Antibodies to PD-1 and methods of use thereof

Abstract

The present invention relates to human monoclonal antibodies that bind to the cell surface receptor PD-1 (Programmed Death 1). The antibodies can be used to treat cancer and chronic viral infections.

Description

[Technical field]

[0001] This application is an international application claiming the benefit of priority from U.S. Provisional Patent Application No. 62 / 861,643, filed June 14, 2019, the entire contents of which are incorporated herein by reference in their entirety.

[0002] All patents, patent applications, and publications cited herein are hereby incorporated by reference in their entirety. The disclosures of these publications are incorporated by reference into this application in order to more fully describe the state of the art known to those skilled in the art as of the date of the invention described and claimed herein.

[0003] This patent disclosure contains material that is subject to copyright protection. The copyright owner has no objection to the facsimile reproduction of either the patent document or the patent disclosure, as it appears in the U.S. Patent and Trademark Office patent files or records, but otherwise reserves all copyright rights whatsoever.

[0004] FIELD OF THEINVENTION The present invention relates to antibodies against PD-1 and methods of using the same. [Background technology]

[0005] 2. Background of the Invention Programmed cell death-1 (PD-1) is a cell surface membrane protein of the immunoglobulin superfamily. The protein is expressed in pro-B cells and is thought to play a role in their differentiation. PD-1, a member of the CD28 family, is upregulated on activated T cells, B cells, and monocytes. PD-1 has two identified ligands in the B7 family, PD-L1 (programmed cell death-1 ligand 1; also known as cluster of differentiation 274 (CD274) or B7 homolog 1 (B7-H1)) and PD-L2. PD-L1 is a 40 kDa type I transmembrane protein. Binding of PD-L1 to PD-1 or B7.1 transmits an inhibitory signal that reduces the proliferation of CD8+ T cells in lymph nodes, and as a complement, PD-1 can also control the accumulation of foreign antigen-specific T cells in lymph nodes through apoptosis that is further mediated by downregulation of the gene Bcl-2. PD-L2 expression tends to be more restricted and is found primarily on activated antigen-presenting cells (APCs), whereas PD-L1 expression is more widespread, including hematopoietic cells (such as activated T cells, B cells, monocytes, dendritic cells and macrophages) and peripheral non-lymphoid tissues (such as cardiac, skeletal, muscle, placental, lung, kidney and liver tissues). The widespread expression of PD-L1 indicates a significant role in regulating PD-1 / PD-L1-mediated peripheral tolerance. Summary of the Invention

[0006] The present invention provides PD-1 antibody compositions and methods of use thereof.

[0007] One aspect of the present invention relates to an isolated monoclonal antibody or antigen-binding fragment thereof that binds to human programmed cell death 1 (PD-1) protein. In one embodiment, the isolated monoclonal PD-1 antibody or antigen-binding fragment thereof comprises a heavy chain, a light chain, or a combination thereof. In some embodiments, the heavy chain comprises a G-(X 1 )-TF-(X 2 X 3 )-Y-(X 4 ) (SEQ ID NO: 81), G-(X 5 )-TF-(X6 X 7 X 8 )-A (SEQ ID NO:82), GDSVSSDNYF (SEQ ID NO:43), or GYTFNRFG (SEQ ID NO:55); CDR2 comprising ISWNSGSI (SEQ ID NO:19), IYPDDSDT (SEQ ID NO:33), VYYNGNT (SEQ ID NO:45), TNPYNGNT (SEQ ID NO:57), or ISYDGSNK (SEQ ID NO:69); CDR3 comprising ASDYGDKYYYYGMDV (SEQ ID NO:21), AFWGASGAPVNGFDI (SEQ ID NO:35), ATETPPTSYFNSGPFDS (SEQ ID NO:47), ARVVAVNGMDV (SEQ ID NO:59), ASQTVAGSDY (SEQ ID NO:71), or ASDYGDKYSYYGMDV (SEQ ID NO:79); or a combination of these CDRs. In other embodiments, the light chain comprises CDR1; (X 9 )-DN (SEQ ID NO: 83), (X 10 )-NN (SEQ ID NO:84) or DDS (SEQ ID NO:75); CDR3 comprising AAWDDGLNGRGV (SEQ ID NO:28), AAWDDSLNAPV (SEQ ID NO:41), SSWDSSLSGYV (SEQ ID NO:53), QSYDSSNLWV (SEQ ID NO:65) or QVWHSVSDQGV (SEQ ID NO:77); or a combination of those CDRs. In some embodiments, the isolated monoclonal PD-1 antibody or antigen-binding fragment thereof comprises a heavy chain and a light chain comprising the CDRs described herein. In further embodiments, the isolated monoclonal PD-1 antibody or antigen-binding fragment thereof is fully human or humanized. In further embodiments, the isolated monoclonal PD-1 antibody or antigen-binding fragment thereof is monospecific, bispecific, or multispecific. In further embodiments, the isolated monoclonal PD-1 antibody or antigen-binding fragment thereof is a single chain antibody. In other embodiments, the isolated monoclonal PD-1 antibody or antigen-binding fragment thereof is at least 1.0×10 -9In other embodiments, the isolated monoclonal PD-1 antibody or antigen-binding fragment thereof further comprises a heavy chain constant region, a light chain constant region, an Fc region, or a combination thereof. In some embodiments, the X of the CDRs from the isolated monoclonal PD-1 antibody or antigen-binding fragment thereof is 1 , X 4 , X 5 , or X 8 The amino acid residue is a non-polar amino acid residue. In some embodiments, the X of the CDR from an isolated monoclonal PD-1 antibody or antigen-binding fragment thereof is 1 , X 4 , X 5 , or X 8 The amino acid residue is tyrosine (Y), phenylalanine (F), or alanine (A). In some embodiments, the X of the CDR from an isolated monoclonal PD-1 antibody or antigen-binding fragment thereof is 2 , X 3 , X 4 , X 6 , X 7 or X 8 In some embodiments, the amino acid residue is a polar amino acid residue. 2 , X 3 , X 4 , X 6 , X 7 , or X 8 The amino acid residues are aspartic acid (D), threonine (T), serine (S), or tryptophan (W). In another embodiment, the X of the CDRs from an isolated monoclonal PD-1 antibody or antigen-binding fragment thereof is 1 The amino acid residue is tyrosine (Y) or phenylalanine (F). In another embodiment, the X of the CDR from an isolated monoclonal PD-1 antibody or antigen-binding fragment thereof is 2 The amino acid residue is aspartic acid (D), threonine (T), or serine (S). In another embodiment, the X of the CDR from an isolated monoclonal PD-1 antibody or antigen-binding fragment thereof is 3The amino acid residue is aspartic acid (D), threonine (T), or serine (S). In another embodiment, the X of the CDR from an isolated monoclonal PD-1 antibody or antigen-binding fragment thereof is 4 The amino acid residue is alanine (A) or tryptophan (W). In another embodiment, the X of the CDR from an isolated monoclonal PD-1 antibody or antigen-binding fragment thereof is 5 The amino acid residue is phenylalanine (F) or tyrosine (Y). In another embodiment, the X of the CDR from an isolated monoclonal PD-1 antibody or antigen-binding fragment thereof is 6 The amino acid residue is aspartic acid (D) or serine (S). In another embodiment, the X of the CDR from an isolated monoclonal PD-1 antibody or antigen-binding fragment thereof is 7 The amino acid residue is aspartic acid (D) or serine (S). In another embodiment, the X of the CDR from an isolated monoclonal PD-1 antibody or antigen-binding fragment thereof is 8 The amino acid residue is phenylalanine (F) or tyrosine (Y). In another embodiment, the X of the CDR from an isolated monoclonal PD-1 antibody or antigen-binding fragment thereof is 9 In another embodiment, the amino acid residues are polar hydrophilic amino acid residues. 9 The amino acid residue is glutamic acid (E), asparagine (N), or aspartic acid (D). In another embodiment, the X of the CDR from an isolated monoclonal PD-1 antibody or antigen-binding fragment thereof is 10 In another embodiment, the amino acid residues are polar hydrophilic amino acid residues. 10 The amino acid residues are serine (S) or arginine (R).

[0008] One aspect of the invention relates to an antibody composition comprising at least one antibody, the at least one antibody comprising two heavy chains and two light chains. In some embodiments, the heavy chain CDRs are selected from residues 27-38, 56-65, and 105-119 according to the IMGT numbering of SEQ ID NO:1; or residues 27-38, 56-65, and 105-119 according to the IMGT numbering of SEQ ID NO:3; or residues 27-38, 56-65, and 105-121 according to the IMGT numbering of SEQ ID NO:5; or residues 27-38, 56-65, and 105-115 according to the IMGT numbering of SEQ ID NO:7; or residues 27-38, 56-65, and 105-114 according to the IMGT numbering of SEQ ID NO:9; or residues 27-38, 56-65, and 105-114 according to the IMGT numbering of SEQ ID NO:10; or residues 27-38, 56-65, and 105-119 according to the IMGT numbering of SEQ ID NO: 12 (e.g., an HL-14 mutant described herein); or residues 27-38, 56-65, and 105-119 according to the IMGT numbering of SEQ ID NO: 13 (e.g., an HLkin-1 mutant described herein); or residues 27-38, 56-65, and 105-119 according to the IMGT numbering of SEQ ID NO: 15 (e.g., a mut-3 mutant described herein), but at least one of the heavy chain CDRs differs in a single amino acid substitution compared to that reference CDR.In some embodiments, the light chain CDRs comprise residues 27-38, residues 56-65, and residues 105-116 according to the IMGT numbering of SEQ ID NO:2; or residues 27-38, residues 56-65, and residues 105-115 according to the IMGT numbering of SEQ ID NO:4; or residues 27-38, residues 56-65, and residues 105-115 according to the IMGT numbering of SEQ ID NO:6; or residues 27-38, residues 56-65, and residues 105-115 according to the IMGT numbering of SEQ ID NO:8. or residues 27-38, 56-65, and 105-114 according to the IMGT numbering of SEQ ID NO:10; or residues 27-38, 56-65, and 105-116 according to the IMGT numbering of SEQ ID NO:11 (e.g., the HL-7 variants described herein), but at least one of the light chain CDRs differs by a single amino acid substitution compared to its reference CDR. In some embodiments, the antibody composition binds to an epitope that includes amino acid residues within the face of PD-1 generated by the FCC' chain but does not contact the C'D loop of PD-1 that includes non-adjacent amino acids in SEQ ID NO:XX.

[0009] One aspect of the present invention relates to an isolated antibody or fragment thereof that binds to human programmed cell death 1 (PD-1) protein. In one embodiment, the isolated antibody or fragment thereof that binds to PD-1 comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28. In one embodiment, the isolated antibody or fragment thereof that binds to PD-1 comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 31, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 33, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 35, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 37, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 39, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 41. In one embodiment, an isolated antibody or fragment thereof that binds PD-1 comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 43, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 45, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 47, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 49, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 51, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 53. In one embodiment, an isolated antibody or fragment thereof that binds PD-1 comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 55, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 57, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 59, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 61, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 63, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 65. In one embodiment, the isolated antibody or fragment thereof that binds to PD-1 comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO:67, a VH CDR2 comprising the amino acid sequence of SEQ ID NO:69, a VH CDR3 comprising the amino acid sequence of SEQ ID NO:71, a VL CDR1 comprising the amino acid sequence of SEQ ID NO:73, a VL CDR2 comprising the amino acid sequence of SEQ ID NO:75, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO:77.In one embodiment, an isolated antibody or fragment thereof that binds PD-1 comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28 (e.g., an HL-7 variant described herein). In one embodiment, an isolated antibody or fragment thereof that binds PD-1 comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 79, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28 (e.g., an HL-14 variant described herein). In one embodiment, an isolated antibody or fragment thereof that binds PD-1 comprises a VH CDR1 comprising the amino acids of SEQ ID NO: 78, a VH CDR2 comprising the amino acids of SEQ ID NO: 19, a VH CDR3 comprising the amino acids of SEQ ID NO: 21, a VL CDR1 comprising the amino acids of SEQ ID NO: 24, a VL CDR2 comprising the amino acids of SEQ ID NO: 26, and a VL CDR3 comprising the amino acids of SEQ ID NO: 28 (e.g., an HLkin-1 mutant described herein). In one embodiment, an isolated antibody or fragment thereof that binds PD-1 comprises a VH CDR1 comprising the amino acids of SEQ ID NO: 78, a VH CDR2 comprising the amino acids of SEQ ID NO: 19, a VH CDR3 comprising the amino acids of SEQ ID NO: 21, a VL CDR1 comprising the amino acids of SEQ ID NO: 24, a VL CDR2 comprising the amino acids of SEQ ID NO: 80, and a VL CDR3 comprising the amino acids of SEQ ID NO: 28 (e.g., an HLkin-1 HL-7 mut2 mutant described herein).In one embodiment, an isolated antibody or fragment thereof that binds to PD-1 comprises a VH CDR1 comprising the amino acids of SEQ ID NO: 78, a VH CDR2 comprising the amino acids of SEQ ID NO: 19, a VH CDR3 comprising the amino acids of SEQ ID NO: 79, a VL CDR1 comprising the amino acids of SEQ ID NO: 24, a VL CDR2 comprising the amino acids of SEQ ID NO: 80, and a VL CDR3 comprising the amino acids of SEQ ID NO: 28 (e.g., the HLkin-1 HL-7 HL-14 mut3 mutant described herein).

[0010] One aspect of the present invention relates to an isolated antibody or fragment thereof that binds to human programmed cell death 1 (PD-1) protein. In one embodiment, the isolated antibody or fragment thereof that binds to human PD-1 protein comprises a heavy chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 1, 3, 5, 7, 9, 12, 13, and 15, and a light chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, and 11.

[0011] In other embodiments, the isolated antibody or fragment thereof that binds to a human PD-1 protein comprises:

[0012] In other embodiments, the isolated antibody or fragment thereof that binds to human PD-1 protein comprises: In other embodiments, the isolated antibody or fragment thereof that binds to human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO:1 and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO:2. In other embodiments, the isolated antibody or fragment thereof that binds to human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO:3 and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO:4. In other embodiments, the isolated antibody or fragment thereof that binds to human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO:5 and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO:6. In other embodiments, the isolated antibody or fragment thereof that binds to human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO:7 and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO:8. In other embodiments, the isolated antibody or fragment thereof that binds to human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO:9 and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO:10. In other embodiments, the isolated antibody or fragment thereof that binds to human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO:1 and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO:11. In other embodiments, the isolated antibody or fragment thereof that binds to the human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO:12, and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO:2.In other embodiments, the isolated antibody or fragment thereof that binds to human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 13, and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 2. In other embodiments, the isolated antibody or fragment thereof that binds to human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 13, and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 11. In other embodiments, the isolated antibody or fragment thereof that binds to human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 15, and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 11.

[0013] One aspect of the present invention relates to an isolated bispecific antibody comprising a first antibody fragment that binds to human PD-1 protein and a second antigen-binding fragment having specificity for a molecule on an immune cell. In one embodiment, the isolated bispecific antibody comprises a fragment of a human antibody to the PD-1 protein described herein. In some embodiments, the molecule on the immune cell comprises B7H3, B7H4, CD27, CD28, CD40, CD40L, CD47, CD122, CTLA-4, GITR, GITRL, ICOS, ICOSL, LAG-3, LIGHT, OX-40, OX40L, PD-1, TIM3, 4-1BB, TIGIT, VISTA, HEVM, BTLA, or KIR. In some embodiments, the antibody fragment that binds to human PD-1 protein comprises a Fab fragment, a single chain variable fragment (scFv), or a single domain antibody. In other embodiments, the second antigen-binding fragment having specificity for a molecule on an immune cell comprises a Fab fragment, a single chain variable fragment (scFv), or a single domain antibody. In some embodiments, the bispecific antibody comprises an Fc fragment.

[0014] One aspect of the present invention relates to an isolated multispecific antibody comprising a first antibody fragment that binds to human PD-1 protein, and a second and a third antigen-binding fragment having specificity for a molecule on an immune cell. In one embodiment, the isolated multispecific antibody comprises a fragment of a human antibody against the PD-1 protein described herein. In some embodiments, the molecule on the immune cell comprises B7H3, B7H4, CD27, CD28, CD40, CD40L, CD47, CD122, CTLA-4, GITR, GITRL, ICOS, ICOSL, LAG-3, LIGHT, OX-40, OX40L, PD-1, TIM3, 4-1BB, TIGIT, VISTA, HEVM, BTLA, or KIR. In some embodiments, the antibody fragment that binds to human PD-1 protein comprises a Fab fragment, a single chain variable fragment (scFv), or a single domain antibody. In other embodiments, the second and third antigen-binding fragments having specificity for a molecule on an immune cell comprise a Fab fragment, a single chain variable fragment (scFv), or a single domain antibody. In some embodiments, the multispecific antibody comprises an Fc fragment. In some embodiments, the multispecific antibody further comprises a fourth and / or a fifth antigen-binding fragment having specificity for a molecule on an immune cell.

[0015] One aspect of the invention relates to a nucleic acid encoding an isolated monoclonal antibody or antigen-binding fragment thereof that binds to the human programmed cell death 1 (PD-1) protein described herein. One aspect of the invention relates to a nucleic acid encoding an isolated antibody or fragment thereof that binds to the human PD-1 protein described herein. One aspect of the invention relates to a nucleic acid encoding a bispecific antibody described herein. One aspect of the invention relates to a nucleic acid encoding a multispecific antibody described herein. In some embodiments, the invention relates to a vector comprising a nucleic acid described herein. In some embodiments, the invention relates to a cell comprising a vector described herein.

[0016] One aspect of the present invention relates to a pharmaceutical composition comprising an antibody or fragment that binds to a human PD-1 protein as described herein and a pharma- ceutically acceptable carrier or excipient. In some embodiments, the pharmaceutical composition further comprises at least one additional therapeutic agent. In other embodiments, the therapeutic agent is a toxin, a radiolabel, an siRNA, a small molecule, or a cytokine.

[0017] One aspect of the present invention relates to a pharmaceutical composition comprising a bispecific antibody or fragment that binds to human PD-1 protein and a second antigen-binding fragment having specificity for a molecule on an immune cell as described herein, and a pharma- ceutically acceptable carrier or excipient. In some embodiments, the pharmaceutical composition further comprises at least one additional therapeutic agent. In other embodiments, the therapeutic agent is a toxin, a radiolabel, an siRNA, a small molecule, or a cytokine.

[0018] One aspect of the invention relates to a pharmaceutical composition comprising a bispecific antibody or fragment that binds to human PD-1 protein, in addition to a second, third, fourth or fifth antigen-binding fragment having specificity for a molecule on an immune cell as described herein, and a pharma- ceutically acceptable carrier or excipient. In some embodiments, the pharmaceutical composition further comprises at least one additional therapeutic agent. In other embodiments, the therapeutic agent is a toxin, a radiolabel, an siRNA, a small molecule, or a cytokine.

[0019] One aspect of the invention relates to an isolated cell comprising one or more polynucleotides encoding a PD-1 antibody or fragment thereof as described herein.One aspect of the invention relates to an isolated cell comprising one or more polynucleotides encoding a bispecific antibody or fragment thereof as described herein.One aspect of the invention relates to an isolated cell comprising one or more polynucleotides encoding a multispecific antibody or fragment thereof as described herein.

[0020] One embodiment of the present invention pertains to a kit comprising a pharmaceutical composition as described herein; a syringe, needle, or applicator for administration of the pharmaceutical composition to a subject; and instructions for use.

[0021] One aspect of the invention relates to an engineered cell comprising a chimeric antigen receptor, the chimeric antigen receptor comprising an extracellular ligand binding domain specific for an antigen on the surface of a cancer cell, the antigen comprising PD-1. Another aspect of the invention relates to an engineered cell comprising a chimeric antigen receptor, the chimeric antigen receptor comprising an extracellular ligand binding domain specific for a first antigen and a second antigen on the surface of a cancer cell, the first antigen comprising PD-1, and the second antigen comprising a tumor-specific surface antigen described herein. In one embodiment, the extracellular ligand binding domain comprises an antibody or a fragment thereof. In another embodiment, the antibody comprises a VH and / or VL according to Tables 1-11, or any combination of heavy or light chains described herein. In one embodiment, the antibody comprises CDR1, CDR2, and / or CDR3 of Table 12, or any combination of CDRs described herein. In one embodiment, the engineered cell is a T cell, a NK cell, or a NKT cell. In one embodiment, the T cells are CD4+, CD8+, CD3+ pan T cells, or any combination thereof.

[0022] One aspect of the present invention relates to a method of treating cancer in a subject. In some embodiments, the method comprises administering to a subject in need thereof a therapeutically effective amount of a composition comprising a PD-1 antibody as described herein. In some embodiments, the method comprises administering to a subject in need thereof a therapeutically effective amount of a composition comprising a pharmaceutical composition as described herein. In some embodiments, the method comprises administering to a subject in need thereof a therapeutically effective amount of a composition comprising a CAR composition as described herein. In one embodiment, the cancer expresses PD-1. In another embodiment, the cancer comprises non-small cell lung cancer, melanoma, ovarian cancer, lymphoma, or renal cell carcinoma. In some embodiments, the method further comprises administering to the subject a chemotherapeutic agent.

