A DNA cutting agent based on the Cas9 protein from the bacterium Pasteurella pneumotropica

Abstract

The present invention describes a novel bacterial nuclease from the bacterium Pasteurella pneumoniae (P. pneumotropica) of the CRISPR-Cas9 system, and its use to generate precisely specific double-stranded cuts in DNA molecules. This nuclease has unique properties and can be used as a tool to introduce changes at precisely defined locations in the genomic DNA sequences of unicellular and multicellular organisms. Thus, the present invention increases the versatility of available CRISPR-Cas9 systems, enabling the use of Cas9 nucleases from a variety of organisms to cut genomic or plasmid DNA at multiple specific sites and under a variety of conditions.

Description

[Technical field]

[0001] The present invention relates to biotechnology, in particular to novel Cas nuclease enzymes of the CRISPR-Cas system that are used to cut DNA and edit the genomes of various organisms. This technology may be used in the future for gene therapy of inherited human diseases, as well as for editing the genomes of other organisms. [Background technology]

[0002] The modification of DNA sequences is one of the hot topics in the field of biotechnology today. Editing and modifying the genomes of eukaryotic and prokaryotic organisms, as well as the manipulation of DNA in vitro, requires the targeted introduction of double-strand breaks in DNA sequences.

[0003] To solve this problem, the following technologies are currently used: artificial nuclease system containing zinc finger type domain, TALEN system, and bacterial CRISPR-Cas system. The first two technologies require the effort of optimizing the nuclease amino acid sequence for the recognition of specific DNA sequences. In contrast, in the case of CRISPR-Cas system, the structure that recognizes the DNA target is not a protein, but a small guide RNA. Cutting of a specific DNA target does not require de novo synthesis of the nuclease or its gene, but is performed by using a guide RNA that is complementary to the target sequence. This makes the CRISPR Cas system a suitable and efficient means for cutting various DNA sequences. The technology allows DNA to be cut in several regions simultaneously using guide RNAs with different sequences. Such an approach is also used in eukaryotes to simultaneously modify several genes.

[0004] By its nature, the CRISPR-Cas system is a prokaryotic immune system capable of introducing very specific breaks in viral genetic material (Mojica FJM et al. Intervening sequences of regularly spaced prokaryotic repeats derive from foreign genetic elements / / Journal of molecular evolution. 2005. Vol. 60. Issue 2. pp.174-182). The abbreviation CRISPR-Cas stands for "Clustered Regularly Interspaced Short Palindromic Repeats and CRISPR associated Genes" (Jansen R. et al. Identification of genes that are associated with DNA repeats in prokaryotes / / Molecular microbiology. 2002. Vol. 43. Issue 6. pp.1565-1575). All CRISPR-Cas systems consist of a CRISPR cassette and genes encoding various Cas proteins (Jansen R. et al., Molecular microbiology. 2002. Vol. 43. Issue 6. pp.1565-1575). Each CRISPR cassette consists of a spacer with a unique nucleotide sequence and a repeating palindromic repeat (Jansen R. et al., Molecular microbiology. 2002. Vol. 43. Issue 6. pp.1565-1575).Transcription of the CRISPR cassette and its subsequent processing results in the formation of a guide crRNA, which, together with Cas proteins, forms an effector complex (Brouns SJJ et al. Small CRISPR RNAs guide antiviral defense in prokaryotes / / Science. 2008. Vol. 321. Issue 5891. pp.960-964). Through complementary pairing between the crRNA and the target DNA site, called the protospacer, Cas nuclease recognizes the DNA target and introduces a highly specific cut therein.

[0005] CRISPR-Cas systems containing a single effector protein are grouped into six different types (types I-VI) depending on the Cas protein contained in the system. In 2013, the use of type II CRISPR-Cas9 systems was first proposed to edit genomic DNA in human cells (Cong L, et al., Multiplex genome engineering using CRISPR / Cas systems. Science. 2013 Feb 15;339(6121):819-23). ​​Type II CRISPR-Cas9 systems are characterized by a simple composition and mechanism of activity, i.e., their function requires only the formation of an effector complex consisting of one Cas9 protein and two small RNAs: crRNA and tracer RNA (tracrRNA). The tracer RNA complementarily pairs with the crRNA region arising from the CRISPR repeats to form a secondary structure required for the guide RNA to bind to the Cas effector. Determining the sequence of the guide RNA is a critical step in the characterization of previously unexplored Cas orthologues. The Cas9 effector protein is an RNA-dependent DNA endonuclease that has two nuclease domains (HNH and RuvC) that introduce breaks into the complementary strand of the target DNA, thus forming double-stranded DNA breaks (Deltcheva E. et al. CRISPR RNA maturation by trans-encoded small RNA and host factor RNase III / / Nature. 2011. Vol. 471. Issue 7340. p.602).

[0006] To date, several CRISPR-Cas nucleases are known that can target and specifically introduce double-strand breaks in DNA. CRISPR-Cas9 technology is one of the latest and rapidly developing technologies that introduces breaks in DNA of various organisms ranging from bacterial strains to human cells and also provides in vitro applications (Song M. The CRISPR / Cas9 system: Their delivery, in vivo and ex vivo applications and clinical development by startups. Biotechnol Prog. 2017 Jul;33(4):1035-1045).

