partial double-stranded structure is a reverse complement of the anchor sequence A and the anchor sequence B, The sequencing linker A and the sequencing linker B are sequencing linkers selected according to various sequencing platforms; The random tag is 8-14 bp (e.g., 8-10 bp, 10-14 bp, 8 bp, 10 bp, or 14 bp) of random bases, The anchor sequence A is 12-20 bp in length (e.g., 12-16 bp, 16-20 bp, 12 bp, 16 bp, or 20 bp) and has no more than three consecutive repeated bases; The n linkers use n different anchor sequences A, and each anchor sequence A has four types of bases balanced, and the number of mismatched bases is three or more; n is any natural number greater than or equal to 8. The present invention relates to a method for constructing a sequencing library.

[0007] Generally, a linker for constructing a primer is formed by annealing two sequences, and has a "Y" shaped structure, and the complementary paired portions of the two sequences (i.e., anchor sequence A and anchor sequence B) are called anchor sequences, which serve as fixed incorporation tags of sequences to mark the original template molecule.

[0008] The anchor sequence does not interact (eg, form a hairpin structure, a dimer, etc.) with other portions of the primer.

[0009] The upstream primer A may comprise, from the 5' end, a sequencing linker A, a random tag, an anchor sequence A, and a base T in this order.

[0010] The upstream primer A is composed of a sequencing linker A, a random tag, an anchor sequence A, and a base T in this order from the 5' end.

[0011] The downstream primer A may comprise, from the 5' end, an anchor sequence B and a sequencing linker B in this order.

[0012] The downstream primer A is composed of an anchor sequence B and a sequencing linker B in this order from the 5' end.

[0013] The phrase "each anchor sequence A has four types of bases in balance" means that A, T, C and G are evenly distributed.

[0014] The "number of mismatched bases is 3 or more" may mean that the linker mixture contains n anchor sequences A, and at least three bases differ between the anchor sequences A. The differences may be in positions or in order.

[0015] The DNA sample may be a genomic DNA, cDNA, ct DNA or cf DNA sample.

[0016] The n is particularly 12.

[0017] The random tag may in particular be 8 bp of random bases.

[0018] The length of said anchor sequence A may in particular be 12 bp.

[0019] In the case of n=12, the nucleotide sequence of the anchor sequence A may be specifically represented as follows: 30-41 positions from the 5' end of sequence 1 in the sequence listing; 30-41 positions from the 5' end of sequence 3 in the sequence listing; 30-41 positions from the 5' end of sequence 5 in the sequence listing; 30-41 positions from the 5' end of sequence 7 in the sequence listing; 30-41 positions from the 5' end of sequence 9 in the sequence listing; 30-41 positions from the 5' end of sequence 11 in the sequence listing; 30-41 positions from the 5' end of sequence 13 in the sequence listing; 30-41 positions from the 5' end of sequence 15 in the sequence listing; 30-41 positions from the 5' end of sequence 17 in the sequence listing; 30-41 positions from the 5' end of sequence 19 in the sequence listing; 30-41 positions from the 5' end of sequence 21 in the sequence listing; and 30-41 positions from the 5' end of sequence 23 in the sequence listing.

[0020] The sequencing linker A may in particular be the sequencing linker of the Truseq sequencing kit from Illumina. The sequencing linker A may in particular be represented by positions 1-29 from the 5' end of sequence 1 in the sequence listing.

[0021] The sequencing linker B may in particular be a sequencing linker similar to the nextera sequencing kit from Illumina, Inc. The sequencing linker B may in particular be represented by positions 13-41 from the 5' end of sequence 2 in the sequence listing.

[0022] When n=12, the 12 linkers are as follows: The linker 1 may be a partial double-stranded structure formed by a single-stranded DNA molecule shown in sequence 1 of the sequence listing and a single-stranded DNA molecule shown in sequence 2; the linker 2 may be a partial double-stranded structure formed by a single-stranded DNA molecule shown in sequence 3 of the sequence listing and a single-stranded DNA molecule shown in sequence 4; the linker 3 may be a partial double-stranded structure formed by a single-stranded DNA molecule shown in sequence 5 of the sequence listing and a single-stranded DNA molecule shown in sequence 6; the linker 4 may be a partial double-stranded structure formed by a single-stranded DNA molecule shown in sequence 7 of the sequence listing and a single-stranded DNA molecule shown in sequence 8; the linker 5 may be a partial double-stranded structure formed by a single-stranded DNA molecule shown in sequence 9 of the sequence listing and a single-stranded DNA molecule shown in sequence 10; the linker 6 may be a partial double-stranded structure formed by a single-stranded DNA molecule shown in sequence 11 of the sequence listing and a single-stranded DNA molecule shown in sequence 12; and the linker 7 may be The linker 8 may be a partial double-stranded structure formed by a single-stranded DNA molecule shown in sequence 15 and a single-stranded DNA molecule shown in sequence 16 in the sequence listing. The linker 9 may be a partial double-stranded structure formed by a single-stranded DNA molecule shown in sequence 17 and a single-stranded DNA molecule shown in sequence 18 in the sequence listing. The linker 10 may be a partial double-stranded structure formed by a single-stranded DNA molecule shown in sequence 19 and a single-stranded DNA molecule shown in sequence 20 in the sequence listing. The linker 11 may be a partial double-stranded structure formed by a single-stranded DNA molecule shown in sequence 21 and a single-stranded DNA molecule shown in sequence 22 in the sequence listing. The linker 12 may be a partial double-stranded structure formed by a single-stranded DNA molecule shown in sequence 23 and a single-stranded DNA molecule shown in sequence 24 in the sequence listing.

[0023] The linker may be an annealed upstream primer A and downstream primer A.

[0024] In the linker mixture, each linker may be mixed in equimolar amounts.

[0025] The method may further comprise a step of amplifying the library obtained in step (3). The amplification primers are designed based on the linker sequence, i.e., the amplification primers have at least one sequence segment completely identical to the sequence segment with the linker. The primer pair used for the amplification consists of two single-stranded DNA molecules, in particular those shown in the sequence listing, sequence 25 and sequence 26.

[0026] The single-stranded DNA molecule shown in Sequence 25 in the Sequence Listing corresponds to positions 1 to 19 from the 5' end of sequencing linker A.

[0027] The single-stranded DNA molecule shown in Sequence 26 in the Sequence Listing corresponds to positions 1 to 22 from the 3' end of sequencing linker B.

[0028] The present invention also relates to a DNA library constructed by the above method.

[0029] The present invention also relates to a kit for constructing a sequencing library comprising any of the above linker mixtures and a methylation-sensitive restriction endonuclease.

[0030] The kit for constructing said sequencing library particularly comprises a linker mixture as described above and a methylation-sensitive restriction endonuclease.

[0031] The present invention also relates to a kit for detecting tumor mutations and / or methylation in a DNA sample, comprising any of the linker mixtures described above and a combination of primers, the combination of primers comprising primer set I, primer set II, primer set III, primer set IV, primer set V, primer set VI, primer set VII, and primer set VIII; Each primer in the primer set I and the primer set II is a specific primer designed according to a region associated with a tumor mutation, and serves to localize to a specific position in the genome and realize PCR enrichment in the target region; the primer set I and the primer set II are used to detect mutation sites in the DNA plus and minus strands, respectively; Each primer in the primer set III and the primer set IV is a specific primer designed according to a tumor-specific hypermethylated region, and serves to localize to a specific position of the genome and realize PCR enrichment in the target region; the primer set III and the primer set IV are used to detect methylation sites in the DNA plus strand and minus strand, respectively; Each primer in the primer set V, the primer set VI, the primer set VII, and the primer set VIII comprises a linker sequence and a specific sequence, the specific sequence being used to further enrich for a region of interest; In the primer set V and the primer set I, two primers designed for the same mutation site are in a "nested" relationship, In the primer set VI and the primer set II, the two primers designed for the same mutation site are in a "nested" relationship, In the primer set VII and the primer set III, two primers designed for the same methylation site are in a "nested" relationship, In the primer set VIII and the primer set IV, the two primers designed for the same methylation site are in a "nested" relationship.

