Polypeptides and their uses

Abstract

The present invention provides a polypeptide and its use, the polypeptide comprising an N-terminal sequence and a C-terminal sequence, the N-terminal sequence comprising one or more repeating units, the repeating units comprising the amino acid sequence of SEQ ID NO.1.The present invention provides a use of a human body structural material for tissue filling and compatibilization, which does not require transplantation from the human body and has the natural advantages of human body tissue filling, and is expected to be widely applied in the fields of breast augmentation, rhinoplasty, midface filling and the like.

Description

Technical Field

[0001] This application claims the right of priority of Chinese Patent Application for Invention No. 202210761804.8, titled "Polypeptide and Its Use", filed on June 29, 2022, which is incorporated herein by reference. The present invention belongs to the field of synthetic biotechnology, and specifically relates to a collagen polypeptide, which can be used as a human body structural material for tissue filling and compatibilization.

Background Art

[0002] Due to genetic factors, nutritional status, age factors, etc., some people have facial structural defects such as temporal fossa depression, nasal base depression, jaw shortness and shrinkage, and low nasal bridge. Some women have problems such as poor breast development or sagging atrophy, which have a profound impact on aesthetics. With the continuous improvement of people's living standards and the opening of thinking concepts, more and more people are beginning to pay attention to beauty plastic surgery. Currently, by improving a woman's appearance and figure through filling surgery, an excellent nose shape, a flat and smooth face, and a plump and smooth breast can be obtained. The filling surgery at the current stage can be mainly divided into prosthetic transplantation surgery, autologous tissue transplantation surgery, and injection filling surgery.

[0003] Silica gel has good tissue compatibility, no problems such as carcinogenesis, mutagenesis, and teratogenesis, and all aspects such as anti-tearing force, hardness, and elastic shrinkage force are satisfactory. Therefore, early breast augmentation surgery and rhinoplasty often use silica gel prostheses as implants. This has the advantages of being easy to operate, having a beautiful appearance, and showing immediate effects. However, due to the presence of static electricity on the surface of silica gel prostheses, they are likely to adsorb some dust or hair, and it is easy for the wound to become infected. There may also be some complications after surgery. For example, the incision marks for breast augmentation are obvious, the cleavage is too wide, it is difficult to lift, the prosthesis ruptures, leaks, and complications such as capsular contracture occur, and the probability of the prosthesis contracting and rupturing increases with the extension of the transplantation time of the prosthesis. Rhinoplasty is prone to problems such as the prosthesis transmitting light, low tissue compatibility, hard material, poor touch after transplantation, and easy displacement, and it also causes complications such as nasal swelling, nasal tip dermatitis, and excessive subcutaneous tension, and cannot support the nasal dorsum.

[0004] With the development of plastic surgery techniques, autologous tissue transplantation is playing an increasingly important role in cosmetic surgery. Here, autologous fat breast augmentation, rhinoplasty, and central facial filling involve transplanting fat granules from areas rich in autologous fat to the desired areas. Autologous fat transplantation generally adopts an injection method, with less pain, less surgical trauma, short time, no obvious scars in the surgical area, and rapid recovery after surgery. Its filler is derived from oneself, has biocompatibility, has no immune rejection reaction after transplantation, and does not affect the functions of one's own breasts or nose. It has excellent fusion and is less likely to displace. There are few complications after surgery. At the same time, one can lose weight. However, there are deficiencies such as high absorption rate and low survival rate in conventional fat collection techniques and injection techniques. If a single transplantation is excessive, it will cause complications such as breast nodules. Therefore, multiple fat transplants are always required to achieve the desired effect. In addition to autologous fat, autologous cartilage can be used as a raw material for filling the nose and the central part of the face, and has similar advantages to autologous fat, but it generates autologous torsional deformation, which greatly affects the subsequent filling effect.

[0005] Injection filling is a surgical method of filling artificial chemical substances into the breast or facial defect sites by injection. Here, artificial fat is the most commonly used injection filling material, and its chemical composition is hydrophilic polypropylene amine hydrogel, which is generally used in breast augmentation surgery. However, it has been found that it has many complications and adverse reactions in subsequent long-term applications. The hydrogel contains toxic heavy metals in the manufacturing process, is easily absorbed and accumulated by the human body through the skin and mucous membranes, and thereby causes poisoning. Moreover, it also has varying degrees of toxicity and side effects on cells and the kidneys. After injection, it causes complications such as lumps or nodules in the breast, pain, asymmetry of both breasts, infection, lactation mastitis, aseptic inflammation, breast collapse and perforation, displacement of the injected substance, and restriction of upper limb movement. In some patients, several complications coexist.

[0006] With the development of modern technology, recombinant collagen can be produced by genetic engineering technology. However, the currently commercially available collagen is mainly obtained by mutating the sequence of human-derived collagen, belongs to collagen-like, and still has a certain immunogenicity. Moreover, in order to realize its biological properties and complete tissue compatibilization and filling, it is still necessary to mix it with a cross-linking agent to produce a gel product. However, when using a cross-linking agent, side effects and foreign body reactions that have not been observed often occur in collagen with low immunogenicity and no toxicity. Therefore, this field needs to invent a humanized collagen that has no foreign gene sequence, no immunogenicity, high biocompatibility, and can cross-link autonomously, and is used for tissue filling and compatibilization as a human body structural material.

