Gamma polyglutamated antifolates and uses thereof

Abstract

To provide gamma polyglutamated antifolate compositions to overcome pharmacological challenges associated with antifolate therapy, the dose-limiting toxicities and treatment resistance.SOLUTION: Disclosed is a liposome composition comprising a gamma polyglutamated antifolate (Lp-γPANTIFOL composition), where the gamma polyglutamated antifolate comprises 2-10 glutamyl groups, the liposome is PEGylated, and the liposome composition comprises a targeting moiety that has a specific affinity to a surface antigen on a target cell of interest.SELECTED DRAWING: None

Description

[Background technology]

[0001] The present disclosure relates generally to gamma polyglutamated antifolate compositions, including delivery vehicles such as gamma polyglutamated antifolate composition-containing liposomes, and methods of making and using the compositions to treat diseases, including hyperproliferative diseases such as cancer, immune system disorders including inflammatory and autoimmune diseases such as rheumatoid arthritis, and infectious diseases such as HIV, malaria, and schistosomiasis.

[0002] Folate is an essential cofactor mediating the transfer of one-carbon units involved in biosynthesis and DNA repair, homocysteine ​​remethylation (Hcy), and methylation of DNA, proteins, and lipids. The only circulating form of folate in the blood is monoglutamate, and folate monoglutamate is the only form of folate transported across cell membranes, as are monoglutamate-type polyglutamylatable antifolates. Once inside cells, intracellular folate is converted to polyglutamate by the enzyme folylpolygammaglutamate synthase (FPGS).

[0003] Antifolates are transported into cells by the reduced folate carrier (RFC) system and folate receptors (FR) α and β, as well as by the proton-coupled folate transporter (PCFT), which is most active at subnormal pH. RFC is the major antifolate transporter at physiological pH and is widely expressed in normal and diseased cells. Therefore, antifolate therapy is often subject to dose-limiting toxicity, a major obstacle in cancer chemotherapy. Once inside the cell, antifolates are polyglutamated by FPGS, which can add up to six glutamyl groups to the L-gamma carboxyl group bond to the antifolate. L-gamma polyglutamation of antifolates by FPGS serves at least two major therapeutic purposes: (1) it greatly increases the affinity and inhibitory activity of antifolates for DHFR; and (2) it facilitates the accumulation of polyglutamylated antifolates, which, unlike antifolates (monoglutamates), are not readily transported out of cells by cellular efflux pumps.

[0004] Targeting folate metabolism and nucleotide biosynthesis is an established therapeutic strategy for cancer, but clinical efficacy of antifolates has been limited due to a lack of tumor selectivity and the existence of new and acquired drug resistance. Antifolates often act during DNA and RNA synthesis, resulting in significant toxic effects on rapidly dividing cells, such as malignant and myeloid cells. Myelosuppression is usually the dose-limiting toxicity of antifolate therapy, limiting their clinical application.

[0005] Resistance to antifolate therapy is usually associated with one or more of the following: (a) increased cellular efflux pump activity, (b) decreased transport of antifolates into cells, (c) increased DHFR activity, (d) decreased folylpoly-gamma-glutamate synthetase (FPGS) activity, and (e) increased gamma-glutamyl hydrolase (GGH) activity, which cleaves gamma-polyglutamate chains attached to folate and antifolates.

[0006] A problem with the long-standing (>30 years) observation that higher polyglutamate levels of various antifolates have much greater potency than lower glutamate levels has been that the scientific community has relied on intracellular FPGS-mediated mechanisms to convert low levels of glutamate to their higher level forms. The present invention provides a means to deliver higher levels of polyglutamate forms of antifolates directly into cells without relying on cellular machinery to achieve this goal.

[0007] The provided gamma polyglutamated antifolate compositions offer a strategy to overcome the pharmacological challenges associated with dose-limiting toxicity and therapeutic resistance associated with antifolate therapy. In some embodiments, the provided methods deliver gamma polyglutamated forms of antifolates to cancer cells while (1) minimizing / reducing exposure to normal tissue cells, (2) optimizing / improving the cytotoxic effects of antifolate-based drugs on cancer cells, and (3) minimizing / reducing the effects of efflux pumps and other resistance mechanisms that limit the therapeutic efficacy of antifolates. Summary of the Invention

[0008] The present disclosure relates generally to gamma polyglutamated antifolate (γPANTIFOL) compositions and methods of making and using the compositions to treat diseases, including hyperproliferative diseases such as cancer, inflammation and immune system disorders such as rheumatoid arthritis, cardiovascular diseases such as coronary artery disease, and infectious diseases such as HIV, malaria, and schistosomiasis.

[0009] In some embodiments, the present disclosure provides: [1] A composition comprising a gamma polyglutamated antifolate; [2] The composition according to item [1], wherein the antifolate is selected from piritrexim, pralatrexate, AG2034, GW1843, and LY309887, or a stereoisomer thereof; [3] The composition according to item [1], wherein the antifolate is selected from PMX, MTX, RTX, and LTX, or a stereoisomer thereof; [4] The composition according to any one of items [1] to [3], wherein the antifolate is selected from the following: LV (etoposide), L-leucovorin (L-5-formyltetrahydrofolic acid); 5-CH3-THF, 5-methyltetrahydrofolic acid; FA, folic acid; PteGlu, pteroylglutamate (FA); MTX, methotrexate; 2-dMTX, 2-desamino-MTX; 2-CH3-MTX, 2-desamino-2-methyl-MTX; AMT, aminopterin; 2-dAMT, 2-desamino-AMT; 2-CH3-AMT, 2-desamino-2-methyl-AMT; 10-EdAM, 10-ethyl-10-deazaaminopterin; PT523, N alpha-(4-amino-4-deoxypteroyl)-N Delta-(hemiphthaloyl)-L-ornithine; DDATHF (lometrexol), 5,10-dideaza-5,6,7,8-tetrahydrofolic acid; 5-d(i)H4PteGlu, 5-deaza-5,6,7,8-tetrahydroisofolic acid; N9-CH3-5-d(i)H4PteGlu, N9-methyl-5-deaza-5,6,7,8-tetrahydroisofolic acid; 5-dPteHCysA, N alpha-(5-deazapteroyl)-L-homocysteic acid; 5-dPteAPBA, N alpha-(5-deazapteroyl)-DL-2-amino-4-phosphonobutyric acid; 5-dPteOrn, N alpha-(5-deazapteroyl)-L-ornithine; 5-dH4PteHCysA, N Alpha-(5-deaza-5,6,7,8-tetrahydropteroyl)-L-homocysteic acid; 5-dH4PteAPBA, N Alpha-(5-deaza-5,6,7,8-tetrahydropteroyl)-DL-2-amino-4-phosphobutanoic acid; 5-dH4PteOro, N Alpha-(5-dideaza-5,6,7,8-tetrahydropteroyl)-L-ornithine; CB3717, N10-propargyl-5,8-dideazafolate; ICI-198,583, 2-desamino-2-methyl-N10-propargyl-5,8-dideazafolate; 4-H-ICI-198,583, 4-deoxy-ICI-198,583; 4-OCH3-ICI-198,583, 4-methoxy-ICI-198,583 Glu-to-Val-ICI-198,583; valine-ICI-198;583;Glu-to-Sub-ICI-198,583, 2-aminosuberic acid-ICI-198,583; 7-CH3-ICI-198,583, 7-methyl-ICI-198,583; ZD1694, N-[5(N-(3,4-dihydro-2-methyl-4-oxoquinazolin-6-yl-methyl)amino)2-thienyl)]-L-glutamic acid; 2-NH2 -ZD1694, 2-amino-ZD1694; BW1843U89, (S)-2[5-(((1,2-dihydro-3-methyl-1-oxobenzo(f)quinazolin-9-yl)methyl)amino-)-1-oxo-2-isoindolinyl]-glutaric acid; LY231514, N-(4-(2-(2-amino-4,7-dihydro-4-oxo-3H-pyrrolo[ 2,3-D]pyrimidin-5-yl)ethyl)-benzoyl]-L-glutamic acid; IAHQ, 5,8-dideazaisofolic acid; 2-dIAHQ, 2-desamino-IAHQ; 2-CH3-dIAHQ, 2-desamino-2-methyl-IAHQ; 5-d(i)PteGlu, 5-deazaisofolic acid; N9-CH3-5-d(i)PteGlu, N9-methyl-5-deazaisofolic acid; N9-CHO-5-d(i)PteGlu, N9-formyl-5-deazaisofolic acid; AG337, 3,4-dihydro-2-amino-6-methyl-4-oxo-5-(4-pyridylthio)quanazoline; and 2,4-diamino-6[N-(4-(phenysulfonyl)benzyl)ethyl)amino]quinazoline; or stereoisomers thereof; [5] The composition of item [1], wherein the antifolate is selected from methotrexate, raltitrexed, previtrexed, pemetrexed, lometrexol (LMX; 5,10-dideazatetrahydrofolic acid), cyclopenta[g]quinazolines having dipeptide ligands, CB3717, CB300945, or stereoisomers thereof, such as 6-R,S-BGC945 (ONX-0801), CB300638, and BW1843U89; [6] The composition according to any one of items [1] to [5], wherein the gamma polyglutamated antifolate contains 4, 5, 2 to 10, 4 to 6, or more than 5 glutamyl groups: [7] The composition according to any one of items [1] to [6], wherein the gamma polyglutamated antifolate is (a) a gamma tetraglutamate antifolate, (b) a gamma-pentaglutamated antifolate; or (c) a gamma hexaglutamated folate antagonist; composition; [8] The composition according to any one of items [1] to [7], wherein the gamma polyglutamated antifolate contains 1 to 10 glutamyl groups with gamma carboxyl group bonds; [9] The composition according to any one of items [1] to [8], (a) at least two glutamyl groups of the gamma polyglutamated antifolate are in the L-configuration; (b) each glutamyl group of the gamma-polyglutamated antifolate is in the L-configuration; (c) at least one glutamyl group of the gamma polyglutamated antifolate is in the D-form; (d) each glutamyl group of the gamma polyglutamated antifolate other than the glutamyl group of the antifolate is in the D-form; or (e) at least two of the glutamyl groups of the gamma polyglutamated antifolate are in the L-configuration and at least one of the glutamyl groups is in the D-configuration; Composition:

[10] The composition according to any one of items [1] to [9], wherein the polyglutamic acid is linear;

[11] The composition according to any one of items [1] to [9], wherein the polyglutamic acid is branched;

[12] A liposome composition (Lp-γPANTIFOL) containing the gamma polyglutamated folate metabolic antagonist according to any one of items [1] to

[11] ;

[13] The Lp-γPANTIFOL composition according to item

[12] , wherein the polyglutamated folate antimetabolite is selected from the following: (a) AG2034, piritrexim, pralatrexate, GW1843, antifolates, and LY309887; or (b) PMX, MTX, RTX, and LTX, their stereoisomers;

[14] The Lp-γPANTIFOL composition according to item

[12] or

[13] , wherein the polyglutamated folate anti-metabolite is selected from the following: LV (etoposide), L-leucovorin (L-5-formyltetrahydrofolic acid); 5-CH3-THF, 5-methyltetrahydrofolic acid; FA, folic acid; PteGlu, pteroylglutamate (FA); MTX, methotrexate; 2-dMTX, 2-desamino-MTX; 2-CH3-MTX, 2-desamino-2-methyl-MTX; AMT, aminopterin; 2-dAMT, 2-desamino-AMT; 2-CH3-AMT, 2-desamino-2-methyl-AMT; 10-EdAM, 10-ethyl-10-deazaaminopterin; PT523, N Alpha-(4-amino-4-deoxypteroyl)-N delta-(hemiphthaloyl)-L-ornithine; DDATHF (lometrexol), 5,10-dideaza-5,6,7,8-tetrahydrofolic acid; 5-d(i)H4PteGlu, 5-deaza-5,6,7,8-tetrahydroisofolic acid; N9-CH3-5-d(i)H4PteGlu, N9-methyl-5-deaza-5,6,7,8-tetrahydroisofolic acid; 5-dPteHCysA, N alpha-(5-deazapteroyl)-L-homocysteic acid; 5-dPteAPBA, N alpha-(5-deazapteroyl)-DL-2-amino-4-phosphonobutyric acid; 5-dPteOrn, N alpha-(5-deazapteroyl)-L-ornithine; 5-dH4PteHCysA, N alpha-(5-deaza-5,6,7,8-tetrahydropteroyl)-L-homocysteic acid; 5-dH4PteAPBA, N alpha-(5-deaza-5,6,7,8-tetrahydropteroyl)-DL-2-amino-4-phosphobutanoic acid; 5-dH4PteOro, N alpha-(5-dideaza-5,6,7,8-tetrahydropteroyl)-L-ornithine; CB3717, N10-propargyl-5,8-dideazafolic acid; ICI-198,583, 2-desamino-2-methyl-N10-propargyl-5,8-dideazafolic acid;4-H-ICI-198,583, 4-deoxy-ICI-198,583; 4-OCH3-ICI-198,583; 4-methoxy-ICI-198,583 Glu-to-Val-ICI-198,583; valine-ICI-198;583; Glu-to-Sub-ICI-198,583, 2-aminosuberic acid-ICI-198,583; 7-CH3-ICI-198,583, 7-methyl-ICI-198,583; ZD1694, N-[5(N-(3,4-dihydro-2-methyl-4-oxoquinazolin-6-yl-methyl]-ICI-198,583] )amino)2-thienyl)]-L-glutamic acid; 2-NH2-ZD1694, 2-amino-ZD1694; BW1843U89, (S)-2[5-(((1,2-dihydro-3-methyl-1-oxobenzo(f)quinazolin-9-yl)methyl)amino-)-1-oxo-2-isoindolinyl]-glutaric acid; LY231514, N-(4-(2-(2-amino-4,7-dihydrobenzoyl)methyl)amino-)-1-oxo-2-isoindolinyl)- N-(4-oxo-3H-pyrrolo[2,3-D]pyrimidin-5-yl)ethyl)-benzoyl]-L-glutamic acid; IAHQ, 5,8-dideazaisofolic acid; 2-dIAHQ, 2-desamino-IAHQ; 2-CH3-dIAHQ, 2-desamino-2-methyl-IAHQ; 5-d(i)PteGlu, 5-deazaisofolic acid; N9-CH3-5-d(i)PteGlu, N9- Methyl-5-deazaisofolate; N9-CHO-5-d(i)PteGlu, N9-formyl-5-deazaisofolate; AG337, 3,4-dihydro-2-amino-6-methyl-4-oxo-5-(4-pyridylthio)quanazoline; and AG377, 2,4-diamino-6[N-(4-(phenysulfonyl)benzyl)ethyl)amino]quinazoline; or stereoisomers thereof;

[15] The Lp-γPANTIFOL composition according to any one of items

[12] to

[14] , wherein the antifolate is selected from methotrexate, raltitrexed, previtrexed, pemetrexed, lometrexol (LMX; 5,10-dideazatetrahydrofolic acid), cyclopenta[g]quinazolines having dipeptide ligands, CB3717, CB300945, or stereoisomers thereof, such as 6-R,S-BGC945 (ONX-0801), CB300638, and BW1843U89;

[16] The Lp-γPANTIFOL composition according to any one of items

[12] to

[15] , wherein the liposome contains a gamma-polyglutamated antifolate containing 4, 5, 2 to 10, 4 to 6, or more than 5 gamma-glutamyl groups;

[17] The Lp-γPANTIFOL composition according to any one of items

[12] to

[16] , wherein the liposome contains a gamma-tetraglutamated folate antimetabolite;

[18] The Lp-γPANTIFOL composition according to any one of items

[12] to

[16] , wherein the liposome contains a gamma-pentaglutamated antifolate;

[19] The Lp-γPANTIFOL composition according to any one of items

[12] to

[16] , wherein the liposome contains a gamma hexaglutamated antifolate;

[20] The Lp-γPANTIFOL composition according to any one of items

[12] to

[19] , wherein the gamma polyglutamated folate antagonist contains 1 to 10 glutamyl groups having gamma carboxyl group bonds;

[21] The Lp-γ-PANTIFOL composition according to any one of items

[12] to

[20] , (a) at least two glutamyl groups of the gamma polyglutamated antifolate are in the L-configuration; (b) each glutamyl group of the gamma-polyglutamated antifolate is in the L-configuration; (c) at least one glutamyl group of the gamma polyglutamated antifolate is in the D-form; (d) each glutamyl group of the gamma polyglutamated antifolate other than the glutamyl group of the antifolate is in the D-form; or (e) at least two of the glutamyl groups of the gamma polyglutamated antifolate are in the L-configuration and at least one of the glutamyl groups is in the D-configuration; Lp-γPANTIFOL composition:

[22] The Lp-γ-PANTIFOL composition according to any one of items

[12] to

[21] , comprising: (a) at least two glutamyl groups of the gamma polyglutamated antifolate are in the L-configuration; (b) each glutamyl group of the gamma-polyglutamated antifolate is in the L-configuration; (c) at least one glutamyl group of the gamma polyglutamated antifolate is in the D-form; (d) each glutamyl group of the gamma polyglutamated antifolate other than the glutamyl group of the antifolate is in the D-form; or (e) at least two of the glutamyl groups of the gamma polyglutamated antifolate are in the L-configuration and at least one of the glutamyl groups is in the D-configuration; Lp-γPANTIFOL composition:

[23] The Lp-γPANTIFOL composition according to any one of items

[12] to

[22] , wherein the liposome is PEGylated (PLp-γPANTIFOL);

[24] The Lp-γPANTIFOL composition according to any one of items

[12] to

[22] , wherein the liposome is not PEGylated;

[25] The Lp-γPANTIFOL composition according to any one of items

[12] to

[24] , wherein the liposome has a diameter in the range of 20 nm to 200 nm;

[26] The Lp-γPANTIFOL composition according to any one of items

[12] to

[25] , wherein the liposome has a diameter in the range of 80 nm to 120 nm;

[27] The Lp-γPANTIFOL composition according to any one of items

[12] to

[26] , wherein the liposome is formed from a liposome component;

[28] The Lp-γPANTIFOL composition according to item

[27] , wherein the liposome component comprises at least one anionic lipid and a neutral lipid;

[29] The Lp-γPANTIFOL composition according to item

[27] or

[28] , wherein the liposome component comprises at least one selected from DSPE; DSPE-PEG; DSPE-PEG-maleimide; HSPC; HSPC-PEG; cholesterol; cholesterol-PEG; and cholesterol-maleimide;

[30] The Lp-γ-PANTIFOL composition according to any one of items

[27] to

[29] , wherein the liposome component comprises at least one selected from the following: DSPE; DSPE-PEG; DSPE-PEG-FITC; DSPE-PEG-maleimide; cholesterol; and HSPC;

[31] The Lp-γPANTIFOL composition according to any one of items

[27] to

[30] , wherein one or more liposome components further comprise a steric stabilizer;

[32] The Lp-γPANTIFOL composition according to item

[31] , wherein the steric stabilizer is at least one selected from polyethylene glycol (PEG); poly-L-lysine (PLL); monosialoganglioside (GM1); poly(vinylpyrrolidone) (PVP); poly(acrylamide) (PAA); poly(2-methyl-2-oxazoline); poly(2-ethyl-2-oxazoline); phosphatidylpolyglycerol; poly[N-(2-hydroxypropyl)methacrylamide]; amphiphilic poly-N-vinylpyrrolidone; L-amino acid-based polymer; oligoglycerin, polyethylene glycol and polypropylene oxide-containing copolymer, poloxamer 188, and polyvinyl alcohol.

[33] The Lp-γPANTIFOL composition according to item

[32] , wherein the steric stabilizer is PEG, and the PEG has a number average molecular weight (Mn) of 200 to 5,000 daltons;

[34] The Lp-γPANTIFOL composition according to any one of items

[12] to

[33] , wherein the liposome is anionic or neutral;

[35] The Lp-γPANTIFOL composition according to any one of items

[12] to

[33] , wherein the liposome has a zeta potential of zero or less;

[36] The Lp-γPANTIFOL composition according to any one of items

[12] to

[33] , wherein the liposome has a zeta potential of 0 to -150 mV;

[37] The Lp-γPANTIFOL composition according to any one of items

[12] to

[33] , wherein the liposome has a zeta potential of -30 to -50 mV;

[38] The Lp-γPANTIFOL composition according to any one of items

[12] to

[33] , wherein the liposome is cationic;

[39] The Lp-γPANTIFOL composition according to any one of items

[12] to

[38] , wherein the liposome has an internal space containing a gamma polyglutamated antifolate and an aqueous pharmaceutically acceptable carrier;

[40] The Lp-γPANTIFOL composition according to item

[39] , wherein the pharmaceutically acceptable carrier comprises an isotonic agent such as dextrose, mannitol, glycerol, potassium chloride, or sodium chloride at a concentration greater than 1%;

[41] The Lp-γPANTIFOL composition according to item

[39] , wherein the aqueous pharmaceutically acceptable carrier is trehalose;

[42] The Lp-γPANTIFOL composition according to item

[41] , wherein the pharmaceutically acceptable carrier contains 1% to 50% trehalose;

[43] The Lp-γPANTIFOL composition according to any one of items

[39] to

[42] , wherein the pharmaceutically acceptable carrier comprises a 1% to 50% dextrose solution;

[44] The Lp-γPANTIFOL composition according to any one of items

[39] to

[43] , wherein the inner space of the liposome contains 5% dextrose suspended in a HEPES buffer solution;

[45] The Lp-γPANTIFOL composition according to any one of items

[39] to

[44] , wherein the pharmaceutically acceptable carrier comprises a buffer solution such as HEPES-buffered saline (HBS) or a similar substance at a concentration of 1 to 200 mM and a pH of 2 to 8;

[46] The Lp-γPANTIFOL composition according to any one of items

[39] to

[45] , wherein the pharmaceutically acceptable carrier comprises sodium acetate and calcium acetate at a total concentration of 50 mM to 500 mM;

[47] The Lp-γPANTIFOL composition according to any one of items

[12] to

[46] , wherein the internal space of the liposome has a pH of 5 to 8, a pH of 6 to 7, or any range therebetween;

[48] ​​The Lp-γPANTIFOL composition according to any one of items

[12] to

[47] , wherein the liposome contains less than 500,000 or less than 200,000 gamma polyglutamated antifolate molecules;

[49] The Lp-γPANTIFOL composition according to any one of items

[12] to

[48] , wherein the liposome contains 10 to 100,000 gamma polyglutamated antifolate molecules or any range therebetween;

[50] The Lp-γ PANTIFOL composition according to any one of items

[12] to

[49] , further comprising a targeting moiety, wherein the targeting moiety has specific affinity for a surface antigen on a target cell of interest;

[51] The Lp-γPANTIFOL composition according to item

[50] , wherein the targeting moiety is attached to one or both of the PEG and the outer surface of the liposome, and optionally the targeting moiety is covalently attached to one or both of the PEG and the outer surface of the liposome;

[52] The Lp-γPANTIFOL composition according to item

[50] or

[51] , wherein the targeting moiety is a polypeptide;

[53] The Lp-γPANTIFOL composition according to any one of items

[50] to

[52] , wherein the targeting moiety is an antibody or an antigen-binding fragment of an antibody;

[54] The Lp-γ PANTIFOL composition according to any one of items

[50] to

[53] , wherein the targeting moiety has an Lp-γ PANTIFOL concentration of 0.5×10 to 10×10 as measured by BIACORE® analysis. -6an Lp-γPANTIFOL composition that binds to surface antigens with an equilibrium dissociation constant (Kd) in the range of

[55] The Lp-γPANTIFOL composition according to any one of items

[50] to

[54] , wherein the targeting moiety specifically binds to one or more folate receptors selected from the group consisting of folate receptor alpha (FR-α), folate receptor beta (FR-β), and folate receptor delta (FR-δ);

[56] The Lp-γPANTIFOL composition according to any one of items

[50] to

[55] , wherein the targeting moiety comprises one or more selected from the group consisting of an antibody, a humanized antibody, an antigen-binding fragment of an antibody, a single-chain antibody, a single-domain antibody, a bispecific antibody, a synthetic antibody, a pegylated antibody, and a multimeric antibody;

[57] The Lp-γPANTIFOL composition according to any one of items

[50] to

[56] , wherein each PEGylated liposome contains 1 to 1000 or 30 to 200 targeting moieties;

[58] The Lp-γPANTIFOL composition according to any one of items

[39] to

[57] , further comprising one or more of an immunostimulant, a detectable marker, and a maleimide, wherein the immunostimulant, the detectable marker, or the maleimide is bound to the PEG or the outer surface of the liposome;

[59] The Lp-γPANTIFOL composition according to item

[58] , wherein the immunostimulant is at least one selected from the group consisting of a protein immunostimulant, a nucleic acid immunostimulant, a chemical immunostimulant, a hapten, and an adjuvant;

[60] The Lp-γ PANTIFOL composition according to item

[58] or

[59] , wherein the immunostimulant is fluorescein, fluorescein isothiocyanate (FITC), DNP, beta-glucan, beta-1,3-glucan, beta-1,6-glucan, resolvin (e.g., D n-6DPA Or D n-3DPAan Lp-γPANTIFOL composition, wherein the Lp-γPANTIFOL composition is at least one selected from the group consisting of toll-like receptor (TLR) modulators such as resolvin D, resolvin E, or T-series resolvins, and oxidized low-density lipoproteins (e.g., OXPAC, PGPC), and eritoran lipids (e.g., E5564);

[61] The Lp-γPANTIFOL composition according to any one of items

[58] to

[60] , wherein the immunostimulant and the detectable marker are the same;

[62] The Lp-γPANTIFOL composition according to any one of items

[58] to

[61] , further comprising a hapten;

[63] The Lp-γ PANTIFOL composition according to item

[62] , wherein the hapten comprises one or more of fluorescein or beta-1,6-glucan:

[64] The Lp-γPANTIFOL composition according to any one of items

[12] to

[63] , further comprising at least one cryoprotectant selected from the group consisting of mannitol, trehalose, sorbitol, and sucrose;

[65] A targeting composition comprising the composition according to any one of items [1] to

[64] ;

[66] A non-targeted composition comprising the composition according to any one of items [1] to

[49] ;

[67] The Lp-γPANTIFOL composition according to any one of items

[12] to

[66] , further comprising carboplatin and / or pembrolizumab;

[68] A pharmaceutical composition comprising the liposomal gamma polyglutamated antifolate composition according to any one of items

[12] to

[67] ;

[69] A pharmaceutical composition comprising the gamma polyglutamated folate antimetabolite composition according to any one of items [1] to [7];

[70] The composition according to any one of items [1] to

[69] for use in treating a disease;

[71] Use of the composition according to any one of items [1] to

[70] in the manufacture of a drug for the treatment of a disease;

[72] A method for treating or preventing a disease in a subject in need of such treatment or prevention, the method comprising administering to the subject the composition according to any one of items [1] to

[70] ;

[73] A method for treating or preventing a disease in a subject in need of such treatment or prevention, the method comprising administering to the subject the liposomal gamma polyglutamated folate antimetabolite composition according to any one of

[12] to

[69] ;

[74] A method for killing hyperproliferative cells, comprising contacting the hyperproliferative cells with the composition according to any one of items [1] to

[69] ;

[75] A method for killing hyperproliferative cells, comprising contacting the hyperproliferative cells with the liposomal gamma polyglutamated antifolate composition according to any one of items

[12] to

[69] ;

[76] The method according to item

[74] or

[75] , wherein the hyperproliferative cells are cancer cells, mammalian cells, and / or human cells;

[77] A method for treating cancer, comprising administering an effective amount of the composition according to any one of items [1] to

[69] to a subject having or at risk of having cancer;

[78] A method for treating cancer, comprising administering an effective amount of the liposomal gamma polyglutamated antifolate composition according to any one of items

[12] to

[68] to a subject having or at risk of having cancer;

[79] The method according to item

[77] or

[78] , wherein the cancer is selected from non-hematological tumors including, for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, bile duct cancer, gallbladder cancer, bladder cancer, sarcoma (e.g., osteosarcoma), brain cancer, central nervous system cancer, and melanoma; and hematological tumors such as, for example, leukemia, lymphoma and other B-cell malignancies, myeloma and other plasma cell dysplasias;

[80] The method according to item

[77] or

[78] , wherein the cancer is selected from lung cancer, breast cancer, colon cancer, pancreatic cancer, gastric cancer, bladder cancer, head and neck cancer, ovarian cancer, and cervical cancer;

[81] The method according to item

[77] or

[78] , wherein the cancer is selected from colorectal cancer, lung cancer, breast cancer, head and neck cancer, and pancreatic cancer;

[82] The method according to item

[77] or

[78] , wherein the cancer is selected from colorectal cancer, breast cancer, ovarian cancer, lung cancer, head and neck cancer, pancreatic cancer, gastric cancer, and mesothelioma;

[83] A method for treating cancer, comprising administering an effective amount of the Lp-γPANTIFOL composition according to any one of items

[50] to

[66] to a subject having or at risk of having cancer cells expressing a folate receptor bound by a targeting moiety on the surface thereof;

[84] A maintenance therapy for a subject undergoing or having undergone cancer therapy, comprising administering an effective amount of the composition according to any one of items [1] to

[69] to the subject undergoing or having undergone cancer therapy;

[85] A maintenance therapy for a subject undergoing or having undergone cancer therapy, comprising administering an effective amount of the liposomal gamma polyglutamic acid antimetabolite composition according to any one of items

[12] to

[69] to the subject undergoing or having undergone cancer therapy;

[86] A method for treating an immune system disorder, comprising administering an effective amount of the composition according to any one of items [1] to

[69] to a subject having or at risk of having an immune system disorder, optionally wherein the immune system disorder is selected from inflammation (e.g., acute and chronic), systemic inflammation, rheumatoid arthritis, inflammatory bowel disease (IBD), Crohn's disease, dermatomyositis / polymyositis, systemic lupus erythematosus, Takayasu's disease, and psoriasis;

[87] A method for treating an immune system disorder, comprising administering an effective amount of the liposomal gamma polyglutamated antifolate composition according to any one of items [8] to

[69] to a subject having or at risk of having an immune system disorder, optionally wherein the immune system disorder is selected from inflammation (e.g., acute and chronic), systemic inflammation, rheumatoid arthritis, inflammatory bowel disease (IBD), Crohn's disease, dermatomyositis / polymyositis, systemic lupus erythematosus, Takayasu's disease, and psoriasis;

[88] Treatment of: (a) A method for treating an infectious disease, comprising administering an effective amount of the composition according to any one of items [1] to

[69] to a subject having or at risk of having the infectious disease; (b) A method for treating an infectious disease, a cardiovascular disease, a metabolic disease, or another disease, comprising administering an effective amount of the composition according to any one of items [1] to

[69] to a subject having or at risk of having an infectious disease, a cardiovascular disease, or another disease, wherein the disease is a member selected from atherosclerosis, cardiovascular disease (CVD), coronary artery disease, myocardial infarction, stroke, metabolic syndrome, gestational trophoblastic disease, and ectopic pregnancy; (c) A method for treating an autoimmune disease, comprising administering an effective amount of the composition according to any one of items [1] to

[69] to a subject having or at risk of having an autoimmune disease; (d) A method for treating rheumatoid arthritis, comprising administering an effective amount of the composition according to any one of items [1] to

[69] to a subject having or at risk of having rheumatoid arthritis; (e) A method for treating an inflammatory condition, comprising administering an effective amount of the composition according to any one of items [1] to

[69] to a subject having or at risk of having inflammation, wherein the inflammation is, optionally, acute, chronic, and / or systemic inflammation; or (f) A method for treating a skin disease, comprising administering an effective amount of the composition according to any one of items [1] to

[69] to a subject having or at risk of having a skin disease;

[89] A method for treating an infectious disease, comprising administering an effective amount of the liposomal gamma polyglutamated antifolate composition according to any one of items

[12] to

[69] to a subject having or at risk of having the infectious disease;

[90] A method for delivering a gamma polyglutamated antifolate to a tumor expressing a folate receptor on its surface, comprising administering to a subject having a tumor the Lp-γPANTIFOL composition described in any of items [1] to

[69] in an amount sufficient to deliver a therapeutically effective amount of the gamma polyglutamated antifolate to the tumor;

[91] A method for making a gamma polyglutamated antifolate composition, comprising the liposomal gamma polyglutamated antifolate composition according to any one of Items

[12] to

[69] , the method comprising the steps of: forming a mixture in a solution containing liposome components and a gamma polyglutamated antifolate; homogenizing the mixture in the solution to form liposomes; and treating the mixture to form liposomes containing the gamma polyglutamated antifolate.

[92] A method for making the composition according to any one of Items

[12] to

[69] , comprising the steps of: forming a mixture in a solution containing liposome components and a gamma polyglutamated antifolate; homogenizing the mixture in the solution to form liposomes; treating the mixture to form liposomes that encapsulate and / or entrap the gamma polyglutamated antifolate; and providing a targeting moiety on the surface of the liposome, wherein the targeting moiety has specific affinity for at least one of folate receptor alpha (FR-α), folate receptor beta (FR-β), and folate receptor delta (FR-δ).

[93] The method according to item

[92] , wherein the processing step comprises one or more steps of thin film hydration, extrusion, in-line mixing, ethanol injection technique, freeze-thaw method, reverse phase evaporation, dynamic high-pressure microfluidization, microfluidic mixing, double emulsion, freeze-dried double emulsion, 3D printing, membrane contactor method, and stirring; and / or

[94] The method according to

[92] , wherein the processing step comprises one or more steps of modifying the size of the liposomes by one or more steps of extrusion, high-pressure microfluidization, and / or sonication.

[0010] In some embodiments, the present disclosure provides gamma polyglutamated antifolate (γPANTIFOL) compositions, wherein at least two glutamyl residues of the gamma polyglutamated antifolate have their gamma carboxyl linkages. In some embodiments, the γPANTIFOL contains 2 to 20, 2 to 15, 2 to 10, 2 to 5, or more than 5 glutamyl groups (including the glutamyl group of the antifolate). In some embodiments, the gamma polyglutamated antifolate is selected from (a) AG2034, piritrexim, pralatrexate, GW1843, an antifolate, and LY309887; or (b) PMX, MTX, RTX, and LTX, or stereoisomers thereof. In some embodiments, the gamma polyglutamated antifolate is selected from: LV (etoposide), L-leucovorin (L-5-formyltetrahydrofolate); 5-CH3-THF, 5-methyltetrahydrofolic acid; FA, folic acid; PteGlu, pteroylglutamate (FA); MTX, methotrexate; 2-dMTX, 2-desamino-MTX; 2-CH3-MTX, 2-desamino-2-methyl-MTX; AMT, aminopterin; 2-dAMT, 2-desamino-AMT; 2-CH3-AMT, 2-desamino-2-methyl-AMT; 10-EdAM, 10-ethyl-10-deazaaminopterin; PT523, N alpha-(4-amino-4-deoxypteroyl)-N Delta-(hemiphthaloyl)-L-ornithine; DDATHF (lometrexol), 5,10-dideaza-5,6,7,8-tetrahydrofolic acid; 5-d(i)H4PteGlu, 5-deaza-5,6,7,8-tetrahydroisofolic acid; N9-CH3-5-d(i)H4PteGlu, N9-methyl-5-deaza-5,6,7,8-tetrahydroisofolic acid; 5-dPteHCysA, N alpha-(5-deazapteroyl)-L-homocysteic acid; 5-dPteAPBA, N alpha-(5-deazapteroyl)-DL-2-amino-4-phosphonobutyric acid; 5-dPteOrn, N alpha-(5-deazapteroyl)-L-ornithine; 5-dH4PteHCysA, N Alpha-(5-deaza-5,6,7,8-tetrahydropteroyl)-L-homocysteic acid;5-dH4PteAPBA, N alpha-(5-deaza-5,6,7,8-tetrahydropteroyl)-DL-2-amino-4-phosphobutanoic acid; 5-dH4PteOro, N alpha-(5-dideaza-5,6,7,8-tetrahydropteroyl)-L-ornithine; CB3717, N10-propargyl-5,8-dideazafolate; ICI-198,583, 2-desamino-2-methyl-N10-propargyl-5,8-dideazafolate; 4-H-ICI-198,583, 4-deoxy-ICI-198,583; 4-OCH3-ICI-198,583, 4-methoxy-ICI-198,583 Glu-to-Val-ICI-198,583; valine-ICI-198;583; Glu-to-Sub-ICI-198,583, 2-aminosuberic acid-ICI-198,583; 7-CH3-ICI-198,583, 7-methyl-ICI-198,583; ZD1694, N-[5(N-(3,4-dihydro-2-methyl-4-oxoquinazolin-6-yl- 2-NH2-ZD1694, 2-amino-ZD1694; BW1843U89, (S)-2[5-(((1,2-dihydro-3-methyl-1-oxobenzo(f)quinazolin-9-yl)methyl)amino-)-1-oxo-2-isoindolinyl]-glutaric acid; LY231514, N-(4-(2-(2-amino -4,7-dihydro-4-oxo-3H-pyrrolo[2,3-D]pyrimidin-5-yl)ethyl)-benzoyl]-L-glutamic acid; IAHQ, 5,8-dideazaisofolic acid; 2-dIAHQ, 2-desamino-IAHQ; 2-CH3-dIAHQ, 2-desamino-2-methyl-IAHQ; 5-d(i)PteGlu, 5-deazaisofolic acid; N9-CH3-5-d(i) PteGlu, N9-methyl-5-deazaisofolic acid; N9-CHO-5-d(i)PteGlu, N9-formyl-5-deazaisofolic acid; AG337, 3,4-dihydro-2-amino-6-methyl-4-oxo-5-(4-pyridylthio)quanazoline; and AG377, 2,4-diamino-6[N-(4-(phenysulfonyl)benzyl)ethyl)amino]quinazoline;or stereoisomers thereof. In some embodiments, the gamma polyglutamated antifolate is selected from methotrexate, raltitrexed, previtrexed, pemetrexed, lometrexol (LMX; 5,10-dideazatetrahydrofolic acid), cyclopenta[g]quinazolines with dipeptide ligands, CB3717, CB300945, or stereoisomers thereof, such as 6-R,S-BGC945 (ONX-0801), CB300638, and BW1843U89. In some embodiments, γPANTIFOL contains two or more glutamyl groups in the L-form. In some embodiments, γPANTIFOL contains a glutamyl group in the D-form. In further embodiments, γPANTIFOL contains a glutamyl group in the D-form and two or more glutamyl groups in the L-form.