[0032] The "specific primers designed according to regions associated with tumor mutations" are gene-specific primers specifically designed according to regions of tumor-specific gene mutations (e.g., multiple forms of mutations such as point mutations, indel mutations, HBV integration, etc.).

[0033] The "specific primer designed according to a tumor-specific hypermethylated region" is particularly a gene-specific primer designed according to a tumor-specific hypermethylated region.

[0034] In said kit, said tumor is a liver malignant tumor, i.e. hepatocellular carcinoma.

[0035] The regions associated with said HCC mutations are in particular those associated with hypermutated genes in HCC (TP53, CTNNB1, AXIN1, TERT) and hotspot regions for HBV integration.

[0036] In any of the above kits, the primer set I includes 78 single-stranded DNA molecules, and the nucleotide sequences of the 78 single-stranded DNA molecules are sequentially shown in Sequences 28 to 105 of the Sequence Listing. The primer set II includes 82 single-stranded DNA molecules, and the nucleotide sequences of the 82 single-stranded DNA molecules are sequentially shown in Sequences 106 to 187 of the Sequence Listing. The primer set III includes 14 single-stranded DNA molecules, and the nucleotide sequences of the 14 single-stranded DNA molecules are sequentially shown in Sequences 188 to 201 of the Sequence Listing. The primer set IV includes 15 single-stranded DNA molecules, and the nucleotide sequences of the 15 single-stranded DNA molecules are sequentially shown in Sequences 202 to 216 of the Sequence Listing. The primer set V includes 75 single-stranded DNA molecules, and the 75 single-stranded DNA molecules include the nucleotide sequences shown in the 5'-16th to 3'-3rd positions of Sequences 220 to 294 of the Sequence Listing in this order. The primer set VI includes 79 single-stranded DNA molecules, each of which contains the nucleotide sequences shown in the sequence listing from position 16 to 3' from the 5' end of SEQ ID NO:295 to SEQ ID NO:373 in this order. The primer set VII includes 14 single-stranded DNA molecules, each of which contains the nucleotide sequences shown in the sequence listing from position 16 to 3' from the 5' end of SEQ ID NO:374 to SEQ ID NO:387 in this order. The primer set VIII includes 15 single-stranded DNA molecules, each of which contains the nucleotide sequences shown in the sequence listing from position 16 to 3' from the 5' end of SEQ ID NO:388 to SEQ ID NO:402 in this order.

[0037] In the primer set V, the nucleotide sequences of the 75 single-stranded DNA molecules may be sequentially represented as sequence 220 to sequence 294 in the sequence listing. In the primer set VI, the nucleotide sequences of the 79 single-stranded DNA molecules may be sequentially represented as sequence 295 to sequence 373 in the sequence listing. In the primer set VII, the nucleotide sequences of the 14 single-stranded DNA molecules may be sequentially represented as sequence 374 to sequence 387 in the sequence listing. In the primer set VIII, the nucleotide sequences of the 15 single-stranded DNA molecules may be sequentially represented as sequence 388 to sequence 402 in the sequence listing.

[0038] The primer set I specifically consists of the 78 single-stranded DNA molecules.

[0039] The primer set II specifically consists of the 82 single-stranded DNA molecules.

[0040] The primer set III specifically consists of the 14 single-stranded DNA molecules.

[0041] The primer set IV specifically consists of the 15 single-stranded DNA molecules.

[0042] Said primer set V specifically consists of said 75 single-stranded DNA molecules.

[0043] The primer set VI specifically consists of the 79 single-stranded DNA molecules.

[0044] The primer set VII specifically consists of the 14 single-stranded DNA molecules.

[0045] The primer set VIII specifically consists of the 15 single-stranded DNA molecules.

[0046] Any of the above kits particularly comprises any of the above linker mixtures and a combination of the primers.

[0047] Any of the above-mentioned combinations of primers particularly consists of the primer set I, the primer set II, the primer set III, the primer set IV, the primer set V, the primer set VI, the primer set VII and the primer set VIII.

[0048] Any of the above kits may further include materials for library construction, such as reagents for DNA extraction, reagents for DNA primer construction, reagents for library purification, and reagents for library capture.

[0049] The present invention also relates to any of the above-mentioned primer combinations. The use of said primer combinations may be for the detection of tumor mutations and / or methylation in a DNA sample.

[0050] The present invention also relates to S1) or S2) or S3): S1) Use of any of the above primer combinations in the manufacture of a kit for detecting tumor mutations and / or methylation in a DNA sample; S2) Use of any of the above primer combinations in distinguishing between tumor patient blood samples and non-tumor patient blood samples; S3) Use of any of the above kits in distinguishing between tumor patient blood samples and non-tumor patient blood samples.

[0051] In the above uses, the tumor may be a liver malignancy, i.e. hepatocellular carcinoma.

[0052] The present invention also relates to a method for detecting a target mutation and / or methylation in a DNA sample, the method comprising the steps of: (1) constructing a library by the method according to any one of the above; and (2) performing nested PCR amplification twice on the library obtained in step (1), sequencing the products, and analyzing the occurrence of target mutations and / or methylation in the DNA sample based on the sequencing results; In the step (2), a first PCR amplification is carried out using primer combination A; Primer combination A consists of upstream primer A and downstream primer combination A, the upstream primer A is a library amplification primer for library amplification in step (1), The downstream primer combination A is a combination of Y primers designed according to X target targets, where X and Y are both natural numbers of 1 or more, and X≦Y; A second PCR amplification was performed using the product of the first PCR as a template and primer combination B. Primer combination B consists of upstream primer B, downstream primer combination B, and an index primer; the upstream primer B is a library amplification primer, the 3' end of which is partially identical to the upstream primer A, and is used to amplify the product of the first PCR; The index primer comprises, from the 5' end, a segment A for sequencing, an index sequence for distinguishing a sample, and a segment B for sequencing; The primer in downstream primer combination B may have segment B and be nested with a primer in downstream primer combination A that detects the same target of interest.

[0053] The nucleotide sequence of the upstream primer B may be shown in sequence 217 of the sequence listing.

[0054] The index primer consists of, in particular, segment A, the index sequence and segment B from the 5' end.

[0055] The nucleotide sequence of said segment A may be shown in sequence 218 of the sequence listing.

[0056] The nucleotide sequence of said segment B may be shown in sequence 219 of the sequence listing.

[0057] A portion of the sequence of the upstream primer A is completely identical to the sequence of the "sequencing linker A of the upstream primer A of each linker."

[0058] The upstream primer B completely complements the linker sequence of the library molecule, thereby enabling direct sequencing of the amplified product. The upstream primer B and the upstream primer A (primer for the first PCR amplification) have a partially identical nucleotide sequence.

[0059] The nucleotide sequence of the upstream primer A is particularly shown in sequence 27 of the sequence listing.

[0060] The nucleotide sequence of said upstream primer B is particularly shown in sequence 188 of the sequence listing.

[0061] When the target mutation is a hepatocellular carcinoma mutation, the downstream primer combination A consists of any of the above primer sets I and primer set II. The downstream primer combination B consists of any of the above primer sets V and primer set VI. A first round of PCR amplification is performed on a template using primer set I and primer set II. The product amplified using primer set I is amplified with primer set V as a template for the second round of amplification. The product amplified using primer set II is amplified with primer set VI as a template for the second round of amplification. Finally, the amplified products are mixed in equal volumes.

