Method for plant modification using axillary bud meristems

Abstract

A plant transformation method characterized by comprising a step for exposing a shoot apex of an axillary bud of a plant body, and a step for introducing fine particles coated with at least one type of nucleic acid into said shoot apex.

Description

[Technical field]

[0001] The present invention relates to a method for in planta transformation of plants using shoot apical tissue. [Background technology]

[0002] The currently popular methods for plant transformation are those that introduce foreign genes into in vitro cultured protoplasts, calli, or tissue fragments by electroporation, Agrobacterium tumefaciens, or particle gun. However, these methods have the problem that, even if genes are introduced into cells or tissues, depending on the plant variety, it is difficult to perform tissue culture using plant hormones, etc., and it is difficult to regenerate plants and produce transformants. In addition, the transformation efficiency is not high enough, so that marker selection must be performed by introducing a selection marker gene. Another problem is that somatic mutations (somaclonal mutations) frequently occur due to the need for long-term tissue culture. Therefore, from the viewpoints of reducing the labor required for producing transformed plants and the safety of transformed plants, there has been a demand for the development of an in planta transformation method that does not involve tissue culture and a method for producing in planta transformed plants.

[0003] Meanwhile, in wheat, rice, and the like, a transformation method that does not use callus or tissue pieces in an in vitro culture system (in planta transformation method) is also known. Known in planta transformation methods include a method in which a gene is directly introduced into an exposed immature embryo, the shoot apex of a mature embryo, or the shoot of a tuber using a particle gun method (Non-Patent Document 1, Patent Documents 1-2). Patent Document 3 and Non-Patent Document 2 describe a method in which a gene is introduced by infecting a mature embryo immediately after germination with Agrobacterium.

[0004] However, as is common to the prior art documents, many cultivars of vegetatively propagated plants such as potato have male sterility traits, making it difficult to apply the in planta transformation method of obtaining next-generation seeds using immature or mature embryos after gene introduction. In addition, although Patent Documents 1 and 2 use tuber shoots, the survival rate after the shoot apical meristem is exposed is low. Furthermore, Patent Documents 1 and 2 did not demonstrate that the introduced gene was transmitted to the next generation. For these reasons, the above-mentioned techniques have not been widely used to date. [Prior art documents] [Patent documents]

[0005] [Patent Document 1] International Publication No. 2017 / 195905 Brochure [Patent Document 2] International Publication No. 2017 / 195906 Brochure [Patent Document 3] International Publication No. 2005 / 024034 Brochure [Non-patent literature]

[0006] [Non-Patent Document 1] Bilang et al. (1993) Transient gene expression in vegetative shot apical meristems of wheat after ballistic microtargeting. Plant Journal (1993) 4, 735-744 [Non-Patent Document 2] Supartana et al. (2005) Development of simple and efficient in planta transformation for rice (Oryza sativa L.) using Agrobacterium tumefaciencs. Journal of Bioscience AND Bioengineering (2005) 4, 391-397 Summary of the Invention [Problem to be solved by the invention]

[0007] The present invention provides a method for transforming a plant without using callus or tissue explants in tissue culture in the presence of a plant hormone.The present invention also provides a method for transforming a plant without using a plant hormone.The present invention further provides a method for transforming a plant without introducing a selection marker gene.The present invention further provides a method for producing a transformed plant with excellent reproducibility. [Means for solving the problem]

[0008] The present inventors have conducted extensive research to solve the above problems and have completed the present invention.

[0009] That is, the present invention includes the following. <1> This is a method for transforming a plant, comprising the steps of exposing the shoot apex of an axillary bud of a plant body, and introducing microparticles coated with at least one type of nucleic acid into the shoot apex. <2> The present invention relates to a method for producing a transformed plant, the method comprising the steps of: exposing the shoot apex of an axillary bud of a plant body; introducing microparticles coated with at least one type of nucleic acid into the shoot apex; growing the shoot apex to obtain a plant body; and selecting a transformed plant body from the plant body. <3> This is a method for genome editing of plants, comprising the steps of exposing the shoot apex of an axillary bud of a plant body, and introducing into the shoot apex a microparticle coated with at least one type of nucleic acid and / or at least one type of protein. <4> The method for producing a genome-edited plant comprises the steps of exposing the shoot apex of an axillary bud of a plant body, introducing microparticles coated with at least one type of nucleic acid and / or at least one type of protein into the shoot apex, growing the shoot apex to obtain a plant body, and selecting a genome-edited plant body from the plant body. Effect of the Invention

[0010] According to the method of the present invention, by using the shoot apex in the axillary bud as a target for transformation by physical techniques, plant transformants can be obtained reproducibly without the need for tissue culture in the presence of plant hormones, callus formation, or selection marker genes. [Brief description of the drawings]

[0011] [Figure 1] FIG. 1 is a diagram illustrating each part of a potato as an example (Example 1). [Figure 2A] FIG. 2A is a photograph showing transient expression of GFP in potato axillary buds (Example 2; stolon). [Figure 2B] FIG. 2B is a photograph showing transient expression of GFP in potato axillary buds (Example 2; above-ground lateral shoots). [Diagram 3] FIG. 3 is a diagram illustrating a scheme of a method for obtaining a T0 generation genome-edited individual according to Example 2 of the present invention (Example 3). [Figure 4] FIG. 4 shows the analysis results of target gene mutation introduction into T0 plant individuals (Example 4). [Diagram 5] FIG. 5 shows the results of sequence analysis of T0 plant individuals (Example 4). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0012] The present invention will be described in detail below. The in planta transformation method of the present invention includes a step of exposing the shoot apex of an axillary bud of a plant body, and a step of introducing microparticles coated with at least one type of nucleic acid into the shoot apex, and may further include other steps. The plant genome editing method of the present invention includes a step of exposing the shoot apex of an axillary bud of a plant body, and a step of introducing a microparticle coated with at least one type of nucleic acid and / or at least one type of protein into the shoot apex, and may further include other steps. The step of introducing the microparticles can involve introducing microparticles coated with at least one type of nucleic acid and / or at least one type of protein so as to introduce a base deletion, insertion or substitution into a target site on the genomic DNA of the plant, thereby producing a genome-edited plant body in which a base deletion, insertion or substitution is introduced into the target site.

[0013] In the present invention, the term "stem" includes not only natural stems obtained by cultivating (or culturing) a plant under natural or similar conditions, but also stems obtained from tissue cultures such as in vitro seedlings. However, if artificial seeds from which a transformable shoot apex can be obtained are developed, it is also possible to use stems formed from them. Natural stems include not only stems obtained in outdoor fields, but also stems obtained by greenhouse cultivation. In addition, natural stems include not only stems obtained from tubers, but also stems obtained from seeds. Stems obtained by direct reprogramming or the like can also be used as stems in the present invention as long as a shoot apex can be obtained.

