Antibodies to PD-1 and methods of use thereof

Abstract

The present invention relates to human multispecific antibodies that bind to the cell surface receptor PD-1 (Programmed Death 1), which can be used to treat cancer and chronic viral infections.

Description

[Technical field]

[0001] This application is an international application claiming the benefit of priority to U.S. Provisional Patent Application No. 62 / 861,638, filed June 14, 2019, and U.S. Provisional Patent Application No. 62 / 884,473, filed August 8, 2019, each of which is incorporated by reference in its entirety herein.

[0002] All patents, patent applications, and publications cited herein are hereby incorporated by reference in their entirety. The disclosures of these publications are incorporated by reference into this application in order to more fully describe the state of the art known to those skilled in the art as of the date of the invention described and claimed herein.

[0003] This patent disclosure contains material that is subject to copyright protection. The copyright owner has no objection to the facsimile reproduction of either the patent document or the patent disclosure, as it appears in the U.S. Patent and Trademark Office patent files or records, but otherwise reserves all copyright rights whatsoever.

[0004] FIELD OF THEINVENTION The present invention relates to antibodies against PD-1 and methods of using the same. [Background technology]

[0005] 2. Background of the Invention Programmed cell death-1 (PD-1) is a cell surface membrane protein of the immunoglobulin superfamily. The protein is expressed on pro-B cells and is thought to play a role in their differentiation. PD-1, a member of the CD28 family, is upregulated on activated T cells, B cells, and monocytes. PD-1 has two identified ligands of the B7 family, namely PD-L1 (also known as programmed cell death-1 ligand 1, cluster of differentiation 274 (CD274) or B7 homolog 1 (B7-H1)) and PD-L2. PD-L1 is a 40 kDa type I transmembrane protein. Binding of PD-L1 to PD-1 or B7.1 transmits an inhibitory signal that reduces the proliferation of CD8+ T cells in lymph nodes, and complementary to that, PD-1 can also control the accumulation of foreign antigen-specific T cells through apoptosis in lymph nodes, which is further mediated by downregulation of the Bcl-2 gene. PD-L2 expression tends to be more restricted and is found primarily on activated antigen-presenting cells (APCs), whereas PD-L1 expression is widespread, including on hematopoietic cells (including activated T cells, B cells, monocytes, dendritic cells and macrophages) and peripheral non-lymphoid tissues (including cardiac, skeletal, muscle, placental, lung, kidney and liver tissues). The widespread expression of PD-L1 indicates its important role in regulating peripheral immune tolerance via PD-1 / PD-L1. Summary of the Invention

[0006] The present invention provides PD-1 antibody compositions and methods of use thereof.

[0007] One aspect of the present invention relates to an isolated multispecific antibody or antigen-binding fragment thereof that binds to the human programmed cell death 1 (PD-1) protein and the interleukin-12 (IL-12) receptor. In one embodiment, the isolated multispecific PD-1 antibody or antigen-binding fragment thereof comprises a heavy chain, a light chain, or a combination thereof. In some embodiments, the heavy chain comprises a G-(X 1 )-TF-(X 2 X 3 )-Y-(X4 ) (SEQ ID NO: 81), G-(X 5 )-TF-(X 6 X 7 X 8 )-A (SEQ ID NO:82), GDSVSSDNYF (SEQ ID NO:43), or GYTFNRFG (SEQ ID NO:55), CDR2 comprising ISWNSGSI (SEQ ID NO:19), IYPDDSDT (SEQ ID NO:33), VYYNGNT (SEQ ID NO:45), TNPYNGNT (SEQ ID NO:57), or ISYDGSNK (SEQ ID NO:69), CDR3 comprising ASDYGDKYYYYGMDV (SEQ ID NO:21), AFWGASGAPVNGFDI (SEQ ID NO:35), ATETPPTSYFNSGPFDS (SEQ ID NO:47), ARVVAVNGMDV (SEQ ID NO:59), ASQTVAGSDY (SEQ ID NO:71), or ASDYGDKYSYYGMDV (SEQ ID NO:79), or a combination of these CDRs. In other embodiments, the light chain comprises CDR1, (X 9 )-DN (SEQ ID NO: 83), (X 10)-NN (SEQ ID NO:84), or DDS (SEQ ID NO:75), and a CDR3 comprising AAWDDGLNGRGV (SEQ ID NO:28), AAWDDSLNAPV (SEQ ID NO:41), SSWDSSLSGYV (SEQ ID NO:53), QSYDSSNLWV (SEQ ID NO:65), or QVWHSVSDQGV (SEQ ID NO:77), or a combination of CDRs thereof. In other embodiments, the isolated multispecific PD-1 antibody or antigen-binding fragment thereof further comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO:129. In some embodiments, the isolated multispecific PD-1 antibody or antigen-binding fragment thereof comprises a heavy chain and a light chain that comprise the CDRs described herein. In further embodiments, the isolated multispecific PD-1 antibody or antigen-binding fragment thereof is fully human or humanized. In further embodiments, the isolated multispecific PD-1 antibody or antigen-binding fragment thereof is monospecific, bispecific, or multispecific. In a further embodiment, the isolated multispecific PD-1 antibody or antigen-binding fragment thereof is a single chain antibody. In other embodiments, the isolated multispecific PD-1 antibody or antigen-binding fragment thereof is at least 1.0×10 -6 In other embodiments, the isolated multispecific PD-1 antibody or antigen-binding fragment thereof further comprises a heavy chain constant region, a light chain constant region, an Fc region, or a combination thereof. In some embodiments, the X of the CDRs from the isolated multispecific PD-1 antibody or antigen-binding fragment thereof is 1 , X 4 , X 5 or X 8 In some embodiments, the X of the CDRs from an isolated multispecific PD-1 antibody or antigen-binding fragment thereof is a non-polar amino acid residue. 1 , X 4 , X 5 or X 8 The amino acid residue is tyrosine (Y), phenylalanine (F), or alanine (A). In some embodiments, the X of the CDRs from an isolated multispecific PD-1 antibody or antigen-binding fragment thereof 2 , X3 , X 4 , X 6 , X 7 or X 8 In some embodiments, the X of the CDRs from an isolated multispecific PD-1 antibody or antigen-binding fragment thereof is a polar amino acid residue. 2 , X 3 , X 4 , X 6 , X 7 or X 8 The amino acid residue is aspartic acid (D), threonine (T), serine (S), or tryptophan (W). In another embodiment, the X of the CDRs from an isolated multispecific PD-1 antibody or antigen-binding fragment thereof is 1 The amino acid residue is tyrosine (Y) or phenylalanine (F). In another embodiment, the X of the CDRs from an isolated multispecific PD-1 antibody or antigen-binding fragment thereof is 2 The amino acid residue is aspartic acid (D), threonine (T), or serine (S). In another embodiment, the X of the CDRs from an isolated multispecific PD-1 antibody or antigen-binding fragment thereof is 3 The amino acid residue is aspartic acid (D), threonine (T), or serine (S). In another embodiment, the X of the CDRs from an isolated multispecific PD-1 antibody or antigen-binding fragment thereof is 4 The amino acid residue is alanine (A) or tryptophan (W). In another embodiment, the X of the CDRs from an isolated multispecific PD-1 antibody or antigen-binding fragment thereof is 5 The amino acid residue is phenylalanine (F) or tyrosine (Y). In another embodiment, the X of the CDRs from an isolated multispecific PD-1 antibody or antigen-binding fragment thereof is 6 The amino acid residue is aspartic acid (D) or serine (S). In another embodiment, the X of the CDRs from an isolated multispecific PD-1 antibody or antigen-binding fragment thereof is 7 The amino acid residue is aspartic acid (D) or serine (S). In another embodiment, the X of the CDRs from an isolated multispecific PD-1 antibody or antigen-binding fragment thereof is 8The amino acid residue is phenylalanine (F) or tyrosine (Y). In another embodiment, the X of the CDRs from an isolated multispecific PD-1 antibody or antigen-binding fragment thereof is 9 In another embodiment, the amino acid residues are polar hydrophilic amino acid residues. 9 The amino acid residue is glutamic acid (E), asparagine (N), or aspartic acid (D). In another embodiment, the X of the CDRs from an isolated multispecific PD-1 antibody or antigen-binding fragment thereof is 10 In another embodiment, the amino acid residues are polar hydrophilic amino acid residues. 10 The amino acid residues are serine (S) or arginine (R).

[0008] One aspect of the present invention relates to an antibody composition comprising at least one antibody, wherein the at least one antibody comprises two heavy chains and two light chains. In some embodiments, the heavy chain CDRs are between residues 27 and 38, residues 56 and 65, and residues 105 and 119 according to the IMGT numbering of SEQ ID NO: 1, or between residues 27 and 38, residues 56 and 65, and residues 105 and 119 according to the IMGT numbering of SEQ ID NO: 3, or between residues 27 and 38, residues 56 and 65, and residues 105 and 121 according to the IMGT numbering of SEQ ID NO: 5, or between residues 27 and 38, residues 56 and 65, and residues 105 and 115 according to the IMGT numbering of SEQ ID NO: 7, or between residues 27 and 38, residues 56 and 65, and residues 105 and 114 according to the IMGT numbering of SEQ ID NO: 9, or between residues 27 and 38, residues 56 and 65, and residues 105 and 119 according to the IMGT numbering of SEQ ID NO: 12 (e.g., the HL-14 variant described herein), or between residues 27 and 38, residues 56 and 65, and residues 105 and 119 according to the IMGT numbering of SEQ ID NO: 13 (e.g., the HLkin-1 variant described herein), or between residues 27 and 38, residues 56 and 65, and residues 105 and 119 according to the IMGT numbering of SEQ ID NO: 15 (e.g., the mut-3 variant described herein), and are identical to the CDRs of the reference germline present therein, provided that at least one of the heavy chain CDRs differs from its reference CDR by a single amino acid substitution as compared thereto.In some embodiments, the light chain CDRs are between residues 27 and 38, residues 56 and 65, and residues 105 and 116 according to the IMGT numbering of SEQ ID NO:2, or between residues 27 and 38, residues 56 and 65, and residues 105 and 115 according to the IMGT numbering of SEQ ID NO:4, or between residues 27 and 38, residues 56 and 65, and residues 105 and 115 according to the IMGT numbering of SEQ ID NO:6, or between residues 27 and 38, residues 56 and 65 according to the IMGT numbering of SEQ ID NO:8. and residues 105 and 114, or between residues 27 and 38, residues 56 and 65, and residues 105 and 115 according to the IMGT numbering of SEQ ID NO: 10, or between residues 27 and 38, residues 56 and 65, and residues 105 and 116 according to the IMGT numbering of SEQ ID NO: 11 (e.g., the HL-7 variants described herein), except that at least one of the light chain CDRs differs by a single amino acid substitution compared to the reference CDR. In some embodiments, the antibody composition binds to an epitope that includes amino residues in the face of PD-1 generated by the FCC' chain but does not contact the C'D loop of PD-1 that includes non-adjacent amino acids in SEQ ID NO: XX. In some embodiments, the antibody composition further comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129.

[0009] One aspect of the present invention relates to an isolated antibody or fragment thereof that binds to human programmed cell death 1 (PD-1) protein and interleukin-12 (IL-12) receptor. In one embodiment, the isolated antibody or fragment thereof that binds to PD-1 and interleukin-12 (IL-12) receptor comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28. In one embodiment, an isolated antibody or fragment thereof that binds to PD-1 and an interleukin-12 (IL-12) receptor comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 31, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 33, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 35, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 37, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 39, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 41. In one embodiment, an isolated antibody or fragment thereof that binds to PD-1 and an interleukin-12 (IL-12) receptor comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 43, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 45, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 47, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 49, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 51, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 53. In one embodiment, an isolated antibody or fragment thereof that binds to PD-1 and the interleukin-12 (IL-12) receptor comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO:55, a VH CDR2 comprising the amino acid sequence of SEQ ID NO:57, a VH CDR3 comprising the amino acid sequence of SEQ ID NO:59, a VL CDR1 comprising the amino acid sequence of SEQ ID NO:61, a VL CDR2 comprising the amino acid sequence of SEQ ID NO:63, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO:65.In one embodiment, an isolated antibody or fragment thereof that binds to PD-1 and an interleukin-12 (IL-12) receptor comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 67, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 69, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 71, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 73, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 75, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 77. In one embodiment, an isolated antibody or fragment thereof that binds to PD-1 and an interleukin-12 (IL-12) receptor comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28 (e.g., an HL-7 variant described herein). In one embodiment, an isolated antibody or fragment thereof that binds to PD-1 and an interleukin-12 (IL-12) receptor comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 79, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28 (e.g., an HL-14 variant described herein). In one embodiment, an isolated antibody or fragment thereof that binds to PD-1 and an interleukin-12 (IL-12) receptor comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28 (e.g., an HLkin-1 variant described herein).In one embodiment, an isolated antibody or fragment thereof that binds to PD-1 and the interleukin-12 (IL-12) receptor comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28 (e.g., the HLkin-1HL-7 mut2 mutant described herein). In one embodiment, an isolated antibody or fragment thereof that binds to PD-1 and an interleukin-12 (IL-12) receptor comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 79, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28 (e.g., an HLkin-1 HL-7 HL-14 mut3 mutant described herein). In one embodiment, an isolated antibody or fragment thereof that binds to PD-1 and an interleukin-12 (IL-12) receptor described herein further comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129.

[0010] One aspect of the present invention relates to an isolated multispecific antibody or antigen-binding fragment thereof, wherein the antibody binds to human programmed cell death 1 (PD-1) protein. In one embodiment, the isolated multispecific antibody or antigen-binding fragment thereof that binds to human PD-1 protein comprises a heavy chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 1, 3, 5, 7, 9, 12, 13, and 15, and a light chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, and 11. In one embodiment, in the isolated multispecific antibody or antigen-binding fragment thereof, the antibody binds to human PD-1 protein and also binds to the interleukin-12 (IL-12) receptor, and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129.

[0011] In another embodiment, the isolated multispecific antibody or antigen-binding fragment thereof that binds to human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO:1, and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO:2, and the antibody binds to an IL-12 receptor comprising a constant region, a linker, and an interleukin-12 (IL-12) amino acid sequence having at least 90% identity to SEQ ID NO: 129. In another embodiment, the isolated multispecific antibody or antigen-binding fragment thereof that binds to human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO:3, and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO:4, and the antibody binds to an IL-12 receptor comprising a constant region, a linker, and an interleukin-12 (IL-12) amino acid sequence having at least 90% identity to SEQ ID NO:129. In another embodiment, the isolated multispecific antibody or antigen-binding fragment thereof that binds to human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO:5, and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO:6, and the antibody binds to an IL-12 receptor comprising a constant region, a linker, and an interleukin-12 (IL-12) amino acid sequence having at least 90% identity to SEQ ID NO: 129. In another embodiment, the isolated multispecific antibody or antigen-binding fragment thereof that binds to human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO:7, and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO:8, and the antibody binds to an IL-12 receptor comprising a constant region, a linker, and an interleukin-12 (IL-12) amino acid sequence having at least 90% identity to SEQ ID NO:129.In another embodiment, the isolated multispecific antibody or antigen-binding fragment thereof that binds to human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO:9, and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO:10, and the antibody binds to an IL-12 receptor comprising a constant region, a linker, and an interleukin-12 (IL-12) amino acid sequence having at least 90% identity to SEQ ID NO: 129. In another embodiment, the isolated multispecific antibody or antigen-binding fragment thereof that binds to human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO:1, and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO:11, and the antibody binds to an IL-12 receptor comprising a constant region, a linker, and an interleukin-12 (IL-12) amino acid sequence having at least 90% identity to SEQ ID NO:129. In another embodiment, the isolated multispecific antibody or antigen-binding fragment thereof that binds to human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 12, the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 2, and the antibody binds to an IL-12 receptor comprising a constant region, a linker, and an interleukin-12 (IL-12) amino acid sequence having at least 90% identity to SEQ ID NO: 129. In another embodiment, the isolated multispecific antibody or antigen-binding fragment thereof that binds to human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 13, the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 2, and the antibody binds to an IL-12 receptor comprising a constant region, a linker, and an interleukin-12 (IL-12) amino acid sequence having at least 90% identity to SEQ ID NO: 129.In another embodiment, the isolated multispecific antibody or antigen-binding fragment thereof that binds to human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 13, the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 11, and the antibody binds to an IL-12 receptor comprising a constant region, a linker, and an interleukin-12 (IL-12) amino acid sequence having at least 90% identity to SEQ ID NO: 129. In another embodiment, the isolated multispecific antibody or antigen-binding fragment thereof that binds to human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 15, the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 11, and the antibody binds to an IL-12 receptor comprising a constant region, a linker, and an interleukin-12 (IL-12) amino acid sequence having at least 90% identity to SEQ ID NO: 129.

[0012] One aspect of the present invention relates to an isolated bispecific antibody comprising a first antibody fragment that binds to human PD-1 protein and a second antigen-binding fragment having specificity for a molecule on an immune cell. In one embodiment, the isolated bispecific antibody comprises a fragment of a human antibody to the PD-1 protein described herein. In some embodiments, the molecule on an immune cell comprises B7H3, B7H4, CD27, CD28, CD40, CD40L, CD47, CD122, CTLA-4, GITR, GITRL, ICOS, ICOSL, LAG-3, LIGHT, OX-40, OX40L, PD-1, TIM3, 4-1BB, TIGIT, VISTA, HEVM, BTLA, or KIR. In some embodiments, the antibody fragment that binds to human PD-1 protein comprises a Fab fragment, a single chain variable fragment (scFv), or a single domain antibody. In other embodiments, the second antigen-binding fragment having specificity for a molecule on an immune cell comprises a Fab fragment, a single chain variable fragment (scFv), or a single domain antibody. In some embodiments, the bispecific antibody comprises an Fc fragment.

[0013] One aspect of the present invention relates to an isolated multispecific antibody comprising a first antibody fragment that binds to human PD-1 protein and a second and a third antigen-binding fragment having specificity for a molecule on an immune cell. In one embodiment, the isolated multispecific antibody comprises a fragment of a human antibody against the PD-1 protein described herein. In some embodiments, the molecule on the immune cell comprises B7H3, B7H4, CD27, CD28, CD40, CD40L, CD47, CD122, CTLA-4, GITR, GITRL, ICOS, ICOSL, LAG-3, LIGHT, OX-40, OX40L, PD-1, TIM3, 4-1BB, TIGIT, VISTA, HEVM, BTLA, or KIR. In some embodiments, the antibody fragment that binds to human PD-1 protein comprises a Fab fragment, a single chain variable fragment (scFv), or a single domain antibody. In other embodiments, the second and third antigen-binding fragments with specificity for a molecule on an immune cell comprise a Fab fragment, a single chain variable fragment (scFv), or a single domain antibody. In some embodiments, the multispecific antibody comprises an Fc fragment. In some embodiments, the multispecific antibody further comprises a fourth and / or a fifth antigen-binding fragment with specificity for a molecule on an immune cell.