[0007] The effector ribonucleic complex consisting of Cas9 and the crRNA / tracrRNA duplex requires, in addition to crRNA spacer-protospacer complementarity, the presence of a PAM (protospacer regulatory motif) on the DNA target for DNA recognition and subsequent hydrolysis (Mojica FJM et al. 2009). The PAM is a strictly defined sequence of several nucleotides located in type II systems adjacent to or several nucleotides away from the 3' end of the protospacer on the off-target strand. In the absence of a PAM, hydrolysis of the DNA bond with the formation of a double-stranded break does not occur. The requirement for the presence of a PAM sequence on the target increases the recognition specificity but at the same time imposes constraints on the choice of the target DNA region to introduce the break. Thus, the presence of a desirable PAM sequence adjacent to the DNA target from the 3' end is a limiting feature for the use of CRISPR-Cas systems at any DNA site.

[0008] Different CRISPR-Cas proteins use different and unique PAM sequences in their activities. To be able to modify any DNA region both in vitro and in the genome of a living organism, the use of CRISPR-Cas proteins with novel and diverse PAM sequences is required. The modification of eukaryotic genomes also requires the use of small nucleases to provide AAV-mediated delivery of the CRISPR-Cas system into cells.

[0009] Although many techniques are known for cutting DNA and modifying genomic DNA sequences, there remains a need for new, efficient means for modifying DNA in diverse organisms and at precisely specific sites in the DNA sequence. [Prior art documents] [Non-patent literature]

[0010] [Non-Patent Document 1] Mojica FJM et al. Intervening sequences of regularly spaced prokaryotic repeats derive from foreign genetic elements / / Journal of molecular evolution. 2005. Vol. 60. Issue 2. pp.174-182 [Non-Patent Document 2] Jansen R. et al. Identification of genes that are associated with DNA repeats in prokaryotes / / Molecular microbiology. 2002. Vol. 43. Issue 6. pp.1565-1575 [Non-Patent Document 3] Brouns SJJ et al. Small CRISPR RNAs guide antiviral defense in prokaryotes / / Science. 2008. Vol. 321. Issue 5891. pp.960-964 [Non-Patent Document 4] Cong L, et al., Multiplex genome engineering using CRISPR / Cas systems. Science. 2013 Feb 15;339(6121):819-23 [Non-Patent Document 5] Deltcheva E. et al. CRISPR RNA maturation by trans-encoded small RNA and host factor RNase III / / Nature. 2011. Vol. 471. Issue 7340. p.602 [Non-Patent Document 6] Song M. The CRISPR / Cas9 system: Their delivery, in vivo and ex vivo applications and clinical development by startups. Biotechnol Prog. 2017 Jul;33(4):1035-1045 Summary of the Invention [Problem to be solved by the invention]

[0011] The aim of the present invention is to provide a novel means for modifying genomic DNA sequences of unicellular or multicellular organisms using the CRISPR-Cas9 system. Existing systems are limited in use due to the specific PAM sequence that must be present at the 3' end of the DNA region to be modified. The search for new Cas9 enzymes with other PAM sequences will expand the range of available means for creating double-strand breaks at desired and precisely defined sites in DNA molecules of various organisms. To solve this problem, the authors characterized the type II CRISPR nuclease PpCas9, previously predicted for Pasteurella pneumotropica (P. pneumotropica). The enzyme can be used to introduce directed modifications in the genomes of both the above and other organisms. The present invention is characterized by having the following essential features: (a) a short PAM sequence that is different from other known PAM sequences; (b) a relatively small size of the characterized PpCas9 protein, which is 1055 amino acid residues (aar). [Means for solving the problem]

[0012] The problem is solved by forming a double-stranded break in a DNA molecule located immediately before the nucleotide sequence 5'-NNNN(A / G)T-3' in the DNA molecule using a protein comprising the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 1 and differs from SEQ ID NO: 1 only in non-conserved amino acid residues. In some embodiments of the present invention, the use is characterized in that a double-stranded break is formed in the DNA molecule at a temperature between 35°C and 45°C.

[0013] The problem is further solved by providing a method for modifying a genomic DNA sequence of a single cell or a multicellular organism, comprising the steps of introducing into at least one cell of the organism an effective amount of: a) either a protein comprising the amino acid sequence of SEQ ID NO: 1, or a nucleic acid encoding a protein comprising the amino acid sequence of SEQ ID NO: 1, and b) either a guide RNA comprising a sequence that forms a duplex with a nucleotide sequence of a region of the genomic DNA of the organism immediately adjacent to the nucleotide sequence 5'-NNNN(A / G)T-3' and interacts with the protein after duplex formation, or a DNA sequence encoding the guide RNA; wherein the interaction of the protein with the guide RNA and the nucleotide sequence 5'-NNNN(A / G)T-3' results in the formation of a double-strand break in the genomic DNA sequence immediately adjacent to the sequence 5'-NNNN(A / G)T-3'. In some embodiments of the present invention, the method is characterized in that it further comprises the introduction of an exogenous DNA sequence simultaneously with the guide RNA.