[0014] In the present invention, the term "stolon" refers to a type of lateral branch that develops from a subterranean node of a main stem. In addition, in the present invention, a stolon newly developed from a node of a stolon can also be used.

[0015] In the present invention, the term "axillary bud" refers to tissue including a new shoot tip arising from the base of a leaf or a node in a stem or stolon. As the material from which the axillary buds are obtained, it is preferable to use tubers or fully ripe seeds. Fully ripe seeds refer to seeds that have completed the ripening process after pollination and are fully ripe as seeds. The axillary buds are not particularly limited and can be appropriately selected depending on the purpose, but are preferably above-ground lateral branches of stems sprouting from tubers or underground lateral branches (stolons) of stems sprouting from tubers, and more preferably underground lateral branches (stolons) of stems sprouting from tubers. Among these, axillary buds which are formed by sprouting tubers and then growing them on a medium are preferred.

[0016] In this specification, the shoot apex includes the growing point at the tip of the stem (shoot apical meristem) as well as tissue consisting of the growing point and several leaf primordia arising from the growing point. In the present invention, only the hemispherical (dome-shaped) growing point from which the leaf primordia have been removed may be used as the shoot apex, or a shoot apex including the growing point and leaf primordia or a plant tissue including the shoot apex may be used. By using only the growing point from which the leaf primordia have been removed, virus-free tissue can be obtained.

[0017] 1. Pretreatment steps for transformation The in planta transformation method according to the present invention is not limited to vegetatively propagated plants, but can be applied to a wide variety of seed-producing plants. Thus, the target plants of the in planta transformation method according to the present invention are seed plants including angiosperms and gymnosperms. Angiosperms include monocotyledonous and dicotyledonous plants.

[0018] The monocotyledonous plant may be of any type, but examples thereof include plants of the Gramineae family, Liliaceae family, Musaceae family, Bromeliaceae family, and Orchidaceae family.

[0019] Grass Examples of the plants in the family Liliaceae include rice, wheat, barley, corn, oats, turfgrass, sorghum, rye, foxtail millet, and sugarcane. Examples of the plants in the family Liliaceae include leeks and asparagus. Examples of the plants in the family Musaceae include bananas. Examples of the plants in the family Bromeliaceae include pineapples. Examples of the plants in the family Orchidaceae include orchids.

[0020] Examples of dicotyledonous plants include Brassicaceae, legumes, Solanaceae, Cucurbitaceae, Convolvulaceae, Rosaceae, Mulberry, Malvaceae, Asteraceae, Amaranthaceae, and Polygonaceae. Among these, solanaceae plants are preferred.

[0021] Examples of Brassicaceae plants include Arabidopsis thaliana, Chinese cabbage, rapeseed, cabbage, cauliflower, and Japanese radish. Examples of Leguminaceae plants include soybean, adzuki bean, kidney bean, pea, cowpea, and alfalfa. Examples of Solanaceae plants include tomato, eggplant, potato, tobacco, and chili pepper. Among these, potato is preferred. Examples of Cucurbitaceae plants include oriental melon, cucumber, melon, and watermelon. Examples of Convolvulaceae plants include morning glory, sweet potato (sweet potato), and bindweed. Examples of Rosaceae plants include rose, strawberry, and apple. Examples of Mulberry family plants include mulberry, fig, and rubber tree. Examples of Malvaceae plants include cotton and kenaf. Examples of Asteraceae plants include lettuce and stevia. Examples of Amaranthaceae plants include sugar beet (sugar beet). Examples of Polygonaceae plants include buckwheat.

[0022] On the other hand, gymnosperms include pines, cedars, ginkgo trees, and cycads.

[0023] In the in planta transformation method according to the present invention, sterilized tubers are first sprouted. If necessary, germination and growth under light exposure may be performed by light exposure treatment. Sprouting is performed by cutting the tubers and incubating them in soil or vermiculite in a dark place. Stolon is adjusted by placing the nodes of the elongated stem on an agar medium and incubating them in a dark place. In addition, in the case of producing in vitro seedlings, the sprouted or axillary buds are grown on an agar medium. The agar medium may be any medium commonly used for plant culture, but preferably MS medium, Gamborg B5 medium, LS medium, etc., and more preferably MS medium can be used. For example, in the case of potatoes, the growth temperature is preferably 10 to 23°C, more preferably 20°C.

[0024] 2. Removing leaves and leaf primordia to expose the shoot apex Next, the internodes of the stolon or in vitro seedling prepared above are cut using a cutting tool such as a scalpel. In the case of potato, the leaves and leaf primordia are removed to expose the shoot apex. Any means for exposing the shoot apex may be used as long as it can remove the leaves and leaf primordia under a stereomicroscope, and examples of such means include a drilling tool such as a needle with a diameter of about 0.2 mm, tweezers, a pipette, a syringe, and cutting tools such as a scalpel and a cutter. Next, the excess stolon or stem portion is cut off using a cutting tool such as a scalpel, and the stolon or side branch containing the exposed shoot apex is placed on an agar medium with the shoot apex facing upward. In order to obtain a virus-free shoot apex, the scalpel may be replaced with a new sterile scalpel at the final stage of cutting out the shoot apex. In this case, a virus-free transformant can be obtained.

[0025] 3. Introducing nucleic acids and / or proteins into shoot apex cells The introduction of a target gene can be carried out by known genetic engineering techniques, and is not particularly limited. In general, a recombinant vector containing a target gene is prepared, and a nucleic acid (such as a recombinant vector) or a protein can be introduced into the shoot apex of an axillary bud by the Agrobacterium method, electroporation, particle gun method, PEG-calcium phosphate method, liposome method, microinjection method, whisker method, laser injection method, or the like. The particle gun method involves coating microparticles with nucleic acid and / or protein and injecting them into cell tissue, and is effective in cases where the infection efficiency of Agrobacterium is low, such as in monocotyledonous plants.

[0026] The means for introducing microparticles coated with nucleic acid and / or protein into the cells of the shoot apex is not particularly limited as long as it is capable of introducing the microparticles into the plant cells, and examples thereof include a particle gun (gene gun) in the particle gun method. The method for introducing microparticles coated with nucleic acid and / or protein into the cells of the shoot apex is not particularly limited as long as it is a method that can introduce microparticles into plant cells, and examples of the method include a method in which microparticles are shot using a particle gun (gene gun) in the particle gun method.

[0027] The fine particles are not particularly limited as long as they have a high specific gravity to enhance the penetration into cells, are chemically inactive, and are unlikely to cause harm to the living body, and examples of the fine particles include metal fine particles, ceramic fine particles, etc. The metal fine particles may be simple metal fine particles or alloy fine particles, and among the simple metal fine particles, gold particles, tungsten particles, etc. are particularly preferred. The coating may cover the entire surface of the fine particles or only a part of the surface.