[0014] One aspect of the invention relates to a nucleic acid encoding an isolated multispecific antibody or antigen-binding fragment thereof that binds to human programmed cell death 1 (PD-1) protein as described herein. One aspect of the invention relates to a nucleic acid encoding an isolated antibody or fragment thereof that binds to human PD-1 protein as described herein. One aspect of the invention relates to a nucleic acid encoding a bispecific antibody as described herein. One aspect of the invention relates to a nucleic acid encoding a multispecific antibody as described herein. In some embodiments, the invention relates to a vector comprising a nucleic acid as described herein. In some embodiments, the invention relates to a cell comprising a vector as described herein.

[0015] One aspect of the invention relates to a pharmaceutical composition comprising an antibody or fragment that binds to a human PD-1 protein as described herein and a pharma- ceutically acceptable carrier or excipient. In some embodiments, the pharmaceutical composition further comprises at least one additional therapeutic agent. For example, the therapeutic agent can be a toxin, a radiolabel, an siRNA, a small molecule, or a cytokine.

[0016] One aspect of the present invention relates to a pharmaceutical composition comprising a bispecific antibody or fragment that binds to human PD-1 protein, a second antigen-binding fragment having specificity for a molecule on an immune cell as described herein, and a pharma- ceutically acceptable carrier or excipient. In some embodiments, the pharmaceutical composition further comprises at least one additional therapeutic agent. For example, the therapeutic agent can be a toxin, a radiolabel, an siRNA, a small molecule, or a cytokine.

[0017] One aspect of the invention relates to a pharmaceutical composition comprising a bispecific antibody or fragment that binds to human PD-1 protein, as well as a second, third, fourth or fifth antigen-binding fragment having specificity for a molecule on an immune cell, as described herein, and a pharma- ceutically acceptable carrier or excipient. In some embodiments, the pharmaceutical composition further comprises at least one additional therapeutic agent. For example, the therapeutic agent can be a toxin, a radiolabel, an siRNA, a small molecule, or a cytokine.

[0018] One aspect of the invention relates to an isolated cell comprising one or more polynucleotides encoding a PD-1 antibody or fragment thereof as described herein.One aspect of the invention relates to an isolated cell comprising one or more polynucleotides encoding a bispecific antibody or fragment thereof as described herein.One aspect of the invention relates to an isolated cell comprising one or more polynucleotides encoding a multispecific antibody or fragment thereof as described herein.

[0019] One aspect of the invention relates to a kit comprising a syringe, needle, or applicator and instructions for use for administering a pharmaceutical composition to a subject.

[0020] One aspect of the invention relates to an engineered cell comprising a chimeric antigen receptor, the chimeric antigen receptor comprising an extracellular ligand binding domain specific for an antigen on the surface of a cancer cell, the antigen comprising PD-1. One aspect of the invention also relates to an engineered cell comprising a chimeric antigen receptor, the chimeric antigen receptor comprising an extracellular ligand binding domain specific for a first antigen and a second antigen on the surface of a cancer cell, the first antigen comprising CXCR4 and the second antigen comprising CLDN4, or the first antigen comprising CAIX and the second antigen comprising CD70, or the first antigen comprising MUC1 and the second antigen comprising Msln. In one embodiment, the extracellular ligand binding domain comprises an antibody or a fragment thereof. In one embodiment, the antibody comprises a VH and / or VL according to Tables 1-11, or any combination thereof, the antibody further comprising a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129. In one embodiment, the antibody comprises CDR1, CDR2, and / or CDR3 of Table 12, or any combination thereof, and the antibody further comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129. In one embodiment, the engineered cell is a T cell, a NK cell, or a NKT cell. In one embodiment, the T cell is a CD4+, CD8+, CD3+ panT cell, or any combination thereof.

[0021] One aspect of the invention relates to a method of treating cancer in a subject. In one embodiment, the method comprises administering to a subject in need of cancer treatment a therapeutically effective amount of a composition comprising an antibody as described herein. In one embodiment, the method comprises administering to a subject in need of cancer treatment a therapeutically effective amount of a pharmaceutical composition as described herein. In one embodiment, the method comprises administering to a subject in need of cancer treatment a therapeutically effective amount of a CAR composition as described herein. In some embodiments, the cancer expresses PD-1. In other embodiments, the cancer comprises non-small cell lung cancer, melanoma, ovarian cancer, lymphoma, B-cell chronic lymphocytic leukemia (CLL), or renal cell carcinoma. In a further embodiment, the method further comprises administering to the subject a chemotherapeutic agent.

[0022] [The present invention 1001] 1. An isolated multispecific antibody or antigen-binding fragment thereof that binds to human programmed cell death 1 (PD-1) protein and interleukin-12 (IL-12) receptor, G-(X 1 )-TF-(X 2 X 3 )-Y-(X 4 ) (SEQ ID NO: 81), G-(X 5 )-TF-(X 6 X 7 X 8 )-A (SEQ ID NO: 82), GDSVSSDNYF (SEQ ID NO: 43), or GYTFNRFG (SEQ ID NO: 55), CDR2 comprising ISWNSGSI (SEQ ID NO: 19), IYPDDSDT (SEQ ID NO: 33), VYYNGNT (SEQ ID NO: 45), TNPYNGNT (SEQ ID NO: 57), or ISYDGSNK (SEQ ID NO: 69), CDR3 comprising ASDYGDKYYYYGMDV (SEQ ID NO: 21), AFWGASGAPVNGFDI (SEQ ID NO: 35), ATETPPTSYFNSGPFDS (SEQ ID NO: 47), ARVVAVNGMDV (SEQ ID NO: 59), ASQTVAGSDY (SEQ ID NO: 71), or ASDYGDKYSYYGMDV (SEQ ID NO: 79), or a combination of these CDRs a heavy chain comprising CDR1 comprising SSNIGSNT (SEQ ID NO: 24), SSNIGAGYV (SEQ ID NO: 37), SNNVGAHG (SEQ ID NO: 49), SGSIAAYY (SEQ ID NO: 61), or NIGSKS (SEQ ID NO: 73); (X 9 )-DN (SEQ ID NO: 83), (X 10 )-NN (SEQ ID NO: 84), or DDS (SEQ ID NO: 75), CDR3 comprising AAWDGGLNGRGV (SEQ ID NO: 28), AAWDDSLNAPV (SEQ ID NO: 41), SSWDSSLSGYV (SEQ ID NO: 53), QSYDSSNLWV (SEQ ID NO: 65), or QVWHSVSDQGV (SEQ ID NO: 77), or a combination of these CDRs a light chain, or Combinations of these and further comprising a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129. [The present invention 1002] The antibody of the present invention which is bispecific. [The present invention 1003] The antibody of the present invention which is a single chain antibody. [The present invention 1004] At least 1.0×10 -6 The antibody of the present invention having a binding affinity of M. [The present invention 1005] The antibody or fragment of the present invention, wherein the constant region comprises a heavy chain constant region, a light chain constant region, an Fc region, or a combination thereof. [The present invention 1006] X 1 、X 4 、X 5 or X 8 is a nonpolar amino acid residue. [The present invention 1007] X 1 、X 4 、X 5 or X 8 is tyrosine (Y), phenylalanine (F), or alanine (A). [The present invention 1008] X 2 、X 3 、X 4 、X 6 、X 7 or X 8 is a polar amino acid residue. [The present invention 1009] X 2 、X 3 、X 4 、X 6 、X 7 or X 8 is aspartic acid (D), threonine (T), serine (S), or tryptophan (W). [The present invention 1010] X1 is phenylalanine (F) or tyrosine (Y). [The present invention 1011] X 2 is aspartic acid (D), threonine (T), or serine (S). [The present invention 1012] X 3 is aspartic acid (D), threonine (T), or serine (S). [The present invention 1013] X 4 is alanine (A) or tryptophan (W). [The present invention 1014] X 5 is phenylalanine (F) or tyrosine (Y). [The present invention 1015] X 6 is aspartic acid (D) or serine (S). [The present invention 1016] X 7 is aspartic acid (D) or serine (S). [The present invention 1017] X 8 is phenylalanine (F) or tyrosine (Y). [The present invention 1018] X 9 is a polar hydrophilic amino acid residue. [The present invention 1019] X 9 is glutamic acid (E), asparagine (N), or aspartic acid (D). [The present invention 1020] X 10 is a polar hydrophilic amino acid residue. [The present invention 1021] X 10 is serine (S) or arginine (R). [The present invention 1022] An antibody composition comprising at least one antibody, said at least one antibody comprising two heavy chains and two light chains, the heavy chain CDRs are between residues 27 and 38, residues 56 and 65, and residues 105 and 119 according to the IMGT numbering of SEQ ID NO:1, or between residues 27 and 38, residues 56 and 65, and residues 105 and 119 according to the IMGT numbering of SEQ ID NO:3, or between residues 27 and 38, residues 56 and 65, and residues 105 and 121 according to the IMGT numbering of SEQ ID NO:5, or between residues 27 and 38, residues 56 and 65, and residues 105 and 115 according to the IMGT numbering of SEQ ID NO:7, or between residues 27 and 38, residues 56 and 65, and residues 105 and 115 according to the IMGT numbering of SEQ ID NO:9 or between residues 27 and 38, 56 and 65, and 105 and 114 according to the IMGT numbering of SEQ ID NO: 12, or between residues 27 and 38, 56 and 65, and 105 and 119 according to the IMGT numbering of SEQ ID NO: 13, or between residues 27 and 38, 56 and 65, and 105 and 119 according to the IMGT numbering of SEQ ID NO: 15, with the proviso that at least one of said heavy chain CDRs differs by a single amino acid substitution compared to the reference CDR; and the light chain CDRs are between residues 27 and 38, residues 56 and 65, and residues 105 and 116 according to the IMGT numbering of SEQ ID NO:2, or between residues 27 and 38, residues 56 and 65, and residues 105 and 115 according to the IMGT numbering of SEQ ID NO:4, or between residues 27 and 38, residues 56 and 65, and residues 105 and 115 according to the IMGT numbering of SEQ ID NO:6, or between residues 27 and 38, residues 56 and 65, and residues 105 and 115 according to the IMGT numbering of SEQ ID NO:8, between residues 6 and 65, and residues 105 and 114, or between residues 27 and 38, residues 56 and 65, and residues 105 and 115 according to the IMGT numbering of SEQ ID NO: 10, or between residues 27 and 38, residues 56 and 65, and residues 105 and 116 according to the IMGT numbering of SEQ ID NO: 11, with the proviso that at least one of said light chain CDRs differs by a single amino acid substitution compared to the reference CDR; the antibody composition binds to an epitope that includes amino acid residues in the face of PD-1 generated by the FCC' chain but does not contact the C'D loop of PD-1 that includes non-adjacent amino acids in SEQ ID NO:XX; and the antibody further comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129. Antibody composition. [The present invention 1023] 1. An isolated multispecific antibody or fragment thereof that binds to human programmed cell death 1 (PD-1) protein and interleukin-12 (IL-12) receptor, (a) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28, or (b) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 31, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 33, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 35, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 37, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 39, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 41, or (c) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 43, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 45, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 47, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 49, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 51, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 53, or (d) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 55, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 57, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 59, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 61, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 63, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 65, or (e) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 67, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 69, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 71, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 73, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 75, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 77, or (f) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28, or (g) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 79, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28, or (h) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28, or (i) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28, or (j) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 79, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28 and further comprising a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129. [The present invention 1024] 1. An isolated multispecific antibody or antigen-binding fragment thereof, wherein the antibody binds to human PD-1 protein and comprises a heavy chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 1, 3, 5, 7, 9, 12, 13, and 15, and a light chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, and 11, and the antibody binds to an interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129. [The present invention 1025] 1. An isolated multispecific antibody or antigen-binding fragment thereof, wherein the antibody binds to PD-1 and comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:1, and the light chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:2, and wherein the antibody binds to an interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO:129. [The present invention 1026] 1. An isolated multispecific antibody or antigen-binding fragment thereof, wherein the antibody binds to PD-1 and comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:3 and the light chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:4, and wherein the antibody binds to an interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO:129. [The present invention 1027] 1. An isolated multispecific antibody or antigen-binding fragment thereof, wherein the antibody binds to PD-1 and comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:5, and the light chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:6, and wherein the antibody binds to an interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO:129. [The present invention 1028] 1. An isolated multispecific antibody or antigen-binding fragment thereof, wherein the antibody binds to PD-1 and comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:7, and the light chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:8, and wherein the antibody binds to an interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO:129. [The present invention 1029] 1. An isolated multispecific antibody or antigen-binding fragment thereof, wherein the antibody binds to PD-1 and comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO:9, and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO:10, and the antibody binds to an interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO:129. [The present invention 1030] 1. An isolated multispecific antibody or antigen-binding fragment thereof, wherein the antibody binds to PD-1 and comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO:1, and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO:11, and the antibody binds to an interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO:129. [The present invention 1031] 1. An isolated multispecific antibody or antigen-binding fragment thereof, wherein the antibody binds to PD-1 and comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO: 12, and the light chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO: 2, and wherein the antibody binds to an interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129. [The present invention 1032] 1. An isolated multispecific antibody or antigen-binding fragment thereof, wherein the antibody binds to PD-1 and comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO: 13, and the light chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO: 2, and wherein the antibody binds to an interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129. [The present invention 1033] 1. An isolated multispecific antibody or antigen-binding fragment thereof, wherein the antibody binds to PD-1 and comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 13, and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 11, and the antibody binds to an interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129. [The present invention 1034] 1. An isolated multispecific antibody or antigen-binding fragment thereof, wherein the antibody binds to PD-1 and comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 15, and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 11, and the antibody binds to an interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129. [The present invention 1035] A nucleic acid encoding any one of the antibodies of the present invention Nos. 1001 to 1034. [The present invention 1036] A pharmaceutical composition comprising any one of the antibodies or fragments thereof of the present invention 1001 to 1034 and a pharma- ceutically acceptable carrier or excipient. [The present invention 1037] The pharmaceutical composition of the present invention 1036 further comprising at least one additional therapeutic agent. [The present invention 1038] The pharmaceutical composition of the present invention 1037, wherein said therapeutic agent is a toxin, a radiolabel, an siRNA, a small molecule, or a cytokine. [The present invention 1039] An isolated cell comprising one or more polynucleotides encoding any one of the antibodies or fragments thereof of the present invention 1001 to 1034. [The present invention 1040] A vector comprising the nucleic acid of the present invention. [The present invention 1041] A cell comprising the vector of the present invention. [The present invention 1042] A kit comprising at least one antibody composition of the invention 1036, a syringe, needle or applicator for administering said at least one antibody to a subject, and instructions for use. [The present invention 1043] 1. An engineered cell comprising a chimeric antigen receptor, the chimeric antigen receptor comprising an extracellular ligand binding domain specific for an antigen on the surface of a cancer cell, the antigen comprising PD-1. [The present invention 1044] An engineered cell comprising a chimeric antigen receptor, the chimeric antigen receptor comprising an extracellular ligand binding domain specific for a first antigen and a second antigen on the surface of a cancer cell, the first antigen comprising CXCR4 and the second antigen comprising CLDN4, or the first antigen comprising CAIX and the second antigen comprising CD70, or the first antigen comprising MUC1 and the second antigen comprising Msln. [The present invention 1045] 1043. The engineered cell of claim 1044, wherein said extracellular ligand binding domain comprises an antibody or a fragment thereof. [The present invention 1046] The engineered cell of the present invention 1045, wherein the antibody comprises a VH and / or VL according to Tables 1-11, or any combination thereof, and the antibody further comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129. [The present invention 1047] The engineered cell of the present invention 1045, wherein the antibody comprises CDR1, CDR2, and / or CDR3 of Table 12, or any combination thereof, and the antibody further comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129. [The present invention 1048] The engineered cell of claim 1043 or 1044, wherein the engineered cell comprises a T cell, a NK cell, or a NKT cell. [The present invention 1049] The engineered cell of the present invention 1048, wherein said T cells are CD4+, CD8+, CD3+ pan T cells, or any combination thereof. [The present invention 1050] A method for treating cancer in a subject, comprising administering to a subject in need thereof a therapeutically effective amount of an antibody of any of claims 1001 to 1034, a pharmaceutical composition of claim 1036, or a composition comprising a CAR composition of any of claims 1043 to 1048. [The present invention 1051] The method of claim 1050, wherein the cancer expresses PD-1. [The present invention 1052] The method of claim 1050, wherein the cancer comprises non-small cell lung cancer, melanoma, ovarian cancer, lymphoma, B-cell chronic lymphocytic leukemia (CLL), or renal cell carcinoma. [The present invention 1053] The method of claim 1050, further comprising administering to said subject a chemotherapeutic agent. Other objects and advantages of the present invention will become readily apparent from the following description. [Brief description of the drawings]

