pks island-positive E. coli as a marker of negative response to anti-PD1 therapy in colorectal cancer

Abstract

Provided is a method for predicting resistance to anti-PD1 therapy in a subject suffering from cancer, comprising: a) determining the presence of a bacterial pks island in a biological sample from the subject, particularly a fecal or colon biopsy sample from the subject; and b) predicting, from the results of step a), that the subject is likely to be resistant to anti-PD1 therapy. Also provided is a method for treating cancer in a subject by assessing the presence or absence of a bacterial pks island in a biological sample from the subject, particularly a fecal or colon biopsy sample from the subject, and administering an anti-cancer therapy to the subject.

Description

[Technical field]

[0001] The present invention relates to a method for selecting patients suffering from colorectal cancer for anti-PD1 therapy. [Background technology]

[0002] Colorectal cancer (CRC) is the third most common malignancy worldwide, the fourth leading cause of cancer-related deaths in men and the third leading cause in women. This represents a high therapeutic need. Indeed, for the majority of patients with metastatic CRC, chemotherapy is the only viable possibility. However, anti-PD1 immunotherapy has recently been approved by the Food and Drug Administration as a second-line treatment for certain subgroups of patients.

[0003] Anti-checkpoint antibodies (e.g., anti-PD1 antibody nivolumab and anti-CTLA4 antibody ipilimumab) are a new class of antibodies that are very promising molecules in the cancer treatment of various malignancies, such as multiple melanoma, lung, bladder, lymphoma and CRC. However, only a small number of patients respond well to said treatment. In fact, the results of major clinical trials have revealed that about 40 to 60% of patients do not respond satisfactorily to these therapies.

[0004] Therefore, it is important to have biomarkers that can efficiently predict the response of patients suffering from CRC to anti-PD1 therapy.

[0005] Several biomarkers have been presented to predict the efficacy of anti-PD1 therapy. For example, PD-L1 overexpression is an important and widely investigated predictive biomarker for response to anti-PD1 therapy. However, PD-L1 staining cannot be used to accurately select patients for anti-PD1 therapy due to its low predictive accuracy and dynamic changes in expression. Tumor-infiltrating immune cells and molecules in the tumor microenvironment, or together with PD-L1 expression, may be important to predict the clinical benefit of anti-PD1 therapy. However, to the best of our knowledge, there is currently no simple technique available to select CRC patients who respond to anti-PD1 treatment, especially sporadic MSS (Microsatellite Stable) CRC patients. Therefore, there is still a significant need for biomarkers to predict the response of CRC patients to anti-PD1 therapy.

[0006] The present invention fulfills this need.

[0007] Host factors related to environmental and nutritional factors play an important role in colorectal carcinogenesis. In the last two decades, increasing attention has been paid to the role of gut microbiota in CRC carcinogenesis. Studies have shown reduced tumor formation in the intestine of animals raised in a germ-free environment in both genetically induced and colonic inflammation-associated CRC mouse models. In addition, colorectal cancer patients often exhibit a distinctive microflora compared to healthy populations. However, the mechanism by which gut microbiota dysbiosis has been shown to promote colorectal carcinogenesis remains to be elucidated. Recently, Non-Patent Document 1 has shown that tube feeding with stool from colorectal cancer patients promotes intestinal carcinogenesis in germ-free and azoxymethane (ACM) carcinogen mouse models. Despite numerous studies, CRC-associated dysbiosis has not been well defined. However, several bacterial strains, such as Bacteroides fragilis, Fusobacterium nucleatum and Escherichia coli, have a well-established role in CRC development.

[0008] Although E. coli is a commensal bacterium, some strains have acquired several virulence factors, including genotoxic substances, such as colibactin. The colibactin toxin is a hybrid polyketide nonribosomal peptide, encoded by a polyketide synthase (pks) pathogenicity island (Non-Patent Document 2). E. coli harboring these pks islands were preferentially detected in CRC samples compared to non-tumorous controls (Non-Patent Document 3, Non-Patent Document 4). The mechanisms by which CRC-associated E. coli promote colorectal carcinogenesis are diverse and somewhat specific to the animal model and the animal's microbial status (germ-free or SPF). However, regulation of immune responses and inflammation appears to play a central role in these mechanisms.

[0009] Interestingly, metagenomic whole-genome sequencing (WGS) of the gut microbiome in patients with melanoma and treated with anti-PD1 therapy showed a significant enrichment of Escherichia coli in non-responders (Non-Patent Document 5). [Prior art documents] [Non-patent literature]

[0010] [Non-Patent Document 1] Wong et al. (2017) Gastroenterology 153:1621-1633 [Non-Patent Document 2] Johnson et al. (2008) J. Clin. Microbiol. 46:3906-3911 [Non-Patent Document 3] Arthur et al. (2012) Science 338:120-123 [Non-Patent Document 4] Buc et al. (2013) PLoS ONE 8:e56964 [Non-Patent Document 5] Gopalakrishnan et al. (2018) Science 359: 97-103 Summary of the Invention [Problem to be solved by the invention]

[0011] The present invention arises from the unexpected discovery by the inventors that the presence of E. coli carrying the pks island in mice implanted subcutaneously with MC38 tumors suppresses the activity of anti-PD1 antibodies, while the anti-PD1 antibodies are effective in mice implanted with MC38 tumors but with native microbiota. Thus, the presence of E. coli carrying the pks island in a patient's stool or colon biopsy may be predictive of the patient's resistance to anti-PD1 therapy. [Means for solving the problem]

[0012] Accordingly, the present invention relates to a method for predicting resistance to an anti-PD1 therapy in a subject suffering from cancer, said method comprising: a) determining the presence of a pks island from a biological sample from a subject, in particular a fecal or colon biopsy sample from a subject; b) predicting, based on the result of step a), that the subject is likely to be resistant to anti-PD1 therapy; Includes.

[0013] In a particular embodiment, the presence of a pks island is determined in step a) by determining the presence of E. coli bacteria positive for the pks island.

[0014] In certain embodiments, the cancer is colorectal cancer.

[0015] In a particular embodiment, the presence of a pks island is determined in step a) by determining the presence of pks island DNA.

[0016] In another specific embodiment, the presence of pks island DNA is determined by PCR.

[0017] In a particular embodiment, the presence of a pks island is determined in step a) by determining the presence of E. coli bacteria positive for the pks island, the presence of E. coli bacteria positive for the pks island being determined by isolating the E. coli bacteria on agar and determining the presence of pks island DNA, in particular by PCR.

[0018] In another particular embodiment, the presence of a pks island is determined in step a) by determining the presence of E. coli bacteria positive for the pks island, the presence of E. coli bacteria positive for the pks island is determined by determining the presence of E. coli specific DNA, particularly by PCR, and the presence of pks island DNA, particularly by PCR.

[0019] In a particular embodiment, determining the presence of pks island DNA by PCR is carried out by determining the presence of at least one, in particular two, of the genes of the pks island by PCR.

[0020] In yet another embodiment, the anti-PD-1 therapy is cemiplimab therapy.

[0021] Another object of the present invention is a method for selecting a therapy for treating a subject suffering from cancer, said method comprising: a) determining the presence of a pks island from a biological sample from a subject, in particular a fecal sample or a colon biopsy from a subject; b) if the pks island is determined to be present in step a), selecting an anti-cancer therapy for the subject that is not an anti-PD-1 therapy. Includes.

[0022] In a particular embodiment, the presence of a pks island is determined in step a) by determining the presence of E. coli bacteria positive for the pks island.

[0023] In certain embodiments, the cancer is colorectal cancer.