[0062] When the target methylation is hepatocellular carcinoma methylation, the downstream primer combination A consists of any one of the primer sets III and primer set IV, and the downstream primer combination B consists of any one of the primer sets VII and primer set VIII.

[0063] The first round of PCR amplification is performed on the templates using primer set III and primer set IV, respectively. The product amplified using primer set III is amplified with primer set VII as a template for the second round of amplification. The product amplified using primer set IV is amplified with primer set VIII as a template for the second round of amplification. Finally, the amplified products are mixed in equal volumes.

[0064] In the above method, in the method for analyzing the target mutation in the DNA sample, the DNA molecules whose sequencing data meet the criterion A are backtracked to one molecular cluster, and the molecular clusters that meet the criterion B are marked as a pair of duplex molecular clusters, and one mutation is (a1) supported by at least one pair of duplex molecular clusters (this condition only supports capture sequencing data and does not apply to race data); or (a2) Supported by at least four molecular clusters If the above criteria are met, then the mutation is a true mutation derived from the original DNA sample, and criterion A is: 1. The DNA inserts are the same length and have identical sequences other than the mutation site. 2. The random tag sequences are identical; 3. The anchor sequence must be identical. and criterion B is 4. The DNA inserts are the same length and have identical sequences other than the mutation site. 5. The anchor sequences at both ends of the molecular cluster must be identical but in the opposite positions. It may be so arranged.

[0065] In the above method, in the method for analyzing methylation in the DNA sample, DNA molecules whose sequencing data meet criterion C are marked as clusters, the number of clusters whose fragment ends are the enzyme cleavage site of interest is calculated and recorded as unmethylated fragments, the number of all clusters whose amplified fragments are equal to or larger than the first enzyme cleavage site is calculated and recorded as the total number of fragments, and the average methylation level of the corresponding region is calculated from the number of two types of fragments by methylation level of the region = (1 - number of unmethylated fragments / total number of fragments) x 100%, and criterion C is 6. The random tag sequences are identical; 7. The anchor sequences are identical; 8. The DNA inserts are the same length and have identical sequences other than the mutation site. and the above conditions may be satisfied simultaneously.

[0066] The above-mentioned DNA insert fragments are in particular DNA fragments resulting from amplification other than linkers.

[0067] The present invention also relates to a method for detecting multiple targeted mutations and / or methylations in a DNA sample, the method comprising: (1) constructing a library by the method according to any one of the above; (2) enriching the library of step (1) for a target region, sequencing the library, and analyzing the occurrence of target mutations and / or methylation in the DNA sample based on the sequencing results; may include:

[0068] In the above method, in the method for analyzing a target mutation in the DNA sample, the DNA molecules whose sequencing data meet criterion A are backtracked to one molecular cluster, and the molecular clusters whose sequencing data meet criterion B are marked as a pair of duplex molecular clusters. If a mutation meets the following criteria: (a1) it is supported by at least a pair of duplex molecular clusters, or (a2) it is supported by at least four molecular clusters, the mutation is a true mutation derived from the original DNA sample; and criterion A is: 1. The DNA inserts are the same length and have identical sequences other than the mutation site. 2. The random tag sequences are identical; 3. The anchor sequences are identical and Criterion B is: 4. The DNA inserts are the same length and have identical sequences other than the mutation site. 5. The anchor sequences at both ends of the molecular cluster must be identical but in the opposite positions. It may be so arranged.

[0069] In the above method, in the method for analyzing methylation in the DNA sample, DNA molecules whose sequencing data meets criterion C are marked as clusters, the number of clusters whose fragment ends are the enzyme cleavage site of interest is calculated and recorded as non-methylated fragments, the number of all clusters whose amplified fragments are equal to or larger than the first enzyme cleavage site is calculated and recorded as the total number of fragments, and the average methylation level of the corresponding region is calculated from the number of two types of fragments by methylation level of the region = (1 - number of non-methylated fragments / total number of fragments) x 100%, Criterion C is: 6. The random tag sequences are identical; 7. The anchor sequences are identical; 8. The DNA insert fragments must be the same length and have identical sequences other than the mutation site. It is.

[0070] The target region enrichment may be performed by a conventional commercially available target capture kit (e.g., Agilent sureselect XT target capture kit, Agilent 5190-8646), in which the PCR amplification primer pair in the last step is changed to a primer pair consisting of primer A and primer B. The nucleotide sequence of primer A may be shown in sequence 403 of the sequence listing. The primer B may include segment A, an index sequence, and segment B. The primer B is specifically composed of segment A, the index sequence, and the segment B. The nucleotide sequence of segment A may be shown in sequence 404 of the sequence listing. The nucleotide sequence of segment B may be shown in sequence 405 of the sequence listing.

[0071] In any of the methods above, the targeted mutation and / or methylation may be a tumor mutation and / or methylation. The tumor may be a liver malignancy, i.e. hepatocellular carcinoma.

[0072] In the above, a library of multiple different samples is usually sequenced as a mixture, and the index sequence marks the different samples. After sequencing is completed, the whole sequencing data is divided according to each index sequence. The principle of designing the index is almost the same as the design principle of the anchor sequence described above.

[0073] In the above, when a DNA sample is cut with a methylation-sensitive restriction endonuclease, DNA fragments (at this time, both ends of the DNA fragment become sticky ends, and a part of the nucleotide sequence of the single strand at the end becomes a breakpoint sequence) are formed, and the DNA fragments undergo end repair and are then linked to linkers (the 5' end and the 3' end are each linked to one linker, and the linkers can be the same or reversed), and at this time, in the DNA molecule, the DNA fragment between the two linkers is a DNA insert fragment.

[0074] The present invention provides a method for simultaneously detecting mutations (including multiple forms of mutations such as point mutations, indel mutations, and HBV integration) and / or methylation of tumor-specific genes in ctDNA in one sample, and not only does it require a small amount of sample, but the MC library produced by the method can support 10-20 subsequent detections, and any detection result can reflect the methylation modification of the region covered by the mutation and enzyme cleavage site of all the original ctDNA specimens without reducing the sensitivity and specificity. The library constructed using the method can be used for both PCR hotspot detection and capture sequencing, and the added DNA barcode can effectively eliminate false positive results, thus achieving high-specificity sequencing based on duplex. In addition, the library construction method can be applied not only to cfDNA samples but also to genomic DNA and cDNA samples. The present invention is clinically important for early tumor screening, disease tracking, efficacy evaluation, prognosis prediction, etc., and has high application value. [Brief description of the drawings]

[0075] [Figure 1] Schematic diagram of adapter and primer structures. [Diagram 2] Schematic of RaceSeq target region enrichment and library construction. [Diagram 3] Schematic diagram of capture and duplex sequencing for MC libraries. [Figure 4] 1 shows the results of detecting the methylation level of the AK055957 gene by the Padlock method and the mutation / methylation co-detection method (i.e., the method provided by the present invention). [Diagram 5] The results show the mutation and mutation frequency obtained by the mutation-only detection method and the mutation / methylation co-detection method. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0076] The following examples will aid in understanding the present invention but are not intended to be limiting thereof.

[0077] Unless otherwise stated, the experimental methods in the following examples are conventional. Unless otherwise specified, the test materials used in the following examples were purchased from general biochemical reagent stores. All quantitative tests in the following examples were performed in triplicate and the results were averaged.

[0078] The TE buffer used in the following examples is a product of ThermoFisher, catalog number 12090015. In the following examples, informed consent was obtained from patients with hepatocellular carcinoma regarding the contents of the present invention.