Summary of the Invention

[0007] The inventors of the present invention have conducted long-term research on humanized collagen and discovered various type III collagen polypeptides in Chinese Patent Applications CN201210482543.2 and CN201811438582.6. The inventors further studied these discovered collagen polypeptides and found that these collagen polypeptides cannot form gels by themselves at low temperatures. Surprisingly, the inventors added small peptide segments based on the collagen polypeptides of the conventional invention, and the formed collagen polypeptides can form gels at low temperatures. The gel of the present invention may not contain a cross-linking agent.

[0008] In one aspect, the present invention provides a polypeptide, the polypeptide includes an N-terminal sequence and a C-terminal sequence, the N-terminal sequence includes one or more repeating units, the repeating unit includes the amino acid sequence shown in SEQ ID NO.1, and the C-terminal sequence is the amino acid sequence shown in SEQ ID NO.2. The amino acid sequence of SEQ ID NO.1 is gergapgfrgpagpngipgekgpagergap. The amino acid sequence of SEQ ID NO.2 is gapgpccgg.

[0009] In one embodiment, the repeating unit may be an amino acid sequence obtained after the amino acid sequence of SEQ ID NO.1 has undergone mutations (substitutions, insertions, deletions, or additions) of one or more amino acid residues.

[0010] In one embodiment, the C-terminal sequence may be an amino acid sequence obtained after the amino acid sequence of SEQ ID NO.2 has undergone mutations (substitutions, insertions, deletions, or additions) of one or more amino acid residues.

[0011] In one embodiment, the number of repeating units is 1-20.

[0012] In one embodiment, the number of repeating units is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.

[0013] In one embodiment, the N-terminal sequence and the C-terminal sequence are directly connected or connected with one or more amino acid residues intervening therebetween.

[0014] In one embodiment, each repeating unit is directly connected or connected with one or more amino acid residues intervening therebetween.

[0015] In one embodiment, the polypeptide comprises the amino acid sequence shown in SEQ ID NO.3, or an amino acid sequence obtained after the amino acid sequence of SEQ ID NO.3 has undergone mutations (substitution, insertion, deletion or addition) of one or more amino acid residues.

[0016] In one embodiment, when the polypeptide sequence is mutated, the resulting polypeptide retains the functions of the present invention, such as cell adhesion, the ability to form a gel by itself, etc.

[0017] In one aspect, the present invention provides a polynucleotide, which encodes the polypeptide described in the present application.

[0018] In one embodiment, the polynucleotide comprises the nucleotide sequence shown in SEQ ID NO.4.

[0019] In one aspect, the present invention provides a nucleic acid, which contains the polynucleotide of the present application.

[0020] In one embodiment, the nucleic acid further contains nucleotides encoding a purification tag, such as His tag, GST tag, MBP tag, SUMO tag or NusA tag.

[0021] In one embodiment, the nucleic acid further contains nucleotides encoding a leader sequence.

[0022] In one aspect, the present invention provides a vector, which contains the polynucleotide or nucleic acid of the present application.

[0023] In one embodiment, the vector is an expression vector.

[0024] In one embodiment, the vector comprises an expression control element, such as a promoter, a terminator, and / or an enhancer, operably linked to a polynucleotide or nucleic acid.

[0025] In one aspect, the present invention provides a host cell, which comprises the polynucleotide, nucleic acid, or vector of the present application.

[0026] In one embodiment, the host cell is a bacterium, a fungus, or an animal cell.

[0027] In one embodiment, the bacterium is Escherichia coli.

[0028] In one embodiment, the fungus is yeast, such as Saccharomyces cerevisiae.

[0029] In one aspect, the present invention provides a method for producing a polypeptide, the method comprising the following steps: (1) culturing the host cell of the present application under appropriate culture conditions; (2) harvesting the host cell and / or the medium containing the polypeptide; (3) purifying the polypeptide.

[0030] In one aspect, the present invention provides a composition, which comprises the polypeptide described in the present application. The composition may be a composition for tissue filling and / or solubilization.

[0031] In one aspect, the present invention provides a gel, which comprises the polypeptide described in the present application or is produced from the polypeptide.

[0032] In one embodiment, the gel does not contain a crosslinking agent.

[0033] In one embodiment, the gel of the present application is a human structural material and can be used for tissue filling and / or compatibilization.

[0034] In another aspect, the present invention provides a method for manufacturing a gel, the method including the step of storing the polypeptide described in the present application at a low temperature.

[0035] In one embodiment, the low temperature is a temperature of 2 to 8 °C.

[0036] In one embodiment, the low temperature is 2 °C, 3 °C, 4 °C, 5 °C, 6 °C, 7 °C or 8 °C.

[0037] In one embodiment, the method of the present invention includes the step of storing a polypeptide solution. Preferably, the polypeptide solution is a sodium chloride solution of the polypeptide. The solution may be 50 - 500 mM of NaCl, for example 100 mM, 150 mM, 200 mM, 250 mM, 300 mM, 350 mM, 400 mM or 450 mM.

[0038] In one embodiment, the pH of the sodium chloride solution is 6 or more, for example 6.5, 7, 7.5, 8.0, 8.5, 9 or 9.5.

[0039] In another aspect, the present invention provides the use of the polypeptide, polynucleotide, nucleic acid, host cell, composition or gel of the present application for increasing cell adhesion or for tissue filling and compatibilization. For example, the polypeptide, polynucleotide, nucleic acid, host cell, composition or gel of the present application can be used for breast augmentation, rhinoplasty and / or facial filling.