[0024] In certain embodiments, the anti-cancer therapy that is not an anti-PD-1 therapy is selected from the group consisting of irinotecan, oxaliplatin, a combination of irinotecan with 5-FU and leucovorin, a combination of oxaliplatin with 5-FU and leucovorin, a combination of irinotecan with capecitabine, a combination of oxaliplatin and capecitabine, an anti-EGFR antibody such as cetuximab and panitumumab, an anti-VEGFR antibody such as bevacizumab, an anti-VEGFR2 antibody such as ramucirumab, aflibercept, ziv aflibercept, a combination of regorafenib, trametinib and palbociclib, reolysin®, a combination of dabrafenib, trametinib and panitumumab, and combinations thereof.

[0025] The present invention also relates to an anti-cancer therapy that is not an anti-PD-1 therapy for use in a method of treating a subject suffering from cancer, said method comprising: a) determining the presence of a pks island from a biological sample from a subject, in particular a fecal or colon biopsy sample from a subject; b) if the pks island is determined to be present in step a), administering to the subject a therapeutically effective amount of an anti-cancer therapy that is not the anti-PD-1 therapy. Includes.

[0026] In a particular embodiment, the presence of a pks island is determined in step a) by determining the presence of E. coli bacteria positive for the pks island.

[0027] In certain embodiments, the cancer is colorectal cancer.

[0028] The present invention also relates to an anti-PD1 and / or anti-PDL1 antibody for use in a method of treating a subject suffering from cancer, said method comprising: a) determining the presence of a pks island from a biological sample from a subject, in particular a fecal or colon biopsy sample from a subject; b) if the pks island is determined to be absent in step a), administering to the subject a therapeutically effective amount of an anti-PD-1 and / or anti-PDL1 antibody. Includes.

[0029] In a particular embodiment, the presence of a pks island is determined in step a) by determining the presence of E. coli bacteria positive for the pks island.

[0030] In certain embodiments, the cancer is colorectal cancer.

[0031] In certain embodiments, the anti-PD1 or anti-PDL1 antibody is cemiplimab.

[0032] The present invention further relates to a method of treating a subject suffering from cancer, said method comprising: a) determining the presence of a pks island from a biological sample from a subject, in particular a fecal or colon biopsy sample from a subject; b) if the pks island is determined to be present in step a), administering to the subject a therapeutically effective amount of an anti-cancer therapy that is not an anti-PD-1 therapy; or if the pks island is determined to be absent in step a), administering to the subject a therapeutically effective amount of an anti-PD-1 therapy. Includes.

[0033] In a particular embodiment, the presence of a pks island is determined in step a) by determining the presence of E. coli bacteria positive for the pks island.

[0034] In certain embodiments, the cancer is colorectal cancer.

[0035] In other specific embodiments, the anti-cancer therapy that is not an anti-PD-1 therapy is selected from the group consisting of irinotecan, oxaliplatin, a combination of irinotecan with 5-FU and leucovorin, a combination of oxaliplatin with 5-FU and leucovorin, a combination of irinotecan with capecitabine, a combination of oxaliplatin and capecitabine, an anti-EGFR antibody such as cetuximab and panitumumab, an anti-VEGFR antibody such as bevacizumab, an anti-VEGFR2 antibody such as ramucirumab, aflibercept, ziv aflibercept, a combination of regorafenib, trametinib and palbociclib, a combination of Leolysin®, dabrafenib, trametinib and panitumumab, and combinations thereof.

[0036] In another particular embodiment, the anti-PD1 therapy is cemiplimab therapy.

[0037] The present invention also relates to a method of predicting resistance to anti-PD-1 therapy in a subject suffering from cancer, the method comprising: a) optionally isolating E. coli bacteria from a biological sample from a subject, in particular a fecal or colon biopsy sample from a subject, on agar or performing PCR on said biological sample using primers specific for E. coli bacteria to detect the presence of E. coli bacteria; b) performing PCR on the biological sample from the subject using primers specific for the pks gene island, in particular primers specific for a gene selected from the group consisting of ClbH, ClbJ, ClbN, ClbC, ClbI, ClbO, ClbB and ClbK genes, to detect the presence of the pks island; c) predicting that the subject is resistant to anti-PD-1 therapy if the pks island is present as a result of step b) Includes.

[0038] In a particular embodiment, the method comprises step a) of isolating E. coli bacteria from a biological sample from a subject, in particular a fecal or colon biopsy sample from a subject, on agar or performing PCR on said biological sample using primers specific for E. coli bacteria to detect the presence of E. coli bacteria, and step c) consists of predicting from the results of steps a) and b) that the subject is resistant to anti-PD1 therapy if E. coli bacteria positive for the pks island are present.

[0039] According to a particular embodiment, the primer specific for a gene selected from the group consisting of ClbH, ClbJ, ClbN, ClbC, ClbI, ClbO, ClbB and ClbK genes is specific for the ClbN gene of the pks island.

[0040] According to another particular embodiment, PCR is carried out using one or both of a primer comprising SEQ ID NO:1 and a primer comprising SEQ ID NO:2.

[0041] In an alternative embodiment, the method of predicting resistance to anti-PD-1 therapy comprises: a) sequencing the microbiota from a biological sample, in particular a fecal or colon biopsy sample from a subject; b) determining the presence of E. coli bacteria positive for the pks island, in particular the pks island, from the sequencing carried out in step a); and c) predicting from the results of step b) that the subject is resistant to anti-PD-1 therapy if there is a positive E. coli bacterium for the pks island, in particular for the pks island; Includes.

[0042] According to other embodiments, the cancer is colorectal cancer.

[0043] According to another embodiment, the anti-PD-1 therapy is cemiplimab therapy.

[0044] The present invention further relates to a method of selecting a therapy for treating a subject suffering from cancer, said method comprising: a) optionally isolating E. coli bacteria from a biological sample from a subject, in particular a fecal or colon biopsy sample from a subject, on agar or performing PCR on said biological sample using primers specific for E. coli bacteria to detect the presence of E. coli bacteria; b) performing PCR on the biological sample from the subject using primers specific for pks island genes, in particular primers specific for genes selected from the group consisting of ClbH, ClbJ, ClbN, ClbC, ClbI, ClbO, ClbB and ClbK genes, to detect the presence of pks islands; c) if it is determined in step b) that the pks island is present, selecting an anti-cancer therapy for the subject that is not an anti-PD-1 therapy. Includes.

[0045] In a particular embodiment, the method comprises step a) of isolating E. coli bacteria from a biological sample from a subject, in particular a fecal or colon biopsy sample from a subject, on agar or performing PCR on said biological sample using primers specific for E. coli bacteria to detect the presence of E. coli bacteria, and step c) consists of selecting an anti-cancer therapy for said subject that is not an anti-PD-1 therapy if it is determined from steps a) and b) that E. coli bacteria positive for the pks island are present.

[0046] According to a particular embodiment, the primer specific for a gene selected from the group consisting of ClbH, ClbJ, ClbN, ClbC, ClbI, ClbO, ClbB and ClbK genes is specific for the ClbN gene of the pks island.

[0047] According to another particular embodiment, PCR is carried out using one or both of a primer comprising SEQ ID NO:1 and a primer comprising SEQ ID NO:2.

[0048] In an alternative embodiment, the method of predicting resistance to anti-PD-1 therapy comprises: a) sequencing the microbiota from a biological sample, in particular a fecal or colon biopsy sample from a subject; b) determining the presence of E. coli bacteria positive for the pks island, in particular the pks island, from the sequencing carried out in step a); and c) if it is determined in step b) that a pks island, in particular a pks island positive E. coli bacterium is present, selecting for said subject an anti-cancer therapy that is not an anti-PD-1 therapy; Includes.