[0023] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0024] [Figure 1] 1 shows an overview of the PMPL panning strategy for antibody discovery (e.g., PD-1 antibodies of the invention). [Figure 2-1] FIG. 2 shows a schematic of the VH and VL sequences of the anti-PD-1 antibody P4-B3. [Figure 2-2] See description of Figure 2-1. [Figure 3-1] Figure 3 illustrates the three-dimensional protein structure of human PD-1, highlighting in red the differences between human and cynomolgus PD-1. The corresponding amino acid sequences are shown below. A high degree of similarity is observed between human and cynomolgus PD-1. The three-dimensional protein structure of PD-1 bound to nivolumab is also shown. [Figure 3-2] See description of Figure 3-1. [Figure 4] 1 is a graph showing binding curves of P4-B3 minibody to human and cynomolgus PD-1. [Diagram 5] 1 shows a graph of the octet binding curves of various formats of P4-B3. [Figure 6] Binding curves for PD-L1 competition assay using PD-1 antibody. [Figure 7] Binding curves for IgG ELISA are shown. [Figure 8-1] FIG. 8 shows FACS analysis plots of PD1 FACS performed with anti-PD1 IgG. [Figure 8-2] See description of Figure 8-1. [Figure 9] FIG. 1 is a schematic diagram of the PD1-PDL1 bioassay. [Figure 10A] Figure 10 shows a graph of induction curves from a commercially available PD1-PDL1 bioassay. (A) IgG1wt monomeric version of P4-B3 with pembro (pembrolizumab) and nivo (nivolumab). As shown, the P4-B3 anti-PD1 antibody shows approximately half the signal of pembro and nivo. [Figure 10B] Figure 10 shows a graph of induction curves from a commercially available PD1-PDL1 bioassay. (B) Comparison of hexamers with different IgG1 LALA configurations. The hexamer configuration shows an approximately 2-3 fold shift in the dose-response curve. [Figure 10C] Figure 10 shows a graph of induction curves from a commercial PD1-PDL1 bioassay. (C) Direct comparison of IgG4 constructs (monomer and hexamer) with nivo. Here, a similar trend to 10A and 10B is observed. The commercial antibody is 2x more potent than P4-B3, with the hexamer shifting approximately 2-3 fold compared to the monomer. [Figure 11] Schematic ribbon diagram of human PD-1 (see Cheng, X et al., (2013). JBC doi.org / 10.1074 / jbc.M112.448126). PD-1 is an antiparallel B sandwich. Depicting an antiparallel B sandwich. The front sheet of the PD-1 ribbon diagram includes G, F, C, C', and the back sheet of the PD-1 ribbon diagram includes A, B, E, D. PD-1 lacks cysteines in the stalk region, preventing homodimerization of PD-1. [Figure 12-1] Figure 12 is a schematic of the protein structure showing the interaction of PD-1 with its ligands PDL-1 or PDL-2. See Cheng et al, Structure and Interactions of the Human Programmed Cell Death 1 Receptor, JBC 2013; Tan et al. (2016) Protein Cell DOI: 10.1007 / s13238-016-0337-7, and Yan et al. (2008) PNAS, DPO: 10.1073 / pnas.0804453105. [Figure 12-2] See description of Figure 12-1. [Figure 13-1] Figure 13 shows ribbon diagrams of PD-1 binding to commercial antibodies. (A) Nivo blocks PD-L1 by binding to the FG loop. (B) Pembro blocks by binding to the C and C' strands. See Fessas et al,Seminars in Oncology,2017. [Figure 13-2] See description of Figure 13-1. [Figure 14] Protein model overlay and amino acid sequence comparison of human and mouse PD-1. Similarity of PD-1 between human and mouse: about 64%. See Cheng, X et al., (2013). JBC doi.org / 10.1074 / jbc.M112.448126. [Figure 15] Protein model overlay and amino acid sequence comparison of human and mouse PD-1. Amino acid residue P110 (purple) introduces a kink into the FG loop. In mouse PD1, this residue orients the BC loop toward the DE loop through hydrophobic interactions between Arg83 and Trp39. Amino acid residue P63 (blue) in human PD-1 moves the loop away from the C' strand, forming a very flexible loop. Without being bound by theory, the difference between these two structures influences the lack of cross-reactivity of Pembro and Nivo with mouse PD-1. See Cheng,X et al.,(2013).JBC doi.org / 10.1074 / jbc.M112.448126. [Figure 16] 1 is a graph showing P4-B3 binding to mouse PD-1. P4-B3 has high affinity for mouse PD-1, which distinguishes it from Pembro and Nivo. [Figure 17]

[0033] Figure 1 is a schematic diagram of a staining strategy that can be used to differentially label displayed yeast libraries prior to screening by FACS. See Cherf and Cochran, 2015, Methods Mol Biol. [Figure 18]A plot of FACS analysis is shown. Standard staining sorting is shown with blue gates being positive hits and green gates being negatives. The blue gate is shifted upwards along the x=y axis. Without being bound by theory, PD-1 antibody clones bind PD-1 with higher affinity. [Figure 19] Plots of FACS analysis of dynamic staining are shown. Cells collected in the blue gate, examples of targets are shown in red circles. The collection gate was kept wide to obtain many samples. [Figure 20] 1 is a graph of the binding curve of P4-B3 mutants. [Figure 21] 1 is a graph of the binding curve of P4-B3 mutants. [Figure 22-1] FIG. 22 is a schematic of the P4-B3 (anti-PD1) germline alignment and a diagram of the amino acid residues that were altered in the generated P4-B3 mutants. [Figure 22-2] See description of Figure 22-1. [Figure 22-3] See description of Figure 22-1. [Diagram 23] A graph of the octet binding curves of various P4-B3 mutants is shown.SA sensors were coated with 2.5ug / ml of biotinylated PD-1. [Figure 24] Binding curves of PD-L1 competition assay using PD-1 antibodies (various P4-B3 mutants) are shown. [Diagram 25] FIG. 1 is a schematic representation of the amino acid residues that were altered in the P4-B3 mutants generated. [Figure 26-1] Figure 26 is a schematic diagram of the germline alignment of anti-PD1 antibody clones. These candidates were explored via soluble protein panning (PD1-hFc). [Figure 26-2] See description of Figure 26-1. [Figure 26-3] See description of Figure 26-1. [Figure 26-4] See description of Figure 26-1. [Figure 27]A graph of the octet binding curve is shown. Both PD1 and PDL1 have His tags. As evident from sensor H4, the sensor was not saturated before adding PDL1. Further sequencing confirmed that PD1#5 is not an antibody. A4: R&D anti-PD1 (AF1086), B4: PD1 mini3, C4: PD1 mini4, D4: PD1 mini5, E4: PD1 mini7, F4: PD1 mini13, G4: TIG1 (control ab) + PDL1, H4: No Ab + PD1 to confirm if the sensor was saturated. [Figure 28] A graph of the octet binding curves is shown. Both PD1 and PDL1 have His tags as evident from sensor H4. The sensors were not saturated prior to the addition of PDL1. PD1 and PDL1 were used at 2.5ug / ml. Antibodies were used at 2ug / ml. All samples were diluted in 1xPBST. A new PD-1 antibody was used in scFv-Fc format, Nivo and Pembro are commercial formulations. A6: Nivo, B6: Pembro, C6: PD1#3, D6: PD1#4, E6: PD1#5, F6: PD1#7, G6: PD1#13, H6: TIG1(-). [Figure 29] A graph of the octet binding curve is shown. SA sensors were loaded with 2.5ug of expi293 expressing soluble PD1-avi and biotinylated with Avidity's biotinylation kit. PD1#3 showed a high off rate. [Figure 30-1] FIG. 30 is a schematic diagram of the germline sequence of anti-PD1 antibody clone P4-B7. [Figure 30-2] See description of Figure 30-1. [Diagram 31] A graph of P4-B7 minibody binding curves to human and cynomolgus PD-1 is shown. Curves were generated in expi293 cells 48 hours after transfection. Expression levels were normalized by commercial antibodies for the human variants but not for the cynomolgus variants. Normalization was not performed for the cynomolgus variants because the commercial antibodies used have not been reported to bind to cynomolgus PD#1. [Diagram 32] A graph of the binding curve of IgG ELISA with P4-B7 is shown. The reaction kinetics were not suitable for proceeding because P4-B7 shifted significantly to the right. Above, ELISA plates were coated with soluble PD1 at 1ug / ml for 2 hours at 37℃. The plates were then washed and blocked with 2%BSA / PBS for 1 hour at 37℃. Blocking solution was removed and 3-fold serial dilutions of the antibodies starting at 6ug / ml were added to each well (100ul) in 2% milk-PBST. The plates were then incubated at room temperature with gentle shaking, washed 6 times with PBS-T, and secondary anti-human Fc-HRP (1:150k, Bethyl) was added. The plates were again incubated at room temperature with gentle shaking for 1 hour, then washed 6 times with PBS-T. TMB substrate was added and the plates were incubated at 30C for 10 minutes to promote the HRP reaction. The signal was then quenched with TMB stop solution and read at 450nm. Bottom, the protocol for data acquisition was the same as the protocol for data acquisition in the graph above, except plates were coated with 3-fold serial dilutions of antigen starting at 6ug / ml. Antibody was then added to all wells at a constant concentration of 1ug / ml. [Diagram 33] Graph of induction curve from a commercially available PD1-PDL1 bioassay is shown. [Diagram 34] A schematic diagram of the Promega PD1-PDL1 bioassay (J1250) is shown. The Promega PD1-PDL1 bioassay (J1250) was performed using wild-type aPD-1scFv-Fc (P4-B3) and single and combo mutants generated from a random mutagenesis yeast library. Nivolumab was used as a benchmark control. [Diagram 35]P4-B3 mutants Promega bioassay (scFv-Fc format bioassay) are shown. Nivo (black circle) reaches about 6-fold induction, which is similar to previous experiments. Single mutants HLkin-1, HL-7, and combo mutants Mut+2, Mut+3 show higher or equal levels of PD-1 / PD-L1 blockade compared to Nivo. This is also reflected in the EC50 values, where the EC50 value of Mut+2 is about half that of Nivo. P4-B3 wild type shows lower levels of blockade, with an EC50 value 1.75-fold greater than Nivo. The point mutations identified by our random mutagenesis yeast display library are believed to have a significant impact on binding and checkpoint blocking ability. All P4-B3 samples used in this assay are in scFv-Fc format. Only Nivo and F10 were used as full IgG. [Diagram 36] Octet binding curves of P4-B3 WT / mutant IgG. SA sensors were coated with biotinylated PD-1 and immersed in various concentrations of anti-PD1 antibodies. The first step after baseline indicates antibody binding and the second step indicates dissociation. As is evident from this figure, P4-B3 WT has a fast off rate, whereas mutant and Pembro have much slower off rates. [Figure 37] Binding curves of P4-B3 single versus combo mutants with mouse PD-1 (mPD-1) in scFv-Fc format are shown. [Figure 38] Unless otherwise stated, binding curves of P4-B3 single vs. combo mutants with hPD1 in scFv-Fc format are shown. [Figure 39] Shown is the MFI of P4-B3 single vs. combo mutants with hPD1 in scFv-Fc format, excluding pembro / nivo / WT IgG1. [Figure 40-1] FIG. 40 is a schematic diagram of the design of aPD1-scIL12 fusions such as HCF2A scIL12. [Figure 40-2] See description of Figure 40-1. [Figure 41-1]FIG. 41 is a schematic diagram of the design of aPD1-scIL12 fusions such as HCG4S scIL12. [Figure 41-2] See description of Figure 41-1. [Figure 42-1] FIG. 42 is a schematic diagram of the design of aPD1-scIL12 fusions such as LC F2A scIL12. [Figure 42-2] See description of Figure 42-1. [Figure 43-1] FIG. 43 is a schematic diagram of the design of aPD1-scIL12 fusions such as LC G4S scIL12. [Figure 43-2] See description of Figure 43-1. [Figure 44-1] FIG. 44 is a schematic diagram of the cloning strategy of aPD1-scIL12 fusion using stuffer. [Figure 44-2] See description of Figure 44-1. [Figure 44-3] See description of Figure 44-1. [Figure 44-4] See description of Figure 44-1. [Figure 44-5] See description of Figure 44-1. [Figure 44-6] See description of Figure 44-1. [Figure 44-7] See description of Figure 44-1. [Figure 44-8] See description of Figure 44-1. [Figure 44-9] See description of Figure 44-1. [Figure 44-10] See description of Figure 44-1. [Figure 44-11] See description of Figure 44-1. [Figure 44-12] See description of Figure 44-1. [Figure 45A]Figure 45 shows (A) a photographic image of a protein gel showing protein expression and (B) a photographic image of a protein gel showing expression and purification of a protein sample. For Figure 45B, samples were run on a NuPAGE Tris-acetate 3-8% gel in Tris-acetate SDS running buffer at 120V for 1 hour. The reduced samples were mixed with 10% BME. [Figure 45B] See legend to Figure 45A. [Figure 46-1] Figure 46 is a graph of the kinetic binding data of aPD1-scIL12 fusion protein. Octet assays were performed to measure the binding affinity of P4-B3 WT versus Mut+2 and Mut+3 to PD-1. [Figure 46-2] See description of Figure 46-1. [Figure 47] Figure 13 is a graph of kinetic binding data for aPD1-scIL12 fusion proteins. Octet assays were performed to measure the binding affinity of P4-B3 mut+3 HC and LC scIL12 constructs to PD-1. [Figure 48] FIG. 1 is a schematic diagram of the IL-12 signaling cascade. [Figure 49] 13 is a graph of an IL-12 reporter assay. [Figure 50] FIG. 1 is a schematic showing the plate layout for the killing assay using CAR T cells. [Figure 51] Graph showing a comparison of aPD1-IL12-HC fusion with aPD1 in a killing assay. Percentage of killed target cells = (T0-x) / T0 [Figure 52] Graph showing a comparison of aPD1-IL12-HC fusion, aPD1, and IL-12 in a killing assay. Percentage of killed target cells = (T0-x) / T0 [Figure 53-1] Figure 53 shows the results of cytokine ELISA in a bar graph, * p<0.05, ** p<0.005, *** p<0.0005, **** p<0.0001. [Figure 53-2] See description of Figure 53-1. [Figure 54-1] Figure 54 shows the results of cytokine ELISA in a bar graph, * p<0.05, ** p<0.005, *** p<0.0005, **** p<0.0001. [Figure 54-2] See description of Figure 54-1. [Figure 55-1] Figure 55 shows the results of cytokine ELISA in a bar graph, * p<0.05, ** p<0.005, *** p<0.0005, **** p<0.0001. [Figure 55-2] See description of Figure 55-1. [Figure 56-1] FIG. 56 is a schematic diagram of scIL-12 fusion antibodies and mechanism of action. [Figure 56-2] See description of Figure 56-1. [Figure 57] FIG. 1 is a schematic representation of the amino acid residues that were altered in the P4-B3 mutants generated. [Figure 58] Schematic diagram of a mixed lymphocyte reaction (MLR) assay. CD4+ T cells express high levels of PD-1 upon activation. DCs express high levels of PD-L1 to improve self-tolerance in the body. T cell activation via MHC mismatch is limited due to PD-1 / PD-L1 blockade. Addition of anti-PD-1 antibody removes this inhibitory signal, increasing T cell activation (measured by cytokine release). [Figure 59-1] FIG. 59 shows a graph of the MLR assay showing cytokine production, as indicated in the graph title. [Figure 59-2] See description of Figure 59-1. [Figure 60-1] FIG. 60 shows a graph of the MLR assay showing cytokine production, as indicated in the graph title. [Figure 60-2] See description of Figure 60-1. [Figure 61-1] FIG. 61 shows a statistical data table of the MLR assay of Pembro versus P4B3mut+3 IgG4. [Figure 61-2] See description of Figure 61-1. [Figure 62-1] FIG. 62 shows a statistics table for the Pembro vs. P4B3mut+3 IgG4 MLR assay. [Figure 62-2] See description of Figure 62-1. [Figure 63-1] Figure 63 shows a statistical data table of the MLR assay of Pembro versus P4B3mut+3 IgG4. [Figure 63-2] See description of Figure 63-1. [Figure 64-1] Figure 64 shows a statistical data table of the MLR assay of Pembro versus P4B3mut+3 IgG4. [Figure 64-2] See description of Figure 64-1. [Figure 65-1] FIG. 65 shows a graph of the MLR assay showing cytokine production, as indicated in the graph title. [Figure 65-2] See description of Figure 65-1. [Figure 66-1] FIG. 66 shows a graph of the MLR assay showing cytokine production, as indicated in the graph title. [Figure 66-2] See description of Figure 66-1. [Figure 67] FIG. 1 is a schematic diagram of a construct comprising constant region-linker-IL12, further comprising the p40 and p35 subunits of IL-12 separated by an MMP9 cleavage site (GPLGVRG). [Figure 68] FIG. 1 is a schematic diagram of a construct comprising constant region-linker-IL12 (further comprising the p40 and p35 subunits of IL-12 separated by a mutated MMP9 cleavage site). [Figure 69] FIG. 1 is a schematic diagram of armored CAR-T cells. [Figure 70] FIG. 1 is a schematic diagram of cytokines that stimulate CART therapy. [Figure 71-1] FIG. 71 is a schematic diagram of the fusion of P4B3mut+3-scIL12 LC with an extended (G4S)5 linker. [Figure 71-2] See description of Figure 71-1. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0025] Detailed Description of the Invention Abbreviations and Definitions Detailed description of one or more embodiments is provided herein.However, it is understood that the present invention can be embodied in various forms.Therefore, the specific details disclosed herein should not be interpreted as limiting, but as a basis for claims and as a representative basis for teaching a person skilled in the art to use the present invention in any suitable manner.

[0026] The singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. The use of the words "a" or "an" when used in conjunction with the term "comprising" in the claims and / or specification can mean "one," but is also consistent with the meaning of "one or more," "at least one," and "one or more."

[0027] Whenever any of the phrases "for example," "such as," "including," and the like are used herein, unless expressly stated otherwise, it is understood that the phrase "without limitation" is accompanying. Similarly, "an example," "exemplary," and the like are understood to be non-limiting.

[0028] The term "substantially" permits deviations from the descriptors that do not adversely affect the intended purpose. It is understood that a descriptor is modified by the term "substantially" even if the word "substantially" is not expressly recited.

[0029] Terms such as "comprising" and "including" and "having" and "involving" (and similarly "comprises," "includes," "has," and "involves") are used interchangeably and have the same meaning. Specifically, each of the terms is defined consistent with the general U.S. patent law definition of "comprising," and therefore is to be construed as an open term meaning "at least the following," and not excluding additional features, limitations, aspects, etc. Thus, for example, "a process comprising steps a, b, and c" means that the process includes at least steps a, b, and c. Whenever the term "a" or "an" is used, it is to be understood as "one or more," unless such an interpretation is meaningless in the context.

[0030] As used herein, the term "about" is used herein to mean approximately, roughly, approximately, or within the region. When the term "about" is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the stated numerical values. In general, the term "about" is used herein to modify numerical values ​​above and below the stated value by a variance of 20 percent above or below (high or low).

[0031] PD-1 Programmed T-cell death 1 (PD-1) is a transmembrane protein present on the surface of T cells that, when bound to programmed T-cell death ligand 1 (PD-L1) on tumor cells, results in the suppression of T-cell activity and a decrease in T-cell-mediated cytotoxicity. Thus, PD-1 and PD-L1 are immune downregulators or immune checkpoint "off switches." Examples of PD-1 inhibitors include, but are not limited to, nivolumab, (Opdivo) (BMS-936558), pembrolizumab (Keytruda), pidilizumab, AMP-224, MEDI0680 (AMP-514), PDR001, MPDL3280A, MEDI4736, BMS-936559, and MSB0010718C.