[0023] [The present invention 1001] 1. An isolated monoclonal antibody or antigen-binding fragment thereof that binds to human Programmed Cell Death 1 (PD-1) protein, comprising a heavy chain, a light chain, or a combination thereof, The heavy chain comprises: G-(X 1 )-TF-(X 2 X 3 )-Y-(X 4 ) (SEQ ID NO: 81), G-(X 5 )-TF-(X 6 X 7 X 8 )-A (SEQ ID NO: 82), GDSVSSDNYF (SEQ ID NO: 43), or GYTFNRFG (SEQ ID NO: 55), CDR2 comprising ISWNSGSI (SEQ ID NO: 19), IYPDDSDT (SEQ ID NO: 33), VYYNGNT (SEQ ID NO: 45), TNPYNGNT (SEQ ID NO: 57), or ISYDGSNK (SEQ ID NO: 69), CDR3 comprising ASDYGDKYYYYGMDV (SEQ ID NO:21), AFWGASGAPVNGFDI (SEQ ID NO:35), ATETPPTSYFNSGPFDS (SEQ ID NO:47), ARVVAVNGMDV (SEQ ID NO:59), ASQTVAGSDY (SEQ ID NO:71), or ASDYGDKYSYYGMDV (SEQ ID NO:79), or a combination of these CDRs and The light chain comprises: CDR1 comprising SSNIGSNT (SEQ ID NO: 24), SSNIGAGYV (SEQ ID NO: 37), SNNVGAHG (SEQ ID NO: 49), SGSIAAYY (SEQ ID NO: 61), or NIGSKS (SEQ ID NO: 73), (X 9 )-DN (SEQ ID NO: 83), (X 10 )-NN (SEQ ID NO: 84), or DDS (SEQ ID NO: 75), CDR3 comprising AAWDGGLNGRGV (SEQ ID NO: 28), AAWDDSLNAPV (SEQ ID NO: 41), SSWDSSLSGYV (SEQ ID NO: 53), QSYDSSNLWV (SEQ ID NO: 65), or QVWHSVSDQGV (SEQ ID NO: 77), or a combination of these CDRs Including, An isolated monoclonal antibody or antigen-binding fragment thereof. [The present invention 1002] The antibody of the present invention which is fully human or humanized. [The present invention 1003] The antibody of the present invention which is monospecific, bispecific, or multispecific. [The present invention 1004] The antibody of the present invention which is a single chain antibody. [The present invention 1005] At least 1.0×10 -6 The antibody of the present invention having a binding affinity of M. [The present invention 1006] The antibody or fragment of the present invention further comprising a heavy chain constant region, a light chain constant region, an Fc region, or a combination thereof. [The present invention 1007] X 1、X 4 、X 5 , or X 8 is a non-polar amino acid residue, [The present invention 1008] X 1 、X 4 、X 5 , or X 8 is tyrosine (Y), phenylalanine (F), or alanine (A). [The present invention 1009] X 2 、X 3 、X 4 、X 6 、X 7 , or X 8 is a polar amino acid residue, [The present invention 1010] X 2 、X 3 、X 4 、X 6 、X 7 , or X 8 is aspartic acid (D), threonine (T), serine (S), or tryptophan (W). [The present invention 1011] X 1 is phenylalanine (F) or tyrosine (Y), [The present invention 1012] X 2 is aspartic acid (D), threonine (T), and serine (S), [The present invention 1013] X 3 is aspartic acid (D), threonine (T), and serine (S), [The present invention 1014] X 4 is alanine (A) or tryptophan (W), [The present invention 1015] X 5 is phenylalanine (F) or tyrosine (Y), [The present invention 1016] X 6 is aspartic acid (D) or serine (S), [The present invention 1017] X 7 is aspartic acid (D) or serine (S), [The present invention 1018] X 8 is phenylalanine (F) or tyrosine (Y), [The present invention 1019] X 9 is a polar hydrophilic amino acid residue, [The present invention 1020] X 9 is glutamic acid (E), asparagine (N), or aspartic acid (D). [The present invention 1021] X 10 is a polar hydrophilic amino acid residue, [The present invention 1022] X 10 is serine (S) or arginine (R), [The present invention 1023] An antibody composition comprising at least one antibody, said at least one antibody comprising two heavy chains and two light chains; The heavy chain CDRs comprise residues 27-38, 56-65, and 105-119 according to the IMGT numbering of SEQ ID NO:1; or residues 27-38, 56-65, and 105-119 according to the IMGT numbering of SEQ ID NO:3; or residues 27-38, 56-65, and 105-121 according to the IMGT numbering of SEQ ID NO:5; or residues 27-38, 56-65, and 105-115 according to the IMGT numbering of SEQ ID NO:7; or residues 27-38, 56-65, and 105-115 according to the IMGT numbering of SEQ ID NO:9. or residues 27-38, 56-65, and 105-119 according to the IMGT numbering of SEQ ID NO:12; or residues 27-38, 56-65, and 105-119 according to the IMGT numbering of SEQ ID NO:13; or residues 27-38, 56-65, and 105-119 according to the IMGT numbering of SEQ ID NO:15; but at least one of said heavy chain CDRs differs by a single amino acid substitution compared to the reference CDR, and The light chain CDRs comprise residues 27-38, 56-65, and 105-116 according to the IMGT numbering of SEQ ID NO:2; or residues 27-38, 56-65, and 105-115 according to the IMGT numbering of SEQ ID NO:4; or residues 27-38, 56-65, and 105-115 according to the IMGT numbering of SEQ ID NO:6; or residues 27-38, 56-65, and 105-115 according to the IMGT numbering of SEQ ID NO:8. or residues 27-38, 56-65, and 105-114 according to the IMGT numbering of SEQ ID NO: 10; or residues 27-38, 56-65, and 105-116 according to the IMGT numbering of SEQ ID NO: 11, but at least one of said light chain CDRs differs by a single amino acid substitution compared to the reference CDR, and the antibody composition binds to an epitope comprising amino acid residues within the face of PD-1 generated by the FCC' chain but does not contact the C'D loop of PD-1 comprising non-contiguous amino acids in SEQ ID NO:XX; Antibody composition. [The present invention 1024] 1. An isolated antibody or fragment thereof that binds to human Programmed Cell Death 1 (PD-1) protein, (a) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28, or (b) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 31, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 33, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 35, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 37, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 39, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 41, or (c) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 43, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 45, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 47, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 49, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 51, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 53, or (d) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 55, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 57, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 59, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 61, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 63, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 65, or (e) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 67, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 69, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 71, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 73, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 75, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 77, or (f) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28, or (g) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 79, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28, or (h) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28, or (i) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28, or (j) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 79, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28 An isolated antibody or fragment thereof comprising: [The present invention 1025] An isolated antibody or fragment thereof that binds to human PD-1 protein, comprising a heavy chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 1, 3, 5, 7, 9, 12, 13, and 15, and a light chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, and 11. [The present invention 1026] 1. An isolated monoclonal antibody or antigen-binding fragment thereof that binds to PD-1, comprising a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:1, and the light chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:2. [The present invention 1027] 1. An isolated monoclonal antibody or antigen-binding fragment thereof that binds to PD-1, comprising a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:3, and the light chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:4. [The present invention 1028] 1. An isolated monoclonal antibody or antigen-binding fragment thereof that binds to PD-1, comprising a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:5, and the light chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:6. [The present invention 1029] 1. An isolated monoclonal antibody or antigen-binding fragment thereof that binds to PD-1, comprising a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:7, and the light chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:8. [The present invention 1030] 1. An isolated monoclonal antibody or antigen-binding fragment thereof that binds to PD-1, comprising a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:9, and the light chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:10. [The present invention 1031] 1. An isolated monoclonal antibody or antigen-binding fragment thereof that binds to PD-1, comprising a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:1, and the light chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:11. [The present invention 1032] 1. An isolated monoclonal antibody or antigen-binding fragment thereof that binds to PD-1, comprising a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:12, and the light chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:2. [The present invention 1033] 1. An isolated monoclonal antibody or antigen-binding fragment thereof that binds to PD-1, comprising a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:13, and the light chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:2. [The present invention 1034] 1. An isolated monoclonal antibody or antigen-binding fragment thereof that binds to PD-1, comprising a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:13, and the light chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:11. [The present invention 1035] 1. An isolated monoclonal antibody or antigen-binding fragment thereof that binds to PD-1, comprising a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:15, and the light chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:11. [The present invention 1036] 1. An isolated bispecific antibody comprising a fragment of 1001, 1023, 1024, 1025, 1026, 1027, 1028, 1029, 1030, 1031, 1032, 1033, 1034, or 1035 and a second antigen-binding fragment having specificity for a molecule on an immune cell. [The present invention 1037] The molecule is selected from the group consisting of B7H3, B7H4, CD27, CD28, CD40, CD40L, CD47, CD122, CTLA-4, GITR, GITRL, ICOS, ICOSL, LAG-3, LIGHT, OX-40, OX40L, PD-1, TIM3, 4-1BB, TIGIT, VISTA, HEVM, BTLA, and KIR. [The present invention 1038] The bispecific antibody of the present invention, wherein each of said fragment and the second fragment is independently selected from a Fab fragment, a single chain variable fragment (scFv), or a single domain antibody. [The present invention 1039] A bispecific antibody according to the invention 1036, further comprising an Fc fragment. [The present invention 1040] A nucleic acid encoding any one of the antibodies of the present invention 1001 to 1035. [The present invention 1041] A nucleic acid encoding the bispecific antibody according to any one of claims 1036 to 1039 of the present invention. [The present invention 1042] A pharmaceutical composition comprising any one of the antibodies or fragments thereof of the present invention 1001 to 1035 and a pharma- ceutically acceptable carrier or excipient. [The present invention 1043] The pharmaceutical composition of invention 1042 further comprising at least one additional therapeutic agent. [The present invention 1044] The pharmaceutical composition of the present invention, wherein said therapeutic agent is a toxin, a radiolabel, an siRNA, a small molecule, or a cytokine. [The present invention 1045] A pharmaceutical composition comprising any one of the bispecific antibodies of the present invention 1036 to 1039 and a pharma- ceutically acceptable carrier or excipient. [The present invention 1046] The pharmaceutical composition of the present invention 1045 further comprising at least one additional therapeutic agent. [The present invention 1047] The pharmaceutical composition of claim 1046, wherein said therapeutic agent is a toxin, a radiolabel, an siRNA, a small molecule, or a cytokine. [The present invention 1048] An isolated cell comprising one or more polynucleotides encoding the antibody or fragment thereof of any one of 1001 to 1035 of the present invention. [The present invention 1049] An isolated cell comprising one or more polynucleotides encoding the bispecific antibody or a fragment thereof of any one of 1036 to 1039 of the present invention. [The present invention 1050] A vector comprising the nucleic acid of the present invention 1040 or 1041. [The present invention 1051] A cell comprising a vector of the present invention. [The present invention 1052] A kit comprising at least one antibody composition of the invention 1042 or 1045, a syringe, needle, or applicator for administering at least one antibody to a subject, and instructions for use. [The present invention 1053] An engineered cell comprising a chimeric antigen receptor, the chimeric antigen receptor comprising an extracellular ligand binding domain specific for an antigen on the surface of a cancer cell, the antigen comprising PD-1. [The present invention 1054] The engineered cell of the present invention, wherein said extracellular ligand binding domain comprises an antibody or a fragment thereof. [The present invention 1055] The engineered cell of the present invention 1053, wherein the antibody comprises a VH and / or VL according to Tables 1-11, or any combination thereof. [The present invention 1056] The engineered cell of the present invention 1054, wherein the antibody comprises CDR1, CDR2, and / or CDR3 of Table 12, or any combination thereof. [The present invention 1057] The engineered cell of the present invention 1053, wherein the engineered cell comprises a T cell, a NK cell, or a NKT cell. [The present invention 1058] The engineered cell of the present invention 1057, wherein said T cells are CD4+, CD8+, CD3+ pan T cells, or any combination thereof. [The present invention 1059] A method for treating cancer in a subject, comprising administering to a subject in need thereof a therapeutically effective amount of an antibody of any of claims 1001 to 1039 of the present invention, a pharmaceutical composition of any of claims 1042 to 1046 of the present invention, or a composition comprising a CAR composition of any of claims 1053 to 1058 of the present invention. [The present invention 1060] The method of claim 1059, wherein the cancer expresses PD-1. [The present invention 1061] The method of claim 1059, wherein the cancer comprises non-small cell lung cancer, melanoma, ovarian cancer, lymphoma, or renal cell carcinoma. [The present invention 1062] The method of claim 1059, further comprising administering a chemotherapeutic agent to the subject. Other objects and advantages of the present invention will become readily apparent from the following description. [Brief description of the drawings]

[0024] The patent or application contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be obtained from the Office upon request and payment of the necessary fee.

[0025] [Figure 1] 1 shows a schematic diagram of the PMPL panning strategy for antibody discovery (e.g., PD-1 antibodies of the invention). [Figure 2-1] FIG. 2 is a schematic diagram of the VH and VL sequences of the anti-PD-1 antibody, P4-B3. [Figure 2-2] See description of Figure 2-1. [Figure 3-1] Figure 3 is a diagram of the 3D protein structure of human PD-1, with the differences between human and cynomolgus PD-1 highlighted in red. The corresponding amino acid sequences are aligned below. A high degree of similarity is observed between human and cynomolgus PD-1. The 3D protein structure of PD-1 bound to nivolumab is also shown. [Figure 3-2] See description of Figure 3-1. [Figure 4] 1 is a graph showing binding curves of P4-B3 minibody to human and cynomolgus PD-1. [Diagram 5] 1 shows a graph of the octet binding curves for different forms of P4-B3. [Figure 6] Binding curves for a PD-L1 competition assay using a PD-1 antibody are shown. [Figure 7] Binding curves for IgG ELISA are shown. [Figure 8-1] FIG. 8 shows FACS analysis plots for PD1 FACS performed with anti-PD1 IgG. [Figure 8-2] See description of Figure 8-1. [Figure 9] FIG. 1 is a schematic diagram of the PD1-PDL1 bioassay. [Figure 10A] Figure 10 shows a graph of induction curves from a commercial PD1-PDL1 bioassay. (A) IgG1 wild-type monomer version of P4-B3 versus pembro and nivo. As shown in the figure, the P4-B3 anti-PD1 antibody achieves approximately half the signal of pembro and nivo. [Figure 10B] Figure 10 shows a graph of the induction curve from the commercial PD1-PDL1 bioassay. (B) Hexamer comparison of the IgG1 LALA configuration. The hexamer configuration shows an approximately 2-3 fold shift in the dose response curve. [Figure 10C] Figure 10 shows a graph of the induction curve from the commercial PD1-PDL1 bioassay. (C) Direct comparison of IgG4 constructs (monomer and hexamer) with nivo. Here, similar trends to Figure 10A and Figure 10B are observed. The commercial antibody is 2x more potent than P4-B3, and the hexamer has an approximately 2-3 fold shift compared to the monomer. [Figure 11] FIG. 1 is a schematic diagram of a ribbon diagram of human PD-1 (see Cheng, X et al., (2013). JBC doi.org / 10.1074 / jbc.M112.448126). PD-1 is an antiparallel B-sandwich. The antiparallel B sandwich is shown. The front sheet of the PD-1 ribbon diagram includes G, F, C, C', and the back sheet of the PD-1 ribbon diagram includes A, B, E, D. PD-1 lacks cysteines in the stalk region, which prevents PD-1 from homodimerizing. [Figure 12-1]Figure 12 is a schematic of the protein structure showing the interaction of PD-1 with its ligands PDL-1 or PDL-2. See Cheng et al, Structure and Interactions of the Human Programmed Cell Death 1 Receptor, JBC 2013; Tan et al. (2016) Protein Cell DOI: 10.1007 / s13238-016-0337-7; and Yan et al, (2008) PNAS, DPO: 10.1073 / pnas.0804453105. [Figure 12-2] See description of Figure 12-1. [Figure 13-1] Figure 13 shows ribbon diagrams of PD-1 binding to commercially available antibodies. (A) Nivo blocks PD-L1 by binding to the FG loop. (B) Pembro blocks by binding to the C and C' strands. See Fessas et al,Seminars in Oncology,2017. [Figure 13-2] See description of Figure 13-1. [Figure 14] Protein model overlay and amino acid sequence comparison of human vs. mouse PD-1. The degree of similarity between human and mouse PD-1: about 64%. See Cheng, X et al., (2013). JBC doi.org / 10.1074 / jbc.M112.448126. [Figure 15]Protein model overlay and amino acid sequence comparison of human vs. mouse PD-1. Amino acid residue P110 (purple) introduces a kink into the FG loop. In mouse PD1, this residue orients the BC loop toward the DE loop due to hydrophobic interactions with Arg83 and Trp39. Amino acid residue P63 (blue) in human PD-1 moves the loop away from the C' strand, creating a more flexible loop. Without wishing to be bound by theory, these two structural differences play a role in the lack of cross-reactivity of Pembro and Nivo with mouse PD-1. See Cheng, X et al., (2013). JBC doi.org / 10.1074 / jbc.M112.448126. [Figure 16] 1 is a graph showing P4-B3 binding to mouse PD-1. P4-B3 has moderate affinity for mouse PD-1, setting it apart from Pembro and Nivo. [Figure 17]

[0023] Figure 1 is a schematic diagram of a staining strategy that can be used to differentially label displayed yeast libraries prior to screening by FACS. See Cherf and Cochran, 2015, Methods Mol Biol. [Figure 18] A plot of FACS analysis is shown. Standard staining sorting is shown with blue gates being positive hits and green gates being negatives. The blue gate is shifted upwards along the x=y axis. Without wishing to be bound by theory, PD-1 antibody clones bind PD-1 with higher affinity. [Figure 19] A plot of FACS analysis of dynamic staining is shown. Collected cells are in the blue gate, and examples of interest are circled in red. The collection gate was kept wide to allow for more samples. [Figure 20] 1 is a graph of the binding curve of P4-B3 mutants. [Figure 21] 1 is a graph of the binding curve of P4-B3 mutants. [Figure 22-1]FIG. 22 is a schematic diagram of the P4-B3 (anti-PD1) germline alignment and a diagram of the amino acid residues that were changed in the P4-B3 mutants that were generated. [Figure 22-2] See description of Figure 22-1. [Figure 22-3] See description of Figure 22-1. [Figure 23] A graph of the octet binding curves of different P4-B3 mutants is shown. SA sensors were coated with 2.5ug / ml biotinylated PD-1. [Figure 24] Binding curves for PD-L1 competition assays using PD-1 antibodies (various P4-B3 mutants) are shown. [Diagram 25] FIG. 1 is a schematic representation of the amino acid residues that were changed in the P4-B3 mutants generated. [Figure 26-1] Figure 26 is a schematic diagram of the germline alignment of anti-PD1 antibody clones. These candidates were found by soluble protein panning (PD1-hFc). [Figure 26-2] See description of Figure 26-1. [Figure 26-3] See description of Figure 26-1. [Figure 26-4] See description of Figure 26-1. [Figure 27] Shown are graphs of octet binding curves. Both PD1 and PDL1 are tagged. As can be seen from sensor H4, the sensor was not saturated before adding PDL1. Further sequencing confirmed that PD1#5 is not an antibody. A4: R&D anti-PD1 (AF1086); B4: PD1 mini3; C4: PD1 mini4; D4: PD1 mini5; E4: PD1 mini7; F4: PD1 mini13; G4: TIG1 (control ab) + PDL1; H4: no antibody + PD1 to see if the sensor was saturated. [Figure 28]Graphs of octet binding curves are shown. As can be seen from sensor H4, both PD1 and PDL1 are tagged. Sensors were not saturated prior to addition of PDL1. PD1 and PDL1 were used at 2.5ug / ml. Antibodies were used at 2ug / ml. All samples were diluted in 1xPBST. Novel PD-1 antibodies were used in scFv-Fc format, Nivo and Pembro are commercial preparations. A6: Nivo; B6: Pembro; C6: PD1#3; D6: PD1#4; E6: PD1#5; F6: PD1#7; G6: PD1#13; H6: TIG1(-). [Figure 29] Octet binding curve graph. SA sensor, 2.5ug of expi293 expressed soluble PD1-avi was loaded and biotinylated via Avidity biotinylation kit. PD1#3 showed high off-rate. [Figure 30-1] FIG. 30 is a schematic diagram of the germline alignment of the anti-PD1 antibody clone, P4-B7. [Figure 30-2] See description of Figure 30-1. [Diagram 31] Figure 1 shows a graph of minibody binding curves of P4-B7 to human and cynomolgus PD-1. Curves were generated using expi293 cells 48 hours after transfection. Human variants were normalized to expression levels via commercial antibodies, whereas cynomolgus variants were not. Cynomolgus variants were not normalized because the commercial antibody used has not been reported to bind to cynomolgus PD#1. [Diagram 32]A graph of the binding curve for an IgG ELISA using P4-B7 is shown. P4-B7 is shifted too far to the right for the kinetics to proceed properly. Above, an ELISA plate was coated with soluble PD1 at 1ug / ml for 2 hours at 37°C. The plate was then washed and blocked with 2%BSA / PBS for 1 hour at 37°C. The blocking solution was removed and a 3x serial dilution of the antibody was added to each well (100ul) in 2% milk-PBST, starting at 6ug / ml. The plate was then incubated at room temperature with gentle shaking, washed 6 times with PBS-T, and secondary anti-human Fc-HRP (1:150k, Bethyl) was added. The plate was again incubated at room temperature with gentle shaking for 1 hour, then washed 6 times with PBS-T. TMB substrate was added and the plate was incubated at 30°C for 10 minutes to accelerate the HRP reaction. The signal was then quenched with TMB stop solution and read at 450nm. The protocol for the data obtained in the bottom graph was the same as that for the data obtained in the top graph, except plates were coated with 3x serial dilutions of antigen starting at 6ug / ml. Antibody was then added to all wells at a constant concentration of 1ug / ml. [Diagram 33] 1 shows a graph of the induction curve from a commercially available PD1-PDL1 bioassay. [Diagram 34] A schematic diagram of the Promega PD1-PDL1 bioassay (J1250) is shown. The Promega PD1-PDL1 bioassay (J1250) was performed with wild-type aPD-1 scFv-Fc (P4-B3) and mutant single and combo mutants generated from a random mutagenesis yeast library. Nivolumab was used as a benchmark control. [Diagram 35]P4-B3 mutant Promega bioassay (scFv-Fc type bioassay) is shown. Nivo (black circle) reached an induction fold of about 6, which is similar to our previous experiments. Single mutants HLkin-1, HL-7 and combo mutants Mut+2, Mut+3 show higher or equal levels of PD-1 / PD-L1 blockade compared to Nivo. This is also reflected in the EC50 values, with Mut+2 having about half the EC50 value of Nivo. P4-B3 wild type shows lower levels of blockade and also has an EC50 value 1.75 times higher than Nivo. The point mutations identified by our random mutagenesis yeast display library appear to have a significant effect on binding and checkpoint blockade capabilities. All P4-B3 samples used in this assay were in scFv-Fc type. Only Nivo and F10 were used as full IgG. [Diagram 36] Octet binding curves for P4-B3 wild type / mutant IgG. SA sensors were coated with biotinylated PD-1 and then immersed in various concentrations of anti-PD1 antibody. The first step after baseline indicates antibody binding and the second step indicates dissociation. As can be seen in this figure, P4-B3 wild type has a fast off rate, while the mutant and Pembro have much slower off rates. [Figure 37] Binding curves of P4-B3 single vs. combo mutants with mouse PD-1 (mPD-1) are shown (scFv-Fc format). [Figure 38] Binding curves for P4-B3 single vs. combo mutants with hPD1 are shown (scFv-Fc format unless otherwise stated). [Figure 39] Binding curves for P4-B3 single vs. combo mutants with hPD1 are shown (scFv-Fc format except for pembro / nivo / wild type IgG1). [Diagram 40] FIG. 1 is a schematic representation of the amino acid residues that were changed in the P4-B3 mutants generated. [Diagram 41]Schematic diagram of a mixed lymphocyte reaction (MLR) assay. CD4+ T cells express high levels of PD-1 upon activation. DCs express high levels of PD-L1 to improve self-tolerance in the body. T cell activation by MHC mismatch is limited due to PD-1 / PD-L1 blockade. Addition of anti-PD-1 antibodies removes this inhibitory signal, resulting in increased T cell activation (measured by cytokine release). [Figure 42-1] FIG. 42 shows a graph of the MLR assay showing cytokine production as indicated in the graph title. [Figure 42-2] See description of Figure 42-1. [Figure 43-1] FIG. 43 shows a graph of the MLR assay showing cytokine production as indicated in the graph title. [Figure 43-2] See description of Figure 43-1. [Figure 44-1] FIG. 44 shows a statistical data table of the MLR assay for Pembro versus P4B3mut+3 IgG4. [Figure 44-2] See description of Figure 44-1. [Figure 45-1] FIG. 45 shows a statistical data table of the MLR assay for Pembro versus P4B3mut+3 IgG4. [Figure 45-2] See description of Figure 45-1. [Figure 46-1] FIG. 46 shows a statistical data table of the MLR assay for Pembro versus P4B3mut+3 IgG4. [Figure 46-2] See description of Figure 46-1. [Figure 47-1] FIG. 47 shows a statistical data table of the MLR assay for Pembro versus P4B3mut+3 IgG4. [Figure 47-2] See description of Figure 47-1. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0026] Detailed Description of the Invention Abbreviations and Definitions Detailed description of one or more embodiments is provided herein.However, it is understood that the present invention can be embodied in various forms.Therefore, the specific details disclosed herein should not be interpreted as limiting, but as a basis for claims and as a representative basis for teaching a person skilled in the art to use the present invention in any suitable manner.