[0049] According to other embodiments, the cancer is colorectal cancer.

[0050] According to other embodiments, the anti-cancer therapy that is not anti-PD-1 is selected from the group consisting of irinotecan, oxaliplatin, a combination of irinotecan with 5-FU and leucovorin, a combination of oxaliplatin with 5-FU and leucovorin, a combination of irinotecan with capecitabine, a combination of oxaliplatin and capecitabine, an anti-EGFR antibody such as cetuximab and panitumumab, an anti-VEGFR antibody such as bevacizumab, an anti-VEGFR2 antibody such as ramucirumab, aflibercept, ziv aflibercept, a combination of regorafenib, trametinib and palbociclib, a combination of Leolysin®, dabrafenib, trametinib and panitumumab, and combinations thereof.

[0051] The present invention further relates to a method of treating a subject suffering from cancer, said method comprising: a) determining the presence of a pks island from a biological sample from a subject, in particular a fecal or colon biopsy sample from a subject; b) if the pks island is determined to be absent in step a), administering to the subject a therapeutically effective amount of an anti-PD-1 and / or anti-PDL1 antibody. Includes.

[0052] In a particular embodiment, the presence of a pks island is determined in step a) by determining the presence of E. coli bacteria positive for the pks island.

[0053] In certain embodiments, the cancer is colorectal cancer.

[0054] According to another particular embodiment, said anti-PD1 and / or anti-PDL1 antibody is cemiplimab.

[0055] According to other embodiments, the method further comprises administering an additional anti-cancer therapy.

[0056] According to other embodiments, the additional anti-cancer therapy is selected from the group consisting of immune checkpoint inhibitors, radiation therapy, surgery, small molecule kinase inhibitors, chemotherapeutic agents, such as platinum-based chemotherapeutic agents, nucleic acid synthesis inhibitors, cancer vaccines, anti-CD38 antibodies, anti-MUC16xCD3 bispecific antibodies, anti-CD20xCD3 bispecific antibodies, granulocyte-macrophage colony-stimulating factor (GM-CSF), anti-TGFβ antibodies, indoleamine-2,3-dioxygenase (IDO) inhibitors, IL-6R inhibitors, IL-4R inhibitors, IL-10 inhibitors, cytokines such as IL-2, IL-7, IL-21 and IL-15, anti-inflammatory agents, and combinations thereof.

[0057] According to other embodiments, the additional anti-cancer therapy is radiation therapy selected from the group consisting of hypofractionated radiation therapy and stereotactic body radiation therapy.

[0058] According to other embodiments, the additional anti-cancer therapy is a small molecule kinase inhibitor selected from the group consisting of sorafenib and ceritinib.

[0059] According to other embodiments, the additional anti-cancer therapy is a chemotherapeutic agent selected from the group consisting of paclitaxel, pemetrexed, and gemcitabine.

[0060] According to other embodiments, the additional anti-cancer therapy is a platinum-based chemotherapeutic agent selected from the group consisting of carboplatin and cisplatin.

[0061] According to other embodiments, the additional anti-cancer therapy is a nucleic acid synthesis inhibitor that is decitabine.

[0062] According to other embodiments, the additional anti-cancer therapy is a cancer vaccine that is ISA101b.

[0063] According to another embodiment, the additional anti-cancer therapy is an anti-TGFβ antibody that is SAR439459.

[0064] According to other embodiments, the additional anti-cancer therapy is an anti-inflammatory agent selected from the group consisting of corticosteroids and non-steroidal anti-inflammatory agents.

[0065] The present invention further relates to a method of treating a subject suffering from cancer, said method comprising: a) determining the presence of a pks island from a biological sample from a subject, in particular a fecal or colon biopsy sample from a subject; b) if the pks island is determined to be present in step a), administering to the subject a therapeutically effective amount of an anti-cancer therapy that is not an anti-PD-1 therapy; or if the pks island is determined to be absent in step a), administering to the subject a therapeutically effective amount of an anti-PD-1 therapy. Includes.

[0066] In a particular embodiment, the presence of a pks island is determined in step a) by determining the presence of E. coli bacteria positive for the pks island.

[0067] In certain embodiments, the cancer is colorectal cancer.

[0068] According to other particular embodiments, the anti-cancer therapy that is not an anti-PD-1 therapy is selected from the group consisting of irinotecan, oxaliplatin, a combination of irinotecan with 5-FU and leucovorin, a combination of oxaliplatin with 5-FU and leucovorin, a combination of irinotecan with capecitabine, a combination of oxaliplatin and capecitabine, an anti-EGFR antibody such as cetuximab and panitumumab, an anti-VEGFR antibody such as bevacizumab, an anti-VEGFR2 antibody such as ramucirumab, aflibercept, ziv aflibercept, a combination of regorafenib, trametinib and palbociclib, a combination of Leolysin (registered trademark), dabrafenib, trametinib and panitumumab, and combinations thereof.

[0069] According to another particular embodiment, said anti-PD1 therapy is cemiplimab therapy. [Brief description of the drawings]

[0070] [Figure 1] Figure 1: Lack of antitumor effect of PD-1-based immunotherapy on the growth rate of MC38 mouse colon tumors in pks+ E. coli pre-infected mice. Figure 1: Levels of 11G5-bacterial colonization (CFU / g of feces) in feces of mice injected with isotype control (11G5+isotype control, circles) or RMP1-14 antibody (11G5+Ab, squares). [Diagram 2] Figure 1: Lack of antitumor effect of PD-1-based immunotherapy on the growth rate of MC38 mouse colon tumors in pks+ E. coli pre-infected mice. Figure 2: Levels of 11G5-bacterial colonization (CFU / g of tissue) in colon tissue of mice injected with isotype control (11G5 isotype control) or RMP1-14 antibody (11G5 Ab). [Diagram 3] Figure 3: Lack of antitumor effect of PD-1-based immunotherapy on the growth rate of MC38 mouse colon tumors in pks+ E. coli pre-infected mice. Figure 4: Response to PD-1-based immunotherapy as assessed by MC38 tumor volume (mm3) in RMP1-14 treated animals (PBS+Ab, triangles) versus untreated animals (PBS+isotype CTL, squares). [Figure 4] Figure 4: Lack of antitumor effect of PD-1 based immunotherapy on the growth rate of MC38 mouse colon tumors in pks+ E. coli pre-infected mice. Figure 4: Lack of response to PD-1 based immunotherapy in mice pre-infected with pks+ E. coli 11G5 strain as assessed by MC38 tumor volume (mm3) in the presence (11G5+Ab, triangles) or absence (11G5+isotype CTL, squares) of RMP1-14 antibody. [Diagram 5] Figure 1. Density of TILs in tumors and invasive margins of patients colonized with pks+ or pks- E. coli assessed by digital image analysis. *p=0.05. [Figure 6]Figure 1 shows that colon cancer-associated E. coli 11G5 strain modulates T cell density in the colon of APCMin / + mice. Immunofluorescence staining for CD3 was performed on colon sections 50 days after infection. Cell density was determined by digital image analysis of each stained section. The figure shows the density of TILs for each group of mice (uninfected: PBS and 11G5ΔClbQ-infected: 11G5). *p=0.05. [Figure 7] Figure 7: Effect of pks+ E. coli pre-infection on TIL levels in mice implanted with MC38 tumors. Figure 7: Representative flow cytometry plots to assess the percentage ratio of CD3+ T cells among live CD45+ leukocytes in implanted MC38 tumors for each group of mice. [Figure 8] Figure 8: Effect of pks+ E. coli pre-infection on TIL levels in mice implanted with MC38 tumors. Figure 8: Significantly reduced percentage of CD3+ T cells among live CD45+ leukocytes in tumors of 11G5-infected mice compared to control mice (mean plus SEM). [Figure 9] Figure 9: Effect of pks+ E. coli pre-infection on TIL levels in mice implanted with MC38 tumors. Figure 9: Representative flow cytometry plots to assess the percentage ratio of CD8+CD3+ T cells among live CD45+ leukocytes in implanted MC38 tumors for each group of mice. [Figure 10] Figure 10: Effect of pks+ E. coli pre-infection on TIL levels in mice implanted with MC38 tumors. Figure 10: Significantly reduced percentage of CD8+CD3+ T cells among live CD45+ leukocytes in tumors of 11G5-infected mice compared to control mice (mean plus SEM). [Figure 11]Figure 11: Effect of pks+ E. coli pre-infection on TIL levels in mice implanted with MC38 tumors. Figure 11: Representative flow cytometry plots to assess the percentage ratio of neutrophils (CD11b+Ly6G+Ly6C- cells) among live CD45+ leukocytes in implanted MCD38 tumors for each group of mice. [Figure 12] Figure 11: Effect of pks+ E. coli pre-infection on TIL levels in mice implanted with MC38 tumors. Figure 12: Significant increase (mean plus SEM) in the percentage of neutrophils among live CD45+ leukocytes in tumors of 11G5-infected mice compared to control mice. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0071] In the context of the present invention, the term "cancer" refers to any cancer for which anti-PD1 therapy can be considered. Examples of such cancers include colorectal cancer, particularly advanced metastatic colorectal cancer, multiple melanoma, lung cancer, particularly non-small cell lung cancer, bladder cancer, lymphoma, particularly Hodgkin's lymphoma, B-cell lymphoma or follicular lymphoma, renal cell carcinoma, squamous cell carcinoma of the head and neck, ovarian cancer, Merkel cell carcinoma and urothelial carcinoma.