[0011] In one embodiment, the γ-PANTIFOL composition comprises a chain of three glutamyl groups attached to a glutamyl group in the antifolate (i.e., a γ-tetraglutamated antifolate). In some embodiments, the polyglutamated antifolate is an antifolate described in item [2] of the Summary of the Invention section. In some embodiments, the polyglutamated antifolate is an antifolate described in item [3] of the Summary of the Invention section. In some embodiments, the polyglutamated antifolate is an antifolate described in item [4] of the Summary of the Invention section. In some embodiments, the polyglutamated antifolate is an antifolate described in item [5] of the Summary of the Invention section. In some embodiments, the γ-PANTIFOL is a polyglutamated antifolate described in the Summary of the Invention section. In some embodiments, the tetraglutamated antifolate comprises two or more L-glutamyl groups. In other embodiments, the tetraglutamated antifolate comprises a glutamyl group in the D-form. In some embodiments, the tetraglutamated antifolate comprises two or more glutamyl groups in the D-form. In further embodiments, the tetraglutamated antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form. In some embodiments, the tetraglutamated antifolate comprises one, two, or three glutamyl groups in the D-form and three, two, or one glutamyl group in the L-form, respectively.

[0012] In one embodiment, the γ-PANTIFOL composition comprises a chain of four γ-glutamyl groups attached to a glutamyl group in the antifolate (i.e., a γ-pentaglutamated antifolate). In some embodiments, the polyglutamated antifolate is an antifolate described in item [2] of the Summary of the Invention section. In some embodiments, the polyglutamated antifolate is an antifolate described in item [3] of the Summary of the Invention section. In some embodiments, the polyglutamated antifolate is an antifolate described in item [4] of the Summary of the Invention section. In some embodiments, the polyglutamated antifolate is an antifolate described in item [5] of the Summary of the Invention section. In some embodiments, the γ-PANTIFOL is a polyglutamated antifolate described in the Summary of the Invention section. In some embodiments, the pentaglutamated antifolate comprises two or more glutamyl groups in the L-form. In other embodiments, the pentaglutamated antifolate comprises a glutamyl group in the D-form. In some embodiments, the pentaglutamated antifolate comprises two or more glutamyl groups in the D-form. In further embodiments, the pentaglutamated antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form. In some embodiments, the pentaglutamated antifolate comprises one, two, three, or four glutamyl groups in the D-form and four, three, two, or one glutamyl group in the L-form, respectively.

[0013] In one embodiment, the γ-PANTIFOL composition comprises a chain of five γ-glutamyl groups linked to a glutamyl group in the antifolate (i.e., a γ-hexaglutamated antifolate). In some embodiments, the polyglutamated antifolate is an antifolate described in item [2] of the Summary of the Invention section. In some embodiments, the polyglutamated antifolate is an antifolate described in item [3] of the Summary of the Invention section. In some embodiments, the polyglutamated antifolate is an antifolate described in item [4] of the Summary of the Invention section. In some embodiments, the polyglutamated antifolate is an antifolate described in item [5] of the Summary of the Invention section. In some embodiments, the γ-PANTIFOL is a polyglutamated antifolate described in the Summary of the Invention section. In some embodiments, a hexaglutamated antifolate comprises two or more glutamyl groups in the L-form. In some embodiments, a hexaglutamated antifolate comprises a glutamyl group in the D-form. In some embodiments, a hexaglutamated antifolate comprises two or more glutamyl groups in the D-form. In further embodiments, a hexaglutamated antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form. In some embodiments, a pentaglutamated antifolate comprises one, two, three, four, or five glutamyl groups in the D-form and five, four, three, two, or one glutamyl group in the L-form, respectively.

[0014] In further embodiments, the present disclosure provides compositions comprising delivery vehicles, such as liposomes, loaded (i.e., encapsulated) and / or otherwise bound to a gamma polyglutamated antifolate, and methods for making and using γPANTIFOL-loaded / bound delivery carrier compositions (DV-γPANTIFOL) to deliver gamma polyglutamated antifolates to diseased (e.g., cancerous) cells and / or target cells. These compositions have uses including, but not limited to, the treatment of diseases including, for example, hyperproliferative diseases such as cancer, immune system disorders such as inflammation and rheumatoid arthritis, and infectious diseases such as HIV, malaria, and schistosomiasis. γPANTIFOL-loaded / bound delivery carrier compositions provide selective delivery of a more cytotoxic payload (polyglutamated antifolate) compared to the cytotoxicity of antifolates administered in their monoglutamated state (ANTIFOL), thereby improving the efficacy and safety of antifolate delivery to cancer cells. In some embodiments, the gamma polyglutamated antifolate in DV-γPANTIFOL contains 2 to 20, 2 to 15, 2 to 10, 2 to 5, or more than 5, or more than 20 glutamyl groups (including the glutamyl groups of the antifolate). In some embodiments, the delivery vehicle contains a polyglutamated antifolate described in any of items [1]-

[11] in the Summary of the Invention section. In some embodiments, the delivery vehicle contains a polyglutamated antifolate described in the Summary of the Invention section. In some embodiments, the delivery vehicle is a liposome described in any of items

[12] -

[67] in the Summary of the Invention section.

[0015] In further embodiments, the present disclosure provides a composition (Lp-γPANTIFOL) comprising a liposome encapsulated (loaded) with a gamma polyglutamated antifolate. In some embodiments, the gamma polyglutamated antifolate in the Lp-γPANTIFOL contains 2 to 20, 2 to 15, 2 to 10, 2 to 5, or more than 20 glutamyl groups (including the glutamyl groups of the antifolate). In some embodiments, the gamma polyglutamated antifolate encapsulated by the liposome is selected from (a) AG2034, piritrexim, pralatrexate, GW1843, antifolates, and LY309887; or (b) PMX, MTX, RTX, and LTX, or stereoisomers thereof. In some embodiments, the gamma polyglutamated antifolate drug encapsulated by the liposome is selected from: LV (etoposide), L-leucovorin (L-5-formyltetrahydrofolate); 5-CH3-THF, 5-methyltetrahydrofolate; FA, folic acid; PteGlu, pteroylglutamate (FA); MTX, methotrexate; 2-dMTX, 2-desamino-MTX; 2-CH3-MTX, 2-desamino-2-methyl-MTX; AMT, aminopterin; 2-dAMT, 2-desamino-AMT; 2-CH3-AMT, 2-desamino-2-methyl-AMT; 10-EdAM, 10-ethyl-10-deazaaminopterin; PT523, N alpha-(4-amino-4-deoxypteroyl)-N Delta-(hemiphthaloyl)-L-ornithine; DDATHF (lometrexol), 5,10-dideaza-5,6,7,8-tetrahydrofolic acid; 5-d(i)H4PteGlu, 5-deaza-5,6,7,8-tetrahydroisofolic acid; N9-CH3-5-d(i)H4PteGlu, N9-methyl-5-deaza-5,6,7,8-tetrahydroisofolic acid; 5-dPteHCysA, N alpha-(5-deazapteroyl)-L-homocysteic acid; 5-dPteAPBA, N alpha-(5-deazapteroyl)-DL-2-amino-4-phosphonobutyric acid; 5-dPteOrn, N alpha-(5-deazapteroyl)-L-ornithine;5-dH4PteHCysA, N alpha-(5-deaza-5,6,7,8-tetrahydropteroyl)-L-homocysteic acid; 5-dH4PteAPBA, N alpha-(5-deaza-5,6,7,8-tetrahydropteroyl)-DL-2-amino-4-phosphobutanoic acid; 5-dH4PteOro, N Alpha-(5-dideaza-5,6,7,8-tetrahydropteroyl)-L-ornithine; CB3717, N10-propargyl-5,8-dideazafolate; ICI-198,583, 2-desamino-2-methyl-N10-propargyl-5,8-dideazafolate; 4-H-ICI-198,583, 4-deoxy-ICI-198,583; 4-OCH3-ICI-198,583, 4-methoxy-ICI-198,583 Glu-to-Val-ICI-198,583; valine-ICI-198;583; Glu-to-Sub-ICI-198,583, 2-aminosuberic acid-ICI-198,583; 7-CH3-ICI-198,583, 7-methyl-ICI-198,583; ZD1694, N-[5(N-(3,4-dihydro-2-methyl-4- 2-NH2-ZD1694, 2-amino-ZD1694; BW1843U89, (S)-2[5-(((1,2-dihydro-3-methyl-1-oxobenzo(f)quinazolin-9-yl)methyl)amino-)-1-oxo-2-isoindolinyl]-glutamic acid; taric acid; LY231514, N-(4-(2-(2-amino-4,7-dihydro-4-oxo-3H-pyrrolo[2,3-D]pyrimidin-5-yl)ethyl)-benzoyl]-L-glutamic acid; IAHQ, 5,8-dideazaisofolic acid; 2-dIAHQ, 2-desamino-IAHQ; 2-CH3-dIAHQ, 2-desamino-2-methyl-I AHQ; 5-d(i)PteGlu, 5-deazaisofolic acid; N9-CH3-5-d(i)PteGlu, N9-methyl-5-deazaisofolic acid; N9-CHO-5-d(i)PteGlu, N9-formyl-5-deazaisofolic acid; AG337, 3,4-dihydro-2-amino-6-methyl-4-oxo-5-(4-pyridylthio)quanazoline;and AG377, 2,4-diamino-6[N-(4-(phenysulfonyl)benzyl)ethyl)amino]quinazoline; or stereoisomers thereof. In some embodiments, the gamma polyglutamated antifolate drug encapsulated by the liposome is selected from methotrexate, raltitrexed, previtrexed, pemetrexed, lometrexol (LTX; 5,10-dideazatetrahydrofolic acid), cyclopenta[g]quinazolines bearing dipeptide ligands, CB3717, CB300945, or stereoisomers thereof, such as 6-R,S-BGC945 (ONX-0801), CB300638, and BW1843U89. In some embodiments, the gamma polyglutamated antifolate drug in Lp-γPANTIFOL contains two or more L-glutamyl groups. In another embodiment, the gamma polyglutamated antifolate in Lp-γPANTIFOL contains a glutamyl group in the D-form. In a further embodiment, the gamma polyglutamated antifolate in Lp-γPANTIFOL contains a glutamyl group in the D-form and two or more glutamyl groups in the L-form.

[0016] In one embodiment, the Lp-γPANTIFOL composition comprises a gamma polyglutamated antifolate containing a chain of three glutamyl groups attached to a glutamyl group in the antifolate (i.e., a tetraglutamated antifolate). In some embodiments, the polyglutamated antifolate is an antifolate described in item [2] of the Summary of the Invention section. In some embodiments, the polyglutamated antifolate is an antifolate described in item [3] of the Summary of the Invention section. In some embodiments, the polyglutamated antifolate is an antifolate described in item [4] of the Summary of the Invention section. In some embodiments, the polyglutamated antifolate is an antifolate described in item [5] of the Summary of the Invention section. In some embodiments, γPANTIFOL is a polyglutamated antifolate described in the Summary of the Invention section. In some embodiments, the tetraglutamated antifolate comprises two or more glutamyl groups in the L-form. In other embodiments, the tetraglutamated antifolate comprises a glutamyl group in the D-form. In further embodiments, the tetraglutamated antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.

[0017] In one embodiment, the Lp-γPANTIFOL composition comprises a gamma polyglutamated antifolate comprising a chain of four gamma glutamyl groups linked to a glutamyl group in the antifolate (e.g., a gamma pentaglutamated antifolate). In some embodiments, the polyglutamated antifolate is an antifolate described in item [2] of the Summary of the Invention section. In some embodiments, the polyglutamated antifolate is an antifolate described in item [3] of the Summary of the Invention section. In some embodiments, the polyglutamated antifolate is an antifolate described in item [4] of the Summary of the Invention section. In some embodiments, the polyglutamated antifolate is an antifolate described in item [5] of the Summary of the Invention section. In some embodiments, the γPANTIFOL is a polyglutamated antifolate described in the Summary of the Invention section. In some embodiments, the pentaglutamated antifolate comprises two or more glutamyl groups in the L-form. In some embodiments, the gamma pentaglutamated antifolate comprises a glutamyl group in the D-form. In further embodiments, the pentaglutamated antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.

[0018] In one embodiment, the Lp-γPANTIFOL composition comprises a gamma polyglutamated antifolate comprising a chain of five gamma glutamyl groups attached to a glutamyl group in the antifolate (e.g., a gamma hexaglutamated antifolate). In some embodiments, the polyglutamated antifolate is an antifolate described in item [2] of the Summary of the Invention section. In some embodiments, the polyglutamated antifolate is an antifolate described in item [3] of the Summary of the Invention section. In some embodiments, the polyglutamated antifolate is an antifolate described in item [4] of the Summary of the Invention section. In some embodiments, the polyglutamated antifolate is an antifolate described in item [5] of the Summary of the Invention section. In some embodiments, the γPANTIFOL is a polyglutamated antifolate described in the Summary of the Invention section. In some embodiments, the gamma hexaglutamated antifolate comprises two or more glutamyl groups in the L-form. In other embodiments, the gamma hexaglutamated antifolate comprises a glutamyl group in the D-form. In further embodiments, the gamma hexaglutamated antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.

[0019] In some embodiments, the Lp-γPANTIFOL composition is cationic. In some embodiments, the Lp-γPANTIFOL liposomes are cationic and have a diameter in the range of 20 nm to 200 nm, 30 nm to 175 nm, or 50 nm to 150 nm, or any range therebetween. In further embodiments, the Lp-γPANTIFOL liposomes are cationic and have a diameter in the range of 30 nm to 175 nm or 50 nm to 150 nm, or any range therebetween. In still further embodiments, the Lp-γPANTIFOL liposomes have a diameter in the range of 80 nm to 120 nm, or any range therebetween. In some embodiments, cationic Lp-γPANTIFOL compositions comprise at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75% liposome-encapsulated gamma tetraglutamated antifolate. In some embodiments, cationic Lp-γPANTIFOL comprises at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75% liposome-encapsulated gamma penta-glutamated antifolate. In other embodiments, the Lp-γPANTIFOL comprises at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75% liposome-encapsulated gamma hexaglutamated antifolate. In further embodiments, the liposome-encapsulated gamma polyglutamated antifolate is present in a HEPES buffer solution within the liposomes.

[0020] In other embodiments, the Lp-γPANTIFOL composition is anionic or neutral. In some embodiments, the Lp-γPANTIFOL composition is cationic. In some embodiments, the Lp-γPANTIFOL liposomes are anionic or neutral and have diameters ranging from 20 nm to 200 nm, 30 nm to 175 nm, or 50 nm to 150 nm, or any range therebetween. In further embodiments, the Lp-γPANTIFOL liposomes are anionic or neutral and have diameters ranging from 30 nm to 175 nm, or 50 nm to 150 nm, or any range therebetween. In still further embodiments, the Lp-γPANTIFOL liposomes are anionic or neutral and have diameters ranging from 80 nm to 120 nm, or any range therebetween. In some embodiments, the Lp-γPANTIFOL liposomes are anionic and have a diameter ranging from 20 nm to 200 nm, 30 nm to 175 nm, or 50 nm to 150 nm, or any range therebetween. In further embodiments, the Lp-γPANTIFOL liposomes are anionic and have a diameter ranging from 30 nm to 175 nm or 50 nm to 150 nm, or any range therebetween. In further embodiments, the Lp-γPANTIFOL liposomes are anionic and the composition has a diameter ranging from 80 nm to 120 nm, or any range therebetween. In some embodiments, the Lp-γPANTIFOL liposomes are neutral and have a diameter ranging from 20 nm to 200 nm, 30 nm to 175 nm, or 50 nm to 150 nm, or any range therebetween. In a further embodiment, the Lp-γPANTIFOL liposomes are neutral and have a diameter ranging from 30 nm to 175 nm or 50 nm to 150 nm, or any range therebetween.In a further embodiment, the Lp-γPANTIFOL liposomes are neutral and the composition has a diameter ranging from 80 nm to 120 nm, or any range therebetween.In some embodiments, anionic or neutral Lp-γPANTIFOL compositions comprise at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75% liposome-encapsulated gamma tetraglutamated antifolate. In some embodiments, anionic or neutral Lp-γPANTIFOL compositions comprise at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75% liposome-encapsulated gamma penta-glutamated antifolate. In other embodiments, the Lp-γPANTIFOL composition comprises at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75% liposome-encapsulated gamma hexaglutamated antifolate. In further embodiments, the liposome-encapsulated gamma polyglutamated antifolate is present in a HEPES buffer solution within the liposomes.

[0021] In a further embodiment, the liposomal gamma polyglutamated antifolate composition is pegylated (PLp-γPANTIFOL).

[0022] In some embodiments, the liposomal gamma polyglutamated antifolate composition is non-targeted (NTLp-γPANTIFOL). That is, the NTLp-γPANTIFOL composition does not have specific affinity for an epitope expressed on the surface of a target cell of interest (e.g., an epitope on a surface antigen). In some embodiments, the NTLp-γPANTIFOL composition does not include a targeting moiety. In further embodiments, the non-targeted liposomal gamma polyglutamated antifolate composition is pegylated (NTPLp-γPANTIFOL).

[0023] In other embodiments, the liposomal gamma polyglutamated antifolate composition is targeted (TLp-γPANTIFOL). That is, the TLp-γPANTIFOL composition comprises a targeting moiety that has specific affinity for an epitope (surface antigen) on a target cell of interest. In some embodiments, the TLp-γPANTIFOL or TPLp-γPANTIFOL is not covalently attached to the liposome. In other embodiments, the targeting moiety of the TLp-γPANTIFOL or TPLp-γPANTIFOL is attached to one or both of the PEG and the exterior surface of the liposome. In some embodiments, the targeting moiety of the TLp-γPANTIFOL or TPLp-γPANTIFOL is covalently attached to the liposome. The function of the targeting moiety of TLp-γPANTIFOL and / or TPLp-γPANTIFOL composition includes, but is not limited to, targeting liposomes to desired target cells in vivo or in vitro; interacting with a surface antigen to which the targeting moiety has specific affinity; and delivering the liposomal payload (γPANTIFOL) to cells. Suitable targeting moieties are known in the art and include, but are not limited to, antibodies, antigen-binding antibody fragments, scaffold proteins, polypeptides, and peptides. In some embodiments, the targeting moiety is a polypeptide. In further embodiments, the targeting moiety is a polypeptide comprising at least 3, 5, 10, 15, 20, 30, 40, 50, or 100 amino acid residues.

[0024] Targeted liposomal gamma polyglutamated antifolate compositions (TLp-γPANTIFOL and TPLp-γPANTIFOL) provide further improvements over the efficacy and safety profile of antifolates by specifically delivering gamma polyglutamated (e.g., gamma pentaglutamated and / or gamma hexaglutamated) antifolates to target cells, such as cancer cells. In further embodiments, the targeted liposomal gamma polyglutamated antifolate compositions are PEGylated (TPLp-γPANTIFOL). In some embodiments, the targeting moiety of TLp-γPANTIFOL and TPLp-γPANTIFOL is attached to one or both of the PEG and the exterior surface of the liposome. In some embodiments, the targeting moiety of TLp-γPANTIFOL and TPLp-γPANTIFOL is attached to the liposome via a covalent bond. The function of the targeting moiety of TLp-γPANTIFOL and / or TPLp-γPANTIFOL composition includes, but is not limited to, targeting liposomes to desired target cells in vivo or in vitro; interacting with a surface antigen to which the targeting moiety has specific affinity; and delivering the liposomal payload (γPANTIFOL) to cells. Suitable targeting moieties are known in the art and include, but are not limited to, antibodies, antigen-binding antibody fragments, scaffold proteins, polypeptides, and peptides. In some embodiments, the targeting moiety is a polypeptide. In further embodiments, the targeting moiety is a polypeptide comprising at least 3, 5, 10, 15, 20, 30, 40, 50, or 100 amino acid residues.

[0025] In some embodiments, the targeting moiety of TLp-γPANTIFOL or TPLp-γPANTIFOL is an antibody or an antigen-binding antibody fragment. In further embodiments, the targeting moiety comprises one or more of an antibody, a humanized antibody, an antigen-binding fragment of an antibody, a single-chain antibody, a single-domain antibody, a bispecific antibody, a synthetic antibody, a pegylated antibody, and a multimeric antibody. In some embodiments, the targeting moiety of TLp-γPANTIFOL or TPLp-γPANTIFOL has specific affinity for an epitope that is selectively expressed on target cells, such as tumor cells, compared to normal or non-tumor cells. In some embodiments, the targeting moiety has specific affinity for an epitope on a tumor cell surface antigen that is present on tumor cells but absent or inaccessible on non-tumor cells. In some embodiments, the targeting moiety has a specific affinity of 0.5x10 as measured by BIACORE® analysis. -10 ~10x10 -6 It binds to the epitope of interest with an equilibrium dissociation constant (Kd) in the range of

[0026] In certain embodiments, the TLp-γPANTIFOL or TPLp-γPANTIFOL targeting moiety comprises a polypeptide that specifically binds to a folate receptor. In some embodiments, the targeting moiety is an antibody or an antigen-binding antibody fragment. In some embodiments, the folate receptor bound by the targeting moiety specifically binds to one or more folate receptors selected from folate receptor alpha (FR-α, FOLR1), folate receptor beta (FR-β, FOLR2), and folate receptor delta (FR-δ, FOLR4). In some embodiments, the folate receptor bound by the targeting moiety is folate receptor alpha (FR-α). In some embodiments, the folate receptor bound by the targeting moiety is folate receptor beta (FR-β). In some embodiments, the targeting moiety specifically binds to FR-α and FR-β.

[0027] In further embodiments, the Lp-γPANTIFOL composition comprises one or more of an immunostimulant, a detectable marker, and a maleimide disposed on at least one of the PEG or outer surface of the liposome. In some embodiments, the liposomal γPANTIFOL composition (e.g., Lp-γPANTIFOL, PLp-γPANTIFOL, NTLp-γPANTIFOL, NTPLp-γPANTIFOL, TLp-γPANTIFOL, or TPLp-γPANTIFOL) is cationic. In other embodiments, the liposomal γPANTIFOL composition (e.g., Lp-γPANTIFOL, PLp-γPANTIFOL, NTLp-γPANTIFOL, NTPLp-γPANTIFOL, TLp-γPANTIFOL, or TPLp-γPANTIFOL) is anionic or neutral. In further embodiments, the liposomes of the liposomal γPANTIFOL composition (e.g., Lp-γPANTIFOL, PLp-γPANTIFOL, NTLp-γPANTIFOL, NTPLp-γPANTIFOL, TLp-γPANTIFOL, or TPLp-γPANTIFOL) have diameters ranging from 20 nm to 200 nm, or any range therebetween. In further embodiments, the liposomes of the liposomal γPANTIFOL composition have diameters ranging from 80 nm to 120 nm, or any range therebetween. In some embodiments, the liposomal γPANTIFOL composition is pegylated (e.g., PLp-γPANTIFOL, NTPLp-γPANTIFOL, or TPLp-γPANTIFOL). In some embodiments, the liposomal γPANTIFOL composition comprises a targeting moiety (e.g., TLp-γPANTIFOL or TPLp-γPANTIFOL). In further embodiments, the liposomal γPANTIFOL composition is pegylated and targeted (e.g., TPLp-γPANTIFOL). In some embodiments, the liposomal γPANTIFOL composition comprises a gamma polyglutamated antifolate containing 4, 5, 2-10, 4-6, or more than 5 glutamyl groups. In some embodiments, the liposomal γPANTIFOL composition comprises a gamma tetraglutamated antifolate.In some embodiments, the liposomal γ-PANTIFOL composition comprises a gamma-pentaglutamated antifolate. In some embodiments, the liposomal γ-PANTIFOL composition comprises a gamma-hexaglutamated antifolate. In some embodiments, the liposomal composition comprises a gamma-polyglutamated antifolate described in any of items [1]-

[11] in the Summary of the Invention section. In some embodiments, the liposome comprises a liposomal composition described in any of items

[11] -

[69] in the Summary of the Invention section. In some embodiments, the composition comprises a gamma-polyglutamated antifolate described in the Summary of the Invention section.

[0028] In further embodiments, the liposomal γPANTIFOL composition (i.e., Lp-γPANTIFOL, such as PLp-γPANTIFOL, NTLp-γPANTIFOL, NTPLp-γPANTIFOL, TLp-γPANTIFOL, or TPLp-γPANTIFOL) comprises at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75% liposome-entrapped gamma polyglutamated antifolate. In some embodiments, the liposomal γPANTIFOL composition comprises between 1% and 98.5% liposome-entrapped gamma polyglutamated antifolate. In further embodiments, the liposomal gamma-PANTIFOL composition comprises at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75% liposome-encapsulated gamma polyglutamated antifolate containing 4, 5, 2-10, 4-6, or more than 5 glutamyl groups. In some embodiments, the liposomal gamma-PANTIFOL composition comprises 1% to 98.5% liposome-encapsulated gamma polyglutamated antifolate containing 4, 5, 2-10, 4-6, or more than 5 glutamyl groups. In some embodiments, liposomal γ-PANTIFOL compositions comprise at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75% liposome-encapsulated gamma tetraglutamated antifolate. In some embodiments, liposomal γ-PANTIFOL compositions comprise 1% to 98.5% liposome-encapsulated gamma polyglutamated antifolate. In some embodiments, liposomal γ-PANTIFOL compositions comprise at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75% liposome-encapsulated gamma penta-glutamated antifolate. In some embodiments, the liposomal gamma-PANTIFOL composition comprises between 1% and 98.5% liposome-encapsulated gamma-pentaglutamated antifolate.In some embodiments, the liposomal γ-PANTIFOL composition comprises at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75% liposome-encapsulated gamma hexaglutamated antifolate. In some embodiments, the liposomal γ-PANTIFOL composition comprises 1% to 98.5% liposome-encapsulated gamma pentaglutamated antifolate. In some embodiments, the liposomal composition comprises a gamma polyglutamated antifolate described in any of items [1] through

[11] in the Summary of the Invention section. In some embodiments, the liposome comprises a liposomal composition described in any of items

[11] through

[69] in the Summary of the Invention section. In some embodiments, the composition comprises a gamma polyglutamated antifolate described in the Summary of the Invention section or in the Figures herein.

[0029] Also provided are liposomal compositions comprising γ-PANTIFOL-encapsulated liposomes. In some embodiments, the liposomal composition comprises a PEGylated γ-PANTIFOL composition. In some embodiments, the liposomal composition comprises a γ-PANTIFOL composition linked or otherwise attached to a targeting moiety. In further embodiments, the liposomal composition comprises a γ-PANTIFOL composition that is PEGylated and linked or otherwise attached to a targeting moiety. In some embodiments, the liposomal composition comprises γ-PANTIFOL containing 4, 5, 2-10, 4-6, or more than 5 glutamyl groups. In some embodiments, the liposomal composition comprises a gamma-tetraglutamated antifolate. In some embodiments, the liposomal composition comprises a gamma-pentaglutamated antifolate. In other embodiments, the liposomal composition comprises a gamma-hexaglutamated antifolate. In some embodiments, the polyglutamated antifolate is an antifolate as described in item [2] of the Summary of the Invention section. In some embodiments, the polyglutamated antifolate is an antifolate described in item [3] of the Summary of the Invention section. In some embodiments, the polyglutamated antifolate is an antifolate described in item [4] of the Summary of the Invention section. In some embodiments, the polyglutamated antifolate is an antifolate described in item [5] of the Summary of the Invention section. In some embodiments, γ-PANTIFOL is a polyglutamated antifolate described in the Summary of the Invention section.

[0030] In some embodiments, the liposomal composition comprises liposomal γPANTIFOL (e.g., Lp-γPANTIFOL, PLp-γPANTIFOL, NTLp-γPANTIFOL, NTPLp-γPANTIFOL, TLp-γPANTIFOL, and TPLp-γPANTIFOL). In some embodiments, the liposomal γPANTIFOL is pegylated (e.g., NTPLp-γPANTIFOL and TPLp-γPANTIFOL). In some embodiments, the pharmaceutical composition comprises γPANTIFOL containing 4, 5, 2-10, 4-6, or more than 5 glutamyl groups. In some embodiments, the pharmaceutical composition comprises a gamma tetraglutamated antifolate. In some embodiments, the pharmaceutical composition comprises a gamma pentaglutamated antifolate. In other embodiments, the pharmaceutical composition comprises a gamma hexaglutamated antifolate. In some embodiments, the polyglutamated antifolate is an antifolate described in item [2] of the Summary of the Invention section. In some embodiments, the polyglutamated antifolate is an antifolate described in item [3] of the Summary of the Invention section. In some embodiments, the polyglutamated antifolate is an antifolate described in item [4] of the Summary of the Invention section. In some embodiments, the polyglutamated antifolate is an antifolate described in item [5] of the Summary of the Invention section. In some embodiments, the γPANTIFOL is a polyglutamated antifolate described in the Summary of the Invention section. In some embodiments, the liposomal γPANTIFOL comprises a targeting moiety having specific affinity for an epitope of an antigen on the surface of a target cell of interest, such as a cancer cell (e.g., TLp-γPANTIFOL or TPLp-γPANTIFOL). In further embodiments, the liposome composition comprises PEGylated liposomal γPANTIFOL and further comprises a targeting moiety having specific affinity for an epitope of an antigen on the surface of a target cell of interest, such as a cancer cell (e.g., TPLp-γPANTIFOL). In some embodiments, the liposome composition comprises liposomal γPANTIFOL that is cationic.In other embodiments, the liposome composition comprises anionic or neutral liposomal γ-PANTIFOL. In further embodiments, the liposome composition comprises liposomal γ-PANTIFOL having a diameter of 20 nm to 200 nm, or any range therebetween. In further embodiments, the liposomal γ-PANTIFOL has a diameter of 80 nm to 120 nm, or any range therebetween.

[0031] Pharmaceutical compositions comprising a gamma polyglutamated antifolate (γPANTIFOL) with a delivery vehicle, such as liposomal γPANTIFOL, are also provided. In some embodiments, the pharmaceutical composition comprises a pegylated γPANTIFOL composition. In some embodiments, the pharmaceutical composition comprises a γPANTIFOL composition linked or otherwise attached to a targeting moiety. In further embodiments, the pharmaceutical composition comprises a γPANTIFOL composition that is pegylated and linked or otherwise attached to a targeting moiety. In some embodiments, the pharmaceutical composition comprises γPANTIFOL containing 4, 5, 2-10, 4-6, or more than 5 glutamyl groups. In some embodiments, the pharmaceutical composition comprises a gamma tetraglutamated antifolate. In some embodiments, the pharmaceutical composition comprises a gamma pentaglutamated antifolate. In other embodiments, the pharmaceutical composition comprises a gamma hexaglutamated antifolate. In some embodiments, the gamma polyglutamated antifolate is a polyglutamated antifolate described in any of items [1]-

[11] in the Summary of the Invention section. In some embodiments, the polyglutamated antifolate is a polyglutamated antifolate described in the Summary of the Invention section.

[0032] In some embodiments, the pharmaceutical composition comprises liposomal γPANTIFOL (e.g., Lp-γPANTIFOL, PLp-γPANTIFOL, NTLp-γPANTIFOL, NTPLp-γPANTIFOL, TLp-γPANTIFOL, and TPLp-γPANTIFOL). In some embodiments, the liposomal γPANTIFOL composition is pegylated (e.g., NTPLp-γPANTIFOL and TPLp-γPANTIFOL). In some embodiments, the liposomal γPANTIFOL comprises a targeting moiety having specific affinity for an epitope of an antigen on the surface of a target cell of interest, such as a cancer cell (e.g., TLp-γPANTIFOL or TPLp-γPANTIFOL). In further embodiments, the pharmaceutical composition comprises pegylated liposomal γPANTIFOL and further comprises a targeting moiety having specific affinity for an epitope of an antigen on the surface of a target cell of interest, such as a cancer cell (e.g., TPLp-γPANTIFOL). In some embodiments, the pharmaceutical composition comprises cationic liposomal γ-PANTIFOL. In other embodiments, the pharmaceutical composition comprises anionic or neutral liposomal γ-PANTIFOL. In further embodiments, the pharmaceutical composition comprises liposomal γ-PANTIFOL having a diameter of 20 nm to 200 nm, or any range therebetween. In further embodiments, the liposomal γ-PANTIFOL composition has a diameter of 80 nm to 120 nm, or any range therebetween. In some embodiments, the pharmaceutical composition comprises γ-PANTIFOL containing 4, 5, 2 to 10, 4 to 6, or more than 5 glutamyl groups. In some embodiments, the pharmaceutical composition comprises a gamma tetraglutamated antifolate. In some embodiments, the pharmaceutical composition comprises a gamma pentaglutamated antifolate. In other embodiments, the pharmaceutical composition comprises a gamma hexaglutamated antifolate. In some embodiments, the composition comprises a gamma polyglutamated antifolate described in any of items [1] to

[11] in the Summary of the Invention section. In some embodiments, the pharmaceutical composition comprises a liposome composition described in any one of items

[11] to

[69] in the Summary of the Invention section.In some embodiments, the composition comprises a gamma polyglutamated antifolate as described in the Summary of the Invention section.

[0033] In further embodiments, the present disclosure provides methods of modulating cellular activation, chemokine production, or metabolic activity, the method comprising contacting a cell with a composition comprising a gamma polyglutamated antifolate (γPANTIFOL) composition. In some embodiments, the contacted cell is a mammalian cell. In further embodiments, the contacted cell is a human cell. In some embodiments, the contacted cell is a hyperproliferative cell. In further embodiments, the cell is an immune cell. In some embodiments, the method is performed in vivo. In other embodiments, the method is performed in vitro. In some embodiments, the γPANTIFOL comprises 4, 5, 2-10, 4-6, or more than 5 glutamyl groups. In some embodiments, the γPANTIFOL composition comprises a gamma tetraglutamated antifolate. In some embodiments, the γPANTIFOL composition comprises a gamma pentaglutamated antifolate. In other embodiments, the γPANTIFOL composition comprises a gamma hexaglutamated antifolate. In some embodiments, the composition comprises a gamma polyglutamated antifolate described in any of Items [1]-

[11] in the Summary of the Invention section. In some embodiments, the pharmaceutical composition comprises a liposomal composition described in any of Items

[11] -

[69] in the Summary of the Invention section. In some embodiments, the composition comprises a gamma polyglutamated antifolate described in the Summary of the Invention section or in the Figures herein.

[0034] In further embodiments, the present disclosure provides methods for modulating cellular activation, chemokine production, or metabolic activity, the method comprising contacting a cell with a liposome comprising a gamma polyglutamated antifolate (γPANTIFOL) composition. In some embodiments, the contacted cell is a mammalian cell. In further embodiments, the contacted cell is a human cell. In some embodiments, the contacted cell is a hyperproliferative cell. In further embodiments, the cell is an immune cell. In some embodiments, the method is performed in vivo. In other embodiments, the method is performed in vitro. In some embodiments, the γPANTIFOL comprises 4, 5, 2-10, 4-6, or more than 5 glutamyl groups. In some embodiments, the γPANTIFOL composition comprises a gamma tetraglutamated antifolate. In some embodiments, the γPANTIFOL composition comprises a gamma pentaglutamated antifolate. In other embodiments, the γPANTIFOL composition comprises a gamma hexaglutamated antifolate. In some embodiments, the polyglutamated antifolate comprises an antifolate described in item [2] of the Summary of the Invention. In some embodiments, the polyglutamated antifolate is an antifolate described in item [3] of the Summary of the Invention. In some embodiments, the polyglutamated antifolate is an antifolate described in item [4] of the Summary of the Invention. In some embodiments, the polyglutamated antifolate is an antifolate described in item [5] of the Summary of the Invention. In some embodiments, γ-PANTIFOL is a polyglutamated antifolate described in the Summary of the Invention.