[0032] The immune system must maintain a balance between an effective response to eliminate pathogens and the maintenance of tolerance to prevent autoimmune diseases. T cells are central to maintaining this balance, and their proper regulation is primarily orchestrated by molecules of the B7-CD28 family. The interaction between members of the B7 family, acting as ligands, and members of the CD28 family, acting as receptors, not only provides important positive signals that initiate, enhance, and sustain T cell responses, but also contributes important negative signals that limit, terminate, and / or dampen T cell responses when necessary. PD-1 is a member of the CD28 family.

[0033] The binding between PD-L1 and PD-1 has a profound effect on the regulation of T cell responses. Specifically, PD-L1 / PD-1 interaction inhibits T cell proliferation and the production of effector cytokines that mediate T cell activity and immune responses, such as IL-2 and IFN-γ. This negative regulatory function is important for preventing T cell-mediated autoimmunity and immunopathology. However, the PD-1 / PD-L1 axis has also been shown to be involved in T cell exhaustion, whereby the negative regulatory function inhibits T cell responses to adversely affect the host. Prolonged or chronic antigen stimulation of T cells may induce a negative immunological feedback mechanism, whereby antigen-specific responses are inhibited, resulting in immune evasion of pathogens. T cell exhaustion may also progress to physical deletion of the antigen-specific T cells themselves. Expression of PD-1 on T cells is upregulated upon chronic antigen stimulation, and its binding to PD-L1 blocks effector function in both CD4+ (T helper cells) and CD8+ (cytotoxic T lymphocytes or CTL) T cells, thus indicating a PD-1 / PD-L1 interaction in inducing T cell exhaustion.

[0034] Recent studies have shown that some chronic viral infections and cancers have developed immune evasion tactics that specifically exploit the PD-1 / PD-L1 axis by inducing PD-1 / PD-L1-mediated T cell exhaustion. Many human tumor cells and tumor-associated antigen-presenting cells express PD-L1 at high levels, suggesting that tumors induce T cell exhaustion to evade antitumor immune responses. For example, during chronic HIV infection, HIV-specific CD8+ T cells are functionally impaired, including a reduced ability to produce cytokines and effector molecules and a reduced ability to proliferate. Studies have shown that PD-1 is highly expressed on HIV-specific CD8+ T cells in HIV-infected individuals, suggesting therapeutic potential in treating HIV infection and AIDS patients by blocking the PD-1 / PD-L1 pathway. Taken together, agents that block the PD-1 / PD-L1 pathway offer a novel therapeutic approach for various cancers, HIV infection, and / or other diseases and conditions associated with T cell exhaustion. Therefore, there is an urgent need for agents that can block or prevent PD-1 / PD-L1 interaction.

[0035] Overexpression of PD-L1 has been detected in various cancers. For example, in breast cancer, PD-L1 is overexpressed and associated with high-risk prognostic factors. In renal cell carcinoma, PD-L1 is upregulated and increased expression of PD-1 is also seen in tumor-infiltrating leukocytes. Anti-PD-L1 and anti-PD-1 antibodies have shown some clinical efficacy in Phase I trials in renal cell carcinoma. Therapeutic agents that can bind to PD-1 or PD-L1 may be useful to specifically target tumor cells. Agents that can block PD-1 / PD-L1 interaction may further help treat cancers that have evaded antitumor T-cell activity by inducing T-cell exhaustion. The use of such agents alone or in combination with other anticancer therapeutic agents allows to effectively target tumor cells that overexpress PD-L1 and increase antitumor T-cell activity, thereby enhancing the immune response against the target tumor cells.

[0036] PD-1 and PD-L1 can also be upregulated by T cells after chronic antigen stimulation, for example, by chronic infection. During chronic HIV infection, HIV-specific CD8+ T cells are functionally impaired, with a reduced ability to produce cytokines and effector molecules and a reduced ability to proliferate. PD-1 is highly expressed on HIV-specific CD8+ T cells in HIV-infected individuals. Thus, blocking this pathway may enhance the ability of HIV-specific T cells to proliferate and produce cytokines in response to stimulation by HIV peptides, thereby enhancing the immune response against HIV. Other chronic infections, such as chronic viral, bacterial, and parasitic infections, may also benefit from the use of PD-1 / PD-L1 blockade.

[0037] An embodiment of the present invention provides an isolated multispecific antibody having specificity for PD-1. The term "isolated" as used herein with respect to nucleic acids such as cells, DNA or RNA, refers to a molecule that is separated from other DNA or RNA, respectively, present in the natural source of the macromolecule. The term "isolated" may also refer to a nucleic acid or peptide that is substantially free of cellular material, viral material or medium, if produced by recombinant DNA technology, or chemical precursors or other chemicals, if chemically synthesized. For example, an "isolated nucleic acid" can include a nucleic acid fragment that is not naturally occurring as a fragment and would not be found in the natural state. "Isolated" may also refer to a cell or polypeptide that is isolated from other cellular proteins or tissues. An isolated polypeptide can encompass both purified and recombinant polypeptides. The isolated antibodies were identified through the use of a 27 billion human single chain antibody (scFv) phage display library by using PD-1 as the library selection target. These antibodies are a new class of monoclonal antibodies against PD-1 that can compete with the binding of PD-L1, pembrolizumab, and nivolumab. Furthermore, the monoclonal PD-1 antibodies discussed herein cross-react with the PD-1 protein of cynomolgus monkeys (Macaca fascicularis). The monoclonal PD-1 antibodies discussed herein can also be used in the construction of multispecific antibodies or as payloads for CAR-T cells.

[0038] Ten unique recombinant monoclonal PD-1 antibodies are described herein. These include P4-B3, P4-B7, PD1#2, PD1#3, PD1#13, P4-B3-HLkin1, P4-B3-HL-7, P4-B3-HL-14, P4-B3 HLkin-1, HL-7 mut2, and P4-B3 HLkin-1 HL-7 HL-14 mut3. "Recombinant" in reference to a polypeptide (such as an antibody) or polynucleotide refers to a form of a polypeptide or polynucleotide that is not naturally occurring, a non-limiting example of which can be made by combining polynucleotides or polypeptides that do not normally come together.

[0039] Provided below are the nucleic acid and amino acid sequences of monoclonal PD-1 antibodies, in addition to exemplary wild-type IgG constant regions useful in combination with the VH and VL sequences provided herein (see Table 2). TIFF0007680968000001.tif18154

[0040] Table 1A: Nucleic acid sequences of the variable regions of Ab (antibody) P4-B3 TIFF0007680968000002.tif77152

[0041] Table 1B: Amino acid sequences of the variable regions of Ab P4-B3 TIFF0007680968000003.tif44152

[0042] Table 2A: Nucleic acid sequence of the constant region of Ab P4-B3 - wild type IgG monomer TIFF0007680968000004.tif153152

[0043] Table 2B. Amino acid sequence of the constant region of Ab P4-B3 - wild type IgG monomer TIFF0007680968000005.tif86152

[0044] Table 3A: Nucleic acid sequences of the variable regions of Ab P4-B7 TIFF0007680968000006.tif77152

[0045] Table 3B: Amino acid sequences of the variable regions of Ab P4-B7 TIFF0007680968000007.tif44152

[0046] Table 4A: Nucleic acid sequences of the variable regions of PD1#2 TIFF0007680968000008.tif77152

[0047] Table 4B: Amino acid sequences of the variable regions of Ab PD1#2 TIFF0007680968000009.tif44152

[0048] Table 5A: Nucleic acid sequences of the variable regions of PD1#3 TIFF0007680968000010.tif77152

[0049] Table 5B: Amino acid sequences of the variable regions of Ab PD1#3 TIFF0007680968000011.tif43152

[0050] Table 6A: Nucleic acid sequences of the variable regions of Ab PD1#13 TIFF0007680968000012.tif73152

[0051] Table 6B: Amino acid sequences of the variable regions of Ab PD1#13 TIFF0007680968000013.tif39152

[0052] TIFF0007680968000014.tif11156

[0053] Table 7A: Nucleic acid sequences of the variable regions of Ab P4-B3-HLkin1 TIFF0007680968000015.tif77152

[0054] Table 7B: Amino acid sequences of the variable regions of Ab HLKin1 TIFF0007680968000016.tif43152

[0055] Table 8A: Nucleic acid sequences of the variable regions of Ab P4-B3-HL-7 TIFF0007680968000017.tif81152

[0056] Table 8B: Amino acid sequences of the variable regions of Ab HL-7 TIFF0007680968000018.tif43152

[0057] Table 9A: Nucleic acid sequences of the variable regions of Ab P4-B3-HL-14 TIFF0007680968000019.tif77152

[0058] Table 9B: Amino acid sequences of the variable regions of Ab HL-14 TIFF0007680968000020.tif48152

[0059] Table 10A: Nucleic acid sequences of the variable regions of Ab HLkin-1 HL-7 mut2 TIFF0007680968000021.tif77152

[0060] Table 10B: Amino acid sequences of the variable regions of Ab HLkin-1 HL-7 mut2 TIFF0007680968000022.tif44152

[0061] Table 11A: Nucleic acid sequences of the variable regions of Ab HLkin-1 HL-7 HL-14 mut3 TIFF0007680968000023.tif77152

[0062] Table 11B: Amino acid sequences of the variable regions of Ab HLkin-1 HL-7 HL-14 mut3 TIFF0007680968000024.tif43152

[0063] The amino acid sequences of the complementarity-determining regions of the heavy and light chains of the PD-1 antibody are shown in Tables 12A - B below.

[0064] (Table 12A) Complementarity-determining regions (CDRs) of the heavy chain (V H ) of the PD-1 antibody TIFF0007680968000025.tif114134

[0065] (Table 12B) Complementarity-determining regions (CDRs) of the light chain (V L ) of the PD-1 antibody TIFF0007680968000026.tif114134

[0066] The amino acid sequences of the framework regions of the heavy and light chains of the PD-1 antibody are shown in Tables 13A - B below.

[0067] (Table 13A) Framework regions (FRs) of the heavy chain (V H ) of the PD-1 antibody TIFF0007680968000027.tif202155

[0068] (Table 13B) Framework regions (FRs) of the light chain (V L ) of the PD-1 antibody TIFF0007680968000028.tif202155

[0069] The PD-1 antibodies described herein bind to PD-1. In one embodiment, the PD-1 antibodies have high affinity and high specificity for PD-1. Some embodiments also feature antibodies that have a certain percentage of identity or similarity to the amino acid or nucleotide sequences of the anti-PD-1 antibodies described herein. For example, "homology" or "identity" or "similarity" refers to the sequence similarity between two peptides or two nucleic acid molecules. Homology can be determined by comparing the position of each sequence, which may be aligned for comparison purposes. If a position in the compared sequences is occupied by the same base or amino acid, the molecules are homologous at that position. The degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. For example, an antibody can have 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more amino acid sequence identity when compared to a particular region or the full length of any one of the anti-PD-1 antibodies described herein. For example, an antibody can have 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more nucleic acid sequence identity when compared to a particular region or the full length of any one of the anti-PD-1 antibodies described herein. Sequence identity or similarity for the nucleic acids and proteins of the invention can be determined by sequence comparison and / or alignment by methods known in the art, such as those described in Ausubel et al. eds. (2007) Current Protocols in Molecular Biology. For example, sequence comparison algorithms (i.e., BLAST or BLAST 2.0), manual alignment, or visual inspection can be used to determine percent sequence identity or similarity for the nucleic acids and proteins of the invention.

[0070] "Polypeptide" as used herein can encompass a single "polypeptide" as well as multiple "polypeptides" and refers to a molecule composed of monomers (amino acids) linked in a linear chain by amide bonds (also known as peptide bonds). The term "polypeptide" refers to any one or more chains of two or more amino acids and does not refer to a specific length of the product. Thus, peptide, dipeptide, tripeptide, oligopeptide, "protein," "amino acid chain," or any other term used to refer to a chain of two or more amino acids can refer to a "polypeptide" herein, and the term "polypeptide" can be used in place of or interchangeably with any of these terms. "Polypeptide" can also refer to post-expression modified products of a polypeptide, such as, but not limited to, glycosylation, acetylation, phosphorylation, amidation, derivatization with known protecting / blocking groups, proteolytic cleavage, or modification with non-naturally occurring amino acids. A polypeptide can be derived from a natural biological source or produced by recombinant technology and is not necessarily translated from a specific nucleic acid sequence. It can be generated in any manner, including chemical synthesis. With respect to amino acid sequences, one of skill in the art will readily recognize that individual substitutions, deletions, or additions to a nucleic acid, peptide, polypeptide, or protein sequence that modify, add, delete, or replace a single amino acid or a small percentage of amino acids in the encoded sequence are collectively referred to herein as "conservatively modified variants." In some embodiments, the modification results in the replacement of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. Such conservatively modified variants of the anti-PD-1 antibodies disclosed herein can exhibit increased cross-reactivity to PD-1 compared to unmodified PD-1 antibodies.

[0071] For example, a "conservative amino acid substitution" is one in which an amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues with similar side chains are defined in the art as: basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), non-polar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), β-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, a non-essential amino acid residue in an immunoglobulin polypeptide is replaced with another amino acid residue from the same side chain family. In another embodiment, an amino acid chain can be replaced with a structurally similar chain that differs in the order and / or composition of the side chain family members.

[0072] antibody As used herein, an "antibody" or "antigen-binding polypeptide" can refer to a polypeptide or polypeptide complex that specifically recognizes and binds an antigen. An antibody can be a whole antibody and any antigen-binding fragment, or a single chain thereof. For example, an "antibody" can include any protein or peptide-containing molecule that contains at least a portion of an immunoglobulin molecule that has the biological activity of binding to an antigen. Non-limiting examples include the complementarity determining regions (CDRs) of a heavy or light chain or a ligand-binding portion thereof, the variable region of a heavy or light chain, the constant region of a heavy or light chain, the framework (FR) region, or any portion thereof, or at least a portion of a binding protein. As used herein, the term "antibody" can refer to immunoglobulin molecules and immunoglobulin (Ig) molecules, i.e., immunologically active portions of molecules that contain an antigen-binding site that specifically binds (immunoreacts with) an antigen. "Specifically binds" or "immunoreacts" means that the antibody reacts with one or more antigenic determinants of a desired antigen and not with other polypeptides.

[0073] As used herein, the term "antibody fragment" or "antigen-binding fragment" refers to an antibody that binds to a F (ab’)2 , F (ab)2 , F ab ', F ab , Fv, scFv, etc. Antibody fragments, regardless of structure, bind to the same antigen recognized by the complete antibody. The term "antibody fragment" can include aptamers (such as spiegelmers), minibodies, and diabodies. The term "antibody fragment" can also include any synthetic or engineered protein that acts like an antibody by binding to a specific antigen to form a complex. Antibodies, antigen-binding polypeptides, variants, or derivatives described herein include, but are not limited to, polyclonal, monoclonal, multispecific, human, humanized, or chimeric antibodies, single chain antibodies, epitope-binding fragments, e.g., Fab, Fab', F(ab') 2 , Fds, Fvs, single-chain Fvs (scFv), single-chain antibodies, dAbs (domain antibodies), minibodies, disulfide-linked Fvs (sdFv), fragments containing either the VL or VH domains, fragments produced by a Fab expression library, and anti-idiotypic (anti-Id) antibodies.

[0074] A "single-chain variable fragment" or "scFv" is a fragment of an immunoglobulin heavy chain (V H ) and light chain (V L("scFv") refers to a fusion protein of the variable regions of the VH:VL heterodimers. Single-chain Fv ("scFv") polypeptide molecules are covalently linked VH:VL heterodimers that can be expressed from gene fusions containing VH and VL encoding genes linked by a peptide-encoded linker. (See Huston et al. (1988) Proc Nat Acad Sci USA 85(16):5879-5883). In some embodiments, the regions are linked by a short linker peptide of 10 to about 25 amino acids. The linker can be rich in glycines for flexibility and serine or threonine for solubility, where the VH:VL heterodimers ... H N-terminus and V L or vice versa. The protein retains the specificity of the original immunoglobulin despite the removal of the constant region and the introduction of a linker. Many methods have been described for identifying chemical structures for converting naturally aggregated but chemically separated light and heavy polypeptide chains from antibody V regions into scFv molecules that fold into a three-dimensional structure substantially similar to that of the antigen-binding site. See, for example, U.S. Patent Nos. 5,091,513, 5,892,019, 5,132,405, and 4,946,778, each of which is incorporated by reference in its entirety.

[0075] Very large naive human scFv libraries have been and can be made to provide a large source of rearranged antibody genes against a large number of target molecules. Smaller libraries can be constructed from individuals with infectious diseases to isolate disease-specific antibodies. (See Barbas et al., Proc. Natl. Acad. Sci. USA 89:9339-43 (1992); Zebedee et al., Proc. Natl. Acad. Sci. USA 89:3 175-79 (1992)).

[0076] Antibody molecules obtained from humans are classified into five classes of immunoglobulins, IgG, IgM, IgA, IgE, and IgD, which differ from each other in the nature of the heavy chains present in the molecule. Those skilled in the art will appreciate that heavy chains are classified as gamma, mu, alpha, delta, or epsilon (γ, μ, α, δ, ε), with several subclasses within these (e.g., γ1-γ4). Specific classes include IgG, 1 , IgG 2 , IgG 3 , and IgG 4 Immunoglobulin subclasses (isotypes), such as IgG, IgG2, IgG3, IgG4, IgG5, IgG6, IgG7, IgG8, IgG9, IgG10, IgG11, IgG12, IgG13, IgG14, IgG15, IgG16, IgG17, IgG18, IgG19, IgG20, IgG21, IgG22, IgG23, IgG24, IgG 1 , IgG 2 , IgG 3 , IgG 4 , IgG 5 etc. are well characterized and known to confer functional specificity. With respect to IgG, a standard immunoglobulin molecule contains two identical light chain polypeptides with a molecular weight of approximately 23,000 daltons, and two identical heavy chain polypeptides with a molecular weight of 53,000-70,000. The four chains are typically linked by disulfide bonds in a "Y" configuration, with the light chains surrounding the heavy chains, which begin at the mouth of the "Y" and continue through the variable region. The immunoglobulin or antibody molecules described herein can be of any type (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) or subclass of immunoglobulin molecule.