[0072] In a particular embodiment, the cancer is melanoma or colorectal cancer, more particularly colorectal cancer.

[0073] In a more specific embodiment, said colorectal cancer is microsatellite stable (MSS) colorectal cancer.

[0074] A "subject" for the purposes of the present invention includes humans and other animals, particularly mammals, as well as other organisms. Thus, the present methods are applicable to both human therapy and veterinary applications. In certain embodiments, the subject is a mammal, and in more specific embodiments, the subject is a human.

[0075] The method of the invention comprises the step a) of determining the presence of a pks island from a biological sample derived from a subject as defined above.

[0076] As used herein, "biological sample" refers to a sample obtained from a subject's digestive tract, such as a fecal sample or a colonic biopsy sample.

[0077] As used herein, "pks island" refers to a 54 kb genomic island that contains all 19 genes (clbA to clbS) that encode the machinery that allows for the production of colibactin. This machinery consists of three non-ribosomal peptide megasynthases (ClbH, ClbJ, ClbN), three polyketide megasynthases (ClbC, ClbI, ClbO), two hybrid NRPS / PKS megasynthases (ClbB, ClbK) and nine accessory, tailoring and editing enzymes.

[0078] According to the invention, determining the presence of a pks island is carried out by determining the presence of at least one expression product or expression product derivative of the pks island or by determining the presence of pks island DNA.

[0079] As used herein, "expression product of at least one pks island" means at least one protein or mRNA encoded by at least one of the 19 genes of the pks island, in particular at least one of the ClbH, ClbJ, ClbN, ClbC, ClbI, ClbO, ClbB and ClbK genes.

[0080] As used herein, "pks island expression product derivatives" refers to metabolites, intermediates and toxins, such as colibactin, produced via the machinery encoded by the pks island as defined above, in particular via enzymes encoded by at least one of the ClbH, ClbJ, ClbN, ClbC, ClbI, ClbO, ClbB and ClbK genes.

[0081] The determination of the presence of at least one expression product of the pks island is carried out by any technique well known to those skilled in the art, such as Western blot, enzyme-linked immunosorbent assay, immunochemistry, RT-PCR or qPCR.

[0082] The determination of the presence of at least one derivative expression product of the pks island is carried out by any technique well known to those skilled in the art, such as Western blot, enzyme-linked immunosorbent assay or immunochemistry.

[0083] In a particular embodiment, the determination of the presence of a pks island is determined by comparing the determined level of the pks island with a pre-determined threshold. Statistical methods for determining an appropriate threshold will be readily apparent to those skilled in the art. The threshold is determined, if necessary, from samples from subjects known to contain (positive control) or not contain (negative control) a pks island.

[0084] In a particular embodiment, the presence of a pks island is determined in step a) by determining the presence of pks island DNA.

[0085] As used herein, "pks island DNA" refers to a nucleic acid contained in a pks island, said nucleic acid being at least 25 bp, in particular at least 50 bp, at least 100 bp, at least 200 bp, at least 300 bp, at least 400 bp, at least 500 bp, at least 600 bp, at least 700 bp, at least 800 bp, at least 900 bp, at least 1000 bp, at least 2000 bp, at least 3000 bp, at least 4000 bp, at least 5000 bp, at least 6000 bp, at least 7000 bp, at least 8000 bp, at least 9000 bp, at least 10000 bp, at least 20000 bp, at least 30000 bp, at least 40000 bp or at least 50000 bp.

[0086] The pks island DNA may in particular be a nucleic acid contained in at least one of the 19 genes of a pks island, in particular at least one of the ClbH, ClbJ, ClbN, ClbC, ClbI, ClbO, ClbB and ClbK genes. For example, the pks island DNA is a nucleic acid contained in the ClbN gene of a pks island.

[0087] The determination of the presence of pks island DNA is carried out by any technique well known to those skilled in the art, for example by PCR, typically using specific probes on a DNA chip, or by sequencing.

[0088] In a particular embodiment, determining the presence of pks island DNA is performed by PCR.

[0089] In a particular embodiment, the presence of pks island DNA is determined by determining the presence of at least one, in particular two, genes of the pks island as defined above, in particular at least one, in particular two genes selected from the group consisting of ClbH, ClbJ, ClbN, ClbC, ClbI, ClbO, ClbB and ClbK genes, by PCR.

[0090] In a particular embodiment, the determination of the presence of pks island DNA is carried out by PCR using primers specific for the pks island genes, in particular primers specific for at least one, in particular two genes of the pks island as defined above, in particular at least one, in particular two genes selected from the group consisting of the ClbH, ClbJ, ClbN, ClbC, ClbI, ClbO, ClbB and ClbK genes.

[0091] In a particular embodiment, the presence of pks island DNA is determined by PCR using primers specific for the pks island gene, in particular using primers specific for the ClbN gene of the pks island, more particularly using one or both of a primer comprising sequence number 1 and a primer comprising sequence number 2.

[0092] Typically, the presence of a pks island is determined by the following method: Total DNA is preferably extracted from the stool sample to be tested. DNA amplification is then preferably performed using Taq DNA polymerase, typically with primers, in particular with 10 μM primers typically located in the ClbN gene of the pks island. Suitable primers, as disclosed in Johnson et al. (2008) J. Clin. Microbiol. 46:3906-3911, typically have the following sequences: - Forward primer: GTTTTGCTCGCCAGATAGTCATTC (SEQ ID NO: 1) - Reverse primer: CAGTTCGGGTATGTGTGGAAGG (SEQ ID NO: 2) It is of the following.

[0093] In a particular embodiment, the presence of the pks island is determined by determining the presence of E. coli bacteria positive for the pks island.

[0094] Determining the presence of E. coli bacteria positive for the pks island is performed by any suitable method well known to those of skill in the art.