[0014] A mixture of crRNA and tracer RNA (tracrRNA) that can form a complex with the target DNA region and PpCas9 protein may be used as guide RNA. In a preferred embodiment of the present invention, a hybrid RNA constructed based on crRNA and tracer RNA may be used as guide RNA. Methods for constructing hybrid guide RNA are known to those skilled in the art (Hsu PD et al., DNA targeting specificity of RNA-guided Cas9 nucleases. Nat Biotechnol. 2013 Sep;31(9):827-32). One approach for constructing hybrid RNA is disclosed in the following examples.

[0015] The present invention may be used both for in vitro cutting of target DNA and for modifying the genome of some living organisms. The genome may be modified in a direct manner, i.e. by cutting the genome at the corresponding site, as well as by inserting exogenous DNA sequences through homologous repair.

[0016] Any region of double-stranded or single-stranded DNA (or the composition of such region in itself, and including other DNA fragments) from the genome of an organism other than that used for administration may be used as an exogenous DNA sequence, where the region (or the composition of the region) is intended to be induced by PpCas9 nuclease and integrated into the site of double-stranded break in the target DNA. In some embodiments of the present invention, the double-stranded DNA region from the genome of an organism used for the introduction of PpCas9 protein and further modified by mutation (nucleotide substitution) and by the insertion or deletion of one or more nucleotides may be used as an exogenous DNA sequence.

[0017] A technical result of the present invention is to increase the versatility of available CRISPR-Cas9 systems, allowing the use of Cas9 nuclease to cut genomic or plasmid DNA at a greater number of specific sites and under specific conditions. [Brief description of the drawings]

[0018] [Figure 1] Scheme of the locus of the CRISPR PpCas9 system. DRs (direct repeats) are regularly repeated regions that are part of the CRISPR cassette. [Diagram 2] In vitro PAM screening. Experimental scheme. [Diagram 3] PpCas9 nuclease cut of 7N library fragments at different reaction temperatures. [Figure 4](A) Analysis of the results of the in vitro screening of PpCas9 nuclease with calculation of the logarithm of the fractional change for each specific nucleotide at each PAM (FC) position. (B) PpCas9 nuclease PAM Logo. The occurrence of adenine, cytosine, thymine, and guanine is shown for each position. The letter height corresponds to the nucleotide occurrence at a given position in the PAM sequence. [Diagram 5] Examination of the effect of a single base substitution at PAM position 1 on the efficiency of DNA target cleavage by PpCas9 nuclease. [Figure 6] Validation of the importance of nucleotide positions in the PpCas9 PAM sequence. [Figure 7] Examination of the effect of A to G substitution at PAM position 6 on the efficiency of DNA target cleavage by PpCas9 nuclease. [Figure 8] Examination of the effect of a single base substitution at PAM position 7 on the efficiency of DNA target cleavage by PpCas9 nuclease. [Figure 9] Cutting of various DNA sites using PpCas9 protein. Lanes 1 and 2 are positive controls. [Figure 10] Verification of recognition of the PAM sequence CAGCATT by the PpCas9 nuclease. Lanes 1 and 2 are positive controls. [Figure 11] Schematic diagram of the DNA cutting tool PpCas9. [Figure 12] DNA target cutting experiments using hybrid guide RNAs of different lengths. [Figure 13] Alignment of the amino acid sequences of PpCas9 and Cas9 protein from Staphylococcus aureus using NCBI BLASTp software (default parameters). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0019] When used in describing the present invention, the terms "includes" and "including" should be interpreted to mean "including, among other things." The terms are not intended to be interpreted as "consisting only of." Unless otherwise defined, technical and scientific terms in this application have the typical meanings commonly accepted in the scientific and technical literature.

[0020] In this specification, the term "percent homology of two sequences" is equivalent to the term "percent identity of two sequences". Sequence identity is determined based on a reference sequence. Algorithms for sequence analysis are known in the art, such as BLAST, described in Altschul et al., J. Mol. Biol., 215, pp.403-10 (1990). For the purposes of the present invention, the comparison of nucleotide and amino acid sequences may be used to determine the level of identity and similarity between nucleotide and amino acid sequences, which is carried out by the BLAST software package (http: / / www.ncbi.nlm.nih.gov / blast) provided by the National Center for Biotechnology Information with standard parameters and using gapped alignment. The percent identity of two sequences is determined by the number of identical amino acid positions in these two sequences, taking into account the number of gaps inserted and the length of each gap for optimal comparison of the two sequences by alignment. The percent identity takes into account the sequence alignment and is equal to the number of identical amino acids at a given position divided by the total number of positions ×100.

[0021] The term "specifically hybridize" refers to the association between two single-stranded nucleic acid molecules or sequences that are sufficiently complementary to permit such hybridization under predetermined conditions typically used in the art.

[0022] The phrase "a double-stranded break located immediately before a nucleotide PAM sequence" means that a double-stranded break in the target DNA sequence is created at a distance of 0 to 25 nucleotides before the nucleotide PAM sequence.

[0023] The exogenous DNA sequence introduced together with the guide RNA is intended to refer to a DNA sequence that is specifically prepared for specific modification of double-stranded target DNA at the cleavage site determined by the specificity of the guide RNA. Such modification may be, for example, the insertion or deletion of a specific nucleotide at the cleavage site in the target DNA. The exogenous DNA may be either a DNA region from a different organism or a DNA region from the same organism as that of the target DNA.