[0027] The singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. Use of the words "a" or "an" when used in conjunction with the term "comprising" in the claims and / or specification can mean "one," but is also consistent with the meaning of "one or more," "at least one," and "one or more."

[0028] Whenever the phrases "for example," "such as," "including," and the like are used herein, unless expressly stated otherwise, they are understood to be accompanied by the phrase "without limitation." Similarly, "an example," "exemplary," and the like are understood to be non-limiting.

[0029] The term "substantially" permits deviations from the descriptive language that do not adversely affect the intended purpose. It is understood that the descriptive language is modified by the term "substantially" even if the word "substantially" is not expressly recited.

[0030] The terms "comprising" and "including," as well as "having" and "involving" (and similarly "comprises," "includes," "has," and "involves"), etc., are used interchangeably and have the same meaning. Specifically, each term is defined consistent with the general U.S. Patent Law definition of "comprising," and therefore is to be interpreted as meaning "at least the following" in the open term, and not excluding additional features, limitations, aspects, etc. Thus, for example, "a process involving steps a, b, and c" means that the process includes at least steps a, b, and c. Whenever the terms "a" and "an" are used, they are to be understood as "one or more," unless such an interpretation is meaningless in the context.

[0031] The term "about" is used herein to mean approximately, roughly, approximately, or within the region. When the term "about" is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values ​​set forth. In general, the term "about" is used herein to modify a numerical value above and below the set forth value by a variance of 20 percent (up and down).

[0032] PD-1 Programmed T-cell death 1 (PD-1) is a transmembrane protein found on the surface of T cells, which, upon binding to programmed T-cell death ligand 1 (PD-L1) on tumor cells, leads to suppression of T-cell activity and reduction of T-cell-mediated cytotoxicity. Thus, PD-1 and PD-L1 are immune downregulators or immune checkpoint "off switches." Examples of PD-1 inhibitors include, but are not limited to, nivolumab, (Opdivo) (BMS-936558), pembrolizumab (Keytruda), pidilizumab, AMP-224, MEDI0680 (AMP-514), PDR001, MPDL3280A, MEDI4736, BMS-936559, and MSB0010718C.

[0033] The immune system must achieve a balance between an effective response to eliminate pathogens and the maintenance of tolerance to prevent autoimmune diseases. T cells play a central role in maintaining this balance, and their proper regulation is mainly orchestrated by molecules of the B7-CD28 family. The interaction between B7 family members, acting as ligands, and CD28 family members, acting as receptors, provides important positive signals that not only initiate, augment, and maintain T cell responses, but also contributes to important negative signals that limit, terminate, and / or attenuate T cell responses when appropriate. PD-1 is a member of the CD28 family.

[0034] The binding between PD-L1 and PD-1 has a profound effect on the regulation of T cell responses. Specifically, PD-L1 / PD-1 interaction inhibits T cell proliferation and the production of effector cytokines, such as IL-2 and IFN-γ, that mediate T cell activity and immune responses. This negative regulatory function is important for preventing T cell-mediated autoimmunity and immunopathology. However, the PD-1 / PD-L1 axis has also been shown to play a role in T cell exhaustion, whereby the negative regulatory function inhibits T cell responses to host damage. Prolonged or chronic antigen stimulation of T cells can induce a negative immunological feedback mechanism that inhibits antigen-specific responses and results in immune evasion of pathogens. T cell exhaustion can also result in the progressive physical loss of antigen-specific T cells themselves. T cell expression of PD-1 is upregulated during chronic antigen stimulation and its binding to PD-L1 results in blockade of effector function in both CD4+ (T helper cells) and CD8+ (cytotoxic T lymphocytes or CTL) T cells, thus implicating PD-1 / PD-L1 interaction in the induction of T cell exhaustion.

[0035] Recently, studies have shown that several chronic viral infections and cancers have developed immune evasion strategies that specifically exploit the PD-1 / PD-L1 axis by inducing PD-1 / PD-L1-mediated T cell exhaustion. Many human tumor cells and tumor-associated antigen-presenting cells express high levels of PD-L1, suggesting that tumors induce T cell exhaustion to evade antitumor immune responses. For example, during chronic HIV infection, HIV-specific CD8+ T cells are functionally impaired, exhibiting a reduced ability to produce cytokines and effector molecules and a reduced proliferative capacity. Studies have shown that PD-1 is highly expressed on HIV-specific CD8+ T cells in HIV-infected individuals, indicating that blocking the PD-1 / PD-L1 pathway may have therapeutic potential for the treatment of HIV infection and AIDS patients. Taken together, agents that block the PD-1 / PD-L1 pathway would provide a new therapeutic approach for various cancers, HIV infection, and / or other diseases and conditions associated with T cell exhaustion. Therefore, there is an urgent need for agents that can block or prevent PD-1 / PD-L1 interaction.

[0036] Overexpression of PD-L1 has been detected in various cancers. For example, in breast cancer, PD-L1 is overexpressed and is associated with high-risk prognostic factors. In renal cell carcinoma, PD-L1 is upregulated, and increased expression of PD-1 has also been found in tumor-infiltrating leukocytes. Anti-PD-L1 and anti-PD-1 antibodies have demonstrated some clinical efficacy in Phase I trials for renal cell carcinoma. Therapeutic agents that can bind to PD-1 or PD-L1 may be useful to specifically target tumor cells. Agents that can block PD-1 / PD-L1 interaction may be even more useful in treating cancers that induce T cell exhaustion to evade anti-tumor T cell activity. Such agents can be used alone or in combination with other anti-cancer therapeutics to effectively target tumor cells that overexpress PD-L1 and increase anti-tumor T cell activity, thereby enhancing the immune response to the target tumor cells.

[0037] PD-1 and PD-L1 can also be upregulated by T cells after chronic antigen stimulation, for example, due to chronic infection. During chronic HIV infection, HIV-specific CD8+ T cells are functionally impaired, have a reduced ability to produce cytokines and effector molecules, and show reduced proliferation capacity. PD-1 is highly expressed on HIV-specific CD8+ T cells of HIV-infected individuals. Thus, blocking this pathway can enhance the ability of HIV-specific T cells to proliferate and produce cytokines in response to stimulation with HIV peptides, thereby enhancing the immune response to HIV. Other chronic infections, such as chronic viral, bacterial, or parasitic infections, can also benefit from the use of PD-1 / PD-L1 blocking agents.

[0038] An embodiment of the present invention provides an isolated monoclonal antibody specific for PD-1. As used herein with respect to cells, nucleic acids (e.g., DNA or RNA), the term "isolated" refers to a molecule separated from other DNA or RNA, respectively, present in the natural source of the macromolecule. The term "isolated" can also refer to a nucleic acid or peptide that is substantially free of cellular material, viral material, or culture medium, if produced by recombinant DNA technology, or chemical precursors or other chemicals, if chemically synthesized. For example, an "isolated nucleic acid" can include a nucleic acid fragment that is not naturally occurring as a fragment and would not be found in the natural state. "Isolated" can also refer to a cell or polypeptide that is isolated from other cellular proteins or tissues. An isolated polypeptide can include both purified and recombinant polypeptides. The isolated antibodies were identified by the use of a 27 billion human single chain antibody (scFv) phage display library via paramagnetic proteoliposomes, using PD-1 as the library selection target. These antibodies represent a new class of monoclonal antibodies against PD-1 that can compete with PD-L1, pembrolizumab and nivolumab binding. Furthermore, the monoclonal PD-1 antibodies discussed herein cross-react with Macaca fascicularis PD-1 protein. The monoclonal PD-1 antibodies discussed herein can also be used in the construction of multispecific antibodies or as payloads for CAR-T cells.

[0039] Ten unique recombinant monoclonal PD-1 antibodies are described herein. These include P4-B3, P4-B7, PD1#2, PD1#3, PD1#13, P4-B3-HLkin1, P4-B3-HL-7, P4-B3-HL-14, P4-B3 HLkin-1 HL-7 mut2, and P4-B3 HLkin-1 HL-7 HL-14 mut3. The term "recombinant" with respect to a polypeptide (such as an antibody) or polynucleotide refers to a form of a polypeptide or polynucleotide that is not naturally occurring, a non-limiting example of which can be made by combining polynucleotides or polypeptides that are not normally found together.

[0040] Provided below are the nucleic acid and amino acid sequences of monoclonal PD-1 antibodies, in addition to exemplary wild-type IgG constant regions useful in combination with the VH and VL sequences provided herein (see Table 2). TIFF0007680967000001.tif18154

[0041] (Table 1A) Ab P4-B3 variable region nucleic acid sequence TIFF0007680967000002.tif77152

[0042] Table 1B: Ab P4-B3 variable region amino acid sequence TIFF0007680967000003.tif44152

[0043] Table 2A: Ab P4-B3 constant region nucleic acid sequence - wild type IgG monomer TIFF0007680967000004.tif153152

[0044] Table 2B. Ab P4-B3 constant region amino acid sequence - wild type IgG monomer TIFF0007680967000005.tif86152

[0045] (Table 3A) Ab P4-B7 variable region nucleic acid sequence TIFF0007680967000006.tif77152

[0046] Table 3B: Ab P4-B7 variable region amino acid sequence TIFF0007680967000007.tif44152

[0047] Table 4A: PD1#2 variable region nucleic acid sequences TIFF0007680967000008.tif77152

[0048] Table 4B: Ab PD1#2 variable region amino acid sequence TIFF0007680967000009.tif44152

[0049] Table 5A: PD1#3 variable region nucleic acid sequence TIFF0007680967000010.tif77152

[0050] Table 5B: Ab PD1#3 variable region amino acid sequence TIFF0007680967000011.tif43152

[0051] Table 6A: Ab PD1#13 variable region nucleic acid sequence TIFF0007680967000012.tif73152

[0052] Table 6B: Ab PD1#13 variable region amino acid sequence TIFF0007680967000013.tif39152

[0053] TIFF0007680967000014.tif11156

[0054] Table 7A: Ab P4-B3-HLkin1 variable region nucleic acid sequences TIFF0007680967000015.tif77152

[0055] Table 7B: Ab HLKin1 variable region amino acid sequences TIFF0007680967000016.tif43152

[0056] (Table 8A) Ab P4-B3-HL-7 variable region nucleic acid sequence TIFF0007680967000017.tif81152

[0057] Table 8B: Ab HL-7 variable region amino acid sequences TIFF0007680967000018.tif43152

[0058] (Table 9A) Ab P4-B3-HL-14 variable region nucleic acid sequence TIFF0007680967000019.tif77152

[0059] Table 9B: Ab HL-14 variable region amino acid sequences TIFF0007680967000020.tif48152

[0060] Table 10A: Ab HLkin-1 HL-7 mut2 variable region nucleic acid sequence TIFF0007680967000021.tif77152

[0061] Table 10B: Ab HLkin-1 HL-7 mut2 variable region amino acid sequence TIFF0007680967000022.tif44152

[0062] Table 11A: Ab HLkin-1 HL-7 HL-14 mut3 variable region nucleic acid sequences TIFF0007680967000023.tif77152

[0063] Table 11B: Ab HLkin-1 HL-7 HL-14 mut3 variable region amino acid sequences TIFF0007680967000024.tif43152

[0064] The amino acid sequences of the heavy and light chain complementarity determining regions of the PD-1 antibody are shown in Tables 12A-B below.

[0065] Table 12A: PD-1 antibody heavy chain (V H ) complementarity determining region (CDR) TIFF0007680967000025.tif114134

[0066] Table 12B. PD-1 antibody light chain (V L ) complementarity determining region (CDR) TIFF0007680967000026.tif114134

[0067] The amino acid sequences of the heavy and light chain framework regions of the PD-1 antibody are shown below in Tables 13A-B.

[0068] Table 13A: PD-1 antibody heavy chain (V H ) Framework region (FR) TIFF0007680967000027.tif202155

[0069] Table 13B. PD-1 antibody light chain (V L ) Framework region (FR) TIFF0007680967000028.tif202155

[0070] The PD-1 antibodies described herein bind to PD-1. In one embodiment, the PD-1 antibodies have high affinity and high specificity for PD-1. Some embodiments also feature antibodies that have a certain percentage of identity or similarity to the amino acid or nucleotide sequences of the anti-PD-1 antibodies described herein. For example, "homology" or "identity" or "similarity" refers to the sequence similarity between two peptides or two nucleic acid molecules. Homology can be determined by comparing positions in each sequence that can be aligned for comparison. If a position in the compared sequences is occupied by the same base or amino acid, the molecules are homologous at that position. The degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. For example, an antibody may have 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more amino acid sequence identity when compared to a particular region or the full length of any one of the anti-PD-1 antibodies described herein. For example, an antibody may have 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more nucleic acid identity when compared to a particular region or the full length of any one of the anti-PD-1 antibodies described herein. Sequence identity or similarity for the nucleic acids and proteins of the present invention can be determined by sequence comparison and / or alignment using software programs known in the art, for example, as described in Current Protocols in Molecular Biology, eds. Ausubel et al. (2007). For example, sequence comparison algorithms (i.e., BLAST or BLAST 2.0), manual alignment or visual inspection can be used to determine percent sequence identity or similarity for the nucleic acids and proteins of the present invention.

[0071] As used herein, "polypeptide" can encompass a single "polypeptide" as well as multiple "polypeptides" and refers to a molecule composed of monomers (amino acids) linearly linked by amide bonds (also known as peptide bonds). The term "polypeptide" refers to any one or more chains of two or more amino acids and does not refer to a specific length of the product. Thus, peptide, dipeptide, tripeptide, oligopeptide, "protein," "amino acid chain," or any other term used to refer to a chain of two or more amino acids can refer to a "polypeptide" herein, and the term "polypeptide" can be used in place of or interchangeably with any of these terms. "Polypeptide" can also refer to the product of post-expression modification of a polypeptide, including, but not limited to, glycosylation, acetylation, phosphorylation, amidation, derivatization with known protecting / blocking groups, proteolytic cleavage, or modification with non-naturally occurring amino acids. A polypeptide can be derived from a natural biological source or produced by recombinant technology, but is not necessarily translated from a specified nucleic acid sequence. It can be generated in any manner, including chemical synthesis. With respect to amino acid sequences, one of skill in the art will readily recognize that individual substitutions, deletions, or additions to a nucleic acid, peptide, polypeptide, or protein sequence that modify, add, delete, or replace a single amino acid or a small percentage of amino acids in the encoded sequence are collectively referred to herein as "conservatively modified variants." In some embodiments, the modification results in the replacement of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. Such conservatively modified variants of the anti-PD-1 antibodies disclosed herein may exhibit increased cross-reactivity to PD-1 compared to unmodified PD-1 antibodies.

[0072] For example, a "conservative amino acid substitution" is one in which an amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues with similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), non-polar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, a non-essential amino acid residue in an immunoglobulin polypeptide is replaced with another amino acid residue from the same side chain family. In another embodiment, the string of amino acids can be replaced with a structurally similar string that differs in the order and / or composition of the side chain family members.

[0073] antibody As used herein, an "antibody" or "antigen-binding polypeptide" can refer to a polypeptide or polypeptide complex that specifically recognizes and binds an antigen. An antibody can be a whole antibody and any antigen-binding fragment or single chain thereof. For example, an "antibody" can include any protein or peptide-containing molecule that contains at least a portion of an immunoglobulin molecule that has the biological activity of binding to an antigen. Non-limiting examples include the complementarity determining regions (CDRs) of a heavy or light chain or a ligand-binding portion thereof, a heavy or light chain variable region, a heavy or light chain constant region, a framework (FR) region or any portion thereof, or at least a portion of a binding protein. As used herein, the term "antibody" can refer to immunoglobulin molecules and immunologically active portions of immunoglobulin (Ig) molecules, i.e., molecules that contain an antigen-binding site that specifically binds (immunoreacts with) an antigen. "Specifically binds" or "immunoreacts" refers to an antibody that reacts with one or more antigenic determinants of a desired antigen and not with other polypeptides.

[0074] As used herein, the term "antibody fragment" or "antigen-binding fragment" refers to (ab ' )2 , F (ab)2 , F ab ', F ab Antibody fragments are portions of antibodies, such as Fv, scFv, etc. Regardless of structure, antibody fragments bind to the same antigen recognized by the intact antibody. The term "antibody fragment" includes aptamers (e.g., spiegel), minibodies, and diabodies. The term "antibody fragment" can also include any synthetic or engineered protein that acts like an antibody by binding to a specific antigen to form a complex. Antibodies, antigen-binding polypeptides, variants, or derivatives described herein include polyclonal, monoclonal, multispecific, human, humanized or chimeric antibodies, single chain antibodies, epitope-binding fragments, such as Fab, Fab', and F(ab') 2, Fds, Fvs, single-chain Fvs (scFv), single-chain antibodies, dAbs (domain antibodies), minibodies, disulfide-linked Fvs (sdFv), fragments containing either the VL or VH domains, a Fab expression library, and fragments produced by anti-idiotypic (anti-Id) antibodies.

[0075] A "single-chain variable fragment" or "scFv" is a fragment of an immunoglobulin heavy chain (V H ) and light chain (V L Single-chain Fv ("scFv") polypeptide molecules are covalently linked VH:VL heterodimers and can be expressed from gene fusions containing a VH-encoding gene and a VL-encoding gene joined by a peptide-encoding linker. (See Huston et al. (1988) Proc Nat Acad Sci USA 85(16):5879-5883). In some embodiments, the domains are joined by a short linker peptide of 10 to about 25 amino acids. The linker can be rich in glycine for flexibility and serine or threonine for solubility, and can be rich in the VH:VL heterodimer. H N-terminus of V L The C-terminus of the scFv molecule may be linked to the C-terminus of the antibody V-region or vice versa. The protein retains the specificity of the original immunoglobulin despite the removal of the constant region and the introduction of the linker. Many methods have been described for identifying chemical structures for converting naturally aggregated but chemically separated light and heavy polypeptide chains from antibody V-regions into scFv molecules that fold into a three-dimensional structure substantially similar to that of the antigen-binding site. See, for example, U.S. Patent Nos. 5,091,513; 5,892,019; 5,132,405; and 4,946,778, each of which is incorporated by reference in its entirety.

[0076] Very large naive human scFv libraries have been and can be made to provide a large source of rearranged antibody genes against many target molecules. Smaller libraries can be constructed from individuals with infectious diseases to isolate disease-specific antibodies. (See Barbas et al., Proc. Natl. Acad. Sci. USA 89:9339-43 (1992); Zebedee et al., Proc. Natl. Acad. Sci. USA 89:3 175-79 (1992)).