[0079] Example 1, Construction of MC library 1. Enzymatic cleavage by methylation-sensitive restriction endonucleases A reaction system was prepared using 5-40 ng of cfDNA as shown in Table 1, and then enzyme cleavage was performed using a PCR device according to the program described in Table 2 to obtain the enzyme cleavage product (stored at 4°C). Both Restriction Enzyme and Restriction Enzyme 10x Buffer are products of ThermoFisher Inc. Restriction Enzyme and Restriction Enzyme 10x Buffer may be selected according to the target region to be detected, based on the criterion that the region to be detected contains at least one enzyme cleavage site by the methylation-sensitive restriction endonuclease.

[0080] JPEG0007614192000001.jpg50170

[0081] JPEG0007614192000002.jpg24170

[0082] 2. Purification of enzyme cleavage products The enzymatic cleavage products obtained in step 1 were analyzed using Apostle MiniMax TM The purified product was obtained by purification and concentration using a High Efficiency Cell-Free DNA Isolation Kit (standard version) (Apostle product, catalog number A17622-50).

[0083] 3. Repair of blunt ends of purified products and A-tailing treatment For the purified product obtained in step 2, a reaction system was prepared as shown in Table 3, and then end repair and 3'-end A tailing were performed using a PCR device according to the reaction program in Table 4 to obtain the reaction product (stored at 4°C).

[0084] JPEG0007614192000003.jpg43170

[0085] JPEG0007614192000004.jpg30170

[0086] 4. Linking reaction products and adapters A reaction system was prepared as shown in Table 5, and reacted at 20° C. for 15 minutes to obtain a ligated product (stored at 4° C.).

[0087] JPEG0007614192000005.jpg56170

[0088] Adapter sequence information is shown in Table 6. Each of the single-stranded DNA molecules listed in Table 6 was dissolved in TE buffer and diluted to a concentration of 100 μM. Two single-stranded DNA molecules of the same group were mixed in equal volumes (50 μl each), and then annealed (annealing procedure: 95°C, 15 min; 25°C, 2 h (hours)) to obtain 12 groups of DNA solutions, and the 12 groups of DNA solutions were mixed in equal volumes to obtain the Adapter Mix.

[0089] JPEG0007614192000006.jpg242170JPEG0007614192000007.jpg104170

[0090] In Table 6, N of 8 represents a random tag of 8 bp. In practical applications, the random tag length may be 8-14 bp. The underlined parts represent the 12bp anchor sequence, and in the upstream sequence (those with "F" in the name are upstream sequences) and downstream sequence (those with "R" in the name are downstream sequences) of each group, the underlined parts are reverse-complementary, and the upstream sequence and downstream sequence are linked by annealing to form a linker. The anchor sequence may also mark the original template molecule as an incorporation tag with a fixed sequence. In practical applications, the length of the anchor sequence may be 12-20bp, with no more than 3 consecutive repeat bases, and no interaction with other parts of the primer (e.g., formation of hairpin structures, dimers, etc.), with balanced bases (i.e., A, T, C, and G are evenly distributed) at all positions of the 12 groups, and with 3 or more mismatched bases (i.e., at least 3 bases are different between the anchor sequences, and the differences are in position or order). The bolded T at the end of the upstream sequence is complementary to the "A" at the end of the original molecule, resulting in TA ligation. In the upstream sequence, positions 1 to 21 from the 5' end (Illumina's Truseq sequencing kit) are a sequencing primer binding sequence, and positions 1 to 19 from the 5' end are a library amplification primer portion. In the downstream sequence, the non-underlined portion (Illumina's nextera sequencing kit) is the sequencing primer binding sequence, in which positions 1 to 22 from the 3' end are the library amplification primer portion.

[0091] In Table 6, a total of 12 groups of linkers are included, and 12 x 12 = 144 types of mark combinations can be formed. When combined with the sequence information of the molecule itself, this is sufficient to distinguish all molecules in the original sample. In practical applications, the number of groups can be appropriately increased (higher synthesis costs) or decreased (slightly worse discrimination effect).

[0092] The structure of the ligation product is shown in Figure 1, where a is the linker moiety, b and f are library amplification primers, c is an 8 bp random tag (represented by 8 Ns in Table 6), d is a 12 bp anchor sequence (represented by underline in Table 6), and e is the insert (cfDNA).

[0093] V. Purification of the ligated product To the ligation product obtained in step 4, add 110-220 μl (i.e., 1-2 times the volume) of AMPure XP magnetic beads (Beckman A63880), mix thoroughly with a vortex, leave at room temperature for 10 minutes, adsorb on a magnetic rack for 5 minutes, and when the solution becomes clear, discard the supernatant. Then, add 200 μl of 80% by volume ethanol aqueous solution to wash twice, discard the supernatant, and after the ethanol has evaporated, add 30 μl of DNase / RNase-Free Water, mix thoroughly with a vortex, leave at room temperature for 10 minutes, adsorb on a magnetic rack for 5 minutes, and aspirate the supernatant solution into a PCR tube to use as a PCR template.

[0094] 6. Library amplification and purification 1. Using the PCR template obtained in step 5, the reaction system was prepared as shown in Table 7, and PCR amplification was performed as shown in Table 8 to obtain the PCR amplified product (stored at 4°C).

[0095] JPEG0007614192000008.jpg49170

[0096] In Table 7, the primer information is as follows: MC_F (sequence 25): 5'-GACACGACGCTCTTCCGAT-3'; MC_R (sequence 26): 5'-GTGGGCTCGGAGATGTGTATAA-3'.

[0097] JPEG0007614192000009.jpg50170

[0098] 2. Add 70-140μl (i.e. 1-2 times the volume) of AMPure XP magnetic beads to the PCR amplified product obtained in step 1, mix evenly with a vortex, leave at room temperature for 10 minutes, adsorb with a magnetic rack for 5 minutes, discard the supernatant when the solution becomes clear, add 200μl of 80% ethanol solution by volume, wash twice, discard the supernatant, add 100μl of DNase / RNase-Free Water after the ethanol has evaporated, mix evenly with a vortex, leave at room temperature for 10 minutes, adsorb with a magnetic rack for 5 minutes, aspirate the supernatant solution, and obtain the product (store at -20℃). The product is an MC library that can be stored for a long time and used repeatedly. As a result of the detection, the MC library can support 10-20 subsequent detections, and the results of each detection can reflect all the mutations of the original sample and the methylation modification of the region covered by the enzyme cleavage site, without reducing the sensitivity and specificity. In addition, the library construction method can be applied not only to cfDNA samples but also to genomic DNA or cDNA samples.

[0099] Example 2. Enrichment of target regions and sequencing library construction by RaceSeq As shown in Figure 2, primers designed for the relevant regions of Chinese HCC hypermutated genes (TP53, CTNNB1, AXIN1, TERT), HBV integration hotspot regions, and HCC-specific hypermethylated regions (EMX1, LRRC4, BDH1, etc.) were combined with predetermined primers to perform two rounds of PCR amplification on the MC library, and the amplified products were the sequencing library. In Figure 2, a is the upstream primer for the first library amplification, b is the upstream primer for the second library amplification, c is the downstream primer library for the first library amplification for specific enrichment of the target sequence, d is the downstream primer library for the second library amplification for specific enrichment of the target sequence, and e is the index primer for adding the index sequence.

[0100] 1. 300 ng of the MC library produced in Example 1 was divided into two parts to prepare the reaction system shown in Table 9 (one part was added to the GSP1A mix and the other part was added to the GSP1B mix), and the first PCR amplification was performed according to the reaction program shown in Table 11 to obtain the first amplification product (a total of two first amplification products were obtained, one of which was the amplification product of the GSP1A mix and the other was the amplification product of the GSP1B mix).