[0024] A protein comprising a particular amino acid sequence is intended to refer to a protein having an amino acid sequence composed of said amino acid sequence and possibly other sequences linked to said amino acid sequence by peptide bonds. Examples of other sequences may be nuclear localization signals (NLS) or other sequences providing increased functionality of said amino acid sequence.

[0025] The exogenous DNA sequence introduced together with the guide RNA is intended to refer to the DNA sequence that is specifically prepared for specific modification of double-stranded target DNA at the site of cleavage determined by the specificity of the guide RNA. Such modification may be, for example, the insertion or deletion of a specific nucleotide at the cleavage site in the target DNA. The exogenous DNA may be either a DNA region from a different organism or a DNA region from the same organism as that of the target DNA.

[0026] The effective amount of protein and RNA introduced into a cell is intended to refer to the amount of protein and RNA that, when introduced into said cell, can form a functional complex, i.e. a complex that will specifically bind to target DNA and generate a double-strand break in said DNA at a site determined by the guide RNA and the PAM sequence on the DNA. The efficiency of this process can be evaluated by analyzing the target DNA isolated from said cell, using conventional techniques known to those skilled in the art.

[0027] Protein and RNA can be delivered to cells by various techniques.For example, protein can be delivered as DNA plasmid that codes for the gene of this protein, as mRNA that is translated into this protein in cytoplasm, or as ribonucleoprotein complex that contains this protein and guide RNA.Delivery can be carried out by various techniques known to those skilled in the art.

[0028] Nucleic acids encoding components of the system may be introduced directly or indirectly into cells as follows: by transfection or transformation of cells by methods known to those skilled in the art, by the use of recombinant viruses, by manipulation of cells, such as DNA microinjection, etc.

[0029] The ribonucleic acid complex consisting of the nuclease and the guide RNA and exogenous DNA (if necessary) may be delivered by transfecting the complex into the cell or by mechanically introducing the complex into the cell, for example by microinjection.

[0030] The nucleic acid molecule that codes for the protein to be introduced into cells can be integrated into chromosomes or can be DNA that replicates extrachromosomally.In some embodiments, in order to ensure the effective expression of protein genes in DNA introduced into cells, it is necessary to modify the sequence of said DNA according to cell type to optimize codons for expression, since the frequency of synonymous codons is unequal in the coding regions of various organism genomes.Codon optimization is necessary to increase expression in animal, plant, fungal or microbial cells.

[0031] For a protein having a sequence at least 95% identical to the amino acid sequence of SEQ ID NO: 1 to function in a eukaryotic cell, it is necessary that the protein end up in the nucleus of the cell. Thus, in some embodiments of the present invention, a protein having a sequence at least 95% identical to the amino acid sequence of SEQ ID NO: 1 and further modified at one or both ends by the addition of one or more nuclear localization signals is used to form a double-stranded break in the target DNA. For example, a nuclear localization signal from SV40 virus may be used. To provide efficient delivery to the nucleus, the nuclear localization signal may be separated from the main protein sequence by a spacer sequence, for example, as described in Shen B et al. "Generation of gene-modified mice via Cas9 / RNA-mediated gene targeting", Cell Res. 2013 May;23(5):720-3. Furthermore, in other embodiments, a different nuclear localization signal or an alternative method for delivering the protein into the cell nucleus may be used.

[0032] The present invention involves the use of a protein from the pulmonary Pasteurella organism that is homologous to the previously characterized Cas9 protein to introduce double-strand breaks in DNA molecules at precisely specified positions.The use of CRISPR nucleases to introduce targeted modifications into genomes has several advantages.First, the specificity of the activity of the system is determined by the crRNA sequence, which allows one type of nuclease to be used for all target loci.Second, the technology allows several guide RNAs that are complementary to different gene targets to be delivered simultaneously into cells, thereby allowing several genes to be modified simultaneously.

[0033] PpCas9 is a Cas nuclease found in P. pneumotropica ATCC35149, a rodent pathogen that lives in animal lungs. The P. pneumotropica CRISPR Cas9 system (hereafter referred to as CRISPR PpCas9) belongs to the II-C type CRISPR Cas system and consists of a CRISPR cassette carrying four direct repeats (DRs) with the sequence 5'ATTATAGCACTGCGAAATGAAAAAGGGAGCTACAAC3', spaced by a unique spacer sequence. None of the spacers in the system match any currently known bacteriophage or plasmid, a fact that makes it impossible to determine the PpCas9 PAM of interest by bioinformatics analysis. The CRISPR cassette is flanked by the genes of Cas1 and Cas2 proteins involved in the adaptation and integration of novel spacers, along with the genes of the effector Cas9 protein PpCas9. Near the Cas gene, we found a sequence that was partially complementary to the direct repeat and folded into a characteristic secondary structure that is intended to be a tracer RNA (tracrRNA) (Figure 1).

[0034] Knowledge of the characteristic assembly of the RNA-Cas protein complex in type II-C systems made it possible to predict the transcriptional direction of the CRISPR cassette: the pre-crRNA is transcribed in the opposite direction to the Cas gene (Figure 1).

[0035] Thus, analysis of the PpCas9 locus sequence made it possible to predict the sequences of the tracer and guide RNAs (Table 1). Table 1. Guide RNA sequences of the CRISPR PpCas9 system determined by bioinformatics methods. Bold indicates direct repeat (DR) sequences.