[0095] In particular, determining the presence of E. coli bacteria positive for the pks island is determined by isolating the E. coli bacteria present in the sample on agar as disclosed above and determining the presence of pks island DNA.

[0096] Isolation of E. coli bacteria present in a sample on agar is typically carried out by culturing said sample on a suitable culture medium, for example MacConkey agar plates, in particular aerobically, followed by morphological characterization of the colonies obtained and further identification of Gram-negative colonies using a suitable bacterial identification kit. Alternatively, isolation of E. coli bacteria present in a sample on agar is typically carried out by culturing said sample on Drigalski agar and chromogenic agar chromID CPS3® (bioMerieux), which allows identification of E. coli, and optionally confirming said identification using an automated Vitek II® system (bioMerieux). Typically, isolation of E. coli bacteria present in a sample on agar is carried out as disclosed in Buc et al. (2013) PLoS ONE 8:e56964.

[0097] Alternatively, the presence of E. coli bacteria positive for the pks island is determined by determining the presence of E. coli specific DNA in the sample and determining the presence of pks island DNA, as disclosed above.

[0098] The determination of the presence of E. coli specific DNA in the sample is carried out by any method well known to those skilled in the art, in particular by PCR.

[0099] In particular, the determination of the presence of E. coli specific DNA is carried out by PCR using primers specific for E. coli bacteria.

[0100] Such primers specific for E. coli bacteria are well known to those skilled in the art. Typically, primers specific for E. coli 16S DNA are used as disclosed in Sabat et al. (2000) Applied Environ. Microbiol. 66:844-849. Alternatively, primers specific for the E. coli uidA gene or the adjacent region of the E. coli uspA gene are used as disclosed in Choi et al. (2018) Korean J. Food. Sci. Anim. Resour. 38:829-834 and Chen and Griffiths (1998) Lett. Appl. Microbiol. 27:369-371, respectively.

[0101] Alternatively, the determination of the presence of E. coli bacteria positive for the pks island is performed by sequencing, DNA chip, FISH, Western blot, enzyme-linked immunosorbent assay, immunochemistry, immunofluorescence or global sequencing of the microbiota.

[0102] In the context of the present invention, the term "anti-PD1 therapy" refers to any therapeutic treatment that inhibits or antagonizes the PD1 / PDL1 pathway.

[0103] Anti-PD1 therapies are well known to those skilled in the art and include anti-PD1 antibodies or antibody derivatives, such as pembrolizumab, nivolumab, cemiplimab, spartalizumab (also known as PDR001; see, e.g., WO 2015 / 112900), tislelizumab (also known as BGB-A317; see, e.g., WO 2015 / 035606), camrelizumab (also known as SHR-1210; see, e.g., WO 2015 / 085847), dostallimab (also known as TSR-042; see, e.g., WO 2014 / 179664), sintilimab (also known as IBI308; see, e.g., WO 2017 / 025016), MEDI 0608 (formerly AMP-514; see, e.g., WO 2012 / 145493 and U.S. Pat. No. 9,205,148), PF-06801591 (see, e.g., WO 2016 / 092419), JS001 (see, e.g., WO 2014 / 206107), MGA012 (see, e.g., WO 2017 / 019846), AGEN2034 (see, e.g., WO 2017 / 040790) and JNJ-63723283 (see, e.g., WO 2017 / 079112) and anti-PDL1 antibodies or antibody derivatives such as atezolizumab, avelumab, durvalumab, BMS-936559 antibody or CK-301 antibody.

[0104] In certain embodiments, the anti-PD1 therapy is therapy with anti-PD1 and / or anti-PDL1 antibodies.

[0105] The terms "antibody," "immunoglobulin," or "Ig" are used interchangeably herein. The term antibody includes, but is not limited to, synthetic antibodies, monoclonal antibodies, recombinantly produced antibodies, multispecific antibodies (including bispecific antibodies), human antibodies, humanized antibodies, chimeric antibodies, intrabodies, single chain Fvs (scFv) (including, e.g., monospecific, bispecific, trispecific, etc.), camelized antibodies, single domain antibodies, Fab fragments, F(ab') fragments, disulfide-linked Fvs (sdFv), anti-idiotypic (anti-Id) antibodies, and any epitope-binding fragments of the above, fusion proteins comprising the antigen-binding domain of an antibody, fusion proteins based on PD-1 or PD-L1 ligands (i.e., "traps," fusion proteins comprising the PD-1 or PD-L1 binding domain of a native PD-1 or PD-L1 ligand fused to, e.g., the Fc portion of an immunoglobulin), and any combination thereof. In particular, antibodies include immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e., molecules that contain an antigen-binding domain or an antigen-binding site that specifically binds to the PD-1 or PD-L1 antigen. Anti-PD1 or anti-PDL1 antibodies can be of any origin (human, murine or other), class (e.g., IgG, IgE, IgM, IgD, IgA and IgY) or subclass (e.g., IgG1, IgG2, IgG2a, IgG2b, IgG3, IgG4, IgA1 and IgA2). In certain embodiments, the anti-PD1 or anti-PDL1 antibodies are humanized, e.g., humanized monoclonal anti-PD1 and / or anti-PDL1 antibodies.

[0106] In a particular embodiment, the anti-PD1 therapy is cemiplimab therapy.

[0107] "Resistance to anti-PD1 therapy" as used herein means that the anti-PD1 treatment does not improve the well-being of the treated patient with respect to the disease being treated, e.g., tumor growth is not reduced and / or slowed, and / or survival rates are not increased.

[0108] "Predicting resistance to anti-PD1 therapy" as used herein means determining the likelihood that an anti-PD1 therapy, as defined above, when administered to a patient, will not improve the health status of said patient with respect to the disease being treated.

[0109] As used herein, the term "anti-cancer therapy" refers to any procedure, method and / or agent used to prevent, manage, treat and / or ameliorate cancer. In certain embodiments, the terms "therapies" and "therapy" refer to biological therapy, supportive therapy and / or other therapies known to those skilled in the art, e.g., medical professionals, that are useful in the prevention, management, treatment and / or amelioration of cancer.

[0110] "Anti-cancer therapy that is not an anti-PD1 therapy" means any therapy that is not an anti-PD1 therapy as defined above, preferably known to have a beneficial effect on the particular cancer being treated.

[0111] Typically, when the cancer is colorectal cancer, the anti-cancer therapy that is not an anti-PD1 therapy is selected from the group consisting of irinotecan, oxaliplatin, a combination of irinotecan with 5-FU and leucovorin, a combination of oxaliplatin with 5-FU and leucovorin, a combination of irinotecan with capecitabine, a combination of oxaliplatin and capecitabine, an anti-EGFR antibody such as cetuximab and panitumumab, an anti-VEGFR antibody such as bevacizumab, an anti-VEGFR2 antibody such as ramucirumab, aflibercept, ziv aflibercept, a combination of regorafenib, trametinib and palbociclib, a combination of Leolysin (registered trademark), dabrafenib, trametinib and panitumumab, and combinations thereof.

[0112] If the pks island, and in particular E. coli positive for the pks island, is not present in a biological sample from the subject, in particular a fecal or colon biopsy sample, then the anti-PD-1 and / or anti-PDL1 therapy is administered in combination with a further anti-cancer therapy.