[0101] JPEG0007614192000010.jpg49170

[0102] In Table 9, the primer information is as follows: Upstream primer 1355 (sequence 27): 5'-TCTTTCCCTACACGACGCTCTTCCGAT-3'. GSP1A mix: Each primer belonging to primer pool GSP1A in Table 10 was dissolved in TE buffer and diluted to a concentration of 100 μM, then mixed in equal volumes and diluted to 0.3 μM with TE buffer. Primers in primer pool GSP1A are used for amplifying the plus strand of the template. GSP1B mix: Each primer belonging to primer pool GSP1B in Table 10 was dissolved in TE buffer and diluted to a concentration of 100 μM, then mixed in equal volumes and diluted to 0.3 μM with TE buffer. Primers in primer pool GSP1B are used for amplifying the minus strand of the template. In primer pool GSP1A and primer pool GSP1B, the same mutation site was detected in the forward and reverse directions for primers with the same number (i.e., the last four digits of the primer number were the same), and the original molecular information that could be maximally enriched was used.

[0103] JPEG0007614192000011.jpg236170JPEG0007614192000012.jpg237170JPEG0007614192000013.jpg237170JPEG00076141920 00014.jpg231170JPEG0007614192000015.jpg237170JPEG0007614192000016.jpg231170JPEG0007614192000017.jpg244170

[0104] JPEG0007614192000018.jpg49170

[0105] 2. The two first-round amplification products obtained in step 1 were each purified with 30-60 μl (i.e., 1-2 times the volume) of AMPure XP magnetic beads, and then eluted with 25 μl of DNase / RNase-Free Water to obtain the first-round purified products.

[0106] 3. Using the first purified products obtained in step 2 as templates, the reaction system described in Table 12 was prepared (when the GSP1A mix amplification product was used as a template, amplification was performed with the GSP2A mix; when the GSP1B mix amplification product was used as a template, amplification was performed with the GSP2B mix). A second PCR amplification was performed according to the reaction program described in Table 14 to obtain the second amplification product (stored at 4°C).

[0107] JPEG0007614192000019.jpg56170

[0108] In Table 12, the primer information is as follows: Upstream primer 3355 (sequence 217): 5'-AATGATACGGCGACCACCGAGATCTACAC TCTTTCCCTACACGACGCTCT -3'; the underlined portion is the same portion of the first upstream primer 1355, and 3355 and 1355 are all fixed sequences for Illumina sequencing platform sequencing (they may be changed to sequences that can be sequenced on other sequencing platforms). GSP2A mix: Each primer belonging to primer pool GSP2A in Table 13 was dissolved in TE buffer and diluted to a concentration of 100 μM, then mixed in equal volumes and diluted to 0.3 μM with TE buffer. Primers in primer pool GSP2A are used for amplifying the plus strand of the template. GSP2B mix: Each primer belonging to primer pool GSP2B in Table 13 was dissolved in TE buffer and diluted to a concentration of 100 μM, then mixed in equal volumes and diluted to 0.3 μM with TE buffer. Primers in primer pool GSP2B are used for amplifying the minus strand of the template.

[0109] In Table 13, positions 1 to 15 from the 5' end are the portion that is bound to the Index primer. In the GSP2A mix and GSP1A mix, primers with the same primer number (i.e., the last four digits of the primer number are the same) were designed for the same mutation site, and the two primers are in a nested relationship. In the GSP2B mix and the GSP2A mix, primers with the same primer number (i.e., the last four digits of the primer number are the same) were designed for the same mutation site, and the two primers are in a nested relationship. Index primer: 5'-CAAGCAGAAGACGGCATACGAGAT (sequence 218)********GTGACTGGAGTTC CTTGGCACCCGAGAA -3' (sequence 219); the underlined part is the part that is bound to the GSP2 mix. ******** is the index sequence position. The index is 6-8 bp in length and contributes to distinguishing sequences between samples and sequencing multiple samples mixed together. In addition to the index sequence, the rest are all fixed sequences derived from Illumina's small RNA sequencing kit.

[0110] JPEG0007614192000020.jpg236170JPEG0007614192000021.jpg231170JPEG0007614192000022.jpg23117 0JPEG0007614192000023.jpg231170JPEG0007614192000024.jpg231170JPEG0007614192000025.jpg23117 0JPEG0007614192000026.jpg231170JPEG0007614192000027.jpg231170JPEG0007614192000028.jpg23217 0JPEG0007614192000029.jpg231170JPEG0007614192000030.jpg231170JPEG0007614192000031.jpg62170

[0111] JPEG0007614192000032.jpg70170

[0112] 4. The products of the second amplification using the GSP2A mix obtained in step 3 and the products of the second amplification using the GSP1B mix were mixed in equal volumes and purified in a 1:(1-2) ratio using AMPure XP magnetic beads, and then eluted with 50 μl of DNase / RNase-Free Water to obtain a sequencing library that could be sequenced on the Illumina Hiseq X platform as the second purification product. The DNA random tag in the MC library was added downstream of the Read1 sequence of the sequencing library along with the cfDNA sequence. During sequencing, the DNA random tag sequence, anchor sequence, and cfDNA sequence (sequences c, d, and e in Figure 1) were obtained sequentially.

[0113] A method for analyzing hepatocellular carcinoma-specific gene mutations: The sequencing data backtracks DNA molecules that meet criterion A to one molecular cluster, and marks the molecular clusters that meet criterion B as a pair of duplex molecular clusters. If a mutation meets the following criteria: (a1) it is supported by at least one pair of duplex molecular clusters, or (a2) it is supported by at least four molecular clusters, the mutation is a true mutation derived from the original DNA sample; and criterion A is: 1. The DNA inserts are the same length and have identical sequences other than the mutation site. 2. The random tag sequences are identical; 3. The anchor sequences are identical Criterion B is to simultaneously satisfy the above criteria. 4. The DNA inserts are the same length and have identical sequences other than the mutation site. 5. The anchor sequences at both ends of the molecular cluster must be identical but in the opposite positions. It is. Analysis method for the degree of hepatocellular carcinoma-specific methylation modification: Mark DNA molecules whose sequencing data meets criterion C as clusters, calculate the number of clusters whose fragment ends are the enzyme cleavage site of interest, and record them as unmethylated fragments. Calculate the number of all clusters whose amplified fragments are equal to or greater than the first enzyme cleavage site, and record them as the total number of fragments. From the numbers of the two types of fragments, calculate the average methylation level of the corresponding region by the formula: methylation level of the region = (1-number of unmethylated fragments / total number of fragments) x 100%, and criterion C is: 6. The random tag sequences are identical; 7. The anchor sequences are identical; 8. The DNA insert fragments must be the same length and have identical sequences other than the mutation site. It is.

[0114] Example 3. Capturing and sequencing MC libraries As shown in Figure 3, the target region enrichment may be captured by optimizing the design based on a conventional commercially available target capture kit. For example, the capture based on the methylation region may refer to Roche SeqCap Epi CpGiant Enrichment Kit (Roche 07138881001) or Illumina Infinium Methylation EPIC BeadChip WG-317-1001), and the design of the capture targeting the methylation region requires selection according to the degree of coverage of the enzyme cleavage site and adjustment of the base converted by bisulfite treatment in the probe. The capture based on the gene mutation region may refer to Agilent sureselect XT target capture kit (Agilent 5190-8646), except that the primers for PCR amplification in the last step are changed to the following primers. Upstream primer: 5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCT ACACGACGCTCTTCCGAT CT-3' (sequence 403) ("a" in Figure 3), the underlined part is the same as the primer MC_F part and is for library amplification, and the remaining part is a fixed sequence required for sequencing on the Illumina sequencing platform. Downstream primer: 5'-CAAGCAGAAGACGGCATACGAGAT (sequence 404)********GTCTC GTGGGCTCGGAGATGTGTATAA -3' (sequence 405) ("b" in Figure 3), the underlined part is the same as primer MC_R, and is for library amplification. ******** is the index sequence position, which is 6-8 bp in length and contributes to distinguishing sequences between samples and sequencing multiple samples mixed together. The remaining part is a fixed sequence required for sequencing on the Illumina sequencing platform. The post-capture library contains the same DNA random tag sequence, anchor sequence, and cfDNA sequence as the MC library, and is located downstream of Read1 in that order.