[0077] Antibody molecules obtained from humans relate to one of five classes: IgG, IgM, IgA, IgE, and IgD, which differ from one another in the nature of the heavy chains present in the molecule. Those skilled in the art will appreciate that heavy chains are classified as gamma, mu, alpha, delta, or epsilon (γ, μ, α, δ, ε), with several subclasses within these (e.g., γ1-γ4). Particular classes include, for example, IgG 1 , IgG 2 , IgG 3 and IgG 4 Immunoglobulin subclasses (isotypes), such as IgG 1 , IgG 2 , IgG 3 , IgG 4 , IgG 5 etc. are well characterized and known to confer functional specialization. For IgG, a standard immunoglobulin molecule contains two identical light chain polypeptides with a molecular weight of approximately 23,000 daltons, and two identical heavy chain polypeptides with a molecular weight of 53,000-70,000. The four chains are typically linked by disulfide bonds in a "Y" configuration, with the light chains surrounding the heavy chains, which begin at the mouth of the "Y" and continue through the variable region. The immunoglobulin or antibody molecules described herein can be of any type (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) or subclass of immunoglobulin molecule.

[0078] Light chains are classified as either kappa or lambda (κ, λ). Each heavy chain class can be associated with either a kappa or lambda light chain. Generally, light and heavy chains are covalently linked to each other, and when immunoglobulins are produced by either hybridomas, B cells, or genetically engineered host cells, the "tail" portions of the two heavy chains are linked to each other by covalent disulfide bonds or non-covalent bonds. In the heavy chains, the amino acid sequence runs from the N-terminus at the forked ends of the Y configuration to the C-terminus at the bottom of each chain.

[0079] Both light and heavy chains are divided into regions of structural and functional homology. The terms "constant" and "variable" are used functionally. The variable domains of both the light (VL) and heavy (VH) chain portions determine antigen recognition and specificity. Conversely, the constant domains of the light (CL) and heavy (CH1, CH2 or CH3) chains confer important biological properties such as secretion, transplacental mobility, Fc receptor binding, and complement binding. The term "antigen-binding site" or "binding portion" can refer to the portion of an immunoglobulin molecule involved in antigen binding. The antigen-binding site is formed by amino acid residues of the N-terminal variable ("V") regions of the heavy ("H") and light ("L") chains. Three highly divergent stretches within the V regions of the heavy and light chains, called "hypervariable regions", are inserted between more conserved adjacent stretches known as "framework regions" or "FRs". Thus, the term "FR" can refer to the amino acid sequences naturally found between and adjacent to the hypervariable regions of immunoglobulins. In an antibody molecule, the three hypervariable regions of the light chain and the three hypervariable regions of the heavy chain are arranged relative to each other in three-dimensional space to form an antigen-binding surface. The antigen-binding surface is complementary to the three-dimensional surface of a bound antigen, and the three hypervariable regions of each of the heavy and light chains are referred to as "complementarity determining regions" or "CDRs." The VH and VL regions containing the CDRs, as well as the framework (FR) of the PD-1 antibody, are shown in Tables 1A-15B.

[0080] The six CDRs present in each antigen-binding domain are short non-contiguous sequences of amino acids specifically arranged to form the antigen-binding domain as the antibody assumes its three-dimensional configuration in an aqueous environment. The remaining amino acids in the antigen-binding domain, the FR regions, show less intermolecular variation. The framework regions adopt a predominantly β-sheet structure, and the CDRs form loops to connect to, and in some cases form part of, the β-sheet structure. The framework regions act to form a scaffold that positions the CDRs in the correct orientation by non-covalent interactions between the chains. The antigen-binding domain formed by the positioned CDRs provides a surface complementary to the epitope on the immunoreactive antigen, facilitating non-covalent binding of the antibody to its cognate epitope. The amino acids which comprise the CDRs and framework regions, respectively, can be readily identified for a heavy or light chain variable region by one of skill in the art as they have been previously defined (see "Sequences of Proteins of Immunological Interest", Kabat, E. et al., USDepartment of Health and Human Services, (1983); and Chothia and Lesk, J. Mol. Biol., 196:901-917 (1987)).

[0081] In the event that there is more than one definition of a term used and / or accepted in the art, the definition of the term used herein is intended to include all such meanings unless expressly stated otherwise. A specific example is the use of the term "complementarity determining region" ("CDR") to describe the non-adjacent antigen binding sites found within the variable regions of both heavy and light chain polypeptides. This particular region is described by Kabat et al., USDept. of Health and Human Services, "Sequences of Proteins of Immunological Interest" (1983) and Chothia et al., Mol. Biol. 196:901-917 (1987), which are incorporated herein by reference in their entirety. The CDR definitions by Kabat and Chothia include overlapping or subsets of amino acid residues when compared to each other. Nevertheless, application of either definition to refer to the CDR of an antibody or variants thereof is intended to be within the scope of the term defined and used herein. The appropriate amino acid residues encompassing the CDRs defined by each of the above cited references are set forth in the following table for comparison. The exact residue numbers which encompass a particular CDR will vary depending on the sequence and size of the CDR. One skilled in the art can routinely determine which residues comprise a particular CDR, given the variable region amino acid sequence of an antibody. TIFF0007680967000029.tif48128

[0082] Kabat et al. defined a numbering system for variable domain sequences that is applicable to any antibody. One of skill in the art can unambiguously assign this "Kabat numbering" system to any variable domain sequence without relying on any experimental data other than the sequence itself. As used herein, "Kabat numbering" refers to the numbering system set forth by Kabat et al., USDept. of Health and Human Services, "Sequence of Proteins of Immunological Interest" (1983).

[0083] In addition to the above table, the Kabat numbering system describes the CDR regions as follows: CDR-H1 begins at about amino acid 31 (i.e., approximately 9 residues after the first cysteine ​​residue), includes approximately 5-7 amino acids, and ends at the next tryptophan residue. CDR-H2 begins at the 15th residue after the end of CDR-H1, includes approximately 16-19 amino acids, and ends at the next arginine or lysine residue. CDR-H3 begins at about the 33rd amino acid residue after the end of CDR-H2, includes 3-25 amino acids, and ends with the sequence WGXG (where X is any amino acid). CDR-L1 begins at about the 24th residue (i.e., following the cysteine ​​residue), includes approximately 10-17 residues, and ends at the next tryptophan residue. CDR-L2 begins at about the 16th residue after the end of CDR-L1, and includes approximately 7 residues. CDR-L3 begins at about the 33rd residue after the end of CDR-L2 (i.e., following the cysteine ​​residue), includes about 7-11 residues, and ends with the sequence F or WGXG (where X is any amino acid).

[0084] As used herein, the term "epitope" can include any protein determinant capable of specific binding to an immunoglobulin, scFv, or T-cell receptor. The variable region allows an antibody to selectively recognize and specifically bind to an epitope on an antigen. For example, the VL and VH domains of an antibody, or a subset of complementarity determining regions (CDRs), combine to form the variable region that defines a three-dimensional antigen-binding site. This quaternary antibody structure forms the antigen-binding site present at the end of each arm of the Y. Epitope determinants usually consist of chemically active surface groups of molecules, such as amino acids or sugar side chains, and usually have specific three-dimensional structural characteristics as well as specific charge characteristics. For example, antibodies can be raised against N-terminal or C-terminal peptides of a polypeptide. More specifically, the antigen-binding site is defined by three CDRs (i.e., CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3) on each of the VH and VL chains. In one embodiment, the antibody may be directed to PD-1 comprising the amino acid sequence of SEQ ID NO:XX (Genbank Accession No. NP_005009; having a length of 288 amino acid residues). TIFF0007680967000030.tif18137

[0085] As used herein, the terms "immunological binding" and "immunological binding properties" can refer to the type of non-covalent interactions that occur between an immunoglobulin molecule and an antigen for which the immunoglobulin is specific. The strength or affinity of an immunological binding interaction is determined by the equilibrium binding constant (K D ), and K D A smaller K represents a higher affinity. The immunological binding properties of a selected polypeptide can be quantified using methods well known in the art. One such method involves measuring the rates of formation and dissociation of the antigen-binding site / antigen complex, which depend on the concentrations of the complex partners, the affinity of the interaction, and geometric parameters that affect the rates in both directions equally. Thus, the "on-rate constant" (K on) and the "off rate constant" (K off Both the K and the K can be determined by calculation of the concentration and the actual rates of association and dissociation. (See Nature 361:186-87 (1993)). off / K on The ratio of D (See generally, Davies et al. (1990) Annual Rev Biochem 59:439-473.) The antibodies of the present invention have an equilibrium binding constant (K D ) is ≦1 μM, ≦10 μM, ≦10 nM, ≦10 pM, or ≦100 pM to about 1 pM, as measured by a kinetic assay, such as a radioligand binding assay, or a similar assay known to those of skill in the art, such as BIAcore or Octet (BLI). For example, in some embodiments, K D is about 1E-12M to about 1E-11M K D In some embodiments, K D is about 1E-11M to about 1E-10M K D In some embodiments, K D is about 1E-10M to about 1E-9M K D In some embodiments, K D is about 1E-9M to about 1E-8M K D In some embodiments, K D is about 1E-8M to about 1E-7M K D In some embodiments, K D is about 1E-7M to about 1E-6M K D For example, in some embodiments, K D is about 1E-12M, but in other embodiments, K D is about 1E-11M. In some embodiments, K D is about 1E-10M, but in other embodiments, K D is about 1E-9M. In some embodiments, K D is about 1E-8M, but in other embodiments, K Dis about 1E-7M. In some embodiments, K D is about 1E-6M, but in other embodiments, K D is about 1E-5M. In some embodiments, for example, K D is about 3E-11M, but in other embodiments, K D is about 3E-12M. In some embodiments, K D is about 6E-11M. "Specifically binds" or "has specificity" can refer to an antibody that binds to an epitope through its antigen-binding domain, and the binding involves a degree of complementarity between the antigen-binding domain and the epitope. For example, an antibody is said to "specifically bind" if it binds to an epitope through its antigen-binding domain more readily than it would bind to a random, unrelated epitope.

[0086] For example, PD-1 antibodies can be monovalent or bivalent and include single chain or two chains. Functionally, the binding affinity of PD-1 antibodies is greater than or equal to 10 -5 M~10 -12 For example, the binding affinity of PD-1 antibodies is in the range of 10 -6 M~10 -12 M, 10 -7 M~10 -12 M, 10 -8 M~10 -12 M, 10 -9 M~10 -12 M, 10 -5 M~10 -11 M, 10 -6 M~10 -11 M, 10 -7 M~10 -11 M, 10 -8 M~10 -11 M, 10 -9 M~10 -11 M, 10 -10 M~10 -11 M, 10 -5 M~10 -10 M, 10 -6 M~10 -10 M, 10 -7 M~10 -10 M, 10 -8 M~10 -10M, 10 -9 M~10 -10 M, 10 -5 M~10 -9 M, 10 -6 M~10 -9 M, 10 -7 M~10 -9 M, 10 -8 M~10 -9 M, 10 -5 M~10 -8 M, 10 -6 M~10 -8 M, 10 -7 M~10 -8 M, 10 -5 M~10 -7 M, 10 -6 M~10 -7 M, 10 -5 M~10 -6 It's M.

[0087] The PD-1 proteins of the invention, or derivatives, fragments, analogs, homologs or orthologues thereof, can be utilized as immunogens in the generation of antibodies that immunospecifically bind to these protein components, such as amino acid residues comprising SEQ ID NO: X. The PD-1 proteins, or derivatives, fragments, analogs, homologs or orthologues thereof, bound to proteoliposomes, can be utilized as immunogens in the generation of antibodies that immunospecifically couple to these protein components.

[0088] One of skill in the art will recognize that it is possible, without undue experimentation, to determine whether a human monoclonal antibody has the same specificity as a human monoclonal antibody of the invention by determining whether the former prevents the latter from binding to PD-1. If the human monoclonal antibody being tested competes with a human monoclonal antibody of the invention, e.g., as indicated by reduced binding by the human monoclonal antibody of the invention, then the two monoclonal antibodies likely bind to the same epitope or a closely related epitope.

[0089] Another method for determining whether a human monoclonal antibody has the specificity of the human monoclonal antibody of the present invention is to preincubate the human monoclonal antibody of the present invention with the PD-1 protein to which it is normally reactive, and then add the human monoclonal antibody to be tested to determine whether the human monoclonal antibody to be tested is inhibited in its ability to bind to PD-1. If the human monoclonal antibody to be tested is inhibited, then it likely has the same, or a functionally equivalent, epitopic specificity as the monoclonal antibody of the present invention. Screening of the human monoclonal antibodies of the present invention can also be performed by utilizing PD-1 and determining whether the test monoclonal antibody can neutralize PD-1.

[0090] Various procedures known in the art can be used for the production of polyclonal or monoclonal antibodies to a protein of the invention, or to derivatives, fragments, analogs, homologs, or orthologs thereof (see, e.g., Antibodies: A Laboratory Manual, Harlow E, and Lane D, 1988, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, incorporated herein by reference).

[0091] Antibodies can be purified by well-known techniques such as affinity chromatography using protein A or protein G, which mainly provides the IgG fraction of immune serum. Subsequently, or alternatively, the specific antigen or epitope that is the target of the desired immunoglobulin can be immobilized on a column, and the immune specific antibody can be purified by immunoaffinity chromatography. Purification of immunoglobulins is discussed, for example, by D. Wilkinson (The Scientist, published by The Scientist, Inc., Philadelphia PA, Vol. 14, No. 8 (April 17, 2000), pp. 25-28).

[0092] The term "monoclonal antibody" or "mAb" or "Mab" or "monoclonal antibody composition" as used herein can refer to a population of antibody molecules that contains only one molecular species of antibody molecule consisting of a unique light chain gene product and a unique heavy chain gene product. In particular, the complementarity determining regions (CDRs) of a monoclonal antibody are identical in all molecules of the population. MAbs contain an antigen binding site capable of immunoreacting with a particular epitope of an antigen characterized by a unique binding affinity for it.

[0093] Monoclonal antibodies can be prepared using the hybridoma method, such as that described by Kohler and Milstein, Nature, 256:495 (1975). In the hybridoma method, a mouse, hamster, or other suitable host animal is typically immunized with an immunizing agent to elicit lymphocytes that produce, or are capable of producing, antibodies that specifically bind to the immunizing agent. Alternatively, lymphocytes can be immunized in vitro.

[0094] The immunizing agent may comprise a protein antigen, a fragment thereof or a fusion protein thereof. For example, if cells of human origin are desired, peripheral blood lymphocytes may be used, or if non-human mammalian sources are desired, spleen cells or lymph node cells may be used. The lymphocytes are then fused with an immortalized cell line using a suitable fusing agent, such as polyethylene glycol, to form hybridoma cells (see Goding, Monoclonal Antibodies: Principles and Practice, Academic Press, (1986) pp.59-103). The immortalized cell line may be a transformed mammalian cell, particularly a myeloma cell of rodent, bovine and human origin. For example, a rat or mouse myeloma cell line is used. The hybridoma cells may be cultured in a suitable culture medium containing one or more substances that inhibit the growth or survival of unfused immortalized cells. For example, if the parent cells lack the enzyme hypoxanthine guanine phosphoribosyltransferase (HGPRT or HPRT), the culture medium for the hybridoma typically contains hypoxanthine, aminopterin, and thymidine ("HAT medium"), substances that prevent growth of HGPRT-deficient cells.

[0095] Useful immortalized cell lines are those that fuse efficiently, support stable high-level expression of antibody by selected antibody-producing cells, and are sensitive to medium such as HAT medium. For example, immortalized cell lines may be mouse myeloma lines, which can be obtained, for example, from the Salk Institute Cell Distribution Center (San Diego, California) and the American Type Culture Collection (Manassas, Virginia). Human myeloma and mouse-human heteromyeloma cell lines have also been described for the production of human monoclonal antibodies. (See Kozbor, J. Immunol, 133:3001 (1984); Brodeur et al, Monoclonal Antibody Production Techniques and Applications, Marcel Dekker, Inc., New York, (1987) pp.51-63).

[0096] The culture medium in which the hybridoma cells are cultured can then be assayed for the presence of monoclonal antibodies against the antigen.For example, the binding specificity of the monoclonal antibodies produced by hybridoma cells can be determined by immunoprecipitation or by in vitro binding assays such as radioimmunoassay (RIA) or enzyme-linked immunosorbent assay (ELISA).Such techniques and assays are known in the art.The binding affinity of monoclonal antibodies can be determined, for example, by Scatchard analysis as described by Munson and Pollard, Anal.Biochem.,107:220(1980).Furthermore, in the therapeutic use of monoclonal antibodies, it is important to identify antibodies that have a high degree of specificity and high binding affinity for target antigens.

[0097] After the desired hybridoma cells are identified, the clones can be subcloned by limiting dilution procedures and grown by standard methods. (See Goding, Monoclonal Antibodies: Principles and Practice, Academic Press, (1986) pp.59-103). Suitable culture media for this purpose include, for example, Dulbecco's modified Eagle's medium and RPMI-1640 medium. Alternatively, the hybridoma cells can be grown in vivo as ascites in a mammal.

[0098] The monoclonal antibodies secreted by the subclones can be isolated or purified from the culture medium or ascites fluid by conventional immunoglobulin purification procedures such as, for example, protein A-Sepharose, hydroxylapatite chromatography, gel electrophoresis, dialysis, or affinity chromatography.

[0099] Monoclonal antibodies can also be produced by recombinant DNA methods, such as those described in U.S. Patent No. 4,816,567, which is incorporated herein by reference in its entirety. DNA encoding the monoclonal antibodies of the present invention can be easily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that can specifically bind to genes encoding the heavy and light chains of mouse antibodies). Hybridoma cells of the present invention serve as a source of such DNA. Once isolated, the DNA can be placed into an expression vector and then transfected into host cells, such as monkey COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not produce immunoglobulin proteins, to obtain the synthesis of monoclonal antibodies in the recombinant host cells. The DNA can also be modified, for example, by substituting the coding sequence for human heavy and light chain constant domains for the homologous murine sequences (see U.S. Pat. No. 4,816,567; Morrison, Nature 368,812-13 (1994)), or by covalently linking all or part of the coding sequence of a non-immunoglobulin polypeptide to the immunoglobulin coding sequence. Such a non-immunoglobulin polypeptide can be substituted for the constant domains of an antibody of the invention, or can be substituted for the variable domains of one antigen-binding site of an antibody of the invention to create a chimeric bivalent antibody.

[0100] A fully human antibody is an antibody molecule in which the entire sequences of both the light and heavy chains, including, for example, the CDRs, originate from human genes. Such antibodies are referred to as "human antibodies" or "fully human antibodies." A "humanized antibody" can be an antibody from a non-human species in which the light and heavy chain protein sequences have been modified to increase similarity with the antibody variants produced in humans. A humanized antibody is an antibody molecule derived from a non-human species antibody that binds to a desired antigen, having one or more complementarity determining regions (CDRs) from a non-human species and framework regions from a human immunoglobulin molecule. Often, framework residues in the human framework regions are replaced with corresponding residues from the CDR donor antibody to alter (e.g., improve) antigen binding. These framework replacements are identified by methods well known in the art, for example, by modeling the interactions of CDRs and framework residues to identify framework residues important for antigen binding, and sequence comparison to identify unusual framework residues at specific positions. (See, e.g., Queen et al., U.S. Pat. No. 5,585,089; Riechmann et al., Nature 332:323 (1988), which are incorporated by reference in their entireties.) For example, the non-human portions of the antibody (light chain, light and / or heavy chain CDRs) can be bound to a target antigen. Humanized monoclonal antibodies are sometimes referred to herein as "human monoclonal antibodies."

[0101] Antibodies can be humanized using a variety of techniques known in the art, such as, for example, CDR grafting (EP 239,400; PCT Publication WO 91 / 09967; U.S. Pat. Nos. 5,225,539; 5,530,101; and 5,585,089), veneering or resurfacing (EP 592,106; EP 519,596; Padlan, Molecular Immunology 28(4 / 5):489-498 (1991); Studnicka et al., Protein Engineering 7(6):805-814 (1994); Roguska.et al., Proc. Natl. Sci. USA 91:969-973 (1994)), and chain shuffling (U.S. Pat. No. 5,565,332, incorporated by reference in its entirety). "Humanization" (also called reshaping or CDR grafting) is a well-established technique understood by those skilled in the art to reduce the immunogenicity of monoclonal antibodies (mAbs) from xenogeneic sources (generally rodents) and improve activation of the human immune system (see, e.g., Hou S, Li B, Wang L, Qian W, Zhang D, Hong X, Wang H, Guo Y (July 2008). "Humanization of an anti-CD34 monoclonal antibody by complementarity-determining region grafting based on computer-assisted molecular modeling". J Biochem. 144(1):115-20).

[0102] Human monoclonal antibodies (e.g., fully human and humanized antibodies) can be prepared by using trioma technology; human B-cell hybridoma technology (see Kozbor, et al, 1983 Immunol Today 4:72); and EBV hybridoma technology to produce human monoclonal antibodies (see Cole, et al, 1985 "MONOCLONAL ANTIBODIES AND CANCER THERAPY", Alan R. Liss, Inc., pp. 77-96). Human monoclonal antibodies can be used and can be produced using human hybridomas (see Cote, et al, 1983. Proc Natl Acad Sci USA 80:2026-2030) or by transforming human B cells with Epstein-Barr virus in vitro (see Cole, et al., 1985 "MONOCLONAL ANTIBODIES AND CANCER THERAPY", Alan R. Liss, Inc., pp. 77-96).