[0077] Light chains are classified as either kappa or lambda (κ, λ). Each heavy chain class can be associated with either a kappa or lambda light chain. Generally, light and heavy chains are covalently linked to each other, and when immunoglobulins are produced by either hybridomas, B cells, or genetically engineered host cells, the "tails" of the two heavy chains are linked to each other by covalent disulfide bonds or non-covalent bonds. In the heavy chains, the amino acid sequence runs from the N-terminus at the forked end of the Y-shape to the C-terminus at the bottom of each chain.

[0078] Both light and heavy chains are divided into regions of structural and functional homology. The terms "constant" and "variable" are used in a functional sense. The variable domains (VL and VH) of both the light and heavy chain portions determine antigen recognition and specificity. Conversely, the constant domains (CL, and CH1, CH2 or CH3) of the light and heavy chains confer important biological properties such as secretion, transplacental mobility, Fc receptor binding, and complement binding. The term "antigen-binding site" or "binding portion" can refer to the portion of an immunoglobulin molecule involved in antigen binding. The antigen-binding site is formed by amino acid residues of the N-terminal variable ("V") regions of the heavy ("H") and light ("L") chains. Three highly divergent sections within the V regions of the heavy and light chains, called "hypervariable regions", are interposed between more conserved adjacent sections known as "framework regions" or "FRs". Thus, the term "FR" refers to the amino acid sequences naturally found between and adjacent to the hypervariable regions of immunoglobulins. In an antibody molecule, the three hypervariable regions of the light chain and the three hypervariable regions of the heavy chain are arranged relative to one another in three-dimensional space to form an antigen-binding surface. The antigen-binding surface is complementary to the three-dimensional surface of the antigen to which it binds, and the three hypervariable regions of each of the heavy and light chains are referred to as "complementarity determining regions" or "CDRs." The VH and VL regions, including the CDRs and frameworks (FRs), of the PD-1 antibody are shown in Tables 1A-15B.

[0079] The six CDRs present in each antigen-binding domain are short non-contiguous sequences of amino acids that are specifically arranged to form the antigen-binding domain when the antibody assumes its three-dimensional configuration in an aqueous environment. The remaining amino acids of the antigen-binding domain, the FR regions, show less intermolecular variation. The framework regions adopt a predominantly beta-sheet conformation, and the CDRs form loops that connect and in some cases form part of the beta-sheet structure. The framework regions function to form a scaffold for positioning the CDRs in the correct orientation by non-covalent interactions between the chains. The antigen-binding domain formed by the positioned CDRs provides a surface complementary to the epitope on the antigen in the immune response, facilitating non-covalent binding of the antibody to its cognate epitope. The amino acids which comprise the CDRs and framework regions, respectively, can be readily identified for a heavy or light chain variable region by one of ordinary skill in the art, as they have been previously identified (see "Sequences of Proteins of Immunological Interest," Kabat, E., et al., USDepartment of Health and Human Services, (1983), and Chothia and Lesk, J. Mol. Biol., 196:901-917(1987)).

[0080] In the event that there are more than one definition for a term used and / or accepted in the art, the definition of the term used herein is intended to encompass all such meanings unless specifically and explicitly stated to the contrary. A specific example is the use of the term "complementarity determining region" ("CDR") to describe the non-contiguous antigen binding sites found within the variable regions of both heavy and light chain polypeptides. This particular region is described by Kabat et al., USDept. of Health and Human Services, "Sequences of Proteins of Immunological Interest" (1983) and Chothia et al., J. Mol. Biol. 196:901-917 (1987), which are incorporated herein by reference in their entireties. The definitions of CDRs by Kabat and Chothia include overlapping or subsets of amino acid residues when compared to each other. Nevertheless, it is intended that the application of either definition to refer to the CDRs of an antibody or variants thereof is within the scope of the term as defined and used herein. The appropriate amino acid residues encompassing the CDRs defined by each of the above cited references are set forth in the following table for comparison. The exact residue numbers which comprise a particular CDR will vary depending on the sequence and size of the CDR, and one of skill in the art can routinely determine which residues constitute a particular CDR given the variable region amino acid sequence of an antibody. TIFF0007680968000029.tif48128

[0081] Kabat et al. defined a numbering system for variable domain sequences that is applicable to any antibody. One of skill in the art can unambiguously assign this "Kabat numbering" system to any variable domain sequence, without relying on other experimental data of the sequence itself. As used herein, "Kabat numbering" refers to the numbering system described in Kabat et al., US Dept. of Health and Human Services, "Sequence of Proteins of Immunological Interest" (1983).

[0082] In addition to the above table, the Kabat numbering system describes the CDR regions as follows: CDR-H1 begins about amino acid 31 (i.e., about 9 residues after the first cysteine ​​residue), includes about 5-7 amino acids, and ends at the next tryptophan residue. CDR-H2 begins about the 15th residue after the end of CDR-H1, includes about 16-19 amino acids, and ends at the next arginine or lysine residue. CDR-H3 begins about the 33rd amino acid residue after the end of CDR-H2, includes 3-25 amino acids, and ends with the sequence WGXG, where X is any amino acid. CDR-L1 begins about residue 24 (i.e., following the cysteine ​​residue), includes about 10-17 residues, and ends at the next tryptophan residue. CDR-L2 begins about the 16th residue after the end of CDR-L1, and includes about 7 residues. CDR-L3 begins about the 33rd residue after the end of CDR-L2 (i.e., following the cysteine ​​residue), includes about 7-11 residues, and ends with the sequence F or WGXG, where X is any amino acid.

[0083] As used herein, the term "epitope" can include any protein determinant capable of specifically binding to an immunoglobulin, scFv, or T-cell receptor. The variable region allows the antibody to selectively recognize and specifically bind to an epitope on an antigen. For example, the VL and VH domains of an antibody, or a subset of complementarity determining regions (CDRs), combine to form the variable region that defines a three-dimensional antigen-binding site. The quaternary structure of this antibody forms the antigen-binding site present at the end of each arm of the Y. Epitope determinants usually consist of chemically active surface groups of molecules, such as amino acids or sugar side chains, and usually have specific three-dimensional structural characteristics, as well as specific charge characteristics. For example, antibodies can be raised against N-terminal or C-terminal peptides of a polypeptide. More specifically, the antigen-binding site is defined by three CDRs (i.e., CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3) on each of the VH and VL chains. In one embodiment, the antibody may be directed against PD-1 comprising the amino acid sequence of SEQ ID NO:XX (Genbank Accession No. NP_005009; 288 amino acid residues in length). TIFF0007680968000030.tif18137

[0084] As used herein, the terms "immunological binding" and "immunological binding properties" can refer to the type of non-covalent interactions that occur between an immunoglobulin molecule and an antigen for which the immunoglobulin is specific. The strength, or affinity, of an immunological binding interaction is determined by the dissociation constant (K D ) and the smaller (K D ) represents a greater affinity. The immunological binding properties of a selected polypeptide can be quantified using methods well known in the art. One such method involves measuring the rates of antigen-binding site / antigen complex formation and dissociation, which depend on the concentrations of the complex partners, the affinity of the interaction, and geometric parameters that affect the rates in both directions equally. Thus, both "on-rate constants" (K on) and the "off rate constant" (K off ) can be determined by calculation of the concentrations and actual rates of association and dissociation. (See Nature 361:186-87 (1993)). K off / K on The ratio of the dissociation constant K D (See generally, Davies et al. (1990) Annual Rev Biochem 59:439-473.) The antibodies of the present invention have an equilibrium binding constant (K D ) is ≦1 μM, ≦10 μM, ≦10 nM, ≦10 pM, or ≦100 pM to about 1 pM. For example, in some embodiments, D is between about 1E-12M and 1E-11M. D In some embodiments, K D is between about 1E-11M and 1E-10M. D In some embodiments, K D is between about 1E-10M and 1E-9M. D In some embodiments, K D is between about 1E-9M and 1E-8M. D In some embodiments, K D is between about 1E-8M and 1E-7M. D In some embodiments, K D is between about 1E-7M and 1E-6M. D For example, in some embodiments, K D is about 1E-12M, and in other embodiments, K D is about 1E-11M. In some embodiments, K D is about 1E-10M, and in other embodiments, K D is about 1E-9M. In some embodiments, K D is about 1E-8M, and in other embodiments, KD is about 1E-7M. In some embodiments, K D is about 1E-6M, and in other embodiments, K D is about 1E-5M. In some embodiments, for example, K D is about 3E-11M, and in other embodiments, K D is about 3E-12M. In some embodiments, K D is about 6E-11M. "Specifically binds" or "has specificity for" can refer to an antibody that binds to an epitope through its antigen-binding domain, and that the binding involves some complementarity between the antigen-binding domain and the epitope. For example, an antibody is said to "specifically bind" to an epitope if it binds to that epitope through its antigen-binding domain more readily than it binds to a random, unrelated epitope.

[0085] For example, PD-1 antibodies can be monovalent or bivalent and include single or double chains. Functionally, the binding affinity of PD-1 antibodies is greater than or equal to 10 -5 M~10 -12 For example, the binding affinity of PD-1 antibodies is in the range of 10 -6 M~10 -12 M, 10 -7 M~10 -12 M, 10 -8 M~10 -12 M, 10 -9 M~10 -12 M, 10 -5 M~10 -11 M, 10 -6 M~10 -11 M, 10 -7 M~10 -11 M, 10 -8 M~10 -11 M, 10 -9 M~10 -11 M, 10 -10 M~10 -11 M, 10 -5 M~10 -10 M, 10 -6 M~10 -10 M, 10 -7 M~10 -10 M, 10-8 M~10 -10 M, 10 -9 M~10 -10 M, 10 -5 M~10 -9 M, 10 -6 M~10 -9 M, 10 -7 M~10 -9 M, 10 -8 M~10 -9 M, 10 -5 M~10 -8 M, 10 -6 M~10 -8 M, 10 -7 M~10 -8 M, 10 -5 M~10 -7 M, 10 -6 M~10 -7 M, or 10 -5 M~10 -6 It's M.

[0086] The PD-1 proteins of the invention, or derivatives, fragments, analogs, homologs or orthologs thereof, can be utilized as immunogens in the generation of antibodies that immunologically specifically bind to these protein components, such as amino acid residues comprising SEQ ID NO: X. The PD-1 proteins coupled to proteoliposomes, or derivatives, fragments, analogs, homologs or orthologs thereof, can be utilized as immunogens in the generation of antibodies that immunologically specifically bind to these protein components.

[0087] One of ordinary skill in the art will recognize that one can determine, without undue experimentation, whether a human monoclonal antibody has the same specificity as a human monoclonal antibody of the invention by determining whether the former prevents the latter from binding to PD-1. If the human monoclonal antibody being tested exhibits reduced binding by and competes with a human monoclonal antibody of the invention, then it is likely that the two monoclonal antibodies bind to the same or closely related epitopes.

[0088] Another method for determining whether a human monoclonal antibody has the specificity of a human monoclonal antibody of the invention is to preincubate the human monoclonal antibody of the invention with the PD-1 protein with which it is normally reactive, then add the human monoclonal antibody to be tested and determine whether the human monoclonal antibody to be tested is inhibited in its ability to bind to PD-1. If the human monoclonal antibody to be tested is inhibited, then it likely has the same, or a functionally equivalent, epitopic specificity as the monoclonal antibody of the invention. Screening of the human monoclonal antibodies of the invention can also be performed using PD-1 to determine whether the monoclonal antibody to be tested can neutralize PD-1.

[0089] Various procedures known in the art can be used for the production of polyclonal or monoclonal antibodies directed against the proteins of the invention or against their derivatives, fragments, analogs, homologs, or orthologs (see, e.g., Antibodies: A Laboratory Manual, Harlow E, and Lane D, 1988, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, incorporated herein by reference).

[0090] Antibodies can be purified by well-known techniques such as affinity chromatography using Protein A or Protein G, which provide primarily the IgG fraction of immune serum. Subsequently, or alternatively, the specific antigen that is the target of the desired immunoglobulin, or an epitope thereof, can be immobilized on a column to purify the immune specific antibody by immunoaffinity chromatography. Purification of immunoglobulins is discussed, for example, by D. Wilkinson (The Scientist, published by The Scientist, Inc., Philadelphia PA, Vol. 14, No. 8 (April 17, 2000), pp. 25-28).

[0091] As used herein, the term "monoclonal antibody" or "mAb" or "Mab" or "monoclonal antibody composition" can refer to a population of antibody molecules that contain only one molecular species of antibody molecule consisting of a unique light chain gene product and a unique heavy chain gene product. In particular, the complementarity determining regions (CDRs) of a monoclonal antibody are identical in all molecules of the population. MAbs contain an antigen-binding site capable of immunoreacting with a particular epitope of an antigen characterized by a unique binding affinity for it.

[0092] Monoclonal antibodies can be prepared using hybridoma methods, such as those described by Kohler and Milstein, Nature, 256:495 (1975). In the hybridoma method, a mouse, hamster, or other suitable host animal is typically immunized with an immunizing agent to induce lymphocytes that produce, or can produce, antibodies that will specifically bind to the immunizing agent. Alternatively, lymphocytes can be immunized in vitro.

[0093] The immunizing agent may contain a protein antigen, a fragment thereof, or a fusion protein thereof. For example, peripheral blood lymphocytes are used if cells of human origin are desired, or spleen cells or lymph node cells are used if non-human mammalian sources are desired. The lymphocytes are then fused with an immortalized cell line using a suitable fusing agent, such as polyethylene glycol, to form hybridoma cells (see Goding, Monoclonal Antibodies: Principles and Practice, Academic Press, (1986) pp.59-103). The immortalized cell line may be a transformed mammalian cell, particularly a myeloma cell of rodent, bovine, and human origin. For example, a rat or mouse myeloma cell line is used. The hybridoma cells may be cultured in a suitable medium containing one or more substances that inhibit the growth or survival of unfused, immortalized cells. For example, if the parent cells lack the enzyme hypoxanthine guanine phosphoribosyltransferase (HGPRT or HPRT), the culture medium for the hybridoma typically contains hypoxanthine, aminopterin, and thymidine ("HAT medium"), substances that prevent growth of HGPRT-deficient cells.

[0094] Useful immortalized cell lines are those that fuse efficiently, maintain stable high-level expression of antibody by selected antibody-producing cells, and are sensitive to media such as HAT medium. Immortalized cell lines are, for example, mouse myeloma lines available from the Salk Institute Cell Distribution Center (San Diego, California) and the American Type Culture Collection (Manassas, Virginia). Human myeloma and mouse-human heteromyeloma cell lines have also been described for the production of human monoclonal antibodies. (See Kozbor, J. Immunol, 133:3001 (1984); Brodeur et al, Monoclonal Antibody Production Techniques and Applications, Marcel Dekker, Inc., New York, (1987) pp.51-63)).

[0095] The culture medium in which hybridoma cells are cultured can then be assayed for the presence of monoclonal antibodies against the antigen.For example, the binding specificity of the monoclonal antibodies produced by hybridoma cells is determined by immunoprecipitation or by in vitro binding assays such as radioimmunoassay (RIA) or enzyme-linked immunosorbent assay (ELISA).Such techniques and assays are known in the art.The binding affinity of monoclonal antibodies can be determined, for example, by Scatchard analysis as described by Munson and Pollard, Anal.Biochem.,107:220(1980).Furthermore, in therapeutic applications of monoclonal antibodies, it is important to identify antibodies that have high specificity and high binding affinity for target antigens.

[0096] After the desired hybridoma cells are identified, the clones can be subcloned by limiting dilution procedures and grown by standard methods. (See Goding, Monoclonal Antibodies: Principles and Practice, Academic Press, (1986) pp.59-103). Suitable culture media for this purpose include, for example, Dulbecco's modified Eagle's medium and RPMI-1640 medium. Alternatively, the hybridoma cells can be grown in vivo as ascites in a mammal.

[0097] The monoclonal antibodies secreted by the subclones can be isolated or purified from the culture medium or ascites fluid by conventional immunoglobulin purification procedures such as, for example, protein A-Sepharose, hydroxylapatite chromatography, gel electrophoresis, dialysis, or affinity chromatography.

[0098] Monoclonal antibodies can also be produced by recombinant DNA methods, such as those described in U.S. Patent No. 4,816,567, which is incorporated herein by reference in its entirety. DNA encoding the monoclonal antibodies of the present invention can be easily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that can specifically bind to genes encoding the heavy and light chains of mouse antibodies). Hybridoma cells of the present invention serve as a source of such DNA. Once isolated, the DNA can be placed into an expression vector, which is then transfected into host cells, such as monkey COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin proteins, to obtain the synthesis of monoclonal antibodies in recombinant host cells. The DNA can also be modified, for example, by substituting the coding sequence for human heavy and light chain constant domains for the homologous murine sequences (see U.S. Pat. No. 4,816,567; Morrison, Nature 368,812-13 (1994)) or by covalently linking all or part of the coding sequence of a non-immunoglobulin polypeptide to the immunoglobulin coding sequence. Such a non-immunoglobulin polypeptide can be used in place of the constant domains of an antibody of the invention, or in place of the variable domains of one antigen-binding site of an antibody of the invention to create a chimeric bivalent antibody.

[0099] A fully human antibody is an antibody molecule in which the entire sequences of both the light and heavy chains, including, for example, the CDRs, arise from human genes. Such antibodies are referred to herein as "humanized antibodies" or "fully human antibodies." A "humanized antibody" can be an antibody derived from a non-human species, but whose light and heavy chain protein sequences have been modified to increase similarity to antibody variants produced in humans. A humanized antibody is an antibody molecule derived from a non-human species antibody that binds to a desired antigen, having one or more complementarity determining regions (CDRs) from the non-human species and framework regions from a human immunoglobulin molecule. Often, framework residues in the human framework regions are replaced with corresponding residues from the CDR donor antibody, thereby altering, e.g., improving, antigen binding. These framework substitutions are identified by methods well known in the art, for example, by modeling the interactions between CDRs and framework residues to identify framework residues important for antigen binding, and by comparing sequences to identify unusual framework residues at specific positions (see, for example, Queen et al., US Pat. No. 5,585,089; Riechmann et al., Nature 332:323 (1988), which are incorporated herein by reference in their entirety). For example, the non-human portion of the antibody (such as the CDRs of the light and / or heavy chains) can bind to the target antigen. Humanized monoclonal antibodies may also be referred to herein as "human monoclonal antibodies."