[0028] The vector used in the present invention is not particularly limited, and examples of vectors that can be used include the pAL series (pAL51, pAL156, etc.), pUC series (pUC18, pUC19, pUC9, etc.), pBI series (pBI121, pBI101, pBI221, pBI2113, pBI101.2, etc.), pPZP series, pSMA series, intermediate vector series (pLGV23Neo, pNCAT, etc.), cauliflower mosaic virus (CaMV), bean mosaic virus (BGMV), tobacco mosaic virus (TMV), etc.

[0029] A vector containing a gene of interest can be prepared, for example, as follows. To insert a gene of interest into a vector, for example, a method can be used in which purified DNA is cleaved with an appropriate restriction enzyme, and inserted into an appropriate restriction enzyme site or multicloning site of vector DNA, and then ligated to the vector. Alternatively, the gene of interest may be inserted into an intermediate vector by double cross-over, or TA cloning, In-Fusion cloning, etc. may be used.

[0030] The target gene is not particularly limited, and may be an endogenous gene of the target plant or a foreign gene, as long as the expression or inhibition of the expression of the gene is desired. The foreign gene may be from a different species of organism, and may be, for example, an animal, a plant, a microorganism, or a virus. Examples of such genes include sugar metabolism-related genes, lipid metabolism-related genes, useful substance (medicine, enzyme, pigment, aroma component, etc.) production genes, plant growth control (promotion / inhibition) genes, flowering regulation-related genes, disease and pest resistance (resistance to insect feeding, resistance to nematodes, mold (fungi) and bacterial diseases, resistance to viruses (diseases), etc.), environmental stress (low temperature, high temperature, dryness, salt, light damage, ultraviolet light) resistance genes, transporter genes, flour milling characteristics, bread making characteristics, and noodle making characteristics-related genes, and site-specific nuclease genes. In addition to the sense strand, the target gene may be introduced so as to express antisense, ribozyme, RNAi, etc., depending on the purpose of gene introduction.

[0031] In this specification, "genome editing" is a part of the technology called New Breeding Technique (NBT), which uses meganuclease, CRISPR-CAS, etc. to cut and modify specific genes in the genome. different It refers to the destruction of a gene by introducing a DNA fragment, or the deletion, insertion, or replacement of a DNA fragment in a site-specific manner. Using genome editing technology, the targeted gene can be destroyed with high efficiency. In the case of gene destruction, some countries do not treat it as a recombinant plant because it is possible to destroy only the targeted gene without leaving any trace of genetic recombination. Genome editing also makes it possible to efficiently insert or replace a site-specific DNA fragment by linking fragments homologous to the sequences on both sides of the cleavage sequence to both sides of the DNA fragment to be introduced at that site.

[0032] In the above sense, genome editing can be said to be a different technology from conventional plant transformation methods in which foreign genes are incorporated almost randomly, such as direct introduction methods and Agrobacterium methods, and it is possible to consider excluding genome editing technology from the definition of transformation methods. Genome editing technology is characterized by including a step of cleaving genomic DNA using a nuclease or guide RNA and nuclease that can target the cleavage site, and can be distinguished from conventional transformation methods that do not use such targetable nuclease or guide RNA and nuclease. Here, the meaning of "using nuclease or guide RNA and nuclease" means that a nuclease protein may be introduced into a cell, or DNA and / or RNA encoding a nuclease gene may be introduced into a cell to express the nuclease protein. In addition, with regard to guide RNA, RNA may be introduced into a cell, or DNA capable of expressing guide RNA may be introduced to express guide RNA.

[0033] Examples of proteins encoded by site-specific nuclease genes include zinc finger nucleases, proteins expressing zinc finger nuclease activity, or TAL effector nucleases (TALENs). Zinc finger nucleases are fusion proteins of several zinc finger motifs that recognize specific bases and FokI nuclease. TALLENs are fusion proteins of Transcription Activator Like (TAL) effector and FokI nuclease. Site-specific nucleases are composed of other additional targeting technologies, such as meganucleases, RNA-induced CRISPR-Cas9, or leucine zippers.

[0034] The site-specific nuclease can be introduced into a cell using the transformation method of the present invention, integrated into the genome, expressed, and genome editing can be performed to change or modify the expression of one or more gene products. That is, a CRISPR-Cas system can be introduced into a cell that contains and expresses a DNA molecule encoding one or more gene products, which may include a Cas protein and one or more guide RNAs that target the DNA molecule, so that the one or more guide RNAs target the genomic locus of the DNA molecule encoding one or more gene products, and the Cas protein cleaves the genomic locus of the DNA molecule encoding one or more gene products, thereby changing or modifying the expression of one or more gene products.

[0035] The Cas protein and the guide RNA may be naturally occurring (combined) or may be a combination that does not occur in nature. In the present invention, the expression of two or more gene products may be altered or modified. The guide RNA may comprise a guide sequence fused to a tracr sequence.

[0036] The length of the guide RNA is at least 15, 16, 17, 18, 19, or 20 nucleotides, and the preferred upper limit is 30 or less, more preferably 25 or less, even more preferably 22 or less, and most preferably 20 nucleotides.

[0037] In a preferred embodiment, the cell to be transformed is a plant cell, more preferably a cell of the shoot apical meristem.

[0038] In the present invention, the Cas protein may include one or more nuclear localization signals (NLS). In some embodiments, the Cas protein is a type II CRISPR enzyme. In some embodiments, the Cas protein is a Cas9 protein. In some embodiments, the Cas9 protein is S. pneumoniae, S. pyogenes, or S. thermophilus Cas9, including mutant Cas9 from these organisms. The protein may be a Cas9 homolog or ortholog.

[0039] The Cas protein may be codon-optimized for expression in eukaryotic cells. The Cas protein may direct one or two strand cleavage at the location of the target sequence. In another aspect of the invention, the expression of a gene product is reduced, and the gene product is a protein.

[0040] In addition to the gene of interest, for example, a promoter, an enhancer, an insulator, an intron, a terminator, a polyA addition signal, a selection marker gene, etc. can be ligated to the vector.

[0041] The target gene to be inserted into the vector may be of multiple types per vector, and the recombinant vector to be coated on the microparticle may also be of multiple types per microparticle. For example, a recombinant vector containing a target gene and a recombinant vector containing a drug resistance gene may be separately prepared. Manufacturing The mixture may then be mixed to coat the microparticles and then bombarded into plant tissue.