[0040] The present invention includes the following advantages: 1. The present invention has successfully synthesized a recombinant type III humanized collagen low-temperature gel for the first time, and all of its amino acid sequences are derived from the human body itself without foreign amino acid sequences. 2. The recombinant type III humanized collagen produced by the present invention can generate a cross-linking reaction to form a low-temperature gel even when no exogenous cross-linking agent is involved, and has no biological toxicity. 3. The recombinant type III humanized collagen low-temperature gel produced by the present invention belongs to humanized collagen, has good tissue filling and compatibilizing effects, has no immune reaction when applied to the human body, has high tissue compatibility, and can be directly injected into the human body as a human body structural material. 4. The method for biosynthesizing the recombinant type III humanized collagen low-temperature gel in the present invention can be stably produced on an industrial scale. 5. The present invention provides the use of a human body structural material used for tissue filling and compatibilization. Since it does not need to be transplanted from the human body and has the natural advantages of human tissue filling, it can be expected to be widely applied in fields such as breast augmentation, rhinoplasty, and central facial filling.

Brief Description of the Drawings

[0041]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Embodiments for Carrying Out the Invention

[0042] To make the objectives, technical solutions, and advantages of the present invention clearer, the following combines the embodiments of the present invention to clearly and completely explain the technical configurations in the embodiments of the present invention. The described embodiments are some of the embodiments of the present invention, not all of them. Based on the embodiments in the present invention, any other embodiments that can be conceived by those skilled in the art without creative efforts belong to the protection scope of the present invention.

[0043] The inventors of the present invention have conducted long-term research on humanized collagen and discovered various type III collagen polypeptides in Chinese Patent Applications CN201210482543.2 and CN201811438582.6. The inventors of the present invention further studied these discovered collagen polypeptides and found that these collagen polypeptides cannot form gels by themselves at low temperatures. Surprisingly, the inventors added small peptide segments based on the collagen polypeptides of the conventional invention, and the formed collagen polypeptides can form gels at low temperatures. The gel of the present invention may not contain a cross-linking agent. The amino acid sequence of the screened recombinant type III humanized collagen AT16 functional region is as follows: gergapgfrgpagpngipgekgpagergap gergapgfrgpagpngipgekgpagergap gergapgfrgpagpngipgekgpagergap gergapgfrgpagpngipgekgpagergap gergapgfrgpagpngipgekgpagergap gergapgfrgpagpngipgekgpagergap gergapgfrgpagpngipgekgpagergap gergapgfrgpagpngipgekgpagergap gergapgfrgpagpngipgekgpagergap gergapgfrgpagpngipgekgpagergap gergapgfrgpagpngipgekgpagergap gergapgfrgpagpngipgekgpagergap gergapgfrgpagpngipgekgpagergap gergapgfrgpagpngipgekgpagergap gergapgfrgpagpngipgekgpagergap gergapgfrgpagpngipgekgpagergap g apgpccgg (SEQ ID NO.3). The underlined amino acid sequence portion is a new combination of functional regions made based on the amino acids of Patent CN201811438582.6.

[0044] As described in the present application, "polypeptide" refers to a plurality of amino acid residues connected by peptide bonds. As described in the present application, for a polypeptide or a specific amino acid sequence, "C-terminal" and "N-terminal" refer to the positions relative to the polypeptide or the specific amino acid sequence, specifically referring to the directions located at the carboxyl terminus or amino terminus of the polypeptide or the specific amino acid sequence.

[0045] In the present application, from the N-terminal to the C-terminal, the polypeptide can include an N-terminal sequence and a C-terminal sequence. The N-terminal sequence can include one or more repeating units, and the repeating unit includes the amino acid sequence shown in SEQ ID NO.1 or an amino acid sequence obtained by mutation (substitution, addition, insertion or deletion) of one or more amino acid residues in the amino acid sequence. The number of repeating units can be 1 - 20. For example, the number of repeating units can be 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20. In particular, the mutation can be a substitution, for example, a conservative amino acid substitution. The amino acid sequence of SEQ ID NO.1 is gergapgfrgpagpngipgekgpagergap. In the N-terminal sequence, each repeating unit can be directly connected or connected with one or more amino acid residues in between.

[0046] The C-terminal sequence may be the amino acid sequence shown in SEQ ID NO.2 or an amino acid sequence in which the amino acid sequence has undergone mutation (substitution, addition, insertion or deletion) of one or more amino acid residues. In particular, the mutation may be a substitution, for example, a conservative amino acid substitution. The amino acid sequence of SEQ ID NO.2 is gapgpccgg. The N-terminal sequence and the C-terminal sequence can be directly connected or separated and connected by one or more amino acid residues, for example, 2-10 amino acid residues. For example, the N-terminal sequence and the C-terminal sequence can be separated and connected by 3, 4, 5, 6, 7, 8 or 9 amino acid residues.

[0047] When a mutation occurs in the polypeptide sequence or a spacer sequence exists, the resulting polypeptide retains the functions of the present invention, such as cell adhesion, the ability to form a gel by itself, etc.

[0048] The polypeptide of the present invention may be synthesized or expressed recombinantly. When expressed recombinantly, the polypeptide of the present invention can be encoded by a polynucleotide. The polynucleotide can be codon-optimized for the host cell to be expressed. The polynucleotide encoding the polypeptide can be operably linked to expression control elements, such as a promoter, a terminator and / or an enhancer, to form a nucleic acid or an expression cassette. The nucleic acid can further contain a nucleotide encoding a purification tag, such as a His tag, a GST tag, an MBP tag, a SUMO tag or a NusA tag, or a nucleotide encoding a leader sequence, in order to facilitate the purification or secretion of the polypeptide.