[0100] Antibodies can be humanized using various techniques known in the art, such as, for example, CDR grafting (EP 239,400; PCT Publication WO 91 / 09967; U.S. Pat. Nos. 5,225,539, 5,530,101, and 5,585,089), veneering or resurfacing (EP 592,106; EP 519,596; Padlan, Molecular Immunology 28(4 / 5):489-498 (1991); Studnicka et al., Protein Engineering 7(6):805-814 (1994); Roguska.et al., Proc. Natl. Sci. USA 91:969-973 (1994)), and chain shuffling (U.S. Pat. No. 5,565,332, incorporated by reference in its entirety). "Humanization" (also called reshaping or CDR grafting) is an established technique well known to those skilled in the art for reducing the immunogenicity of monoclonal antibodies (mAbs) from xenogeneic sources (usually rodents) and improving activation of the human immune system (see, for example, Hou S, Li B, Wang L, Qian W, Zhang D, Hong X, Wang H, Guo Y (July 2008) "Humanization of an anti-CD34 monoclonal antibody by complementarity-determining region grafting based on computer-assisted molecular modeling" J Biochem. 144(1):115-20).

[0101] Human monoclonal antibodies, including fully human and humanized antibodies, can be prepared using trioma technology, human B cell hybridoma technology (see Kozbor, et al, 1983 Immunol Today 4:72), EBV hybridoma technology producing human monoclonal antibodies (see Cole, et al, 1985 In:MONOCLONAL ANTIBODIES AND CANCER THERAPY, Alan R. Liss, Inc., pp.77-96). Human monoclonal antibodies are available and can be produced by using human hybridomas (see Cote, et al, 1983. Proc Natl Acad Sci USA 80:2026-2030) or by transforming human B cells in vitro with Epstein-Barr virus (Cole, et al., 1985 In:MONOCLONAL ANTIBODIES AND CANCER THERAPY, Alan R. Liss, Inc., pp. 77-96).

[0102] In addition, human antibodies can also be produced using other technologies such as phage display libraries. (See Hoogenboom and Winter, J. Mol. Biol, 227:381 (1991); Marks et al., J. Mol. Biol, 222:581 (1991)). Similarly, human antibodies can be made by introducing human immunoglobulin loci into transgenic animals, such as mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. After challenge, human antibody production is observed, which closely resembles that seen in humans in all aspects, including gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in U.S. Pat. Nos. 5,545,807, 5,545,806, 5,569,825, 5,625,126, 5,633,425, and 5,661,016, as well as in Marks et al., Bio / Technology 10, 779-783 (1992), Lonberg et al., Nature 368 856-859 (1994), Morrison, Nature 368, 812-13 (1994), Fishwild et al., Nature Biotechnology 14, 845-51 (1996), Neuberger, Nature Biotechnology 14, 826 (1996), and Lonberg and Huszar, Intern. Rev. Immunol. 13, 1997. 65-93(1995).

[0103] Human antibodies can additionally be produced using transgenic non-human animals that are modified to produce fully human antibodies in response to antigen challenge rather than the animal's endogenous antibodies. (See PCT Publication No. WO 94 / 02602 and U.S. Patent No. 6,673,986). The endogenous genes encoding heavy and light immunoglobulin chains in the non-human host are disabled, and active loci encoding human heavy and light immunoglobulin chains are inserted into the host's genome. Human genes are incorporated, for example, using yeast artificial chromosomes that contain the necessary human DNA segments. Animals that provide all the desired modifications are then obtained as progeny by mating intermediate transgenic animals that contain fewer than the total number of modifications required. A preferred embodiment of such a non-human animal is a mouse, referred to as Xenomouse™, as disclosed in PCT Publication Nos. WO 96 / 33735 and WO 96 / 34096. This animal produces B cells that secrete fully human immunoglobulins. Antibodies can be obtained directly from animals after immunization with the immunogen of interest, for example as a preparation of polyclonal antibodies, or alternatively from immortalized B cells derived from the animals, such as hybridomas that produce monoclonal antibodies. In addition, genes encoding immunoglobulins with human variable regions can be recovered and expressed to obtain antibodies directly, or further modified to obtain analogs of antibodies, such as, for example, single chain Fv (scFv) molecules. Thus, such techniques can be used to produce therapeutically useful IgG, IgA, IgM and IgE antibodies. For an overview of this technology for producing human antibodies, see Lonberg and Huszar Int.Rev.Immunol.73:65-93 (1995).For a detailed discussion of this technology for producing human antibodies and human monoclonal antibodies, as well as protocols for producing such antibodies, see, e.g., PCT Publication Nos. WO 98 / 24893, WO 96 / 34096, WO 96 / 33735, U.S. Patent Nos. 5,413,923, 5,625,126, 5,633,425, 5,569,825, 5,661,016, 5,545,806, 5,814,318, and 5,939,598, which are incorporated herein by reference in their entireties. Additionally, companies such as Creative BioLabs (Shirley, NY) can offer to provide human antibodies against a selected antigen using technology similar to that described above.

[0104] An example of a method for producing a non-human host, exemplified as a mouse, lacking expression of endogenous immunoglobulin heavy chains is disclosed in U.S. Patent No. 5,939,598. This can be obtained by a method comprising deleting a J segment gene from at least one endogenous heavy chain locus in an embryonic stem cell to prevent rearrangement of the locus and to prevent the formation of a transcript of the rearranged immunoglobulin heavy chain locus, the deletion being performed by a targeting vector containing a gene encoding a selectable marker, and producing a transgenic mouse from the embryonic stem cell, the somatic and germ cells of which contain a gene encoding a selectable marker.

[0105] One method for producing an antibody of interest, such as a human antibody, is disclosed in U.S. Patent No. 5,916,771. The method involves introducing an expression vector containing a nucleotide sequence encoding a heavy chain into one mammalian host cell in culture, introducing an expression vector containing a nucleotide sequence encoding a light chain into another mammalian host cell, and fusing the two cells to form a hybrid cell. The hybrid cell expresses the antibody containing the heavy and light chains.

[0106] In a further refinement of this procedure, methods for identifying clinically relevant epitopes on immunogens and corresponding methods for selecting antibodies that immunospecifically bind with high affinity to the relevant epitopes are disclosed in PCT Publication WO 99 / 53049.

[0107] The antibody of interest can also be expressed by a vector containing a DNA segment encoding the single-chain antibody described above. For example, the vector can include, but is not limited to, chemical conjugates comprising a targeting moiety (e.g., a ligand for a cell surface receptor) and a nucleic acid binding moiety (e.g., polylysine), as described in WO 93 / 64701, viral vectors (e.g., DNA or RNA viral vectors), fusion proteins, such as those described in PCT / US95 / 02140 (WO95 / 22618), i.e., fusion proteins comprising a targeting moiety (e.g., an antibody specific for a target cell) and a nucleic acid binding moiety (e.g., protamine), plasmids, phages, viral vectors, and the like. The vector can be chromosomal, non-chromosomal, or synthetic. Retroviral vectors can also be used, including Moloney murine leukemia virus. DNA viral vectors can also be used, including pox vectors, such as orthopox or avipox vectors, herpes viral vectors, such as herpes simplex I virus (HSV) vectors (see Geller, AI et al, J. Neurochem, 64:487 (1995); Lim, F., et al, in DNA Cloning: Mammalian Systems, D. Glover, Ed. (Oxford Univ. Press, Oxford England) (1995); Geller, AI et al, Proc Natl. Acad. Sci.: USA 90:7603 (1993); Geller, AI, et al, Proc Natl. Acad. Sci USA 87:1149 (1990)), adenoviral vectors (LeGal LaSalle et al, Science, 259:988 (1993); Davidson, et al, Nat. Genet. 3:219 (1993); Yang, et al, J. Virol. 69:2004 (1995)), and adeno-associated viral vectors (Kaplitt, MG. et al, Nat. Genet. 8:148 (1994)).

[0108] Poxvirus vectors introduce genes into the cytoplasm of cells. Avipoxvirus vectors provide only short-term expression of the nucleic acid. Adenovirus vectors, adeno-associated virus vectors, and herpes simplex virus (HSV) vectors can be used to introduce nucleic acids into neural cells. Adenovirus vectors provide shorter-term expression (about 2 months) than adeno-associated virus (about 4 months), which in turn is shorter than HSV vectors. The particular vector selected will depend on the target cell and the condition being treated. Introduction can be by standard techniques, e.g., infection, transfection, transduction, or transformation. Examples of modes of gene introduction include, e.g., naked DNA, CaP0 4 These include precipitation, DEAE dextran, electroporation, protoplast fusion, lipofection, cell microinjection, and viral vectors.

[0109] Vectors can be used to target essentially any desired target cell. For example, stereotactic injection can be used to guide vectors (e.g., adenovirus, HSV) to the desired location. In addition, particles can be delivered by intracerebroventricular (icv) injection using a minipump infusion system such as the SynchroMed Infusion System. A method based on bulk flow, called convection, has also proven effective in delivering large molecules to extended regions of the brain and can be useful for delivering vectors to target cells. (See Bobo et al, Proc. Natl. Acad. Sci. USA 91:2076-2080 (1994); Morrison et al, Am. J. Physiol. 266:292-305 (1994)). Other methods that can be used include catheter, intravenous, parenteral, intraperitoneal, and subcutaneous injection, as well as oral or other known routes of administration.

[0110] These vectors can be used to express large amounts of antibodies that can be used in a variety of ways, for example to detect the presence of PD-1 in a sample. Antibodies can also be used to attempt to bind and destroy PD-1 activity.

[0111] Techniques can be adapted to produce single chain antibodies specific to antigenic proteins of the invention (see, e.g., U.S. Pat. No. 4,946,778). In addition, methods can be used to ab Monoclonal Fs with desired specificity for the protein, or derivatives, fragments, analogs, or homologs thereof, are identified in a manner compatible with the construction of expression libraries (see, e.g., Huse, et al, 1989 Science 246:1275-1281). ab Antibody fragments containing the idiotype to a protein antigen can be produced by techniques known in the art, including but not limited to: (i) F produced by pepsin digestion of the antibody molecule; (ab’)2 Fragment, (ii)F (ab’)2 F produced by reducing the disulfide bridges of the fragment ab (iii) F fragments produced by treatment of antibody molecules with papain and a reducing agent. ab fragments, and (iv) F v Includes fragments.

[0112] Heteroconjugate antibodies are also within the scope of the present invention. Heteroconjugate antibodies are composed of two covalently linked antibodies. Such antibodies can, for example, target immune system cells to unwanted cells (see U.S. Pat. No. 4,676,980) and treat HIV infection (see PCT International Publication Nos. WO 91 / 00360 and WO 92 / 20373). It is contemplated that antibodies can be prepared in vitro using known methods in the field of protein synthetic chemistry, such as using cross-linking agents. For example, immunotoxins can be constructed using disulfide exchange reactions or by forming thioether bonds. Examples of suitable reagents for this purpose include iminothiolate and methyl-4-mercaptobutyrimidate, and those disclosed, for example, in U.S. Pat. No. 4,676,980.

[0113] The antibody of the present invention can be modified with respect to effector function, for example, to enhance the effectiveness of the antibody in the treatment of cancer. For example, cysteine ​​residues can be introduced into the Fc region, thereby allowing interchain disulfide bond formation in this region. The homodimeric antibody thus generated can have improved internalization capability and / or increased complement-mediated cell killing and antibody-dependent cellular cytotoxicity (ADCC). (See Caron et al, J. Exp Med., 176:1 191-1 195 (1992) and Shopes, J. Immunol., 148:2918-2922 (1992)). Alternatively, antibodies can be engineered with dual Fc regions, thereby having enhanced complement lysis and ADCC capabilities. (See Stevenson et al, Anti-Cancer Drug Design, 3:219-230 (1989)).

[0114] In certain embodiments, the antibodies of the present invention can include Fc variants that contain amino acid substitutions that modify the antigen-independent effector functions of the antibody, in particular the circulating half-life of the antibody. Such antibodies, when compared to antibodies lacking these substitutions, exhibit either increased or decreased binding to FcRn, and therefore have increased or decreased serum half-life, respectively. Fc variants with improved affinity for FcRn are expected to have longer serum half-life, and such molecules have useful applications in methods of treating mammals where a long half-life of the administered antibody is desired, for example, to treat chronic diseases or disorders. In contrast, Fc variants with reduced FcRn binding affinity are expected to have shorter half-life, and such molecules are also useful, for example, for administration to mammals where a shortened circulation time may be advantageous, for example, for in vivo diagnostic imaging, or in situations where the starting antibody has toxic side effects if present in the circulation for an extended period of time. Fc variants with reduced FcRn binding affinity are also less likely to cross the placenta and are therefore useful in treating diseases or disorders in pregnant women. In addition, other applications in which reduced FcRn binding affinity may be desirable include applications in which localization to the brain, kidney, and / or liver is desirable. In one embodiment, the Fc variant-containing antibody may exhibit reduced transport from the vasculature across the epithelium of the renal glomerulus. In another embodiment, the Fc variant-containing antibody may exhibit reduced transport from the brain across the blood-brain barrier (BBB) ​​into the vascular space. In one embodiment, the antibody with altered FcRn binding comprises an Fc domain with one or more amino acid substitutions in the "FcRn binding loop" of the Fc domain. The FcRn binding loop is composed of amino acid residues 280-299 (according to EU numbering). Exemplary amino acid substitutions that alter FcRn binding activity are disclosed in PCT Publication WO 05 / 047327, which is incorporated herein by reference. In certain exemplary embodiments, an antibody of the invention, or a fragment thereof, comprises an Fc domain having one or more of the following substitutions: V284E, H285E, N286D, K290E, and S304D (EU numbering).

[0115] In some embodiments, mutations are introduced into the constant region of the mAb so that the antibody-dependent cell-mediated cytotoxicity (ADCC) activity of the mAb is modified. For example, the mutation is a LALA mutation in the CH2 domain. In one embodiment, the antibody (e.g., a human mAb, or a bispecific Ab) contains a mutation on one scFv unit of the heterodimeric mAb that reduces the ADCC activity. In another embodiment, the mAb contains a mutation on both chains of the heterodimeric mAb that completely eliminates the ADCC activity. For example, the mutation introduced into one or both scFv units of the mAb is a LALA mutation in the CH2 domain. These mAbs with variable ADCC activity can be optimized so that the mAb shows maximum selective killing towards cells expressing one antigen recognized by the mAb, but minimum killing towards a second antigen recognized by the mAb.

[0116] In other embodiments, antibodies for use in the diagnostic and therapeutic methods described herein can be, for example, IgG 1 or IgG 4 The antibody of the present invention has a constant region, such as a heavy chain constant region of, which is altered to reduce or eliminate glycosylation. For example, the antibody of the present invention may also include an Fc variant comprising an amino acid substitution that alters the glycosylation of the antibody. For example, the Fc variant can have reduced glycosylation (e.g., N-linked or O-linked glycosylation). In some embodiments, the Fc variant has reduced glycosylation of the N-linked glycan normally found at amino acid position 297 (EU numbering). In another embodiment, the antibody has an amino acid substitution near or within a glycosylation motif, such as an N-linked glycosylation motif comprising the amino acid sequence NXT or NXS. In a specific embodiment, the antibody comprises an Fc variant having an amino acid substitution at amino acid position 228 or 299 (EU numbering). In a more specific embodiment, the antibody comprises an IgG1 or IgG4 constant region comprising S228P and T299A mutations (EU numbering).

[0117] Exemplary amino acid substitutions that reduce or alter glycosylation are disclosed in PCT Publication WO 05 / 018572, which is incorporated herein by reference. In some embodiments, the antibodies, or fragments thereof, of the present invention are modified to eliminate glycosylation. Such antibodies, or fragments thereof, may be referred to as "agly" antibodies, or fragments thereof (e.g., "agly" antibodies). Without being bound by theory, "agly" antibodies, or fragments thereof, may have improved safety and stability profiles in vivo. Exemplary agly antibodies, or fragments thereof, are IgG antibodies that lack Fc effector functions, thereby eliminating the potential for Fc-mediated toxicity to normal living tissues and cells that express PD-1. 4 The antibody comprises a deglycosylated Fc region. In yet another embodiment, the antibody of the present invention, or a fragment thereof, comprises an altered glycan. For example, the antibody can have a reduced number of fucose residues on the N-glycan at Asn297 of the Fc region, i.e., is defucosylated. In another embodiment, the antibody can have an altered number of sialic acid residues on the N-glycan at Asn297 of the Fc region.

[0118] The present invention also relates to immunoconjugates comprising antibodies conjugated to cytotoxic agents such as toxins (e.g., enzymatically active toxins of bacterial, fungal, plant, or animal origin, or fragments thereof), or to radioisotopes (the latter being radioconjugates).

[0119] Enzymatically active toxins and fragments thereof that can be used include diphtheria A chain, nonbinding active fragments of diphtheria toxin, exotoxin A chain (from Pseudomonas aeruginosa), ricin A chain, abrin A chain, modeccin A chain, alpha-sarcin, Aleurites fordii proteins, dianthin proteins, Phytolaca americana proteins (PAPI, PAPII, and PAP-S), momordica charantia inhibitor, curcin, crotin, sapaonaria officinalis inhibitor, gelonin, mitgellin, restrictocin, phenomycin, enomycin, and the trichothecenes. A variety of radionuclides are available for the production of radioconjugated antibodies. Non-limiting examples include: 212 Bi, 131 I, 131 In, 90 Y, and 186 Re is an example.

[0120] Conjugates of antibodies and cytotoxic agents are made using various bifunctional protein binding agents, such as N-succinimidyl-3-(2-pyridyldithiol)propionate (SPDP), iminothiolane (IT), bifunctional derivatives of imidoesters (such as dimethyl adipimidate HCL), active esters (such as disuccinimidyl suberate), aldehydes (such as glutaraldehyde), bis-azido compounds (such as bis(p-azidobenzoyl)hexanediamine), bis-diazonium derivatives (such as bis-(p-diazoniumbenzoyl)-ethylenediamine), diisocyanates (such as triene 2,6-diisocyanate), and bis-active fluorine compounds (such as 1,5-difluoro-2,4-dinitrobenzene). For example, ricin immunotoxins can be prepared as described in Vitetta et al, Science 238:1098 (1987). Carbon-14 labeled 1-isothiocyanatobenzyl-3-methyldiethylenetriaminepentaacetic acid (MX-DTPA) is an exemplary chelating agent for conjugation of radionucleotides to antibodies (see PCT Publication WO 94 / 11026 and U.S. Patent No. 5,736,137).

[0121] Those skilled in the art will recognize that a wide variety of possible moieties can be attached to a given antibody or other molecule of the invention (see, e.g., "Conjugate Vaccines," Contributions to Microbiology and Immunology, JM Cruse and RE Lewis, Jr (eds), Carger Press, New York, (1989), the entire contents of which are incorporated herein by reference).