[0042] The promoter does not have to be derived from a plant, as long as it functions in a plant body or plant cells and is constitutively expressed or can induce expression in a specific tissue or at a specific developmental stage of a plant. Specific examples include the cauliflower mosaic virus (CaMV) 35S promoter, the El2-35S omega promoter, the nopaline synthase gene promoter (Pnos), the ubiquitin promoter derived from maize, the actin promoter derived from rice, the PR protein promoter derived from tobacco, the ADH, and the RuBisco promoter. The translation efficiency can be increased by using a sequence that enhances translation activity, for example, the omega sequence of the tobacco mosaic virus. In addition, proteins can be translated from multiple coding regions by inserting an IRES (internal ribosomal entry site) as a translation initiation region at the 3'-downstream side of the promoter and the 5'-upstream side of the translation initiation codon.

[0043] The terminator may be any sequence that can terminate the transcription of the gene transcribed by the promoter and has a polyA addition signal, and examples of such a sequence include the nopaline synthase (NOS) gene terminator, the octopine synthase (OCS) gene terminator, and the CaMV 35S terminator.

[0044] Examples of the selection marker gene include herbicide resistance genes (bialaphos resistance gene, glyphosate resistance gene (EPSPS), sulfonylurea resistance gene (ALS)), drug resistance genes (tetracycline resistance gene, ampicillin resistance gene, kanamycin resistance gene, hygromycin resistance gene, spectinomycin resistance gene, chloramphenicol resistance gene, neomycin resistance gene, etc.), fluorescent or luminescent reporter genes (luciferase, β-galactosidase, β-glucuronidase (GUS), green fluorescent protein (GFP), etc.), and enzyme genes such as neomycin phosphotransferase II (NPT II) and dihydrofolate reductase. However, according to the present invention, it is possible to produce a transformant without introducing a selection marker gene.

[0045] The vector containing the above-mentioned target gene is shot into the axillary buds of potatoes by the particle gun method. The target gene and / or protein can be coated on the surface of fine particles (microcarriers) and shot into plant cells with a gene gun. As the fine particles, metal fine particles are preferably used because they have a high specific gravity to increase the penetration into cells, are chemically inactive, and are unlikely to cause harm to living organisms. Among metal fine particles, gold particles, tungsten particles, etc. are particularly preferably used.

[0046] In the particle gun method, a gene of interest can be introduced into plant cells as follows: First, fine particles such as gold or tungsten particles are washed and sterilized, and the fine particles, nucleic acid (recombinant vector, linear DNA, RNA, etc.), CaCl2, and spermidine are added while stirring with a vortex mixer or the like to coat the gold or tungsten particles with DNA, and then washed with ethanol.

[0047] The particle diameter of the fine particles is preferably 0.3 μm to 0.9 μm, more preferably 0.4 μm or more, even more preferably 0.5 μm or more, and particularly preferably 0.6 μm. The upper limit of the particle diameter is more preferably 0.8 μm or less, even more preferably 0.7 μm or less, and particularly preferably 0.6 μm.

[0048] Gold particles or tungsten particles are applied as uniformly as possible to the macrocarrier film using a pipette or the like, and then dried in a sterile environment such as a clean bench. Then, the macrocarrier film and the plate on which the shoot tip of the target axillary bud is placed are placed in a particle gun device, and high-pressure helium gas is fired from the gas acceleration tube toward the macrocarrier film. The macrocarrier film is stopped by the stopping plate, but the gold particles pass through the stopping plate and penetrate into the target placed below the stopping plate, and the target gene is introduced. In the case of protein-coated microparticles, it is preferable to use a hydrophilic macrocarrier film.

[0049] The hydrophilic macrocarrier film may be made by attaching a hydrophilic film to the macrocarrier film or by applying a hydrophilic coating to the macrocarrier film. Methods for making the film hydrophilic include methods using surfactants, photocatalysts, and hydrophilic polymers.

[0050] Examples of hydrophilic polymers used in the above-mentioned methods include polymers of hydrophilic monomers such as polyethylene glycol, hydroxyethyl methacrylate, hydroxypropyl methacrylate, dihydroxyethyl methacrylate, diethylene glycol methacrylate, triethylene glycol methacrylate, polyethylene glycol methacrylate, vinylpyrrolidone, acrylic acid, acrylamide, dimethylacrylamide, glucoxyoxyethyl methacrylate, 3-sulfopropylmethacryloxyethyldimethylammonium betaine, 2-methacryloyloxyethyl phosphorylcholine, and 1-carboxydimethylmethacryloyloxyethylmethane ammonium.

[0051] The distance between the stopping plate and the target shoot apex depends on the particle size of the microparticles, but is preferably 9 cm or less, more preferably 8 cm or less, even more preferably 7 cm or less, and particularly preferably 6 cm or less, and the lower limit of the distance is preferably 2 cm or more, more preferably 3 cm or more, and even more preferably 4 cm or more. The optimal value of the distance between the stopping plate and the target can be appropriately determined by transient expression experiments or the like depending on the type, particle size, gas pressure, etc. of the microparticles.

[0052] The gas pressure depends on the type of fine particles and the distance from the target, but is preferably, for example, 1,100 to 1,800 psi, and more preferably 1,300 to 1,500 psi. The optimal gas pressure can be determined appropriately by a transient expression experiment or the like depending on the type of fine particles, the type of target, the distance between the target and the stopping plate, and the like.

[0053] In the transformation method of the present invention, the number of times that the microparticles are bombarded into the shoot apex is preferably 2 or more, more preferably 3 or more, and even more preferably 4 or more. The upper limit of the number of times that the microparticles are bombarded into the shoot apex is preferably 20 or less, more preferably 15 or less, and even more preferably 10 or less. The optimal number of times that the microparticles are bombarded can be appropriately determined by a transient expression experiment or the like.

[0054] In cells bombarded with microparticles, nucleic acids are released from the microparticles and integrated into genomic DNA to obtain transformed cells. However, when nucleic acids that grow in a plasmid form such as geminiviruses or artificial chromosomes are introduced, transformation may occur without integration. In addition, according to the transformation method of the present invention, it is also possible to introduce foreign genes into organelles. In that case, it is preferable to use a gene functionally linked to a promoter that is specifically expressed in the organelle.

[0055] 4.Other processes Examples of the other steps include a step of growing the shoot tip bombarded with the microparticles to obtain a plant body, and a step of selecting a target plant body from the obtained plant bodies. The process of growing the shoot apex bombarded with the particles to obtain a plant body is not particularly limited and can be selected appropriately depending on the purpose, but examples include a method in which the shoot apex of the transformed axillary bud is grown on an agar medium for about a month and then transplanted into soil. In the case of shoot apex bombardment, transformants can be obtained by growing the plants in a normal medium without applying selective pressure using drugs (not containing antibiotics), but a drug resistance gene can also be introduced. When a drug resistance gene is introduced, the transformed cells can be selectively cultured using a drug. A known example of a selective drug suitable for shoot apex culture is the sulfonylurea herbicide chlorosulfuron (resistance can be acquired by introducing a mutant ALS gene (acetobutyrate synthase gene)).