[0103] Additionally, antibodies can also be produced using other techniques, including phage display libraries. (See Hoogenboom and Winter, J. Mol. Biol, 227:381 (1991); Marks et al., J. Mol. Biol, 222:581 (1991)). Similarly, human antibodies can be made by introducing human immunoglobulin loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon challenge, human antibody production is observed, which closely resembles that seen in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in U.S. Patent Nos. 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016; and Marks et al., Bio / Technology 10, 779-783 (1992); Lonberg et al., Nature 368, 856-859 (1994); Morrison, Nature 368, 812-13 (1994); Fishwild et al., Nature Biotechnology 14, 845-51 (1996); Neuberger, Nature Biotechnology 14, 826 (1996); and Lonberg and Huszar, Intern. Rev. Immunol. 13 65-93 (1995).

[0104] Human antibodies can also be produced using transgenic non-human animals that have been modified to produce fully human antibodies in response to challenge with an antigen rather than the animal's endogenous antibodies. (See PCT Publication No. WO94 / 02602 and U.S. Patent No. 6,673,986). The endogenous genes encoding heavy and light immunoglobulin chains in the non-human host are disabled, and active loci encoding human heavy and light immunoglobulin chains are inserted into the host's genome. Human genes are incorporated, for example, using yeast artificial chromosomes that contain the necessary human DNA fragments. Animals that provide all the desired modifications are then obtained as progeny by mating intermediate transgenic animals that contain less than the full complement of modifications. A non-limiting example of such a non-human animal is the mouse, referred to as the Xenomouse™, as disclosed in PCT Publication Nos. WO96 / 33735 and WO96 / 34096. The animal produces B cells that secrete fully human immunoglobulins. Antibodies can be obtained directly from animals after immunization with the immunogen of interest, for example as a polyclonal antibody preparation, or from immortalized B cells derived from animals, such as hybridomas that produce monoclonal antibodies. Additionally, genes encoding immunoglobulins with human variable regions can be recovered and expressed to obtain antibodies directly, or further modified to obtain analogs of antibodies, such as, for example, single chain Fv (scFv) molecules. Thus, such techniques can be used to produce therapeutically useful IgG, IgA, IgM and IgE antibodies. For an overview of this technique for producing human antibodies, see Lonberg and Huszar Int. Rev. Immunol. 73:65-93 (1995).For a detailed discussion of this technology for producing human antibodies and human monoclonal antibodies and protocols for producing such antibodies, see, e.g., PCT publications WO 98 / 24893, WO 96 / 34096; WO 96 / 33735; U.S. Patent Nos. 5,413,923; 5,625,126; 5,633,425; 5,569,825; 5,661,016; 5,545,806; 5,814,318; and 5,939,598, which are incorporated herein by reference in their entireties. Additionally, companies such as Creative BioLabs (Shirley, NY) may be engaged to provide human antibodies against a selected antigen using technology similar to that described above.

[0105] An example of a method for producing a non-human host, exemplified as a mouse, lacking the expression of endogenous immunoglobulin heavy chain is disclosed in US Patent No. 5,939,598. This can be obtained by a method comprising: deleting J segment genes from at least one endogenous heavy chain locus in embryonic stem cells to prevent rearrangement of the locus and prevent the formation of rearranged immunoglobulin heavy chain locus transcripts (the deletion is effected by a targeting vector that contains a gene encoding a selection marker); and producing a transgenic mouse from the embryonic stem cells whose somatic and germ cells contain a gene encoding a selection marker.

[0106] One method for producing an antibody of interest, such as a human antibody, is disclosed in U.S. Patent No. 5,916,771. The method includes introducing an expression vector containing a nucleotide sequence encoding a heavy chain into one mammalian host cell in culture, introducing an expression vector containing a nucleotide sequence encoding a light chain into another mammalian host cell, and fusing the two cells to form a hybrid cell. The hybrid cell expresses the antibody containing the heavy and light chains.

[0107] In a further improvement of this procedure, methods for identifying clinically relevant epitopes on immunogens and correlative methods for selecting antibodies that immunospecifically bind with high affinity to the relevant epitopes are disclosed in PCT Publication WO 99 / 53049.

[0108] The antibody of interest can also be expressed by a vector containing a DNA fragment encoding the single chain antibody described above. Vectors include, but are not limited to, chemical conjugates as described in WO93 / 64701, which have a targeting moiety (e.g., a ligand for a cell surface receptor) and a nucleic acid binding moiety (e.g., polylysine), viral vectors (e.g., DNA or RNA viral vectors), fusion proteins as described in PCT / US95 / 02140 (WO95 / 22618), which are fusion proteins containing a targeting moiety (e.g., an antibody specific for a target cell) and a nucleic acid binding moiety (e.g., protamine), plasmids, phages, viral vectors, and the like. Vectors can be chromosomal, non-chromosomal, or synthetic. Retroviral vectors can also be used, including Moloney murine leukemia virus. DNA viral vectors may also be used, including pox vectors, such as orthopox or avipox vectors, herpes virus vectors, such as herpes simplex virus type I (HSV) vectors (Geller, AI et al, J. Neurochem, 64:487 (1995); Lim, F., et al, "DNA Cloning: Mammalian Systems", D. Glover, Ed. (Oxford Univ. Press, Oxford England) (1995); Geller, AI et al, Proc Natl. Acad. Sci.: USA 90:7603 (1993); Geller, AI, et al, Proc Natl. Acad. Sci USA 87:1149 (1990), Adenovirus Vectors (see LeGal LaSalle et al, Science, 259:988 (1993); Davidson, et al, Nat. Genet 3:219 (1993); Yang, et al, J. Virol. 69:2004 (1995) and Adeno-associated Virus Vectors (see Kaplitt, MG. et al, Nat. Genet. 8:148 (1994)).

[0109] Poxvirus vectors introduce genes into the cytoplasm. Avipoxvirus vectors result in only short-term expression of the nucleic acid. Adenovirus vectors, adeno-associated virus vectors and herpes simplex virus (HSV) vectors can be used to introduce nucleic acids into neural cells. Adenovirus vectors result in shorter-term expression (about 2 months) than adeno-associated virus (about 4 months), which in turn results in shorter-term expression than HSV vectors. The particular vector selected will depend on the target cell and the condition being treated. Introduction can be by standard techniques (e.g., infection, transfection, transduction or transformation). Examples of modes of gene introduction include, for example, naked DNA, CaP0 4 These include precipitation, DEAE dextran, electroporation, protoplast fusion, lipofection, cell microinjection, and viral vectors.

[0110] Vectors can be used to target essentially any desired target cell. For example, stereotactic injection can be used to direct vectors (e.g., adenovirus, HSV) to the desired location. In addition, particles can be delivered by intracerebroventricular (icv) injection using a minipump infusion system (e.g., SynchroMed Infusion System). A method based on bulk flow, called convection, has also proven effective in delivering large molecules to widespread areas of the brain and can be useful in delivering vectors to target cells. (See Bobo et al., Proc. Natl. Acad. Sci. USA 91:2076-2080 (1994); Morrison et al., Am. J. Physiol. 266:292-305 (1994)). Other methods that can be used include catheter, intravenous, parenteral, intraperitoneal and subcutaneous injection, as well as oral or other known routes of administration.

[0111] These vectors can be used to express large amounts of antibodies that can be used in a variety of ways, for example to detect the presence of PD-1 in a sample. Antibodies can also be used to attempt to bind and destroy PD-1 activity.

[0112] Techniques can be adapted for the production of single chain antibodies specific for the antigenic proteins of the present invention (see, e.g., U.S. Pat. No. 4,946,778). In addition, methods can be used to produce monoclonal antibodies with the desired specificity for the protein or derivatives, fragments, analogs or homologs thereof. ab To allow for rapid and effective identification of fragments, ab Methods can be adapted for the construction of expression libraries (see, e.g., Huse, et al, 1989 Science 246:1275-1281). Antibody fragments containing the idiotype to a protein antigen can be prepared by (i) F-antibody fragments produced by pepsin digestion of the antibody molecule. (ab ' )2 Fragment;(ii)F (ab ' )2 F produced by reducing the disulfide bridges of the fragment ab (iii) F fragments produced by treating antibody molecules with papain and reducing agents. ab fragments, and (iv) F v These fragments can be produced by techniques known in the art, including but not limited to.

[0113] Heteroconjugate antibodies are also within the scope of the present invention. Heteroconjugate antibodies are composed of two covalently linked antibodies. Such antibodies can, for example, target immune system cells to unwanted cells (see U.S. Pat. No. 4,676,980) and can be for the treatment of HIV infection (see PCT Publication Nos. WO91 / 00360; WO92 / 20373). Antibodies can be prepared in vitro using known methods in synthetic protein chemistry, including those involving cross-linking agents. For example, immunotoxins can be constructed using disulfide exchange reactions or by forming thioether bonds. Examples of suitable reagents for this purpose include iminothiolate and methyl-4-mercaptobutyrimidate, and those disclosed, for example, in U.S. Pat. No. 4,676,980.

[0114] The antibody of the present invention can be modified with respect to effector function, for example, to enhance the effectiveness of the antibody in treating cancer. For example, cysteine ​​residues can be introduced into the Fc region, allowing the formation of interchain disulfide bonds in this region. The homodimeric antibody thus generated can have improved internalization capability and / or increased complement-mediated cell killing and antibody-dependent cellular cytotoxicity (ADCC). (See Caron et al., J. Exp Med., 176:1191-1195 (1992) and Shopes, J. Immunol., 148:2918-2922 (1992)). Alternatively, an antibody can be engineered with dual Fc regions, thereby having enhanced complement lysis and ADCC capabilities. (See Stevenson et al., Anti-Cancer Drug Design, 3:219-230 (1989)).

[0115] In certain embodiments, the antibodies of the present invention may include Fc variants that contain amino acid substitutions that modify the antigen-independent effector functions of the antibody, in particular the circulating half-life of the antibody. Such antibodies, when compared to antibodies lacking these substitutions, exhibit increased or decreased binding to FcRn, and therefore increased or decreased half-life in serum, respectively. Fc variants with improved affinity for FcRn are expected to have longer serum half-lives, and such molecules have useful applications in methods of treating mammals where a long half-life of the administered antibody is desired, for example, to treat chronic diseases or disorders. In contrast, Fc variants with reduced FcRn binding affinity are expected to have shorter resting periods, and such molecules may also be useful, for example, for administration to mammals where a shortened circulation time may be advantageous, for example, in in vivo imaging, or in situations where the starting antibody has toxic side effects if present in the circulation for an extended period of time. Fc variants with reduced FcRn binding affinity are also useful in treating diseases or disorders in pregnant women, as they are less likely to cross the placenta. Additionally, other applications in which reduced FcRn binding affinity may be desirable include applications in which localization to the brain, kidney, and / or liver is desired. In one embodiment, Fc variant-containing antibodies may exhibit reduced transport across the epithelium of the renal glomerulus from the vasculature. In another embodiment, Fc variant-containing antibodies may exhibit reduced transport across the blood-brain barrier (BBB) ​​from the brain to the vascular space. In one embodiment, an antibody with altered FcRn binding comprises an Fc domain with one or more amino acid substitutions in the "FcRn binding loop" of the Fc domain. The FcRn binding loop is composed of amino acid residues 280-299 (according to EU numbering). Exemplary amino acid substitutions with altered FcRn binding activity are disclosed in PCT Publication WO05 / 047327, which is incorporated herein by reference. In certain exemplary embodiments, an antibody or fragment thereof of the invention comprises an Fc domain having one or more of the following substitutions: V284E, H285E, N286D, K290E and S304D (EU numbering).

[0116] In some embodiments, a mutation is introduced into the constant region of the mAb so that the antibody-dependent cell-mediated cytotoxicity (ADCC) activity of the mAb is modified. For example, the mutation is a LALA mutation in the CH2 domain. In one embodiment, the antibody (e.g., a human mAb or a bispecific Ab) contains a mutation on one scFv unit of the heterodimeric mAb that reduces ADCC activity. In another embodiment, the mAb contains a mutation on both chains of the heterodimeric mAb that completely eliminates ADCC activity. For example, the mutation introduced into one or both scFv units of the mAb is a LALA mutation in the CH2 domain. These mAbs with variable ADCC activity can be optimized so that the mAb shows maximum selective killing against cells expressing one antigen recognized by the mAb, but minimum killing against a second antigen recognized by the mAb.

[0117] In other embodiments, the antibodies of the invention for use in the diagnostic and therapeutic methods described herein comprise constant regions that can be modified to reduce or eliminate glycosylation, e.g., IgG 1 or IgG 4 The antibody of the present invention has a heavy chain constant region. For example, the antibody of the present invention may also include an Fc variant comprising an amino acid substitution that alters the glycosylation of the antibody. For example, the Fc variant may have reduced glycosylation (e.g., N- or O-linked glycosylation). In some embodiments, the Fc variant comprises reduced glycosylation of the N-linked glycan normally found at amino acid position 297 (EU numbering). In another embodiment, the antibody has an amino acid substitution near or within a glycosylation motif, e.g., an N-linked glycosylation motif comprising the amino acid sequence NXT or NXS. In a particular embodiment, the antibody comprises an Fc variant having an amino acid substitution at amino acid position 228 or 299 (EU numbering). In a more particular embodiment, the antibody comprises an IgG1 or IgG4 constant region comprising S228P and T299A mutations (EU numbering).

[0118] Exemplary amino acid substitutions that confer reduced or altered glycosylation are described in PCT Publication WO05 / 018572, which is incorporated herein by reference in its entirety. In some embodiments, the antibodies or fragments thereof of the present invention are altered to eliminate glycosylation. Such antibodies or fragments thereof may be referred to as "agly" antibodies or fragments thereof (e.g., "agly" antibodies). Without wishing to be bound by theory, "agly" antibodies or fragments thereof may have improved safety and stability profiles in vivo. Exemplary agly antibodies or fragments thereof are IgG antibodies that lack Fc-effector functions. 4 The antibody comprises a non-glycosylated Fc region, thus eliminating the possibility of Fc-mediated toxicity to normal vital tissues and cells expressing PD-1. In yet another embodiment, the antibody or fragment thereof of the present invention comprises modified glycan. For example, the antibody has a reduced number of fucose residues on the N-glycan at Asn297 of the Fc region, i.e., is defucosylated. In another embodiment, the antibody can have a modified number of sialic acid residues on the N-glycan at Asn297 of the Fc region.

[0119] The present invention is also directed to immunoconjugates comprising an antibody conjugated to a cytotoxic agent, such as a toxin (e.g., an enzymatically active toxin of bacterial, fungal, plant, or animal origin, or a fragment thereof), or a radioactive isotope (i.e., a radioconjugate).

[0120] Enzymatically active toxins and fragments thereof that can be used include diphtheria A chain, nonbinding active fragments of diphtheria toxin, exotoxin A chain (from Pseudomonas aeruginosa), ricin A chain, abrin A chain, modeccin A chain, α-sarcin, Aleurites fordii protein, dianthin protein, Phytolaca americana proteins (PAPI, PAPII, and PAP-S), momordica charantia inhibitor, curcin, crotin, sapaonaria officinalis inhibitor, gelonin, mitgellin, restrictocin, phenomycin, enomycin, and the trichothecenes. A variety of radionuclides are available for the production of radioconjugated antibodies. Non-limiting examples include: 212 Bi, 131 I, 131 In, 90 Y, and 186 Re is an example.

[0121] Conjugates of antibodies and cytotoxic drugs are made using a variety of bifunctional protein coupling agents, such as N-succinimidyl-3-(2-pyridyldithiol)propionate (SPDP), iminothiolane (IT), bifunctional derivatives of imidoesters (such as dimethyl adipimidate HCL), active esters (such as disuccinimidyl suberate), aldehydes (such as glutaraldehyde), bis-azido compounds (such as bis(p-azidobenzoyl)hexanediamine), bis-diazonium derivatives (such as bis-(p-diazoniumbenzoyl)ethylenediamine), diisocyanates (such as trimethylene 2,6-diisocyanate), and bis-active fluorine compounds (such as 1,5-difluoro-2,4-dinitrobenzene). For example, ricin immunotoxins can be prepared as described in Vitetta et al, Science 238:1098 (1987). Carbon-14 labeled 1-isothiocyanatobenzyl-3-methyldiethylenetriaminepentaacetic acid (MX-DTPA) is an exemplary chelating agent for attaching radionucleotides to antibodies. (See PCT Publication No. WO 94 / 11026 and U.S. Patent No. 5,736,137.)

[0122] Those skilled in the art will appreciate that a wide variety of possible moieties can be attached to a given antibody or other molecule of the invention. (See, e.g., "Conjugate Vaccines," Contributions to Microbiology and Immunology, JM Cruse and RE Lewis, Jr (eds), Carger Press, New York, (1989), incorporated herein by reference in its entirety.

[0123] Coupling can be achieved by any chemical reaction that binds two molecules together, so long as the antibody and the other moiety retain their respective activities. This binding includes many chemical mechanisms, such as covalent bonds, affinity bonds, intercalation, coordinate bonds, and complex formation. In one embodiment, the binding is a covalent bond. Covalent binding can be achieved either by direct condensation of existing side chains or by incorporating an external crosslinking molecule. Many bivalent or polyvalent linking agents are useful in coupling protein molecules (e.g., antibodies of the present invention) to other molecules. For example, representative coupling agents include organic compounds (e.g., thioesters, carbodiimides, succinimide esters, diisocyanates, glutaraldehyde, diazobenzene, and hexamethylenediamine). This list is not intended to be exhaustive of the various classes of coupling agents known in the art, but rather is illustrative of the more common coupling agents. (See Killen and Lindstrom, Jour. Immun. 133:1335-2549 (1984); Jansen et al., Immunological Reviews 62:185-216 (1982); and Vitetta et al., Science 238:1098 (1987)). Non-limiting examples of linkers are described in the literature. (See, for example, Ramakrishnan, S. et al., Cancer Res. 44:201-208 (1984), which describes the use of MBS (M-maleimidobenzoyl-N-hydroxysuccinimide ester). See also U.S. Pat. No. 5,030,719, which describes the use of halogenated acetylhydrazide derivatives coupled to antibodies via oligopeptide linkers.Non-limiting examples of useful linkers that can be used with the antibodies of the invention include: (i) EDC (1-ethyl-3-(3-dimethylamino-propyl) carbodiimide hydrochloride; (ii) SMPT (4-succinimidyloxycarbonyl-α-methyl-α-(2-pyridyl-dithio)-toluene (Pierce Chem. Co., Catalog No. 21558G); (iii) SPDP (succinimidyl-6[3-(2-pyridyldithio)propionamido]hexanoate (Pierce Chem. Co., Catalog No. 21651G); (iv) sulfo-LC-SPDP (sulfosuccinimidyl-6[3-(2-pyridyldithio)-propionamido]hexanoate (Pierce Chem. Co., Catalog No. 2165-G); and (v) sulfo-NHS (-hydroxysulfo-succinimide: Pierce Chem. Co., Catalog No. 2165-G) coupled to EDC. Chem. Co., catalog number 24510).

[0124] The linkers described herein contain components with different attributes, thus resulting in conjugates with different physicochemical properties. For example, sulfo-NHS esters of alkyl carboxylates are more stable than sulfo-NHS esters of aromatic carboxylates. NHS-ester-containing linkers are less soluble than sulfo-NHS esters. In addition, the linker SMPT can contain sterically hindered disulfide bonds to form conjugates with increased stability. Disulfide bonds are generally less stable than other bonds because disulfide bonds are cleaved in vitro, resulting in fewer conjugates available. Sulfo-NHS in particular can increase the stability of carbodiimide coupling. Carbodiimide coupling (such as EDC) when used with sulfo-NHS forms esters that are more resistant to hydrolysis than carbodiimide coupling reactions alone.

[0125] The antibody disclosed herein can also be formulated as immunoliposome.The liposome containing the antibody is prepared by the method known in the art, such as described in Epstein et al, Proc.Natl.Acad.Sci.USA, 82:3688(1985);Hwang et al, Proc.Natl.Acad.Sci.USA, 77:4030(1980);and in U.S. Patent No. 4,485,045 and U.S. Patent No. 4,544,545.Liposome with enhanced circulation time is disclosed in U.S. Patent No. 5,013,556.

[0126] A non-limiting example of a useful liposome can be generated by the reverse phase evaporation method using a lipid composition comprising phosphatidylcholine, cholesterol, and PEG-derivatized phosphatidylethanolamine (PEG-PE). Liposomes are extruded through filters of defined pore size to generate liposomes with the desired diameter. The Fab' fragment of the antibody of the present invention can be bound to liposomes via a disulfide exchange reaction as described in Martin et al, J.Biol.Chem.,257:286-288 (1982).

[0127] bispecific antibody A bispecific antibody (bsAb) is an antibody that contains two variable domains or scFv units, and the resulting antibody recognizes two different antigens. The present invention provides a bispecific antibody that recognizes PD-1 and a second antigen. Exemplary second antigens include tumor-associated antigens (e.g., LINGO1), cytokines, and cell surface receptors. Non-limiting examples of second antigens include CTLA-4, LAG-3, CD28, CD122, 4-1BB, TIM3, OX-40, OX40L, CD40, CD40L, LIGHT, ICOS, ICOSL, GITR, GITRL, TIGIT, CD27, VISTA, B7H3, B7H4, HEVM (or BTLA), CD47, and CD73. Different types of bispecific antibodies are also provided herein. In some embodiments, each of the anti-PD1 fragment and the second fragment is independently selected from a Fab fragment, a single chain variable fragment (scFv), or a single domain antibody. In some embodiments, the bispecific antibody further comprises an Fc fragment. The bispecific antibody of the invention comprises a heavy and light chain combination or scFv of the PD-1 antibodies disclosed herein.

[0128] The bispecific antibodies of the present invention can be constructed using methods known in the art. In some embodiments, the bispecific antibodies are single polypeptides in which two scFv fragments are linked by a long linker polypeptide that is long enough to allow intramolecular association between the two scFv units to form an antibody. In other embodiments, the bispecific antibodies are two or more polypeptides that are linked by covalent or non-covalent bonds.

