Pseudosciaena crocea fast-growing character associated SNP (Single Nucleotide Polymorphism) marker combination and breeding application

Abstract

The invention provides a larimichthys crocea fast-growing character associated SNP marker combination and breeding application, the combination is prepared from a probe for detecting 10 SNP molecular marker combinations of larimichthys crocea fast-growing characters, and information of positions of all SNP molecular markers on chromosomes, alleles with changed sites and reference genes is shown in a table 1. According to the SNP marker combination disclosed by the invention, the optimal large yellow croaker individuals with fast-growing potential and a certain scale can be selected from the breeding offspring in advance for breeding and breed conservation, and the large yellow croaker individuals are bred to the parent without breeding and breed conservation of a large number of offspring seeds in the breeding process, so that the breeding cost can be greatly reduced. The SNP marker combination provided by the invention can solve the problem that non-lethal detection of the growth speed of the large yellow croaker cannot be realized in a traditional breeding mode, and can ensure smooth development of fast-growing character breeding work of the large yellow croaker.

Description

Technical Field

[0001] The invention belongs to the field of fish genetic breeding, relates to the technical field of fish molecular marker-assisted breeding, and specifically relates to a fast-growing trait-associated SNP marker combination and breeding application of large yellow croaker. Background Art

[0002] Large yellow croaker is one of the important economic fish species in China and is widely distributed in the southeastern coastal areas of China. Its meat is delicious and nutritious, and it is deeply loved by consumers. It has high market demand and breeding value. With the development of aquaculture technology and the innovation of breeding models, how to cultivate fast-growing large yellow croaker has become the focus of the aquaculture industry. Traditional breeding methods mainly rely on phenotypic selection. Although this method has achieved results to a certain extent, it has many limitations. For example, phenotypic selection usually requires long-term observation and recording, which is costly and inefficient.

[0003] In recent years, with the advancement of molecular biology and genomics technology, the application of molecular marker-assisted selection in breeding has become more and more extensive. Molecular marker-assisted breeding can select individuals in the early development stage by analyzing the association between markers at the DNA level and target traits, greatly improving breeding efficiency. Single nucleotide polymorphism (SNP) refers to the variation of a single nucleotide in the genome. SNP markers have become ideal molecular marker tools due to their high-density distribution in the genome and stable genetic characteristics. By identifying SNP markers that are significantly associated with the fast-growing traits of large yellow croaker and applying them to breeding practice, the efficiency and accuracy of breeding can be significantly improved.

[0004] Although some studies have been conducted on the genome of large yellow croaker, the research on the screening and application of SNP markers specifically for the fast-growing traits of large yellow croaker is still relatively limited. Therefore, it is urgent to develop new molecular marker tools to promote the development and promotion of large yellow croaker fast-growing breeding technology. Summary of the invention

[0005] In response to the above technical problems, the present invention provides a SNP marker combination associated with the fast-growing trait of large yellow croaker and a corresponding breeding application, which can achieve low-cost and efficient genetic improvement of the fast-growing trait of large yellow croaker, and can be used for genotype identification, growth trait association analysis and genome selection breeding of large yellow croaker breeding populations, so as to save costs and improve breeding efficiency and accuracy.

[0006] In order to achieve the above object, the technical solution provided by the present invention is as follows:

[0007] In a first aspect, the present invention provides a combination of SNP markers associated with the fast-growing traits of large yellow croaker, by whole-genome resequencing of fast-growing and slow-growing large yellow croaker populations, and using whole-genome association analysis ( Figure 1The nucleotide sequences of 10 SNP markers are shown in Table 1.

[0008] Table 1 Nucleotide sequences where SNP markers are located

[0009]

[0010] The specific meanings of the English headers in Table 1 are as follows: SNP represents the number of the single nucleotide polymorphism marker; chromosome represents the chromosome number; Positions represents the physical position of the SNP marker on the chromosome; REF represents the reference allele of the SNP site; ALT represents the altered allele of the SNP site; P represents the significance value of the SNP marker in the genome-wide association analysis. MAF represents the frequency of the minor allele, MarkerR 2 , namely the phenotypic explanation rate PVE, represents the proportion of phenotypic differences explained by each SNP marker.