[0049] As described in the present application, the term "vector" is a nucleic acid delivery tool into which a polynucleotide can be inserted. A vector is called an expression vector when it can express the protein encoded by the inserted polynucleotide. A vector can be introduced into a host cell by transformation, transduction or transfection, and express the genetic material element carried therein in the host cell. Vectors are known to those skilled in the art and include, but are not limited to, the following: plasmids; phages; cosmids; artificial chromosomes, such as yeast artificial chromosomes (YACs), bacterial artificial chromosomes (BACs) or P1-derived artificial chromosomes (PACs); phages, such as λ phages or M13 phages, and animal viruses, etc. A vector can contain elements that control various expressions, including, but not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection elements and reporter genes. In addition, a vector can further contain an origin of replication. A vector can contain the nucleic acid of the present invention for introduction into a cell for expression. A vector can contain expression control elements, such as promoters, terminators and / or enhancers, operably linked to the nucleic acid.

[0050] As described in the present application, the term "host cell" is a cell into which a nucleic acid molecule has been introduced by molecular biology techniques. These techniques include transfection with viral vectors, transformation with plasmid vectors, and introduction into naked DNA by electroporation, lipid transfection, and particle guns. The host cell may be a eukaryotic cell or a prokaryotic cell. For example, eukaryotic cells are yeast cells, animal cells and / or insect cells. The prokaryotic cell may be an Escherichia coli cell.

[0051] The present invention further provides a method for producing a polypeptide, which includes the following steps: (1) culturing the host cell of the present application under appropriate culture conditions, (2) harvesting the host cell and / or the medium containing the polypeptide, and (3) purifying the polypeptide. The method of the present invention can include the step of enzymatically cleaving the tag.

[0052] The polypeptide of the present invention can be manufactured into a composition or a kit. The composition or the kit may be a composition or a kit for tissue filling and / or compatibilization. The composition or the kit may further contain an auxiliary substance. The composition of the present invention may be a gel, which contains the polypeptide described in the present application. The gel can be spontaneously generated by the polypeptide described in the present application and does not contain a cross-linking agent. The composition of the present invention, particularly the gel, is a human body structural material and can be used, for example, for tissue filling and / or compatibilization. The gel of the present invention can be manufactured by a simple method. For example, the method for manufacturing the gel can include the step of storing the polypeptide described in the present application at a low temperature. The polypeptide of the present invention can complete self-gelation at a low temperature. The low temperature may be a temperature of 2 to 8 °C, for example, 2 °C, 3 °C, 4 °C, 5 °C, 6 °C, 7 °C or 8 °C. The method of the present invention can include the step of storing a polypeptide solution. Preferably, the polypeptide solution is an aqueous solution of sodium chloride of the polypeptide. The sodium chloride solution may be a solution of 50 mM to 500 mM. For example, the sodium chloride solution may be 100 mM, 150 mM, 200 mM, 250 mM, 300 mM, 350 mM, 400 mM or 450 mM.

[0053] In one embodiment, the pH of the sodium chloride solution is 6 or more, for example, 6.5, 7, 7.5, 8.0, 8.5, 9 or 9.5. The polypeptide concentration in the solution may be greater than 5 mg / mL, or may be greater than 10 mg / mL. For example, the polypeptide concentration may be 10 mg / mL, 15 mg / mL, 20 mg / mL, 30 mg / mL, 40 mg / mL, 50 mg / mL, 60 mg / mL, 70 mg / mL, 80 mg / mL, 90 mg / mL, 100 mg / mL, 200 mg / mL, 300 mg / mL or a concentration higher than that. Examples

[0054] The present invention will be described by providing the following examples. Those skilled in the art should understand that the examples are merely illustrative and not limiting. The present invention is limited only by the appended claims.

[0055] Example 1: Construction and Expression of Recombinant Type III Humanized Collagen Gel

[0056] 3. The synthesized gene fragment was inserted into the pET-28a-Trx-His expression vector to obtain a recombinant expression plasmid.

[0057] 4. The successfully constructed expression plasmid was transformed into Escherichia coli competent cells BL21(DE3). The specific process is as follows: (1) Take out Escherichia coli competent cells BL21(DE3) from the ultra-low temperature refrigerator and place them on ice. When they are semi-melted, take 2 μl of the plasmid to be transformed and add it to Escherichia coli competent cells BL21(DE3), and mix evenly 2-3 times. (2) Incubate the mixture in an ice bath on ice for 30 min, then perform heat shock in a 42 °C water bath for 45-90 s. After taking it out, incubate it in an ice bath on ice for 2 min. (3) Transfer it to a biosafety cabinet and add it to 700 μl of liquid LB medium, and then culture it at 37 °C and 220 rpm for 60 min. (4) Take 200 μl of the bacterial solution and spread it evenly on an LB plate containing kanamycin. (5) Culture the plate in an incubator at 37 °C for 15-17 h to generate colonies with uniform size.

[0058] 5. Select a preferred single Escherichia coli genetic engineering colony, place it in an LB liquid medium containing kanamycin, culture it at 37 °C and 220 rpm for 5 h, then cool it down to 16 °C, and add IPTG with a final concentration of 0.5 mM for induction. After culturing for 16 h, centrifuge at 6000 rpm and 4 °C for 12 min to collect the bacterial cells.