[0035] In further embodiments, the disclosure provides a method of killing a cell, the method comprising contacting the cell with a composition comprising a gamma polyglutamated antifolate (γPANTIFOL) composition. In some embodiments, the contacted cell is a mammalian cell. In further embodiments, the contacted cell is a human cell. In some embodiments, the contacted cell is a hyperproliferative cell. In further embodiments, the hyperproliferative cell is a cancer cell. In further embodiments, the contacted cancer cells are primary cells or cells from a cell line obtained / derived from a cancer selected from non-hematologic tumors including, for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, bile duct cancer, gallbladder cancer, bladder cancer, sarcoma (e.g., osteosarcoma), brain cancer, central nervous system cancer, and melanoma; and hematologic tumors such as, for example, leukemia, lymphoma and other B-cell malignancies, myeloma and other plasma cell dysplasias or cachexia. In some embodiments, the cancer is selected from breast cancer, advanced head and neck cancer, lung cancer, gastric cancer, osteosarcoma, non-Hodgkin's lymphoma (NHL), acute lymphocytic leukemia (ALL), mycosis fungoides (cutaneous T-cell lymphoma), choriocarcinoma, chorioadenoma, non-leukemic meningeal carcinomatosis, soft tissue sarcoma (demenoid tumor, aggressive fibromatosis), bladder cancer, and central nervous system (CNS) cancer. In some embodiments, the contacted cancer cells are primary cells or cells from a cell line obtained / derived from lung cancer (e.g., NSCLC or mesothelioma). In some embodiments, the contacted cancer cells are primary cells or cells from a cell line obtained / derived from breast cancer (e.g., HER2++ or triple-negative breast cancer). In some embodiments, the contacted cancer cells are primary cells or cells from a cell line obtained / derived from colorectal cancer. In some embodiments, the contacted cancer cells are primary cells or cells from a cell line obtained / derived from ovarian cancer. In some embodiments, the contacted cancer cells are primary cells or cells from a cell line obtained / derived from endometrial cancer. In some embodiments, the contacted cancer cells are primary cells or cells from a cell line obtained / derived from pancreatic cancer.In some embodiments, the cancer cells contacted are primary cells or cells from a cell line obtained / derived from liver cancer. In some embodiments, the cancer cells contacted are primary cells or cells from a cell line obtained / derived from head and neck cancer. In some embodiments, the cancer cells contacted are primary cells or cells from a cell line obtained / derived from osteosarcoma. In some embodiments, the method is performed in vivo. In other embodiments, the method is performed in vitro. In some embodiments, the γ-PANTIFOL comprises 4, 5, 2-10, 4-6, or more than 5 γ-glutamyl groups. In some embodiments, the γ-PANTIFOL composition comprises a gamma tetraglutamated antifolate. In some embodiments, the γ-PANTIFOL composition comprises a gamma pentaglutamated antifolate. In other embodiments, the γ-PANTIFOL composition comprises a gamma hexaglutamated antifolate. In some embodiments, the gamma polyglutamated antifolate is a polyglutamated antifolate described in any of items [1]-

[11] in the Summary of the Invention section. In some embodiments, the gamma polyglutamated antifolate is a polyglutamated antifolate described in any of items [1]-

[11] in the Summary of the Invention section.

[0036] In further embodiments, the disclosure provides methods of killing cells, the methods comprising contacting the cells with a liposome comprising a gamma polyglutamated antifolate (e.g., Lp-γPANTIFOL, such as PLp-γPANTIFOL, NTLp-γPANTIFOL, NTPLp-γPANTIFOL, TLp-γPANTIFOL, or TPLp-γPANTIFOL). In some embodiments, the contacted cells are mammalian cells. In further embodiments, the contacted cells are human cells. In some embodiments, the contacted cells are hyperproliferative cells. In further embodiments, the contacted hyperproliferative cells are cancer cells. In further embodiments, the cancer cells are primary cells or cells from a cell line obtained / derived from a cancer selected from non-hematologic tumors including, for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, bile duct cancer, gallbladder cancer, bladder cancer, sarcoma (e.g., osteosarcoma), brain cancer, central nervous system cancer, and melanoma; and hematologic tumors such as, for example, leukemia, lymphoma and other B-cell malignancies, myeloma and other plasma cell dysplasias or cachexia. In some embodiments, the cells are primary cells or cells from a cell line obtained / derived from a cancer selected from breast cancer, advanced head and neck cancer, lung cancer, gastric cancer, osteosarcoma, non-Hodgkin's lymphoma (NHL), acute lymphocytic leukemia (ALL), mycosis fungoides (cutaneous T-cell lymphoma), choriocarcinoma, chorioadenoma, non-leukemic meningeal carcinomatosis, soft tissue sarcoma (demenoid tumor, aggressive fibromatosis), bladder cancer, or central nervous system (CNS) cancer. In some embodiments, the contacted cancer cells are primary cells or cells from a cell line obtained / derived from lung cancer (e.g., NSCLC or mesothelioma). In some embodiments, the contacted cancer cells are primary cells or cells from a cell line obtained / derived from breast cancer (e.g., HER2++ or triple-negative breast cancer). In some embodiments, the contacted cancer cells are primary cells or cells from a cell line obtained / derived from colorectal cancer. In some embodiments, the contacted cancer cells are primary cells or cells from a cell line obtained / derived from an ovarian cancer.In some embodiments, the cancer cells contacted are primary cells or cells from a cell line obtained / derived from endometrial cancer. In some embodiments, the cancer cells contacted are primary cells or cells from a cell line obtained / derived from pancreatic cancer. In some embodiments, the cancer cells contacted are primary cells or cells from a cell line obtained / derived from liver cancer. In some embodiments, the cancer cells contacted are primary cells or cells from a cell line obtained / derived from head and neck cancer. In some embodiments, the cancer cells contacted are primary cells or cells from a cell line obtained / derived from osteosarcoma. In some embodiments, the method is performed in vivo. In other embodiments, the method is performed in vitro. In some embodiments, the liposome comprises γ-PANTIFOL containing 4, 5, 2-10, 4-6, or more than 5 glutamyl groups. In some embodiments, the liposome comprises a gamma-tetraglutamated antifolate. In some embodiments, the liposome comprises a gamma-pentaglutamated antifolate. In other embodiments, the liposome comprises a gamma hexaglutamated antifolate. In some embodiments, the gamma polyglutamated antifolate is a polyglutamated antifolate described in any of items [1]-

[11] in the Summary of the Invention section. In some embodiments, γ-PANTIFOL is a polyglutamated antifolate described in the Summary of the Invention section. In some embodiments, the liposome is a liposome described in any of items

[12] -

[67] in the Summary of the Invention section.

[0037] In further embodiments, the present disclosure provides methods of treating cancer, the method comprising administering to a subject having or at risk of having cancer an effective amount of a delivery vehicle (e.g., an antibody immunoconjugate or liposome) comprising a gamma polyglutamated antifolate. In some embodiments, the delivery vehicle is an antibody-containing immunoconjugate (e.g., comprising a full-length IgG antibody, a bispecific antibody, or an scFv). In some embodiments, the delivery vehicle is a liposome (e.g., Lp-γPANTIFOL, such as PLp-γPANTIFOL, NTLp-γPANTIFOL, NTPLp-γPANTIFOL, TLp-γPANTIFOL, or TPLp-γPANTIFOL). In some embodiments, the administered delivery vehicle is pegylated. In some embodiments, the administered delivery vehicle is non-pegylated. In further embodiments, the administered delivery vehicle comprises a targeting moiety having specific affinity for an epitope of an antigen on the surface of a cancer cell.In further embodiments, the delivery vehicle comprises a targeting moiety that specifically binds to a cell surface antigen selected from the following: GONMB, TACSTD2 (TROP2), CEACAM5, EPCAM, a folate receptor (e.g., folate receptor-α, folate receptor-β, or folate receptor-δ), mucin 1 (MUC-1), MUC-6, STEAP1, mesothelin, nectin 4, ENPP3, guanylyl cyclase C (GCC), SLC44A4, NaPi2b, CD70 (TNFSF7), CA9 (carbonic anhydrase), 5T4 (TPBG), SLTRK6, SC-16, tissue factor, LIV-1 (ZIP6), CGEN-15027, P-cadherin, fibronectin, and the like. extra domain B (ED-B), VEGFR2 (CD309), tenascin, collagen IV, periostin, endothelin receptor, HER2, HER3, EGFR, IGFR-1, EGFRvIII, CD2, CD3, CD4, CD5, CD6, CD11, CD11a, CD15, CD18, CD19, CD20, CD22, CD26, CD27L, CD30, CD33, CD34, CD37, CD38, CD40, CD44, CD56, CD70, CD74, CD79, CD79b, CD105, CD133, CD138, Cryptosporin, CD38, EphA receptors, EphB receptors, EphA2, integrins (e.g., integrin α). v β3, α v β5 or α vβ6), C242 antigen, Apo2, PSGR, NGEP, PSCA, TMEFF2, endoglin, PSMA, CD98, CD56, CanAg, and CALLA. In some embodiments, the delivery vehicle comprises a targeting moiety that specifically binds to a cell surface antigen determined to be derived from or expressed by a specific target cancer (tumor), such as a neoantigen. In some embodiments, the targeting moiety specifically binds to a cell surface antigen determined to be derived from or expressed by a specific target tumor, such as a neoantigen. In some embodiments, the targeting moiety is an antibody or an antigen-binding antibody fragment. In some embodiments, the administered delivery vehicle comprises γ-PANTIFOL containing 4, 5, 2-10, 4-6, or more than 5 glutamyl groups. In some embodiments, the administered delivery vehicle comprises a gamma tetraglutamated antifolate. In some embodiments, the administered delivery vehicle comprises a gamma pentaglutamated antifolate. In some embodiments, the administered delivery vehicle comprises a gamma polyglutamated antifolate. In some embodiments, the administered delivery vehicle comprises 2, 3, 4, 5, or more than 5 L-gamma glutamyl groups. In some embodiments, the administered delivery vehicle comprises a D-gamma polyglutamated antifolate. In some embodiments, the administered delivery vehicle comprises 2, 3, 4, 5, or 5, or more than 5 D-gamma glutamyl groups. In some embodiments, the administered delivery vehicle comprises an L- and D-gamma polyglutamated antifolate. In some embodiments, the administered delivery vehicle comprises 2, 3, 4, 5, or 5, or more than 5 L-gamma glutamyl groups and 2, 3, 4, 5, or more than 5 D-gamma glutamyl groups. In some embodiments, the cancer is selected from non-hematologic tumors, including, for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, bile duct cancer, gallbladder cancer, bladder cancer, sarcoma, brain cancer, central nervous system cancer, and melanoma; and hematologic tumors, such as, for example, leukemia, lymphoma and other B-cell malignancies, myeloma and other plasma cell dysplasias or cachexia.In some embodiments, the cancer is selected from breast cancer, advanced head and neck cancer, lung cancer, gastric cancer, osteosarcoma, non-Hodgkin's lymphoma (NHL), acute lymphocytic leukemia (ALL), mycosis fungoides (cutaneous T-cell lymphoma), choriocarcinoma, chorioadenoma, non-leukemic meningeal carcinomatosis, soft tissue sarcoma (demenoid tumor, aggressive fibromatosis), bladder cancer, and central nervous system (CNS) cancer. In some embodiments, the cancer is lung cancer (e.g., NSCLC or mesothelioma). In some embodiments, the cancer is breast cancer (e.g., HER2++ or triple-negative breast cancer). In some embodiments, the cancer is colorectal cancer. In some embodiments, the cancer is ovarian cancer. In some embodiments, the cancer is endometrial cancer. In some embodiments, the cancer is pancreatic cancer. In some embodiments, the cancer is liver cancer. In some embodiments, the cancer is head and neck cancer. In some embodiments, the cancer is osteosarcoma. In some embodiments, the administered delivery vehicle comprises γ-PANTIFOL containing 4, 5, 2 to 10, 4 to 6, or more than 5 glutamyl groups. In some embodiments, the administered delivery vehicle comprises a gamma-tetraglutamated antifolate. In some embodiments, the administered delivery vehicle comprises a gamma-pentaglutamated antifolate. In other embodiments, the administered delivery vehicle comprises a gamma-hexaglutamated antifolate. In some embodiments, the administered delivery vehicle comprises a polyglutamated antifolate described in any of items [1] to

[11] in the Summary of the Invention section. In some embodiments, the administered delivery vehicle is a liposome composition comprising a polyglutamated antifolate described in any of items [1] to

[11] in the Summary of the Invention section. In some embodiments, the γ-pantifol is a polyglutamated antifolate described in the Summary of the Invention. In some embodiments, the liposome composition comprises a liposome described in any of Items

[12] -

[67] in the Summary of the Invention.

[0038] In further embodiments, the present disclosure provides methods of treating cancer, the methods comprising administering an effective amount of liposomes comprising a gamma polyglutamated antifolate (e.g., Lp-γPANTIFOL, such as PLp-γPANTIFOL, NTLp-γPANTIFOL, NTPLp-γPANTIFOL, TLp-γPANTIFOL, or TPLp-γPANTIFOL) to a subject having or at risk of having cancer. In some embodiments, the liposomes are pegylated. In some embodiments, the liposomes are not pegylated. In further embodiments, the liposomes comprise a targeting moiety having specific affinity for an epitope of an antigen on the surface of a cancer cell. In further embodiments, the liposome comprises a targeting moiety that specifically binds to a cell surface antigen selected from the following: GONMB, TACSTD2 (TROP2), CEACAM5, EPCAM, a folate receptor (e.g., folate receptor-α, folate receptor-β, or folate receptor-δ), mucin 1 (MUC-1), MUC-6, STEAP1, mesothelin, nectin 4, ENPP3, guanylyl cyclase C (GCC), SLC44A4, NaPi2b, CD70 (TNFSF7), CA9 (carbonic anhydrase), 5T4 (TPBG), SLTRK6, SC-16, tissue factor, LIV-1 (ZIP6), CGEN-15027, P-cadherin, fibroneclase, or fibroneclase. Cytokinin extra domain B (ED-B), VEGFR2 (CD309), tenascin, collagen IV, periostin, endothelin receptor, HER2, HER3, EGFR, IGFR-1, EGFRvIII, CD2, CD3, CD4, CD5, CD6, CD11, CD11a, CD15, CD18, CD19, CD20, CD22, CD26, CD27L, CD30, CD33, CD34, CD37, CD38, CD40, CD44, CD56, CD70, CD74, CD79, CD79b, CD105, CD133, CD138, criptine, CD38, EphA receptors, EphB receptors, EphA2, integrins (e.g., integrin α) v β3, α v β5 or α vβ6), C242 antigen, Apo2, PSGR, NGEP, PSCA, TMEFF2, endoglin, PSMA, CD98, CD56, CanAg, and CALLA. This also includes the use of cancer stem cell targeting moieties, such as those targeting CD34, CD133 and CD44, CD138, and CD15. In some embodiments, the targeting moiety is an antibody or antigen-binding antibody fragment. In some embodiments, the liposome comprises γ-pantifol containing 4, 5, 2-10, 4-6, or more than 5 glutamyl groups. In some embodiments, the liposome comprises a gamma tetraglutamated antifolate. In some embodiments, the liposome comprises a gamma pentaglutamated antifolate. In other embodiments, the liposome comprises a gamma hexaglutamated antifolate. In some embodiments, the polyglutamated antifolate comprises an antifolate described in any of Items [1]-

[11] in the Summary of the Invention section. In some embodiments, γ-PANTIFOL is a polyglutamated antifolate described in the Summary of the Invention section. In some embodiments, the liposome composition comprises a liposome described in any of Items

[12] -

[67] in the Summary of the Invention section. In some embodiments, the liposome comprises an L-gamma polyglutamated antifolate. In some embodiments, the liposome comprises 2, 3, 4, 5, or more than 5 L-gamma glutamyl groups. In some embodiments, the liposome comprises a D-gamma polyglutamated antifolate. In some embodiments, the liposome comprises 2, 3, 4, 5, or more than 5 D-gamma glutamyl groups. In some embodiments, the administered liposome comprises 2, 3, 4, 5, or more than 5 L-gamma glutamyl groups. In some embodiments, the liposomes comprise L and D gamma polyglutamated antifolates, hi some embodiments, the liposomes comprise 2, 3, 4, 5, or 5 or more than 5 L-gamma glutamyl groups and 2, 3, 4, 5, or more than 5 D-gamma glutamyl groups.In some embodiments, the cancer is selected from lung cancer (e.g., non-small cell lung cancer), pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, bile duct cancer, gallbladder cancer, bladder cancer, sarcoma (e.g., osteosarcoma), brain cancer, central nervous system cancer, melanoma, and hematological tumors (e.g., leukemia or lymphoma). In some embodiments, the cancer is selected from breast cancer, advanced head and neck cancer, lung cancer, gastric cancer, osteosarcoma, non-Hodgkin's lymphoma (NHL), acute lymphocytic leukemia (ALL), mycosis fungoides (cutaneous T-cell lymphoma), choriocarcinoma, chorioadenoma, non-leukemic meningeal carcinomatosis, soft tissue sarcoma (demenoid tumor, aggressive fibromatosis), bladder cancer, and central nervous system (CNS) cancer. In some embodiments, the cancer is lung cancer (e.g., NSCLC or mesothelioma). In some embodiments, the cancer is breast cancer (e.g., HER2++ or triple-negative breast cancer). In some embodiments, the cancer is colorectal cancer. In some embodiments, the cancer cells are ovarian cancer. In some embodiments, the cancer is endometrial cancer. In some embodiments, the cancer is pancreatic cancer. In some embodiments, the cancer is liver cancer. In some embodiments, the cancer is head and neck cancer. In some embodiments, the cancer is osteosarcoma.

[0039] In a further embodiment, the present disclosure provides a method of treating cancer, the method comprising administering to a subject having or at risk of having cancer an effective amount of a liposome composition comprising a gamma polyglutamated antifolate and a liposome comprising a targeting moiety having specific affinity for an epitope of an antigen on the surface of the cancer. In some embodiments, the liposome comprises a targeting moiety that specifically binds to a cell surface antigen selected from the following: GONMB, TACSTD2 (TROP2), CEACAM5, EPCAM, a folate receptor (e.g., folate receptor-α, folate receptor-β, or folate receptor-δ), mucin 1 (MUC-1), MUC-6, STEAP1, mesothelin, nectin 4, ENPP3, guanylyl cyclase C (GCC), SLC44A4, NaPi2b, CD70 (TNFSF7), CA9 (carbonic anhydrase), 5T4 (TPBG), SLTRK6, SC-16, tissue factor, LIV-1 (ZIP6), CGEN-15027, P-cadherin, fibronectin, or fibronectin. Cytokinin extra domain B (ED-B), VEGFR2 (CD309), tenascin, collagen IV, periostin, endothelin receptor, HER2, HER3, EGFR, IGFR-1, EGFRvIII, CD2, CD3, CD4, CD5, CD6, CD11, CD11a, CD15, CD18, CD19, CD20, CD22, CD26, CD27L, CD30, CD33, CD34, CD37, CD38, CD40, CD44, CD56, CD70, CD74, CD79, CD79b, CD105, CD133, CD138, criptine, CD38, EphA receptors, EphB receptors, EphA2, integrins (e.g., integrin α) v β3, α v β5 or α vβ6), C242 antigen, Apo2, PSGR, NGEP, PSCA, TMEFF2, endoglin, PSMA, CD98, CD56, CanAg, and CALLA. In some embodiments, the liposomes comprise a targeting moiety that specifically binds to a cell surface antigen(s) determined to be derived from or expressed on a particular target tumor, such as a neoantigen. In some embodiments, the targeting moiety comprises an antibody or an antigen-binding antibody fragment. In some embodiments, the liposomes comprise gamma-pantifol containing 4, 5, 2-10, 4-6, or more than 5 gamma-glutamyl groups. In some embodiments, the liposomes comprise a gamma-tetraglutamated antifolate. In some embodiments, the liposomes comprise a gamma-pentaglutamated antifolate. In other embodiments, the polyglutamated antifolate comprises a gamma-hexaglutamated antifolate. In some embodiments, the polyglutamated antifolate is an antifolate described in any one of Items [1]-

[11] in the Summary of the Invention section. In some embodiments, the γ-PANTIFOL is a polyglutamated antifolate described in any one of Items

[12] -

[67] in the Summary of the Invention section. In some embodiments, the liposome composition comprises a liposome described in any one of Items

[12] -

[67] in the Summary of the Invention section. In some embodiments, the liposome comprises γ-PANTIFOL comprising an L-type γ-glutamyl group. In some embodiments, the liposome comprises γ-PANTIFOL comprising a D-type γ-glutamyl group. In some embodiments, the liposome comprises γ-PANTIFOL comprising at least one L-type γ-glutamyl group and at least one D-type γ-glutamyl group. In some embodiments, the cancer is selected from lung cancer (e.g., non-small cell lung cancer), pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, bile duct cancer, gallbladder cancer, bladder cancer, sarcoma (e.g., osteosarcoma), brain cancer, central nervous system cancer, melanoma, and hematological tumors (e.g., leukemia or lymphoma).In some embodiments, the cancer is selected from breast cancer, advanced head and neck cancer, lung cancer, gastric cancer, osteosarcoma, non-Hodgkin's lymphoma (NHL), acute lymphocytic leukemia (ALL), mycosis fungoides (cutaneous T-cell lymphoma), choriocarcinoma, chorioadenoma, non-leukemic meningeal carcinomatosis, soft tissue sarcoma (demenoid tumor, aggressive fibromatosis), bladder cancer, and central nervous system (CNS) cancer. In some embodiments, the cancer is lung cancer (e.g., NSCLC or mesothelioma). In some embodiments, the cancer is breast cancer (e.g., HER2++ or triple-negative breast cancer). In some embodiments, the cancer is colorectal cancer. In some embodiments, the cancer cells are ovarian cancer. In some embodiments, the cancer is endometrial cancer. In some embodiments, the cancer is pancreatic cancer. In some embodiments, the cancer is liver cancer. In some embodiments, the cancer is head and neck cancer. In some embodiments, the cancer is osteosarcoma.

[0040] In some embodiments, the administered liposome composition comprises a PEGylated liposome (e.g., TPLp-γPANTIFOL). In some embodiments, the administered liposome composition comprises a non-PEGylated liposome. In some embodiments, the administered liposome comprises γPANTIFOL containing 4, 5, 2-10, 4-6, or more than 5 glutamyl groups. In some embodiments, the administered liposome comprises a gamma tetraglutamated antifolate. In some embodiments, the administered liposome comprises a gamma pentaglutamated antifolate. In other embodiments, the administered liposome comprises a gamma hexaglutamated antifolate. In some embodiments, the administered liposome comprises a polyglutamated antifolate described in any of items [1]-

[11] in the Summary of the Invention section. In some embodiments, the γ-pantifol is a polyglutamated antifolate as described in the Summary of the Invention section. In some embodiments, the liposome composition comprises a liposome as described in any of Items

[12] -

[67] in the Summary of the Invention section. In some embodiments, the liposome composition is administered to treat a cancer selected from lung cancer (e.g., non-small cell lung cancer), pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, bile duct cancer, gallbladder cancer, bladder cancer, sarcoma (e.g., osteosarcoma), brain cancer, central nervous system cancer, melanoma, myeloma and other plasma cell dysplasias or cachexia, and leukemia, lymphoma and other B-cell malignancies. In some embodiments, the liposome composition is administered to treat a cancer selected from breast cancer, advanced head and neck cancer, lung cancer, gastric cancer, osteosarcoma, non-Hodgkin's lymphoma (NHL), acute lymphocytic leukemia (ALL), mycosis fungoides (cutaneous T-cell lymphoma), choriocarcinoma, chorioadenoma, non-leukemic meningeal carcinomatosis, soft tissue sarcoma (demenoid tumor, aggressive fibromatosis), bladder cancer, and central nervous system (CNS) cancer. In some embodiments, the liposome composition is administered to treat lung cancer (e.g., NSCLC or mesothelioma).In some embodiments, the liposome composition is administered to treat breast cancer (e.g., HER2++ or triple-negative breast cancer). In some embodiments, the liposome composition is administered to treat colorectal cancer. In some embodiments, the liposome composition is administered to treat ovarian cancer. In some embodiments, the liposome composition is administered to treat endometrial cancer. In some embodiments, the liposome composition is administered to treat pancreatic cancer. In some embodiments, the liposome composition is administered to treat liver cancer. In some embodiments, the liposome composition is administered to treat head and neck cancer. In some embodiments, the liposome composition is administered to treat osteosarcoma.

[0041] In further embodiments, the present disclosure provides methods for treating cancer, the method comprising administering an effective amount of a liposome composition to a subject having or at risk of having a cancer that expresses a folate receptor on its cell surface, the liposome composition comprising (a) a gamma polyglutamated antifolate (γPANTIFOL) and (b) a liposome comprising a targeting moiety having specific binding affinity for the folate receptor. In some embodiments, the targeting moiety has specific binding affinity for folate receptor alpha (FR-α), folate receptor beta (FR-β), and / or folate receptor delta (FR-δ). In some embodiments, the targeting moiety has specific binding affinity for folate receptor alpha (FR-α) and folate receptor beta (FR-β). In some embodiments, the administered liposome composition comprises pegylated liposomes (e.g., TPLp-γPANTIFOL). In some embodiments, the administered liposome composition comprises non-pegylated liposomes. In some embodiments, the liposomes of the administered liposome composition comprise γ-PANTIFOL containing 4, 5, 2-10, 4-6, or more than 5 γ-glutamyl groups. In some embodiments, the liposomes of the administered liposome composition comprise a gamma-tetraglutamated antifolate. In some embodiments, the liposomes of the administered liposome composition comprise a gamma-pentaglutamated antifolate. In other embodiments, the liposomes of the administered liposome composition comprise a gamma-hexaglutamated antifolate. In some embodiments, the liposomes comprise a polyglutamated antifolate described in any of items [1]-

[11] in the Summary of the Invention section. In some embodiments, the γ-PANTIFOL is a polyglutamated antifolate described in the Summary of the Invention section. In some embodiments, the liposome composition comprises a liposome described in any of items

[12] -

[67] in the Summary of the Invention section.In some embodiments, the liposome compositions are administered to treat cancers selected from non-hematologic tumors, including, for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, bile duct cancer, gallbladder cancer, bladder cancer, sarcoma (e.g., osteosarcoma), brain cancer, central nervous system cancer, and melanoma; and hematologic tumors, such as, for example, leukemia, lymphoma and other B-cell malignancies, myeloma and other plasma cell dysplasias or cachexia. In some embodiments, the liposome composition is administered to treat a cancer selected from breast cancer, advanced head and neck cancer, lung cancer, gastric cancer, osteosarcoma, non-Hodgkin's lymphoma (NHL), acute lymphocytic leukemia (ALL), mycosis fungoides (cutaneous T-cell lymphoma), choriocarcinoma, chorioadenoma, non-leukemic meningeal carcinomatosis, soft tissue sarcoma (demenoid tumor, aggressive fibromatosis), bladder cancer, and central nervous system (CNS) cancer. In some embodiments, the liposome composition is administered to treat lung cancer (e.g., NSCLC or mesothelioma). In some embodiments, the liposome composition is administered to treat breast cancer (e.g., HER2++ or triple-negative breast cancer). In some embodiments, the liposome composition is administered to treat colorectal cancer. In some embodiments, the liposome composition is administered to treat ovarian cancer. In some embodiments, the liposome composition is administered to treat endometrial cancer. In some embodiments, the liposome composition is administered to treat pancreatic cancer. In some embodiments, the liposome composition is administered to treat liver cancer, in some embodiments, the liposome composition is administered to treat head and neck cancer, in some embodiments, the liposome composition is administered to treat osteosarcoma.

[0042] In further embodiments, the present disclosure provides a method for maintenance therapy of cancer, the method comprising administering an effective amount of a liposomal composition comprising a gamma polyglutamated antifolate (Lp-γPANTIFOL) to a subject undergoing or who has undergone cancer therapy. In some embodiments, the administered liposomal composition is PLp-γPANTIFOL, NTLp-γPANTIFOL, NTPLp-γPANTIFOL, TLp-γPANTIFOL, or TPLp-γPANTIFOL. In some embodiments, the liposomes of the administered liposomal composition comprise PEGylated liposomes (e.g., PLp-γPANTIFOL, NTPLp-γPANTIFOL, or TPLp-γPANTIFOL). In some embodiments, the administered liposomal composition comprises targeted liposomes (e.g., TLp-γPANTIFOL or TPLp-γPANTIFOL). In some embodiments, the administered liposome composition comprises a pegylated liposome comprising a targeting moiety (e.g., TPLp-γPANTIFOL). In some embodiments, the administered liposome comprises a gamma polyglutamated antifolate comprising 4, 5, 2-10, 4-6, or more than 5 gamma glutamyl groups. In some embodiments, the administered liposome comprises a gamma tetraglutamated antifolate. In some embodiments, the administered liposome comprises a gamma pentaglutamated antifolate. In some embodiments, the administered liposome comprises a gamma hexaglutamated antifolate. In some embodiments, the administered liposome comprises a liposome comprising a gamma polyglutamate as described in any of items [1]-

[11] in the Summary of the Invention section. In some embodiments, the γ-pantifol is a polyglutamated antifolate described in the Summary of the Invention. In some embodiments, the liposome composition comprises a liposome described in any of Items

[12] -

[67] in the Summary of the Invention.

[0043] In further embodiments, the present disclosure provides methods for treating an immune system disorder, the method comprising administering an effective amount of a liposome composition comprising a liposome comprising a gamma polyglutamated antifolate (e.g., Lp-γPANTIFOL, PLp-γPANTIFOL, NTLp-γPANTIFOL, NTPLp-γPANTIFOL, TLp-γPANTIFOL, or TPLp-γPANTIFOL) to a subject having or at risk of having an immune system disorder. In some embodiments, the liposome composition is administered to treat an autoimmune disease. In further embodiments, the liposome composition is administered to treat rheumatoid arthritis. In another embodiment, the liposome composition is administered to treat inflammation. In some embodiments, the immune system disorder is selected from inflammation (e.g., acute and chronic), systemic inflammation, rheumatoid arthritis, inflammatory bowel disease (IBD), Crohn's disease, dermatomyositis / polymyositis, systemic lupus erythematosus, Takayasu's disease, and psoriasis. In some embodiments, the administered liposome composition comprises a pegylated liposome (e.g., PLp-γPANTIFOL, NTPLp-γPANTIFOL, or TPLp-γPANTIFOL). In some embodiments, the administered liposome composition comprises a targeted liposome (e.g., TLp-γPANTIFOL or TPLp-γPANTIFOL) comprising a targeting moiety having specific affinity for a surface antigen on a target cell (e.g., an immune cell) of interest. In further embodiments, the administered liposome composition comprises a pegylated liposome (e.g., TPLp-γPANTIFOL) comprising a targeting moiety. In some embodiments, the administered liposome composition comprises a gamma-polyglutamated antifolate containing 4, 5, 2-10, 4-6, or more than 5 gamma-glutamyl groups. In some embodiments, the administered liposome comprises a gamma-tetraglutamated antifolate. In some embodiments, the liposomes of the administered liposome composition comprise a gamma-pentaglutamated antifolate, hi other embodiments, the liposomes of the administered liposome composition comprise a gamma-hexaglutamated antifolate.In some embodiments, the liposome composition comprises a liposome comprising a gamma polyglutamate as described in any one of Items [1]-

[11] in the Summary of the Invention. In some embodiments, γ-PANTIFOL is a polyglutamated antifolate as described in the Summary of the Invention. In some embodiments, the liposome composition comprises a liposome as described in any one of Items

[12] -

[67] in the Summary of the Invention.

[0044] In further embodiments, the present disclosure provides methods for treating an autoimmune disease, the method comprising administering an effective amount of a liposome composition comprising a liposome containing a gamma polyglutamated antifolate (e.g., Lp-γPANTIFOL, PLp-γPANTIFOL, NTLp-γPANTIFOL, NTPLp-γPANTIFOL, TLp-γPANTIFOL, or TPLp-γPANTIFOL) to a subject having or at risk of having an autoimmune disease. In some embodiments, the autoimmune disease is rheumatoid arthritis. In some embodiments, the autoimmune disease is a disease or disorder selected from inflammatory bowel disease (IBD), Crohn's disease, systemic lupus erythematosus, and psoriasis. In some embodiments, the autoimmune disease is a disease or disorder selected from the following: Addison's disease, alopecia areata, ankylosing spondylitis, autoimmune hepatitis, autoimmune parotitis, diabetes mellitus (Type 1), dystrophic epidermolysis bullosa, epididymitis, glomerulonephritis, Graves' disease, Guillain-Barré syndrome, Hashimoto's disease, hemolytic anemia, systemic lupus erythematosus, multiple sclerosis, myasthenia gravis, pemphigus vulgaris, psoriasis, rheumatic fever, rheumatoid arthritis, sarcoidosis, scleroderma, Sjögren's syndrome, spondyloarthropathy, thyroiditis, vasculitis, vitiligo, myxedema, pernicious anemia, and ulcerative colitis. In some embodiments, the administered liposome composition comprises PEGylated liposomes (e.g., PLp-γPANTIFOL, NTPLp-γPANTIFOL, or TPLp-γPANTIFOL). In some embodiments, the administered liposome composition comprises a targeted liposome (e.g., TLp-γPANTIFOL or TPLp-γPANTIFOL) comprising a targeting moiety with specific affinity for a surface antigen on a target cell (e.g., an immune cell) of interest. In further embodiments, the administered liposome composition comprises a liposome (e.g., TPLp-γPANTIFOL) that is pegylated and comprises a targeting moiety. In some embodiments, the administered liposomes of the liposome composition comprise a gamma polyglutamated antifolate containing 4, 5, 2-10, 4-6, or more than 5 glutamyl groups. In some embodiments, the administered liposomes of the liposome composition comprise a gamma tetraglutamated antifolate.In some embodiments, the liposomes of the administered liposome composition comprise a gamma-pentaglutamated antifolate. In other embodiments, the liposomes of the administered liposome composition comprise a gamma-hexaglutamated antifolate. In some embodiments, the liposomes comprise a polyglutamated antifolate described in any of items [1]-

[11] in the Summary of the Invention section. In some embodiments, γ-pantifol is a polyglutamated antifolate described in the Summary of the Invention section. In some embodiments, the liposome composition comprises a liposome described in any of items

[12] -

[67] in the Summary of the Invention section.

[0045] In further embodiments, the present disclosure provides methods of treating an inflammatory disease, the method comprising administering an effective amount of a liposome composition comprising a liposome containing a gamma polyglutamated antifolate (e.g., Lp-γPANTIFOL, PLp-γPANTIFOL, NTLp-γPANTIFOL, NTPLp-γPANTIFOL, TLp-γPANTIFOL, or TPLp-γPANTIFOL) to a subject having or at risk of having an inflammatory disease. In some embodiments, the inflammatory disease is a disease selected from acute inflammation, chronic inflammation, systemic inflammation, rheumatoid arthritis, inflammatory bowel disease (IBD), Crohn's disease, dermatomyositis / polymyositis, and systemic lupus erythematosus. In some embodiments, the inflammatory disease is selected from rheumatoid or other arthritic diseases (e.g., acute arthritis, acute gouty arthritis, bacterial arthritis, chronic inflammatory arthritis, osteoarthritis (degenerative arthritis), infectious arthritis, juvenile arthritis, fungal arthritis, neuropathic arthritis, polyarthritis, proliferative arthritis, psoriatic arthritis, venereal arthritis, viral arthritis), connective tissue inflammation, pelvic inflammatory disease, acne, psoriasis, actinomycosis, dysentery, biliary cirrhosis, Lyme disease, heat rash, Stevens-Johnson syndrome, mumps, pemphigus vulgaris, and blastomycosis. In some embodiments, the inflammatory disease is inflammatory bowel disease. Inflammatory bowel disease is a chronic inflammatory disease of the gastrointestinal tract, including, but not limited to, Crohn's disease, ulcerative colitis, and indeterminate colitis. In some embodiments, the administered liposome composition comprises a pegylated liposome (e.g., PLp-γPANTIFOL, NTPLp-γPANTIFOL, or TPLp-γPANTIFOL). In some embodiments, the administered liposome composition comprises a targeted liposome (e.g., TLp-γPANTIFOL or TPLp-γPANTIFOL) comprising a targeting moiety that has specific affinity for a surface antigen on a target cell (e.g., an immune cell) of interest. In further embodiments, the administered liposome composition comprises a pegylated liposome (e.g., TPLp-γPANTIFOL) comprising a targeting moiety.In some embodiments, the liposomes of the administered liposome composition comprise a gamma-pentaglutamated antifolate containing 4, 5, 2-10, 4-6, or more than 5 glutamyl groups. In some embodiments, the liposomes of the administered liposome composition comprise a gamma-tetraglutamated antifolate. In some embodiments, the liposomes of the administered liposome composition comprise a gamma-pentaglutamated antifolate. In other embodiments, the liposomes of the administered liposome composition comprise a gamma-hexaglutamated antifolate. In some embodiments, the liposomes comprise a polyglutamated antifolate described in any of items [1]-

[11] in the Summary of the Invention section. In some embodiments, γ-PANTIFOL is a polyglutamated antifolate described in the Summary of the Invention section. In some embodiments, the liposome composition comprises a liposome described in any of items

[12] -

[67] in the Summary of the Invention section.

[0046] The present disclosure also provides a method for delivering a gamma polyglutamated antifolate to a site of inflammation in a subject, the method comprising administering to a subject with inflammation a composition comprising a gamma polyglutamated antifolate (L-γPANTIFOL) and a targeting moiety having specific binding affinity for an epitope on a surface antigen of a cell at the site of inflammation or that otherwise affects the inflammation (e.g., via pro-inflammatory cytokine production). In some embodiments, the administered targeting moiety is conjugated to a delivery vehicle. In some embodiments, the delivery vehicle is an antibody or an antigen-binding fragment of an antibody. In further embodiments, the delivery vehicle is a liposome. In further embodiments, the antibody, antigen-binding antibody fragment, or liposome is a pegylated liposome (e.g., TPLp-γPANTIFOL). In some embodiments, the administered composition comprises a gamma polyglutamated antifolate containing 4, 5, 2-10, 4-6, or more than 5 glutamyl groups. In some embodiments, the administered composition comprises a gamma tetraglutamated antifolate. In some embodiments, the administered composition comprises a gamma pentaglutamated antifolate. In other embodiments, the administered composition comprises a gamma hexaglutamated antifolate. In some embodiments, the γ-pantifol is a polyglutamated antifolate described in any of items [1]-

[11] in the Summary of the Invention section. In some embodiments, the γ-pantifol is a polyglutamated antifolate described in the Summary of the Invention section. In some embodiments, the delivery vehicle is a liposome described in any of items

[12] -

[67] in the Summary of the Invention section.