[0011] The sequences of 50 bp before and after the 10 sites on the genome are as follows, where the SNP sites are in brackets.

[0012] LG1_15601822

[0013] TTTAATGAATAGATCTATTTCAATCAGAAGAGACAAGTGAAGGAAGTGAA(G / A)A TGATTGTTTATTATACAACTCTCTGACCCAATTTAAATGTCATTTTG(SEQ ID NO.1)

[0014] LG2_16815030

[0015] TGTATCTGCCTTGTAATTCAGATCCCTTCCAAAATGTAATGGATCCTGCC(T / A)TGA CCCTTACTTACCCTTAAATTTGGGAAATCCTGCTCACAGACAAACAA(SEQ ID NO.2)

[0016] LG9_2408311

[0017] TGAAACTGTGGCTAGACACAAAGAAAGAAGAAATCACATAGGTACAGTAA(C / G)AGGCCACACATTGTTTGTGACGTTCAGTGACTGCAGCATGAGGAACATG(SEQ ID NO.3)

[0018] LG10_18792519

[0019] CAGTTATAAAAACAGATGAGTGCGCAACAAGATGATGTTATTAAAAGAGC(T / G)C ATTTGATGGACACACAGCTACTGTCCAGCCAGACCAGTTAACCCACATC(SEQ ID NO.4)

[0020] LG16_6992719

[0021] CTCCCATCTGTCTGCCAATGAAGTGCAACATGCTTTTAAAGACTAGGTCC(A / T)CT CTTCGTGCCTGACCAAGTCCCACAATTAGAGTTGAATATGATAATTCC(SEQ ID NO.5)

[0022] LG16_17593706

[0023] GGTTCGTCTCGAATTGCTGCTCCAACAAGAAACTAGCAGTAATGATAGTA(G / A)C TGGTGGTATCTTCCCAGGACCCCACGCTACCAGATTCAATGTTTTTCTG(SEQ ID NO.6)

[0024] LG18_10424432

[0025] ATAGCCCAAAGGCCAACATTGCTCAGCTAATGCAGGATTGCATAACAATG(G / A)A AGACCCACTGGGCAAAATTTCAAAATTAGCATTAAGGTGGCTGCCAGTA(SEQ ID NO.7)

[0026] LG18_25441716

[0027] TCATCATTTTCAATAACGTCAGAAAAAATGAAAAAGTCACAGAGCGAGAG(G / T)GTGAAAACTGCAGGGAAAGGAGTGGTTTACATCAGTTAAAGGCCAGACAG(SEQ ID NO.8)

[0028] LG19_18697561

[0029] AAATGTGCCAAAGCCAGCACACCAGGCATCACATCATTAAGTTTGCCAAC(A / G)G CTTGGTCATAGTGTCACTGATAGAAAATAAATCAAATTAAAAAATAAAA(SEQ ID NO.9)

[0030] LG19_19564455

[0031] TTTCAACATATCACATTTTAATTTTATATGTACATATGGATTAACTACG(A / T)CTCA CCTTAAAAGTGGATAACGTCTCATCTTTATACACACTTTTGTTTTGG (SEQ ID NO. 10).

[0032] In a second aspect, the present invention provides a chip loaded with the above-mentioned combination of SNP markers associated with the fast-growing trait of large yellow croaker.

[0033] Preferably, the chip is a solid-state chip or a liquid-phase chip.

[0034] The third aspect of the present invention provides the use of the above-mentioned SNP marker combination or chip associated with the fast-growing trait of large yellow croaker in the identification of the fast-growing trait genotype of large yellow croaker or the breeding of fast-growing traits.