[0059] 5. Recombinant humanized type III collagen was purified and enzymatically cleaved. The specific process is as follows: (1) Bacteria were resuspended in Tris buffer (25 mM Tris, 200 mM NaCl, 20 mM imidazole, pH = 8.0), homogenously disrupted, centrifuged at 17,000 rpm for 20 minutes at 4°C, and the supernatant was collected; (2) The protein was bound to a Ni6FF affinity column, the heteroproteins were rinsed with a washing buffer solution containing 20 mM imidazole (20 mM imidazole, 25 mM Tris, 200 mM NaCl, pH 8.0), and the target protein was eluted with a solution containing 350 mM imidazole (350 mM imidazole, 25 mM Tris, 200 mM NaCl, pH 8.0); (3) An appropriate amount of TEV protease with His tag was added to the eluted protein sample at 20°C and enzymatically cleaved for 2 h to obtain recombinant humanized type III collagen AT16; (4) Using a 10 kDa dialysis bag, the mixture of enzymatically cleaved recombinant humanized type III collagen AT16 was dialyzed to exchange it with a sodium chloride solution; (5) Using a 10 kDa ultrafiltration concentration tube, the exchanged recombinant humanized type III collagen AT16 was concentrated to a protein concentration of 10 mg / mL or higher.

[0060] 6. Formation of recombinant type III humanized collagen gel. The specific process is as follows: The obtained recombinant humanized type III collagen AT16 was stored in a refrigerator, and the protein was crosslinked in a low-temperature environment to form a gel.

[0061] 7. Purity detection of recombinant type III humanized collagen gel The obtained AT16 protein was detected for purity using SDS-PAGE. The specific process is as follows: Take 20 μL of the purified protein solution, add 5 μL of 5× protein loading buffer (250 mM Tris-HCl (pH 6.8), 10% SDS, 0.5% bromophenol blue, 50% glycerin, 5% β-mercaptoethanol), place it in boiling water at 100 °C and boil for 5 min. Then add 10 μL to each well of the SDS-PAGE protein gel, perform electrophoresis at a voltage of 150 V for 1 h, then perform protein staining with Coomassie Brilliant Blue staining solution (0.1% Coomassie Brilliant Blue R-250, 25% ethanol, 10% glacial acetic acid) for 3 min, and further decolorize with protein decolorizing solution (10% acetic acid, 5% ethanol).

[0062] Figure 1 shows the electrophoresis detection results of the purified recombinant type III humanized collagen AT16. The apparent molecular weight of AT16 is 45 kDa, which corresponds to the AT16 polypeptide molecular weight, indicating that the polypeptide AT16 is accurately expressed.

[0063] Example 2: Detection of the biological activity of recombinant type III humanized collagen AT16 For the method of detecting the activity of collagen, reference can be made to the literature Juming Yao, Satoshi Yanagisawa, Tetsuo Asakura, Design, Expression and Characterization of Collagen-Like Proteins Based on the Cell Adhesive and Crosslinking Sequences Derived from Native Collagens, J Biochem. 136, 643-649(2004). The specific implementation method is as follows.

[0064] (1) Detect the concentration of the protein sample measured using the ultraviolet absorption method, including bovine type I collagen standard product (Sigma, number: 380002) and the recombinant type III humanized collagen AT16 provided by the present invention.

[0065] Specifically, the ultraviolet light absorption of each sample was measured at 215 nm and 225 nm, and the protein concentration was calculated using the empirical formula C (μg / mL) = 144×(A215 - A225). It should be noted that it is necessary to detect when A215 < 1.5. The principle of this method is as follows: Measure the characteristic absorption of peptide bonds in far ultraviolet light, which is not affected by the chromophore content, has few interfering substances, is easy to operate, and is suitable for detecting human collagen and its analogs that do not cause Coomassie Brilliant Blue to develop color. (The reference is Walker JM. The Protein Protocols Handbook, second edition. HumanaPress. 43 - 45). After detecting the protein concentration, all measured protein concentrations were adjusted to 0.5 mg / mL with PBS.

[0066] (2) 100 μL of various protein solutions and blank PBS solution controls were added to a 96 - well plate and left standing at room temperature for 60 min.

[0067] (3) 10 5 cultured 3T3 cells in good condition were added to each well and incubated at 37 °C for 60 min.

[0068] (4) Each well was washed 4 times with PBS.

[0069] (5) The absorbance at OD492 nm was detected using an LDH detection kit (Roche, 04744926001). Based on the numerical value of the blank control, the cell adhesion rate can be calculated. The calculation formula is as follows: Cell adhesion rate = (measured well - blank well) / (positive well - blank well)×100%. The cell adhesion rate can reflect the activity of collagen. The higher the protein activity, the better the external environment for cells can be provided in a short time, and the cell adhesion can be assisted.

[0070] The results are as shown in Figure 2 (D-PBS indicates the blank PBS group; B colI indicates the bovine type I collagen standard control group; 0.25 indicates the 0.25 mg / mL AT16 group; 0.5 indicates the 0.5 mg / mL AT16 group; 1 indicates the 1.0 mg / mL AT16 group). As can be seen from the comparison, compared with commercial human collagen, the recombinant type III humanized collagen AT16 at different concentrations of the present invention has better bioadhesive activity.