[0113] In certain embodiments, the additional anti-cancer therapy is an immune checkpoint inhibitor, radiation therapy (e.g., hypofractionated radiation therapy, stereotactic body radiation therapy), surgery, a small molecule kinase inhibitor (e.g., sorafenib, ceritinib), a chemotherapeutic agent (e.g., paclitaxel, pemetrexed, gemcitabine), such as a platinum-based chemotherapeutic agent (e.g., carboplatin, cisplatin), a nucleic acid synthesis inhibitor (e.g., decitabine), a cancer vaccine (e.g., ISA101b), an anti-CD38 antibody (e.g., isatuximab), an anti-MUC16xCD3 bispecific antibodies (e.g., REGN4018), anti-CD20xCD3 bispecific antibodies (e.g., REGN1979), granulocyte-macrophage colony-stimulating factor (GM-CSF), anti-TGFβ antibodies (e.g., SAR439459), indoleamine-2,3-dioxygenase (IDO) inhibitors, IL-6R inhibitors, IL-4R inhibitors, IL-10 inhibitors, cytokines such as IL-2, IL-7, IL-21 and IL-15, anti-inflammatory drugs such as corticosteroids, non-steroidal anti-inflammatory drugs, and combinations thereof.

[0114] In certain embodiments, the immune checkpoint inhibitor is an anti-CTLA4 antibody (e.g., ipilimumab, REGN4659) or an anti-LAG-3 antibody (e.g., REGN3767).

[0115] The present invention also relates to an anti-PD1 and / or anti-PDL1 antibody, as defined above, for use in a method of treating a subject suffering from cancer, said method comprising: a) determining the presence of a pks island as defined above from a biological sample from the subject, in particular a fecal or colon biopsy sample from the subject, b) if it is determined in step a) that the pks island is absent, administering to the subject a therapeutically effective amount of an anti-PD1 and / or anti-PDL1 antibody, as defined above. Includes.

[0116] Another object of the invention relates to the use of an anti-PD1 and / or anti-PDL1 antibody as defined above in the manufacture of a medicament intended for a method of treating a subject suffering from cancer, said method comprising: a) determining the presence of a pks island as defined above from a biological sample from the subject, in particular a fecal or colon biopsy sample from the subject, b) if it is determined in step a) that the pks island is not present, administering to the subject a therapeutically effective amount of an anti-PD1 and / or anti-PDL1 antibody as defined above.

[0117] The present invention further relates to a method of treating a subject suffering from cancer, said method comprising: a) determining the presence of a pks island as defined above from a biological sample from the subject, in particular a fecal or colon biopsy sample from the subject, b) if the pks island is determined to be present in step a), administering to the subject a therapeutically effective amount of an anti-cancer therapy that is not an anti-PD-1 therapy, as defined above; or if in step a) it is determined that the pks island is absent, administering to the subject a therapeutically effective amount of an anti-PD-1 therapy, as defined above. Includes.

[0118] Unless otherwise specified, as used herein, "treating" or "treatment" of a disease, disorder or syndrome means inhibiting the disease, disorder or syndrome, i.e., arresting its development; and alleviating the disease, disorder or syndrome, i.e., causing the regression of the disease, disorder or syndrome.As is known in the art, in the context of treatment, adjustments for systemic versus local delivery, age, weight, general health, sex, diet, administration time, drug interactions and severity of symptoms may be necessary, which can be ascertained by routine experimentation by those skilled in the art.

[0119] The term "administer" or "administration" refers to injecting or otherwise physically delivering a substance (e.g., a formulation of the present invention) that is external to the body into a patient, for example, by mucosal, intradermal, intravenous, subcutaneous, intramuscular delivery and / or any other physical delivery method described herein or known in the art. When a disease or its symptoms are being treated, administration of the substance typically occurs after the onset of the disease or its symptoms. When a disease or its symptoms are being prevented, administration of the substance typically occurs before the onset of the disease or its symptoms.

[0120] The term "effective amount" or "pharmaceutical effective amount" or "therapeutically effective amount" refers to an amount of an agent sufficient to provide a desired biological, therapeutic and / or prophylactic result. The result may be a decrease, amelioration, alleviation, reduction, delay and / or alleviation of one or more of the signs, symptoms or causes of a disease or any other desired change in a biological system. In the context of cancer, an effective amount includes an amount sufficient to cause tumor regression and / or reduce the rate of tumor growth (e.g., inhibit tumor growth) or prevent or slow other undesirable cell proliferation. In some embodiments, an effective amount is an amount sufficient to slow development. In some embodiments, an effective amount is an amount sufficient to prevent or slow recurrence.

[0121] An effective amount is administered in one or more administrations. An effective amount of a therapy can: (i) reduce the number of cancer cells; (ii) reduce tumor size; (iii) inhibit, impede, slow to some extent and preferably stop cancer cell invasion into peripheral organs; (iv) inhibit (i.e. slow to some extent and preferably stop) tumor metastasis; (v) inhibit tumor growth; (vi) prevent or slow tumor onset and / or recurrence; and / or (vii) alleviate to some extent one or more of the symptoms associated with cancer.

[0122] The amount may vary depending on factors such as the size and weight of the subject, the type of disease or the particular compound of the therapy. The amount may also vary depending on the compound, the disease state and its severity, the age of the patient being treated, etc. The effective amount can be determined by one of ordinary skill in the art having the knowledge and interest of this disclosure.

[0123] The terms "comprising" and "including" are used herein in their open-ended and open-ended sense, unless otherwise noted.

[0124] In the context of describing the present invention (particularly in the context of the claims which follow), the terms "a" and "an" and "the" and similar references are to be understood to cover both the singular and the plural, unless otherwise specifically stated herein or clearly contradicted by context.

[0125] [Table 1]

[0126] The invention is further illustrated by the following examples. EXAMPLES

[0127] Colorectal cancer (CRC) is the third most common malignant tumor worldwide, the fourth leading cause of cancer-related deaths in men, and the third leading cause in women. Host factors related to environmental and nutritional factors play an important role in colorectal carcinogenesis. In the last two decades, increasing attention has been paid to the role of gut microbiota dysbiosis in CRC carcinogenesis. Studies have shown reduced tumor formation in the intestine of animals raised in a germ-free environment in both genetically induced or colitis-associated CRC mouse models. Furthermore, colorectal cancer patients often exhibit a distinctive microbiota compared to healthy populations (Nakatsu et al. (2015) Nat. Commun. 6:8727). The mechanisms by which gut microbiota dysbiosis has been shown to promote colorectal carcinogenesis remain to be elucidated. The association between exposure to antibiotics at an early age and the development of colorectal adenoma risk at age 60 indicates the influence of microbiota dysbiosis in the first step of carcinogenesis. Recently, Wong et al. have shown that tube feeding with feces from colorectal cancer patients promotes intestinal carcinogenesis in germ-free and azoxymethane (ACM) carcinogen mouse models (Wong et al. (2017) Gastroenterology 153:1621-1633). Despite numerous studies, CRC-associated dysbiosis is not well defined. However, some bacterial strains, such as Bacteroides fragilis, Fusobacterium nucleatum, and Escherichia coli, have a well-established role in CRC development.

[0128] Although E. coli is a symbiotic bacterium, some strains have acquired several virulence factors, including genotoxins, such as colibactin, a hybrid polyketide nonribosomal peptide encoded by the polyketide synthase (pks) pathogenicity island (Johnson et al. (2008) J. Clin. Microbiol. 46:3906-3911). This colibactin pks island was preferentially detected in CRC samples compared to non-neoplastic controls (Nakatsu et al. (2015) Nat. Commun. 6:8727; Arthur et al. (2012) Science 338:120-123; Buc et al. (2013) PLoS ONE 8:e56964; Prorok-Hamon et al. (2014) Gut 63:761-770; Eklof et al. (2017) Int. J. Cancer 141:2528-2536). The gene for colibactin (clbB gene of the pks island) was highly enriched in the colonic mucosa of familial adenomatous polyposis (FAP) patients compared to healthy individuals. Similarly, Nakatsu et al. detected pks-positive bacteria in adenomas, indicating the presence of these bacteria at an early stage of carcinogenesis (Nakatsu et al. (2015) Nat. Commun. 6:8727).