[0056] When a drug resistance gene is introduced, the drug resistance gene may be on the same vector as the gene of interest or on a different vector. When the gene is inserted on a different vector, if the gene is integrated into a different chromosome, it is advantageous in that the plant individual into which the gene of interest has been introduced and the plant individual having the drug resistance gene can be separated by self-pollination or backcrossing to obtain progeny.

[0057] The method for producing a transformed plant of the present invention includes the steps of exposing the shoot apex of an axillary bud of a plant body, bombarding the shoot apex with microparticles coated with at least one type of nucleic acid, growing the shoot apex to obtain a plant body, and selecting a transformed plant body from the plant body. The method for producing a genome-edited individual of a plant of the present invention includes the steps of exposing the shoot apex of an axillary bud of a plant body, bombarding the shoot apex with microparticles coated with at least one type of nucleic acid and / or at least one type of protein, growing the shoot apex to obtain a plant body, and selecting a genome-edited plant body from the plant body. The steps are as described above. By the above-mentioned methods, it is possible to produce plants into which a gene of interest has been introduced or plants that have been genome-edited. Furthermore, in the plants produced in this way, the gene of interest is stably expressed or the expression of the gene of interest is suppressed, and the gene is normally inherited (transmitted) to progeny.

[0058] The efficiency of gene introduction and genome editing into potato can be examined as follows.

[0059] The efficiency of gene introduction can be determined by extracting DNA from grown individuals after gene introduction treatment and performing PCR and / or Southern blotting to detect whether the target gene has been genome-edited. The genome editing efficiency can be calculated from the number of explants used for introduction and the number of grown individuals that contained the foreign gene.

[0060] The genome editing efficiency of the target gene can be detected by extracting DNA from the grown individuals after gene introduction and treating the PCR product with a restriction enzyme, and the genome editing efficiency is calculated from the number of explants used for introduction and the number of grown individuals that had the target mutation. The grown individuals in which the target mutation was confirmed are examined for the presence or absence of RNA expressed from the target gene. The presence or absence of RNA can be confirmed, for example, by RT-PCR. It may also be detected by Northern blotting.

[0061] It is also possible to examine the presence or absence of a protein expressed from the genome-edited gene of interest. The presence or absence of a protein can be confirmed, for example, by staining of plant pieces, electrophoresis, ELISA, RIA, dot immunobinding assay, and / or Western blotting. The genome editing efficiency of the gene of interest is calculated from the number of explants used for introduction and the number of grown individuals in which the presence (or absence) of the protein resulting from genome editing of the gene of interest was confirmed. EXAMPLES

[0062] The present invention will be specifically described below with reference to examples, but the present invention is not limited to these examples in any way.

[0063] (Example 1) Examination of optimal tissue for transformation To perform transformation, leaf primordia are removed to expose the shoot apex. To select tissues suitable for transformation, the shoot apex of each tissue was exposed (Fig. 1) and the survival rate was calculated.

[0064] 1. Organizational Adjustment (1) Preparation of shoots Potato tubers (variety: Danshaku potato) were immersed in ethanol (99.5%) for a moment, placed on a Kimtowel, and incubated at 22°C. After sprouting, the base of the tuber was cut with a sterilized knife, and the shoot was separated from the tuber. Under a stereomicroscope, the leaf primordia were removed using the tip of a needle (0.20 mm in diameter). The tubers were then placed on MS-sucrose medium (4.3 g / L MS salt, MS vitamin, 30 g / L sucrose, 0.98 g / L MES, 3% PPM (plant preservative mixture, Nacalai Tesque), 7.0 g / L phytagel, pH 5.8) with the shoot apex facing upwards.

[0065] (2) Adjustment of above-ground lateral branches Potato (Russet Burbank variety) tubers were immersed in ethanol (99.5%) for a moment, placed on a Kimtowel, and incubated at 22°C. After sprouting, the tubers were cut in half with a sterilized knife, transplanted into a disposable plant cell culture vessel containing MS-sucrose medium, and grown for about one month under long days (22°C, 16-hour day length). The internodes of the stems of the regenerated plants were cut with a sterilized knife, and the nodes were transplanted again into a disposable plant cell culture vessel containing MS-sucrose medium and grown under the same conditions. After repeating this procedure two or more times, the stems of the regenerated plants were used for the experiment. The leaves at the internodes and nodes were cut with a sterilized knife, and the leaf primordia were removed using the tip of a needle (0.20 mm in diameter) under a stereomicroscope. The tubers were then placed on MS-sucrose medium with the shoot apex facing upwards. The same procedure was carried out when adjusting above-ground lateral branches using potatoes (variety: Danshaku potato).

[0066] (3) Adjustment of the stron Potato tubers (variety: Danshaku potato) were immersed in ethanol (99.5%) for a moment, placed on a Kimtowel, and incubated at 22°C. After sprouting, the tubers were cut in half with a sterilized knife and transplanted into a pot containing horticultural seedling soil. They were then grown in a dark place in an artificial climate machine set at 22°C until the stems elongated. The internodes were cut with a sterilized knife, and the nodes were transplanted into a disposable plant cell culture vessel containing MS-sucrose medium, and grown in a dark place in an artificial climate machine set at 22°C until the stolons elongated. The internodes of the stolons were cut with a sterilized knife, and the leaf primordia were removed using the tip of a needle (diameter 0.20 mm) under a stereomicroscope. The tubers were then placed on MS-sucrose medium with the shoot apex facing upwards.

[0067] 2. Calculation of survival rate The plates prepared in Example 1-(1) and (2) were grown under long-day conditions (22°C, 16-hour day length) for approximately 3 weeks. The plates prepared in Example 1-(3) were similarly grown in the dark at 22°C for approximately 3 weeks. Individuals with elongated stems or stolons were considered survivors, and the survival rate of each tissue after the shoot apex exposure procedure was calculated (Table 1). As a result, the survival rate of the shoot buds was low at 16%, while the survival rate of the above-ground lateral branches and stolons was high at 100% and 90%, respectively. It was found that the survival rate after the shoot apex exposure procedure differed greatly depending on the tissue.

[0068] [Table 1]

[0069] (Example 2) Obtaining a transformant It was found that the survival rate after the shoot apex exposure procedure was high when axillary buds (above-ground lateral branches, stolon) were used, and it is therefore possible to obtain transformants by the in planta method using these tissues.

[0070] 1. Organizational Adjustment The method described in Examples 1-(2) to 1-(3) was followed. Each tissue was placed on MS-sucrose medium at 15-20 pieces / plate with the shoot apex facing upward.