[0047] The present disclosure also provides methods for delivering a gamma polyglutamated antifolate to tumor and / or cancer cells, the methods comprising administering to a subject having a tumor a composition comprising a gamma polyglutamated antifolate (L-γPANTIFOL) and a targeting moiety having specific binding affinity for an epitope on a surface antigen of a tumor or cancer cell. In some embodiments, the administered targeting moiety is conjugated to a delivery vehicle. In some embodiments, the delivery vehicle is an antibody or an antigen-binding fragment of an antibody. In further embodiments, the delivery vehicle is a liposome. In further embodiments, the antibody, antigen-binding antibody fragment, or liposome is a pegylated liposome (e.g., TPLp-γPANTIFOL). In some embodiments, the administered composition comprises a gamma polyglutamated antifolate containing 4, 5, 2 to 10, 4 to 6, or more than 5 glutamyl groups. In some embodiments, the administered composition comprises a gamma tetraglutamated antifolate. In some embodiments, the administered composition comprises a gamma-pentaglutamated antifolate. In other embodiments, the administered composition comprises a gamma-hexaglutamated antifolate. In some embodiments, the administered composition is an antifolate described in any of items [1]-

[11] in the Summary of the Invention section. In some embodiments, γ-PANTIFOL is a polyglutamated antifolate described in the Summary of the Invention section. In some embodiments, the administered composition comprises a liposome described in any of items

[12] -

[67] in the Summary of the Invention section.

[0048] In further embodiments, the present disclosure provides methods for making liposomal compositions containing liposomal gamma polyglutamated antifolate (γ-PANTIFOL) compositions, the methods comprising: forming a mixture in solution containing liposome components and a γ-polyglutamated antifolate; homogenizing the mixture in solution to form liposomes; and treating the mixture to form liposomes containing the polyglutamated antifolate. In some embodiments, the γ-polyglutamated antifolate contains 4, 5, 2-10, 4-6, or more than 5 γ-glutamyl groups. In some embodiments, the γ-PANTIFOL contains a γ-tetraglutamated antifolate. In some embodiments, the γ-PANTIFOL contains a γ-pentaglutamated antifolate. In other embodiments, the γ-PANTIFOL contains a γ-hexaglutamated antifolate. In some embodiments, the γ-pantifol is a polyglutamated antifolate described in any one of items [1]-

[11] in the Summary of the Invention section. In some embodiments, the γ-pantifol is a polyglutamated antifolate described in any one of items

[12] -

[67] in the Summary of the Invention section. In some embodiments, the liposome composition comprises a liposome described in any one of items

[12] -

[67] in the Summary of the Invention section.

[0049] In one embodiment, the present disclosure provides a kit comprising an antifolate gamma polyglutamate composition and / or a γPANTIFOL delivery vehicle, such as a liposome, comprising γPANTIFOL and a γPANTIFOL immune complex (e.g., ADC) described herein. [Brief explanation of the drawings]

[0050] [Figures 1A-1N]The chemical formulas of the antifolate drug pemetrexed (Figure 1A), as well as the representative gamma-pemetrexed polyglutamate, gamma-pemetrexed diglutamate (Figure 1B), gamma-pemetrexed triglutamate (Figures 1C and 1D), gamma-pemetrexed tetraglutamate (Figures 1E and 1F), gamma-pemetrexed pentaglutamate (Figures 1G and 1H), gamma-pemetrexed hexaglutamate (Figures 1I and 1J), gamma-pemetrexed heptaglutamate (Figures 1K and 1L), and gamma-pemetrexed octaglutamate (Figures 1M and 1N) are shown. [Figure 2] Figure 1 shows the relative efficacy of liposomal pemetrexed gamma-L hexaglutamate (liposomal aG6) and its enantiomer liposomal gamma-D hexaglutamate (liposomal aDG6) compared to pemetrexed after 48 hours of exposure to the cancer cell lines SW620 (CRC), HT-29 (colon cancer), H1806 (triple-negative breast cancer), OAW28 (ovarian cancer), H292 (NSCLC, adenocarcinoma subtype), and H2342 (NSCLC, adenocarcinoma subtype). [Figure 3] FIG. 1 shows an example of the dose-response relationship of free pemetrexed L-gamma hexaglutamate (gG6), liposomal pemetrexed L-gamma hexaglutamate (liposomal gG6), pemetrexed, and folate receptor alpha-targeting antibody (FR1Ab) liposomal pemetrexed L-gamma hexaglutamate (liposomal gG6-FR1Ab) in HT-29 (colon cancer) at 48 hours. [Figure 4] Figure 1 shows the effects of free pemetrexed L-gamma hexaglutamate (Hexa-gG6) and liposomal pemetrexed L-gamma hexaglutamate (Liposomal Hexa-gG6) on the growth of colon cancer SW260 cells after 48 hours of exposure to 256 nM of the corresponding drug. Both non-targeted and targeted liposomal pemetrexed hexa-gG6 can enter cells more efficiently than free pemetrexed hexa-gG6 to inhibit the proliferation of colon cancer SW260 cells. [Figure 5]Figure 1 shows the relative efficacy of liposomal pemetrexed L-gamma hexaglutamate (liposomal gG6) and its enantiomer liposomal pemetrexed gamma-D hexaglutamate (liposomal gDG6) compared to pemetrexed after 48 hours of exposure to the cancer cell lines SW620 (CRC), HT-29 (colon cancer), H1806 (triple-negative breast cancer), OAW28 (ovarian cancer), H292 (NSCLC, adenocarcinoma subtype), and H2342 (NSCLC, adenocarcinoma subtype). [Figure 6] 1 shows the therapeutic effect on HCC1806 triple-negative breast cancer cells after 48 hours of exposure to liposomal pemetrexed gamma-L hexaglutamate (Lps Hexa gG6), liposomal pemetrexed gamma-D hexaglutamate (Lps Hexa gDG6), and pemetrexed. [Figure 7] 1 shows the therapeutic effect on OAW28 ovarian cancer cells after exposure to liposomal pemetrexed gamma-L hexaglutamate (Lps Hexa gG6), liposomal pemetrexed gamma-D hexaglutamate (Lps Hexa gDG6) compared to pemetrexed over a 48 hour period. [Figure 8] 1 shows the therapeutic effect on H292 non-small cell lung cancer cells after 48 hours of exposure to liposomal pemetrexed gamma-L hexaglutamate (Lps Hexa gG6), liposomal pemetrexed gamma-D hexaglutamate (Lps Hexa gDG6), and pemetrexed. [Figure 9] This figure shows the therapeutic effects of liposomal pemetrexed gamma-L hexaglutamate (liposomal gG6), liposomal pemetrexed gamma-D hexaglutamate (liposomal gDG6), and pemetrexed at various dose levels ranging from 16 to 128 nM on H292 non-small cell lung cancer cells after 48 hours of exposure. Within each tested dose range, the liposomal pemetrexed gG6 formulation exhibited superior inhibition of H292 non-small cell lung cancer cells compared to pemetrexed. [Figure 10]This figure shows the therapeutic efficacy of liposomal pemetrexed gamma-L hexaglutamate (liposomal gG6), liposomal pemetrexed gamma-D hexaglutamate (liposomal gDG6), and pemetrexed at various dose levels ranging from 16 to 128 nM against HCC1806 triple-negative breast cancer cells after 48 hours of exposure. Within each tested dose range, the liposomal pemetrexed gG6 formulation was superior to pemetrexed in inhibiting HCC1806 triple-negative breast cancer cells. [Figure 11] Figure 1 shows the therapeutic effects of liposomal pemetrexed gamma-L hexaglutamate (liposomal gG6), liposomal gamma-D hexaglutamate (liposomal gDG6), and pemetrexed at a range of concentrations on OAW28 ovarian cancer cells after 48 hours of exposure. At a dose of 128 nM, pemetrexed appears to be more effective than the liposomal pemetrexed gG6 liposomal formulation, but at doses of 32 nM and 64 nM, the liposomal formulation has superior therapeutic effects to pemetrexed. At 16 nM, the therapeutic effect of liposomal pemetrexed gG6 is similar to that of pemetrexed. [Figure 12] Figure 1 shows the toxicity of liposomal pemetrexed gamma-L hexaglutamate (liposomal gG6), liposomal pemetrexed gamma-D hexaglutamate (liposomal gDG6), and pemetrexed at 64 nM, 128 nM, and 264 nM toward differentiated human neutrophils. The figure shows that liposomal pemetrexed gG6 is significantly less toxic than pemetrexed toward differentiated human neutrophils. [Figure 13] Shown are the effects of liposomal pemetrexed gamma-L hexaglutamate (liposomal gG6), liposomal gamma-D hexaglutamate (liposomal gDG6), and the corresponding pemetrexed agents at various dose levels ranging from 16 to 128 nM on neutrophils (differentiated from CD34+ cells) after 48 hours of exposure. [Figure 14]This figure shows the effects of liposomal pemetrexed gamma-L hexaglutamate (liposomal gG6), liposomal pemetrexed gamma-D hexaglutamate (liposomal gDG6), and pemetrexed at 16 nM, 32 nM, 64 nM, and 128 nM of the corresponding drug on AML12 liver cells after 48 hours of exposure. Remarkably, none of the liposomal drug tested at the dose levels appeared to be toxic to AML12 liver cells after treatment with liposomal pemetrexed gG6. In contrast, pemetrexed treatment resulted in a reduction in AML12 liver cell counts by approximately 40% at all doses examined. [Figure 15]

[0023] Figure 1 shows the effects of liposomal pemetrexed gamma-L hexaglutamate (liposomal gG6), liposomal pemetrexed gamma-D hexaglutamate (liposomal gDG6), and pemetrexed at 16 nM, 32 nM, 64 nM, and 128 nM of the corresponding drug on CCD841 colonic epithelial cells after 48 hours of exposure. At all concentrations tested, pemetrexed results in a reduction of CCD841 colonic epithelial cell counts of about 50% or more, compared to a reduction of about 20% or less after treatment with each of the liposomal compositions tested. [Figure 16] The structures of the polyglutamate antifolate, cisplatin (CDDP), and two possible gG6-cisplatin complexes are shown. The pH-dependent formation of inter- and / or intra-chain coordination between the carboxyl groups of the polyglutamate antifolate and cisplatin may lead to its degradation into separate molecules of gG6 and cisplatin upon encountering the acidic pH of the lysosome (pH 3-5) and in the presence of intracellular chloride ions. [Figure 17] Hematological parameters: Effect of liposomal aG6 treatment in mice at 40 mg / kg and 80 mg / kg once weekly for 4 weeks on white blood cell (WBC) count, neutrophil count, and platelet count. No significant decrease in mean neutrophil, mean white blood cell, or mean platelet count was observed. [Figure 18]This figure shows the effect of liposomal aG6 treatment in mice at 40 mg / kg and 80 mg / kg weekly doses for 4 weeks on hemoglobin and reticulocyte count indices. There is a minimal decrease in mean hemoglobin concentration at higher dose levels. Concomitantly, there is a slight increase in mean reticulocyte count indices. [Figure 19] The effects of liposomal aG6 treatment in mice at 40 mg / kg and 80 mg / kg once weekly for 4 weeks on liver markers, including serum aspartate aminotransferase (AST) and serum alanine aminotransferase (ALT), in addition to serum albumin, are shown. No apparent increase in liver aminotransferase mean AST or ALT levels was observed, and furthermore, no changes in mean albumin levels were observed. [Figure 20] Relative tumor volumes in immunocompromised female Nu / J mice (6-8 weeks old) inoculated with NCI-H292 (non-small cell lung cancer) cells and treated intravenously with control, pemetrexed, or liposomal aG6 at 167 mg / kg once every three weeks are shown. These preliminary data show that liposomal aG6 results in reduced tumor control compared to pemetrexed. [Figure 21A-F]Liposomal pemetrexed alpha-L triglutamate () for 48 hours against H2342 (NSCLC, adenocarcinoma subtype) (Figure 21A), H292 (NSCLC, adenocarcinoma subtype) (Figure 21B), HT-29 (colon cancer) (Figure 21C), HCC1806 (triple-negative breast cancer) (Figure 21D), MCF7 (ER+ breast cancer) (Figure 21E), and OAW28 (ovarian cancer) (Figure 21F). Figure 1 shows the dose-response relationship for liposomal pemetrexed alpha-L pentaglutamate (liposome aG3), liposomal pemetrexed alpha-L octaglutamate (liposome aG7), and the combination of liposomal pemetrexed alpha-L hexaglutamate (liposome aG6) and alpha-L dodecaglutamate (liposome aG12) (liposome aG6 and aG12). Cell viability was measured using the CellTiter-Glo® (CTG) luminescent cell viability assay, essentially as described in Example 1. As shown in all cell lines, the potency of each polyglutamated pemetrexed liposome composition significantly exceeded that of the liposome carrier and empty liposome control. DETAILED DESCRIPTION OF THE INVENTION

[0051] Generally, the present disclosure relates to gamma polyglutamated antifolate compositions. The compositions offer an advancement over existing treatments for hyperproliferative diseases, such as cancer. Methods for producing, delivering, and using the gamma polyglutamated antifolate compositions are also provided. The gamma polyglutamated compositions have uses including, but not limited to, the treatment or prevention of hyperproliferative diseases, such as cancer, disorders of the immune system, including inflammation, and autoimmune diseases, such as rheumatoid arthritis, and infectious diseases, such as HIV, malaria, and schistosomiasis.

[0052] definition Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0053] Whenever an embodiment is described herein with the term "comprising," other similar embodiments are also provided that are described with the terms "containing," "consisting of," and / or "consisting essentially of." However, when used as transitional phrases in the claims, each should be construed separately and in the appropriate legal and factual context (e.g., in the claims, the transitional phrase "comprising" is considered to be more open-ended, "consisting of" is considered more exclusive, and "consisting essentially of" is considered intermediate).

[0054] As used herein, the singular forms "a," "an," and "the" include plural references unless otherwise stated or unless it is clearly clear from the context that plural reference is not intended.

[0055] The term "and / or" as used in phrases such as "A and / or B" is intended herein to include both A and B; A or B; A alone; and B alone. Similarly, the term "and / or" as used in phrases such as "A, B and / or C" encompasses each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A alone; B alone; and C alone.

[0056] Headings and subheadings are used for convenience and / or to comply with official rules only, and are not intended to limit the subject technology, nor are they to be cited in connection with the interpretation of the description of the subject technology. Features described under one heading or one subheading of the subject disclosure may, in various embodiments, be combined with features described under other headings or subheadings. Furthermore, not all features under a single heading or subheading may necessarily be used together in some embodiments.

[0057] Unless otherwise indicated, the terms "antifolate" and "ANTIFOL" are used interchangeably and include salt, acid and / or free base forms of antifolates (e.g., antifolate disodium). Compositions containing ANTIFOL salts may also contain various cations, e.g., Na + , Mg 2+ , K. + , N.H. 4+ , and / or Ca 2+ In certain embodiments, the salt is a pharmaceutically acceptable salt. Antifolates contain one L-gamma glutamyl group and are therefore considered monoglutamated for purposes of this disclosure.

[0058] Although the compounds of the present invention can exist as a mixture of stereoisomers, they are preferably resolved into a single optically active isomeric form. Such a requirement complicates the synthesis of the compounds, and therefore they preferably contain as few asymmetric carbon atoms as possible consistent with achieving the desired activity.

[0059] However, as previously indicated, the cyclopenta[g]quinazolines of the present invention contain at least three asymmetric carbon atoms. Of these, it is preferred that the asymmetric carbon atom at position 6 of the ring system has a 6S orientation rather than a 6R orientation. The preferred compounds (I) hereinabove are therefore those having such an arrangement at the asymmetric carbon atoms, and less preferred are mixtures in which one or both of these asymmetric carbon atoms are not resolved.

[0060] The antifolate may be any known or future-derived folate or polyglutamated antifolate. In some embodiments, the antifolate is LV (etoposide), L-leucovorin (L-5-formyltetrahydrofolic acid); 5-CH3-THF, 5-methyltetrahydrofolic acid; FA, folic acid; PteGlu, pteroylglutamate (FA); MTX, methotrexate; 2-dMTX, 2-desamino-MTX; 2-CH3-MTX, 2-desamino-2-methyl-MTX; AMT, aminopterin; 2-dAMT, 2-desamino-AMT; 2-CH3-AMT, 2-desamino-2-methyl-AMT; 10-EdAM, 10-ethyl-10-deazaaminopterin; PT523, N alpha-(4-amino-4-deoxypteroyl)-N Delta-(hemiphthaloyl)-L-ornithine; DDATHF (lometrexol), 5,10-dideaza-5,6,7,8-tetrahydrofolic acid; 5-d(i)H4PteGlu, 5-deaza-5,6,7,8-tetrahydroisofolic acid; N9-CH3-5-d(i)H4PteGlu, N9-methyl-5-deaza-5,6,7,8-tetrahydroisofolic acid; 5-dPteHCysA, N alpha-(5-deazapteroyl)-L-homocysteic acid; 5-dPteAPBA, N alpha-(5-deazapteroyl)-DL-2-amino-4-phosphonobutyric acid; 5-dPteOrn, N alpha-(5-deazapteroyl)-L-ornithine; 5-dH4PteHCysA, N Alpha-(5-deaza-5,6,7,8-tetrahydropteroyl)-L-homocysteic acid; 5-dH4PteAPBA, N Alpha-(5-deaza-5,6,7,8-tetrahydropteroyl)-DL-2-amino-4-phosphobutanoic acid; 5-dH4PteOro, N Alpha-(5-dideaza-5,6,7,8-tetrahydropteroyl)-L-ornithine; CB3717, N10-propargyl-5,8-dideazafolate; ICI-198,583, 2-desamino-2-methyl-N10-propargyl-5,8-dideazafolate; 4-H-ICI-198,583, 4-deoxy-ICI-198,583; 4-OCH3-ICI-198,583, 4-methoxy-ICI-198,583 Glu-to-Val-ICI-198,583;Valine-ICI-198;583; Glu-to-Sub-ICI-198,583, 2-aminosuberic acid-ICI-198,583; 7-CH3-ICI-198,583, 7-methyl-ICI-198,583; ZD1694, N-[5(N-(3,4-dihydro-2-methyl-4-oxoquinazolin-6-yl-methyl)amino)2-thienyl)]-L-glutamic acid ;2-NH2-ZD1694, 2-amino-ZD1694; BW1843U89, (S)-2[5-(((1,2-dihydro-3-methyl-1-oxobenzo(f)quinazolin-9-yl)methyl)amino-)-1-oxo-2-isoindolinyl]-glutaric acid; LY231514, N-(4-(2-(2-amino-4,7-dihydro-4-oxo-3H-pyrrolo[2,3-D ]pyrimidin-5-yl)ethyl)-benzoyl]-L-glutamic acid; IAHQ, 5,8-dideazaisofolic acid; 2-dIAHQ, 2-desamino-IAHQ; 2-CH3-dIAHQ, 2-desamino-2-methyl-IAHQ; 5-d(i)PteGlu, 5-deazaisofolic acid; N9-CH3-5-d(i)PteGlu, N9-methyl-5-deazaisofolic acid; N9-CHO- 5-d(i)PteGlu, N9-formyl-5-deazaisofolic acid; AG337, 3,4-dihydro-2-amino-6-methyl-4-oxo-5-(4-pyridylthio)quanazoline; and AG377, 2,4-diamino-6[N-(4-(phenysulfonyl)benzyl)ethyl)amino]quinazoline; or a stereoisomer thereof, or a stereoisomer thereof.

[0061] In some embodiments, the antifolate is a member selected from the following: aminopterin, methotrexate, raltitrexed (TOMUDEX®, also known as ZD1694 (RTX)), previtrexed (BGC9331; also known as ZD9331), pemetrexed (ALIMTA, also known as LY231514), lometrexol (LTX) (5,10-dideazatetrahydrofolic acid), cyclopenta[g]quinazolines with dipeptide ligands, CB3717, CB300945 (also known as BGC945), or stereoisomers thereof such as 6-R,S-BGC945 (ONX-0801), CB300638 (also known as BGC638), and BW1843U89.

[0062] The terms "polyglutamated antifolate," "polyglutamated ANTIFOL," "ANTIFOL-PG," and "PANTIFOL" are used interchangeably herein to refer to antifolate compositions containing at least one glutamyl group in addition to those in the antifolate (i.e., ANTIFOL-PGn, n≧1). References to the number of glutamyl groups in γPANTIFOL (ANTIFOL-PG) herein count the glutamyl groups in the antifolate. For example, an ANTIFOL-PG composition containing five glutamyl residues in addition to those in ANTIFOL is referred to herein as a hexaglutamated antifolate or antifolate hexaglutamate. The polyglutamate chain contains an N-terminal glutamyl group and one or more C-terminal glutamyl groups. The N-terminal glutamyl group of a polyglutamate chain is not bound to another glutamyl group through its amino group, but is bound to one or more glutamyl groups through its carboxylic acid group. In some embodiments, the N-terminal glutamyl group of a polyglutamated antifolate is the glutamyl group of an antifolate. The C-terminal glutamyl group(s) of a polyglutamate chain is / are bound to another glutamyl group through their amino group, but is / are not bound to another glutamyl group through their carboxylic acid group.

[0063] The terms "alpha glutamyl group," "alpha glutamate," "alpha linkage," and iterations thereof, when referring to the linkage of a glutamyl group, refer to a glutamyl group that includes an alpha carboxylic group linkage. In some embodiments, none of the glutamyl groups of the provided polyglutamated antifolates includes an alpha linkage.

[0064] The terms "gamma glutamyl group," "gamma glutamate," and "gamma linkage," when referring to a glutamyl group bond, refer to a glutamyl group containing a gamma carboxyl group bond. In some embodiments, the gamma linkage is an amide bond between the gamma carboxyl group of one glutamyl group and a second glutamyl group. The gamma linkage can be between a glutamyl group and a glutamyl group in an antifolate, or between a glutamyl group and a second glutamyl group not present in the antifolate, such as a glutamyl group in a polyglutamate chain attached to the antifolate. In some embodiments, the gamma linkage refers to the amide bond of the glutamyl group of the antifolate. Reference to a gamma linkage includes the gamma linkage of the glutamyl group of the antifolate, unless otherwise specified or clearly apparent from the context. In some embodiments, the gamma glutamyl group is in the L-form. In some embodiments, the gamma glutamyl group is D-type. As discussed herein, during antifolate therapy, the antifolate enters cells and is polyglutamated by the enzyme folylpoly-gamma-glutamate synthase (FPGS), which tandemly adds L-glutamyl groups to the gamma carboxyl groups of glutamic acid within the L-glutamyl group of the antifolate. As a result, D-gamma polyglutamated antifolate compositions are not formed intracellularly during antifolate therapy.

[0065] The terms "gamma polyglutamated antifolate," "gamma polyglutamated antifolate," "γPANTIFOL," "gamma polyglutamated antifolate," "polyglutamated antifolate," "γANTIFOL-PG," and repeats thereof are used interchangeably herein and refer to antifolate compositions that contain at least one gamma glutamyl group with a gamma carboxyl group linkage in addition to the gamma glutamyl groups in the antifolate (e.g., ANTIFOL-PG). n (where n≧1 gamma glutamyl group). References herein to the number of glutamyl groups in gamma PANTIFOL (γANTIFOL-PG) count the gamma glutamyl groups of the antifolate. For example, a gamma ANTIFOL-PG composition containing five gamma glutamyl groups in addition to the glutamyl groups of the antifolate may be referred to herein as a gamma hexaglutamated antifolate or a gamma antifolate hexaglutamate.

[0066] The terms "alpha glutamyl group," "α glutamyl group," and "alpha linkage," when referring to a glutamyl group linkage, refer to a glutamyl group that includes an alpha carboxyl group linkage.

[0067] As used herein, the term "isolated" refers to a composition in a form not found in nature. Isolated gamma polyglutamated compositions include those that have been purified to the extent that they are no longer in the form found in nature. In some embodiments, isolated gamma polyglutamated antifolates are substantially pure. Isolated compositions are free or substantially free of naturally incorporated substances, such as proteins and other cellular components, such as nucleic acids, that may potentially be found in nature or in the environment in which they are produced (e.g., cell culture). Gamma polyglutamated compositions can be formulated with a diluent or adjuvant and further isolated for practical purposes—for example, when used as a diagnostic or therapeutic agent, gamma polyglutamated compositions are typically mixed with a pharmaceutically acceptable carrier or diluent. In some embodiments, isolated gamma polyglutamated compositions (e.g., gamma polyglutamates and delivery vehicles such as liposomes comprising gamma polyglutamates) contain less than 1% or less than 0.1% undesired DNA or protein content. In some embodiments, gamma polyglutamate compositions (e.g., gamma polyglutamates and delivery vehicles such as liposomes comprising gamma polyglutamates) are "isolated."

[0068] As used herein, the term "targeting moiety" refers to a molecule that confers enhanced affinity to a selected target, e.g., a cell, cell type, tissue, organ, body region, or compartment, e.g., a cell, tissue, or organ compartment. Targeting moieties can include a wide variety of entities. Targeting moieties include natural molecules, or recombinant or synthetic molecules. In some embodiments, the targeting moiety is an antibody, antigen-binding antibody fragment, bispecific antibody, or other antibody-based molecule or compound. In some embodiments, the targeting moiety is an aptamer, avimer, receptor-binding ligand, nucleic acid, biotin-avidin binding pair, peptide, protein, carbohydrate, lipid, vitamin, toxin, microbial component, hormone, receptor ligand, or any derivative thereof. Other targeting moieties are known in the art and are encompassed by the present disclosure.

[0069] The terms "specific affinity" or "specifically bind" mean that a targeting moiety, such as an antibody or antigen-binding antibody fragment, reacts with or binds to an epitope, protein, or target molecule more frequently, more rapidly, for a longer period of time, with greater affinity, or some combination thereof, than to another substance, including a protein unrelated to the target epitope. Due to sequence identity between homologous proteins in different species, a particular affinity, in some embodiments, includes binding substances that recognize proteins or targets in more than one species. Similarly, due to homology within a particular region of the polypeptide sequence of different proteins, the terms "specific affinity" or "specific binding" can include binding substances that recognize more than one protein or target. In certain embodiments, it is understood that a targeting moiety that specifically binds to a first target may or may not specifically bind to a second target. Thus, "specific affinity" does not necessarily require exclusive binding, e.g., binding to only one target (although it can include such binding). Thus, a targeting moiety may, in certain embodiments, specifically bind to more than one target. In certain embodiments, multiple targets may be bound by the same targeting moiety.

[0070] The term "epitope" refers to a portion of an antigen that can be recognized and specifically bound by a targeting moiety (i.e., binding moiety) such as an antibody. When the antigen is a polypeptide, epitopes can be formed from both contiguous and non-contiguous amino acids juxtaposed by tertiary folding of the protein. Epitopes formed from contiguous amino acids are typically retained upon protein denaturation, whereas epitopes formed by tertiary folding are typically lost upon protein denaturation. An epitope typically comprises at least three amino acids, more commonly at least five or eight to ten amino acids, in a unique spatial conformation.

[0071] Expressions known in the art, such as "binding affinity to target", "binding to target" and similar expressions, refer to the affinity constant, a property of targeting moiety that can be directly measured by determining, for example, the amount of binding and dissociation of targeting moiety at a given antigen concentration.Other methods can be used to characterize intermolecular interactions, including but not limited to, competitive analysis, equilibrium analysis and microcalorimetry, and real-time interaction analysis based on surface plasmon resonance interaction (for example, using BIACORE® device).These methods are well known to those skilled in the art and are described, for example, in Neri et al., Tibtech 14:465-470 (1996), and Jansson et al., J.Biol.Chem.272:8189-8197 (1997).

[0072] The term "delivery vehicle" generally refers to any composition that acts to support, promote, or facilitate the entry of gamma polyglutamated antifolates into cells. Such delivery vehicles are known in the art and include, but are not limited to, liposomes, lipospheres, polymers (e.g., polymer conjugates), peptides, proteins such as antibodies (e.g., immunoconjugates such as antibody-drug conjugates (ADCs) and antigen-binding antibody fragments and their derivatives), cellular components, cyclic oligosaccharides (e.g., cyclodextrins), micelles, microparticles (e.g., microspheres), nanoparticles (e.g., lipid nanoparticles, biodegradable nanoparticles, and core-shell nanoparticles), hydrogels, lipoprotein particles, viral sequences, viral agents, or lipid or liposomal formulations, and combinations thereof. The delivery vehicle can be directly or indirectly conjugated to a targeting moiety. In some examples, the targeting moiety is selected from a macromolecule, a protein, a peptide, a monoclonal antibody, or a fatty acid lipid.

[0073] "Subject" means a human or vertebrate mammal, including, but not limited to, a dog, a cat, a horse, a goat, and a primate, such as a monkey. Thus, the present invention can also be used to treat a disease or condition in a non-human subject. For example, cancer is one of the leading causes of death in companion animals (e.g., cats and dogs). In some embodiments of the present invention, the subject is a human. In this disclosure, the terms "subject" and "patient" are used interchangeably and have the same meaning. Generally, it is preferred to use a maximum dose, i.e., the maximum safe dose according to sound medical judgment.

[0074] As used herein, "effective amount" refers to the administration of a drug sufficient to produce a medically desired result. An effective amount may vary depending on the desired outcome, the specific condition being treated or prevented, the age and health of the subject being treated, the severity of the condition, the duration of treatment, the nature of concurrent or concomitant therapy (if any), the specific route of administration, and similar factors within the knowledge and professional opinion of a health practitioner. An "effective amount" may be determined empirically and routinely in connection with the stated purpose. In the case of cancer, an effective amount of a drug may reduce the number of cancer cells; reduce tumor size; inhibit (i.e., slow to some extent, and preferably stop) the infiltration of cancer cells into surrounding organs; inhibit (i.e., slow to some extent, and preferably stop) tumor metastasis; inhibit tumor growth to some extent; and / or alleviate to some extent one or more symptoms associated with the disorder. Depending on the extent to which a drug may prevent and / or kill existing cancer cells, the drug may be cytostatic and / or cytotoxic. For cancer therapy, in vivo efficacy can be measured, for example, by assessing survival time, progression-free survival (PFS), response rate (RR), duration of response, and / or quality of life.

[0075] The terms "hyperproliferative disorder," "proliferative disease," and "proliferative disorder" are used interchangeably herein and refer to unwanted or uncontrolled cell proliferation of unwanted, excessive, or abnormal cells, such as neoplastic or hyperplastic growth, whether in vitro or in vivo. In some embodiments, the proliferative disorder is a cancer or tumor disease (including benign or cancerous) and / or any tumor metastasis, regardless of the location of the cancer, tumor, and / or tumor metastasis. In some embodiments, the proliferative disorder is a benign or malignant tumor. In some embodiments, the proliferative disorder is a non-cancerous disease. In some embodiments, the proliferative disorder is a hyperproliferative condition such as hyperplasia, fibrosis (particularly pulmonary, but also other types of fibrosis, such as renal fibrosis), angiogenesis, psoriasis, smooth muscle proliferation in blood vessels, such as atherosclerosis, and post-angioplasty stenosis or restenosis.

[0076] "Cancer," "tumor," or "malignant tumor" are used interchangeably and refer to any of a number of diseases characterized by uncontrolled, abnormal proliferation of cells, spread of infected cells locally or via the bloodstream and lymphatic system to other parts of the body (metastasis), and a number of distinctive structural and / or molecular features. As used herein, "tumor" refers to all neoplastic cell growth and proliferation, whether malignant or benign, and all pre-cancerous and cancerous cells and tissues. A "cancerous tumor," or "malignant cell," is understood to be a cell that has specific structural characteristics, lacks differentiation, and is capable of invasion and metastasis. Cancers that can be treated using the γPANTIFOL compositions provided herein include, but are not limited to, non-hematologic tumors, including, for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, bile duct cancer, gallbladder cancer, bladder cancer, sarcoma (e.g., osteosarcoma), brain cancer, central nervous system cancer, and melanoma; and hematologic tumors, such as, for example, leukemia, lymphoma and other B-cell malignancies, myeloma and other plasma cell dysplasias or cachexia. In some embodiments, the cancer is selected from breast cancer, advanced head and neck cancer, lung cancer, gastric cancer, osteosarcoma, non-Hodgkin's lymphoma (NHL), acute lymphocytic leukemia (ALL), mycosis fungoides (cutaneous T-cell lymphoma), choriocarcinoma, chorioadenoma, non-leukemic meningeal carcinomatosis, soft tissue sarcoma (dsemoid tumor, aggressive fibromatosis), bladder cancer, and central nervous system (CNS) cancer. Other types of cancers and tumors that can be treated with γPANTIFOL compositions are described herein or known in the art. The term "metastasis" refers to the spread or dissemination of a tumor, cancer, or neoplasm to another site, location, region, organ, or tissue system within a subject, where the site, location, region, organ, or tissue system in the subject is different from the primary tumor, cancer, or neoplasm. The terms "cancer," "cancerous," "cell proliferative disorder," "proliferative disorder," and "tumor" are not mutually exclusive when referred to herein.

[0077] The terms "treating," or "treatment," or "treat," and the like, refer to both (a) therapeutic measures that cure, slow, lessen the symptoms, and / or halt the progression of a diagnosed condition or disorder, and (b) prophylactic or preventative measures that prevent and / or delay the onset of the targeted disease or condition. Thus, subjects in need of treatment include those already with the cancer, disorder, or disease, those at risk of developing the cancer or condition, and those in whom the infection or condition is to be prevented. The subject has been identified, using well-known medical and diagnostic techniques, as "at risk of having" cancer, an infectious disease, an immune system disorder, a hyperproliferative disease, or another disease or disorder referred to herein. In certain embodiments, a subject has been successfully "treated" by the methods provided herein if, for example, the subject exhibits total, partial, or temporary remission or elimination of symptoms associated with the disease or condition (e.g., cancer, inflammation, and rheumatoid arthritis). In certain embodiments, the term "treating" or "treatment" or "treat" refers to the improvement of at least one measurable physical parameter of a proliferative disorder, such as tumor growth, which may not necessarily be discernible by the patient. In other embodiments, the term "treating" or "treatment" or "treat" refers to the inhibition of progression of a proliferative disorder, either physically, e.g., by stabilization of a discernible symptom, or physiologically, e.g., by stabilization of a physical parameter, or both. In other embodiments, the term "treating" or "treatment" or "treat" refers to the reduction or stabilization of size, tumor cell growth or survival, or cancer cell number. Treatment can involve the use of γPANTIFOL compositions alone or in combination with additional therapeutic agents.

[0078] "Subject," "patient," and "animal" are used interchangeably and refer to mammals, such as human patients and non-human primates, as well as laboratory animals, such as rabbits, rats, mice, and other animals. Animals include all vertebrates, e.g., mammals and non-mammals, such as chickens, amphibians, and reptiles. As used herein, "mammal" refers to any member of the class Mammalia, including, but not limited to, humans and non-human primates, e.g., chimpanzees and other apes and monkey species; livestock animals, such as cows, sheep, pigs, goats, and horses; domestic mammals, such as dogs and cats; laboratory animals, such as rodents, e.g., mice, rats, guinea pigs, and other members of the class Mammalia. In certain embodiments, the patient is a human.

[0079] As used herein, "treatment of a proliferative disorder" includes maintaining or reducing tumor size, inducing tumor regression (partial or complete), inhibiting tumor growth, and / or extending the lifespan of a subject with a proliferative disorder. In one embodiment, the proliferative disorder is a solid tumor. Such tumors include, for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, bile duct cancer, gallbladder cancer, bladder cancer, sarcoma (e.g., osteosarcoma), brain cancer, central nervous system cancer, and melanoma. In one embodiment, the proliferative disorder is a hematological tumor. Such hematological tumors include, for example, leukemia, lymphoma and other B-cell malignancies, myeloma and other plasma cell dysplasias or cachexia.

[0080] As used herein, the term "autoimmune disease" is defined as a disorder resulting from an autoimmune response. Autoimmune diseases are the result of an inappropriate or excessive response to self-antigens. Examples of autoimmune diseases include, but are not limited to, Addison's disease, alopecia areata, ankylosing spondylitis, autoimmune hepatitis, autoimmune parotitis, Crohn's disease, diabetes mellitus (type 1), dystrophic epidermolysis bullosa, epididymitis, glomerulonephritis, Graves' disease, Guillain-Barré syndrome, Hashimoto's disease, hemolytic anemia, systemic lupus erythematosus, multiple sclerosis, myasthenia gravis, pemphigus vulgaris, psoriasis, rheumatic fever, rheumatoid arthritis, sarcoidosis, scleroderma, Sjögren's syndrome, spondyloarthropathy, thyroiditis, vasculitis, vitiligo, myxedema, pernicious anemia, and ulcerative colitis.