[0129] In another embodiment, bispecific antibodies are constructed using the "knobs-into-holes" method (Ridgway et al., Protein Eng 7:617-621 (1996)). In this method, Ig heavy chains of two different variable domains are reduced to selectively disrupt heavy chain pairing while preserving heavy chain-light chain pairing. Two heavy chain-light chain heterodimers that recognize two different antigens are mixed to promote heteroligation pairing mediated through engineered "knobs-into-holes" in the CH3 domain.

[0130] In another embodiment, bispecific antibodies can be constructed by exchanging heavy-light chain dimers from two or more different antibodies to generate a hybrid antibody, where a first heavy-light chain dimer recognizes PD-1 and a second heavy-light chain dimer recognizes a second antigen. The heavy-light chain dimer mechanism is similar to that of human IgG, which also functions as a bispecific molecule. 4 The dimerization of IgG heavy chains is driven by intramolecular forces such as pairing of the CH3 domain of each heavy chain with a disulfide bridge. The presence of a specific amino acid (R409) in the CH3 domain is essential for dimer exchange and the formation of IgG 4 It has been shown that heavy chain pairing is further stabilized by inter-heavy chain disulfide bridges in the hinge region of the antibody. 4 In the hinge region, the amino acid sequence Cys-Pro-Ser-Cys is included at amino acids 226-230 (compared to the stable IgG1 hinge region which contains the sequence Cys-Pro-Pro-Cys). This sequence difference at serine 229 is the IgG 4 is associated with the tendency to form intrachain disulfides in the hinge region (Van der Neut Kolfschoten, M. et al., 2007, Science 317:1554-1557 and Labrijn, AF et al., 2011, Journal of Immunol 187:3238-3246).

[0131] Thus, a bispecific antibody of the present invention can be made by introduction of the R409 residue in the CH3 domain and a Cys-Pro-Ser-Cys sequence in the hinge region of an antibody that recognizes PD-1 or a second antigen, resulting in an exchange of heavy-light chain dimers to generate an antibody molecule with one heavy-light chain dimer that recognizes PD-1 and a second heavy-light chain dimer that recognizes the second antigen (wherein the second antigen is any antigen disclosed herein). 4 The molecules can also be engineered such that the heavy and light chains recognize PD-1 or a second antigen, as disclosed herein. Use of this method to construct bispecific antibodies of the invention can be accomplished using IgG 4 This may be beneficial due to the unique characteristics of the molecule, where the Fc region differs from other IgG subtypes in that it interacts little with the effector systems of the immune response (e.g., complement and Fc receptors expressed by certain white blood cells). 4 Bispecific antibodies based on IgG1 are attractive for therapeutic applications in which the antibody must bind to a target and functionally alter a signaling pathway associated with the target, but do not induce effector activity.

[0132] In some embodiments, a mutation is introduced into the constant region of the bsAb so that the antibody-dependent cell-mediated cytotoxicity (ADCC) activity of the bsAb is modified. For example, the mutation is a LALA mutation in the CH2 domain. In one aspect, the bsAb contains a mutation on one scFv unit of the heterodimeric bsAb that reduces ADCC activity. In another aspect, the bsAb contains a mutation on both chains of the heterodimeric bsAb that completely removes ADCC activity. For example, the mutation introduced into one or both scFv units of the bsAb is a LALA mutation in the CH2 domain. These bsAbs with variable ADCC activity can be optimized so that the bsAb shows the most selective killing against cells expressing one antigen recognized by the bsAb, but the least killing against a second antigen recognized by the bsAb.

[0133] The bispecific antibodies disclosed herein may be useful in the treatment of chronic infections, diseases, or medical conditions, such as cancer.

[0134] Use of antibodies against PD-1 The antibodies of the present invention that specifically bind to PD-1 protein or fragments thereof can be administered for the treatment of PD-1-associated diseases or disorders. "PD-1-associated diseases or disorders" include disease states and / or symptoms associated with disease states in which there is an increase in the level of PD-1 and / or activation of cell signaling pathways involving PD-1. Exemplary PD-1-associated diseases or disorders include, but are not limited to, diseases in which T cells are suppressed, such as cancer and infectious diseases. In some embodiments, the infectious disease may be caused by a microorganism, such as a DNA virus, an RNA virus, or a reverse transcription virus. Non-limiting examples of viruses include adenovirus, coxsackievirus, Epstein-Barr virus, hepatitis A virus, hepatitis B virus, hepatitis C virus, herpes simplex virus type 1, herpes simplex virus type 2, cytomegalovirus, human herpes virus type 8, HIV, influenza virus, measles virus, mumps virus, human papillomavirus, parainfluenza virus, poliovirus, rabies virus, respiratory syncytial virus, rubella virus, varicella zoster virus. In some embodiments, the infectious disease may be caused by a microorganism, such as a gram-positive bacterium, a gram-negative bacterium, a protozoan, or a fungus.

[0135] Non-limiting examples of disease-causing bacteria include Bacillus anthracis, Bacillus cereus, Bartonella henselae, Bartonella Quintana, Bordetella pertussis, Borrelia burgdorferi, Borrelia garinii, Borrelia afzelii, Borrelia recurrentis, Brucella abortus, Brucella canis, Brucella melitensis, Brucella suis, Campylobacter jejuni, and the like. jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Chlamydophila psittaci, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Clostridium tetani, Corynebacterium diphtheria, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Francisella tularensis, Haemophilus influenzae influenza, Helicobacter pylori, Legionella pneumophila, Leptospira interrogansinterrogans, Leptospira santarosai, Leptospira weilii, Leptospira noguchii, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Mycobacterium ulcerans, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitides, Pseudomonas aeruginosa, Rickettsia rickettsia, Salmonella typhi, Salmonella typhimurium, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus saprophyticus, Streptococcus agalactiae, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholera, Yersinia pestis, Yersinia enterocolitica enterocolitica, and Yersinia pseudotuberculosis.

[0136] Non-limiting examples of disease-causing protozoa include Plasmodium falciparum (malaria), Toxoplasma gondii (toxoplasmosis), Leishmania species (leishmaniasis), Trypanosoma brucei (African sleeping sickness), Trypanosoma cruzi (Chagas disease), and Giardia intestinalis (giardiasis).

[0137] Non-limiting examples of disease-causing fungi include Candida albicans, Aspergillus fumigatus, Aspergillus flavus, Cryptococcus neoformans, Cryptococcus gattii, Histoplasma capsulatum, Pneumocystis carinii, and Stachybotrys chartarum.

[0138] The antibodies of the present invention, including bispecific, polyclonal, monoclonal, humanized and fully human antibodies, can be used as therapeutic agents. Such agents are generally used to treat cancer in subjects, to increase the efficiency of vaccines, or to enhance natural immune responses. Antibody preparations (e.g., those with high specificity and high affinity for their target antigens) are administered to subjects and generally have an effect due to binding with the target. Administration of antibodies can disable, inhibit or interfere with the activity of PD-1 protein.

[0139] The antibody of the present invention that specifically binds to PD-1 protein or a fragment thereof can be administered for the treatment of cancer in the form of a pharmaceutical composition. Principles and considerations related to the preparation of therapeutic pharmaceutical compositions containing antibodies, as well as guidance on the selection of ingredients, are provided, for example, in Remington: The Science And Practice Of Pharmacy 20th ed. (Alfonso R. Gennaro, et al., editors). Mack Pub. Co., Easton, Pa., 2000; Drug Absorption Enhancement: Concepts, Possibilities, Limitations, And Trends, Harwood Academic Publishers, Langhorne, Pa., 1994; and Peptide And Protein Drug Delivery (Advances In Parenteral Sciences, Vol. 4), 1991, M. Dekker, New York.

[0140] The specific dosage and treatment regimen for any particular patient depends on various factors, such as the specific antibody, its variant or derivative used, the patient's age, weight, general health, sex, and diet, as well as administration time, excretion rate, drug combination, and the severity of the particular disease being treated.The judgment of such factors by medical caregivers is within the scope of those skilled in the art.This amount also depends on the individual patient being treated, the administration route, the type of formulation, the characteristics of the compound being used, the severity of the disease, and the desired effect.The amount used can be determined by pharmacological and pharmacokinetic principles well known in the art.

[0141] A therapeutically effective amount of an antibody of the invention may be the amount necessary to achieve a therapeutic goal. As described herein, this may be a binding interaction between an antibody and its target antigen, which in certain cases interferes with the function of the target. The amount required to be administered further depends on the binding affinity of the antibody for its specific antigen, and also on the rate at which the administered antibody is depleted from the free volume of the other subject to which it is administered. The dosage administered to a subject (e.g., a patient) of an antigen-binding polypeptide described herein is typically 0.1 mg / kg to 100 mg / kg of the patient's body weight, 0.1 mg / kg to 20 mg / kg of the patient's body weight, or 1 mg / kg to 10 mg / kg of the patient's body weight. Human antibodies have a longer half-life in the human body than antibodies from other species due to the immune response to the foreign polypeptide. Thus, lower dosages and less frequent administration of human antibodies are often possible. Additionally, the dosage and frequency of administration of the antibodies of the present disclosure may be reduced by enhancing antibody uptake and tissue penetration (e.g., into the brain) by modifications such as, for example, lipidation. A typical therapeutically effective dose range for the antibody or antibody fragment of the present invention may be, by way of non-limiting example, about 0.1 mg / kg (body weight) to about 50 mg / kg (body weight). Typical administration frequency may range, for example, from twice a day to once a week.

[0142] When an antibody fragment is used, the smallest inhibitory fragment that specifically binds to the binding domain of the target protein is preferred. For example, peptide molecules that retain the ability to bind to the target protein sequence can be designed based on the variable region sequence of the antibody. Such peptides can be chemically synthesized and / or produced by recombinant DNA technology. (See, for example, Marasco et al., Proc. Natl. Acad. Sci. USA, 90:7889-7893 (1993)). The formulation can also contain more than one active compound as necessary for the particular indication being treated, for example, those with complementary activities that do not adversely affect each other. Alternatively, or in addition, the composition can include an agent that enhances its function, such as a cytotoxic agent, a cytokine (e.g., IL-15), a chemotherapeutic agent or a growth inhibitory agent. Such molecules are suitably present in combination in an amount effective for the intended purpose.

[0143] The active ingredient can also be encapsulated in microcapsules prepared, for example, by coacervation techniques or interfacial polymerization (e.g., hydroxymethylcellulose or gelatin-microcapsules and poly-(methyl methacrylate) microcapsules, respectively), in colloidal drug delivery systems (e.g., liposomes, albumin microspheres, microemulsions, nanoparticles, and nanocapsules), or in macroemulsions.

[0144] Formulations to be used for in vivo administration must be sterile, which is readily accomplished by filtration through sterile filtration membranes.

[0145] Sustained release preparations can be prepared. Suitable examples of sustained release preparations include semipermeable matrices of solid hydrophobic polymers containing antibodies, which matrices are in the form of shaped articles, such as films or microcapsules. Examples of sustained release matrices include polyesters, hydrogels (such as poly(2-hydroxyethyl-methacrylate) or poly(vinyl alcohol)), polylactides (U.S. Pat. No. 3,773,919), copolymers of L-glutamic acid and gamma-ethyl-L-glutamate, non-degradable ethylene-vinyl acetate, degradable lactic acid-glycolic acid copolymers, such as LUPRON DEPOT™ (injectable microspheres composed of lactic acid-glycolic acid copolymers and leuprolide acetate), and poly-D-(-)-3-hydroxybutyric acid. Polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid allow the release of molecules for over 100 days, while certain hydrogels release proteins for shorter periods of time.

[0146] The antibodies according to the present invention can be used as agents for detecting the presence of PD-1 (or a protein fragment thereof) in a sample. For example, the antibodies can contain a detectable label. The antibodies can be polyclonal or monoclonal. An intact antibody or a fragment thereof (e.g., F ab , scFv, or F (ab)2) may be used. With respect to a probe or antibody, the term "labeled" may encompass direct labeling of the probe or antibody by coupling (i.e., physically binding) a detectable substance to the probe or antibody, as well as indirect labeling of the probe or antibody by reactivity with another reagent that is directly labeled. Examples of indirect labeling include detection of a primary antibody using a fluorescently labeled secondary antibody, and end-labeling of a DNA probe with biotin, such that it can be detected with fluorescently labeled streptavidin. The term "biological sample" may include tissues, cells, and fluids isolated from a subject, as well as tissues, cells, and fluids present within a subject. Thus, included in the use of the term "biological sample" are blood and fractions or components of blood, such as serum, plasma, or lymph. That is, the detection method of the present invention may be used to detect analyte mRNA, protein, or genomic DNA in a biological sample in vitro and in vivo. For example, in vitro techniques for detection of analyte mRNA include Northern hybridization and in situ hybridization. In vitro techniques for detection of an analyte protein include enzyme linked immunosorbent assays (ELISAs), Western blots, immunoprecipitations, and immunofluorescence. In vitro techniques for detection of an analyte genomic DNA include Southern hybridizations.

[0147] Procedures for performing immunoassays are described, for example, in "ELISA: Theory and Practice: Methods in Molecular Biology", Vol. 42, J.R.Crowther (Ed.) Human Press, Totowa, NJ, 1995; "Immunoassay", E. Diamandis and T. Christopoulus, Academic Press, Inc., San Diego, CA, 1996; and "Practice and Theory of Enzyme Immunoassays", P. Tijssen, Elsevier Science Publishers, Amsterdam, 1985. Additionally, in vivo techniques for detecting analyte proteins include introducing a labeled anti-analyte protein antibody into a subject. For example, the antibody can be labeled with a radioactive marker whose presence and location in the subject can be detected by standard imaging techniques.

[0148] Antibodies to the PD-1 protein (or fragments thereof) can be used in methods known in the art for localizing and / or quantitating PD-1 protein (e.g., for use in measuring levels of PD-1 protein in an appropriate physiological sample, for use in diagnostic methods, for use in protein imaging, etc.). In certain embodiments, antibodies specific for the PD-1 protein, or derivatives, fragments, analogs or homologs thereof, including antibody-derived antigen-binding domains, are utilized as pharmacologically active compounds (referred to herein as "therapeutic agents").

[0149] Antibodies of the invention specific for the PD-1 protein can be used to isolate PD-1 polypeptides by standard techniques, such as immunoaffinity, chromatography, or immunoprecipitation. Antibodies to the PD-1 protein (or fragments thereof) can be used diagnostically to monitor protein levels in tissues as part of a clinical trial procedure, for example, to determine the efficacy of a given therapeutic regimen.

[0150] Detection can be facilitated by coupling (i.e., physically linking) the antibody to a detectable substance. Examples of detectable substances include, but are not limited to, various enzymes, prosthetic groups, fluorescent substances, luminescent substances, bioluminescent substances, and radioactive substances. Non-limiting examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin / biotin and avidin / biotin; examples of suitable fluorescent substances include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride, or phycoerythrin; examples of luminescent substances include luminol; examples of bioluminescent substances include luciferase, luciferin, and aequorin, and examples of suitable radioactive substances include, 125 I, 131 I, 35 S, 32 P, or 3 Examples include H.

[0151] The antibody or agent of the present invention (also referred to herein as "active compound"), as well as its derivatives, fragments, analogs and homologs, can be incorporated into pharmaceutical compositions suitable for administration. Such pharmaceutical compositions can include the antibody or agent and a pharmaceutically acceptable carrier. As used herein, the term "pharmaceutically acceptable carrier" can include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Suitable carriers are described in the latest edition of Remington's Pharmaceutical Sciences, a standard reference text in the art, which is incorporated herein by reference. Non-limiting examples of such carriers or diluents include water, saline, Ringer's solution, dextrose solution, and 5% human serum albumin. Non-aqueous vehicles such as liposomes and fixed oils can also be used. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, its use in the composition is contemplated. Supplementary active compounds can also be incorporated into the composition.

[0152] The pharmaceutical composition of the present invention can be formulated to suit its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (i.e., topical), transmucosal, and rectal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can contain the following components: a sterile diluent (e.g., water for injection, saline, fixed oils, polyethylene glycol, glycerin, propylene glycol, or other synthetic solvents); antibacterial agents (e.g., benzyl alcohol or methylparaben); antioxidants (e.g., ascorbic acid or sodium bisulfite); chelating agents (e.g., ethylenediaminetetraacetic acid (EDTA)); buffers (e.g., acetates, citrates, or phosphates), and agents for adjusting tonicity (e.g., sodium chloride or dextrose). The pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. Parenteral preparations can be enclosed in ampoules, disposable syringes, or multiple dose vials made of glass or plastic.

[0153] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions, and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, NJ), or phosphate buffered saline (PBS). In embodiments, the composition is sterile and fluid to the extent that easy syringability exists. It may be stable under the conditions of manufacture and storage and may be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier may be, for example, a solvent or dispersion medium containing water, ethanol, a polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. The carrier may be, for example, a solvent or dispersion medium containing water, ethanol, a polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. Proper fluidity may be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. Prevention of microbial action can be achieved by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, etc. In many cases, it may be useful to include isotonic agents, such as sugars, polyalcohols such as mannitol, sorbitol, sodium chloride, etc. Prolonged absorption of injectable compositions can be achieved by including agents that delay absorption, such as aluminum monostearate and gelatin, in the composition.

[0154] Sterile injectable solution can be prepared by incorporating the required amount of active compound into a suitable solvent with one or combination of the above-listed components as required, followed by filtration sterilization.For example, dispersion is prepared by incorporating active compound into a sterile vehicle that contains basic dispersion medium and other components required from the above-listed ones.For the preparation of sterile injectable solution, the preparation method is vacuum drying and freeze-drying, which produces powder of active ingredient and any additional desired components from the solution that has been previously sterile filtered.

[0155] Oral compositions include inert diluents or edible carriers. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, active compounds can be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, where the compound in the fluid carrier is applied orally and rolled in the mouth and expectorated or swallowed. Pharmaceutically compatible binding agents and / or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like may contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate or orange flavoring.

[0156] For administration by inhalation, the compounds are delivered in the form of an aerosol spray from pressured container or dispenser which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer.

[0157] Systemic administration can also be by transmucosal or transdermal means.For transmucosal or transdermal administration, a penetrant suitable for the barrier to be permeated is used in the formulation.Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives.Transmucosal administration can be achieved through the use of nasal sprays or suppositories.For transdermal administration, active compound is formulated into ointments, salves, gels, or creams generally known in the art.

[0158] The compounds can also be prepared in the form of suppositories (eg, with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.

[0159] In one embodiment, the active compound is prepared with a carrier that protects the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters and polylactic acid, can be used. Methods for preparing such formulations are clear to those skilled in the art. Materials are also commercially available from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions, including liposomes targeted to infected cells with monoclonal antibodies against viral antigens, can also be used as pharma-ceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.

[0160] Oral or parenteral compositions can be formulated in dosage unit form for ease of administration and uniformity of dosage.Dosage unit form as used herein refers to a physically separate unit suitable as a unitary dosage for the subject to be treated, each unit containing a predetermined amount of active compound calculated to produce a desired therapeutic effect in association with the required pharmaceutical carrier.The specification of the dosage unit form of the present invention is determined and directly depends on the inherent characteristics of the active compound and the specific therapeutic effect to be achieved, as well as the inherent limitations of the technical field of compounding such active compound for the treatment of individuals.

[0161] The pharmaceutical compositions can be included in a container, pack, or dispenser together with instructions for administration.

[0162] treatment As used herein, the term "treatment" or "treatment" refers to both therapeutic treatment and prophylactic or preventative measures, the purpose of which is to prevent or slow down (alleviate) undesirable physiological changes or disorders, such as the progression of cancer. Beneficial or desired clinical outcomes include, but are not limited to, alleviation of symptoms, whether detectable or undetectable, reduction in the extent of disease, a stable (i.e., not worsening) state of disease, delay or slowing of disease progression, improvement or alleviation of disease symptoms, and remission (partial or total). "Treatment" refers to prolonging survival compared to expected survival in the absence of treatment. Those in need of treatment include those already with the condition or disorder, as well as those prone to have the condition or disorder, or those in whom the condition or disorder is to be prevented.

[0163] The present invention provides both preventative and therapeutic methods of treating subjects at risk for (or susceptible to) cancer (e.g., when early detection cancer biomarkers are identified in such subjects) or other cell proliferation-related diseases or disorders. Such diseases or disorders include, but are not limited to, diseases or disorders associated with, for example, aberrant expression of PD-1. For example, these methods are used to treat, prevent, or alleviate symptoms of cancer. In one embodiment, the method is used to treat, prevent, or alleviate symptoms of solid tumors. Non-limiting examples of other tumors that can be treated by the embodiments herein include lung, ovarian, prostate, colon, cervical, brain, skin, liver, pancreatic, or gastric cancer. In addition, the methods of the present invention can be used to treat blood cancers, such as leukemia and lymphoma. Alternatively, these methods can be used to treat, prevent, or alleviate symptoms of metastasized cancers. For example, cancers that can be treated or prevented or ameliorated include B-cell chronic lymphocytic leukemia (CLL), non-small cell lung cancer, melanoma, ovarian cancer, lymphoma, or renal cell carcinoma.Cancers that can also be treated or prevented or ameliorated include solid tumors with high mutational burden and WBC in the filtrate. Cancers that can be treated or prevented, or whose symptoms can be alleviated, include cancers in which signals in the PD-1 / PD-L1 axis are modulated, including, but not limited to, breast cancer, lung cancer (e.g., non-small cell lung cancer or lung adenocarcinoma), gastric cancer, colorectal cancer, bladder cancer, pancreatic cancer, prostate cancer, esophageal squamous cell carcinoma, nasopharyngeal carcinoma, and liquid tumors in which the PD1 / PDL1 axis is active (e.g., diffuse large B-cell lymphoma (DLBCL) and B-cell chronic lymphocytic leukemia (B-CLL)) (see, e.g., Han et al., PD-1 / PD-L1 pathway: current researches in cancer, Am J Cancer Res 2020;10(3):727-742).