[0036] [Table 1]

[0037] To verify the activity of the PpCas9 nuclease and to determine the PpCas9 PAM of interest, we performed experiments to reproduce the DNA cutting reaction in vitro. In vitro cutting of a double-stranded PAM library was used to determine the PAM sequence of the PpCas9 protein. To this end, all components of the PpCas9 effector complex had to be obtained in recombinant form: guide RNA and nuclease. Determination of the guide RNA sequence allowed the synthesis of crRNA and tracrRNA molecules in vitro. Synthesis was performed using the NEB HiScribe T7 RNA synthesis kit. The double-stranded DNA library was a 374 base pair (bp) fragment containing a protospacer sequence flanked by randomized 7 nucleotides (5'-NNNNNNN-3') from the 3' end:

[0038] [ka]

[0039] To cut this target, we used a guide RNA with the following sequence: tracrRNA:

[0040] [ka]

[0041] and crRNA:

[0042] [ka]

[0043] Bold indicates the crRNA sequence that is complementary to the protospacer (target DNA sequence). To produce recombinant PpCas9 protein, the gene was cloned into plasmid pET21a. DNA synthesized by Integrated DNA Technology (IDT) was used as DNA encoding the gene. The sequence was codon-optimized to eliminate codons that are rarely found in the P. pneumoniae genome. The resulting plasmid pET21a-6xHis-PpCas9 was transformed into E. coli Rosetta cells.

[0044] 500 μl of the overnight culture was diluted in 500 ml of LB medium and the cells were grown at 37° C. until an optical density of 0.6 Ru was obtained. Target protein synthesis was induced by adding IPTG to a concentration of 1 mM and the cells were then incubated at 20° C. for 6 hours. The cells were then centrifuged at 5,000 g for 30 minutes and the resulting cell pellet was frozen at −20° C.

[0045] The precipitate was thawed on ice for 30 min, resuspended in 15 ml of lysis buffer (Tris-HCl 50 mM pH 8, 500 mM NaCl, b-mercaptoethanol 1 mM, imidazole 10 mM) supplemented with 15 mg of lysozyme, and incubated again on ice for 30 min. Cells were then disrupted by sonication for 30 min and centrifuged at 16,000 g for 40 min. The resulting supernatant was passed through a 0.2 μm filter and applied onto a HisTrap HP 1 mL column (GE Healthcare) at 1 ml / min.

[0046] Chromatography was performed at 1 ml / min using an AKTA FPLC chromatograph (GE Healthcare). The column containing the applied protein was washed with 20 ml of lysis buffer supplemented with 30 mM imidazole, followed by washing the protein with lysis buffer supplemented with 300 mM imidazole.

[0047] Protein fractions obtained over the course of affinity chromatography were then passed through a Superdex200 10 / 300GL gel filtration column (24 ml) equilibrated with the following buffer: Tris-HCl 50 mM pH 8, 500 mM NaCl, 1 mM DTT. The fractions corresponding to the monomeric form of the PpCas9 protein were concentrated to 3 mg / ml using an Amicon concentrator (containing a 30 kDa filter), and the purified protein was then stored at -80°C in a buffer containing 10% glycerol.

[0048] An in vitro reaction to cut the linear PAM library was carried out in a volume of 20 μl under the following conditions. The reaction mixture consisted of: 1xCutSmart Buffer (NEB), 5 mM DTT, 100 nM PAM library, 2 μM trRNA / crRNA, 400 nM PpCas9 protein. As a control, a sample containing no RNA was prepared in a similar manner. The samples were incubated at different temperatures and analyzed by gel electrophoresis in a 2% agarose gel. If the DNA was correctly recognized and specifically cut by the PpCas9 protein, two DNA fragments of approximately 326 base pairs and approximately 48 base pairs should be generated (see FIG. 2).

[0049] The experimental results showed that PpCas9 exhibited nuclease activity and cut a portion of the PAM library fragment. The temperature gradient (Figure 3) showed that the protein was active in the temperature range of 35-45 °C. The study then used a temperature of 42 °C as the working temperature.

[0050] The library cut reaction was repeated under the selected conditions. The reaction products were applied onto a 1.5% agarose gel and subjected to electrophoresis. Uncut DNA fragments of 374 bp in length were extracted from the gel and prepared for high-throughput sequencing using the NEB NextUltra II kit. The samples were sequenced on the Illumina platform, and then sequence analysis was performed using bioinformatics methods: we used the approach described in Maxwell CS et al., A detailed cell-free transcription-translation-based assay to decipher CRISPR protospacer-adjacent motifs. Methods. 2018 Jul 1;143:48-57 to determine the difference in the occurrence of nucleotides at individual positions of the PAM (NNNNNNN) compared to the control sample. Furthermore, to analyze the results, a PAM logo was constructed (Figure 4).

[0051] Both approaches to data analysis (Figure 4) indicate the importance of PAM positions 5, 6 and 7. Thus, the in vitro analysis allowed us to establish a putative PAM sequence for PpCas9 as follows: NNNNATT. However, this sequence is only putative, given the imprecise results obtained by screening approaches to determine the PAM.