[0122] The binding can be achieved by any chemical reaction that will link the two molecules, so long as the antibody and the other moiety retain their respective activities. The binding can include many chemical mechanisms, such as covalent binding, affinity binding, intercalation, coordinate binding, complex formation. In one embodiment, the binding is a covalent bond. Covalent binding can be achieved by direct condensation of existing side chains or by incorporation of an external cross-linking molecule. Many bivalent or multivalent binding agents are useful for linking protein molecules, such as the antibodies of the present invention, to other molecules. For example, representative binding agents can include organic compounds such as thioesters, carbodiimides, succinimide esters, diisocyanates, glutaraldehyde, diazobenzene, and hexamethylenediamine. This list is not intended to be exhaustive of the various classes of binding agents known in the art, but rather is illustrative of the more common binding agents. (See Killen and Lindstrom, Jour. Immun. 133:1335-2549 (1984); Jansen et al., Immunological Reviews 62:185-216 (1982); and Vitetta et al., Science 238:1098 (1987)). Non-limiting examples of linkers are described in the literature. (See, for example, Ramakrishnan, S. et al., Cancer Res. 44:201-208 (1984), which describes the use of MBS (M-maleimidobenzoyl-N-hydroxysuccinimide ester). See also U.S. Pat. No. 5,030,719, which describes the use of halogenated acetylhydrazide derivatives attached to antibodies by oligopeptide linkers.Non-limiting examples of useful linkers that can be used with the antibodies of the invention include: (i) EDC (1-ethyl-3-(3-dimethylamino-propyl) carbodiimide hydrochloride, (ii) SMPT (4-succinimidyloxycarbonyl-α-methyl-α-(2-pyridyl-dithio)-toluene (Pierce Chem. Co., Cat. (21558G), (iii) SPDP (succinimidyl-6[3-(2-pyridyldithio)propionamido]hexanoate (Pierce Chem. Co., Cat. 21651G), (iv) sulfo-LC-SPDP (sulfosuccinimidyl-6[3-(2-pyridyldithio)-propianamido]hexanoate (Pierce Chem. Co., Cat. #2165-G), and (v) sulfo-NHS conjugated to EDC (-hydroxysulfo-succinimide: Pierce Chem. Co., Cat. #24510).

[0123] The linkers described herein contain components with different attributes, thus resulting in conjugates with different physicochemical properties. For example, sulfo-NHS esters of alkyl carboxylates are more stable than sulfo-NHS esters of aromatic carboxylates. NHS-ester-containing linkers are less soluble than sulfo-NHS esters. In addition, the linker SMPT can contain sterically hindered disulfide bonds to form conjugates with improved stability. Disulfide bonds are generally less stable than other bonds, because they are cleaved in vitro, resulting in fewer available conjugates. In particular, sulfo-NHS can increase the stability of carbodiimide bonds. Carbodiimide bonds (such as EDC) when used in combination with sulfo-NHS form esters that are more resistant to hydrolysis than carbodiimide bond reactions alone.

[0124] The antibody disclosed herein can also be formulated as immunoliposome.The liposome containing antibody is prepared by the method known in the art, such as described in Epstein et al, Proc.Natl.Acad.Sci.USA, 82:3688(1985), Hwang et al, Proc.Natl Acad.Sci.USA, 77:4030(1980), and U.S. Patent No. 4,485,045 and U.S. Patent No. 4,544,545.Liposome with extended circulation time is disclosed in U.S. Patent No. 5,013,556.

[0125] Non-limiting examples of useful liposomes can be generated by reverse phase evaporation with a lipid composition comprising phosphatidylcholine, cholesterol, and PEG-derivatized phosphatidylethanolamine (PEG-PE). Liposomes are extruded through filters of defined pore size to generate liposomes with the desired diameter. Fab' fragments of the antibody of the present invention can be conjugated to liposomes as described in Martin et al, J.Biol.Chem.,257:286-288 (1982) via a disulfide exchange reaction.

[0126] bispecific antibody A bispecific antibody (bsAb) is an antibody that contains two variable domains or scFv units, such that the resulting antibody recognizes two different antigens. The present invention provides a bispecific antibody that recognizes PD-1 and a second antigen (e.g., a non-immunodepleting anti-PD1-scFv IL12 fusion protein). Exemplary second antigens include tumor-associated antigens (e.g., LINGO1), cytokines (e.g., IL-12 (IL-12A (p35 subunit) protein sequence having NCBI Reference No. NP_000873.2, IL-12B (p40 subunit) protein sequence having NCBI Reference No. NP_002178.2, IL-18 (protein sequence with NCBI Reference No. NP_001553.1), IL-15 (protein sequence with NCBI Reference No. NP_000576.1), IL-7 (protein sequence with NCBI Reference No. NP_000871.1), IL-2 (protein sequence with NCBI Reference No. NP_000577.2), and IL-21 (protein sequence with NCBI Reference No. NP_068575.1)), and cytokine cognate receptors (e.g., IL-12R), and cell surface receptors. Non-limiting examples of second antigens include CTLA-4, LAG-3, CD28, CD122, 4-1BB, TIM3, OX-40, OX40L, CD40, CD40L, LIGHT, ICOS, ICOSL, GITR, GITRL, TIGIT, CD27, VISTA, B7H3, B7H4, HEVM (or BTLA), CD47 and CD73. In one embodiment, the bispecific antibody comprises a PD-1 fusion protein. For example, the fusion protein comprises an antibody comprising a variable domain or scFv unit and a ligand, whereby the resulting antibody recognizes the antigen and binds to the ligand-specific receptor. In one embodiment, the fusion protein further comprises a constant region and / or a linker as described herein. For example, the fusion protein comprises an antibody that recognizes PD-1 and a ligand.Ligands include tumor-associated antigens (e.g., LINGO1, ErbB2 (HER2 / neu), carcinoembryonic antigen (CEA), epithelial cell adhesion molecule (EpCAM), epidermal growth factor receptor (EGFR), MUC1, MSLN, CD19, CD20, CD30, CD40, CD22, RAGE-1, MN-CA IX, RET1, RET2 (AS), prostate specific antigen (PSA), TAG-72, PAP, p53, Ras, prostein, PSMA, survivin, 9D7, prostate cancer tumor antigen-1 (PCTA-1), GAGE, MAGE, mesothelin, β-catenin, TGF-βRII, BRCA1 / 2, SAP-1, HPV-E6, HPV-E7 (for additional tumor associated surface antigens, see also PCT / US2015 / 067225 and PCT / US2019 / 022272, which are incorporated by reference in their entireties)), cytokines (e.g., IL-12 (IL-12A (p35 subunit) protein sequence having NCBI Reference No. NP_000873.2, IL-12B (p40 subunit) protein sequence having NCBI Reference No. NP_002178.2), IL-1 8 (protein sequence with NCBI reference number NP_001553.1), IL-15 (protein sequence with NCBI reference number NP_000576.1), IL-7 (protein sequence with NCBI reference number NP_000871.1), IL-2 (protein sequence with NCBI reference number NP_000577.2), and IL-21 (protein sequence with NCBI reference number NP_068575.1), CTLA-4, LAG-3, CD28, CD122, 4-1BB, TIM3, OX-40, OX40L, CD40, CD40L, LIGHT, ICOS, ICOSL, GITR, GITRL, TIGIT, CD27, VISTA, B7H3, B7H4, HEVM (or BTLA), CD47, and CD73. Bispecific antibodies in various formats are also provided herein. In some embodiments, each of the anti-PD1 fragment and the second antigen-specific fragment is each independently selected from a Fab fragment, a single chain variable fragment (scFv), or a single domain antibody. In some embodiments, the bispecific antibody further comprises an Fc fragment.Bispecific antibodies of the invention comprise heavy and light chain combinations, or scFvs, of the PD-1 antibodies disclosed herein.

[0127] For example, the nucleic acid and amino acid sequences of bispecific PD-1 antibodies (e.g., PD-1 IL-12 fusions), in addition to exemplary constant regions useful in combination with the VH and VL sequences provided herein, are set forth below: P4-B3 scIL12 fusion (variable and constant regions are the same as the underlying P4-B3 (unless otherwise noted below in Table 1), and in some embodiments, the variable regions of other PD-1 antibodies disclosed herein can also be used to generate the IL12 fusions exemplified herein), CH3 / C L in normal font, TIFF0007680968000031.tif18153

[0128] Table 14A: Nucleic acid sequence of Ab P4-B3 scIL12 HC F2A fusion TIFF0007680968000032.tif152152

[0129] Table 14B: Nucleic acid sequence of Ab P4-B3 scIL12 HC F2A fusion TIFF0007680968000033.tif56152

[0130] Table 15A: Nucleic acid sequence of Ab P4-B3 scIL12 HC G4S fusion TIFF0007680968000034.tif144152

[0131] Table 15B: Amino acid sequence of Ab P4-B3 scIL12 HC G4S fusion TIFF0007680968000035.tif56152

[0132] Table 16A: Nucleic acid sequence of Ab P4-B3 scIL12 LC F2A(-2) fusion TIFF0007680968000036.tif156152

[0133] Table 16B: Amino acid sequence of Ab P4-B3 scIL12 LC F2A(-2) fusion TIFF0007680968000037.tif56152

[0134] Table 17A: Nucleic acid sequence of Ab P4-B3 scIL12 LC G4S fusion TIFF0007680968000038.tif144152

[0135] Table 17B: Amino acid sequence of Ab P4-B3 scIL12 LC (G4S)2 TIFF0007680968000039.tif56152

[0136] Bispecific antibodies of the invention (e.g., non-immunodepleting anti-PD1-scFv IL12 fusion proteins) can be constructed using methods known in the art. In some embodiments, bispecific antibodies are single polypeptides in which two scFv fragments are joined by a long linker polypeptide, of sufficient length to allow intramolecular association between the two scFv units to form the antibody. In other embodiments, bispecific antibodies are two or more polypeptides linked by covalent or non-covalent bonds. In some embodiments, the amino acid linker shown in bold blue (GGGGSGGGGS, "(G4S)2") used with the anti-PD1-scFv IL12 fusion constructs can be generated with a longer G4S linker to improve flexibility. For example, the linker can be "(G4S)3" (e.g., GGGSGGGGSGGGGGS), "(G4S)4" (e.g., GGGSGGGGSGGGGSGGGGS), "(G4S)5" (e.g., GGGSGGGGSGGGGSGGGGSGGGGGS), "(G4S)6" (e.g., GGGSGGGGSGGGGSGGGGSGGGGSGGGGS), "(G4S)7" (e.g., GGGSGGGGSGGGGSGGGGGSGGGGSGGGGGS), and the like. For example, the use of a (G4S)5 linker allows for greater flexibility of the IL-12 molecule and can improve expression. In some embodiments, the linker can also be a (GS) n , (GGS) n , (GGGS) n , (GGSG) n , (GGSGG) n , or (GGGGS) n where n is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. Non-limiting examples of linkers known to those of skill in the art that can be used to construct the anti-PD-1-IL-12 fusions described herein can be found in U.S. Pat. No. 9,708,412, U.S. Patent Application Publication Nos. 2018 / 0134789 and 2020 / 0148771, and PCT Publication No. WO 2019 / 051122, the entire contents of each of which are incorporated by reference.

[0137] In another embodiment, bispecific antibodies are constructed using the "knob into hole" method (Ridgway et al, Protein Eng 7:617-621 (1996)). In this method, Ig heavy chains of two different variable domains are reduced to selectively cleave heavy chain pairing while preserving the heavy-light chain pairing. Two heavy-light chain heterodimers that recognize two different antigens are mixed to promote heteroligation pairing mediated through engineered "knobs into holes" in the CH3 domains.

[0138] In another embodiment, bispecific antibodies (e.g., non-immunodepleting anti-PD1-scFv IL12 fusion proteins) can be constructed through the exchange of heavy-light chain dimers from two or more different antibodies to generate hybrid antibodies in which a first heavy-light chain dimer recognizes PD-1 and a second heavy-light chain dimer recognizes a second antigen. The heavy-light chain dimer mechanism is similar to that of human IgG, which also functions as a bispecific molecule. 4 The dimerization of IgG heavy chains is driven by intramolecular forces such as pairing of the CH3 domains of each heavy chain with disulfide bridges. The presence of a specific amino acid in the CH3 domain (R409) is essential for dimer exchange and the formation of IgG 4 Heavy chain pairing is also further stabilized by inter-heavy chain disulfide bridges in the hinge region of the antibody. 4 In the hinge region, the amino acid sequence Cys-Pro-Ser-Cys is contained at amino acids 226-230 (compared to the stable IgG1 hinge region, which contains the sequence Cys-Pro-Pro-Cys). This difference in sequence at serine at position 229 results in a IgG 4 is associated with the propensity to form intrachain disulfides in the hinge region (Van der Neut Kolfschoten, M. et al, 2007, Science 317:1554-1557 and Labrijn, AF et al, 2011, Journal of Immunol 187:3238-3246).

[0139] Thus, a bispecific antibody of the present invention can be made through the introduction of the R409 residue in the CH3 domain and a Cys-Pro-Ser-Cys sequence in the hinge region of an antibody that recognizes PD-1 or a second antigen, resulting in an exchange of heavy-light chain dimers to produce an antibody molecule with one heavy-light chain dimer that recognizes PD-1 and a second heavy-light chain dimer that recognizes a second antigen, where the second antigen is any antigen disclosed herein. 4 The molecules can also be engineered such that the heavy and light chains recognize PD-1 or a second antigen, as disclosed herein. Use of this method to construct bispecific antibodies of the invention is directed to the construction of IgG subtypes whose Fc region differs from other IgG subtypes in that it interacts poorly with effector systems of the immune response, such as complement and Fc receptors expressed by certain white blood cells. 4 This particular property may be beneficial for these IgG 4 Bispecific antibodies based on IgG1A and IgG2A are attractive for therapeutic applications where the antibody must bind to a target and functionally modify a signaling pathway associated with the target, but not induce effector activity.

[0140] The bispecific antibodies described herein (e.g., non-immunodepleting anti-PD1-scFvIL12 fusion proteins) can be engineered with a non-depleting heavy chain isotype, such as IgG1-LALA or stabilized IgG4 or one of the other non-depleting variants. Without being bound by theory, anti-PD1-scFv IL12 fusion proteins containing the Fc region variants described herein (such as IgG1 LALA mutant or stabilized IgG4) can block PD1+ T cells without depleting them, while providing scIL12 to stimulate them.

[0141] In some embodiments, mutations are introduced into the constant region of the bsAb so that the antibody-dependent cell-mediated cytotoxicity (ADCC) activity of the bsAb is modified. For example, the mutation is a LALA mutation in the CH2 domain. In one aspect, the bsAb contains a mutation on one scFv unit of the heterodimeric bsAb that reduces ADCC activity. In another aspect, the bsAb contains a mutation on both chains of the heterodimeric bsAb that completely removes ADCC activity. For example, the mutation introduced into one or both scFv units of the bsAb is a LALA mutation in the CH2 domain. These bsAbs with variable ADCC activity can be optimized so that the bsAb shows maximum selective killing towards cells expressing one antigen recognized by the bsAb, but minimum killing towards a second antigen recognized by the bsAb.

[0142] The bispecific antibodies disclosed herein can be used effectively to treat chronic infections, diseases, or medical conditions, such as cancer.

[0143] Use of antibodies against PD-1 The antibodies of the present invention that specifically bind to the PD-1 protein or fragments thereof can be administered for the treatment of PD-1-associated diseases or disorders. "PD-1-associated diseases or disorders" include disease states and / or symptoms associated with disease states in which there is an increase in the level of PD-1 and / or activation of cell signaling pathways involving PD-1. Exemplary PD-1-associated diseases or disorders include diseases in which T cells are suppressed, such as, but not limited to, cancer and infectious diseases. In some embodiments, the infectious disease is caused by a microorganism, such as a DNA virus, an RNA virus, or a reverse transcribing virus. Non-limiting examples of viruses include adenovirus, coxsackievirus, Epstein-Barr virus, hepatitis A virus, hepatitis B virus, hepatitis C virus, herpes simplex virus type 1, herpes simplex virus type 2, cytomegalovirus, human herpes virus type 8, HIV, influenza virus, measles virus, mumps virus, human papilloma virus, parainfluenza virus, poliovirus, rabies virus, respiratory syncytial virus, rubella virus, varicella zoster virus. In some embodiments, the infection is caused by a microorganism, such as a gram-positive bacterium, a gram-negative bacterium, a protozoan, or a fungus.

[0144] Non-limiting examples of disease-causing bacteria include Bacillus anthracis, Bacillus cereus, Bartonella henselae, Bartonella Quintana, Bordetella pertussis, Borrelia burgdorferi, Borrelia garinii, Borrelia afzelii, Borrelia recurrentis, Brucella abortus, Brucella canis, Brucella melitensis, Brucella suis, Campylobacter jejuni, and the like. jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Chlamydophila psittaci, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Clostridium tetani, Corynebacterium diphtheria, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Francisella tularensis, Haemophilus influenzae influenza, Helicobacter pylori, Legionella pneumophila, Leptospira interrogansinterrogans, Leptospira santarosai, Leptospira weilii, Leptospira noguchii, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Mycobacterium ulcerans, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitides, Pseudomonas aeruginosa, Rickettsia rickettsia, Salmonella typhi, Salmonella typhimurium, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus saprophyticus, Streptococcus agalactiae, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholera, Yersinia pestis, Yersinia enterocolitica enterocolitica, and Yersinia pseudotuberculosis.

[0145] Non-limiting examples of disease-causing protozoa include Plasmodium falciparum (malaria), Toxoplasma gondii (toxoplasmosis), Leishmania species (leishmaniasis), Trypanosoma brucei (African sleeping sickness), Trypanosoma cruzi (Chagas disease), and Giardia intestinalis (giardiasis).

[0146] Non-limiting examples of disease-causing fungi include Candida albicans, Aspergillus fumigatus, Aspergillus flavus, Cryptococcus neoformans, Cryptococcus gattii, Histoplasma capsulatum, Pneumocystis carinii, and Stachybotrys chartarum.

[0147] The antibodies of the present invention, such as bispecific, polyclonal, monoclonal, humanized and fully human antibodies, can be used as therapeutic agents. Such agents will generally be used to treat or prevent cancer in subjects, improve vaccine efficiency, or enhance natural immune response. Antibody preparations, for example, those with high specificity and high affinity for their target antigens, will generally be administered to subjects to produce effects due to binding with the target. Administration of antibodies can neutralize, inhibit, or interfere with the activity of PD-1 protein.