[0071] 2. Gene transfer by particle gun method Gene introduction into potato shoot tips was carried out using a particle gun method as follows.

[0072] (1) Adjustment and injection of gold particles Weigh out 30 mg of 0.6 μm gold particles, add 500 μL of 70% ethanol, and suspend thoroughly by vortexing. Then, precipitate the gold particles by centrifugation and remove the ethanol. Then, wash the gold particles three times with nuclease-free water, and add 500 μL of nuclease-free water to make a gold particle stock solution.

[0073] In the examples, a plasmid DNA (pUC-based plasmid) containing the fluorescent reporter gene GFP (S65T) was used as the introduced gene. The gene was designed to be expressed under the control of the 35S promoter derived from the cauliflower mosaic virus. As a terminator, the terminator of the nopaline synthase (NOS) gene was added.

[0074] Plasmid DNA solution (1μg / μL) purified by Qiagen Plasmid Midi Kit (Qiagen) was added to a 1.5mL tube so that the amount was 5μg per 750μg of gold particles. Before use, the sterilized gold particle-containing solution was thoroughly suspended using an ultrasonic generator (UW-25 ultrasonic cleaner manufactured by Taga Electric Co., Ltd.), and an appropriate amount was added to the above tube and stirred by pipetting. Next, 25μL of 2.5M CaCl2 (Nacalai Tesque) and 10μL of 0.1M Spermidine (Nacalai Tesque) per 750μg of gold particles were added to the above tube. Immediately after mixing, the solution was vigorously suspended by vortexing for 5 minutes. After leaving it at room temperature for 10 minutes, it was centrifuged at 9,100×g for 2 seconds. The supernatant was removed and the solution was washed with 70% ethanol and 99.5% ethanol. Finally, the supernatant was removed and 24μL of 99.5% ethanol was added and the solution was suspended well. 6 μL of each solution was poured onto the center of a macrocarrier in a clean bench and allowed to air dry.

[0075] The particle gun used was the Biolistic (registered trademark) PDS-1000 / He Particle Delivery System (BIO-RAD), and the pressure at the time of shooting was approximately 94.9 kgf / cm. 2 (1,350 psi), and the distance from the stopping screen to the target tissue was 3.5 cm. Each dish was bombarded four times. After bombardment, the dish was left to stand overnight at 22°C in the dark.

[0076] (2) Confirmation of GFP protein expression GFP fluorescence (excitation: 470 / 40, absorption: 525 / 50) was observed in the shoot apex of the axillary bud under a stereofluorescence microscope (Leica MZFLIII). As a result, GFP fluorescence was observed in spots or throughout the shoot apex of the stolon (Fig. 2A) and above-ground lateral branches (Fig. 2B). This result demonstrated that gene transfer to the shoot apex of the axillary bud using a particle gun was possible.

[0077] 3. Obtaining transformants Individuals in which GFP fluorescence was confirmed in the shoot apex of the axillary bud of the above-ground lateral branch were transplanted into disposable plant cell culture vessels containing MS-sucrose medium and grown for approximately two weeks under long-day conditions (22°C, 16-hour day length). The leaves differentiated from the shoot apex were examined to determine whether the foreign gene had been introduced. Genomic DNA was extracted from the grown leaves (50 mg) using the benzyl chloride method, and PCR reactions were performed using this as a template and primers created from sequences specific to the 35S promoter. 35S-F: CCAGAGGGCTATTGAGACTTTTC (SEQ ID NO: 1) 35S-R: ATATAGAGGAAGGGTCTTGCGAA (SEQ ID NO: 2)

[0078] The PCR reaction solution was prepared by adding 1.0 μL of genomic DNA, 0.4 U of KODFXNeo (TOYOBO), 5 μL of 2× attached buffer, 0.4 mM dNTPs, and 0.2 μM of each primer pair, and then filling up to a total of 10 μL with sterile distilled water. PCR was performed using a TaKaRa PCR Thermal Cycler Dice, with 32 cycles consisting of 10 seconds at 98°C and 1 minute at 68°C. After the PCR reaction, 5 μL of each PCR product was subjected to 1.0% agarose gel electrophoresis and stained with ethidium bromide.

[0079] As a result, as shown in Table 2, signals indicating the insertion of a foreign gene were detected in 16 of the 236 individuals that underwent gene transfer treatment, giving a transformation efficiency of 6.8%. As described above, it was found that transformants can be obtained efficiently by using this method.

[0080] [Table 2]

[0081] (Example 3) Obtaining genome-edited individuals We found that the survival rate after the shoot apex exposure procedure was high when axillary buds (above-ground lateral branches, stolon) were used, and that the use of these tissues made it possible to obtain genome-edited individuals by the in planta method (Figure 3).

[0082] 1. Organizational Adjustment The method described in Examples 1-(2) to 1-(3) was followed. Each tissue was placed on MS-sucrose medium at 15-20 pieces / plate with the shoot apex facing upward.

[0083] 2. Protein introduction by particle gun method Protein introduction into the potato shoot apex is carried out using a particle gun method as follows.

[0084] (1) Adjustment and firing of gold particles Weigh out 60 mg of 0.6 μm gold particles, add 500 μL of 70% ethanol, and suspend thoroughly by vortexing. Then, precipitate the gold particles by centrifugation and remove the ethanol. Then, wash the gold particles three times with nuclease-free water, and add 500 μL of nuclease-free water to make a gold particle stock solution.

[0085] In the examples, a mixture (1 μg / μL) of crRNA and tracrRNA (Fasmac) is used as gRNA. For example, Streptococcus pyogenes-derived Cas9 (Takara) is used as Cas9 protein.

[0086] crRNA-GBSS1-tg1: AGGGCUGUUAACAAGCUUGAguuuuagagcuaugcuguuuug (SEQ ID NO: 3) crRNA-GBSS1-tg2: GGGCUGUUAACAAGCUUGAUguuuuagagcuaugcuguuuug (SEQ ID NO: 4) crRNA-GBSS1-tg3: UACUAAGGUAACACCCAAGAguuuuagagcuaugcuguuuug (SEQ ID NO: 5) crRNA-ALS1 / 2: CAAGUGCCGAGGAGGAUGAUguuuuagagcuaugcuguuuug (SEQ ID NO: 6) tracrRNA: AAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU (SEQ ID NO: 7)

[0087] Add 5 μg of each of the above gRNAs or a mixture of gRNAs (crRNA-GBSS1-tg1, crRNA-GBSS1-tg2, crRNA-GBSS1-tg3), 12 μg of Cas9 protein, 5 μL of 10×Cut Smart buffer, and 1.0 μL of Ribolock RNase Inhibitor, and fill up to a total of 20 μL with sterile distilled water. After leaving it at room temperature for 15 minutes, add 1500 μg of gold particles and leave it on ice for 10 minutes. After discarding the supernatant, add 26 μL of Nuclease-Free Water, and use this as the gold particle / Cas9 complex. In a clean bench, attach a hydrophilic film (3M, SH2CLHF) cut into 1.0 to 1.5 cm squares to the center of the macrocarrier. Pour 6 μL of the above gold particle / Cas9 complex into each well and air dry. The gold particle diameter is 0.6 μm, the amount of gold particles is 375 μg per shot, and shots are performed four times per plate.