[0115] Backtrack to a molecular cluster for DNA molecules whose sequencing data meets criterion A, where A is 1. The DNA inserts are the same length and have identical sequences other than the mutation site. 2. The random tag sequences are identical; 3. The anchor sequences are identical The molecular clusters that satisfy criterion B are marked as a pair of duplex molecular clusters, and criterion B is 4. The DNA inserts are the same length and have identical sequences other than the mutation site. 5. The anchor sequences at both ends of the molecular cluster must be identical but in the opposite positions. If a mutation satisfies (a1) at least one pair of duplex molecular clusters, or (a2) at least four molecular clusters, the mutation is a true mutation derived from the original DNA sample. Mutations supported by a pair of duplex molecular clusters are more reliable and can reduce false positive mutations by 90%. DNA molecules whose sequencing data meet criterion C are marked as clusters, and the number of clusters whose fragment ends are the enzyme cleavage site of interest is calculated and recorded as unmethylated fragments. The number of all clusters whose amplified fragments are equal to or greater than the first enzyme cleavage site is calculated and recorded as the total number of fragments. The average methylation level of the corresponding region is calculated from the number of the two types of fragments by the formula: methylation level of the region = (1 - number of unmethylated fragments / total number of fragments) x 100%, and criterion C is: 6. The random tag sequences are identical; 7. The anchor sequences are identical; 8. The DNA insert fragments must be the same length and have identical sequences other than the mutation site. It is.

[0116] Example 4: Comparison of detection methods 1. Comparison of detection methods 1, cfDNA specimens were collected from 21 patients with HCC. 2. After completing step 1, for each cfDNA specimen, an MC library was constructed according to the method of Example 1, and then RaceSeq target region enrichment was performed according to the method of Example 2, followed by sequencing to obtain the methylation level of the AK055957 gene. 3. After completing step 1, the methylation level of the AK055957 gene was detected for each cfDNA specimen by the Padlock method (Xu RH, Wei W, Krawczyk M, et al. Circulating tumour DNA methylation markers for diagnosis and prognosis of hepatocellular carcinoma[J]. Nature Materials, 2017, 16(11):1155.). Padlock is a methylation-targeted sequencing technology, and the Padlock probe has a padlock-like conformation, is applicable to methylation-targeted high-throughput sequencing, and is an efficient construction method after bisulfite conversion, also known as "BSPP". After bisulfite conversion of cfDNA, the capture arm of the bisulfite lock probe (BSPP) is paired with the complementary arm, which is amplified and ligated into a loop. The exonuclease-ligated lock probe is then selected, and the amplified product is sequenced to obtain the corresponding DNA methylation information. The results are shown in Figure 4. As is clear from the results, the Padlock method and the mutation / methylation co-detection method (i.e., the method provided by the present invention) showed almost the same detection results for the methylation level of the AK055957 gene (hepatocellular carcinoma-specific gene).

[0117] 2. Comparison of detection methods 2 1. Detection of mutations and mutation frequencies by co-detection of mutations and methylation (1) cfDNA was collected from a patient with hepatocellular carcinoma. (2) After completing step (1), the reaction system shown in Table 1 was prepared using 5-40 ng of cfDNA, and then the enzyme cleavage treatment was performed using a PCR device to obtain the enzyme cleavage product (stored at 4 ° C.). Here, the time of the enzyme cleavage treatment was 0 h, 0.2 h, 0.4 h, 0.6 h, 0.8 h, or 1 h. (3) After completing step (2), the enzyme cleavage product is used to construct an MC library according to the methods of Example 1 2 to 6, and then the RaceSeq target region enrichment is performed according to the method of Example 2, and sequencing is performed. In data analysis, the DNA molecular sequencing data with the same random tag sequence, the same DNA insert fragment length, and the same sequence except the mutation site are backtracked to one molecular cluster, and if the number of molecules in the cluster is >5, and the molecular mutation match rate in the cluster is >80%, and the number of clusters is ≧5, the mutation is a true mutation derived from the original DNA sample. The proportion of clusters containing the molecular mutation is the mutation frequency. 2. Detection of mutations and mutation frequencies using mutation-only detection methods (1) cfDNA was collected from a patient with hepatocellular carcinoma. (2) After completing step (1), the reaction system shown in Table 3 was prepared using 5-40 ng of cfDNA, and then end repair and 3'-end A tailing were performed using a PCR device according to the reaction program in Table 4 to obtain the reaction product (stored at 4°C). (3) After completing step (2), the reaction product is used to construct an MC library according to the methods of Example 1 4 to 6, and then the RaceSeq target region enrichment and sequencing are performed according to the method of Example 2. In data analysis, the DNA molecular sequencing data with the same random tag sequence, the same DNA insert fragment length, and the same sequence except for the mutation site are backtracked to one molecular cluster, and if the number of molecules in the cluster is >5, the molecular mutation match rate in the cluster is >80%, and the number of clusters is ≥5, the mutation is a true mutation from the original DNA sample. The proportion of clusters containing the molecular mutation is the mutation frequency. 3. For the mutation site, the mutation frequency obtained by the mutation / methylation co-detection method is plotted as the abscissa and the mutation frequency obtained by the mutation-only detection method is plotted as the ordinate. A linear fit curve and correlation coefficient R 2 was added. The results are shown in Figure 5. As is clear from the results, the mutation / methylation co-detection method and the mutation-only detection method gave almost identical detection results for mutations and mutation frequencies, i.e., methylation detection did not affect mutation detection.

[0118] Example 5, Accuracy Experiment The mutation standard is a product of Horizon Discovery, Inc., catalog number HD701.

[0119] 1. Accuracy Experiment 1 1. Using the mutant standard, an MC library was constructed according to methods 1 to 6 of Example 1, and then RaceSeq target region enrichment was performed according to the method of Example 2 (except that in step 3, the GSP2A mix was changed to GSP2A mix-1, and the GSP2B mix was changed to GSP2B mix-1), and sequencing was performed. GSP2A mix-1: Each primer belonging to primer pool GSP2A in Table 15 was dissolved in TE buffer and diluted to a concentration of 100 μM, then mixed in equal volumes and diluted to 0.3 μM with TE buffer. Primers in primer pool GSP2A are used for amplification of the plus strand of the template. GSP2B mix-1: Each primer belonging to primer pool GSP2B in Table 15 was dissolved in TE buffer and diluted to a concentration of 100 μM, then mixed in equal volumes and diluted to 0.3 μM with TE buffer. Primers in primer pool GSP2B are used for amplifying the minus strand of the template.

[0120] JPEG0007614192000033.jpg238170JPEG0007614192000034.jpg38170

[0121] 2. Based on the sequencing results, the mutation frequency of the mutation site was obtained. The detection results are shown in Table 16. As is clear from the results, the mutation frequency of the mutation site obtained by the mutation / methylation co-detection method for the mutation standard sample is close to the theoretical value. This shows that the mutation / methylation co-detection method has high accuracy in detecting mutations in hepatocellular carcinoma-specific genes (e.g., CTNNB1 gene, TP53 gene, AXIN1 gene).