[0081] The terms "inflammation" and "inflammatory disease" are used interchangeably and refer to diseases or disorders characterized by or caused by inflammation. "Inflammation" refers to a localized response to cellular injury characterized by capillary dilation, leukocyte infiltration, redness, heat, and pain, which serve as mechanisms to initiate clearance of harmful agents and damaged tissue. Sites of inflammation include the lungs, pleura, tendons, lymph nodes or glands, uvula, vagina, brain, spinal cord, nasal and pharyngeal mucosa, muscle, skin, bone or bone tissue, joints, bladder, retina, cervix, canthus of the eye, intestine, vertebrae, rectum, anus, bursa, hair follicles, etc. Such inflammatory diseases include, but are not limited to, inflammatory bowel disease, rheumatoid diseases (e.g., rheumatoid arthritis), other arthritic diseases (e.g., acute arthritis, acute gouty arthritis, bacterial arthritis, chronic inflammatory arthritis, osteoarthritis (degenerative arthritis), infectious arthritis, juvenile arthritis, fungal arthritis, neuropathic arthritis, polyarthritis, proliferative arthritis, psoriatic arthritis, venereal arthritis, and viral arthritis), connective tissue inflammation, pelvic inflammatory disease, acne, psoriasis, actinomycosis, dysentery, biliary cirrhosis, Lyme disease, heat rash, Stevens-Johnson syndrome, mumps, pemphigus vulgaris, and blastomycosis. Inflammatory bowel diseases are chronic inflammatory diseases of the gastrointestinal tract, including, but not limited to, Crohn's disease, ulcerative colitis, and indeterminate colitis. Rheumatoid arthritis is a chronic inflammatory disease primarily of the joints, usually polyarticular, characterized by inflammatory changes in the synovial membrane and articular structures, as well as muscle spasms and bone mineralization.

[0082] As used herein, the term "therapeutic agent" refers to a drug or derivative thereof or prodrug thereof that can interact with hyperproliferative cells, such as cancer cells or immune cells, thereby reducing the proliferative state of the cells and / or killing the cells. Examples of therapeutic agents include, but are not limited to, chemotherapeutic agents, cytotoxic drugs, platinum-based drugs (e.g., cisplatin, carboplatin, oxaliplatin), taxanes (e.g., Taxol®), etoposide, alkylating agents (e.g., cyclophosphamide, ifosfamide), antimetabolites (e.g., antifolates (ANTIFOL)), 5-fluorouracil, gemcitabine, or derivatives thereof), antitumor antibiotics (e.g., mitomycin, doxorubicin), and plant-derived antitumor agents (e.g., vincristine, vindesine, Taxol). Such agents further include, but are not limited to, the anticancer agents trimetrexate, temozolomide, raltitrexed, S-(4-nitrobenzyl)-6-thioinosine (NBMPR), 6-benziguanidine (6-BG), bis-chloronitrosourea (BCNU), and camptothecin™, or any therapeutic derivatives thereof. Additional examples of therapeutic agents that may be suitable for use with the methods of the present disclosure include, but are not limited to, antirestenotic agents, pro- or anti-proliferative agents, anti-inflammatory agents, antineoplastic agents, antimitotic agents, antiplatelet agents, anticoagulants, antifibrinogens, antithrombin agents, cytostatic agents, antibiotics and other anti-infective agents, antienzymes, antimetabolites, angiogenic agents, cytoprotective agents, angiotensin-converting enzyme (ACE) inhibitors, angiotensin II receptor antagonists, and / or cardioprotective agents. "Therapeutic agent" also refers to salt, acid, and free base forms of the above agents.

[0083] As used herein, the term "chemotherapeutic agent," when used in the context of cancer therapy, means any agent that causes the death of cancer cells or inhibits the growth or spread of cancer cells. Examples of such chemotherapeutic agents include alkylating agents, antibiotics, antimetabolites, plant-derived drugs, and hormones. In some embodiments, the chemotherapeutic agent is cisplatin. In some embodiments, the chemotherapeutic agent is carboplatin. In some embodiments, the chemotherapeutic agent is oxaliplatin. In other embodiments, the chemotherapeutic agent is gemcitabine. In other embodiments, the chemotherapeutic agent is doxorubicin.

[0084] As used herein, the term "anti-metabolite" refers to an anti-tumor drug that inhibits the utilization of a metabolite or its prodrug. Examples of anti-metabolites include antifolates, pemetrexed, 5-fluorouracil, 5-fluorouracil prodrugs such as capecitabine, 5-fluorodeoxyuridine monophosphate, cytarabine, cytarabine prodrugs such as nelarabine, 5-azacytidine, gemcitabine, mercaptopurine, thioguanine, azathioprine, adenosine, pentostatin, erythrohydroxynonyladenine, and cladribine. Anti-metabolites useful for practicing the disclosed methods include nucleoside analogs, including purine or pyrimidine analogs. In some embodiments, the gamma polyglutamated antifolate composition is used in combination with an antimetabolite selected from fluoropyrimidine, 5-fluorouracil, 5-fluoro-2'-deoxycytidine, cytarabine, gemcitabine, troxacitabine, decitabine, azacitidine, pseudoisocytidine, zebularine, ancitabine, fazarabine, 6-azacytidine, capecitabine, N4-octadecylcytarabine, elaidic acid cytarabine, fludarabine, cladribine, clofarabine, nelarabine, forodesine, and pentostatin, or derivatives thereof. In one example, the nucleoside analog is a substrate for a nucleoside deaminase that is an adenosine deaminase or a cytidine deaminase. In some examples, the nucleoside analog is selected from fludarabine, cytarabine, gemcitabine, decitabine, and azacitidine or derivatives thereof. In certain embodiments, the antimetabolite is 5-fluorouracil.

[0085] As used herein, a "taxane" is an anti-cancer drug that interferes with or disrupts microtubule stability, formation, and / or function. Taxanes include paclitaxel and docetaxel and their derivatives, which function on microtubules with the same mode of action as the taxanes from which they are derived. In certain embodiments, the taxane is paclitaxel or docetaxel, or a pharmaceutically acceptable salt, acid, or derivative of paclitaxel or docetaxel. In certain embodiments, the taxane is paclitaxel (Taxol®), docetaxel (Taxotere®), albumin-bound paclitaxel (nab-paclitaxel; Abraxane®), DHA-paclitaxel, or PG-paclitaxel.

[0086] The terms "pharmaceutically-acceptable carrier" and "pharmaceutically acceptable carrier" refer to ingredients, other than active ingredients, in a pharmaceutical formulation that are non-toxic to a subject. Pharmaceutically acceptable carriers include, but are not limited to, buffers, excipients, stabilizers, or preservatives. Pharmaceutically acceptable carriers include, for example, one or more compatible solid or liquid fillers, diluents, or encapsulating substances that are suitable for administration to humans or other subjects.

[0087] The present disclosure relates generally to gamma polyglutamated antifolate (γANTIFOL) compositions and methods of making and using the compositions to treat diseases, including hyperproliferative diseases such as cancer, immune system disorders such as rheumatoid arthritis, and infectious diseases such as HIV, malaria, and schistosomiasis.

[0088] In some embodiments, the present disclosure provides: [1] A composition comprising a gamma polyglutamated antifolate; [2] The composition according to item [1], wherein the antifolate is selected from piritrexim, pralatrexate, AG2034, GW1843, and LY309887, and / or stereoisomers thereof; [3] The composition according to item [1], wherein the antifolate is selected from PMX, MTX, RTX, and LTX, or a stereoisomer thereof; [4] The composition according to any one of items [1] to [3], wherein the antifolate is selected from the following: LV (etoposide), L-leucovorin (L-5-formyltetrahydrofolic acid); 5-CH3-THF, 5-methyltetrahydrofolic acid; FA, folic acid; PteGlu, pteroylglutamate (FA); MTX, methotrexate; 2-dMTX, 2-desamino-MTX; 2-CH3-MTX, 2-desamino-2-methyl-MTX; AMT, aminopterin; 2-dAMT, 2-desamino-AMT; 2-CH3-AMT, 2-desamino-2-methyl-AMT; 10-EdAM, 10-ethyl-10-deazaaminopterin; PT523, N alpha-(4-amino-4-deoxypteroyl)-N Delta-(hemiphthaloyl)-L-ornithine; DDATHF (lometrexol), 5,10-dideaza-5,6,7,8-tetrahydrofolic acid; 5-d(i)H4PteGlu, 5-deaza-5,6,7,8-tetrahydroisofolic acid; N9-CH3-5-d(i)H4PteGlu, N9-methyl-5-deaza-5,6,7,8-tetrahydroisofolic acid; 5-dPteHCysA, N alpha-(5-deazapteroyl)-L-homocysteic acid; 5-dPteAPBA, N alpha-(5-deazapteroyl)-DL-2-amino-4-phosphonobutyric acid; 5-dPteOrn, N alpha-(5-deazapteroyl)-L-ornithine; 5-dH4PteHCysA, N Alpha-(5-deaza-5,6,7,8-tetrahydropteroyl)-L-homocysteic acid; 5-dH4PteAPBA, N Alpha-(5-deaza-5,6,7,8-tetrahydropteroyl)-DL-2-amino-4-phosphobutanoic acid; 5-dH4PteOro, N Alpha-(5-dideaza-5,6,7,8-tetrahydropteroyl)-L-ornithine; CB3717, N10-propargyl-5,8-dideazafolate; ICI-198,583, 2-desamino-2-methyl-N10-propargyl-5,8-dideazafolate; 4-H-ICI-198,583, 4-deoxy-ICI-198,583; 4-OCH3-ICI-198,583, 4-methoxy-ICI-198,583 Glu-to-Val-ICI-198,583; valine-ICI-198;583;Glu-to-Sub-ICI-198,583, 2-aminosuberic acid-ICI-198,583; 7-CH3-ICI-198,583, 7-methyl-ICI-198,583; ZD1694, N-[5(N-(3,4-dihydro-2-methyl-4-oxoquinazolin-6-yl-methyl)amino)2-thienyl)]-L-glutamic acid; 2-NH2 -ZD1694, 2-amino-ZD1694; BW1843U89, (S)-2[5-(((1,2-dihydro-3-methyl-1-oxobenzo(f)quinazolin-9-yl)methyl)amino-)-1-oxo-2-isoindolinyl]-glutaric acid; LY231514, N-(4-(2-(2-amino-4,7-dihydro-4-oxo-3H-pyrrolo[ 2,3-D]pyrimidin-5-yl)ethyl)-benzoyl]-L-glutamic acid; IAHQ, 5,8-dideazaisofolic acid; 2-dIAHQ, 2-desamino-IAHQ; 2-CH3-dIAHQ, 2-desamino-2-methyl-IAHQ; 5-d(i)PteGlu, 5-deazaisofolic acid; N9-CH3-5-d(i)PteGlu, N9-methyl-5-deazaisofolic acid; N9-CHO-5-d(i)PteGlu, N9-formyl-5-deazaisofolic acid; AG337, 3,4-dihydro-2-amino-6-methyl-4-oxo-5-(4-pyridylthio)quanazoline; and 2,4-diamino-6[N-(4-(phenysulfonyl)benzyl)ethyl)amino]quinazoline; or stereoisomers thereof. ; [5] The composition of [1], wherein the antifolate is selected from methotrexate, raltitrexed, previtrexed, pemetrexed, lometrexol (LTX; 5,10-dideazatetrahydrofolic acid), cyclopenta[g]quinazolines having dipeptide ligands, CB3717, CB300945, or stereoisomers thereof, such as 6-R,S-BGC945 (ONX-0801), CB300638, and BW1843U89; [6] The composition according to any one of items [1] to [5], wherein the gamma polyglutamated antifolate contains 4, 5, 2 to 10, 4 to 6, or more than 5 glutamyl groups: [7] The composition according to any one of items [1] to [6], wherein the gamma polyglutamated antifolate is (a) is a gamma tetraglutamated folate antagonist; (b) a gamma-pentaglutamated antifolate; or (c) a gamma hexaglutamated folate antagonist; composition; [8] The composition according to any one of items [1] to [7], wherein the gamma polyglutamated antifolate contains 1 to 10 glutamyl groups with gamma carboxyl group bonds; [9] The composition according to any one of items [1] to [8], (a) at least two glutamyl groups of the gamma polyglutamated antifolate are in the L-configuration; (b) each glutamyl group of the gamma-polyglutamated antifolate is in the L-configuration; (c) at least one glutamyl group of the gamma polyglutamated antifolate is in the D-form; (d) each glutamyl group of the gamma polyglutamated antifolate other than the glutamyl group of the antifolate is in the D-form; or (e) at least two of the glutamyl groups of the gamma polyglutamated antifolate are in the L-configuration and at least one of the glutamyl groups is in the D-configuration; Composition:

[10] The composition according to any one of items [1] to [9], wherein the polyglutamic acid is linear;

[11] The composition according to any one of items [1] to [9], wherein the polyglutamic acid is branched;

[12] A liposome composition (Lp-γPANTIFOL) containing the gamma polyglutamated folate metabolic antagonist according to any one of items [1] to

[11] ;

[13] The Lp-γPANTIFOL composition according to item

[12] , wherein the polyglutamated folate antimetabolite is selected from the following: (a) AG2034, piritrexim, pralatrexate, GW1843, antifolates, and LY309887; or (b) PMX, MTX, RTX and LTX, their stereoisomers;

[14] The Lp-γPANTIFOL composition according to item

[12] or

[13] , wherein the polyglutamated folate anti-metabolite is selected from the following: LV (etoposide), L-leucovorin (L-5-formyltetrahydrofolic acid); 5-CH3-THF, 5-methyltetrahydrofolic acid; FA, folic acid; PteGlu, pteroylglutamate (FA); MTX, methotrexate; 2-dMTX, 2-desamino-MTX; 2-CH3-MTX, 2-desamino-2-methyl-MTX; AMT, aminopterin; 2-dAMT, 2-desamino-AMT; 2-CH3-AMT, 2-desamino-2-methyl-AMT; 10-EdAM, 10-ethyl-10-deazaaminopterin; PT523, N Alpha-(4-amino-4-deoxypteroyl)-N delta-(hemiphthaloyl)-L-ornithine; DDATHF (lometrexol), 5,10-dideaza-5,6,7,8-tetrahydrofolic acid; 5-d(i)H4PteGlu, 5-deaza-5,6,7,8-tetrahydroisofolic acid; N9-CH3-5-d(i)H4PteGlu, N9-methyl-5-deaza-5,6,7,8-tetrahydroisofolic acid; 5-dPteHCysA, N alpha-(5-deazapteroyl)-L-homocysteic acid; 5-dPteAPBA, N alpha-(5-deazapteroyl)-DL-2-amino-4-phosphonobutyric acid; 5-dPteOrn, N alpha-(5-deazapteroyl)-L-ornithine; 5-dH4PteHCysA, N alpha-(5-deaza-5,6,7,8-tetrahydropteroyl)-L-homocysteic acid; 5-dH4PteAPBA, N alpha-(5-deaza-5,6,7,8-tetrahydropteroyl)-DL-2-amino-4-phosphobutanoic acid; 5-dH4PteOro, N alpha-(5-dideaza-5,6,7,8-tetrahydropteroyl)-L-ornithine; CB3717, N10-propargyl-5,8-dideazafolic acid; ICI-198,583, 2-desamino-2-methyl-N10-propargyl-5,8-dideazafolic acid;4-H-ICI-198,583, 4-deoxy-ICI-198,583; 4-OCH3-ICI-198,583; 4-methoxy-ICI-198,583 Glu-to-Val-ICI-198,583; valine-ICI-198;583; Glu-to-Sub-ICI-198,583, 2-aminosuberic acid-ICI-198,583; 7-CH3-ICI-198,583, 7-methyl-ICI-198,583; ZD1694, N-[5(N-(3,4-dihydro-2-methyl-4-oxoquinazolin-6-yl-methyl]-ICI-198,583] )amino)2-thienyl)]-L-glutamic acid; 2-NH2-ZD1694, 2-amino-ZD1694; BW1843U89, (S)-2[5-(((1,2-dihydro-3-methyl-1-oxobenzo(f)quinazolin-9-yl)methyl)amino-)-1-oxo-2-isoindolinyl]-glutaric acid; LY231514, N-(4-(2-(2-amino-4,7-dihydrobenzoyl)methyl)amino-)-1-oxo-2-isoindolinyl)- N-(4-oxo-3H-pyrrolo[2,3-D]pyrimidin-5-yl)ethyl)-benzoyl]-L-glutamic acid; IAHQ, 5,8-dideazaisofolic acid; 2-dIAHQ, 2-desamino-IAHQ; 2-CH3-dIAHQ, 2-desamino-2-methyl-IAHQ; 5-d(i)PteGlu, 5-deazaisofolic acid; N9-CH3-5-d(i)PteGlu, N9- Methyl-5-deazaisofolate; N9-CHO-5-d(i)PteGlu, N9-formyl-5-deazaisofolate; AG337, 3,4-dihydro-2-amino-6-methyl-4-oxo-5-(4-pyridylthio)quanazoline; and AG377, 2,4-diamino-6[N-(4-(phenysulfonyl)benzyl)ethyl)amino]quinazoline; or stereoisomers thereof;

[15] The Lp-γPANTIFOL composition according to any one of items

[12] to

[14] , wherein the antifolate is selected from methotrexate, raltitrexed, previtrexed, pemetrexed, lometrexol (LMX; 5,10-dideazatetrahydrofolic acid), cyclopenta[g]quinazolines having dipeptide ligands, CB3717, CB300945, or stereoisomers thereof, such as 6-R,S-BGC945 (ONX-0801), CB300638, and BW1843U89;

[16] The Lp-γPANTIFOL composition according to any one of items

[12] to

[15] , wherein the liposome contains a gamma-polyglutamated antifolate containing 4, 5, 2 to 10, 4 to 6, or more than 5 gamma-glutamyl groups;

[17] The Lp-γPANTIFOL composition according to any one of items

[12] to

[16] , wherein the liposome contains a gamma-tetraglutamated folate antimetabolite;

[18] The Lp-γPANTIFOL composition according to any one of items

[12] to

[16] , wherein the liposome contains a gamma-pentaglutamated antifolate;

[19] The Lp-γPANTIFOL composition according to any one of items

[12] to

[16] , wherein the liposome contains a gamma hexaglutamated antifolate;

[20] The Lp-γPANTIFOL composition according to any one of items

[12] to

[19] , wherein the gamma polyglutamated folate antagonist contains 1 to 10 glutamyl groups having gamma carboxyl group bonds;

[21] The Lp-γ-PANTIFOL composition according to any one of items

[12] to

[20] , (a) at least two glutamyl groups of the gamma polyglutamated antifolate are in the L-configuration; (b) each glutamyl group of the gamma-polyglutamated antifolate is in the L-configuration; (c) at least one glutamyl group of the gamma polyglutamated antifolate is in the D-form; (d) each glutamyl group of the gamma polyglutamated antifolate other than the glutamyl group of the antifolate is in the D-form; or (e) at least two of the glutamyl groups of the gamma polyglutamated antifolate are in the L-configuration and at least one of the glutamyl groups is in the D-configuration; Lp-γPANTIFOL composition:

[22] The Lp-γ-PANTIFOL composition according to any one of items

[12] to

[21] , comprising: (a) at least two glutamyl groups of the gamma polyglutamated antifolate are in the L-configuration; (b) each glutamyl group of the gamma-polyglutamated antifolate is in the L-configuration; (c) at least one glutamyl group of the gamma polyglutamated antifolate is in the D-form; (d) each glutamyl group of the gamma polyglutamated antifolate other than the glutamyl group of the antifolate is in the D-form; or (e) at least two of the glutamyl groups of the gamma polyglutamated antifolate are in the L-configuration and at least one of the glutamyl groups is in the D-configuration; Lp-γPANTIFOL composition:

[23] The Lp-γPANTIFOL composition according to any one of items

[12] to

[22] , wherein the liposome is PEGylated (PLp-γPANTIFOL);

[24] The Lp-γPANTIFOL composition according to any one of items

[12] to

[22] , wherein the liposome is not PEGylated;

[25] The Lp-γPANTIFOL composition according to any one of items

[12] to

[24] , wherein the liposome has a diameter in the range of 20 nm to 200 nm;

[26] The Lp-γPANTIFOL composition according to any one of items

[12] to

[25] , wherein the liposome has a diameter in the range of 80 nm to 120 nm;

[27] The Lp-γPANTIFOL composition according to any one of items

[12] to

[26] , wherein the liposome is formed from a liposome component;

[28] The Lp-γPANTIFOL composition according to item

[27] , wherein the liposome component comprises at least one anionic lipid and a neutral lipid;

[29] The Lp-γPANTIFOL composition according to item

[27] or

[28] , wherein the liposome component comprises at least one selected from DSPE; DSPE-PEG; DSPE-PEG-maleimide; HSPC; HSPC-PEG; cholesterol; cholesterol-PEG; and cholesterol-maleimide;

[30] The Lp-γ-PANTIFOL composition according to any one of items

[27] to

[29] , wherein the liposome component comprises at least one selected from the following: DSPE; DSPE-PEG; DSPE-PEG-FITC; DSPE-PEG-maleimide; cholesterol; and HSPC;

[31] The Lp-γPANTIFOL composition according to any one of items

[27] to

[30] , wherein one or more liposome components further comprise a steric stabilizer;

[32] The Lp-γPANTIFOL composition according to item

[31] , wherein the steric stabilizer is at least one selected from polyethylene glycol (PEG); poly-L-lysine (PLL); monosialoganglioside (GM1); poly(vinylpyrrolidone) (PVP); poly(acrylamide) (PAA); poly(2-methyl-2-oxazoline); poly(2-ethyl-2-oxazoline); phosphatidylpolyglycerol; poly[N-(2-hydroxypropyl)methacrylamide]; amphiphilic poly-N-vinylpyrrolidone; L-amino acid-based polymer; oligoglycerin, polyethylene glycol and polypropylene oxide-containing copolymer, poloxamer 188, and polyvinyl alcohol.

[33] The Lp-γPANTIFOL composition according to item

[32] , wherein the steric stabilizer is PEG, and the PEG has a number average molecular weight (Mn) of 200 to 5,000 daltons;

[34] The Lp-γPANTIFOL composition according to any one of items

[12] to

[33] , wherein the liposome is anionic or neutral;

[35] The Lp-γPANTIFOL composition according to any one of items

[12] to

[33] , wherein the liposome has a zeta potential of zero or less;

[36] The Lp-γPANTIFOL composition according to any one of items

[12] to

[33] , wherein the liposome has a zeta potential of 0 to -150 mV;

[37] The Lp-γPANTIFOL composition according to any one of items

[12] to

[33] , wherein the liposome has a zeta potential of -30 to -50 mV;

[38] The Lp-γPANTIFOL composition according to any one of items

[12] to

[33] , wherein the liposome is cationic;

[39] The Lp-γPANTIFOL composition according to any one of items

[12] to

[38] , wherein the liposome has an internal space containing a gamma polyglutamated antifolate and an aqueous pharmaceutically acceptable carrier;

[40] The Lp-γPANTIFOL composition according to item

[39] , wherein the pharmaceutically acceptable carrier comprises an isotonic agent such as dextrose, mannitol, glycerol, potassium chloride, or sodium chloride at a concentration greater than 1%;

[41] The Lp-γPANTIFOL composition according to item

[39] , wherein the aqueous pharmaceutically acceptable carrier is trehalose;

[42] The Lp-γPANTIFOL composition according to item

[41] , wherein the pharmaceutically acceptable carrier contains 1% to 50% trehalose;

[43] The Lp-γPANTIFOL composition according to any one of items

[39] to

[42] , wherein the pharmaceutically acceptable carrier comprises a 1% to 50% dextrose solution;

[44] The Lp-γPANTIFOL composition according to any one of items

[39] to

[43] , wherein the inner space of the liposome contains 5% dextrose suspended in a HEPES buffer solution;

[45] The Lp-γPANTIFOL composition according to any one of items

[39] to

[44] , wherein the pharmaceutically acceptable carrier comprises a buffer solution such as HEPES-buffered saline (HBS) or a similar substance at a concentration of 1 to 200 mM and a pH of 2 to 8;

[46] The Lp-γPANTIFOL composition according to any one of items

[39] to

[45] , wherein the pharmaceutically acceptable carrier comprises sodium acetate and calcium acetate at a total concentration of 50 mM to 500 mM;

[47] The Lp-γPANTIFOL composition according to any one of items

[12] to

[46] , wherein the internal space of the liposome has a pH of 5 to 8, a pH of 6 to 7, or any range therebetween;

[48] ​​The Lp-γPANTIFOL composition according to any one of items

[12] to

[47] , wherein the liposome contains less than 500,000 or less than 200,000 gamma polyglutamated antifolate molecules;

[49] The Lp-γPANTIFOL composition according to any one of items

[12] to

[48] , wherein the liposome contains 10 to 100,000 gamma polyglutamated antifolate molecules or any range therebetween;

[50] The Lp-γ PANTIFOL composition according to any one of items

[12] to

[49] , further comprising a targeting moiety, wherein the targeting moiety has specific affinity for a surface antigen on a target cell of interest;

[51] The Lp-γPANTIFOL composition according to item

[50] , wherein the targeting moiety is attached to one or both of the PEG and the outer surface of the liposome, and optionally the targeting moiety is covalently attached to one or both of the PEG and the outer surface of the liposome;

[52] The Lp-γPANTIFOL composition according to item

[50] or

[51] , wherein the targeting moiety is a polypeptide;

[53] The Lp-γPANTIFOL composition according to any one of items

[50] to

[52] , wherein the targeting moiety is an antibody or an antigen-binding fragment of an antibody;

[54] The Lp-γ PANTIFOL composition according to any one of items

[50] to

[53] , wherein the targeting moiety is 0.5x10 as measured by BIACORE® analysis. -10 ~10x10 -6an Lp-γPANTIFOL composition that binds to surface antigens with an equilibrium dissociation constant (Kd) in the range of

[55] The Lp-γPANTIFOL composition according to any one of items

[50] to

[54] , wherein the targeting moiety specifically binds to one or more folate receptors selected from the group consisting of folate receptor alpha (FR-α), folate receptor beta (FR-β), and folate receptor delta (FR-δ);

[56] The Lp-γPANTIFOL composition according to any one of items

[50] to

[55] , wherein the targeting moiety comprises one or more selected from the group consisting of an antibody, a humanized antibody, an antigen-binding fragment of an antibody, a single-chain antibody, a single-domain antibody, a bispecific antibody, a synthetic antibody, a pegylated antibody, and a multimeric antibody;

[57] The Lp-γPANTIFOL composition according to any one of items

[50] to

[56] , wherein each PEGylated liposome contains 1 to 1000 or 30 to 200 targeting moieties;

[58] The Lp-γPANTIFOL composition according to any one of items

[39] to

[57] , further comprising one or more of an immunostimulant, a detectable marker, and a maleimide, wherein the immunostimulant, the detectable marker, or the maleimide is bound to the PEG or the outer surface of the liposome;

[59] The Lp-γPANTIFOL composition according to item

[58] , wherein the immunostimulant is at least one selected from the group consisting of a protein immunostimulant, a nucleic acid immunostimulant, a chemical immunostimulant, a hapten, and an adjuvant;

[60] The Lp-γ PANTIFOL composition according to item

[58] or

[59] , wherein the immunostimulant is fluorescein, fluorescein isothiocyanate (FITC), DNP, beta-glucan, beta-1,3-glucan, beta-1,6-glucan, resolvin (e.g., D n-6DPA Or D n-3DPAan Lp-γPANTIFOL composition, wherein the Lp-γPANTIFOL composition is at least one selected from the group consisting of toll-like receptor (TLR) modulators such as resolvin D, resolvin E, or T-series resolvins, and oxidized low-density lipoproteins (e.g., OXPAC, PGPC), and eritoran lipids (e.g., E5564);

[61] The Lp-γPANTIFOL composition according to any one of items

[58] to

[60] , wherein the immunostimulant and the detectable marker are the same;

[62] The Lp-γPANTIFOL composition according to any one of items

[58] to

[61] , further comprising a hapten;

[63] The Lp-γ PANTIFOL composition according to item

[62] , wherein the hapten comprises one or more of fluorescein or beta-1,6-glucan:

[64] The Lp-γPANTIFOL composition according to any one of items

[12] to

[63] , further comprising at least one cryoprotectant selected from the group consisting of mannitol, trehalose, sorbitol, and sucrose;

[65] A targeting composition comprising the composition according to any one of items [1] to

[64] ;

[66] A non-targeted composition comprising the composition according to any one of items [1] to

[49] ;

[67] The Lp-γPANTIFOL composition according to any one of items

[12] to

[66] , further comprising carboplatin and / or pembrolizumab;

[68] A pharmaceutical composition comprising the liposomal gamma polyglutamated antifolate composition according to any one of items

[12] to

[67] ;

[69] A pharmaceutical composition comprising the gamma polyglutamated folate antagonist composition according to any one of items [1] to [7];

[70] The composition according to any one of items [1] to

[69] for use in treating a disease;

[71] Use of the composition according to any one of items [1] to

[70] in the manufacture of a drug for the treatment of a disease;

[72] A method for treating or preventing a disease in a subject in need of such treatment or prevention, the method comprising administering to the subject the composition according to any one of items [1] to

[70] ;

[73] A method for treating or preventing a disease in a subject in need of such treatment or prevention, the method comprising administering to the subject the liposomal gamma polyglutamated folate antimetabolite composition according to any one of

[12] to

[69] ;

[74] A method for killing hyperproliferative cells, comprising contacting the hyperproliferative cells with the composition according to any one of items [1] to

[69] ;

[75] A method for killing hyperproliferative cells, comprising contacting the hyperproliferative cells with the liposomal gamma polyglutamated antifolate composition according to any one of items

[12] to

[69] .

[76] The method according to item

[74] or

[75] , wherein the hyperproliferative cells are cancer cells, mammalian cells, and / or human cells;

[77] A method for treating cancer, comprising administering an effective amount of the composition according to any one of items [1] to

[69] to a subject having or at risk of having cancer;

[78] A method for treating cancer, comprising administering an effective amount of the liposomal gamma polyglutamated antifolate composition according to any one of items

[12] to

[68] to a subject having or at risk of having cancer;

[79] The method according to item

[77] or

[78] , wherein the cancer is selected from non-hematological tumors including, for example, lung cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney cancer, bile duct cancer, gallbladder cancer, bladder cancer, sarcoma (e.g., osteosarcoma), brain cancer, central nervous system cancer, and melanoma; and hematological tumors such as, for example, leukemia, lymphoma and other B-cell malignancies, myeloma and other plasma cell dysplasias;

[80] The method according to item

[77] or

[78] , wherein the cancer is selected from lung cancer, breast cancer, colon cancer, pancreatic cancer, gastric cancer, bladder cancer, head and neck cancer, ovarian cancer, and cervical cancer;

[81] The method according to item

[77] or

[78] , wherein the cancer is selected from colorectal cancer, lung cancer, breast cancer, head and neck cancer, and pancreatic cancer;

[82] The method according to item

[77] or

[78] , wherein the cancer is selected from colorectal cancer, breast cancer, ovarian cancer, lung cancer, head and neck cancer, pancreatic cancer, gastric cancer, and mesothelioma;

[83] A method for treating cancer, comprising administering an effective amount of the Lp-γPANTIFOL composition according to any one of items

[50] to

[66] to a subject having or at risk of having cancer cells expressing a folate receptor bound by a targeting moiety on the surface thereof;

[84] A maintenance therapy for a subject undergoing or having undergone cancer therapy, comprising administering an effective amount of the composition according to any one of items [1] to

[69] to the subject undergoing or having undergone cancer therapy;

[85] A maintenance therapy for a subject undergoing or having undergone cancer therapy, comprising administering an effective amount of the liposomal gamma polyglutamic acid antimetabolite composition according to any one of items

[12] to

[69] to the subject undergoing or having undergone cancer therapy;

[86] A method for treating an immune system disorder, comprising administering an effective amount of the composition according to any one of items [1] to

[69] to a subject having or at risk of having an immune system disorder, optionally wherein the immune system disorder is selected from inflammation (e.g., acute and chronic), systemic inflammation, rheumatoid arthritis, inflammatory bowel disease (IBD), Crohn's disease, dermatomyositis / polymyositis, systemic lupus erythematosus, Takayasu's disease, and psoriasis;

[87] A method for treating an immune system disorder, comprising administering an effective amount of the liposomal gamma polyglutamated antifolate composition according to any one of items [8] to

[69] to a subject having or at risk of having an immune system disorder, optionally wherein the immune system disorder is selected from inflammation (e.g., acute and chronic), systemic inflammation, rheumatoid arthritis, inflammatory bowel disease (IBD), Crohn's disease, dermatomyositis / polymyositis, systemic lupus erythematosus, Takayasu's disease, and psoriasis;

[88] Treatment of: (a) A method for treating an infectious disease, comprising administering an effective amount of the composition according to any one of items [1] to

[69] to a subject having or at risk of having the infectious disease; (b) A method for treating an infectious disease, a cardiovascular disease, a metabolic disease, or another disease, comprising administering an effective amount of the composition according to any one of items [1] to

[69] to a subject having or at risk of having an infectious disease, a cardiovascular disease, or another disease, wherein the disease is a member selected from atherosclerosis, cardiovascular disease (CVD), coronary artery disease, myocardial infarction, stroke, metabolic syndrome, gestational trophoblastic disease, and ectopic pregnancy; (c) A method for treating an autoimmune disease, comprising administering an effective amount of the composition according to any one of items [1] to

[69] to a subject having or at risk of having an autoimmune disease; (d) A method for treating rheumatoid arthritis, comprising administering an effective amount of the composition according to any one of items [1] to

[69] to a subject having or at risk of having rheumatoid arthritis; (e) A method for treating an inflammatory condition, comprising administering an effective amount of the composition according to any one of items [1] to

[69] to a subject having or at risk of having inflammation, wherein the inflammation is, optionally, acute, chronic, and / or systemic inflammation; or (f) A method for treating a skin disease, comprising administering an effective amount of the composition according to any one of items [1] to

[69] to a subject having or at risk of having a skin disease;

[89] A method for treating an infectious disease, comprising administering an effective amount of the liposomal gamma polyglutamated antifolate composition according to any one of items

[12] to

[69] to a subject having or at risk of having the infectious disease;

[90] A method for delivering a gamma polyglutamated antifolate to a tumor expressing a folate receptor on its surface, comprising administering to a subject having a tumor the Lp-γPANTIFOL composition described in any of items [1] to

[69] in an amount sufficient to deliver a therapeutically effective amount of the gamma polyglutamated antifolate to the tumor;

[91] A method for making a gamma polyglutamated antifolate composition, comprising the liposomal gamma polyglutamated antifolate composition according to any one of Items

[12] to

[69] , the method comprising the steps of: forming a mixture in a solution containing liposome components and a gamma polyglutamated antifolate; homogenizing the mixture in the solution to form liposomes; and treating the mixture to form liposomes containing the gamma polyglutamated antifolate.

[92] A method for making a gamma polyglutamated antifolate comprising the liposomal gamma polyglutamated antifolate composition according to any one of Items

[12] to

[69] , the method comprising the steps of forming a mixture comprising liposome components and a gamma polyglutamated antifolate in a solution; and treating the mixture to form liposomes comprising the gamma polyglutamated antifolate.

[93] The method according to item

[92] , wherein the step of treating the mixture includes a step of homogenizing the mixture in a solution to form liposomes.

[94] A method for making the composition according to any one of Items

[50] to

[69] , comprising the steps of: forming a mixture in a solution containing liposome components and a gamma polyglutamated antifolate; homogenizing the mixture in the solution to form liposomes; treating the mixture to form liposomes that encapsulate and / or entrap the gamma polyglutamated antifolate; and providing a targeting moiety on the surface of the liposome, wherein the targeting moiety has specific affinity for at least one of folate receptor alpha (FR-α), folate receptor beta (FR-β), and folate receptor delta (FR-δ).

[95] A method for making the composition according to any one of Items

[50] to

[69] , comprising the steps of: forming a mixture in solution containing liposome components and a gamma polyglutamated antifolate; treating the mixture to form liposomes that encapsulate and / or entrap the gamma polyglutamated antifolate; and providing a targeting moiety on the surface of the liposome, wherein the targeting moiety has specific affinity for at least one of folate receptor alpha (FR-α), folate receptor beta (FR-β), and folate receptor delta (FR-δ).

[96] The method according to item

[95] , wherein the treating step includes homogenizing the mixture in a solution to form liposomes.

[97] The method according to item

[92] , wherein the processing step comprises one or more steps of thin film hydration, extrusion, in-line mixing, ethanol injection technique, freeze-thaw method, reverse phase evaporation, dynamic high-pressure microfluidization, microfluidic mixing, double emulsion, freeze-dried double emulsion, 3D printing, membrane contactor method, and stirring; and / or

[98] The method according to any one of items

[95] to

[97] , wherein the processing step comprises one or more steps of modifying the size of the liposomes by one or more steps of extrusion, high-pressure microfluidization, and / or sonication; and / or

[99] The method according to any one of items

[91] to

[98] , wherein at least 1% of the gamma polyglutamated antifolate starting material is encapsulated or entrapped in liposomes.

[0089] I. Gamma Polyglutamated Folate Antimetabolites (γPANTIFOL) In general, the present disclosure relates to gamma polyglutamated antifolate (γPANTIFOL) compositions. γPANTIFOL compositions contain at least one glutamyl group with a gamma carboxyl linkage. These compositions are structurally distinct from L-gamma polyglutamated antifolates (Lγ1PANTIFOL), which are generated in cells by the enzyme folylpolygammaglutamate synthase (FPGS) during antifolate therapy.