[0088] (2) Growth of protein-transfected plants The protein-introduced individual that has been left to stand overnight is transplanted into a disposable plant cell culture vessel (Sigma) containing MS-sucrose medium, and grown under long-day conditions (22°C, 16-hour day length) for 3-4 weeks.

[0089] (3) Analysis of targeted gene mutations in T0 plants The resulting plants are then examined to see whether a mutation has been introduced into the target gene (GBSS1 or ALS1 / 2 genes). Genomic DNA is extracted from the entire grown plant (50 mg) using the benzyl chloride method, and PCR is performed using this as a template and primers created from sequences specific to each gene. GBSS1-F: CTTGCCTACTGTAATCGGTGATAA (SEQ ID NO: 8) GBSS1-R: TTTGACCTGCAGATAAAGTAGCG (SEQ ID NO: 9) ALS1 / 2-F: GGTTCCCTGGTGTTTGCATT (SEQ ID NO: 10) ALS1 / 2-R: GCTTCACGAACAACCCTAGG (SEQ ID NO: 11)

[0090] The PCR reaction solution was prepared by adding 1.0 μL of genomic DNA, 0.4 U of KODFXNeo (TOYOBO), 5 μL of 2× attached buffer, 0.4 mM dNTPs, and 0.2 μM of each primer pair, and then filling up to a total of 10 μL with sterile distilled water.

[0091] PCR was performed using a TaKara PCR Thermal Cycler Dice, with 35 cycles of 98°C for 10 seconds and 68°C for 1 minute. After the PCR reaction, add 1 μL of each PCR product, 1 μL of 10x included buffer, and 5 U of an appropriate restriction enzyme, and fill up with sterile distilled water to a total of 10 μL. After reacting at 37°C for 3 hours, perform 1.0% agarose gel electrophoresis and stain with ethidium bromide.

[0092] In wild-type strains, the PCR product is completely cleaved by the restriction enzyme, whereas in individuals with mutations, some PCR product remains uncleaved. DNA is extracted and purified from the remaining band and subjected to sequence analysis. Those with mutations in the target gene sequence can be determined to be individuals with target gene mutations. Of the individuals treated with protein introduction, introduction of target gene mutations can be confirmed in a certain percentage of T0 generation plants.

[0093] (Example 4) Obtaining genome-edited individuals We investigated whether it was possible to obtain genome-edited individuals using the in planta method using axillary buds (above-ground lateral branches).

[0094] 1. Organizational Adjustment The method described in Example 1-(2) was followed. 15-20 pieces of each tissue were placed on MS-sucrose medium with the shoot apex facing upwards. The cultivars used were Russet Burbank and May Queen.

[0095] 2. Protein introduction by particle gun method Protein introduction into potato shoot tips was carried out using a particle gun method as follows.

[0096] (1) Adjustment and firing of gold particles 180 mg of 0.6 μm gold particles were weighed out, 500 μL of 70% ethanol was added, and the mixture was thoroughly suspended by vortexing. The gold particles were then precipitated by centrifugation and the ethanol was removed. The gold particles were then washed three times with nuclease-free water, and 500 μL of nuclease-free water was added to prepare a gold particle stock solution.

[0097] A mixture of crRNA and tracrRNA (Fasmac) (1 μg / μL) was used as gRNA. Streptococcus pyogenes-derived Cas9 (New England Biolabs) was used as Cas9 protein.

[0098] crRNA-PDS-tg1: GGACUCUUGCCAGCAAUGCUguuuuagagcuaugcuguuuug (SEQ ID NO: 12) tracrRNA: AAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU (SEQ ID NO: 7)

[0099] 2.5μg of each of the above crRNA-PDS-tg1, 2.5μg of tracrRNA, 16μg of Cas9 protein, 4μL of 10×Cut Smart buffer, and 1.0μL of Ribolock RNase Inhibitor were added, and the total was filled up to 20μL with sterile distilled water. After leaving it at room temperature for 10 minutes, 5μL of 1,4-bis(3-oleoylamidopropyl)piperazine / histone H1 protein mixture (3:1, 1330μg / mL) was added, 2250μg of gold particles were added, and the mixture was left to stand on ice for 10 minutes. After discarding the supernatant, 26μL of Nuclease-Free Water was added, and this was used as the gold particle / Cas9 complex. A hydrophilic film (3M, SH2CLHF) cut into 1.0-1.5cm squares was attached to the center of the macrocarrier in a clean bench. 6μL of the above gold particle / Cas9 complex was poured into each of them and air-dried. The gold particle diameter was 0.6 μm, the amount of gold particles was 562.5 μg per shot, the gas pressure was adjusted to 1750-1800 psi, and two shots were performed per plate.

[0100] (2) Growth of protein-transfected plants The protein-transfected plants were left to stand overnight and then transplanted into disposable plant cell culture vessels (Sigma) containing MS-sucrose medium, and grown under long-day conditions (22°C, 16-hour day length) for 3-4 weeks.

[0101] (3) Analysis of targeted gene mutations in T0 plants We investigated whether the target gene (PDS gene) had been mutated in the obtained plant body. Genomic DNA was extracted from the whole grown plant body (50 mg) by the benzyl chloride method, and PCR was performed using this as a template and primers made from the sequence specific to each gene. PDS-F: TTTCCCCGAAGCTTTACCCG (SEQ ID NO: 13) PDS-R: ATCTGTCACCCTATCCGGCA (SEQ ID NO: 14)

[0102] The PCR reaction solution contained 1.0 μL of genomic DNA, 0.4 U of KODFXNeo (TOYOBO), 5 μL of 2× attached buffer, 0.4 mM dNTPs, and 0.2 μM of each primer pair, and was filled up to a total of 10 μL with sterile distilled water.

[0103] PCR was performed using a TaKara PCR Thermal Cycler Dice, with 35 cycles of 98°C for 10 seconds and 68°C for 1 minute. After the PCR reaction, 1 μL of each PCR product, 1 μL of 10x attached buffer, and 5 U of an appropriate restriction enzyme (BsrDI) were added, and the mixture was filled up to a total of 10 μL with sterile distilled water. After reacting at 37°C for 3 hours, 1.0% agarose gel electrophoresis was performed and stained with ethidium bromide.