[0052] In this regard, the importance of the position of the individual PAM sequences was examined for a more accurate determination of the sequence. To this end, the inventors determined the PAM sequence

[0053] [ka]

[0054] An in vitro reaction was performed to cut a DNA fragment (or its derivatives) containing the DNA target 5'-atctcctttcattgagcac-3' flanked by:

[0055] [ka]

[0056] All DNA cutting reactions were performed under the following conditions: 1xCutSmart buffer 400nM PpCas9 20nM DNA 2μM crRNA 2μM tracrRNA The incubation time was 30 min and the reaction temperature was 42°C.

[0057] Substitution of the PAM 1 position with all four possible nucleotide variants did not affect the protein activity efficiency (Figure 5). Single base substitutions at each PAM position (purine for pyrimidine and vice versa) confirmed the predicted importance of positions 5 and 6. Substitutions at positions 5 and 6 essentially abolished the protein's activity. Substitutions at position 7 reduced the efficiency of PpCas9 activity by 2-fold, reflecting a reduced requirement for a nucleotide at this position (Figure 6). Thus, in accordance with the results of the in vitro PAM screening of PpCas9 nuclease, the most likely nucleotide at PAM position 5 is adenine or guanine, a fact experimentally confirmed (Figure 7). Substitutions from A to G did not reduce the efficiency of fragment cutting.

[0058] According to the results of the in vitro screening, fragments with a "T" or "C" at position 7 should be recognized more efficiently. Further experiments were performed to conclusively verify the importance of the nucleotide at this position. In vitro studies showed that substituting the nucleotide "T" at position 7 with A or G reduced the cutting efficiency by 40-50% (Figure 8). Thus, PAM position 7 is less conserved compared to positions 5 and 6: a purine at position 7 only reduces the recognition efficiency and does not prevent the PpCas9 protein from introducing a double-strand break in DNA.

[0059] The results of the study were as follows: the PAM recognized by the PpCas9 nuclease corresponds to the following formula: 5'-NNNN(A / G)T-3'. The sequence NNNNRTY (NNNN(A / G)-T-(T / C)) is recognized more efficiently when compared to NNNNRTR (NNNN-(A / G)-T-(A / G)). EXAMPLES

[0060] The following exemplary embodiments of the method are provided for the purpose of disclosing the properties of the present invention and are not to be construed as limiting the scope of the present invention in any way. Example 1. Testing the activity of PpCas9 protein in cleaving various DNA targets.

[0061] To check the ability of PpCas9 to recognize diverse DNA sequences flanked by the sequence 5'-NNNN(A / G)T-3', experiments were performed on in vitro cutting of a DNA target derived from the human grin2b gene sequence (see Table 2).

[0062] Table 2. DNA targets derived from the human grin2b gene

[0063] [Table 2]

[0064] PCR fragments of the grin2b gene carrying recognition sites likely recognizable by PpCas9 (Table 2) according to the PAM consensus sequence 5'-NNNN(A / G)T-3' were used as targets in the cutting reaction. crRNAs were synthesized to direct PpCas9 to these sites and recognize these sequences.

[0065] The cleavage reactions were performed under selected conditions for PpCas9; the results are shown in Figure 9. Figure 9 shows that the PpCas9 enzyme successfully cleaves three out of four targets that contain the appropriate PAM.

[0066] The target on lane 6 has the PAM sequence CAGCATT, which should be efficiently recognized by the protein as predicted based on the results of the depletion analysis, however, recognition of this fragment did not occur during this experiment.

[0067] Therefore, the PAM CAGCATT was further validated on another protospacer target restricted by the same PAM (Figure 10). In this case, the PAM was effectively recognized and resulted in DNA cuts. Thus, the protein has some additional preference for the DNA target sequence. This preference is probably related to the secondary structure of the DNA.

[0068] The study thus demonstrated the presence of nuclease activity in PpCas9 and also made it possible to determine its PAM sequence and to verify the sequence of the guide RNA. The PpCas9 ribonucleoprotein complex specifically introduces a cleavage in the target restricted to PAM 5' NNNN(A / G)T 3' from the 5' end of the protospacer. A scheme of the PpCas9 / RNA complex is shown in FIG.

[0069] Example 2. Use of hybrid guide RNA to cut a DNA target. sgRNA is a type of guide RNA, which is a fused tracrRNA (tracer RNA) and crRNA. To select the optimal sgRNA, we constructed three variants of this sequence with different lengths of the tracrRNA-crRNA duplex. We synthesized the RNAs in vitro and performed experiments on them for cutting the DNA target (Figure 12).

[0070] The following RNA sequences were used as hybrid RNAs:

[0071] [ka]

[0072] The bold indicates the 20 nucleotide sequence that provides pairing with the target DNA (the variable part of the sgRNA). In addition, the experiment used a control sample without RNA, and a positive control that was the cut of the target using crRNA + trRNA.

[0073] A sequence containing the recognition site 5' tatctcctttcattgagcac 3' with the corresponding consensus sequence PAM CAACATT was used as the DNA target:

[0074] [ka]

[0075] Bold indicates the recognition site and capital letters represent PAM. The reaction was carried out under the following conditions: the concentration of the DNA sequence containing PAM (CAACATT) was 20 nM, the protein concentration was 400 nM, the RNA concentration was 2 μM; the incubation time was 30 min, and the incubation temperature was 37°C.