[0090] In some embodiments, the γPANTIFOL composition comprises 2 to 20, 2 to 15, 2 to 10, 2 to 5, or more than 5 glutamyl groups (including the glutamyl group of the antifolate). In some embodiments, each glutamyl group in γPANTIFOL other than the glutamyl group of the antifolate has a gamma linkage. In some embodiments, two or more glutamyl groups in γPANTIFOL have a gamma linkage. In some embodiments, each glutamyl group in γPANTIFOL is in the L-form. In some embodiments, each glutamyl group in γPANTIFOL other than the glutamyl group of the antifolate is in the D-form. In some embodiments, γPANTIFOL comprises two or more glutamyl groups in the L-form and one or more glutamyl groups in the D-form.

[0091] In some embodiments, the antifolate is selected from PMX, MTX, RTX, and LTX, or stereoisomers thereof.

[0092] In some embodiments, the antifolate is selected from: LV (etoposide), L-leucovorin (L-5-formyltetrahydrofolate); 5-CH3-THF, 5-methyltetrahydrofolate; FA, folic acid; PteGlu, pteroylglutamate (FA); MTX, methotrexate; 2-dMTX, 2-desamino-MTX; 2-CH3-MTX, 2-desamino-2-methyl-MTX; AMT, aminopterin; 2-dAMT, 2-desamino-AMT; 2-CH3-AMT, 2-desamino-2-methyl-AMT; 10-EdAM, 10-ethyl-10-deazaaminopterin; PT523, N alpha-(4-amino-4-deoxypteroyl)-N Delta-(hemiphthaloyl)-L-ornithine; DDATHF (lometrexol), 5,10-dideaza-5,6,7,8-tetrahydrofolic acid; 5-d(i)H4PteGlu, 5-deaza-5,6,7,8-tetrahydroisofolic acid; N9-CH3-5-d(i)H4PteGlu, N9-methyl-5-deaza-5,6,7,8-tetrahydroisofolic acid; 5-dPteHCysA, N alpha-(5-deazapteroyl)-L-homocysteic acid; 5-dPteAPBA, N alpha-(5-deazapteroyl)-DL-2-amino-4-phosphonobutyric acid; 5-dPteOrn, N alpha-(5-deazapteroyl)-L-ornithine; 5-dH4PteHCysA, N Alpha-(5-deaza-5,6,7,8-tetrahydropteroyl)-L-homocysteic acid; 5-dH4PteAPBA, N Alpha-(5-deaza-5,6,7,8-tetrahydropteroyl)-DL-2-amino-4-phosphobutanoic acid; 5-dH4PteOro, N Alpha-(5-dideaza-5,6,7,8-tetrahydropteroyl)-L-ornithine; CB3717, N10-propargyl-5,8-dideazafolate; ICI-198,583, 2-desamino-2-methyl-N10-propargyl-5,8-dideazafolate; 4-H-ICI-198,583, 4-deoxy-ICI-198,583; 4-OCH3-ICI-198,583, 4-methoxy-ICI-198,583 Glu-to-Val-ICI-198,583; valine-ICI-198;583;Glu-to-Sub-ICI-198,583, 2-aminosuberic acid-ICI-198,583; 7-CH3-ICI-198,583, 7-methyl-ICI-198,583; ZD1694, N-[5(N-(3,4-dihydro-2-methyl-4-oxoquinazolin-6-yl-methyl)amino)2-thienyl)]-L-glutamic acid; 2-NH2- ZD1694, 2-amino-ZD1694; BW1843U89, (S)-2[5-(((1,2-dihydro-3-methyl-1-oxobenzo(f)quinazolin-9-yl)methyl)amino-)-1-oxo-2-isoindolinyl]-glutaric acid; LY231514, N-(4-(2-(2-amino-4,7-dihydro-4-oxo-3H-pyrrolo[2,3 -D]pyrimidin-5-yl)ethyl)-benzoyl]-L-glutamic acid; IAHQ, 5,8-dideazaisofolic acid; 2-dIAHQ, 2-desamino-IAHQ; 2-CH3-dIAHQ, 2-desamino-2-methyl-IAHQ; 5-d(i)PteGlu, 5-deazaisofolic acid; N9-CH3-5-d(i)PteGlu, N9-methyl-5-deazaisofolic acid; N9-CHO-5-d(i)PteGlu, N9-formyl-5-deazaisofolic acid; AG337, 3,4-dihydro-2-amino-6-methyl-4-oxo-5-(4-pyridylthio)quanazoline; and AG377, 2,4-diamino-6[N-(4-(phenysulfonyl)benzyl)ethyl)amino]quinazoline; or stereoisomers thereof. ;

[0093] In some embodiments, the antifolate is selected from methotrexate, raltitrexed, previtrexed, pemetrexed, lometrexol (LTX; 5,10-dideazatetrahydrofolic acid), cyclopenta[g]quinazolines with dipeptide ligands, CB3717, CB300945, or stereoisomers thereof, such as 6-R,S-BGC945 (ONX-0801), CB300638, and BW1843U89.

[0094] In some embodiments, the antifolate is a 6-substituted pyrrolo[2,3-d]pyrimidine benzoylantifolate. In some embodiments, the antifolate is a 6-substituted pyrrolo[2,3-d]pyrimidine benzoylantifolate having a carbon bridge length of 1 to 6 carbons (e.g., compounds having the structure of Formula (I), n1=1-6). In some embodiments, the antifolate is a 6-substituted thieno[2,3-d]pyrimidine benzoylantifolate having a bridge length of 2 to 8 carbons (e.g., compounds having the structure of Formula (II), n2=7-13). In some embodiments, the antifolate is a 6-substituted pyrrolo[2,3-d]pyrimidine antifolate having a bridge length of 2 to 8 carbons in which the benzoyl moiety is replaced with a thienoyl (e.g., compounds having the structure of Formula (III), n1=1-6). In some embodiments, the antifolate has a structure according to any of Formulas (I)-(III), where x=4, 5, 2-10, 4-6, or greater than 5. [ka]

[0095] In some embodiments, the antifolate is selected from: an indoline ring and a modified ornithine-containing methotrexate derivative, an indoline ring and a modified glutamic acid-containing methotrexate derivative, an alkyl-substituted benzene ring C-containing methotrexate derivative, a benzoxazine moiety-containing methotrexate derivative, a benzothiazine moiety-containing methotrexate derivative, a 10-deazaaminopterin analog, a 5-deazaaminopterin methotrexate analog, a 5,10-dideazaaminopterin methotrexate analog, an indoline ring and a modified ornithine-containing methotrexate derivative, an indoline ring and a modified glutamic acid-containing methotrexate derivative, an alkyl-substituted benzene ring C-containing methotrexate derivative, a benzoxazine moiety-containing methotrexate derivative, a 10-deazaaminopterin analog, a 5-deazaaminopterin methotrexate analog, a 5,10-dideazaaminopterin methotrexate analog, an indoline ring and a modified glutamic acid-containing methotrexate derivative, an alkyl-substituted benzene ring C-containing methotrexate derivative, a benzoxazine moiety-containing methotrexate derivative, a 10-deazaaminopterin analog, a 5-deazaaminopterin analog, a 5,10-dideazaaminopterin analog, an indoline ring and a modified glutamic acid-containing methotrexate derivative, an indoline ring and a modified glutamic acid-containing methotrexate derivative, an alkyl-substituted benzene ring C ... methotrexate derivatives containing the dorine moiety, lipophilic amide methotrexate derivatives, L-threo-(2S,4S)-4-fluoroglutamic acid-containing methotrexate analogs, DL-3,3-difluoroglutamic acid-containing methotrexate analogs, methotrexate tetrahydroquinazoline analogs, N-(ac-aminoacyl) methotrexate derivatives, biotin methotrexate derivatives, D-glutamic acid methotrexate analogs, D-erythro,threo-4-fluoroglutamic acid methotrexate analogs, β,γ-methano Methotrexate analogs, 10-deazaaminopterin (10-EDAM) analogs, gamma-tetrazole methotrexate analogs, N-(L-alpha-aminoacyl) methotrexate derivatives, meta isomers of aminopterin, ortho isomers of aminopterin, hydroxymethyl methotrexate, gamma-fluoromethotrexate, polyglutamyl methotrexate derivatives, gem-diphosphonate methotrexate analogs (see, e.g., International Application No. 1988 / 06158, the contents of which are incorporated herein by reference in their entirety), alpha-substituted methotrexate analogs, gamma-substituted methotrexate analogs, 5-methyl-5-deazamethotrexate analogs (see, e.g., U.S. Pat. No. 4,725,687, the contents of which are incorporated herein by reference in their entirety), N δ-acyl-N α-(4-amino-4-deoxypteroyl)-L-ornithine derivatives, 8-deazamethotrexate analogs, acivicin methotrexate analogs, polymeric platinol methotrexate derivatives, methotrexate-γ-dimyristoylphosphatidylethanolamine, methotrexate polyglutamate analogs, poly-γ-glutamyl methotrexate derivatives, deoxyuridylate methotrexate derivatives, iodoacetyl lysine methotrexate methotrexate analogs, 2,ω-diaminoalkaloid acid-containing methotrexate analogs, polyglutamate derivatives, 5-methyl-5-deaza analogs, quinazoline methotrexate analogs, pyrazine methotrexate analogs, cysteine ​​or homocysteic acid methotrexate analogs (see, e.g., U.S. Pat. Nos. 4,490,529 and EPA 0142220, the contents of which are incorporated herein by reference in their entireties), γ-tert- Butyl methotrexate ester, fluorinated methotrexate analogs, folate methotrexate analogs, phosphonoglutamic acid analogs, poly(L-lysine) methotrexate conjugates, dilysine or trilysine methotrexate derivatives, 7-hydroxymethotrexate, poly-γ-glutamyl methotrexate analogs, 3',5'-dichloromethotrexate, diazoketone or chloromethylketone methotrexate analogs, 10-propargyl methotrexate aminopterin, alkyl methotrexate homologs, lectin derivatives of methotrexate, polyglutamate methotrexate derivatives, halogenated methotrexate derivatives, 8-alkyl-7,8-dihydro analogs, 7-methyl methotrexate derivatives, dichloromethotrexate, lipophilic methotrexate derivatives, 3',5'-dichloromethotrexate, deazaamethopterin analogs, and MX068; or stereoisomers thereof.

[0096] In some embodiments, the antifolate has formula (IV): [ka] where X = CH2, C2H4, or O(CH2)3O; R1 = Me or Et; R2 = H, Cl, F, OH, or R2 = R3; and R3 = H, Cl, F, OH, Me, or Br.

[0097] In some embodiments, the antifolate has formula (IV), where X = CH; R = Me or Et; R = H, Cl, F, OH, or R = R; and R = H, Cl, F, OH, Me, or Br. In some embodiments, X = CH; R = Me; R = H, Cl, F, OH; and R = H, Cl, Me, or Br. In some embodiments, X = O(CH)O; R = Me; and R = R = H.

[0098] In some embodiments, the antifolate has formula (V): [ka] where X=C2H4, C4H8, or C6H 12 , O(CH2)2O, or O(CH2)3O; R1 = H or Cl, or R2 = R3; and R3 = H or Cl.

[0099] In some embodiments, the antifolate has the formula (V), where X=C2H4; and R1=R2=H or Cl. In some embodiments, X=C2H4; R1=Cl; and R2=H. In some embodiments, X=C4H8; and R1=R2=H. In some embodiments, X=C6H 12 and R1=R2=H.

[0100] In some embodiments, the antifolate has formula (VI): [ka] where X = CH2 or C2H4; Y = 2,5-thiophene; and R = CH2F, Cn, Et, Me, or CH2OH.

[0101] In some embodiments, the antifolate has formula (VI), where X = CH; Y = 2,5-thiophene; and R = HF, Cn, Et, or CHOH. In some embodiments, X = CH; Y = 2,5-thiophene; and R = Me.

[0102] In some embodiments, the antifolate has formula (VII): [ka] where X=N or CH, Y=NH2, CH3, or H; and R=CH3, CHO, or H.

[0103] In some embodiments, the antifolate has formula (VII), where: (a) X=N; Y=NH2; and R=H; (b) X=N; H=NH2; and R=CH3; (c) X=N; Y=NH2; and R=CHO; (d) X=CH, Y=NH2, R=H; (e) X=CH, Y=H, R=H; or (f) X=CH, Y=CH3, and R=H.

[0104] In some embodiments, the antifolate has formula (VIII): [ka] where A=NH, NCH3, or CH2.

[0105] In some embodiments, the antifolate has formula (IX): [ka] and Y=Glu, (b) X=OCH3; R=H; and Y=Glu, (c) X=OH; R=H; and Y=valine; (d) X=OH; R=H; and Y=suberate; or (e) X=OH; R=CH3; and Y=Glu.

[0106] In further embodiments, the antifolate is a cyclopenta[g]quinazoline derivative. In some embodiments, the cyclopenta[g]quinazoline derivative is N-{N-{4-[N-(2-methyl-4-oxo-3,4,7,8-tetrahydro-6H-cyclopenta[g]quinazolin-6-yl)-N-(prop-2-ynyl)amino]benzoyl}-L-γ-glutamyl}-D-glutamic acid; or N-{N-{4-[N-(2-hydroxymethyl-4-oxo-3,4,7,8-tetrahydro-6H-cyclopenta[g]quinazolin-6-yl)-N-(prop-2-ynyl)amino]benzoyl}-L-γ-glutamyl}-D-glutamic acid; or a pharmaceutically acceptable salt or ester thereof.

[0107] In some embodiments, the antifolate has formula (X): [ka] wherein R1 is H, amino, C1-4 alkyl, C1-4 alkoxy, C1-4 hydroxyalkyl or C1-4 fluoroalkyl; R2 is hydrogen, C1-4 alkyl, C3-4 alkenyl, C3-4 alkynyl, C2-4 hydroxyalkyl, C2-4 halogenoalkyl or C1-4 cyanoalkyl; Ar is phenylene, thiophenediyl, thiazoldiyl, pyridinediyl or pyrimidinediyl, which optionally bears one or two substituents selected from halogeno, hydroxy, amino, nitro, cyano, trifluoromethyl, C1-4 alkyl and C1-4 alkoxy, and R3 is a group of one of the following formulas: -NHCH(CO2H)-A1-Y1-NH-A3-Y3, or R3 is an alpha or gamma carboxyl linked L- or D-glutamyl group.

[0108] In some embodiments, the antifolate has the formula (X), wherein R1 is C1-4 alkyl or C1-4 hydroxyalkyl (e.g., methyl or hydroxymethyl); R2 is (a) methyl, ethyl, propyl, prop-2-enyl, prop-2-ynyl, 2-hydroxyethyl, 2-fluoroethyl, 2-bromoethyl, or 2-cyanoethyl, (b) methyl, or (c) prop-2-ynyl; and Ar is 1,4-phenylene or 1,4-phenylene having one or two substituents selected from chloro and fluoro (e.g., a 2-fluoro substituent, e.g., 2-fluoro-1,4-phenylene or 2,6-difluoro-1,4-phenylene), thiophene-2,5-diyl, thiazol-2,5-diyl, or pyridine-2,5-diyl.

[0109] In some embodiments, the antifolate has the formula (X), where R is methyl or hydroxymethyl; R is methyl or prop-2-ynyl; and Ar is 1,4-phenylene or 2,6-difluoro-1,4-phenylene or, particularly, 1,4-phenylene with a 2-fluoro substituent, such as 2-fluoro-1,4-phenylene, or pyridine 2,5-diyl. In some embodiments, Ar is 1,4-phenylene or 2-fluoro-1,4-phenylene.

[0110] In other embodiments, the gamma polyglutamated antifolate is a cyclopenta[g]quinazoline as disclosed in WO 2009 / 115776, WO 2003 / 020300, WO 2003 / 020706, WO 2003 / 020748, Gibbs et al., Cancer Research 65(15):11721-11728 (2005), and Babetsias et al., Tetrahedron 63(7):1537-1543 (2007), the contents of each of which are incorporated herein by reference in their entirety.

[0111] In some embodiments, the gamma polyglutamated antifolate is diglutamated. That is, the gamma polyglutamated antifolate contains one additional glutamyl group in addition to the glutamyl groups in the antifolate (γANTIFOL-PG1), where the additional glutamyl group is linked to the glutamyl group in the antifolate via a gamma bond. In some embodiments, each glutamyl group in the gamma diglutamated antifolate is in the L-form. In other embodiments, the gamma diglutamated antifolate contains a glutamyl group in the D-form.

[0112] In some embodiments, the gamma polyglutamated antifolate is triglutamated. That is, the gamma polyglutamated antifolate contains two gamma glutamyl groups in addition to the glutamyl group in the antifolate (γANTIFOL-PG2). In some embodiments, each of the two additional glutamyl groups has a gamma linkage. In other embodiments, one of the two glutamyl groups has a gamma linkage and the other glutamyl group has a gamma linkage. In some embodiments, each glutamyl group in the gamma triglutamated antifolate is in the L-form. In other embodiments, the gamma triglutamated antifolate contains a glutamyl group in the D-form. In further embodiments, each glutamyl group in the gamma triglutamated antifolate other than the gamma glutamyl group in the antifolate is in the D-form. In a further embodiment, the gamma triglutamated antifolate comprises a glutamyl group in the D-configuration and two or more glutamyl groups in the L-configuration.

[0113] In some embodiments, the gamma polyglutamated antifolate is tetraglutamated and thus contains three gamma glutamyl groups in addition to the glutamyl group of the antifolate (γANTIFOL-PG3). In some embodiments, the gamma tetraglutamated antifolate contains two or more gamma glutamyl groups in the L-form. In further embodiments, each gamma glutamyl group of the gamma tetraglutamated antifolate is in the L-form. In other embodiments, the gamma tetraglutamated antifolate contains a gamma glutamyl group in the D-form. In some embodiments, the gamma tetraglutamated antifolate contains two gamma glutamyl groups in the D-form. In some embodiments, each glutamyl group of the gamma tetraglutamated antifolate other than the glutamyl group in the antifolate is in the D-form. In a further embodiment, the tetraglutamated antifolate comprises a gamma glutamyl group in the D-configuration and two or more gamma glutamyl groups in the L-configuration.

[0114] In some embodiments, the gamma polyglutamated antifolate is pentaglutamated (γANTIFOL-PG4) and contains a chain of four gamma glutamyl groups linked to a glutamyl group in the antifolate. In some embodiments, the gamma pentaglutamated antifolate contains two or more glutamyl groups in the L-form. In further embodiments, each glutamyl group in the gamma pentaglutamated antifolate is in the L-form. In other embodiments, the gamma pentaglutamated antifolate contains a glutamyl group in the D-form. In some embodiments, the gamma tetraglutamated antifolate contains two or three gamma glutamyl groups in the D-form. In further embodiments, each gamma glutamyl group in the gamma pentaglutamated antifolate other than the glutamyl group in the antifolate is in the D-form. In a further embodiment, the pentaglutamated antifolate comprises a gamma glutamyl group in the D-configuration and two or more gamma glutamyl groups in the L-configuration.

[0115] In some embodiments, the gamma polyglutamated antifolate is hexaglutamated (γANTIFOL-PG5) and contains a chain of five gamma glutamyl groups attached to a glutamyl group in the antifolate. In some embodiments, the gamma hexaglutamated antifolate contains two or more gamma glutamyl groups in the L-form. In further embodiments, each glutamyl group in the gamma hexaglutamated antifolate is in the L-form. In other embodiments, the gamma hexaglutamated antifolate contains a gamma glutamyl group in the D-form. In some embodiments, the gamma tetraglutamated antifolate contains two, three, four, or five gamma glutamyl groups in the D-form. In further embodiments, each glutamyl group in the gamma hexaglutamated antifolate other than the glutamyl group in the antifolate is in the D-form. In a further embodiment, the hexaglutamated antifolate comprises a D-glutamyl group and two or more L-glutamyl groups.

[0116] In some embodiments, the gamma polyglutamated antifolate is heptaglutamated (γANTIFOL-PG6), thus comprising a chain of six gamma glutamyl groups linked to a glutamyl group in the antifolate. In some embodiments, the gamma heptaglutamated antifolate comprises two or more gamma glutamyl groups in the L-form. In further embodiments, each gamma glutamyl group in the gamma heptaglutamated antifolate is in the L-form. In other embodiments, the gamma heptaglutamated antifolate comprises a gamma glutamyl group in the D-form. In some embodiments, the gamma tetraglutamated antifolate comprises two, three, four, five, or six gamma glutamyl groups in the D-form. In further embodiments, each gamma glutamyl group in the gamma heptaglutamated antifolate other than the glutamyl group in the antifolate is in the D-form. In a further embodiment, the heptaglutamated antifolate comprises a gamma glutamyl group in the D-configuration and two or more gamma glutamyl groups in the L-configuration.

[0117] In some embodiments, the gamma polyglutamated antifolate is octaglutamated (γANTIFOL-PG7), thus comprising a chain of seven gamma glutamyl groups linked to a glutamyl group in the antifolate. In some embodiments, the gamma octaglutamated antifolate comprises two or more glutamyl groups in the L-form. In further embodiments, each glutamyl group in the gamma octaglutamated antifolate is in the L-form. In other embodiments, the gamma octaglutamated antifolate comprises a glutamyl group in the D-form. In some embodiments, the gamma octaglutamated antifolate comprises two, three, four, five, six, or seven gamma glutamyl groups in the D-form. In further embodiments, each glutamyl group in the gamma octaglutamated antifolate other than the glutamyl group in the antifolate is in the D-form. In a further embodiment, the octaglutamated antifolate comprises a glutamyl group in the D-configuration and two or more glutamyl groups in the L-configuration.

[0118] In some embodiments, the gamma polyglutamated antifolate is nonaglutamated (γANTIFOL-PG8), comprising a chain of eight gamma glutamyl groups linked to a glutamyl group in the antifolate. In some embodiments, the gamma nonaglutamated antifolate comprises two or more glutamyl groups in the L-form. In further embodiments, each glutamyl group in the gamma nonaglutamated antifolate is in the L-form. In other embodiments, the gamma nonaglutamated antifolate comprises a glutamyl group in the D-form. In further embodiments, each glutamyl group in the gamma nonaglutamated antifolate other than the glutamyl group in the antifolate is in the D-form. In still further embodiments, the nonaglutamated antifolate comprises a gamma glutamyl group in the D-form and two or more gamma glutamyl groups in the L-form.

[0119] In some embodiments, the gamma polyglutamated antifolate is deca-glutamated (γANTIFOL-PG9) (i.e., comprises a chain of nine gamma glutamyl groups attached to a glutamyl group in the antifolate). In some embodiments, the gamma deca-glutamated antifolate comprises two or more glutamyl groups in the L-form. In further embodiments, each glutamyl group in the gamma deca-glutamated antifolate is in the L-form. In other embodiments, the gamma deca-glutamated antifolate comprises a glutamyl group in the D-form. In further embodiments, each glutamyl group in the gamma deca-glutamated antifolate other than the glutamyl group in the antifolate is in the D-form. In still further embodiments, the deca-glutamated antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.

[0120] In some embodiments, the gamma polyglutamated antifolate is undecaglutamated (γANTIFOL-PG10) and comprises a chain of 10 gamma glutamyl groups linked to a glutamyl group in the antifolate. In some embodiments, the gamma undecaglutamated antifolate comprises two or more glutamyl groups in the L-form. In further embodiments, each glutamyl group in the gamma undecaglutamated antifolate is in the L-form. In other embodiments, the gamma undecaglutamated antifolate comprises a glutamyl group in the D-form. In further embodiments, each glutamyl group in the gamma undecaglutamated antifolate other than the glutamyl group in the antifolate is in the D-form. In still further embodiments, the undecaglutamated antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.

[0121] In some embodiments, the gamma polyglutamated antifolate is dodecaglutamated (γANTIFOL-PG11) and comprises a chain of 11 gamma glutamyl groups linked to a glutamyl group in the antifolate. In some embodiments, the gamma dodecaglutamated antifolate comprises two or more glutamyl groups in the L-form. In further embodiments, each glutamyl group in the gamma dodecaglutamated antifolate is in the L-form. In other embodiments, the gamma dodecaglutamated antifolate comprises a glutamyl group in the D-form. In further embodiments, each glutamyl group in the gamma dodecaglutamated antifolate other than the glutamyl group in the antifolate is in the D-form. In still further embodiments, the dodecaglutamated antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.

[0122] In some embodiments, the gamma polyglutamated antifolate is tridecaglutamated (γANTIFOL-PG12) and comprises a chain of 12 gamma glutamyl groups attached to a glutamyl group in the antifolate. In some embodiments, the gamma tridecaglutamated antifolate comprises two or more glutamyl groups in the L-form. In further embodiments, each glutamyl group in the gamma tridecaglutamated antifolate is in the L-form. In other embodiments, the gamma tridecaglutamated antifolate comprises a glutamyl group in the D-form. In further embodiments, each glutamyl group in the gamma tridecaglutamated antifolate other than the glutamyl group in the antifolate is in the D-form. In still further embodiments, the tridecaglutamated antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.

[0123] In some embodiments, the gamma polyglutamated antifolate is tetradecaglutamated (γANTIFOL-PG13) and comprises a chain of 13 gamma glutamyl groups linked to a glutamyl group in the antifolate. In some embodiments, the gamma tetradecaglutamated antifolate comprises two or more glutamyl groups in the L-form. In further embodiments, each glutamyl group in the gamma tetradecaglutamated antifolate is in the L-form. In other embodiments, the gamma tetradecaglutamated antifolate comprises a glutamyl group in the D-form. In further embodiments, each glutamyl group in the gamma tetradecaglutamated antifolate other than the glutamyl group in the antifolate is in the D-form. In further embodiments, the tetradecaglutamated antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.

[0124] In some embodiments, the gamma polyglutamated antifolate is pentadeca-glutamated (γANTIFOL-PG14) and comprises a chain of 14 gamma glutamyl groups linked to a glutamyl group in the antifolate. In some embodiments, the gamma pentadeca-glutamated antifolate comprises two or more glutamyl groups in the L-form. In further embodiments, each glutamyl group in the gamma pentadeca-glutamated antifolate is in the L-form. In other embodiments, the gamma pentadeca-glutamated antifolate comprises a glutamyl group in the D-form. In further embodiments, each glutamyl group in the gamma pentadeca-glutamated antifolate other than the glutamyl group in the antifolate is in the D-form. In still further embodiments, the pentadeca-glutamated antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.

[0125] In some embodiments, the gamma polyglutamated antifolate is hexadeca-glutamated (γANTIFOL-PG15) and comprises a chain of 15 gamma glutamyl groups linked to a glutamyl group in the antifolate. In some embodiments, the gamma hexadeca-glutamated antifolate comprises two or more glutamyl groups in the L-form. In further embodiments, each glutamyl group in the gamma hexadeca-glutamated antifolate is in the L-form. In other embodiments, the gamma hexadeca-glutamated antifolate comprises a glutamyl group in the D-form. In further embodiments, each glutamyl group in the gamma hexadeca-glutamated antifolate other than the glutamyl group in the antifolate is in the D-form. In still further embodiments, the hexadeca-glutamated antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.

[0126] In other embodiments, the gamma polyglutamated antifolate is heptadeca-glutamated (γANTIFOL-PG16), comprising a chain of 16 gamma glutamyl groups linked to a glutamyl group in the antifolate. In some embodiments, the gamma heptadeca-glutamated antifolate comprises two or more glutamyl groups in the L-form. In further embodiments, each glutamyl group in the gamma heptadeca-glutamated antifolate is in the L-form. In other embodiments, the gamma heptadeca-glutamated antifolate comprises a glutamyl group in the D-form. In further embodiments, each glutamyl group in the gamma heptadeca-glutamated antifolate other than the glutamyl group in the antifolate is in the D-form. In further embodiments, the heptadeca-glutamated antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.

[0127] In some embodiments, the gamma polyglutamated antifolate is octadeca-glutamated (γANTIFOL-PG17), comprising a chain of 17 gamma glutamyl groups linked to a glutamyl group in the antifolate. In some embodiments, the gamma octadeca-glutamated antifolate comprises two or more glutamyl groups in the L-form. In further embodiments, each glutamyl group in the gamma octadeca-glutamated antifolate is in the L-form. In other embodiments, the gamma octadeca-glutamated antifolate comprises a glutamyl group in the D-form. In further embodiments, each glutamyl group in the gamma octadeca-glutamated antifolate other than the glutamyl group in the antifolate is in the D-form. In further embodiments, the octadeca-glutamated antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.

[0128] In some embodiments, the gamma polyglutamated antifolate is nonadeca-glutamated (γANTIFOL-PG18), comprising a chain of 18 gamma glutamyl groups attached to a glutamyl group in the antifolate. In some embodiments, the gamma nonadeca-glutamated antifolate comprises two or more glutamyl groups in the L-form. In further embodiments, each glutamyl group in the gamma nonadeca-glutamated antifolate is in the L-form. In other embodiments, the gamma nonadeca-glutamated antifolate comprises a glutamyl group in the D-form. In further embodiments, each glutamyl group in the gamma nonadeca-glutamated antifolate other than the glutamyl group in the antifolate is in the D-form. In still further embodiments, the nonadeca-glutamated antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.

[0129] In some embodiments, the gamma polyglutamated antifolate is eicosa-glutamated (γANTIFOL-PG19), comprising a chain of 19 gamma glutamyl groups linked to a glutamyl group in the antifolate. In some embodiments, the gamma polyglutamated antifolate comprises two or more glutamyl groups in the L-form. In further embodiments, each glutamyl group in the gamma polyglutamated antifolate is in the L-form. In other embodiments, the gamma polyglutamated antifolate comprises a glutamyl group in the D-form. In further embodiments, each glutamyl group in the gamma polyglutamated antifolate other than the glutamyl group in the antifolate is in the D-form. In still further embodiments, the eicosa-glutamated antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.

[0130] In some embodiments, the gamma polyglutamated antifolate is henicosaglutamated (γANTIFOL-PG20), comprising a chain of 20 gamma glutamyl groups linked to a glutamyl group in the antifolate. In some embodiments, the gamma polyglutamated antifolate comprises two or more glutamyl groups in the L-form. In further embodiments, each glutamyl group in the gamma polyglutamated antifolate is in the L-form. In other embodiments, the gamma polyglutamated antifolate comprises a glutamyl group in the D-form. In further embodiments, each glutamyl group in the gamma polyglutamated antifolate other than the glutamyl group in the antifolate is in the D-form. In still further embodiments, the henicosaglutamated antifolate comprises a glutamyl group in the D-form and two or more glutamyl groups in the L-form.

[0131] In some embodiments, the gamma polyglutamated antifolate comprises 4-7 glutamyl groups attached to the antifolate (i.e., γANTIFOL-PGn, n=4-7), wherein each of the 4-7 linked glutamyl groups has a gamma linkage. In some embodiments, each of the 4-7 linked glutamyl groups is in the L-form. In other embodiments, each of the 4-7 linked glutamyl groups is in the D-form. In other embodiments, the 4-7 linked glutamyl groups are in both the L- and D-forms.

[0132] In some embodiments, a gamma polyglutamated antifolate (γPANTIFOL) contains a total of 1 to 15, 1 to 10, 2 to 15, 2 to 10, 3 to 15, 3 to 10, 3 to 6, 3 to 5, 4 to 10, 4 to 7, or 4 to 6 glutamyl groups, including the glutamyl groups of the antifolate, or any range therebetween. In some embodiments, each glutamyl group in γPANTIFOL other than the glutamyl groups in the antifolate has a gamma linkage. In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 of the glutamyl groups in γPANTIFOL have a gamma linkage. In some embodiments, γPANTIFOL contains gamma glutamyl groups in the L- and D-forms. In some embodiments, each glutamyl group in the polyglutamate structure of a polyglutamated antifolate is in the L-form. In some embodiments, each glutamyl group in γPANTIFOL other than the glutamyl group in the antifolate is in the D form. In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 of the glutamyl groups in γPANTIFOL are in the L form. In other embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 of the glutamyl groups in γPANTIFOL are in the D form.

[0133] In some embodiments, the gamma polyglutamated antifolate (γPANTIFOL) contains a total of 2 to 20, 2 to 15, 2 to 10, 2 to 5, or any range therebetween, glutamyl groups, including the glutamyl groups of the antifolate. In some embodiments, each glutamyl group in γPANTIFOL is in the L-form. In some embodiments, each glutamyl group in γPANTIFOL other than the glutamyl groups in the antifolate is in the D-form. In one embodiment, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of the glutamyl groups in γPANTIFOL are in the L-form. In another embodiment, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 of the glutamyl groups in γPANTIFOL are in the D form.

[0134] In some embodiments, the gamma polyglutamated antifolate contains a total of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 glutamyl groups in addition to the glutamyl group of the antifolate.

[0135] In some embodiments, a total of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 glutamyl groups in the gamma polyglutamated antifolate are in the L-form, the D-form, or the L- and D-form. In some embodiments, each glutamyl group in the gamma polyglutamated antifolate is in the L-form. In other embodiments, each glutamyl group in the gamma polyglutamated antifolate other than the glutamyl group in the antifolate is in the D-form. In alternative embodiments, at least two of the glutamyl groups in the gamma polyglutamated antifolate are in the L-form and at least one of the glutamyl groups in the gamma polyglutamated antifolate is in the D-form. In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 glutamyl groups in the gamma polyglutamated antifolate are in the L-form. In other embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 glutamyl groups in the gamma polyglutamated antifolate are in the D-form.

[0136] In further embodiments, the gamma polyglutamated antifolate contains 20-100, 20-75, 20-50, 20-40, 20-30, 20-25, or more than 100 glutamyl groups, or any range therebetween. In some embodiments, each glutamyl group in the gamma polyglutamated antifolate is in the L-form. In other embodiments, each glutamyl group in the gamma polyglutamated antifolate other than the glutamyl group in the antifolate is in the D-form. In alternative embodiments, at least two of the glutamyl groups in the gamma polyglutamated antifolate are in the L-form and at least one of the glutamyl groups in the gamma polyglutamated antifolate is in the D-form.

[0137] In further embodiments, provided compositions comprise a gamma polyglutamated antifolate containing 1, 2, 3, 4, 5, 6, 7, 8, 9, 1-10, or 1-20 glutamyl groups with gamma linkages. In some embodiments, the gamma polyglutamated antifolate contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 1-10, or 1-20 glutamyl groups in the L-form. In some embodiments, the gamma polyglutamated antifolate contains 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 1-10, or 1-20 glutamyl groups in the D-form. In some embodiments, the gamma polyglutamated antifolate contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 1-10, or 1-20 L-glutamyl groups and 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 1-10, or 1-20 D-glutamyl groups.

[0138] In some embodiments, the gamma polyglutamated antifolate compositions provided herein can be tagged with one or more additional glutamyl groups, i.e., the compositions can serve as substrates for FPGS (folylpolyglutamate synthetase). Reagents and assays to measure the ability of gamma polyglutamated antifolate compositions to act as substrates for FPGS (e.g., human FPGS, or rat liver FPGS) are readily available and can be performed routinely.

[0139] In some embodiments, the rate of hepatocyte uptake of naked gamma-PANTIFOL compositions disclosed herein (e.g., gamma-PANTIFOL not conjugated to a delivery vehicle) is significantly reduced compared to the rate of uptake of an antifolate under physiological conditions. In some embodiments, the rate of hepatocyte uptake of naked gamma-PANTIFOL compositions is less than 30%, 20%, 15%, or 10% of the rate of the antifolate. In further embodiments, the rate of efflux (transport) of the gamma-PANTIFOL compositions disclosed herein from hepatocytes occurs at a significantly slower rate (less than 30%, 20%, 15%, or 10%) compared to the antifolate.

[0140] In some embodiments, the gamma polyglutamated antifolate compositions provided herein have greater cytotoxicity against hyperproliferative cells than antifolates. In some embodiments, the hyperproliferative cells are cancer cells. In some embodiments, the hyperproliferative cells are colorectal cancer cells, colon cancer cells, breast cancer cells, or ovarian cancer cells. In some embodiments, the cancer cells are mesothelioma cells or non-small cell lung cancer cells. In some embodiments, the cytotoxicity is measured in an in vitro assay. In some embodiments, the gamma polyglutamated antifolate is a hexaglutamated antifolate.

[0141] In some embodiments, the gamma polyglutamated antifolate compositions provided herein have fewer toxic side effects than antifolates. In some embodiments, the gamma polyglutamated antifolate compositions provided herein are less toxic to non-hyperproliferative cells than antifolates. In some embodiments, the gamma polyglutamated antifolate compositions provided herein are less toxic to neutrophils, liver cells, or colon epithelial cells than antifolates. In some embodiments, the neutrophils are human neutrophils, differentiated human neutrophils, or neutrophils differentiated from CD34+ cells. In some embodiments, the liver cells are AML12 liver cells. In some embodiments, the colon epithelial cells are CCD841 colon epithelial cells. In some embodiments, toxicity is measured by an in vitro assay. In some embodiments, the gamma polyglutamated antifolate is a hexaglutamated antifolate.