[0104] In the wild-type strain, the PCR product was completely cleaved by the restriction enzyme, whereas in the mutant strain, some of the PCR product was left uncleaved (Fig. 4). In Figure 4, lane 1 is a size marker (M), lane 2 is a genome-edited individual of Danshaku potato (#1), lane 3 is a genome-edited individual of May Queen (#2), lane 4 is a wild-type strain (Wt), and lane 5 is a wild-type strain without restriction enzymes (Wt).

[0105] DNA was extracted and purified from the remaining band and subjected to sequence analysis, revealing that an 11-base deletion mutation had been introduced near the target gene sequence (Figure 5). Genome-edited individuals were obtained in 1 out of 69 individuals (1.4%) of Danshaku potatoes and 1 out of 78 individuals (1.3%) of May Queen potatoes. The introduction of target gene mutations was confirmed in a certain percentage of the individuals treated with the protein introduction.

[0106] For other Solanaceae plants, transformants and genome-edited individuals can be obtained essentially using the same techniques as for potatoes.

[0107] Examples of aspects of the present invention include the following. <1> This is a method for transforming a plant, comprising the steps of exposing the shoot apex of an axillary bud of a plant body, and introducing microparticles coated with at least one type of nucleic acid into the shoot apex. <2> The axillary buds of the plant body are axillary buds of a plant body grown on a medium. <1> This is a method according to the present invention. <3> The axillary bud is an axillary bud of a lateral branch. <1> or <2> This is a method according to the present invention. <4> The side branch is a stolon. <3> This is a method according to the present invention. <5> The plant is any one selected from the group consisting of plants of the Solanaceae family. <1> from <4> The method according to any one of the above items. <6> The solanaceae plant is potato. <5> This is a method according to the present invention. <7> The present invention relates to a method for producing a transformed plant, the method comprising the steps of: exposing the shoot apex of an axillary bud of a plant body; introducing microparticles coated with at least one type of nucleic acid into the shoot apex; growing the shoot apex to obtain a plant body; and selecting a transformed plant body from the plant body. <8> This is a method for genome editing of plants, comprising the steps of exposing the shoot apex of an axillary bud of a plant body, and introducing into the shoot apex a microparticle coated with at least one type of nucleic acid and / or at least one type of protein. <9> The axillary buds of the plant body are axillary buds of a plant body grown on a medium. <8> This is a method according to the present invention. <10> The axillary bud is an axillary bud of a lateral branch. <8> or <9> This is a method according to the present invention. <11> The side branch is a stolon. <10> This is a method according to the present invention. <12> The plant is any one selected from the group consisting of plants of the Solanaceae family. <8> from <11> The method according to any one of the above items. <13> The solanaceae plant is potato. <12> This is a method according to the present invention. <14> The method for producing a genome-edited plant comprises the steps of exposing the shoot apex of an axillary bud of a plant body, introducing microparticles coated with at least one type of nucleic acid and / or at least one type of protein into the shoot apex, growing the shoot apex to obtain a plant body, and selecting a genome-edited plant body from the plant body. [Industrial Applicability]

[0108] The present invention can be used in agriculture, the pharmaceutical industry, the enzyme industry, and the like.

Claims

1. The method includes the steps of exposing the shoot apex of an axillary bud of a plant body, and introducing a microparticle coated with at least one type of nucleic acid into the shoot apex, The method for plant transformation, wherein the plant body is any one plant body selected from the group consisting of plants of the Solanaceae family.

2. The method according to claim 1 , wherein the axillary buds of the plant are axillary buds of a plant grown on a medium.

3. The method according to claim 1 or claim 2, wherein the axillary bud is an axillary bud of a lateral branch.

4. The method of claim 3 , wherein the side branch is a stolon.

5. A method according to any one of claims 1 to 4, wherein the solanaceae plant is potato.

6. A method according to any one of claims 1 to 5, wherein in the introducing step, the distance between a stopping plate and the stem tip is 2 cm or more and 9 cm or less, and the number of times the microparticles are shot at the stem tip is 2 to 20 times.

7. A method according to any one of claims 1 to 6, wherein the shoot apex is obtained without the need for tissue culture in the presence of plant hormones, callus formation, and a selection marker gene.

8. A method for producing a transformed plant comprising the steps of: exposing a shoot apex of an axillary bud of a plant; introducing microparticles coated with at least one type of nucleic acid into the shoot apex; growing the shoot apex to obtain a plant; and selecting a transformed plant from the plant; A method for producing a transformed plant, wherein the plant body is any one plant body selected from the group consisting of plants of the Solanaceae family.

9. The method described in claim 8, wherein, in the introducing step, the distance between the stopping plate and the stem tip is 2 cm or more and 9 cm or less, and the number of times the microparticles are shot at the stem tip is 2 to 20 times.

10. A method according to claim 8 or claim 9, wherein the shoot apex is obtained without the need for tissue culture in the presence of plant hormones, callus formation, and a selection marker gene.

11. A method for producing a plant comprising the steps of: exposing a shoot apex of an axillary bud of a plant body; and introducing into the shoot apex a microparticle coated with at least one type of nucleic acid and / or at least one type of protein, A method for genome editing of a plant, characterized in that the plant body is any one plant body selected from the group consisting of Solanaceae plants.

12. The method according to claim 11, wherein the axillary buds of the plant body are axillary buds of a plant body grown on a culture medium.

13. The method described in claim 11 or claim 12, wherein the axillary bud is an axillary bud of a lateral branch.

14. The method according to claim 13, wherein the side branch is a stolon.

15. A method according to any one of claims 11 to 14, wherein the solanaceae plant is potato.

16. A method according to any one of claims 11 to 15, wherein in the introducing step, the distance between a stopping plate and the stem tip is 2 cm or more and 9 cm or less, and the number of times the microparticles are shot at the stem tip is 2 times or more and 20 times or less.

17. A method according to any one of claims 11 to 16, wherein the shoot apex is obtained without the need for tissue culture in the presence of plant hormones, callus formation, and a selection marker gene.

18. A method for producing a plant, comprising the steps of: exposing a shoot apex of an axillary bud of a plant; introducing a microparticle coated with at least one type of nucleic acid and / or at least one type of protein into the shoot apex; growing the shoot apex to obtain a plant; and selecting a genome-edited plant from the plant; A method for producing a genome-edited individual of a plant, wherein the plant body is any one plant body selected from the group consisting of Solanaceae plants.

19. The method described in claim 18, wherein, in the introducing step, the distance between a stopping plate and the stem tip is 2 cm or more and 9 cm or less, and the number of times the microparticles are shot at the stem tip is 2 to 20 times.

20. A method according to claim 18 or claim 19, wherein the shoot apex is obtained without the need for tissue culture in the presence of plant hormones, callus formation, and a selection marker gene.

Images