[0122] JPEG0007614192000035.jpg175170

[0123] II. Accuracy Experiment 2 Human methylated and unmethylated standards are from Zymo Research, catalog number D5014. 1. Among the human methylated and unmethylated standards, the methylated standard and the unmethylated standard were mixed in different ratios to obtain test samples. In the test samples, the proportion of the methylated standard was 0%, 20% or 100%, that is, the methylation proportion of tumor-specific genes (BDH1 gene, EMX1 gene, LRRC4 gene, CLEC11A gene, HOXA1 gene, AK055957 gene, COTL1 gene, ACP1 gene or DAB2IP gene) was 0%, 20% or 100%. 2. Using the test samples, an MC library was constructed according to the method of Example 1, and then RaceSeq target region enrichment was performed according to the method of Example 2, followed by sequencing to obtain the detection value of the methylation sites. The detection results are shown in Tables 17 and 18 (the last four digits of the sample type are the names of the tumor-specific genes). When the mutation / methylation co-detection method was used to detect the methylation standard, the detection values ​​were almost close to the theoretical values. This indicates that the mutation / methylation co-detection method has high detection accuracy for the methylation levels of tumor-specific genes (e.g., BDH1 gene, EMX1 gene, LRRC4 gene, CLEC11A gene, HOXA1 gene, AK055957 gene, COTL1 gene, ACP1 gene, and DAB2IP gene).

[0124] JPEG0007614192000036.jpg114170

[0125] JPEG0007614192000037.jpg99170

[0126] Example 6. Use of the mutation / methylation co-detection method in hepatocellular carcinoma patient cfDNA 1. cfDNA was extracted from blood samples from one healthy subject, one patient with cirrhosis, and three patients with hepatocellular carcinoma. 2. Using 5-40 ng of cfDNA, an MC library was constructed as in Example 1, and RaceSeq target region enrichment was performed and sequenced using the method in Example 2. 3. The methylation detection results are shown in Tables 19 and 20. As a result, the methylation levels of HCC-specific hypermethylated genes were higher in HCC samples than in non-HCC samples. The mutation / methylation co-detection method was useful for detecting HCC cfDNA samples.

[0127] JPEG0007614192000038.jpg120170

[0128] JPEG0007614192000039.jpg105170 [Industrial Applicability]

[0129] The present invention discloses a method for simultaneously detecting mutations (including multiple forms of mutations such as point mutations, indel mutations, HBV integration, etc.) and / or methylation of tumor-specific genes in ctDNA in one sample, and not only does it require a small amount of sample, but the MC library produced by the method can support 10-20 subsequent detections, and any detection result can reflect the mutations of all the original ctDNA specimens and the methylation modification of the region covered by the enzyme cleavage site without reducing the sensitivity and specificity. In addition, the library construction method can be applied to genomic DNA or cDNA samples as well as cfDNA samples. The present invention is clinically important for early tumor screening, disease tracking, efficacy evaluation, prognosis prediction, etc., and has high application value.

Claims

1. 1. A method for constructing a sequencing library, comprising: (1) preparing a DNA sample and enzymatically cleaving it with a methylation-sensitive restriction endonuclease; Step (2) of sequentially performing end repair and 3'-A tailing on the DNA sample enzymatically cleaved in step (1); Step (3) of ligating the DNA sample treated in step (2) with the linkers in the linker mixture and carrying out PCR amplification to obtain a library; and step (4) of amplifying the library obtained in step (3), The linker mixture consists of 12 linkers, Each linker has a partial double-stranded structure formed by one upstream primer A and one downstream primer A, the upstream primer A includes, from the 5' end, a sequencing linker A, a random tag, an anchor sequence A, and a base T located at the end, in this order, and the downstream primer A includes, from the 5' end, an anchor sequence B and a sequencing linker B, in this order, and the partial double-stranded structure is such that the anchor sequence A and the anchor sequence B are reverse-complementary, The sequencing linker A and the sequencing linker B are different sequencing linkers; The random tag is 8-14 bp of random bases, The 12 linkers use 12 different anchor sequences A, and each anchor sequence A has 4 types of bases balanced, and the number of mismatched bases is 3 or more; Specifically, the nucleotide sequence of the anchor sequence A is represented by the following: 30-41 positions from the 5' end of sequence 1 in the sequence listing; 30-41 positions from the 5' end of sequence 3 in the sequence listing; 30-41 positions from the 5' end of sequence 5 in the sequence listing; 30-41 positions from the 5' end of sequence 7 in the sequence listing; 30-41 positions from the 5' end of sequence 9 in the sequence listing; 30-41 positions from the 5' end of sequence 11 in the sequence listing; 30-41 positions from the 5' end of sequence 13 in the sequence listing; 30-41 positions from the 5' end of sequence 15 in the sequence listing; 30-41 positions from the 5' end of sequence 17 in the sequence listing; 30-41 positions from the 5' end of sequence 19 in the sequence listing; 30-41 positions from the 5' end of sequence 21 in the sequence listing; and 30-41 positions from the 5' end of sequence 23 in the sequence listing. Linker 1 is a partial double-stranded structure formed by a single-stranded DNA molecule shown in sequence 1 of the sequence listing and a single-stranded DNA molecule shown in sequence 2; linker 2 is a partial double-stranded structure formed by a single-stranded DNA molecule shown in sequence 3 of the sequence listing and a single-stranded DNA molecule shown in sequence 4; linker 3 is a partial double-stranded structure formed by a single-stranded DNA molecule shown in sequence 5 of the sequence listing and a single-stranded DNA molecule shown in sequence 6; linker 4 is a partial double-stranded structure formed by a single-stranded DNA molecule shown in sequence 7 of the sequence listing and a single-stranded DNA molecule shown in sequence 8; linker 5 is a partial double-stranded structure formed by a single-stranded DNA molecule shown in sequence 9 of the sequence listing and a single-stranded DNA molecule shown in sequence 10; linker 6 is a partial double-stranded structure formed by a single-stranded DNA molecule shown in sequence 11 of the sequence listing and a single-stranded DNA molecule shown in sequence 12; linker 7 is a partial double-stranded structure formed by a single-stranded DNA molecule shown in sequence 12 of the sequence listing. , a partial double-stranded structure is formed by a single-stranded DNA molecule shown in sequence 13 and a single-stranded DNA molecule shown in sequence 14 in the sequence listing; linker 8, a partial double-stranded structure is formed by a single-stranded DNA molecule shown in sequence 15 and a single-stranded DNA molecule shown in sequence 16 in the sequence listing; linker 9, a partial double-stranded structure is formed by a single-stranded DNA molecule shown in sequence 17 and a single-stranded DNA molecule shown in sequence 18 in the sequence listing; linker 10, a partial double-stranded structure is formed by a single-stranded DNA molecule shown in sequence 19 and a single-stranded DNA molecule shown in sequence 20 in the sequence listing; linker 11, a partial double-stranded structure is formed by a single-stranded DNA molecule shown in sequence 21 and a single-stranded DNA molecule shown in sequence 22 in the sequence listing; and linker 12, a partial double-stranded structure is formed by a single-stranded DNA molecule shown in sequence 23 and a single-stranded DNA molecule shown in sequence 24 in the sequence listing. The primer pair used in the amplification in step (4) is composed of two single-stranded DNA molecules represented by SEQ ID NO:25 and SEQ ID NO:26 in the sequence listing. How to build it:

2. The method for constructing a linker according to claim 1, characterized in that the number of mismatched bases is 3 or more means that the linker mixture contains n anchor sequences A, and the anchor sequences A differ in at least three bases, and the differences are differences in position or order.

3. The method of claim 1, wherein the DNA sample is a genomic DNA, cDNA, ct DNA or cf DNA sample.

4. A DNA library constructed by the method according to any one of claims 1 to 3.

5. A kit for constructing a sequencing library by the construction method of any one of claims 1 to 3, comprising a linker mixture of any one of claims 1 to 3 and a methylation-sensitive restriction endonuclease.