[0076] The selected sgRNA1 and sgRNA2 were found to be as efficient as the native tracrRNA and crRNA sequences: cut occurred in more than 80% of the DNA targets (Figure 12).

[0077] These hybrid RNA variants may be used to cleave any other target DNA after modifying the sequence that directly pairs with the DNA target. Example 3. Cas9 protein from a closely related organism belonging to the genus Pasteurella pneumoniae.

[0078] To date, the CRISPR-Cas9 enzyme has not been characterized in Pasteurella pneumoniae. The Cas9 protein from Staphylococcus aureus, which is comparable in size, is 28% identical to PpCas9 (degree of identity calculated using BLASTp software, default parameters). Similar degrees of identity exist in other known Cas9 proteins (not shown).

[0079] Thus, the PpCas9 protein differs significantly in amino acid sequence from other Cas9 proteins studied to date. Those skilled in the art of genetic engineering will recognize that the PpCas9 protein sequence variants obtained and characterized by the applicants may be modified without altering the function of the protein itself (e.g., by site-directed mutagenesis of amino acid residues that do not directly affect functional activity (Sambrook et al., Molecular Cloning: A Laboratory Manual, (1989), CSH Press, pp.15.3-15.108)). In particular, those skilled in the art will recognize that non-conserved amino acid residues may be modified without affecting residues involved in protein functionality (determining protein function or structure). Examples of such modifications include the replacement of non-conserved amino acid residues with homologous ones. Some regions containing non-conserved amino acid residues are shown in FIG. 12. In some embodiments of the present invention, a protein comprising an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO:1 and differs from SEQ ID NO:1 only at non-conserved amino acid residues may be used to form a double-stranded break in a DNA molecule located immediately preceding the nucleotide sequence 5'-NNNN(A / G)T-3' in said DNA molecule. Homologous proteins may be obtained by mutagenesis (e.g., site-directed or PCR-mediated mutagenesis) of the corresponding nucleic acid molecules, and the encoded modified Cas9 proteins may then be tested for retention of their function according to the functional assays described herein.

[0080] Example 4. The PpCas9 system according to the present invention may be used in combination with a guide RNA to modify the genomic DNA sequence of a multicellular organism, including a eukaryote. A variety of approaches known to those skilled in the art may be applied to introduce the PpCas9 system in a complex containing a guide RNA into the cells of this organism (into all cells or into some cells). For example, methods for delivering the CRISPR-Cas9 system to cells of an organism are disclosed in sources (Liu C et al., Delivery strategies of the CRISPR-Cas9 gene-editing system for therapeutic applications. J Control Release. 2017 Nov 28;266:17-26; Lino CA et al., Delivering CRISPR: a review of the challenges and approaches. Drug Deliv. 2018 Nov;25(1):1234-1257) and in sources further disclosed within these sources.

[0081] For efficient expression of the PpCas9 nuclease in eukaryotic cells, it may be desirable to optimize the codons for the amino acid sequence of the PpCas9 protein by methods known to those of skill in the art (e.g., IDT codon optimization tools).

[0082] For effective activity of PpCas9 nuclease in eukaryotic cells, it is necessary to import the protein into the nucleus of eukaryotic cells. This may be done by using the nuclear localization signal derived from SV40 T antigen (Lanford et al., Cell, 1986, 46:575-582) linked to the PpCas9 sequence through the spacer sequence described in Shen B et al. "Generation of gene-modified mice via Cas9 / RNA-mediated gene targeting", Cell Res. 2013 May;23(5):720-3, or without the spacer sequence. Thus, the complete amino acid sequence of the nuclease to be transported into the nucleus of eukaryotic cells will be the following sequence: MAPKKKRKVGIHGVPAA-PpCas9-KRPAATKKAGQAKKKK (hereafter referred to as PpCas9 NLS). Proteins containing the above amino acid sequence may be delivered using at least two approaches.

[0083] Gene delivery is achieved by generating a plasmid carrying the PpCas9 NLS gene under the control of a promoter (e.g., the CMV promoter) and a sequence encoding a guide RNA under the control of the U6 promoter. As a DNA target, a DNA sequence flanked by 5'-NNNN(G / A)T-3' is used, e.g., the sequence of the human grin2b gene:

[0084] [ka]

[0085] Thus, the sgRNA expression cassette looks like this:

[0086] [ka]

[0087] The bold text indicates the U6 promoter sequence, followed by sequences required for DNA target recognition, and further followed by sequences forming the sgRNA structure, highlighted in red. The plasmid DNA is purified and transfected into human HEK293 cells using Lipofectamine 2000 reagent (Thermo Fisher Scientific). The cells are incubated for 72 hours, and then genomic DNA is extracted therefrom using a genomic DNA purification column (Thermo Fisher Scientific). The target DNA site is analyzed by sequencing on an Illumina platform to determine the number of insertions / deletions in DNA that have been made at the target site by directed double-strand breaks and subsequent repair.

[0088] Amplification of the target fragment is carried out using primers flanking the putative site of introduced break. After amplification, the sample is prepared according to the Ultra II DNA Library Prep Kit for Illumina (NEB) Reagent Sample Preparation Protocol for High Throughput Sequencing. Sequencing is then performed on the Illumina platform with 300 cycles and direct reading. The sequencing results are analyzed by bioinformatics methods. The insertion or deletion of some nucleotides in the target DNA sequence is considered as cut detection.