[0129] Using a well-characterized subcutaneous syngeneic mouse model, we assessed the impact of chronic infection on anti-PD-1 immunotherapy-mediated antitumor responses. In parallel, we evaluated T cell populations in a collection of human CRC samples previously characterized for pks island status.

[0130] material and method Bacterial strains A representative CRC-colibactin-producing E. coli strain, designated 11G5, was isolated from colon tissue of a patient with colon cancer and was resistant to ampicillin and kanamycin (Buc et al. (2013) PLoS ONE 8:e56964).

[0131] animal All studies were approved by the local ethical committee (No. CE-2912) and the French Ethical Animal Use Committee (Apafis#5401 and Apafis#13812). Studies were performed with 6- to 7-week-old wild-type (WT) C57BL / 6J mice (Charles River Laboratories, L'Abresle, France). All mice were housed under conventional conditions in the animal care facility of the Universite Clermont Auvergne (Clermont-Ferrand, France).

[0132] Effect of 11G5 on anti-PD-1 mAb efficacy in mice Transplantable MC38 CRC cells derived from C57BL / 6J mice were cultured in vitro at 4 °C for 24 h at 37 °C for 1 h in 5% CO using a culture medium consisting of DMEM (Invitrogen, Cergy Pontoise, France) supplemented with 10% FCS (Biowest, Nuaille, France), 1% glutamine, 1% hepes, 1 mM non-essential amino acids, and 1 mM sodium pyruvate. 2 The mice were maintained as monolayers at 37°C in a humidified incubator containing 0.1% ethanol. Studies were performed in 6-8 week old WT C57BL / 6J male mice, with 8 animals per group. To enhance E. coli strain colonization, we inoculated the mice with bacteria (approximately 1 × 10 9 Streptomycin (2.5 g / L) was administered for 3 days prior to oral inoculation with 1 × 10 bacteria (1 × 10 ng / L) or PBS alone (uninfected control). Nine days after infection, mice were anesthetized by isoflurane inhalation and injected with 1 × 10 ng / L of 1 × 10 ng / mL ... 61000 MC38 cells were inoculated into non-infected or 11G5-infected mice. At 8, 11, 14, 18, 20 and 22 days after tumor cell injection, non-infected or 11G5-infected mice were intraperitoneally (ip) injected with a PD-1 specific blocking antibody (mu anti-PD-1; mIgG1-chimeric version of RPM1-14 rat monoclonal antibody and mouse IgG1 Fc domain) or an IgG1 isotype control antibody (mIgG1, clone 1B711) (10 μg / g mouse). The RPM1-14 rat monoclonal antibody is described in Natalia Martin-Orozco et al. (J Immunol December 15, 2006, 177(12) 8291-8295). The chimeric version of RPM1-14 rat monoclonal antibody and mouse IgG1 Fc domain has a light chain of SEQ ID NO: 3 and a heavy chain of SEQ ID NO: 4. Body weight was measured twice a week to assess potential toxicity. Tumor volume (mm 3 ) into the equation LxS 2 The tumor size was calculated twice weekly from measurements of two perpendicular diameters using a caliper according to the 1990 / 2 standard, where L and S are the maximum and minimum diameters (mm), respectively. Mice were sacrificed on day 30 of the study. Tumors were removed and weighed.

[0133] Chronic infection animal models C57BL / 6J-Apc Min / + Bacterial infection of females was performed as described in Bonnet et al. (2014) Clin Cancer Res 20:859-867. To enhance E. coli colony formation, streptomycin (2.5 g / L) was added to the bacteria (approximately 1x10 in PBS). 8Mice were treated for 3 days prior to oral feeding with 100 mg of bacteria (100 mg of bacteria) or PBS alone (non-infected control). Three E. coli strains were tested: the pks-positive 11G5 strain, its isogenic mutant 11G5ΔClbQ and the K-12 MG1655 commensal strain. Fecal bacterial colonization was routinely quantified as colony-forming units per stool as described in Bonnet et al. (2014) Clin Cancer. Res. 20:859-867. Five days after inoculation, mice were sacrificed. The colon was removed from the cecum to the rectum. Polyps were then counted. Tissues were prepared for bacterial colonization and immunostaining studies. Mesenteric lymph nodes (MLNs) were harvested and homogenized, after which bacterial colonization was evaluated by selective culture and immune cells were analyzed by flow cytometry. According to the parameters tested, at least six animals per group were tested and the studies were reproduced at least twice.

[0134] Immunofluorescence staining and quantification of immune cells At the end of the study, the colon was Swiss-rolled from distal to proximal end and fixed in 10% formalin (Sigma, Tokyo, Japan) for 24 h at room temperature. The blocks were embedded in paraffin and cut into 5 μm sections, after which the tissue sections were prepared for hematoxylin-eosin-safranin staining or immunofluorescence staining to analyze colonic immune cells in the tumor. Immunostaining identified several immune cell populations: CD4+ T cells (CD3+ T cells), CD4+ T cells (CD4+ T cells), and CD4+ T cells (CD4+ T cells). + CD4 + );CD8T cells (CD3 + CD8 + ) was performed on four consecutive sections. All IF staining was performed using automated staining machines, Discovery XT processors (Roch, Bale, Switzerland), and a tyramide signal amplification (TSA)-conjugated fluorescent dye method was used on the entire colonic slide. Cell quantification was performed on the entire colonic mucosa by a specific digital image analysis process.

[0135] Determining the immune composition in human CRC biopsies The immune composition (CD3 and CD8 density) was determined in 40 CRC samples from the MiPaCor collection sample (DC-2017-2972). All samples were previously tested for pks status on colonic tissue by PCR using the primer of sequence SEQ ID NO:1 as forward primer and the primer of sequence SEQ ID NO:2 as reverse primer (Gagniere et al. (2017) Clin. Sci. 131:471-485). We selected 20 pks-negative and 20 pks-positive samples. After colon resection, fresh specimens were collected, fixed in buffered 4% paraformaldehyde, embedded in paraffin and cut into 5 μm slices. Two 4 μm tissue paraffin sections were processed for immunohistochemistry. Digital images of stained tissue sections were obtained at 20× magnification and 0.45 μm / pixel resolution. CD3 in colonic tumors and invasive marginal areas + and CD8 + The density of T cells was determined.

[0136] Analysis of MC38 tumor-infiltrating immune cells by flow cytometry Single cell suspensions from MC38 tumors were prepared using the Mouse Tumor Dissociation kit and gentleMACS Dissociator (Miltenyi-Biotec) according to the manufacturer's instructions. All antibodies used in this study are listed in Table 1 below. Cell suspensions were washed with PBS and stained with fixable Viability Dye eFluor450 (eBioscience) according to the manufacturer's instructions. Cells were then washed and incubated with anti-CD16 / CD32 at 4°C, followed by surface staining for CD45, CD3, CD4, CD8, CD11b, GR-1+, Ly6G+ and Ly6C+ immunoreceptors. Data were acquired on a BD LSR II flow cytometer (Becton-Dickinson) and analysis was performed using FlowJo™ (TreeStar) and BD FACSDIVA™ software (BD Biosciences).

[0137] [Table 2]

[0138] statistical analysis One-way ANOVA followed by Tukey's post-hoc test or unpaired Student's t test was used for statistical analysis. Correlations were determined by Spearman test. All tests were performed using Graph Pad Prism 7 (StataCorp, College Station, TX, USA).