6. A kit for detecting tumor mutations and / or methylation in a DNA sample, comprising the linker mixture according to any one of claims 1 to 3 and a combination of primers, the combination of primers comprising primer set I, primer set II, primer set III, primer set IV, primer set V, primer set VI, primer set VII and primer set VIII, Each primer in the primer set I and the primer set II is a specific primer designed according to a region associated with a tumor mutation, and serves to localize to a specific position in the genome and realize PCR enrichment in the target region; the primer set I and the primer set II are used to detect mutation sites in the DNA plus and minus strands, respectively; Each primer in the primer set III and the primer set IV is a specific primer designed according to a tumor-specific hypermethylated region, and localizes to a specific position of the genome to realize PCR enrichment in the target region. The primer set III and the primer set IV are used to detect methylation sites in the positive and negative strands of DNA, respectively; Each primer in the primer set V, the primer set VI, the primer set VII, and the primer set VIII comprises a linker sequence and a specific sequence, and the specific sequence is used to further enrich the region of interest; In the primer set V and the primer set I, two primers designed for the same mutation site are in a "nested" relationship, In the primer set VI and the primer set II, two primers designed for the same mutation site are in a "nested" relationship, In the primer set VII and the primer set III, two primers designed for the same methylation site are in a "nested" relationship, In the primer set VIII and the primer set IV, two primers designed for the same methylation site are in a "nested" relationship, A kit for detecting tumor mutations and / or methylation in a DNA sample by constructing a library by the construction method described in any one of claims 1 to 3 and sequencing the library using the primer combination.

7. The kit according to claim 6, characterized in that the tumor is a hepatic malignant tumor.

8. The primer set I includes 78 single-stranded DNA molecules, the nucleotide sequences of the 78 single-stranded DNA molecules being sequentially shown in sequence 28 to sequence 105 in the sequence listing; The primer set II includes 82 single-stranded DNA molecules, the nucleotide sequences of the 82 single-stranded DNA molecules being sequentially shown in sequence 106 to sequence 187 in the sequence listing; The primer set III includes 14 single-stranded DNA molecules, the nucleotide sequences of the 14 single-stranded DNA molecules being sequentially shown in sequence 188 to sequence 201 in the sequence listing; The primer set IV includes 15 single-stranded DNA molecules, the nucleotide sequences of the 15 single-stranded DNA molecules being sequentially shown in sequence 202 to sequence 216 in the sequence listing; The primer set V comprises 75 single-stranded DNA molecules, each of which comprises a nucleotide sequence from the 16th position from the 5' end to the 3' end, such as sequences 220 to 294 in the sequence listing; The primer set VI comprises 79 single-stranded DNA molecules, and the 79 single-stranded DNA molecules sequentially comprise nucleotide sequences from the 16th position from the 5' end to the 3' end, such as sequences 295 to 373 in the sequence listing; The primer set VII comprises 14 single-stranded DNA molecules, each of which comprises a nucleotide sequence from the 16th position from the 5' end to the 3' end, such as sequences 374 to 387 in the sequence listing; The kit according to claim 7, characterized in that the primer set VIII contains 15 single-stranded DNA molecules, and the 15 single-stranded DNA molecules sequentially contain nucleotide sequences from the 16th position from the 5' end to the 3' end, such as sequences 388 to 402 in the sequence listing.

9. Use of the kit according to any one of claims 6 to 8 in distinguishing between blood samples from tumor patients and blood samples from non-tumor patients.

10. 1. A method for detecting a target mutation and / or methylation in a DNA sample, comprising: (1) constructing a library by the method according to any one of claims 1 to 3; and (2) performing nested PCR amplification twice on the library obtained in step (1), sequencing the products, and analyzing the occurrence of target mutations and / or methylation in the DNA sample from the sequencing results; In the step (2), a first PCR amplification is carried out using primer combination A; Primer combination A consists of upstream primer A and downstream primer combination A, the upstream primer A is a library amplification primer for library amplification in step (1), The downstream primer combination A is a combination of Y primers designed according to X target targets, where X and Y are both natural numbers of 1 or more, and X≦Y; A second PCR amplification is performed using the product of the first PCR as a template and primer combination B; Primer combination B consists of upstream primer B, downstream primer combination B, and an index primer; the upstream primer B is a library amplification primer, the 3' end of which is partially identical to the upstream primer A, and is used to amplify the product of the first PCR; The index primer includes, from the 5' end, a segment A for sequencing, an index sequence for distinguishing a sample, and a segment B for sequencing; A method of detection, wherein a primer in the downstream primer combination B has the segment B and is in a "nested" relationship with a primer in the downstream primer combination A by which the same target of interest is detected.

11. In the method for analyzing a target mutation in a DNA sample, the DNA molecules whose sequencing data meet criterion A are backtracked to a molecular cluster, and the molecular clusters whose sequencing data meet criterion B are marked as a pair of duplex molecular clusters, and a mutation is (a1) being supported by at least one pair of duplex molecular clusters; or (a2) It is supported by at least four molecular clusters. If the mutation satisfies the above condition, then the mutation is a true mutation derived from the original DNA sample, Criterion A is:

1. The DNA inserts are the same length and have identical sequences other than the mutation site; 2. The random tag sequences are identical; 3. The anchor sequences are identical and Criterion B is:

4. The DNA inserts are the same length and have identical sequences other than the mutation site; 5. The anchor sequences at both ends of the molecular cluster are identical but in opposite positions. and In the method for analyzing methylation in the DNA sample, DNA molecules whose sequencing data meets criterion C are marked as clusters, the number of clusters whose fragment ends are the enzyme cleavage site of interest is calculated and recorded as unmethylated fragments, the number of all clusters whose amplified fragments are equal to or larger than the first enzyme cleavage site is calculated and recorded as the total number of fragments, and the average methylation level of the corresponding region is calculated from the number of the two types of fragments by: methylation level of the region = (1 - number of unmethylated fragments / total number of fragments) x 100%; Criterion C is:

6. The random tag sequences are identical; 7. The anchor sequences are identical; 8. The DNA inserts are the same length and have identical sequences other than the mutation site. To simultaneously satisfy 11. The method of claim 10, wherein:

12. 1. A method for detecting multiple target mutations and / or methylations in a DNA sample, comprising: (1) constructing a library by the method according to any one of claims 1 to 3; (2) performing target region enrichment on the library of step (1), sequencing, and analyzing the occurrence of target mutations and / or methylation in the DNA sample based on the sequencing results.

13. In the method for analyzing a target mutation in a DNA sample, the DNA molecules whose sequencing data meet criterion A are backtracked to a molecular cluster, and the molecular clusters whose sequencing data meet criterion B are marked as a pair of duplex molecular clusters, and a mutation is (a1) being supported by at least one pair of duplex molecular clusters; or (a2) It is supported by at least four molecular clusters. If the mutation satisfies the above condition, then the mutation is a true mutation derived from the original DNA sample, Criterion A is:

1. The DNA inserts are the same length and have identical sequences other than the mutation site; 2. The random tag sequences are identical; 3. The anchor sequences are identical At the same time, Criterion B is:

4. The DNA inserts are the same length and have identical sequences other than the mutation site; 5. The anchor sequences at both ends of the molecular cluster are identical but in opposite positions. At the same time, In the method for analyzing methylation in the DNA sample, DNA molecules whose sequencing data meets criterion C are marked as clusters, the number of clusters whose fragment ends are the enzyme cleavage site of interest is calculated and recorded as unmethylated fragments, the number of all clusters whose amplified fragments are equal to or greater than the first enzyme cleavage site is calculated and recorded as the total number of fragments, and the average methylation level of the corresponding region is calculated from the number of the two types of fragments by: methylation level of the region = (1 - number of unmethylated fragments / total number of fragments) x 100%; Criterion C is:

6. The random tag sequences are identical; 7. The anchor sequences are identical; 8. The DNA inserts are the same length and have identical sequences other than the mutation site.

13. The method according to claim 12, wherein the above requirements are met simultaneously.

Images