[0035] A fourth aspect of the present invention provides a method for breeding large yellow croaker fast-growing traits, comprising the following steps:

[0036] (1) Collect and keep alive the basic population of large yellow croaker for breeding, and cultivate it to parents as candidate parents, with a female-to-male ratio of 3:1;

[0037] (2) Using a non-lethal sampling method, collect fin ray samples from the dorsal fin of large yellow croaker parents, store them in anhydrous ethanol, and replace the anhydrous ethanol every 12 hours within 24 hours;

[0038] (3) extracting DNA from parental fin samples, performing genotyping on the above-mentioned SNP markers, and ensuring that the genotyping of all SNP markers is successful;

[0039] (4) According to the genotyping results, the RandomForest model was used to calculate the breeding value GEBV of the parent individuals using the R language package randomForest. The larger the GEBV value of the candidate parent individual, the faster the growth rate;

[0040] (5) The individuals with the top 10% GEBV values ​​were selected as breeding parents, and the male-female ratio was controlled at 3:1 for artificial breeding to obtain a new fast-growing large yellow croaker germplasm.

[0041] The research results show that the average body weight of the fast-growing large yellow croaker bred by the present invention is increased by more than 20% compared with the non-selected population.

[0042] Therefore, the fifth aspect of the present invention also provides the application of the above-mentioned SNP marker combination associated with the fast-growing trait of large yellow croaker in the genetic improvement of growth rate.

[0043] Functions and Effects of the Invention

[0044] (1) The 10 SNP marker combinations of the present invention can be used to quickly and accurately select and identify fast-growing large yellow croaker breeding parents at an early stage, which not only improves the breeding efficiency, but also greatly reduces the number of large yellow croaker seed conservation, effectively reducing the breeding cost.

[0045] (2) By screening out SNP markers that are significantly associated with the rapid growth trait of large yellow croaker, the best large yellow croaker individuals with rapid growth potential of a certain size can be selected in advance from the breeding offspring for breeding and preservation and cultivation to the parent species. There is no need to breed and preserve a large number of offspring seedlings during the breeding process, which can greatly reduce the breeding cost.

[0046] (3) The use of the SNP marker combination of the present invention can solve the problem that the growth rate of large yellow croaker cannot be detected non-lethally under traditional breeding methods, and can ensure the smooth development of large yellow croaker fast-growing trait breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 Manhattan plots of genome-wide association analyses are shown. DETAILED DESCRIPTION

[0048] The present invention is described in detail below in conjunction with the embodiments and the accompanying drawings. However, the following embodiments should not be considered as limiting the scope of the present invention.

[0049] Example 1 Genotyping Detection of Fast-Growing and Slow-Growing Groups of Large Yellow Croaker

[0050] In 2022, a genotyping experiment was conducted on the fast-growing and slow-growing populations of large yellow croaker. The specific steps are as follows:

[0051] (1) According to body weight, large yellow croaker was divided into fast-growing (441.41±61.92g) and slow-growing (213.14±25.02g) groups, with 200 fish in each group;

[0052] (2) Extracting genomic DNA from the two populations of large yellow croaker and performing whole genome resequencing;

[0053] (3) The detection of SNP marker combinations in the above two groups is shown in Table 2. As shown in Table 2, there are significant differences in the allele frequencies of the 10 SNP loci between the fast-growing and slow-growing groups (P<0.05), which further proves that the SNP markers of the present invention can be used for the fast-growing trait breeding of large yellow croaker.

[0054] Table 2 Detection of SNP marker combinations in fast-growing and slow-growing large yellow croaker populations

[0055]

[0056]

[0057] Example 2 Cultivation of new germplasm of fast-growing large yellow croaker

[0058] In 2023, the SNP marker combination of the present invention was used to carry out fast-growing breeding of large yellow croaker, and a fast-growing large yellow croaker F1 generation new germplasm was successfully cultivated. The specific steps are as follows:

[0059] (1) More than 800 large yellow croaker parents with large size, good stripe shape and no body damage were selected as candidate parents, with a male-female ratio of 3:1.