[0164] Thus, in one aspect, the invention provides a method for preventing, treating or alleviating a symptom of cancer or a cell proliferative disease or disorder in a subject by administering to the subject a monoclonal antibody, scFv antibody or bispecific antibody of the invention. For example, an anti-PD-1 antibody can be administered in a therapeutically effective amount.

[0165] Subjects at risk for cancer or cell proliferation-related diseases or disorders can include patients with a family history of cancer or subjects who have been exposed to a known or suspected cause of cancer. Administration of a prophylactic agent can occur prior to the manifestation of cancer, such that the disease is prevented or its progression is delayed.

[0166] In another embodiment, the proliferation of tumor cells is inhibited by contacting the cells with an anti-PD-1 antibody of the invention. The cells can be any cell that expresses PD-1.

[0167] The present invention further provides both preventive and therapeutic methods of treating subjects at risk (or susceptible) of chronic or acute viral, bacterial or parasitic infection. The present invention also provides treatment methods for both preventive and therapeutic methods of treating subjects at risk of disease or disorder or condition associated with T cell exhaustion or at risk of developing T cell exhaustion. The present invention also provides treatment methods for both preventive and therapeutic methods of treating subjects at risk of disease or disorder or condition associated with T cell exhaustion or at risk of developing T cell exhaustion. Such diseases or disorders include, but are not limited to, HIV, AIDS, and chronic or acute bacterial, viral or parasitic infection. For example, other such chronic infections include those caused by, for example, Hepatitis B virus (HBV), Hepatitis C virus (HCV), Herpes simplex virus type 1 (HSV-1), H. pylori, or Toxoplasma gondii. Other acute infections include those caused by microorganisms such as gram-positive bacteria, gram-negative bacteria, protozoa, or fungi, for example, as described herein.

[0168] The present invention also includes a method of increasing or enhancing the immune response to an antigen. The immune response is increased or enhanced by administering the monoclonal antibody, scFv antibody, or bispecific antibody of the present invention to a subject. The immune response is enhanced, for example, by enhancing antigen-specific T effector function. The antigen is a viral (e.g., HIV), bacterial, parasitic, or tumor antigen. The immune response is an innate immune response. By innate immune response is meant an immune response that is the result of infection. The infection is a chronic infection. The increase or enhancement of the immune response to an antigen can be measured by many methods known in the art. For example, the immune response can be measured by measuring any one of T cell activity, T cell proliferation, T cell activation, production of effector cytokines, and T cell transcriptional profile. Alternatively, the immune response is a response induced by vaccination.

[0169] Thus, in another aspect, the present invention provides a method for enhancing vaccine efficiency by administering to a subject the monoclonal or scFv antibody and vaccine of the present invention. The antibody and vaccine are administered sequentially or simultaneously. The vaccine is a tumor vaccine, a bacterial vaccine or a viral vaccine.

[0170] Combination Method The compositions of the present invention described herein can be administered in combination with chemotherapeutic agents. Chemotherapeutic agents that may be administered with the compositions of the present disclosure include, but are not limited to, antibiotic derivatives (e.g., doxorubicin, bleomycin, daunorubicin, and dactinomycin); antiestrogens (e.g., tamoxifen); antimetabolites (e.g., fluorouracil, 5-FU, methotrexate, floxuridine, interferon alpha-2b, glutamic acid, plicamycin, mercaptopurine, and 6-thioguanine); cytotoxic agents (e.g., carmustine, BCNU, lomustine, CCNU, cytosine arabinoside, cyclophosphamide, estramustine, hydroxyurea, procarbazine, mitomycin, busulfan, cis-platinum ... and vincristine sulfate); hormones (e.g., medroxyprogesterone, estramustine sodium phosphate, ethinyl estradiol, estradiol, megestrol acetate, methyltestosterone, diethylstilbestrol diphosphate, chlorotrianisene, and testolactone); nitrogen mustard derivatives (e.g., mephalen, chlorambucil, mechlorethamine (nitrogen mustard) and thiotepa); steroids and combinations (e.g., betamethasone sodium phosphate); and others (e.g., dicarbazine, asparaginase, mitotane, vincristine sulfate, vinblastine sulfate, and etoposide).

[0171] In further embodiments, the compositions of the invention described herein can be administered in combination with cytokines, including, but not limited to, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-10, IL-13, IL-15, anti-CD40, CD40L, and TNF-α.

[0172] In further embodiments, the compositions described herein can be administered in combination with other therapeutic or prophylactic regimens, such as, for example, radiation therapy.

[0173] In some embodiments, the compositions described herein can be administered in combination with other immunotherapeutic agents, including, but not limited to, simtuzumab, abagovomab, adecatumumab, afutuzumab, alemtuzumab, altumomab, amatuximab, anatumomab, arcitumomab, bavituximab, bectumomab, sirolimus ... b), bevacizumab, bivatuzumab, blinatumomab, brentuximab, cantuzumab, catumaxomab, cetuximab, sitatuzumab, cixutumumab, clivatuzumab, conatumumab, daratumumab Daratumab, drozitumab, duligotumab, dusigitumab, detumomab, dacetuzumab, dalotuzumab, ecromeximab, elotuzumab, ensituximab, ertumaxomab, etaracizumab zumab, farletuzumab, ficlatuzumab, figitumumab, flanvotumab, futuximab, ganitumab, gemtuzumab, girentuximab, glembatumumab, ibritumomab, igovomab,imgatuzumab, indatuximab, inotuzumab, intetumumab, ipilimumab, iratumumab, labetuzumab, lexatumumab, lintuzumab, lorvotuzumab, lucatumumab, mapatumumab, matuzumab (matuzumab), milatuzumab, minretumomab, mitumomab, moxetumomab, narnatumab, naptumomab, necitumumab, nimotuzumab, nofetumomab, ocaratuzumab, ofatumumab, olaratumab b), onartuzumab, oportuzumab, oregovomab, panitumumab, parsatuzumab, patritumab, pemtumomab, pertuzumab, pintumomab, pritumumab, racotumomab, radretumab, rilotumumab lotumumab, rituximab, robatumumab, satumomab, sibrotuzumab, siltuximab, solitomab, tacatuzumab, taplitumomab, tenatumomab, teprotumumab, tigatuzumab, tositumomab,These include trastuzumab, tucotuzumab, ublituximab, veltuzumab, vorsetuzumab, votumumab, zalutumumab, CC49, and 3F8.

[0174] The present invention provides a method of treating cancer in a patient by administering two antibodies that bind to the same epitope of the PD-1 protein, or alternatively, two different epitopes of the PD-1 protein. Alternatively, cancer can be treated by administering a first antibody that binds to PD-1 and a second antibody that binds to a protein other than PD-1. In other embodiments, cancer can be treated by administering a bispecific antibody that binds to PD-1 and to a protein other than PD-1. For example, the protein other than PD-1 includes, but is not limited to, IL-2, IL-2R, IL-15, IL-15R, IL-7, IL-7R, IL-21, or IL-21R. For example, the protein other than PD-1 can be a tumor-associated antigen; the protein other than PD-1 can be a cytokine.

[0175] In some embodiments, the invention provides for the administration of anti-PD-1 antibodies, alone or in combination with an additional antibody that recognizes another protein other than PD-1, together with cells capable of achieving or enhancing an immune response. For example, these cells can be peripheral blood mononuclear cells (PBMCs), or any cell type found in PBMCs, such as cytotoxic T cells, macrophages, and natural killer (NK) cells.

[0176] Additionally, the present invention provides for the administration of antibodies that bind to PD-1 protein and other therapeutic agents, including anti-neoplastic agents, such as small molecules, growth factors, cytokines, or biomolecules, such as peptides, peptidomimetics, peptoids, polynucleotides, lipid-derived mediators, small biogenic amines, hormones, neuropeptides, and proteases. Small molecules include, but are not limited to, inorganic and organic small molecules. Suitable growth factors or cytokines include IL-2, GM-CSF, and TNF-α. Small molecule libraries are known in the art. (See Lam, Anticancer Drug Des., 12:145, 1997).

[0177] Chimeric antigen receptor (CAR) T cell therapy Also provided herein are cell therapies, such as chimeric antigen receptor (CAR) T cell therapy. CAR T cell therapy redirects a patient's T cells to kill tumor cells, for example, by exogenous expression of a CAR on the T cells. A CAR can be a transmembrane fusion protein that links the antigen recognition domain of an antibody to the intracellular signaling domain of a T cell receptor and co-receptor. Suitable cells capable of secreting the anti-PD-1 antibodies of the present invention (or engineered to express the anti-PD-1 antibodies as described herein so as to be secreted) can be used. The secreted anti-PD-1 "payload" can be, for example, a minibody, ScFv, an IgG molecule, a bispecific fusion molecule, and other antibody fragments as described herein.

[0178] Solid tumors provide unique challenges for CAR-T therapy. Some barriers to CAR-T efficacy in solid tumors include heterogeneous antigen expression, poor tissue homing, activation, persistence, and immunosuppressive tumor microenvironment. Unlike hematological cancers, tumor-associated target proteins are overexpressed between tumors and healthy tissues, resulting in on-target / off-tumor T cell killing of healthy tissues. Furthermore, immunosuppression in the tumor microenvironment (TME) limits the activation of CAR-T cells toward tumor killing. With such contact or manipulation, the cells can then be introduced into a cancer patient in need of treatment. The cancer patient can have any of the types of cancer as disclosed herein. The cells (e.g., T cells) can be, for example, but not limited to, tumor-infiltrating T lymphocytes, CD4+ T cells, CD8+ T cells, or combinations thereof.

[0179] Exemplary CARs and CAR factories useful in aspects of the invention include, for example, those disclosed in PCT / US2015 / 067225 and PCT / US2019 / 022272, each of which is incorporated herein by reference in its entirety. For example, CAR-T cells can be generated according to methods known in the art using lentiviral systems (by transduction), retroviral systems (by transfection (electroporation)), and transposon systems (by PiggyBac). Useful promoters of payloads that can be used to generate CAR-Ts include, for example, constitutive promoters (wherein the promoter is the same as that of CAR-T, such as EF1α, then IRES or 2A); inducible promoters (wherein the promoter is different from that of CAR-T, such as NFAT, IL-2prom); and engineered promoters (such as PD-1 locus "knock-in" of cytokines and / or promoters under the control of endogenous promoters). In one embodiment, the PD-1 antibodies discussed herein can be used in the construction of multispecific antibodies or as payloads of CAR-T cells. For example, in one embodiment, the anti-PD-1 antibodies discussed herein can be used for targeting CARS (i.e., as a targeting moiety). In one embodiment, the anti-PD-1 antibodies discussed herein can be used as a payload secreted by CAR-T cells. In another embodiment, the anti-PD-1 antibodies discussed herein can be used as a targeting moiety, and a different PD-1 antibody targeting a different epitope can be used as the payload. In another embodiment, the payload can be an immune-modulating antibody payload. In some embodiments, for use in CAR-T compositions, the PD-1 antibodies described herein are not high affinity PD-1 antibodies (e.g., the antibodies do not therefore bind strongly to the PD-1 target).For example, the PD-1 antibody described herein can be used as a payload secreted by CAR-T cells with two targeting moieties (e.g., tumor-associated surface antigens) selected for a particular cancer (i.e., MSLN and MUC1 in ovarian cancer). Non-limiting examples of tumor-associated surface antigens include ErbB2 (HER2 / neu), carcinoembryonic antigen (CEA), epithelial cell adhesion molecule (EpCAM), epidermal growth factor receptor (EGFR), MUC1, MSLN, CD19, CD20, CD30, CD40, CD22, RAGE-1, MN-CA, and IL-1. IX, RET1, RET2 (AS), prostate specific antigen (PSA), TAG-72, PAP, p53, Ras, prostein, PSMA, survivin, 9D7, prostate cancer tumor antigen-1 (PCTA-1), GAGE, MAGE, mesothelin, betaine-catenin, TGF-betaine RII, BRCA1 / 2, SAP-1, HPV-E6, HPV-E7 (for additional tumor-associated surface antigens, see also PCT / US2015 / 067225 and PCT / US2019 / 022272, which are incorporated by reference in their entireties).

[0180] Diagnostic Assays Anti-PD-1 antibodies can be used diagnostically, e.g., to monitor the development or progression of cancer, e.g., as part of a clinical trial procedure to determine the effectiveness of a given therapeutic and / or prophylactic regimen.

[0181] In some embodiments, for diagnostic purposes, the anti-PD-1 antibodies of the invention are conjugated to a detectable moiety, e.g., to provide a method for detecting cancer cells in a subject at risk for or afflicted with cancer.

[0182] The detectable moiety can be directly attached to the antibody or fragment, or indirectly attached, for example, by using a fluorescent secondary antibody. Direct attachment can be achieved, for example, by standard chemical coupling of a fluorophore to the antibody or antibody fragment, or through genetic engineering. Chimeric or fusion proteins can be constructed that contain an antibody or antibody fragment coupled to a fluorescent or bioluminescent protein. For example, Casadei, et al., (Proc Natl Acad Sci USA. 1990 Mar; 87(6): 2047-51) describe a method for making a vector construct that can express a fusion protein of aequorin and antibody genes in mammalian cells.

[0183] As used herein, the term "labeled" with respect to a probe or antibody can encompass direct labeling of the probe or antibody by coupling (i.e., physically linking) a detectable substance to the probe or antibody, as well as indirect labeling of the probe or antibody by reactivity with another reagent that is directly labeled. Examples of indirect labeling include detection of a primary antibody using a fluorescently labeled secondary antibody, and end-labeling of a DNA probe with biotin, such that it can be detected with fluorescently labeled streptavidin. The term "biological sample" is intended to include tissues, cells, and fluids isolated from a subject (such as a biopsy), as well as tissues, cells, and fluids present within a subject. That is, the detection methods of the present invention can be used to detect cells expressing PD-1 in biological samples in vitro and in vivo. For example, in vitro techniques for detection of PD-1 include enzyme-linked immunosorbent assay (ELISA), Western blot, immunoprecipitation, and immunofluorescence. Additionally, in vivo techniques for detection of PD-1 include introducing a labeled anti-PD-1 antibody into a subject. For example, the antibody can be labeled with a radioactive marker whose presence and location in a subject can be detected by standard imaging techniques.

[0184] In the case of "targeted" conjugates, i.e., conjugates that include a targeting moiety, which is a molecule or feature designed to localize the conjugate within a subject or animal at a specific site or sites, localization can refer to a state in which an equilibrium between the bound "localized" entity and the unbound "free" entity within the subject is essentially achieved. The rate at which such equilibrium is achieved depends on the route of administration. For example, a conjugate administered by intravenous injection may achieve localization within minutes of injection, whereas an orally administered conjugate may take several hours to achieve localization. Alternatively, localization can simply refer to the location of the entity within a subject or animal at a selected period of time after the entity is administered. As another example, localization is achieved when the moiety becomes distributed after administration.

[0185] It is understood that a reasonable estimate of the time to achieve localization can be made by one skilled in the art. Furthermore, the state of localization as a function of time can be tracked by imaging the detectable moiety (e.g., luminescent conjugate) according to the method of the present invention, for example, using a photodetector device. The "photodetector device" used should be sensitive enough to allow imaging of weak light from within the mammal in a reasonable amount of time and to use the signal from such a device to construct an image.

[0186] If it is possible to use a very bright light-generating moiety and / or to detect a light-generating fusion protein that is localized near the surface of the object or animal being imaged, a pair of "night vision" goggles or a standard highly sensitive video camera (e.g., a Silicon Intensified Tube (SIT) camera (e.g., Hammamatsu Photonic Systems, Bridgewater, NJ)) can be used. More typically, however, a more sensitive light detection method is required.

[0187] At extremely low light levels, the photon flux per unit area becomes so low that the scene being imaged does not appear continuous. Instead, it is represented by individual photons that are distinct from each other both in time and space. When viewed on a monitor, such an image appears as scintillation points of light, each representing a single detected photon. By accumulating these detected photons over time in a digital image processor, an image can be acquired and constructed. In contrast to conventional cameras, where the signal at each image point is assigned an intensity value, in photon-counting imaging, the amplitude of the signal is not important. The objective is to simply detect the presence of a signal (photon) and count the occurrences of the signal with respect to its location over time.

[0188] At least two types of photodetector devices, described below, are capable of detecting individual photons and generating a signal that can be analyzed by an image processor. Noise-reduced photodetector devices achieve sensitivity by reducing the background noise of the photon detector rather than amplifying the photon signal. Noise is reduced primarily by cooling the detector array. These devices include charge-coupled device (CCD) cameras called "back-thinned" cooled CCD cameras. In more sensitive instruments, cooling is achieved using, for example, liquid nitrogen, which brings the temperature of the CCD array to about -120°C. "Back-thinned" refers to an ultra-thin backplate that reduces the path length that photons must take to be detected, thereby increasing quantum efficiency. A particularly sensitive back-thinned cryogenic CCD camera is the "TECH 512," a Series 200 camera available from Photometries, Ltd. (Tucson, Ariz.).

[0189] "Photon amplification devices" amplify photons before they hit the detection screen. This class includes CCD cameras equipped with intensifiers, such as microchannel intensifiers. Microchannel intensifiers typically contain a metal array of channels perpendicular to and coextensive with the detection screen of the camera. The microchannel array is placed between the sample, subject, or animal to be imaged and the camera. Most of the photons that enter the channels of the array contact the sides of the channels before exiting. When a voltage is applied to the array, many electrons are released from each photon collision. Electrons from such collisions exit their origin channel in a "shotgun" pattern and are detected by the camera.

[0190] Even greater sensitivity can be achieved by arranging intensifying microchannel arrays in series, such that electrons generated in the first stage give rise to an amplified signal of electrons in the second stage. However, the increase in sensitivity is achieved at the expense of spatial resolution, which decreases with each additional stage of amplification. An exemplary microchannel intensifier-based single-photon detection device is the C2400 series, available from Hamamatsu.

[0191] The image processor processes the signals generated by the photon-counting photodetector device to construct an image that can be displayed, for example, on a monitor or printed on a video printer. Such image processors are typically sold as part of a system that includes the highly sensitive photon-counting camera described above, and are therefore available from the same sources. The image processor is usually connected to a personal computer, such as an IBM-compatible PC or an Apple Macintosh (Apple Computer, Cupertino, CA), and may or may not be included as part of a purchased imaging system. Once the image is in the form of a digital file, it can be manipulated and printed by a variety of image processing programs (e.g., "ADOBE PHOTOSHOP", Adobe Systems, Adobe Systems, Mt. View, CA).

[0192] In one embodiment, the biological sample contains protein molecules from a test subject. One exemplary biological sample is a peripheral blood leukocyte sample isolated by conventional means from a subject.

[0193] The present invention also encompasses kits for detecting the presence of PD-1 or PD-1 expressing cells in a biological sample. For example, the kit can include a labeled compound or agent (e.g., an anti-PD-1 scFv or monoclonal antibody) capable of detecting cancer or tumor cells in a biological sample; a means for determining the amount of PD-1 in the sample; and a means for comparing the amount of PD-1 in the sample with a standard. The standard, in some embodiments, is a non-cancerous cell or a cell extract thereof. The compound or agent can be packaged in a suitable container. The kit can further include instructions for using the kit to detect cancer in a sample.

[0194] Other embodiments Although the present invention has been described in conjunction with a detailed description thereof, the foregoing description is intended to be illustrative, and not limiting, of the scope of the invention, which is defined by the appended claims. Other aspects, advantages, and modifications are within the scope of the appended claims.

[0195] The invention is further described in the following examples, which do not limit the scope of the invention described in the claims. EXAMPLES

[0196] Examples are provided below to facilitate a more complete understanding of the present invention. The following examples illustrate exemplary ways of making and carrying out the present invention. However, the scope of the present invention is not limited to the specific embodiments disclosed in these examples, and are for illustrative purposes only, since alternative methods can be used to obtain similar results.

[0197] Example 1 - PMPL Panning The PD-1 antibodies of the present invention (e.g., P4-B3 and P4-B7) were discovered by PMPL panning. Briefly, PD-1 was expressed genetically fused to a C-terminal C9 tag (TETSQVAPA). Expi293 cells were transiently transfected and then lysed. The lysate was clarified and PD-1 protein was captured using 1D4 (anti-C9 tag)-conjugated magnetic beads. The beads were then dialyzed in a lipid solution, which formed a lipid bilayer around the beads that simulated the cell membrane and aided in protein stability. These beads were then used for panning.

[0198] Example 2 - Minibody Binding Curves Minibody binding curves were performed with transfected cells (see Figure 4). Binding curves for P4-B3 minibody were generated using cells transfected with human or cynomolgus PD1. Human variants were run twice, but negative and cynomolgus were run once. Curves were generated with Expi293 cells 48 hours after transfection. Human variant curves were normalized based on expression levels by commercial antibody staining, but cynomolgus variants were not. Cynomolgus variants were not normalized because the commercial antibody used has not been reported to bind to cynomolgus PD-1.

[0199] Example 3 - Octet binding curves of different antibody types of P4-B3 Streptavidin sensors were loaded with 3ug / ml of biotinylated PD-1. The highest concentration of all forms of P4-B3 was 50nM, with 3 / 4 serial dilutions. Kinetic calculations were performed using Octet Red software and are shown in Figure 5. According to the EMEA Assessment Report (EMEA / H / C / 003820 / 0000), the KD of Pembro is reported to be 2.9E-11 M, which is comparable to the results obtained for Pembro from experiments.

[0200] Example 4 - PD-L1 competition assay SA sensors were loaded with 3ug / ml PD-1 and then incubated with various concentrations (50-0nM) of either Pembro (IgG) or P4-B3 (IgG or minibody), followed by incubation with 5ug / ml PD-L1. In Figure 6, the red curve represents the maximum amount of PD-L1 that binds to a PD-1 functionalized sensor with no antibody loaded. As shown in Figure 6, the P4-B3 antibody appears to block a significant portion of PD-L1 binding, although there is a slight shift with the addition of PD-L1. The curve does not include the antibody loading step, instead showing only the PD-L1 binding step. The original antibody binding step is detailed in Figure 5.