[0071] Example 3: Mass Spectrum Detection of Recombinant Type III Humanized Collagen AT16 Experimental Method

Table 1

[0072] After the protein sample was subjected to DTT reduction and iodoacetamide alkylation treatment, trypsin was added for enzymatic digestion and left overnight. The peptide fragments obtained after enzymatic digestion were further desalted with C18 ZipTip, and then mixed with the matrix α-cyano-4-hydroxycinnamic acid (CHCA) to spot the panel. Finally, matrix-assisted laser desorption ionization-time of flight mass spectrometer MALDI-TOF / TOF Ulraflextreme TM , Brucker, Germany was used for analysis (for the technique of peptide mass fingerprinting (PMF), refer to Protein J. 2016; 35: 212-7).

[0073] Data search is processed on the MS / MS Ion search page from the local maco website. The protein identification results were obtained based on the primary mass spectrum of the peptide fragments generated after enzymatic digestion. Detection parameters: Trypsin enzymatic digestion, two cleavage leakage sites were set. The alkylation of cysteine was set as a fixed modification. The oxidation of methionine was a variable modification. The database used for identification was NCBprot.

[0074]

Table 2

[0075] Example 4: Kinematic viscosity test of recombinant type III humanized collagen T16, TE16c, and AT16 Experimental method Recombinant type III human-derived collagen T16 (amino acid sequence: gergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergaprsgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergaprsgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergaprsgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergaprsgppgpccggg, SEQ ID NO.5) and TE16c (amino acid sequence: GERGAPGFRGPAGPNGIPGEKGPAGERGAPGERGAPGFRGPAGPNGIPGEKGPAGERGAPGERGAPGFRGPAGPNGIPGEKGPAGERGAPGERGAPGFRGPAGPNGIPGEKGPAGERGAPGERGAPGFRGPAGPNGIPGEKGPAGERGAPGERGAPGFRGPAGPNGIPGEKGPAGERGAPGERGAPGFRGPAGPNGIPGEKGPAGERGAPGERGAPGFRGPAGPNGIPGEKGPAGERGAPGERGAPGFRGPAGPNGIPGEKGPAGERGAPGERGAPGFRGPAGPNGIPGEKGPAGERGAPGERGAPGFRGPAGPNGIPGEKGPAGERGAP, SEQ ID NO. 6) and the recombinant type III humanized collagen AT16 of the present invention were stored in an environment of 2 to 8 °C respectively in the same concentration and corresponding solution (150 mM NaCl solution, polypeptide concentration 15 mg / mL), placed in a rotational viscometer, and their kinematic viscosities were measured and compared.

[0076] Experimental results The kinematic viscosities of recombinant type III human-derived collagens T16 and TE16c could not be measured, and the kinematic viscosity measured by the recombinant type III humanized collagen AT16 of the present invention was 3510 mPa·s. This indicates that the recombinant type III humanized collagen AT16 of the present invention can form a gel better under the same conditions, as shown in Figure 4. As can be seen from Figure 4, compared with T16 and TE16c which are colorless and transparent, AT16 is milky white and can form a gel.

[0077] Example 5: Purification and production of AT4, AT8, AT12, AT16, and AT20 proteins As described in Example 1, the AT4, AT8, AT12, AT16, and AT20 proteins were produced and purified. Among them, the number of repeating units (gergapgfrgpagpngipgekgpagergap) of AT4 is 4, the number of repeating units of AT8 is 8, the number of repeating units (gergapgfrgpagpngipgekgpagergap) of AT12 is 12, the number of repeating units of AT16 is 16, and the number of repeating units of the AT20 protein is 20. The specific sequences are as follows.

[0078] Amino acid sequence of AT4 Gergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgapgpccgg (SEQ ID NO. 11)

[0079] Corresponding optimized base sequence GGAGAAAGGGGGGCGCCTGGCTTTCGTGGTCCGGCGGGTCCGAATGGCATTCCGGGTGAAAAGGGTCCTGCCGGTGAGCGTGGTGCTCCGGGTGAGCGCGGCGCTCCGGGTTTCCGCGGTCCCGCGGGTCCGAACGGCATCCCGGGAGAAAAAGGCCCAGCTGGCGAGCGCGGTGCACCGGGCGAACGTGGTGCCCCGGGCTTCCGTGGCCCAGCGGGTCCGAACGGTATTCCGGGCGAGAAAGGTCCGGCAGGTGAACGTGGTGCGCCAGGCGAGCGTGGTGCGCCTGGTTTCAGAGGCCCAGCAGGCCCAAATGGCATCCCCGGTGAGAAGGGCCCAGCCGGTGAGCGCGGGGCACCGGGAGCGCCTGGTCCGTGTTGCGGTGGT(SEQ ID NO.12)

[0080] Amino acid sequence of AT8 Gergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgapgpccgg(SEQ ID NO.13)

[0081] Optimized base sequence for correspondence GGAGAAAGGGGGGCGCCTGGCTTTCGTGGTCCGGCGGGTCCGAATGGCATTCCGGGTGAAAAGGGTCCTGCCGGTGAGCGTGGTGCTCCGGGTGAGCGCGGCGCTCCGGGTTTCCGCGGTCCCGCGGGTCCGAACGGCATCCCGGGAGAAAAAGGCCCAGCTGGCGAGCGCGGTGCACCGGGCGAACGTGGTGCCCCGGGCTTCCGTGGCCCAGCGGGTCCGAACGGTATTCCGGGCGAGAAAGGTCCGGCAGGTGAACGTGGTGCGCCAGGCGAGCGTGGTGCGCCTGGTTTCAGAGGCCCAGCAGGCCCAAATGGCATCCCCGGTGAGAAGGGCCCAGCCGGTGAGCGCGGGGCACCGGGTGAACGTGGCGCGCCGGGCTTTCGCGGACCGGCGGGTCCGAACGGCATCCCGGGTGAGAAGGGTCCGGCTGGCGAGCGTGGTGCGCCGGGTGAACGTGGTGCACCGGGATTCCGCGGCCCGGCGGGACCGAATGGTATTCCGGGTGAGAAGGGTCCGGCGGGCGAACGCGGAGCACCAGGCGAACGCGGCGCTCCGGGCTTTCGCGGTCCGGCGGGTCCGAATGGTATCCCGGGCGAGAAGGGTCCTGCCGGTGAGCGTGGTGCCCCGGGCGAACGTGGCGCTCCGGGTTTTCGTGGTCCGGCGGGTCCGAACGGCATTCCGGGTGAAAAGGGCCCAGCGGGTGAGCGTGGCGCGCCAGGAGCGCCTGGTCCGTGTTGCGGTGGT(SEQ ID NO.14)