[0139] A p value ≤ .05 was considered statistically significant.

[0140] result Infection with colon cancer-associated Escherichia coli strain 11G5 induces resistance to anti-PD-1 immunotherapy. We investigated the effect of chronic infection of the intestine with the 11G5 strain on anti-PD-1 therapeutic efficacy. For this purpose, we selected MC38 mouse tumor xenografts on C57B16 mice as an animal model. The animals were first orally infected with the 11G5 strain and subcutaneously inoculated with MC38 cells 9 days after infection. MC38 tumor-bearing mice were then injected with anti-PD-1 treatment or isotype antibody control 8, 11, 14, 18, 20 and 22 days after MC38 cell inoculation. Figures 1 and 2 showed that anti-PD-1 treatment did not affect bacterial colonization of the intestine. In Figure 3, we observed a significant response of MC38 tumors to anti-PD-1 treatment. In fact, tumor growth was significantly delayed, indicating the anti-cancer efficacy of anti-PD-1 treatment in the test conditions. In contrast, no anti-tumor effect was observed in animals infected with the 11G5 strain and subjected to the same treatment (Figure 4).

[0141] Infection with colibactin-producing E. coli strain 11G5 increased intratumoral CD3 + and CD3 + CD8 + Induces a decrease in T cells. The effect of chronic colibactin-producing E. coli infection on an MC38 mouse xenograft model was examined using flow cytometry.

[0142] CD3 + A significant reduction in tumor infiltrating lymphocytes (TILs) was observed (Figures 7 and 8). + An overall decrease in TILs was observed only in the 11G5-infected mice group (Figures 9 and 10). + There was no discernible effect on TILs (data not shown).Finally, a significant increase in the neutrophil population was measured in 11G5-infected samples (FIGS. 11 and 12).

[0143] Colon cancer-associated E. coli strain 11G5 upregulates CD3 in colon tumors in Min mice + Induces a decrease in cell population. T cell populations were examined by analyzing the total T cell population by CD3 staining on colon sections of tumors from infected and control Min mice (uninfected and 11G5ΔClbQ infected) 50 days after infection. Representative CD3 staining of tumors was obtained. CD3 + A significant decrease in CD3 cells was observed in the tumor (Figure 6). + It was observed that intratumoral redistribution of cells was heterogeneous, with a decrease being observed especially at the margins of polyps.

[0144] Pks-positive E. coli colonization is associated with a decrease in tumor-infiltrating lymphoid T cells (TILs) at the invasive margin of human CRC samples. To make a link with colorectal cancer in humans and see whether the presence of T cells as tumor-infiltrating lymphocytes or at the tumor invasive margin could be correlated with the presence of pks-positive E. coli, CD3 and CD8 staining was performed on 40 CRC tumor samples at the immunomonitoring platform of the Hôpital Europeen Georges Pompidou (Paris).

[0145] CD3 in colon tumors and invasive margins + and CD8 + T cell density was determined and correlated with E. coli colonization and the presence of pks-positive bacteria. Tissue colonization by E. coli and CD3 + or CD8 + No significant correlation was found between the cell populations (data not shown). Figure 5 shows that CD3+ in pks-positive tumors only at the invasive margin + The figures show that the cells were significantly reduced.

[0146] Consideration In the course of research into the immune microenvironment, we focused our research on Apc Min / + We focused on the T cell population in the mouse colon because this population has been shown to be important for cancer prognosis in humans, and we reasoned that the presence of pks island-positive E. coli in the microbiota of these mice would reduce the numbers of T cells in the various immune regions that we saw.

[0147] We hypothesized that the presence of pks+ E. coli may affect the efficacy of antitumor treatments, such as checkpoint inhibitors, that are aimed at T cell activation. To easily monitor tumor growth, we chose to test anti-PD1 immunotherapy on MC38 subcutaneous grafts in mice orally infected with pks+ E. coli. The experimental therapeutic response of this model was shown to be sensitive to the microbiota environment. Moreover, it was also used in different studies to evaluate the impact of some microbes on the efficacy of anti-PD-1 antibodies (Gopalakrishnan et al. (2018) Science 359:97-103; Sivan et al. (2015) Science 350:1084-1089). With this model, we showed that pks+ E. coli infection induces resistance to anti-PD-1 immunotherapy in MC38 tumors.

[0148] The present inventors further demonstrated that CD3 +showed a significant reduction in cells, indicating a relationship between the presence of this bacterium and CRC prognosis.

[0149] This study indicates that E. coli bacteria positive for the pks island may be a new biomarker for predicting anti-PD-1 response in CRC patients.

Claims

1. 1. A method for predicting resistance to anti-PD-1 therapy using an anti-PD1 antibody in a subject suffering from colorectal cancer, comprising: a) determining the presence of E. coli bacteria positive for pks-island in a fecal or colon biopsy sample from the subject; b) predicting, from the result of step a), that the subject is likely to be resistant to anti-PD-1 therapy; The method comprising:

2. 2. The method of claim 1, wherein the presence of E. coli bacteria positive for pks-island is determined by isolating the E. coli bacteria on agar and determining the presence of pks-island DNA.

3. 2. The method of claim 1, wherein the presence of E. coli bacteria positive for pks-island is determined by determining the presence of E. coli specific DNA and determining the presence of pks-island DNA.

4. The method of claim 2 or 3, wherein the presence of pks island DNA is determined by PCR.

5. PCR is performed to identify a gene specific for a gene selected from the group consisting of ClbH, ClbJ, ClbN, ClbC, ClbI, ClbOn ClbB and ClbK genes of the pks island. The method of claim 4, which is carried out using a primer.

6. The method according to any one of claims 1 to 5, wherein the anti-PD-1 therapy is a therapy with cemiplimab.

7. 1. A method for determining unsuitability of a subject suffering from colorectal cancer to anti-PD-1 therapy, comprising: a) determining the presence of E. coli bacteria positive for pks-island in a fecal or colon biopsy sample from the subject; b) determining that the subject is unsuitable for anti-PD-1 therapy if the pks island is determined to be present in step a). The method comprising:

8. 1. A pharmaceutical composition comprising an anti-PD1 antibody for use in treating a subject suffering from colorectal cancer, the treatment of the subject suffering from colorectal cancer comprising: a) determining the presence of E. coli bacteria positive for pks-island in a fecal or colon biopsy sample from the subject; b) if the pks island is determined to be absent in step a), administering to the subject a therapeutically effective amount of an anti-PD1 antibody. The pharmaceutical composition comprising:

9. The pharmaceutical composition of claim 8, wherein the anti-PD1 antibody is cemiplimab.

10. The pharmaceutical composition of claim 8 or 9, wherein the anti-PD1 antibody is used in combination with a further anti-cancer therapy.

11. 11. The pharmaceutical composition of claim 10, wherein the additional anti-cancer therapy is selected from the group consisting of immune checkpoint inhibitors, radiation therapy, surgery, small molecule kinase inhibitors, chemotherapeutic agents including platinum-based chemotherapeutic agents, nucleic acid synthesis inhibitors, cancer vaccines, anti-CD38 antibodies, anti-MUC16xCD3 bispecific antibodies, anti-CD20xCD3 bispecific antibodies, granulocyte-macrophage colony-stimulating factor (GM-CSF), anti-TGFβ antibodies, indoleamine-2,3-dioxygenase (IDO) inhibitors, IL-6R inhibitors, IL-4R inhibitors, IL-10 inhibitors, cytokines such as IL-2, IL-7, IL-21 and IL-15, anti-inflammatory agents such as corticosteroids and non-steroidal anti-inflammatory agents, and combinations thereof.

Images