[0201] Example 5 - IgG ELISA ELISA plates were coated with soluble PD1 at 1ug / ml for 2 hours at 37°C. Plates were then washed and blocked with 2%BSA / PBS for 1 hour at 37C. Blocking solution was removed and 3x serial dilutions of antibody were added to each well (100ul) in 2% milk-PBST, starting at 6ug / ml. Plates were then incubated at room temperature with gentle shaking, washed 6 times with PBS-T, and secondary anti-human Fc-HRP (1:150k, Bethyl) was added. Plates were again incubated at room temperature with gentle shaking for 1 hour, then washed 6 times with PBS-T. TMB substrate was added and plates were incubated at 30°C for 10 minutes to promote the HRP reaction. Signal was then quenched with TMB stop solution and read at 450nm. See top graph of Figure 7.

[0202] The same protocol as described herein was performed for the bottom graph of Figure 7, except plates were coated with 3x serial dilutions of antigen starting at 6ug / ml. Antibody was then added to all wells at a constant concentration of 1ug / ml.

[0203] Example 6 - PD1 FACS with anti-PD1 IgG T cells were cultured with or without 5ug / ml PHA in complete DMEM (293FT medium) for 48 hours. Pembrolizumab and P4-B3 antibodies were detected with Biolegend's anti-human IgG Fc APC (cat. no. 409306). As shown in Figure 8, the P4-B3 PD-1 antibody shows a binding pattern similar to that of pembrolizumab and the control anti-PD1 antibody.

[0204] Example 7 - PD1-PDL1 Bioassay A Promega PD1-PDL1 bioassay (J1250) was performed using a PD-1 antibody of the invention (P4-B3) and the commercially available antibodies pembrolizumab and nivolumab (Figure 9).

[0205] Constructs tested included: (a) IgG1: wild type monomer; (b) LALA: monomer, hexamer, and mutant 3; (c) sIgG4: monomer and hexamer; control: mAb11 LALA monomer.

[0206] All samples were performed in triplicate, except for mAb11.

[0207] Fold induction: RLU stimulated / RLU unstimulated (no Ab) (Figure 10).

[0208] Example 8 - Anti-PD-1 cross-reactivity Many anti-PD-1 antibodies cannot cross-react with mouse and human PD-1 (Pembro and Nivo are not cross-reactive). See Fessas,Petros et al. "A molecular and preclinical comparison of the PD-1-targeted T-cell checkpoint inhibitors nivolumab and pembrolizumab" Seminars in oncology vol.44,2(2017):136-140. Also see Tan JBL,Chen C,Chen K,Preclinical Characterization of GLS-010(AB122):"A Fully Human Clinical-Stage anti-PD-1 Antibody" Poster,Arcus Biosciences;Burova,Elena et al. "Characterization of the Anti-PD-1 Antibody REGN2810 and Its Antitumor Activity in HumanPD-1Knock-In Mice" Large Molecule Therapeutics,2017. See also Li,Dong et al. "Epitope mapping reveals the binding mechanism of a functional antibody cross-reactive to both human and murine programmed death1" mAbs vol.9,4(2017):628-637.

[0209] The antibodies of the present invention (eg, P4-B3) are cross-reactive.

[0210] Expi293 cells transiently transfected with 3E5 were suspended in 100ul of MACS buffer and added to each well. Then, 50ul of each antibody dilution was mixed with the cells and the plate was incubated at 4°C for 30 minutes. After incubation, the plate was washed twice with MACS buffer and incubated with 1ul / well of anti-human Fc-APC (Biolegend#409306). The plate was incubated at 4°C for 25 minutes and washed three times before the samples were analyzed.

[0211] As shown in FIG. 16, P4-B3 has moderate affinity for mouse PD-1, setting it apart from Pembro and Nivo.

[0212] Example 9 - Affinity Maturation Yeast library generation First, P4-B3 scFv from pFarber vector (phage display) is cut and pasted into pCTCON2 vector (yeast display). Then, the library is made according to two methods implemented in the art: (1) digestion / ligation in bacteria and transformation of intact plasmid into yeast; and (2) linearized vector + PCR fragment for homologous recombination in yeast. The digestion / ligation method (method (1) described herein) resulted in very low library size, low efficiency of ligation / bacterial transformation, and very low efficiency of transformation into yeast. However, homologous recombination (method (2) described herein) resulted in about 10 6 ~10 7 This resulted in a library with mutants.

[0213] Error-prone mutagenesis The Agilent GeneMorph II random mutagenesis kit was used, which is designed to vary the mutation rate based on the initial template DNA. TIFF0007680967000031.tif41128

[0214] External primers (approximately 50-60 bp overlap with pCTCON2 vector): (a) pCTCON2-HR-Fwd: GAGGAGGCTCTGGTGGAGGCGGTAGCGGAGGCGGAGGGTCGGCTAGCTGGGCCCAGCCGG (b) pCTCON2-HR-Rev: ACACTGTTGTTATCAGATCTCGAGCTATTACAAGTCCTCTTCAGAAAATAAGCTTTTGTTC

[0215] Internal primers (45 bp overlap with heavy or light chain fragment): (a) G4S-Fwd: GGTGGCGGCGGTTCCGGAGGTGGTGGTTCTGGCGGTGGTGGCAGC (b) G4S-Rev: GCTGCCACCACCGCCAGAACCACCACCTCCGGAACCGCCGCCACC

[0216] Error-prone mutagenesis strategies (a) PCR of the entire scFv fragment with external primers. This strategy allows for mutations in the linker region, which is undesirable. (b) PCR of the heavy and light chains using external and G4S primers separately, using the G4S linker as the third overlap point for three-piece homologous recombination. This strategy protects the linker from mutations, but requires three-piece homologous recombination, which may be less efficient than two-piece.

[0217] Both techniques were used with various amounts of template DNA. The template for the whole scFv PCR was the pCTCON4 vector into which P4-B3 was cloned (approximately 1 / 10 of the template is the target sequence). The template for the heavy / light chain separate PCR was the P4-B3 PCR fragment (approximately 1 / 2 of the template is the target sequence).

[0218] Templates used - total scFv PCR: 4ug, 2ug, 1ug, 0.5ug; heavy / light chain separate PCR: 450ng, 50ng (2 reactions each).

[0219] * PCR was performed for 33 cycles to increase DNA yield.

[0220] Creating a library The protocol described in Benatuil et al., "An improved yeast transformation method for the generation of very large human antibody libraries", Protein Eng Des Sel. 2010Apr;23(4):155-9. was followed.

[0221] General protocol: EBY100 yeast cells were inoculated into 100 ml of YPD medium at OD600=0.3 and grown at 30 °C for approximately 5-6 h until OD600=1.6. Cells were harvested by centrifugation, washed twice with 50 ml of cold ddH2O, and resuspended in 50 ml of cold electroporation buffer (1 M sorbitol / 1 mM CaCl 2 The cells were then washed once with 50 ml of cold electroporation buffer. The cells were then conditioned by shaking in 20 ml of 0.1 M LiAc / 10 mM DTT at 30° C. for 30 min. The cells were harvested and washed with 50 ml of cold electroporation buffer. After pelleting, the cells were resuspended in a final volume of 1 ml suitable for two transformations.

[0222] Total scFv PCR: 4.8ug of insert was obtained and mixed with 4ug of linearized vector (NcoI / BamHI).

[0223] Heavy / light chain PCR: 4.1 ug of HC and 3.5 ug of LC were obtained, reduced to 3 ug of linearized vector (NcoI / BamHI).

[0224] The vector and desired fragment were mixed and then EtOH precipitated to reduce the volume (<50ul). 400ul of electrocompetent yeast cells were transformed using a Biorad at 2.5kV and 25uF. Cells were allowed to recover in 1:1 YPD:1M sorbitol for 1 hour, after which the cells were spun down, washed with SDCAA, and resuspended in 250ml SDCAA for each transformation.

[0225] Titers: (a) whole scFv library: approx. 5.2E6 members; (b) separate H / L chains: approx. 5.8E6 members.

[0226] After two passages, colonies were plated for sequencing (96 colonies per library). Total scFv library: 56 / 96 (58.33%) had at least one mutation. Separate H / L chain library: 42 / 96 (43.75%) had at least one mutation.

[0227] Effective library sizes: (a) total scFv library: approximately 2.9E6 members; (b) separate H / L chains: approximately 2.1E6 members.

[0228] Library selection strategy Two staining methods were used: (1) standard staining looking for improved binding (shift to the upper right quadrant during FACS analysis); and (2) a kinetic strategy looking for improved off-rates.

[0229] In dynamic staining, libraries are stained with labeled antigen at a concentration 10 times the Kd, washed, and then incubated with an increasing volume of unlabeled antigen at a concentration 100 times the Kd. Incubating the sample in a large volume prevents antigen that dissociates from being able to rebind to yeast. Furthermore, adding a higher concentration of unlabeled antigen means that any labeled antigen that is released will be replaced by unlabeled antigen.

[0230] In dynamic staining, the staining time depends on the time constant (τ). τ = (k on [Ag] 0 +koff ) -1

[0231] where k = on rate (M^-1s^-1); k = off rate (s^-1); and [Ag] = initial antigen concentration (M).

[0232] From octet measurements, the P4-B3 scfv has kon=6.85E4, koff=6.45E-5, and Kd=9.4E10.

[0233] At equilibrium binding, 95% of the time, the binding is 3τ, and at 99% the binding is 5τ.

[0234] The staining protocol was performed according to Cherf and Cochran, "Applications of Yeast Surface Display for Protein Engineering", Methods Mol Biol. 2015;1319:155-75.

[0235] Briefly, high affinity protein variants were isolated from yeast display libraries by FACS. Following transformation of yeast cells with the gene library and induction of surface expression, two main strategies are used to differentially label the displayed library prior to screening: (1) an equilibrium binding strategy, in which the library is bound to the expected K of the highest affinity variants; D (1) a kinetic binding strategy (where the library is incubated with ligand as described for the equilibrium binding strategy, but unbound ligand is removed by washing, and the library is then incubated with a 100-fold excess of unlabeled ligand or in a large enough volume of buffer to prevent rebinding of dissociated ligands).

[0236] During this second incubation step, excess unlabeled ligand or large incubation volumes prevent dissociated labeled ligand from rebinding. Thus, proteins are differentiated based on their dissociation rate constants (koff), with mutants with the slowest koff retaining the greatest percentage of prebound labeled ligand. Addition of fluorescently labeled anti-epitope tag antibodies allows normalization of yeast surface expression levels by binding, allowing the isolation of the highest affinity mutants by FACS. The sorted pool of yeast clones can be expanded in culture for either analysis or subsequent sorting, or DNA from these clones can be isolated, subjected to mutagenesis, and used to transform new batches of yeast for further protein evolution. Components of the yeast display platform, such as Aga1p, Aga2p, HA and c-myc epitope tags, as well as detection antibodies shown in Figure 17, are omitted for clarity.

[0237] Library Selection Libraries were sorted on a Sony SH800, recovering approximately 1000 clones per sample. Samples were sorted for clones with increased and decreased binding (key residues were mapped). Sorted cells were plated and only a few dozen grew, all of which were sequenced. Standard and dynamic staining were used to focus on separate H / L chain libraries. TIFF0007680967000032.tif42128

[0238] Sorted cells were plated on SDCAA plates and incubated at 30°C for 3 days. Colonies were then picked, grown in fresh SDCAA medium, and sequenced to identify key mutations. Unique clones from sequencing were then inoculated into fresh SGCAA (induced with galactose) and after 36 hours samples were stained to generate binding curves.

[0239] EBY100 yeast cultures were induced for 1.5 days at 30°C. 1E6 cells were spun down and placed into wells containing various dilutions of antigen in PBS. Plates were incubated for 2 hours at room temperature with shaking. Plates were washed with PBS and 0.1ug / ml streptavidin-APC (biolegend) was added to each well. Plates were incubated for 25 minutes at room temperature with shaking, then washed and read on a FACSCalibur.

[0240] Clones 2, 7, 10, 14 were derived from a random mutagenesis library of P4-B3 (anti-PD1) and selected for higher binding (shifted on the y=x axis). HL clones were generated by error-prone H and L chains separately before being recombined by homologous recombination via linker sequences. HL Dynamic 1 was derived from a dynamic staining approach, where the library was incubated with 10×Kd labeled antigen followed by a prolonged incubation with 100-fold excess of unlabeled antigen at 10× the original chromosome volume. P4-B3 wild type was not positive at this stage, but only a few clones in the library popped up (see Figure 20). The experiment was repeated at the appropriate concentrations and only clones that shifted the curve to the left were used (see Figure 21).

[0241] Other clones identified but not yet characterized TIFF0007680967000033.tif60133

[0242] scFv positives were primarily clones that expressed lower amounts of cMyc but showed some increased binding by binding higher amounts of PD-1 (none shifted upwards on the x=y axis).

[0243] scFv negatives are clones that showed reduced binding compared to wild type.

[0244] In addition to cloning HLkin1, HL-7, and HL-14 into the minibody vector, double (Mut+2:HLkin1+HL-7) and triple (Mut+3:HLkin1+HL-7+HL-14) combination mutants were generated to determine whether additive effects were observed (see Figures 23 and 24).

[0245] For example, the following K D are being measured: PD1#3 approx. 1E-10M P4-B3 wild type approximately 1E-9M Mut+2 (HLkin1+HL-7) approx. 3E-11M Mut+3(HLkin1+HL-7+HL-14) approx. 3E-12M HLkin-1 approx. 6E-11M

[0246] Example 10 - PD1 bioassay with IgG A Promega PD1-PDL1 bioassay (J1250) was performed using PD-1 antibodies of the invention (e.g., P4-B3 and variants described herein) and the commercially available antibodies pembrolizumab and nivolumab (Figure 33).

[0247] Nivo (green triangle) reaches an induction fold of about 5-6, which is similar to previous experiments. In the scFv-Fc experiments, Mut+2, Mut+3, HLkin-1 and HL-7 all showed increased induction compared to Nivo. When converted to IgG, the combo mutant (Mut+2 / Mut+3) continues to function better than Nivo and at a level comparable to Pembro, while the single (HLkin-1 / HL-7) show slightly reduced activity. The original P4-B3 IgG is significantly lower than that of all antibodies. Clone scFv-6 is a double mutant obtained from a yeast library and has two light chain mutations. As can be seen, this is an improvement over the P4-B3 wild type, but is significantly worse than the commercial antibody and the other mutant antibodies.

[0248] Example 11 - Mixed Lymphocyte Reaction (MLR) Protocol CD14+ monocytes were isolated using Miltenyi CD14+ microbeads. Cells were cultured in Miltenyi Mo-DC medium (pre-prepared medium containing GM-CSF+IL4). After culturing the cells for 5 days, TNF-α (1000U / ml), IL-1β (5ng / ml), IL-6 (10ng / ml), and prostaglandin E2 (PGE2) (1μM) were added and the cells were cultured for 2 days to allow DC maturation. T cells were isolated on the day of the MLR experiment (CD4+ negative selection kit StemCell). In the MLR, 100,000 T cells and 10,000 MoDC cells were used per well. Antibodies were added at various concentrations and the cultures were incubated for 5 days.

[0249] Supernatants were saved for ELISA screening (e.g., IL2 and IFNγ). For FACS analysis, cells were stained with CD4-FITC, PD1-PE, LAG3-BV421, TIM3-APCCy7.

[0250] MLR Pembro vs P4-B3mut+3 IgG4. Two T cell donors and two DC donors were used. The titles of the graphs in Figures 42 and 43 indicate the cytokines measured, the T cell donor, and the DC donor. IL2 T2 DCV Untreated corresponds to the IL2 assay, T cell donor 2, DC donor V.

[0251] The P4-B3mut+3 antibody of sIgG4 type was tested against pembrolizumab and a commercial preparation of F10-sIgG4 (negative control). As shown in Figures 42 and 43, the addition of either P4-B3mut+3 or pembrolizumab results in a significant increase in cytokine production compared to that of F10.

[0252] equivalent Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, numerous equivalents to the specific substances and procedures specifically described herein which equivalents are considered to be within the scope of this invention and are covered by the following claims.

Claims

1. 1. An isolated antibody or antigen-binding fragment thereof that binds to human programmed cell death 1 (PD-1) protein, (a) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28, or (b) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28; or (c) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 79, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28, or (d) a VH CDR1 comprising the amino acid sequence of SEQ ID NO:78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO:19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO:21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO:24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO:26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO:28; or (e) a VH CDR1 comprising the amino acid sequence of SEQ ID NO:78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO:19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO:21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO:24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO:80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO:28; or (f) a VH CDR1 comprising the amino acid sequence of SEQ ID NO:78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO:19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO:79, a VL CDR1 comprising the amino acid sequence of SEQ ID NO:24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO:80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO:

28.

2. An isolated antibody or antigen-binding fragment thereof comprising:

2. or an isolated monoclonal antibody or antigen-binding fragment thereof that binds to PD-1, comprising a heavy chain and a light chain, wherein the heavy chain comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO:17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO:19, and a VH CDR3 comprising the amino acid sequence of SEQ ID NO:21, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO:1; and the light chain comprises a VL CDR1 comprising the amino acid sequence of SEQ ID NO:24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO:26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO:28, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO:2; or or an isolated monoclonal antibody or antigen-binding fragment thereof that binds to PD-1, comprising a heavy chain and a light chain, wherein the heavy chain comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO:17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO:19, and a VH CDR3 comprising the amino acid sequence of SEQ ID NO:21, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO:1; and the light chain comprises a VL CDR1 comprising the amino acid sequence of SEQ ID NO:24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO:80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO:28, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO:11; or or an isolated monoclonal antibody or antigen-binding fragment thereof that binds to PD-1, comprising a heavy chain and a light chain, wherein the heavy chain comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO:17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO:19, and a VH CDR3 comprising the amino acid sequence of SEQ ID NO:79, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO:12; and the light chain comprises a VL CDR1 comprising the amino acid sequence of SEQ ID NO:24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO:26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO:28, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO:2; or or an isolated monoclonal antibody or antigen-binding fragment thereof that binds to PD-1, comprising a heavy chain and a light chain, wherein the heavy chain comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO:78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO:19, and a VH CDR3 comprising the amino acid sequence of SEQ ID NO:21, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO:13; and the light chain comprises a VL CDR1 comprising the amino acid sequence of SEQ ID NO:24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO:26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO:28, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO:2; or or an isolated monoclonal antibody or antigen-binding fragment thereof that binds to PD-1, comprising a heavy chain and a light chain, wherein the heavy chain comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO:78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO:19, and a VH CDR3 comprising the amino acid sequence of SEQ ID NO:21, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO:13; and the light chain comprises a VL CDR1 comprising the amino acid sequence of SEQ ID NO:24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO:80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO:28, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO:11; or 1. An isolated monoclonal antibody or antigen-binding fragment thereof that binds to PD-1, comprising a heavy chain and a light chain, wherein the heavy chain comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO:78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO:19, and a VH CDR3 comprising the amino acid sequence of SEQ ID NO:79, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO:15, and the light chain comprises a VL CDR1 comprising the amino acid sequence of SEQ ID NO:24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO:80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO:28, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO:

11.

3. 3. An isolated bispecific antibody comprising an antigen-binding fragment of claim 1 or 2 and a second antigen-binding fragment having specificity for a molecule on an immune cell.

4. the molecule is selected from the group consisting of B7H3, B7H4, CD27, CD28, CD40, CD40L, CD47, CD122, CTLA-4, GITR, GITRL, ICOS, ICOSL, LAG-3, LIGHT, OX-40, OX40L, PD-1, TIM3, 4-1BB, TIGIT, VISTA, HEVM, BTLA, and KIR; or each of the antigen-binding fragment and the second antigen-binding fragment is independently selected from a Fab fragment, a single chain variable fragment (scFv), or a single domain antibody; or Further comprising an Fc fragment, The bispecific antibody of claim 3.

5. A nucleic acid encoding an antibody according to claim 1 or 2, or encoding a bispecific antibody according to claim 3 or 4.

6. A pharmaceutical composition comprising i) an antibody or antigen-binding fragment thereof according to claim 1 or 2, and a pharma- ceutically acceptable carrier or excipient, or ii) a bispecific antibody according to claim 3 or 4, and a pharma- ceutically acceptable carrier or excipient.

7. The pharmaceutical composition of claim 6 further comprising at least one additional therapeutic agent.

8. i) one or more polynucleotides encoding the antibody or antigen-binding fragment thereof according to claim 1 or 2; or ii) one or more polynucleotides encoding the bispecific antibody of claim 3 or 4 1. An isolated cell comprising:

9. A vector comprising the nucleic acid of claim 5.

10. A cell comprising the vector of claim 9.

11. 10. A kit comprising the pharmaceutical composition of claim 6, a syringe, needle, or applicator for administering at least one antibody to a subject, and instructions for use.

12. 3. An engineered cell comprising a chimeric antigen receptor, the chimeric antigen receptor comprising an extracellular ligand binding domain specific for an antigen on the surface of a cancer cell, the antigen comprising PD-1, and the extracellular ligand binding domain comprising the antibody or antigen-binding fragment thereof of claim 1 or 2.

13. The engineered cell of claim 12 , wherein the engineered cell comprises a T cell, an NK cell, or an NKT cell.

14. The pharmaceutical composition of claim 7 , wherein the therapeutic agent is a toxin, a radiolabel, an siRNA, a small molecule, or a cytokine.

15. 14. The engineered cell of claim 13, wherein the T cells are CD4+, CD8+, CD3+ pan T cells, or any combination thereof.

Images