[0082] Amino acid sequence of AT12 gergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgapgpccgg(SEQ ID NO.15)

[0083] Optimized nucleotide sequence for correspondence

[0084] Amino acid sequence of AT16 gergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgapgpccgg

[0085] Optimized corresponding base sequence

[0086] Amino acid sequence of AT20 gergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgergapgfrgpagpngipgekgpagergapgapgpccgg

[0087] Optimized corresponding base sequence

[0088] Example 6: SDS-PAGE Experiment of AT4, AT8, AT12, AT16, and AT20 Experimental procedure: Take 20 μL of the purified protein solution, add 5 μL of 5× protein loading buffer (250 mM Tris HCl (pH 6.8), 10% SDS, 0.5% bromophenol blue, 50% glycerol, 5% β-mercaptoethanol), place it in boiling water at 100 °C and boil for 5 min. Then add 10 μL to each well of the SDS PAGE protein gel, perform electrophoresis at a voltage of 150 V for 1 h, and then perform protein staining with Coomassie Brilliant Blue staining solution (0.1% Coomassie Brilliant Blue R250, 25% ethanol, 10% glacial acetic acid) for 3 min, and further decolorize with protein decolorizing solution (10% acetic acid, 5% ethanol).

[0089] Experimental results: Figure 5 shows the electrophoresis detection results of the purified recombinant type III humanized collagen AT4, AT8, AT12, AT16, and AT20. The apparent molecular weights of AT4, AT8, AT12, AT16, and AT20 are 13 kDa, 26 kDa, 38 kDa, 45 kDa, and 66 kDa respectively, which correspond to the AT4, AT8, AT12, AT16, and AT20 polypeptides, indicating that the AT4, AT8, AT12, AT16, and AT20 polypeptides are accurately expressed.

[0090] Example 7: Detection of the Biological Activity of AT4, AT8, AT12, AT16, and AT20 Experimental procedure: The method for detecting the activity of collagen can refer to the literature Juming Yao, Satoshi Yanagisawa, Tetsuo Asakura, Design, Expression and Characterization of Collagen-Like Proteins Based on the Cell Adhesive and Crosslinking Sequences Derived from Native Collagens, J Biochem. 136, 643-649(2004). The specific implementation method is as follows.

[0091] (1) Detect the concentration of the protein sample measured by using the ultraviolet absorption method, including bovine type I collagen standard product (Sigma, number: 380002), recombinant type III humanized collagen AT4, AT8, AT12, AT16, AT20 provided by the present invention.

[0092] Specifically, measure the ultraviolet light absorption of each sample at 215 nm and 225 nm, calculate the protein concentration by using the empirical formula C (μg / mL) = 144×(A215 - A225), and note that it is necessary to detect when A215 < 1.5. The principle of this method is as follows: measure the characteristic absorption of peptide bonds in far ultraviolet light, which is not affected by the chromophore content, has few interfering substances, is easy to operate, and is suitable for detecting human collagen and its analogs that do not cause Coomassie Brilliant Blue to develop color. (The reference is Walker JM. The Protein Protocols Handbook, second edition. HumanaPress. 43-45.) After detecting the protein concentration, adjust the protein concentration of all samples to 0.5 mg / mL with PBS.

[0093] (2) Add 100 μL of various protein solutions and blank PBS solution control to a 96-well plate, and let it stand at room temperature for 60 min.

[0094] (3) Add 10 5Individual 3T3 cells were added and incubated at 37 °C for 60 min.

[0095] (4) Each well was washed 4 times with PBS.

[0096] (5) The absorbance at OD492 nm was detected using an LDH detection kit (Roche, 04744926001). Based on the numerical values of the blank control, the cell adhesion rate can be calculated. The calculation formula is as follows: Cell adhesion rate = (Measured well - Blank well) / (Positive well - Blank well) × 100%. The cell adhesion rate can reflect the activity of collagen. The higher the protein activity, the better the external environment for cells can be provided in a short time, and it can help cell adhesion.

[0097] Experimental results The results are as shown in Fig. 6 (D-PBS indicates the blank PBS group; B col I indicates the bovine type I collagen standard control group; the concentrations of the test samples AT4, AT8, AT12, AT16, and AT20 are 0.5 mg / mL respectively). As can be seen from the comparison, compared with commercial human collagen, the recombinant type III humanized collagen AT4, AT8, AT12, AT16, and AT20 of the present invention all have excellent bioadhesive activity at a concentration of 0.5 mg / mL.