[0060] (2) Collect fin ray samples, extract genomic DNA, and use SNP liquid phase breeding chip for genotyping.

[0061] (3) The RandomForest model was used to calculate the GEBV of candidate parents using the R language package randomForest. The individuals with the top 10% GEBV values ​​were selected as breeding parents, with a female-to-male ratio of 3:1 (Table 3).

[0062] (4) By May 2023, more than 1 million fast-growing F1 generation large yellow croaker germplasm seedlings will be artificially bred.

[0063] (5) In May 2024, 60 individuals from the fast-growing F1 generation and non-selected lines were randomly selected and weighed. The average body weight increased by more than 20% (Table 4).

[0064] Table 3 Breeding values ​​of breeding parents

[0065]

[0066]

[0067] Table 4 Body mass values ​​of large yellow croaker in breeding and non-breeding populations

[0068]

[0069]

[0070] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The above embodiments and descriptions are only for explaining the principles of the present invention. The present invention may be subject to various changes and improvements without departing from the spirit and scope of the present invention. These changes and improvements fall within the scope of the present invention. The scope of protection of the present invention is defined by the attached claims and their equivalents.

Claims

1. A SNP marker combination associated with the fast-growing trait of large yellow croaker, characterized in that: The probes were prepared from the combination of 10 SNP molecular markers for detecting the fast-growing traits of large yellow croaker. The location of each SNP molecular marker on the chromosome, the allele of the site change, and the reference gene information are shown in the following table:

2. The fast-growing trait-associated SNP marker combination of large yellow croaker according to claim 1, characterized in that: The fast-growing trait is body mass.

3. A chip loaded with the combination of SNP markers associated with the fast-growing traits of large yellow croaker according to claim 1.

4. The chip according to claim 3, characterized in that: The chip is a solid-state chip or a liquid-phase chip.

5. Use of the fast-growing trait associated SNP marker combination of large yellow croaker according to claim 1 in fast-growing trait genotype identification or fast-growing trait breeding of large yellow croaker.

6. A method for breeding large yellow croaker for fast-growing traits, characterized in that: The method is carried out using the SNP marker combination according to claim 1, comprising the following steps: (1) Collecting and keeping alive the basic population of large yellow croaker for breeding, and cultivating it to parents as candidate parents; (2) Samples were collected using a non-lethal sampling method and stored in anhydrous ethanol, with the anhydrous ethanol replaced every 12 hours within 24 hours; (3) extracting DNA from parental samples, performing genotyping on the above-mentioned SNP markers, and ensuring that the genotyping of all SNP markers is successful; (4) Calculate the breeding value GEBV of the parent individuals based on the genotyping results; (5) The parent individuals of large yellow croaker were ranked according to their GEBV values, and the individuals with the highest ranking were selected as breeding parents for artificial breeding. The male-female ratio was controlled at 3:1, and the offspring obtained were the new fast-growing large yellow croaker germplasm.

7. The fast-growing trait breeding method of large yellow croaker according to claim 6, characterized in that: In step (1), the male-female ratio of the candidate parents is 3:1; In step (2), a non-lethal sampling method is used to collect a fin ray sample from the end of the dorsal fin of the large yellow croaker parent; In step (3), DNA is extracted from the parental fin ray sample; In step (4), the RandomForest model is used to calculate the breeding value GEBV of parent individuals using the R language package randomForest.

8. The fast-growing trait breeding method of large yellow croaker according to claim 6, characterized in that: in, Males and females were ranked according to GEBV, and the top 10% of the individuals were selected as the breeding parent group, with a male-female ratio of 3:

1.

9. Use of the fast-growing trait-associated SNP marker combination of claim 1 in fast-growing genetic improvement of large yellow croaker.

Images