[0089] Delivery is performed as a ribonucleic acid complex by incubation of the recombinant PpCas9 NLS with guide RNA in CutSmart buffer (NEB). The recombinant protein is produced from producing bacterial cells by purifying it by affinity chromatography (NiNTA, Qiagen) followed by size exclusion (Superdex200).

[0090] The protein is mixed with the RNA in a ratio of 1:2 (PpCas9 NLS:sgRNA), the mixture is incubated at room temperature for 10 minutes, and then transfected into the cells.

[0091] DNA extracted therefrom is then analyzed for insertions / deletions at the target DNA sites (as described above). The PpCas9 nuclease disclosed herein, derived from the bacterium Pasteurella pulmonary, has several advantages over previously disclosed Cas9 proteins.

[0092] Unlike other known Cas nucleases, PpCas9 has a short two-letter PAM that is necessary for the system to function. The present invention shows that the presence of a short PAM (RT) four nucleotides away from the protospacer is sufficient for PpCas9 to function.

[0093] Most of the Cas nucleases known so far that can introduce double-strand breaks in DNA have complex multiletter PAMs, which limit the selection of suitable sequences for cutting. Among the Cas nucleases that recognize short PAMs studied to date, only PpCas9 can recognize sequences flanked by RT motifs.

[0094] A second advantage of PpCas9 is its small protein size (1055 aar). To date, the enzyme is the only small protein studied that has a two-letter RT PAM sequence.

[0095] PpCas9 is a novel small-sized Cas nuclease with a short and easy-to-use PAM that is distinct from the currently known PAM sequences of other nucleases. The PpCas9 protein cleaves diverse DNA targets with high efficiency, including at 37°C, and may serve as the basis for a novel genome editing tool.

[0096] While the present invention has been described with reference to the disclosed embodiments, those skilled in the art may be familiar with the detailed description. It will be appreciated that the particular embodiments described are provided for purposes of illustrating the invention and are not to be construed as limiting the scope of the invention in any manner It will be understood that various modifications may be made without departing from the spirit of the invention. Without being limited thereto, the present invention includes the following aspects. [Aspect 1] Use of a protein comprising the amino acid sequence of SEQ ID NO:1 or an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO:1 and differs from SEQ ID NO:1 only at non-conserved amino acid residues, to form a double-stranded break in a DNA molecule located immediately before the nucleotide sequence 5'-NNNN(A / G)T-3' in the DNA molecule. [Aspect 2] 2. The use according to embodiment 1, characterized by the formation of double-stranded breaks in DNA molecules at temperatures between 35°C and 45°C. [Aspect 3] 2. Use of the protein according to embodiment 1, wherein the protein comprises the amino acid sequence of SEQ ID NO:1. [Aspect 4] A method for modifying a genomic DNA sequence of a single or multicellular organism, comprising the step of introducing into at least one cell of said organism an effective amount of: a) either a protein comprising the amino acid sequence of SEQ ID NO:1, or a nucleic acid encoding a protein comprising the amino acid sequence of SEQ ID NO:1, and b) either a guide RNA comprising a sequence that forms a duplex with a nucleotide sequence of a region of the genomic DNA of the organism immediately adjacent to the nucleotide sequence 5'-NNNN(A / G)T-3' and interacts with said protein after duplex formation, or a DNA sequence encoding said guide RNA, wherein interaction of the protein with the guide RNA and the nucleotide sequence 5'-NNNN(A / G)T-3' results in the formation of a double-stranded break in the genomic DNA sequence immediately adjacent to the sequence 5'-NNNN(A / G)T-3'. The method. [Aspect 5] The method of embodiment 4, further comprising introducing an exogenous DNA sequence simultaneously with the guide RNA.

Claims

1. 1. Use of a protein for the in vitro formation of a double-stranded break in a DNA molecule located immediately before the nucleotide sequence 5'-NNNN(A / G)T-3' in said DNA molecule, comprising: the protein comprises the amino acid sequence of SEQ ID NO:1, and the protein has the activity of forming a double-stranded break in a DNA molecule; The above uses.

2. 2. The use according to claim 1, characterized in that at temperatures between 35°C and 45°C, double strand breaks are formed in DNA molecules.

3. An in vitro method for modifying genomic DNA of a single or multicellular organism, comprising the steps of introducing into at least one cell of said organism an effective amount of: a) a protein comprising the amino acid sequence of SEQ ID NO:1; and b) either a guide RNA comprising a sequence that forms a duplex with a nucleotide sequence in a region of the organism's genomic DNA immediately adjacent to the 5' side of the nucleotide sequence 5'-NNNN(A / G)T-3' and that interacts with said protein after duplex formation, or a DNA encoding said guide RNA. wherein interaction of the protein with the guide RNA and the nucleotide sequence 5'-NNNN(A / G)T-3' results in the formation of a double-stranded break in the genomic DNA immediately adjacent to the sequence 5'-NNNN(A / G)T-3'. The method.

4. The method of claim 3, further comprising introducing exogenous DNA simultaneously with the guide RNA.

Images