[0098] Example 8: Mass spectrum detection of AT4, AT8, AT12, and AT20 Experimental method

Table 3

[0099] After subjecting the protein sample to DTT reduction and iodoacetamide alkylation treatment, trypsin was added for enzymatic digestion and left overnight. The peptide fragments obtained after enzymatic digestion were further desalted with a C18 ZipTip, and then mixed with the substrate α-cyano-4-hydroxycinnamic acid (CHCA) to spot the panel. Finally, matrix-assisted laser desorption ionization-time of flight mass spectrometer MALDI-TOF / TOF Ulraflextreme TM , Brucker, Germany was used for analysis (for the technique of peptide mass fingerprinting, refer to Protein J. 2016;35:212-7).

[0100] Data search is processed on the MS / MS Ion search page from the local maco website. The protein identification results were obtained based on the primary mass spectra of the peptide fragments generated after enzymatic digestion. Detection parameters: Trypsin enzymatic digestion, two cleavage leakage sites were set. The alkylation of cysteine was set as a fixed modification. The oxidation of methionine is a variable modification. The database used for identification is NCBprot.

[0101] Experimental results AT4 mass spectrum detected molecular weight and corresponding polypeptide

Table 4

[0102] AT8 mass spectrum detected molecular weight and corresponding polypeptide

Table 5

[0103] AT12 mass spectrum detected molecular weight and corresponding polypeptide

Table 6

[0104] AT20 Mass Spectrum Detected Molecular Weight and Corresponding Polypeptide

Table 7

[0105] Example 9: Viscosity Test of AT4, AT8, AT12, AT16, and AT20 Experimental Procedure: The recombinant type III humanized collagen AT4, AT8, AT12, AT16, and AT20 of the present invention were stored in an environment of 2 - 8°C in the same concentration and corresponding solution (150 mM NaCl solution, polypeptide concentration 15 mg / mL), and then placed in a rotational viscometer to measure and compare their kinematic viscosities.

[0106] Experimental Results The kinematic viscosities of the recombinant type III human - derived collagen T16 and TE16c could not be measured. The kinematic viscosities measured by the recombinant type III humanized collagen AT4, AT8, AT12, AT16, and AT20 of the present invention were 3225 mPa·s, 3340 mPa·s, 3475 mPa·s, 3510 mPa·s, and 3650 mPa·s respectively. This indicates that the recombinant type III humanized collagen AT4, AT8, AT12, AT16, and AT20 of the present invention can form gels better under the same conditions, as shown in Figure 7. As can be seen from Figure 7, compared with T16 and TE16c which are colorless and transparent, AT4, AT8, AT12, AT16, and AT20 are milky white and can form gels.

Claims

1. A polypeptide comprising an N-terminal sequence and a C-terminal sequence, the N-terminal sequence being a repeating unit of the amino acid sequence shown in SEQ ID NO. 1, and the C-terminal sequence being the amino acid sequence shown in SEQ ID NO. 2, the N-terminal sequence and the C-terminal sequence being directly connected, each repeating unit being directly connected, the polypeptide completing autogelation at a temperature between 2 and 8°C, and the number of repeating units being between 4 and 20.

2. 2. The polypeptide of claim 1, which consists of the amino acid sequence shown in SEQ ID NO.

3. A polynucleotide encoding the polypeptide of claim 1.

4. 4. The polynucleotide of claim 3, comprising the nucleotide sequence shown in SEQ ID NO.

5. A nucleic acid comprising the polynucleotide of claim 3 and further comprising nucleotides encoding a purification tag and / or further comprising nucleotides encoding a leader sequence.

6. The nucleic acid described in claim 5, wherein the purification tag is a His tag, a GST tag, an MBP tag, a SUMO tag or a NusA tag.

7. A vector comprising the polynucleotide of claim 3.

8. The vector of claim 7 which is an expression vector.

9. The vector of claim 8 comprising an expression control element operably linked to the polynucleotide or nucleic acid.

10. The vector described in claim 9, wherein the expression control element is a promoter, a terminator and / or an enhancer.

11. A host cell comprising a polynucleotide according to claim 3 or 4, a nucleic acid according to claim 5 or 6 or a vector according to any one of claims 7 to 10.

12. The host cell of claim 11 which is a bacterial, fungal or animal cell.

13. The host cell of claim 12, wherein the bacterium is Escherichia coli or the fungus is a yeast.

14. The host cell described in claim 13, wherein the yeast is a budding yeast.

15. A method for producing the polypeptide of claim 1, comprising the steps of: (1) culturing the host cell according to claim 11 under suitable culture conditions; (2) harvesting the host cells and / or medium containing the polypeptide; and (3) purifying the polypeptide; A method comprising:

16. A composition comprising a polypeptide according to claim 1 or 2.

17. A gel comprising the polypeptide according to claim 1 or 2.

18. The gel of claim 17, which does not contain a crosslinking agent.

19. 1. A method for producing a gel, comprising the steps of: A method comprising the step of storing the polypeptide according to claim 1 or 2 at a temperature of 2 to 8°C.

20. 20. The method of claim 19, wherein the polypeptide is a polypeptide in a sodium chloride solution.

21. A kit for increasing cell adhesion or tissue packing and / or compatibilization comprising a polypeptide according to any one of claims 1 or 2, a polynucleotide according to claim 3 or 4, a nucleic acid according to claim 5 or 6, a vector according to any one of claims 7 to 10, a host cell according to any one of claims 11 to 14, a composition according to claim 16, or a gel according to claim 17 or 18.

22. 22. The kit of claim 21 for use in breast augmentation, rhinoplasty and / or face filling.

Images