[0142] In some embodiments, the gamma polyglutamated antifolate compositions provided herein have fewer toxic side effects than antifolates. In some embodiments, the gamma polyglutamated antifolate compositions provided herein result in fewer or less severe toxic side effects than antifolates in in vivo assays. In some embodiments, the in vivo assay is performed in an in vivo mouse model. In some embodiments, the gamma polyglutamated antifolate compositions provided herein result in fewer or less severe hematologic or hepatotoxic side effects than antifolates. In some embodiments, hematologic side effects are assessed by mean neutrophil, mean white blood cell, or mean platelet counts. In some embodiments, hepatotoxic side effects are assessed by measuring serum aspartate aminotransferase (AST), serum alanine aminotransferase (ALT), and / or serum albumin levels. In some embodiments, the in vivo assay involves administering 40 mg / kg or 80 mg / kg of a gamma polyglutamated antifolate composition once a week for four weeks. In some embodiments, the gamma polyglutamated antifolate is a hexaglutamated antifolate.

[0143] In some embodiments, treatment with the gamma polyglutamated antifolate compositions provided herein does not induce significant hematologic or liver toxic side effects in an in vivo mouse model. In some embodiments, hematologic side effects are assessed by mean neutrophil, mean white blood cell, or mean platelet counts. In some embodiments, liver toxic side effects are assessed by measuring serum aspartate aminotransferase (AST), serum alanine aminotransferase (ALT), and / or serum albumin levels. In some embodiments, the gamma polyglutamated antifolate compositions provided herein do not significantly reduce mean neutrophil, mean white blood cell, or mean platelet counts. In some embodiments, the gamma polyglutamated antifolate compositions provided herein do not significantly increase serum aspartate aminotransferase (AST) and serum alanine aminotransferase (ALT) levels. In some embodiments, the gamma polyglutamated antifolate compositions provided herein do not significantly reduce serum albumin levels. In some embodiments, the in vivo assay involves administering 40 mg / kg or 80 mg / kg of a gamma polyglutamated antifolate composition once a week for four weeks. In some embodiments, the gamma polyglutamated antifolate is a hexaglutamated antifolate.

[0144] In some embodiments, the gamma polyglutamated antifolate composition does not contain fluorine atoms, hi some embodiments, the gamma polyglutamated antifolate composition does not contain 4-fluoroglutamyl groups.

[0145] Gamma polyglutamated antifolate (γPANTIFOL) compositions and their uses are further described in International Application No. PCT / US2017 / 046667 and U.S. Patent Application Nos. 62 / 630,824, 62 / 630,613, 62 / 630,713, 62 / 630,620, 62 / 627,733, 62 / 630,625, 62 / 630,652, 62 / 627,732, 62 / 636,289, 62 / 630,751, 62 / 630,821, 62 / 627,741, and 62 / 583,432, respectively. The disclosures of each of these are incorporated herein by reference in their entirety.

[0146] A. Gamma Polyglutamated Antifolate Analogs and Derivatives The present disclosure also encompasses gamma polyglutamated antifolate derivatives and analogs. The compositions and methods disclosed herein are contemplated for application to any and all known polyglutamated antifolate derivatives or analogs. In some embodiments, the analog corresponds to a modified form of an antifolate, in which the glutamyl group of the antifolate is not linked to the rest of the antifolate molecule via a gamma peptide bond. In some embodiments, the analog is a variant of an antifolate, in which the glutamyl group in the antifolate is in the D-form. In some embodiments, the polyglutamated form of an antifolate, or the polyglutamated antifolate analog or derivative, is non-fluorinated.

[0147] In some embodiments, the antifolate is selected from: an indoline ring and a modified ornithine-containing methotrexate derivative, an indoline ring and a modified glutamic acid-containing methotrexate derivative, an alkyl-substituted benzene ring C-containing methotrexate derivative, a benzoxazine moiety-containing methotrexate derivative, a benzothiazine moiety-containing methotrexate derivative, a 10-deazaaminopterin analog, a 5-deazaaminopterin methotrexate analog, a 5,10-dideazaaminopterin methotrexate analog, an indoline ring and a modified ornithine-containing methotrexate derivative, an indoline ring and a modified glutamic acid-containing methotrexate derivative, an alkyl-substituted benzene ring C-containing methotrexate derivative, a benzoxazine moiety-containing methotrexate derivative, a 10-deazaaminopterin analog, a 5-deazaaminopterin methotrexate analog, a 5,10-dideazaaminopterin methotrexate analog, an indoline ring and a modified glutamic acid-containing methotrexate derivative, an alkyl-substituted benzene ring C-containing methotrexate derivative, a benzoxazine moiety-containing methotrexate derivative, a 10-deazaaminopterin analog, a 5-deazaaminopterin analog, a 5,10-dideazaaminopterin analog, an indoline ring and a modified glutamic acid-containing methotrexate derivative, an indoline ring and a modified glutamic acid-containing methotrexate derivative, an alkyl-substituted benzene ring C ... methotrexate derivatives containing the dorine moiety, lipophilic amide methotrexate derivatives, L-threo-(2S,4S)-4-fluoroglutamic acid-containing methotrexate analogs, DL-3,3-difluoroglutamic acid-containing methotrexate analogs, methotrexate tetrahydroquinazoline analogs, N-(ac-aminoacyl) methotrexate derivatives, biotin methotrexate derivatives, D-glutamic acid methotrexate analogs, D-erythro,threo-4-fluoroglutamic acid methotrexate analogs, β,γ-methano Methotrexate analogs, 10-deazaaminopterin (10-EDAM) analogs, gamma-tetrazole methotrexate analogs, N-(L-alpha-aminoacyl) methotrexate derivatives, meta isomers of aminopterin, ortho isomers of aminopterin, hydroxymethyl methotrexate, gamma-fluoromethotrexate, polyglutamyl methotrexate derivatives, gem-diphosphonate methotrexate analogs (see, e.g., International Application No. 1988 / 06158, the contents of which are incorporated herein by reference in their entirety), alpha-substituted methotrexate analogs, gamma-substituted methotrexate analogs, 5-methyl-5-deazamethotrexate analogs (see, e.g., U.S. Pat. No. 4,725,687, the contents of which are incorporated herein by reference in their entirety), N δ-acyl-N α-(4-amino-4-deoxypteroyl)-L-ornithine derivatives, 8-deazamethotrexate analogs, acivicin methotrexate analogs, polymeric platinol methotrexate derivatives, methotrexate-γ-dimyristoylphosphatidylethanolamine, methotrexate polyglutamate analogs, poly-γ-glutamyl methotrexate derivatives, deoxyuridylate methotrexate derivatives, iodoacetyl lysine methotrexate methotrexate analogs, 2,ω-diaminoalkaloid acid-containing methotrexate analogs, polyglutamate derivatives, 5-methyl-5-deaza analogs, quinazoline methotrexate analogs, pyrazine methotrexate analogs, cysteine ​​or homocysteic acid methotrexate analogs (see, e.g., U.S. Pat. Nos. 4,490,529 and EPA 0142220, the contents of which are incorporated herein by reference in their entireties), γ-tert- Butyl methotrexate ester, fluorinated methotrexate analogs, folate methotrexate analogs, phosphonoglutamic acid analogs, poly(L-lysine) methotrexate conjugates, dilysine or trilysine methotrexate derivatives, 7-hydroxymethotrexate, poly-γ-glutamyl methotrexate analogs, 3',5'-dichloromethotrexate, diazoketone or chloromethylketone methotrexate analogs, 10-propargyl methotrexate aminopterin, alkyl methotrexate homologs, lectin derivatives of methotrexate, polyglutamate methotrexate derivatives, halogenated methotrexate derivatives, 8-alkyl-7,8-dihydro analogs, 7-methyl methotrexate derivatives, dichloromethotrexate, lipophilic methotrexate derivatives, 3',5'-dichloromethotrexate, deazaamethopterin analogs, and MX068, or stereoisomers thereof.

[0148] In further embodiments, the gamma polyglutamated antifolate derivative or analog has a variant polyglutamate chain. In some embodiments, the polyglutamate chain contains one or more natural or synthetic residues other than glutamate. In some embodiments, the polyglutamate chain contains one or more glutamyl groups that do not contain an amide bond. In other embodiments, one or more glutamyl groups of the polyglutamate chain are derivatized.

[0149] B.γANTIFOL-PG synthesis The antifolate polyglutamate compositions provided herein can be obtained by synthetic methods known in the art, including, but not limited to, procedures for synthesizing antifolates (including different pharmaceutically acceptable salts or acids (e.g., antifolate disodium) and crystalline and amorphous forms) and intermediates for synthesizing antifolates, such as those described in U.S. Patent Nos. 2,512,572; 3,892,801; 3,989,703; 4,057,548; 4,067,867; 4,079,056; Nos. 4,080,325; 4,106,488; 4,136,101; 4,224,446; 4,306,064; 4,374,987; 4,421,913; 4,558,690; 4,662,359; and 4,767,859; and those described in Calvert, Semin. Oncol. 26:3-10 (1999).

[0150] The antifolate polyglutamate compositions provided herein can be obtained by the following synthetic methods using available reagents and synthetic intermediates. The addition of glutamyl residues to the glutamyl residue of an antifolate can be carried out using synthetic methods known in the art. In some embodiments, glutamyl residues are added sequentially to the glutamyl residue of the antifolate. In further embodiments, polyglutamates are added to the glutamyl residue of the antifolate using "click chemistry" methods or other bioconjugate chemistries known to those skilled in the art. Alternatively, peptides of the desired length of glutamyl residues can be generated and added to a precursor of pemetrexed that lacks glutamyl residues. Peptides can be made using methods known in the art. In some embodiments, an initial glutamyl residue is coupled to wangregin, and additional glutamyl residues are added sequentially by solid-phase peptide synthesis using F-moc chemistry. After the final glutamyl residue is added, the pemetrexed precursor is conjugated to the peptide and the molecule is cleaved from the resin.

[0151] C. Gamma Polyglutamated Antifolate Conjugate The inventors unexpectedly discovered that polyglutamated antifolates, such as antifolates (γ-pantifol), can be complexed with other compositions, including therapeutic agents, including cytotoxic compounds, such as platinum-based compounds. Accordingly, in some embodiments, the present disclosure provides a complex of γ-pantifol (e.g., γ-pantifol disclosed herein) with a therapeutic agent, or a salt or acid thereof. In some embodiments, the present disclosure provides a complex of γ-pantifol with a therapeutic agent, or a salt or acid thereof, as described in any of items [1]-

[11] of the Detailed Description of the Invention section. In some embodiments, the γ-pantifol / complex comprises γ-pantifol and a therapeutic agent. In some embodiments, the therapeutic agent is a cytotoxic compound, such as a chemotherapeutic agent. In further embodiments, the γ-pantifol / complex comprises a platinum-based drug, such as a platinum-based chemotherapeutic agent (e.g., carboplatin and cisplatin). In other embodiments, the γ-pantifol / complex comprises a taxane-based chemotherapeutic agent (e.g., carboplatin and cisplatin). In other embodiments, the γ-PANTIFOL / complex comprises a cyclodextrin. In further embodiments, the γ-PANTIFOL / complex is encapsulated in a liposome. In some embodiments, the liposome is Lp-α-PANTIFOL as described in any of items

[12] to

[67] .

[0152] In further embodiments, the γPANTIFOL / therapeutic agent complex comprises one or more γPANTIFOLs containing 2 to 150, 2 to 100, 2 to 75, 2 to 50, 2 to 24, 2 to 30, 2 to 20, 2 to 19, 2 to 15, 2 to 10, or 2 to 5 glutamyl groups. In some embodiments, the γPANTIFOL / therapeutic agent complex comprises one or more γPANTIFOLs containing 3 to 10, 3 to 9, 3 to 8, or 3 to 7 glutamyl groups, or any range therebetween. In other embodiments, the γPANTIFOL / therapeutic agent complex comprises one or more γPANTIFOLs containing 4 to 10, 4 to 9, 4 to 8, 4 to 7, 4 to 6, or 4 to 5 glutamyl groups, or any range therebetween. In one particular embodiment, the complex comprises one or more γPANTIFOLs containing 3 to 10 glutamyl groups. In further embodiments, the γPANTIFOL / therapeutic agent complex comprises one or more γPANTIFOLs comprising 3 to 7 glutamyl groups. In another embodiment, the γPANTIFOL / therapeutic agent complex comprises one or more γPANTIFOLs comprising 5 glutamyl groups. In another embodiment, the γPANTIFOL / therapeutic agent complex comprises one or more γPANTIFOLs comprising 6 glutamyl groups. In some embodiments, the therapeutic agent is a cytotoxic compound, or a salt or acid thereof. In further embodiments, the therapeutic agent is a chemotherapeutic agent, or a salt or acid thereof. In another embodiment, the chemotherapeutic agent is a platinum-based drug. In another embodiment, the chemotherapeutic agent is a taxane-based drug. In further embodiments, the molar ratio of γPANTIFOL to therapeutic agent in the complex ranges from 1 to 10:1. In some embodiments, the molar ratio of γPANTIFOL to therapeutic agent in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, or 10:1. In some embodiments, the γPANTIFOL / therapeutic agent complex is encapsulated in a liposome (eg, as described herein or otherwise known in the art).In some embodiments, the molar ratio of γPANTIFOL / therapeutic agent in the complex is 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, 1:(21-50), or 1:>50. In some embodiments, the molar ratio of γ-PANTIFOL to therapeutic agent in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (21-50):1, or >50:1. In some embodiments, the γ-PANTIFOL / therapeutic agent complex is encapsulated in a liposome (e.g., as described herein or otherwise known in the art). In some embodiments, the liposome is Lp-α-PANTIFOL as described in any of items

[12] -

[67] of the Detailed Description section.

[0153] In alternative embodiments, the γPANTIFOL complex comprises γPANTIFOL and a cyclodextrin. In some embodiments, the γPANTIFOL complex comprises γPANTIFOL as described in any of Items [1]-

[11] of the Detailed Description section. In some embodiments, the γPANTIFOL complex comprises an antifolate as described in Section I. In some embodiments, the molar ratio of γPANTIFOL (e.g., a γPANTIFOL salt) to cyclodextrin in the complex is in the range of 1 to 20:1, or any range therebetween. In some embodiments, the molar ratio of γPANTIFOL to cyclodextrin in the complex is in the range of 1 to 10:1, or any range therebetween. In further embodiments, the molar ratio of γPANTIFOL to cyclodextrin in the complex is in the range of 2 to 8:1, or any range therebetween. In some embodiments, the molar ratio of γ-PANTIFOL / cyclodextrin in the complex is 1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, or 20:1. In some embodiments, the molar ratio of γ-PANTIFOL / cyclodextrin in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (21-50):1, or >50:1. In other embodiments, the molar ratio of γPANTIFOL / cyclodextrin in the complex ranges from 1:1-20, 1:1-10, or 1:2-8, or any range therebetween. In some embodiments, the molar ratio of γPANTIFOL / cyclodextrin in the complex is 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, or 1:20.In some embodiments, the molar ratio of γ-PANTIFOL / cyclodextrin in the complex is 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, 1:(21-50), or 1:>50. In some embodiments, the γ-PANTIFOL / cyclodextrin complex is encapsulated in a liposome (e.g., as described herein or otherwise known in the art). In some embodiments, the liposome is Lp-γ-PANTIFOL as described in any of items

[12] -

[67] of the Detailed Description section.

[0154] In some embodiments, the present disclosure provides a composition comprising a γPANTIFOL / platinum-based chemotherapeutic agent conjugate. In some embodiments, the conjugate comprises γPANTIFOL as described in any of Items [1]-

[11] of the Detailed Description section. In some embodiments, the γPANTIFOL conjugate comprises a polyglutamated antifolate described in Section I. In some embodiments, the platinum-based chemotherapeutic agent is selected from cisplatin, carboplatin, and oxaliplatin, or a salt or acid thereof. In other embodiments, the γPANTIFOL / platinum-based chemotherapeutic agent conjugate comprises an analog of cisplatin, carboplatin, or oxaliplatin, or a salt or acid thereof. In some embodiments, the molar ratio of γPANTIFOL / platinum-based agent in the conjugate is in the range of 1 to 20:1, or any range therebetween. In some embodiments, the molar ratio of γPANTIFOL / platinum-based agent in the conjugate is in the range of 1 to 10:1, or any range therebetween. In further embodiments, the molar ratio of γPANTIFOL to platinum-based drug in the complex ranges from 2 to 8:1, or any range therebetween. In some embodiments, the molar ratio of γPANTIFOL to platinum-based drug in the complex is 11:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, or 20:1. In some embodiments, the molar ratio of γPANTIFOL to platinum-based chemotherapeutic agent in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (21-50):1, or >50:1. In other embodiments, the molar ratio of γPANTIFOL to platinum-based chemotherapeutic agent in the complex is in the range of 1:1-20, 1:1-10, or 1:2-8, or any range therebetween.In some embodiments, the molar ratio of γPANTIFOL to platinum-based agent in the complex is 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, or 1:20. In some embodiments, the molar ratio of γPANTIFOL to platinum-based agent in the complex is 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, 1:(21-50), or 1:>50. In some embodiments, the γ-PANTIFOL / platinum-based drug complex is encapsulated in a liposome. In some embodiments, the liposome is Lp-α-PANTIFOL as described in any of items

[12] to

[67] of the Detailed Description of the Invention section.

[0155] In further embodiments, the γPANTIFOL / platinum-based chemotherapeutic agent complex comprises a cisplatin, carboplatin, or oxaliplatin analog, or a salt or acid thereof. In some embodiments, the complex comprises γPANTIFOL as described in any of Items [1]-

[11] of the Detailed Description section. In some embodiments, the γPANTIFOL complex comprises a polyglutamated antifolate as described in Section I. In some embodiments, the molar ratio of γPANTIFOL / platinum-based analog in the complex ranges from 1 to 20:1, or any range therebetween. In some embodiments, the molar ratio of γPANTIFOL / platinum-based analog in the complex ranges from 1 to 10:1, or any range therebetween. In further embodiments, the molar ratio of γPANTIFOL / platinum-based agent in the complex ranges from 2 to 8:1, or any range therebetween. In some embodiments, the molar ratio of γPANTIFOL to platinum-based analog in the complex is 11:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, or 20:1. In some embodiments, the molar ratio of γPANTIFOL to platinum-based analog in the complex is 11:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (21-50):1, or >50:1. In some embodiments, the molar ratio of γPANTIFOL to platinum-based agent in the complex is 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, or 1:20. In some embodiments, the molar ratio of γPANTIFOL to platinum-based agent in the complex is 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, 1:(21-50), or 1:>50.In some embodiments, the γ-PANTIFOL / platinum-based analog complex is encapsulated in a liposome. In some embodiments, the liposome is Lp-α-PANTIFOL as described in any of items

[12] to

[67] of the Detailed Description of the Invention section.

[0156] In further embodiments, the present disclosure provides a complex comprising γ-PANTIFOL and cisplatin, or a salt or acid thereof. In some embodiments, the complex comprises γ-PANTIFOL as described in any of Items [1]-

[11] of the Detailed Description section. In some embodiments, the γ-PANTIFOL complex comprises an antifolate as described in Section I. In some embodiments, the molar ratio of γ-PANTIFOL to cisplatin (or a salt or acid of cisplatin) in the complex is in the range of 1 to 20:1, or any range therebetween. In some embodiments, the molar ratio of γ-PANTIFOL to cisplatin (or a salt or acid of cisplatin) in the complex is in the range of 1 to 10:1, or any range therebetween. In further embodiments, the molar ratio of γ-PANTIFOL to cisplatin (or a salt or acid of cisplatin) in the complex is in the range of 2 to 8:1, or any range therebetween. In some embodiments, the molar ratio of γPANTIFOL / cisplatin (or a salt or acid of cisplatin) in the complex is 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, or 1:20. In some embodiments, the molar ratio of γPANTIFOL / cisplatin (or a salt or acid of cisplatin) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (21-50):1, or >50:1. In some embodiments, the molar ratio of γPANTIFOL / cisplatin (or a salt or acid of cisplatin) in the complex is 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, or 1:20.In some embodiments, the molar ratio of γ-PANTIFOL / cisplatin (or a cisplatin salt or acid) in the complex is 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, 1:(21-50), or 1:>50. In some embodiments, the γ-PANTIFOL / cisplatin (or a cisplatin salt or acid) complex is encapsulated in a liposome. In some embodiments, the liposome is Lp-α-PANTIFOL as described in any of items

[12] to

[67] of the Detailed Description section.

[0157] In another embodiment, the present disclosure provides a complex comprising γ-PANTIFOL and carboplatin, or a salt or acid thereof. In some embodiments, the complex comprises γ-PANTIFOL as described in any of Items [1]-

[11] of the Detailed Description section. In some embodiments, the γ-PANTIFOL complex comprises a polyglutamated antifolate as described in Section I of the present specification. In some embodiments, the molar ratio of γ-PANTIFOL to carboplatin (or a carboplatin salt or acid) in the complex is in the range of 1 to 20:1, or any range therebetween. In further embodiments, the molar ratio of γ-PANTIFOL to carboplatin (or a carboplatin salt or acid) in the complex is in the range of 1 to 10:1, or any range therebetween. In further embodiments, the molar ratio of γ-PANTIFOL to carboplatin (or a carboplatin salt or acid) in the complex is in the range of 2 to 8:1, or any range therebetween. In some embodiments, the molar ratio of γPANTIFOL / carboplatin (or carboplatin salt or acid) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, or 20:1. In some embodiments, the molar ratio of γPANTIFOL / carboplatin (or carboplatin salt or acid) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (21-50):1, or >50:1. In some embodiments, the molar ratio of γPANTIFOL / carboplatin in the complex is 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, or 1:20.In some embodiments, the molar ratio of γ-PANTIFOL / carboplatin in the complex is 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, 1:(21-50), or 1:>50. In some embodiments, the γ-PANTIFOL / carboplatin (or carboplatin salt or acid) complex is encapsulated in a liposome. In some embodiments, the liposome is Lp-α-PANTIFOL as described in any of items

[12] -

[67] of the Detailed Description section.

[0158] In another embodiment, the present disclosure provides a complex comprising γ-PANTIFOL and oxaliplatin, or a salt or acid thereof. In some embodiments, the complex comprises γ-PANTIFOL as described in any of Items [1]-

[11] of the Detailed Description section. In some embodiments, the γ-PANTIFOL complex comprises a polyglutamated antifolate as described in Section I. In some embodiments, the molar ratio of γ-PANTIFOL to oxaliplatin (or an oxaliplatin salt or acid) in the complex is in the range of 1 to 20:1, or any range therebetween. In further embodiments, the molar ratio of γ-PANTIFOL to oxaliplatin (or an oxaliplatin salt or acid) in the complex is in the range of 1 to 10:1, or any range therebetween. In further embodiments, the molar ratio of γ-PANTIFOL to oxaliplatin (or an oxaliplatin salt or acid) in the complex is in the range of 2 to 8:1, or any range therebetween. In some embodiments, the molar ratio of γPANTIFOL / oxaliplatin (or a salt or acid of oxaliplatin) in the complex is 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, or 1:20. In some embodiments, the molar ratio of γPANTIFOL / oxaliplatin (or oxaliplatin salt or acid) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (21-50):1, or >50:1. In some embodiments, the molar ratio of γPANTIFOL / oxaliplatin (or a salt or acid of oxaliplatin) in the complex is 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, or 1:20.In some embodiments, the molar ratio of γ-PANTIFOL / oxaliplatin (or an oxaliplatin salt or acid) in the complex is 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, 1:(21-50), or 1:>50. In further embodiments, the γ-PANTIFOL / oxaliplatin (or an oxaliplatin salt or acid) complex is encapsulated in a liposome. In some embodiments, the liposome is Lp-α-PANTIFOL as described in any of items

[12] -

[67] of the Detailed Description section.

[0159] In a further embodiment, the present disclosure provides a conjugate comprising γPANTIFOL and a platinum-based chemotherapeutic agent (platinum) selected from nedaplatin, heptaplatin, lobaplatin, stratoplatin, paraplatin, platinol, cycloplatin, dexorumaplatin, spiroplatin, picoplatin, triplatin, tetraplatin, iproplatin, ormaplatin, zeniplatin, platinum-triamines, satraplatin, enloplatin, JM216, NK121, CI973, DWA2114R, NDDP, and nedaplatin, or a salt or acid thereof. In other embodiments, the γ-PANTIFOL / platinum-based chemotherapeutic agent conjugate comprises nedaplatin, heptaplatin, lobaplatin, stratoplatin, paraplatin, platinol, cycloplatin, dexorumaplatin, spiroplatin, picoplatin, triplatin, tetraplatin, iproplatin, ormaplatin, zeniplatin, platinum-triamine, satraplatin, enloplatin, JM216, NK121, CI973, DWA2114R, NDDP, or a nedaplatin analog, or a salt or acid thereof. In some embodiments, the molar ratio of γ-PANTIFOL to platinum-based chemotherapeutic agent (platinum) (or a salt or acid of a platinum-based chemotherapeutic agent) in the conjugate is in the range of 1 to 20:1, or any range therebetween. In some embodiments, the conjugate comprises γ-PANTIFOL as described in any of items [1] to

[11] in the Detailed Description section. In some embodiments, the γPANTIFOL complex comprises a polyglutamated antifolate described in Section I. In further embodiments, the molar ratio of γPANTIFOL to platinum (or platinum salt or acid) in the complex is in the range of 1 to 10:1, or any range therebetween. In further embodiments, the molar ratio of γPANTIFOL to platinum (or platinum salt or acid) in the complex is in the range of 2 to 8:1, or any range therebetween. In some embodiments, the molar ratio of γPANTIFOL to platinum (or platinum salt or acid) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, or 20:1.In some embodiments, the molar ratio of γPANTIFOL to platinum (or platinum salt or acid) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (21-50):1, or >50:1. In some embodiments, the molar ratio of γPANTIFOL to platinum (or platinum salt or acid) in the complex is 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, or 1:20. In some embodiments, the molar ratio of γ-PANTIFOL to platinum (or a platinum salt or acid) in the complex is 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, 1:(21-50), or 1:>50. In some embodiments, the γ-PANTIFOL / platinum (or a salt or acid or analog thereof) complex is encapsulated in a liposome. In some embodiments, the liposome is Lp-α-PANTIFOL as described in any of items

[12] -

[67] of the Detailed Description section.

[0160] In some embodiments, the present disclosure provides a composition comprising a γPANTIFOL / taxane chemotherapeutic agent (taxane) conjugate. In some embodiments, the conjugate comprises γPANTIFOL as described in any of Items [1]-

[11] of the Detailed Description section. In some embodiments, the γPANTIFOL conjugate comprises a polyglutamated antifolate as described in Section I. In some embodiments, the taxane chemotherapeutic agent is selected from paclitaxel (PTX), docetaxel (DTX), larotaxel (LTX), and cabazitaxel (CTX), or a salt or acid thereof. In some embodiments, the molar ratio of γPANTIFOL / taxane (or taxane salt or acid) in the conjugate is in the range of 1 to 20:1, or any range therebetween. In further embodiments, the molar ratio of γPANTIFOL / taxane (or taxane salt or acid) in the conjugate is in the range of 1 to 10:1, or any range therebetween. In further embodiments, the molar ratio of γPANTIFOL to taxane (or taxane salt or acid) in the complex ranges from 2 to 8:1, or any range therebetween. In some embodiments, the molar ratio of γPANTIFOL to taxane (or taxane salt or acid) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, or 20:1. In some embodiments, the molar ratio of γPANTIFOL / taxane (or taxane salt or acid) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (21-50):1, or >50:1. In some embodiments, the molar ratio of γPANTIFOL / taxane (or taxane salt or acid) in the complex is 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, or 1:20.In some embodiments, the molar ratio of γ-PANTIFOL to taxane (or taxane salt or acid) in the complex is 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, 1:(21-50), or 1:>50. In further embodiments, the γ-PANTIFOL / taxane (or taxane salt or acid) drug complex is encapsulated in a liposome. In some embodiments, the liposome is Lp-α-PANTIFOL as described in any of items

[12] -

[67] of the Detailed Description section.

[0161] In further embodiments, the present disclosure provides a complex comprising γ-PANTIFOL and paclitaxel (PTX) or a salt or acid thereof. In other embodiments, the γ-PANTIFOL / paclitaxel (or a paclitaxel salt or acid) chemotherapeutic agent complex comprises a paclitaxel (PTX) analog, or a salt or acid thereof. In some embodiments, the complex comprises γ-PANTIFOL as described in any of Items [1]-

[11] of the Detailed Description section. In some embodiments, the γ-PANTIFOL complex comprises a polyglutamated antifolate as described in Section I. In some embodiments, the molar ratio of γ-PANTIFOL / paclitaxel (or a paclitaxel salt or acid) in the complex ranges from 1 to 20:1, or any range therebetween. In further embodiments, the molar ratio of γ-PANTIFOL / paclitaxel (or a paclitaxel salt or acid) in the complex ranges from 1 to 10:1, or any range therebetween. In further embodiments, the molar ratio of γPANTIFOL / paclitaxel (or paclitaxel salt or acid) in the complex ranges from 2 to 8:1, or any range therebetween. In some embodiments, the molar ratio of γPANTIFOL / paclitaxel (or paclitaxel salt or acid) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, or 20:1. In some embodiments, the molar ratio of γPANTIFOL / paclitaxel (or paclitaxel salt or acid) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (21-50):1, or >50:1.In some embodiments, the molar ratio of γPANTIFOL / paclitaxel (or a salt or acid of paclitaxel) in the complex is 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, or 1:20. In some embodiments, the molar ratio of γ-PANTIFOL / paclitaxel (or a paclitaxel salt or acid) in the complex is 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, 1:(21-50), or 1:>50. In further embodiments, the γ-PANTIFOL / paclitaxel (or a paclitaxel salt or acid) complex is encapsulated in a liposome. In some embodiments, the liposome is Lp-α-PANTIFOL as described in any of items

[12] -

[67] of the Detailed Description section.

[0162] In further embodiments, the present disclosure provides a complex comprising γ-PANTIFOL and docetaxel (DTX), or a salt or acid thereof. In other embodiments, the γ-PANTIFOL / docetaxel complex comprises a docetaxel (DTX) analog, or a salt or acid thereof. In some embodiments, the complex comprises γ-PANTIFOL as described in any of Items [1]-

[11] of the Detailed Description section. In some embodiments, the γ-PANTIFOL complex comprises a polyglutamated antifolate as described in Section I. In some embodiments, the molar ratio of γ-PANTIFOL / docetaxel (or a docetaxel salt or acid) in the complex is in the range of 1 to 20:1, or any range therebetween. In some embodiments, the molar ratio of γ-PANTIFOL / docetaxel (or a docetaxel salt or acid) in the complex is in the range of 1 to 10:1, or any range therebetween. In further embodiments, the molar ratio of γPANTIFOL / docetaxel (or docetaxel salt or acid) in the complex ranges from 2 to 8:1, or any range therebetween. In some embodiments, the molar ratio of γPANTIFOL / docetaxel (or docetaxel salt or acid) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, or 20:1. In some embodiments, the molar ratio of γPANTIFOL / docetaxel (or docetaxel salt or acid) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (21-50):1, or >50:1. In some embodiments, the molar ratio of γPANTIFOL / docetaxel (or a salt or acid of docetaxel) in the complex is 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, or 1:20.In some embodiments, the molar ratio of γ-PANTIFOL / docetaxel (or a docetaxel salt or acid) in the complex is 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, 1:(21-50), or 1:>50. In further embodiments, the γ-PANTIFOL / docetaxel (or a docetaxel salt or acid) complex is encapsulated in a liposome. In some embodiments, the liposome is Lp-α-PANTIFOL as described in any of items

[12] -

[67] of the Detailed Description section.

[0163] In further embodiments, the present disclosure provides a complex comprising γ-PANTIFOL and larotaxel (LTX), or a salt or acid thereof. In some embodiments, the complex comprises γ-PANTIFOL as described in any of Items [1]-

[11] of the Detailed Description section. In some embodiments, the γ-PANTIFOL complex comprises a polyglutamated antifolate as described in Section I. In some embodiments, the molar ratio of γ-PANTIFOL / larotaxel (or larotaxel salt or acid) in the complex is in the range of 1 to 20:1, or any range therebetween. In further embodiments, the molar ratio of γ-PANTIFOL / larotaxel (or larotaxel salt or acid) in the complex is in the range of 1 to 10:1, or any range therebetween. In further embodiments, the molar ratio of γ-PANTIFOL / larotaxel (or larotaxel salt or acid) in the complex is in the range of 2 to 8:1, or any range therebetween. In some embodiments, the molar ratio of γPANTIFOL / larotaxel (or larotaxel salt or acid) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, or 20:1. In some embodiments, the molar ratio of γPANTIFOL / larotaxel (or larotaxel salt or acid) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (21-50):1, or >50:1. In some embodiments, the molar ratio of γPANTIFOL / larotaxel (or larotaxel salt or acid) in the complex is 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, or 1:20.In some embodiments, the molar ratio of γ-PANTIFOL / larotaxel (or larotaxel salt or acid) in the complex is 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, 1:(21-50), or 1:>50. In further embodiments, the γ-PANTIFOL / larotaxel (or larotaxel salt or acid) complex is encapsulated in a liposome. In some embodiments, the liposome is Lp-α-PANTIFOL as described in any of items

[12] -

[67] of the Detailed Description section.

[0164] In further embodiments, the present disclosure provides a complex comprising γ-pantifol and cabazitaxel (CTX) or a salt or acid thereof. In some embodiments, the complex comprises γ-pantifol as described in any of items [1]-

[11] of the Detailed Description section. In some embodiments, the γ-pantifol complex comprises a polyglutamated antifolate as described in Section I. In some embodiments, the molar ratio of γ-pantifol to cabazitaxel (or a cabazitaxel salt or acid) in the complex is in the range of 1 to 20:1, or any range therebetween. In further embodiments, the molar ratio of γ-pantifol to cabazitaxel (or a cabazitaxel salt or acid) in the complex is in the range of 1 to 10:1, or any range therebetween. In further embodiments, the molar ratio of γ-pantifol to cabazitaxel (or a cabazitaxel salt or acid) in the complex is in the range of 2 to 8:1, or any range therebetween. In some embodiments, the molar ratio of γPANTIFOL / cabazitaxel (or a salt or acid of cabazitaxel) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, or 20:1. In some embodiments, the molar ratio of γPANTIFOL / cabazitaxel (or cabazitaxel salt or acid) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (21-50):1, or >50:1. In some embodiments, the molar ratio of γPANTIFOL / cabazitaxel (or a salt or acid of cabazitaxel) in the complex is 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, or 1:20.In some embodiments, the molar ratio of γ-PANTIFOL / cabazitaxel (or a cabazitaxel salt or acid) in the complex is 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, 1:(21-50), or 1:>50. In further embodiments, the γ-PANTIFOL / cabazitaxel (or a cabazitaxel salt or acid) complex is encapsulated in a liposome. In some embodiments, the liposome is Lp-α-PANTIFOL as described in any of items

[12] -

[67] of the Detailed Description section.

[0165] In further embodiments, the present disclosure provides a complex comprising γPANTIFOL and another anti-metabolite, or a salt or acid thereof. In some embodiments, the complex comprises γPANTIFOL as described in any of Items [1]-

[11] of the Detailed Description section. In some embodiments, the γPANTIFOL complex comprises a polyglutamated antifolate as described in Section I. An anti-metabolite is a chemical compound that is similar in structure to a metabolite required for normal biochemical reactions, but differs sufficiently in structure to interfere with one or more normal cell functions, such as cell division. In some embodiments, the present disclosure provides a complex comprising γPANTIFOL and an anti-folate (ANTIFOL), or a salt or acid thereof. In some embodiments, the present disclosure provides a conjugate comprising γ-PANTIFOL and an antimetabolite selected from gemcitabine, fluorouracil, capecitabine, antifolate (e.g., the antifolate raltitrexed), tegafur, cytosine arabinoside, thioguanine, 5-azacytidine, 6-mercaptopurine, azathioprine, 6-thioguanine, pentostatin, fludarabine phosphate, and cladribine, and pharmaceutically acceptable salts or acids, or derivatives of any of these. In some embodiments, the molar ratio of γ-PANTIFOL to the antimetabolite (or the salt or acid, or prodrug of the antimetabolite) in the conjugate is in the range of 1 to 20:1, or any range therebetween. In further embodiments, the molar ratio of γ-PANTIFOL to the antimetabolite (or the salt or acid, or prodrug of the antimetabolite) in the conjugate is in the range of 1 to 10:1, or any range therebetween. In a further embodiment, the molar ratio of γPANTIFOL / antimetabolite (or antimetabolite salt or acid, or prodrug) in the complex is in the range of 2-8:1, or any range therebetween.In some embodiments, the molar ratio of γPANTIFOL / anti-metabolite (or antimetabolite salt or acid, or prodrug) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, or 20:1. In some embodiments, the molar ratio of γPANTIFOL / antimetabolite (or antimetabolite salt or acid, or prodrug) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (21-50):1, or >50:1. In some embodiments, the molar ratio of γPANTIFOL / anti-metabolite (or antimetabolite salt or acid, or prodrug) in the complex is 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, or 1:20. In some embodiments, the molar ratio of γ-PANTIFOL to the antimetabolite (or antimetabolite salt or acid, or prodrug) in the complex is 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, 1:(21-50), or 1:>50. In further embodiments, the γ-PANTIFOL / antimetabolite (or antimetabolite salt or acid, or prodrug) complex is encapsulated in a liposome. In some embodiments, the liposome is Lp-α-PANTIFOL as described in any of items

[12] -

[67] of the Detailed Description section.

[0166] In further embodiments, the present disclosure provides a complex of γ-PANTIFOL (e.g., γ-PANTIFOL disclosed herein) and cyclodextrin. Cyclodextrins (CDs) are a group of cyclic oligosaccharides that have been shown to improve the physicochemical properties of many drugs through complexation. CDs are cyclic oligosaccharides composed of several D-glucose units linked by α-(1,4) bonds. This cyclic structure provides a hydrophobic interior cavity, giving CDs a shortened, pyramidal shape. Many hydroxyl groups are located on the ends of the ring, making CDs both lipophilic and water-soluble. As a result, CDs can form complexes with a wide variety of hydrophobic drugs, thereby altering the physicochemical properties of these complexed drugs. In some embodiments, the complex comprises γ-PANTIFOL as described in any of items [1]-

[11] of the Detailed Description section.

[0167] The term "cyclodextrin" or "CD," unless otherwise specified, generally refers to a parent or derivatized cyclic oligosaccharide capable of complexing with antifolate-PG, containing a variable number of (α-1,4)-linked D-glucopyranoside units. Each cyclodextrin glucopyranoside subunit has secondary hydroxyl groups at the 2 and 3 positions and a primary hydroxyl group at the 6 position. The terms "parent," "underivatized," or "inactive" cyclodextrin refer to a cyclodextrin of the basic formula CH, containing D-glucopyranoside units. 12 This refers to a cyclodextrin with an O6 and glucose structure and no additional chemical substituents (e.g., α-cyclodextrin, consisting of six D-glucopyranoside units; β-cyclodextrin, consisting of seven D-glucopyranoside units; and γ-cyclodextrin, consisting of eight D-glucopyranoside units). The physical and chemical properties of the parent cyclodextrin can be modified by derivatizing the hydroxyl groups with other functional groups. Any substance located in the cyclodextrin internal phase is said to be "complexed" with the cyclodextrin or to form a complex (inclusion complex) with the cyclodextrin.

[0168] As used herein, there are no particular limitations on the cyclodextrin component of the γ-PANTIFOL / cyclodextrin complex, as long as the cyclodextrin can form a complex with γ-PANTIFOL. In certain embodiments, the cyclodextrin is derivatized to have an ionizable (e.g., weakly basic and / or weakly acidic) functional group to facilitate complexation with γ-PANTIFOL and / or the liposome encapsulation.

[0169] Modification of cyclodextrin hydroxyl groups, such as those facing away from the cyclodextrin internal phase, with ionizable chemical groups is known to facilitate the addition of cyclodextrin and therapeutic agents complexed with the cyclodextrin. In some embodiments, the cyclodextrin in the γ-PANTIFOL / cyclodextrin complex has at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 hydroxyl groups substituted with ionizable chemical groups. The term "charged cyclodextrin" refers to a cyclodextrin having hydroxyl groups substituted with one or more of its charged moieties. Such moieties may themselves be charged groups or may include organic moieties (e.g., C1-C6 alkyl or C1-C6 alkyl ether moieties) substituted with one or more charged moieties.

[0170] In some embodiments, the "ionizable" or "charged" moiety of a CD derivative is weakly ionizable. A weakly ionizable moiety is a weakly basic or weakly acidic moiety. A weakly basic functional group (W) has a pKa with CH3-W of about 6.0-9.0, 6.5-8.5, 7.0-8.0, 7.5-8.0, and any range therebetween (endpoints included). Similarly, a weakly acidic functional group (X) has a logarithmic dissociation constant (pKa) with CH3-X of about 3.0-7.0, 4.0-6.5, 4.5-6.5, 5.0-6.0, 5.0-5.5, and any range therebetween (endpoints included). Representative anionic moieties include, but are not limited to, carboxylate, carboxymethyl, succinyl, sulfonyl, phosphate, sulfoalkyl ether, sulfate carbonate, thiocarbonate, dithiocarbonate, phosphate, phosphonate, sulfonate, nitrate, and borate groups. Representative cationic moieties include, but are not limited to, amino, guanidine, and quaternary ammonium groups.

[0171] In another embodiment, the derivatized cyclodextrin is a "polyanion" or a "polycation." A polyanion is a derivatized cyclodextrin with two or more negatively charged groups, resulting in a net negative ionic charge of three or more units. A polycation is a derivatized cyclodextrin with two or more positively charged groups, resulting in a net positive ionic charge of three or more units.

[0172] In another embodiment, the derivatized cyclodextrin is a "chargeable amphiphile." "Chargeable" means that the amphiphile has a pK in the range of pH 4 to pH 8 or 8.5. A chargeable amphiphile can therefore be a weak acid or base. "Amphoteric," as used herein, refers to a derivatized cyclodextrin having ionizable groups of both anionic and cationic character, where (a) at least one, and optionally both, cationic and anionic amphiphiles are chargeable and have at least one charged group with a pK between 4 and 8-8.5, (b) the cationic charge predominates at pH 4, and (c) the anionic charge predominates at pH 8-8.5.

[0173] In some embodiments, the "ionizable" or "charged" derivatized cyclodextrins, whether polyionic, amphiphilic, or otherwise, are generally weakly ionizable (i.e., have a pKai of about 4.0-8.5, 4.5-8.0, 5.0-7.5, 5.5-7.5, 6.0-6.5, and any range therebetween, inclusive).

[0174] Any one, some, or all of the hydroxyl groups of any one, some, or all of the α-D-glucopyranoside units of a cyclodextrin can be modified with an ionizable chemical group as described herein. Because each cyclodextrin hydroxyl group differs in chemical reactivity, reaction with the modifying moiety can produce an amorphous mixture of regio- and optical isomers. Alternatively, the pre-modified α-D-glucopyranoside units can be reacted to form a homogeneous product, depending on the specific chemistry.

[0175] The aggregate substitution occurring in a mixture of cyclodextrin derivatives is described by a term called the degree of substitution. For example, 6-ethylenediamino-β-cyclodextrin having a degree of substitution of 7 will be composed of a distribution of 6-ethylenediamino-β-cyclodextrin isomers in which the number of ethylenediamino groups per 6-ethylenediamino-β-cyclodextrin molecule is 7. The degree of substitution of a mixture of cyclodextrin derivatives can be routinely determined using mass spectrometry or nuclear magnetic resonance spectroscopy.

[0176] In one embodiment, at least one hydroxyl moiety facing away from the interior of the cyclodextrin is substituted with an ionizable chemical group. For example, at least one α-D-glucopyranoside unit among the C2, C3, C6, C2 and C3, C2 and C6, C3 and C6, and all three C2-C3-C6 hydroxyls is substituted with an ionizable chemical group. Any such hydroxyl combination can be combined with any of the degrees of substitution described herein, as well as at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, and up to all α-D-glucopyranoside units in the modified cyclodextrin. One such derivative is sulfoalkyl ether cyclodextrin (SAE-CD). The sulfobutyl ether derivative of beta cyclodextrin (SBE-β-CD) has been shown to have significantly improved aqueous solubility compared to the parent cyclodextrin.

[0177] Additional cyclodextrin derivatives that can be complexed with therapeutic agents in the disclosed liposomal compositions include sugammadex or Org-25969, in which the 6-hydroxy group on γ-CD has been replaced with a carboxythioacetate ether linkage, and hydroxybutenyl-β-CD. Alternative forms of cyclodextrin include 2,6-di-O-methyl-β-CD (DIMEB), 2-hydroxypropyl-3-cyclodextrin (HP-β-CD), randommethylated-β-cyclodextrin (RAMEB), sulfobutyl ether Examples of suitable cyclodextrins include β-cyclodextrin (SBE-β-CD), sulfobutylether-γ-cyclodextrin (SBEγCD), sulfobutylated-β-cyclodextrin sodium salt, (2-hydroxypropyl)-alpha-cyclodextrin, (2-hydroxypropyl)-β-cyclodextrin, (2-hydroxypropyl)-γ-cyclodextrin, 2,6-di-O-methyl)-β-cyclodextrin (DIMEB-50 heptakis), 2,3,6-tri-O-methyl)-β-cyclodextrin (TRIMEB heptakis), methyl-β-cyclodextrin, octakis(6-deoxy-6-iodo)-γ-cyclodextrin, and octakis(6-deoxy-6-bromo)-γ-cyclodextrin.

[0178] In some embodiments, the cyclodextrin has high solubility in water to facilitate entrapment of a larger amount of cyclodextrin in the liposome internal phase. In some embodiments, the solubility of the cyclodextrin in water is at least 10 mg / mL, 20 mg / mL, 30 mg / mL, 40 mg / mL, 50 mg / mL, 60 mg / mL, 70 mg / mL, 80 mg / mL, 90 mg / mL, 100 mg / mL, or more. In some embodiments, the water solubility of the cyclodextrin is within the range of 10-150 mg / mL, 20-100 mg / mL, 20-75 mg / mL, and any range therebetween (inclusive).

[0179] In some embodiments, a large binding constant between the cyclodextrin and γ-PANTIFOL and / or other therapeutic agent complexed with the cyclodextrin is preferred and can be obtained by selecting the number of glucose units in the cyclodextrin based on the size of the therapeutic agent (e.g., Albers et al., Crit. Rev. Therap. Drug Carrier Syst. 12:311-337 (1995); Stella et al., al., Toxicol. Pathol. 36:30-42 (2008). If the binding constant is pH dependent, a cyclodextrin can be selected that has a high binding constant at the pH of the liposome internal phase. As a result, the solubility (nominal solubility) of the therapeutic agent in the presence of the cyclodextrin can be further improved. In some embodiments, the binding constant between the cyclodextrin and the therapeutic agent is 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, or greater. In some embodiments, the binding constant between the cyclodextrin and the therapeutic agent is 100-1,200, 200-1,000, 300-750, and any range therebetween.

[0180] In some embodiments, the cyclodextrin of the γ-PANTIFOL / cyclodextrin complex and / or the cyclodextrin / therapeutic agent complex is not underivatized.

[0181] In some embodiments, the cyclodextrin of the γPANTIFOL / cyclodextrin complex and / or the cyclodextrin / therapeutic agent complex is derivatized. In further embodiments, the cyclodextrin derivative of the complex has Formula I: [ka] wherein n is 4, 5, or 6; R1, R2, R3, R4, R5, R6, R7, R8, and R9 are each independently -H, a linear or branched C1-C8 alkylene group, or an optionally substituted linear or branched C1-C6 group, and at least one of R1, R2, R3, R4, R5, R6, R7, R8, and R9 is a linear or branched C1-C8 alkylene (e.g., C1-C8-(alkylene)-SO3 - (base).

[0182] In some embodiments, the cyclodextrin derivatization of the γ-PANTIFOL / cyclodextrin complex and / or cyclodextrin / therapeutic agent complex is represented by Formula II: [ka] wherein n is 4, 5, or 6; R1, R2, R3, R4, R5, R6, R7, R8, and R9 each independently represent -O- or -O-(C2-C6 alkylene)-SO3 - group; and at least one of R1 and R2 is independently -O-(C2-C6 alkylene)-SO3 - groups; and S1, S2, S3, S4, S5, S6, S7, S8, and S9 are each independently a pharmaceutically acceptable cation. In a further embodiment, the pharmaceutically acceptable cation is Li + , Na + , or K + Alkali metals such as Ca 2+ , or Mg 2+ and ammonium ions and amine cations such as cations of (C-C)-alkylamines, piperidines, pyrazines, (C-C)-alkanolamines, and (C-C)-cycloalkanolamines. In some embodiments, at least one of R and R is independently -O-(CH). man SO3- group, -O-(C2-C6 alkylene)-SO3- group, where m is 2 to 6, preferably 2 to 4 (e.g., -O-CH2CH2CH2SO3- or -O-CH2CH2CH2CH2SO3-); and S1, S2, S3, S4, S5, S6, S7, S8, and S9 are each independently H or a pharmaceutically acceptable cation, including, for example, an alkali metal (e.g., Li + , Na + , K. + ), alkaline earth metals (e.g., Ca 2+ , Mg 2+ ), ammonium ions and amine cations such as the cations of (C1-C6)-alkylamines, piperidines, pyrazines, (C1-C6)-alkanolamines and (C4-C8)-cycloalkanolamines.

[0183] In some embodiments, the cyclodextrin derivatization of the γ-PANTIFOL / cyclodextrin complex and / or cyclodextrin / therapeutic agent complex is a cyclodextrin disclosed in U.S. Patent Nos. 6,133,248, 5,874,418, 6,046,177, 5,376,645, 5,134,127, 7,034,013, 6,869,939; and WO 02005 / 117911, the contents of each of which are hereby expressly incorporated by reference.

[0184] In some embodiments, the cyclodextrin derivative of the γ-PANTIFOL / cyclodextrin complex and / or cyclodextrin / therapeutic agent complex is a sulfoalkyl ether cyclodextrin. In some embodiments, the cyclodextrin derivative of the complex is sulfobutyl ether-3-cyclodextrin, such as CAPTISOL® (CyDex Pharma. Inc., Lenexa, Kansas). Methods for making sulfobutyl ether-3-cyclodextrin and other sulfoalkyl ether cyclodextrins are known in the art.

[0185] In some embodiments, the cyclodextrin derivative of the γ-PANTIFOL / cyclodextrin complex and / or cyclodextrin / therapeutic agent complex has Formula III: [ka] wherein R is (a)(H) 21-X or (-(CH2)4-SO3Na) X , and x = 1.0–10.0, 1.0–5.0, 6.0–7.0, or 8.0–10.0; (b)(H) 21-X or (-(CH2CH(OH)CH3) X , and x = 1.0–10.0, 1.0–5.0, 6.0–7.0, or 8.0–10.0; (c)(H) 21-X or (sulfoalkyl ether) X , and x = 1.0–10.0, 1.0–5.0, 6.0–7.0, or 8.0–10.0; or (d)(H) 21-X or (-(CH2)4-SO3Na) X , and x = 1.0 to 10.0, 1.0 to 5.0, 6.0 to 7.0, or 8.0 to 10.0.

[0186] In a further embodiment, the γPANTIFOL / cyclodextrin complex and / or cyclodextrin / therapeutic agent complex is encapsulated in a liposome (eg, as described herein or otherwise known in the art).

[0187] D. γ-PANTIFOL Delivery Carrier In alternative embodiments, the present disclosure provides γPANTIFOL delivery systems and their use for delivering a γPANTIFOL payload to a cell or cells in vitro or in vivo. In some embodiments, γPANTIFOL is complexed with or incorporated into a delivery vehicle. Such delivery vehicles are known in the art and include, but are not limited to, liposomes, lipospheres, polymers, peptides, proteins, antibodies (e.g., ADCs such as antibody-γPANTIFOL conjugates), cellular components, cyclic oligosaccharides (e.g., cyclodextrins), nanoparticles (e.g., lipid nanoparticles, biodegradable nanoparticles, and core-shell nanoparticles), lipoprotein particles, and combinations thereof. In certain embodiments, the delivery vehicle is a liposome. In other specific embodiments, the delivery vehicle is an antibody or an antigen-binding antibody fragment. In some embodiments, the γPANTIFOL delivery system comprises γPANTIFOL as described in any of items [1] to

[11] in the Detailed Description section.

[0188] E. Liposomes In some embodiments, the present disclosure provides a liposome composition comprising liposomes encapsulating (loaded with) a gamma polyglutamated antifolate (e.g., γPANTIFOL as disclosed herein). In some embodiments, the liposome composition comprises γPANTIFOL as described in any of Items [1] to

[11] of the Detailed Description of the Invention section. In some embodiments, the liposome composition comprises a polyglutamated antifolate as described in Section I. In some embodiments, the liposome composition comprises a liposome as described in any of Items

[12] to

[67] of the Detailed Description of the Invention section. In some embodiments, the liposomes in the liposome composition comprise γPANTIFOL containing 4, 5, 2 to 10, 4 to 6, or more than 5 glutamyl groups (including the glutamyl groups of the antifolate). In some embodiments, the gamma polyglutamated antifolate in Lp-γPANTIFOL contains two or more L-glutamyl groups. In other embodiments, the gamma polyglutamated antifolate in Lp-γPANTIFOL comprises a D-glutamyl group. In further embodiments, the gamma polyglutamated antifolate in Lp-γPANTIFOL comprises a D-glutamyl group and two or more L-glutamyl groups. In further embodiments, the gamma polyglutamated antifolate in Lp-γPANTIFOL comprises two or more glutamyl groups with gamma carboxyl linkages. In some embodiments, the liposome composition comprises liposomes comprising a gamma pentaglutamated antifolate. In further embodiments, the liposomes comprise an L-γ pentaglutamated antifolate, a D-γ pentaglutamated antifolate, or an L- and D-γ pentaglutamated antifolate. In some embodiments, the liposome composition comprises liposomes comprising a gamma hexaglutamated antifolate (Lp-gamma pantifol). In further embodiments, the liposomes comprise an L-gamma hexaglutamated antifolate, a D-gamma hexaglutamated antifolate, or an L- and D-gamma hexaglutamated antifolate.In some embodiments, the liposome composition comprises liposomes that are anionic or neutral. In some embodiments, the liposome composition comprises liposomes that are cationic. In some embodiments, the Lp-γPANTIFOL composition is not PEGylated. In some embodiments, the Lp-γPANTIFOL composition is non-targeted (NTLp-γPANTIFOL). In some embodiments, the Lp-γPANTIFOL composition is targeted (TLp-γPANTIFOL). In some embodiments, the liposome composition comprises liposomes having a diameter of 20 nm to 500 nm, or any range therebetween. In some embodiments, the liposome composition comprises liposomes having a diameter of 20 nm to 400 nm, or any range therebetween. In some embodiments, the liposome composition comprises liposomes having a diameter of 20 nm to 200 nm, or any range therebetween. In further embodiments, the liposome composition comprises liposomes having a diameter of 20 nm to 150 nm, or any range therebetween. In further embodiments, the liposome composition comprises liposomes having a diameter of 80 nm to 120 nm, or any range therebetween. In further embodiments, 30-70%, 30-60%, or 30-50% w / w of gamma polyglutamated antifolate, or any range therebetween, is encapsulated (entrapped) in Lp-γPANTIFOL during the liposome preparation process. In some embodiments, the Lp-γPANTIFOL composition comprises at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75% w / w of gamma polyglutamated antifolate. In some embodiments, at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75% or more than 75% w / w of the gamma polyglutamated antifolate is encapsulated in Lp-γPANTIFOL during the liposome fabrication process.

[0189] In some embodiments, provided liposomes further comprise an immunostimulatory agent, a detectable marker, or both, disposed on the exterior surface of the liposome. The immunostimulatory agent or detectable marker can be ionically or covalently bound to the exterior surface of the liposome, which may optionally include binding to a steric stabilizing component of the liposome.

[0190] The term "immunostimulatory agent," also known as "immunostimulant" and "immunostimulator," refers to a substance that stimulates immunity (including a pre-existing immune response) by inducing activation or increased activity of any component of the immune system. These immunostimulatory agents include one or more of haptens, adjuvants, protein immunostimulators, nucleic acid immunostimulators, and chemical immunostimulators. Many adjuvants include substances designed to stimulate the immune response, such as lipid A, proteins derived from Bordetella pertussis, or Mycobacterium tuberculosis. Certain adjuvants are commercially available, for example, Freund's incomplete and complete adjuvants (Difco Laboratories, Detroit, Mich.); Merck Adjuvant 65 (Merck and Company, Inc., Rahway, NJ); AS-2 (SmithKline Beecham, Philadelphia, Pa.); aluminum salts such as aluminum hydroxide gel (alum) or aluminum phosphate; calcium, iron, or zinc salts; insoluble suspensions of acylated tyrosine; acylated sugars; cationically or anionically derivatized polysaccharides; polyphosphazenes; biodegradable microspheres; monophosphoryl lipid A and quil A; IFN-alpha, IFN-gamma, FLT3 ligand; and immunostimulatory antibodies (e.g., anti-CTLA-4, anti-CD28, anti-CD3). Cytokines such as GM-CSF, interleukins 2, 7, 12, and 15, and other similar growth factors can also be used as adjuvants. In a preferred embodiment, the immunostimulant may be at least one selected from fluorescein, DNP, beta-glucan, beta-1,3-glucan, and beta-1,6-glucan. In a further preferred embodiment, the immunostimulant is a toll-like receptor (TLR) modulator. In a further embodiment, the toll-like receptor (TLR) modulator is one or more of OXPAC, PGPC, erythrolan lipid (e.g., E5564), and resolvin.

[0191] In some embodiments, the provided liposomes further comprise an agent that enhances uptake of the liposome into a desired intracellular compartment, including the cytosol. In some embodiments, the agent confers the liposomal contents with the ability to bypass the lysosome (e.g., chloroquine). In some embodiments, the agent improves mitochondrial renewal of the liposomal contents (e.g., sphingomyelin and components of mitoport).

[0192] Detectable markers may include, for example, radioisotopes, fluorescent compounds, bioluminescent compounds, chemiluminescent compounds, metal chelators, enzymes, dyes, inks, magnetic compounds, biocatalysts, or pigments that are detectable by any suitable means known in the art, such as, for example, at least, magnetic resonance imaging (MRI), optical imaging, fluorescence / luminescence imaging, or nuclear imaging techniques.

[0193] In some embodiments, the immunostimulatory agent and / or detectable marker is bound to the outer surface by co-incubation with the liposome. For example, the immunostimulatory agent and / or detectable marker can be bound to the liposome membrane by hydrophobic interactions or ionic bonds, such as avidin / biotin bonds or metal chelate bonds (e.g., Ni-NTA). Alternatively, the immunostimulatory agent or detectable marker can be covalently bound to the outer surface of the liposome, for example, by covalently binding to a liposome component or a steric stabilizer such as PEG.

[0194] One example of a reagent is fluorescein isothiocyanate (FITC), which, based on the inventors' experiments, surprisingly functions as both an immunostimulant and a detectable marker.

[0195] In some embodiments, the liposome further comprises an agent that increases uptake of the liposome into a desired intracellular compartment, including the cytosol.

[0196] In some embodiments, the liposomes comprise a mitochondrial targeting agent. In some embodiments, the liposomes comprise triphenylphosphonium (TPP). Methods and mechanisms for surface functionalization of liposomes with TPP are known in the art (e.g., attaching TPP to a lipid anchor via a PEG spacer group and modifying the TPP with a stearyl group (stearyltriphenylphosphonium (STPP))). In some embodiments, the liposomes comprise high-density octaarginine. In some embodiments, the liposomes comprise sphingomyelin and / or sphingomyelin metabolites. Sphingomyelin metabolites used to formulate the liposomes of the present invention can include, for example, ceramide, sphingosine, or sphingosine 1-phosphate. In some embodiments, the liposomes comprise rhodamine 123. In some embodiments, the liposomes comprise a mitochondrial penetrating peptide. In some embodiments, the liposome is selected from a mitofusin peptide, a mitochondrial targeting signal peptide, and an Antennapedia helix III homeodomain cell membrane penetrating peptide (ANT) (e.g., RQIKIWFQNRRMK WKKRKKRRQRRR,RKKRRXRRRGC), or a mitochondrial permeable fragment thereof.In some embodiments, the liposome comprises a mitochondrial-penetrating polynucleotide sequence selected from RQIKIWFQNRRMKWKKRKKRRQR RR (SEQ ID NO: 1), RKKRRXR RRGC, where X is any natural or unnatural amino acid (SEQ ID NO: 2), CCGCCAAGAAGCG (SEQ ID NO: 3), GCGTGCAACACGCGCGTA GACTTCCCCCGCAAGTCACTCGTTAGCCCGCCAAGAAGCGACCCCTCCGGGG CGAGCTGAGCGGCGTGGCGCGGGGGCGTCAT (SEQ ID NO: 4), ACGTGCAT ACGCACGTAGACATTCCCCGCTTCCCACTCCAAAGTCCGCCAAGAAGCGTATC CCGCTGAG CGGCGTGGCGCGGGGGCGTCATCCGTCAGCTC (SEQ ID NO: 5), or ACTTCCCCCGCAAGTCACTCGTTAGCCCGCCAAGAAGCGACCCCTCCGGGGCG AGCTG (SEQ ID NO: 6), or a mitochondrial-penetrating fragment thereof.

[0197] In some embodiments, the liposomes in the provided liposome compositions comprise a mitochondrial penetrant selected from a guanidine-rich peptoid, a tetraguanidinium, a triguanidinium, a diguanidinium, a monoguanidinium, a guanidine-rich polycarbamate, a beta-oligoarginine, a proline-rich dendrimer, and a phosphonium salt (e.g., methyltriphenylphosphonium and / or tetraphenylphosphonium).

[0198] In some embodiments, the liposomes in the provided liposome compositions comprise sphingomyelin and / or stearyl octaarginine. In some embodiments, the liposomes comprise sphingomyelin and / or stearyl octaarginine. In some embodiments, the liposomes comprise DOPE, sphingomyelin, stearyl octaarginine sphingomyelin, and stearyl octaarginine. In some embodiments, the liposomes comprise DOPE, sphingomyelin, stearyl octaarginine sphingomyelin, and stearyl octaarginine in a molar ratio of 9:2:1. In some embodiments, the liposomes comprise the MITO Porter® system or a variant thereof.

[0199] In some embodiments, the liposomes in the provided liposome compositions comprise an agent, such as a membrane permeabilizing agent, that facilitates delivery of the liposomes across a cell membrane and provides the liposomes with the ability to bypass the endocytic pathway and the harsh environment of the lysosome. Membrane permeabilizing agents are known in the art and are routinely used and applicable to the manufacture and use of the provided liposome compositions. In some embodiments, the membrane permeabilizing agent / lysosomal bypassing agent is chloroquine. In some embodiments, the membrane permeabilizing agent is a cell-penetrating peptide.In some embodiments, the liposomes in the provided liposome compositions comprise a membrane permeabilizer selected from the group consisting of RKKRRQRRR (SEQ ID NO: 7), GRKKRRQRRRTPQ (SEQ ID NO: 8), YGRKKRRQRRR (SEQ ID NO: 9), AAVALLPAVLLALLA (SEQ ID NO: 10), MGLGLHLLVLAAALQ (SEQ ID NO: 11), GALFLGFLGAAGS™ (SEQ ID NO: 12), AGYLLGKINLKALAALAKKIL (SEQ ID NO: 13), RVIRVWFQNKRCKDKK (SEQ ID NO: 14). , RQIKIWFQNRRMKWKK (SEQ ID NO: 15), GLFEAIAGFIENGWEGMIDG (SEQ ID NO: 16), GWTLNSAGYLLGKIN (SEQ ID NO: 17), RSQSRSRYYRQRQRS (SEQ ID NO: 18), LAIPEQEY (SEQ ID NO: 19), LGIAEQEY (SEQ ID NO: 20), LGIPAQEY (SEQ ID NO: 21), LGIPEAEY (SEQ ID NO: 22), LGIPEQAY (SEQ ID NO: 23), LGIAEAEY (SEQ ID NO: 24), LGIPEAAY (SEQ ID NO: 25), LGIAEQAY (SEQ ID NO: 26). 26), LGIAEAAY (SEQ ID NO: 27), LLIILRRRIRKQAHAHSK (SEQ ID NO: 28), LKALAALAKKIL (SEQ ID NO: 29), KLALKLALKALKAALKLA (SEQ ID NO: 30), KETWWETWWTEWSQPKKKRKV (SEQ ID NO: 31), DHQLNPAF (SEQ ID NO: 32), DPKGDPKG (SEQ ID NO: 33), VTVTVTVTVTGKGDPKPD (SEQ ID NO: 34), RQIKIWFQNRRMKWKK (SEQ ID NO: 35), GRKKRR...

Claims

1. A liposomal composition comprising a gamma polyglutamylated antifolate (Lp-γ PANTIFOL composition), said gamma polyglutamylated antifolate comprising 2-10 glutamyl groups; The antifolates in the gamma polyglutamated antifolates are pralatrexate, AG2034, GW1843, and LY309887, or stereoisomers thereof; RTX, and LMX, or stereoisomers thereof; 2-dMTX, 2-desamino-MTX; 2-CH3-MTX, 2-desamino-2-methyl-MTX; AMT, aminopterin; 2-dAMT, 2-desamino-AMT; 2-CH3-AMT, 2- Desamino-2-methyl-AMT; 10-EdAM, 10-ethyl-10-deazaaminopterin; DDATHF (lometrexol), 5,10-dideaza-5,6,7,8-tetrahydrofolic acid; 5-d(i)H4PteGlu, 5-deaza-5,6,7,8-tetrahydroisofolic acid; N9-CH3-5-d(i)H4PteGlu, N9-methyl-5-deaza-5,6,7,8-tetrahydroisofolic acid; 5-dPteHCysA, N alpha-(5-deazapteroyl)-L-homocysteic acid; 5-dPteAPBA, N alpha-(5-deazapteroyl)-DL-2-amino-4-phosphonobutyric acid; 5-dPteOrn, N alpha-(5-deazapteroyl)-L-ornithine; 5-dH4PteHCysA, N alpha-(5-deaza-5,6,7,8-tetrahydropteroyl)-L-homocysteic acid; 5-dH4PteAPBA, N alpha-(5-deaza-5,6,7,8-tetrahydropteroyl)-DL-2-amino-4-phosphobutanoic acid; 5-dH4PteOro, N Alpha-(5-dideaza-5,6,7,8-tetrahydropteroyl)-L-ornithine; ICI-198,583, 2-desamino-2-methyl-N10-propargyl-5,8-dideazafolic acid; 4-H-ICI-198,583, 4-deoxy-ICI-198,583: 4-OCH3-ICI-198,583, 4-methoxy-ICI-198,583 Glu-to-Val-ICI-198,583; valine-ICI-198,583; Glu-to-Sub-ICI-198,583, 2-aminosuberic acid-ICI-198,583; 7-CH3-ICI-198,583, 7-methyl-ICI-198,583; ZD1694, N-[5(N-(3,4-dihydro-2-methyl-4-oxo (S)-2[5-(((1,2-dihydro-3-methyl-1-oxobenzo(f)quinazolin-9-yl)methyl)amino-)-1-oxo-2-isoindolinyl]-glutaric acid; LY231514, N-(4-(2-(2-amino-4,7-dihydro-4-oxo-3H-pyrrolo[2,3-D]pyrimidin-5-yl)ethyl)-benzoyl]-L-glutamic acid; IAHQ, 5,8-dideazaisofolic acid; 2-dIAHQ, 2-desamino-IAHQ; 2-CH3-dIAHQ, 2-desamino-2-methyl-IAHQ; 5-d(i)PteGlu, 5-deazaisofolic acid; N9-CH3-5-d(i)PteGlu, N9-methyl-5-deazaisofolic acid; N9-CHO-5-d(i)PteGlu, N9-formyl-5-deazaisofolic acid; The liposome is pegylated and contains a targeting moiety that has specific affinity for a surface antigen on a target cell of interest; The liposomes further encapsulate one or more non-polyglutamylatable and / or non-polyglutamylatable antifolates; the non-polyglutamylatable antifolate is selected from the group consisting of methotrexate (MTX), pemetrexed (PMX), lometrexol (LMX), raltitrexed (RTX), pralatrexate, AG2034, GW1843, aminopterin, and LY309887; the non-polyglutamylatable antifolate is selected from the group consisting of trimetrexate (TMQ), piritrexim (BW301U), and tarotrexin (PT523), nolatrexide (AG337), previtrexed (ZD9331, BGC9331), and BGC945 (ONX0801); Lp-γPANTIFOL composition.

2. The Lp-γ PANTIFOL composition of claim 1, wherein said gamma polyglutamylated antifolate contains from 4 to 6 glutamyl groups.

3. 2. The Lp-γ PANTIFOL composition of claim 1, wherein said gamma polyglutamated antifolate is a gamma tetraglutamated antifolate.

4. 2. The Lp-γ PANTIFOL composition of claim 1, wherein said gamma polyglutamated antifolate is a gamma pentaglutamated antifolate or a gamma hexaglutamated antifolate.

5. (a) at least two of the glutamyl groups of the gamma polyglutamated antifolate are in the L-configuration; (b) each of the glutamyl groups of the gamma polyglutamated antifolate is in the L-configuration; (c) at least one of the glutamyl groups of the gamma polyglutamated antifolate is in the D form; (d) each of the glutamyl groups of the gamma polyglutamylated antifolate other than the glutamyl group of the antifolate is in the D form; or (e) at least two of the glutamyl groups of the gamma polyglutamated antifolate are in the L-form and at least one of the glutamyl groups is in the D-form; The Lp-γ PANTIFOL composition of claim 1.

6. The Lp-γ PANTIFOL composition of claim 1, wherein the liposomes have a diameter in the range of 20 nm to 200 nm or 80 nm to 120 nm.

7. The liposome composition of claim 1 , wherein the targeting moiety is covalently attached to one or both of the PEG and the exterior surface of the liposome.

8. 2. The liposome composition of claim 1, wherein the targeting moiety is a polypeptide or one or more selected from the group consisting of an antibody, a humanized antibody, an antigen-binding fragment of an antibody, a single chain antibody, a single domain antibody, a bispecific antibody, a synthetic antibody, a pegylated antibody, and a multimeric antibody.

9. The liposome composition of claim 1, wherein the liposome comprises 30 to 200 targeting moieties.

10. A liposome is formed from the liposome components; the liposome component comprises at least one of an anionic lipid and a neutral lipid, and at least one selected from the group consisting of DSPE; DSPE-PEG; DSPE-PEG-maleimide; HSPC; HSPC-PEG; cholesterol; cholesterol-PEG; and cholesterol-maleimide; The liposome component may comprise at least one selected from the group consisting of DSPE; DSPE-PEG; DSPE-PEG-FITC; DSPE-PEG-maleimide; cholesterol; and HSPC; One or more of the liposome components may further comprise a steric stabilizer, which may be selected from the group consisting of polyethylene glycol (PEG); poly-L-lysine (PLL); monosialoganglioside (GM1); poly(vinylpyrrolidone) (PVP); poly(acrylamide) (PAA); poly(2-methyl-2-oxazoline); poly(2-ethyl-2-oxazoline); phosphatidyl polyglycerol; poly[N-(2-hydroxypropyl)methacrylamide]; amphiphilic poly-N-vinylpyrrolidone; L-amino acid based polymers; oligoglycerin, polyethylene glycol and polypropylene oxide containing copolymers, poloxamer 188, and polyvinyl alcohol, and the steric stabilizer may be PEG and the PEG may have a number average molecular weight (Mn) of 200 to 5000 Daltons. The Lp-γ PANTIFOL composition of claim 1.

11. The liposomes are anionic; The liposomes are cationic; The liposomes are neutral; The liposomes have a zeta potential of less than zero; the liposome has a zeta potential of 0 to -150 mV; or The liposomes have a zeta potential of -30 to -50 mV; The Lp-γ PANTIFOL composition of claim 1.

12. 2. The Lp-γ PANTIFOL composition of claim 1, wherein the liposome has an interior space that contains a gamma polyglutamated antifolate and an aqueous pharma- ceutically acceptable carrier, The pharma- ceutically acceptable carrier may include isotonicity agents such as dextrose, mannitol, glycerol, potassium chloride, sodium chloride at a concentration greater than 1%, 1%-50% trehalose, 5% dextrose suspended in HEPES buffer, or sodium acetate and calcium acetate at a total concentration of 50 mM-500 mM; The interior space of the liposome may have a pH of 5 to 8 or a pH of 6 to 7, or any range therebetween; The liposome may contain less than 500,000 or less than 200,000 gamma polyglutamated antifolate molecules or between 10 and 100,000 gamma polyglutamated antifolate molecules or any range therebetween. The Lp-γ PANTIFOL composition of claim 1.

13. The liposome further comprises one or more of an immunostimulant, a detectable marker, and a maleimide, wherein the immunostimulant, the detectable marker, or the maleimide is attached to the PEG or the outer surface of the liposome, and the immunostimulant is selected from the group consisting of fluorescein, fluorescein isothiocyanate (FITC), DNP, beta glucan, beta-1,3-glucan, beta-1,6-glucan, resolvin (e.g., DNP, ｎ－６ＤＰＡ Or D ｎ－３ＤＰＡ 2. The Lp-γ PANTIFOL composition of claim 1, wherein the at least one selected from the group consisting of toll-like receptor (TLR) modulators such as resolvin D, resolvin E, or T-series resolvins (e.g., OXPAC, PGPC), and erythrotropin lipids (e.g., E5564), may further comprise at least one cryoprotectant selected from the group consisting of mannitol, trehalose, sorbitol, and sucrose, or may further comprise carboplatin and / or pembrolizumab; Lp-γPANTIFOL composition.

14. A pharmaceutical composition comprising the Lp-γ PANTIFOL composition of claim 1.

15. A Lp-γ PANTIFOL composition according to any one of claims 1 to 13 or a pharmaceutical composition according to claim 14 for use in the treatment of a disease, said disease being cancer, a disorder of the immune system or an infectious disease, said disease being an autoimmune disease, rheumatoid arthritis or an inflammatory condition. The Lp-γ PANTIFOL composition according to any one of claims 1 to 13 or the pharmaceutical composition according to claim 14.

16. 14. A method of making a gamma polyglutamated antifolate composition comprising the Lp-gamma PANTIFOL composition of any of claims 1-13, comprising forming a mixture in a solution comprising liposome components and a gamma polyglutamated antifolate; homogenizing the mixture in the solution to form liposomes; and treating the mixture to form liposomes comprising the gamma polyglutamated antifolate. The processing steps may include one or more steps of thin film hydration, extrusion, in-line mixing, ethanol injection technique, freeze-thaw method, reverse phase evaporation, dynamic high pressure microfluidization, microfluidic mixing, double emulsion, freeze-dried double emulsion, 3D printing, membrane contactor, and stirring; method.

Images