[0148] The antibody specifically binding to the PD-1 protein or a fragment thereof of the present invention can be administered for the treatment of cancer in the form of a pharmaceutical composition. Principles and considerations related to the preparation of therapeutic pharmaceutical compositions containing antibodies, as well as guidance on the selection of ingredients, are provided, for example, in Remington: The Science And Practice Of Pharmacy 20th ed. (Alfonso R. Gennaro, et al, editors) Mack Pub. Co., Easton, Pa., 2000, Drug Absorption Enhancement: Concepts, Possibilities, Limitations, And Trends, Harwood Academic Publishers, Langhorne, Pa., 1994, and Peptide And Protein Drug Delivery (Advances In Parenteral Sciences, Vol. 4), 1991, M. Dekker, New York.

[0149] The specific dosage and treatment regimen for a particular patient depends on a variety of factors, such as the specific antibody, variant or derivative thereof used, the patient's age, weight, general health, sex, and diet, as well as the administration time, excretion frequency, drug combinations, and the severity of the particular disease being treated. The judgment of such factors by a medical practitioner is within the skill of a person skilled in the art. The amount will also depend on the individual patient being treated, the route of administration, the type of formulation, the characteristics of the compound used, the severity of the disease, and the desired effect. The amount used can be determined by pharmaceutical and pharmacokinetic principles well known in the art.

[0150] A therapeutically effective amount of an antibody of the invention can be the amount necessary to achieve a therapeutic goal. As mentioned above, this can be a binding interaction between the antibody and its target antigen, which in certain cases interferes with the function of the target. The amount that needs to be administered further depends on the binding affinity of the antibody for its specific antigen, and also on the rate at which the administered antibody is depleted from the free volume of the other subject to which it is administered. The dosage of the antigen-binding polypeptides described herein administered to a subject (e.g., a patient) is typically 0.1 mg / kg to 100 mg / kg patient body weight, 0.1 mg / kg to 20 mg / kg patient body weight, or 1 mg / kg to 10 mg / kg patient body weight. Human antibodies have a longer half-life in the human body than antibodies from other species due to the immune response to the foreign polypeptide. Thus, lower dosages and less frequent administration of human antibodies is often possible. Additionally, the dosage and frequency of administration of the antibodies of the present disclosure can be reduced by enhancing antibody uptake and tissue (e.g., brain) penetration by modifications such as, for example, lipidation. A typical range for therapeutically effective administration of an antibody or antibody fragment of the invention can be, by way of non-limiting example, from about 0.1 mg / kg body weight to about 50 mg / kg body weight. Typical administration frequency can range, for example, from twice daily to once a week.

[0151] When an antibody fragment is used, the smallest inhibitory fragment that specifically binds to the binding domain of the target protein is preferred. For example, peptide molecules that retain the ability to bind to the target protein sequence can be designed based on the variable region sequence of the antibody. Such peptides can be chemically synthesized and / or produced by recombinant DNA technology. (See, for example, Marasco et al, Proc. Natl. Acad. Sci. USA, 90:7889-7893 (1993)). The formulation can also contain two or more active compounds as necessary for the specific indication to be treated, for example, those with complementary activities that do not adversely affect each other. Alternatively, or in addition, the composition can include an agent that enhances its function, such as, for example, a cytotoxic agent, a cytokine (e.g., IL-15), a chemotherapeutic agent, or a growth inhibitor. Such molecules are suitably present in combination in an amount effective for the intended purpose.

[0152] The active ingredients can also be encapsulated in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization, e.g., hydroxymethylcellulose or gelatin-microcapsules and poly-(methyl methacrylate) microcapsules, in colloidal drug delivery systems (e.g., liposomes, albumin microspheres, microemulsions, nanoparticles, and nanocapsules), or in macroemulsions, respectively.

[0153] Formulations to be used for in vivo administration must be sterile, which is readily accomplished by filtration through sterile filtration membranes.

[0154] Sustained release preparations can be prepared.Suitable examples of sustained release preparations include semipermeable matrices of solid hydrophobic polymers containing antibodies, which matrices are in the form of shaped articles, such as films or microcapsules.Examples of sustained release matrices include polyesters, hydrogels (e.g., poly(2-hydroxyethyl-methacrylate) or poly(vinyl alcohol)), polylactides (U.S. Pat. No. 3,773,919), copolymers of L-glutamic acid and gamma-ethyl-L-glutamate, non-degradable ethylene-vinyl acetate, degradable lactic acid-glycolic acid copolymers such as LUPRON DEPOT™ (injectable microspheres made of lactic acid-glycolic acid copolymer and leuprolide acetate), and poly-D-(-)-3-hydroxybutyric acid.Polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid allow the release of molecules for more than 100 days, while certain hydrogels release proteins for shorter periods of time.

[0155] The antibodies according to the present invention can be used as agents for detecting the presence of PD-1 (or a protein fragment thereof) in a sample. For example, the antibody can include a detectable label. The antibody can be polyclonal or monoclonal. An intact antibody, or a fragment thereof (e.g., F ab , scFv, or F (ab)2) can be used. With respect to a probe or antibody, the term "labeled" can encompass direct labeling of the probe or antibody by binding (i.e., physically linking) a detectable substance to the probe or antibody, and indirect labeling of the probe or antibody by reactivity with another reagent that is directly labeled. Examples of indirect labeling include detection of a primary antibody using a fluorescently labeled secondary antibody, and end-labeling a DNA probe with biotin so that it can be detected with fluorescently labeled streptavidin. The term "biological sample" can include tissues, cells, and biological fluids isolated from a subject, as well as tissues, cells, and biological fluids present within a subject. Thus, the use of the term "biological sample" includes blood, and fractions or components of blood, including serum, plasma, or lymph. That is, the detection methods of the present invention can be used to detect analyte mRNA, protein, or genomic DNA in biological samples in vitro and in vivo. For example, in vitro techniques for detection of analyte mRNA include Northern hybridization and in situ hybridization. In vitro techniques for detection of an analyte protein include enzyme linked immunosorbent assays (ELISAs), Western blots, immunoprecipitations, and immunofluorescence. In vitro techniques for detection of an analyte genomic DNA include Southern hybridizations.

[0156] Procedures for performing immunoassays are described, for example, in "ELISA: Theory and Practice: Methods in Molecular Biology", Vol. 42, J.R.Crowther (Ed.) Human Press, Totowa, NJ, 1995, "Immunoassay", E. Diamandis and T. Christopoulus, Academic Press, Inc., San Diego, CA, 1996, and "Practice and Theory of Enzyme Immunoassays", P. Tijssen, Elsevier Science Publishers, Amsterdam, 1985. Additionally, in vivo techniques for detection of analyte proteins include introducing into a subject a labeled anti-analyte protein antibody. For example, the antibody can be labeled with a radioactive marker whose presence and location in a subject can be detected by standard imaging techniques.

[0157] Antibodies to the PD-1 protein (or fragments thereof) can be used in methods known in the art relating to localizing and / or quantitating PD-1 protein (e.g., for use in measuring levels of PD-1 protein in an appropriate physiological sample, for use in diagnostic methods, for use in protein imaging). In certain embodiments, antibodies specific for the PD-1 protein, or derivatives, fragments, analogs, or homologs thereof, that contain an antigen-binding domain derived from the antibody, are utilized as pharma- ceutical active compounds (hereinafter referred to as "therapeutic agents").

[0158] Antibodies specific for the PD-1 protein of the invention can be used to isolate PD-1 polypeptides by standard techniques, such as immunoaffinity, chromatography, or immunoprecipitation. Antibodies to the PD-1 protein (or fragments thereof) can be used diagnostically to monitor protein levels in tissues as part of a clinical trial procedure, e.g., to determine the effectiveness of a given therapeutic regimen.

[0159] Detection can be facilitated by coupling (i.e., physically linking) the antibody to a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin / biotin and avidin / biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride, or phycoerythrin; examples of luminescent materials include luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin; examples of suitable radioactive materials include, 125 I, 131 I, 35 S, 32 P or 3 Examples include H.

[0160] The antibody or agent of the present invention (also referred to herein as "active compound"), as well as their derivatives, fragments, analogs, and homologs, can be incorporated into pharmaceutical compositions suitable for administration. Such compositions typically include the antibody or agent and a pharma- ceutically acceptable carrier. As used herein, "pharmaceutically acceptable carrier" can include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, that are compatible with pharmaceutical administration. Suitable carriers are described in the latest edition of Remington's Pharmaceutical Sciences, a standard reference text in the field, which is incorporated herein by reference. Preferred examples of such carriers or diluents include, but are not limited to, water, saline, Ringer's solution, dextrose solution, and 5% human serum albumin. Non-aqueous vehicles such as liposomes and fixed oils can also be used. The use of such media and agents for pharma- ceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, its use in the composition is contemplated. Supplementary active compounds can also be incorporated into the compositions.

[0161] The pharmaceutical composition of the present invention is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (i.e., topical), transmucosal, and rectal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can contain the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerin, propylene glycol, or other synthetic solvents; antibacterial agents such as benzyl alcohol or methylparabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid (EDTA); buffers such as acetates, citrates, or phosphates, and agents for adjusting tonicity such as sodium chloride or dextrose. The pH can be adjusted with acids or bases such as hydrochloric acid or sodium hydroxide. Parenteral preparations can be enclosed in ampoules, disposable syringes, or multiple dose vials made of glass or plastic.

[0162] Pharmaceutical compositions suitable for injectable use can include sterile aqueous solutions (if water soluble) or dispersions, and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, NJ), or phosphate buffered saline (PBS). In embodiments, the composition is sterile and fluid to the extent that easy syringability exists. It can be stable under the conditions of manufacture and storage and can be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, etc.), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. Prevention of microbial action can be achieved by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, etc. In many cases, isotonic agents, such as sugars, polyalcohols such as mannitol, sorbitol, sodium chloride, can be included in the composition. Prolonged absorption of injectable compositions can be achieved by including agents that delay absorption, such as aluminum monostearate and gelatin, in the composition.

[0163] Sterile injectable solution can be prepared by incorporating the required amount of active compound into a suitable solvent with one or combination of the ingredients listed above as necessary, followed by filtration sterilization.For example, dispersion is prepared by incorporating active compound into a sterile vehicle that contains basic dispersion solvent and other necessary ingredients listed above.For the preparation of sterile injectable solution, the preparation method is vacuum drying and freeze-drying, which produces a powder of active ingredient and any additional desired ingredients from the solution that has been previously sterile filtered.

[0164] Oral compositions include inert diluents or edible carriers. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, where the compound in the fluid carrier is applied orally, swirled in the mouth, and expectorated or swallowed. Pharmaceutically compatible binding agents, and / or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth, or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, primogel, or corn starch; a lubricant such as magnesium stearate or sterol; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavor.

[0165] For administration by inhalation, the compounds are delivered in the form of an aerosol spray from pressured container or dispenser which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer.

[0166] Systemic administration can also be by transmucosal or transdermal means.For transmucosal or transdermal administration, a penetrant suitable for the barrier to be permeated is used in the formulation.Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives.Transmucosal administration can be achieved through the use of nasal sprays or suppositories.For transdermal administration, active compound is formulated into ointments, salves, gels, or creams generally known in the art.

[0167] The compounds can also be prepared in the form of suppositories (eg, with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.

[0168] In one embodiment, the active compound is prepared in a carrier that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. Methods for preparing such formulations are clear to those skilled in the art. Materials can also be commercially obtained from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes that target infected cells with monoclonal antibodies against viral antigens) can also be used as pharma-ceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.

[0169] For the convenience of administration and uniformity of dosage, oral or parenteral compositions can be formulated in dosage unit form.Dosage unit form as used herein refers to a physically separate unit suitable as a single dosage for the subject to be treated, each unit containing a predetermined amount of active compound calculated to produce desired therapeutic effect in association with required pharmaceutical carrier.The specification of dosage unit form of the present invention is determined and directly depends on the specific characteristics of active compound and the specific therapeutic effect to be achieved, as well as the inherent limitation of the technology of compounding such active compound for individual treatment.

[0170] The pharmaceutical compositions can be included in a container, pack, or dispenser together with instructions for administration.

[0171] Treatment method As used herein, the term "treat" or "treatment" refers to both therapeutic treatment and prophylactic or preventative measures, the purpose of which is to prevent or slow down (alleviate) undesirable physiological changes or disorders, such as the progression of cancer. Beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, reduction in extent of disease, stable (i.e., not worsening) state of disease, delayed or delayed progression of disease, improvement or mitigation of disease condition, remission (partial or total), whether detectable or not. "Treatment" refers to prolonging survival compared to expected survival in the absence of treatment. Those in need of treatment include those already suffering from a disease condition or disorder, as well as those susceptible to a disease condition or disorder, or those in need of prevention of a disease condition or disorder.

[0172] The present invention provides both preventative and therapeutic methods of treating subjects at risk (or susceptible) for cancer, or other cell proliferation-related diseases or disorders. Such diseases or disorders include, but are not limited to, diseases or disorders associated with aberrant expression of PD-1. For example, the methods are used to treat, prevent, or alleviate symptoms of cancer. In one embodiment, the methods are used to treat, prevent, or alleviate symptoms of solid tumors. Non-limiting examples of cancers that can be treated by the compositions described herein include lung cancer, ovarian cancer, prostate cancer, colon cancer, cervical cancer, brain cancer, skin cancer, liver cancer, pancreatic cancer, or gastric cancer. In addition, the methods of the present invention can be used to treat blood cancers, such as leukemia and lymphoma. Alternatively, the methods can be used to treat, prevent, or alleviate symptoms of metastasized cancer. For example, cancers that can be treated or prevented, or symptoms can be alleviated include B-cell chronic lymphocytic leukemia (CLL), non-small cell lung cancer, melanoma, ovarian cancer, lymphoma, or renal cell carcinoma. Cancers that can be treated or prevented or ameliorated also include solid tumors with high mutational burden and WBC in the filtrate. Cancers that can be treated or prevented or ameliorated further include cancers with regulated PD-1 / PD-L1 axis signals, including (but not limited to) breast cancer, lung cancer (e.g., non-small cell lung cancer or lung adenocarcinoma), gastric cancer, colorectal cancer, bladder cancer, pancreatic cancer, prostate cancer, esophageal squamous cell carcinoma, nasopharyngeal carcinoma, and liquid tumors with active PD1 / PDL1 axis (diffuse large B-cell lymphoma (DLBCL) and B-cell chronic lymphocytic leukemia (B-CLL)) (see, e.g., Han et al., PD-1 / PD-L1 pathway: current researches in cancer, Am J Cancer Res 2020;10(3):727-742).

[0173] Thus, in one aspect, the invention provides a method for preventing, treating, or alleviating a symptomatic cancer or cell proliferative disease or disorder in a patient by administering to the patient a monoclonal antibody, scFv antibody, or bispecific antibody of the invention. For example, an anti-PD-1 antibody can be administered in a therapeutically effective amount.

[0174] Subjects at risk for cancer or cell proliferation-related diseases or disorders may include patients with a family history of cancer or subjects who have been exposed to agents known or suspected to cause cancer. Administration of a prophylactic agent can occur prior to the onset of cancer, such that the disease is prevented or, alternatively, its progression is delayed.

[0175] In another embodiment, tumor cell growth is inhibited by contacting the cell with an anti-PD-1 antibody of the invention. The cell can be any cell that expresses PD-1.

[0176] The present invention further provides both preventive and therapeutic methods of treating subjects at risk (or susceptible) of chronic or acute viral, bacterial or parasitic infection. The present invention also provides therapeutic methods for both preventive and therapeutic methods of treating subjects at risk of developing a disease or disorder or condition associated with T cell depletion or at risk of developing T cell depletion. The present invention also provides therapeutic methods for both preventive and therapeutic methods of treating subjects at risk of developing a disease or disorder or condition associated with T cell depletion or at risk of developing T cell depletion. Such diseases or disorders include, but are not limited to, HIV, AIDS, and chronic or acute bacterial, viral, or parasitic infections. Other such chronic infections include, for example, those caused by Hepatitis B virus (HBV), Hepatitis C virus (HCV), Herpes simplex virus 1 (HSV-1), H. pylori, or Toxoplasma gondii. Other acute infections include, for example, those caused by microorganisms such as gram-positive bacteria, gram-negative bacteria, protozoa, or fungi as described herein.

[0177] The present invention also includes a method of increasing or enhancing the immune response to an antigen. The immune response is increased or enhanced by administering the monoclonal antibody, scFv antibody, or bispecific antibody of the present invention to a subject. The immune response is enhanced, for example, by enhancing antigen-specific T effector function. The antigen is a viral (e.g., HIV), bacterial, parasitic, or tumor antigen. The immune response is a natural immune response. By natural immune response is meant an immune response that is the result of an infectious disease. The infectious disease is a chronic infectious disease. The increase or enhancement of the immune response to an antigen can be measured by many methods known in the art. For example, the immune response can be measured by measuring any one of the following: T cell activity, T cell proliferation, T cell activation, production of effector cytokines, and T cell transcriptional profile. Alternatively, the immune response is a response induced by vaccination.

[0178] Thus, in another aspect, the present invention provides a method for increasing vaccine efficacy by administering to a subject a monoclonal or scFv antibody of the present invention and a vaccine. The antibody and vaccine are administered sequentially or simultaneously. The vaccine is a tumor vaccine, a bacterial vaccine, or a viral vaccine.

[0179] Combination Method The compositions of the present invention described herein can be administered in combination with chemotherapeutic agents.The chemotherapeutic agents that can be administered with the compositions of the present disclosure include, but are not limited to, antibiotic derivatives (e.g., doxorubicin, bleomycin, daunorubicin, and dactinomycin), antiestrogens (e.g., tamoxifen), antimetabolites (e.g., fluorouracil, 5-FU, methotrexate, floxuridine, interferon alpha-2b, glutamic acid, plicamycin, mercaptopurine, and 6-thioguanine), cytotoxic agents (e.g., carmustine, BCNU, lomustine, CCNU, cytosine arabinoside, cyclophosphamide, estramustine, hydroxyurea, procarbazine, mitomycin, busulfan, cisplatin, and vincristine sulfate), hormones (e.g., medroxyprogesterone, estramustine sodium phosphate, ethinyl estradiol, estradiol, megestrol acetate, methyltestosterone, diethylstilbestrol diphosphate, chlorotrianisene, and testolactone), nitrogen mustard derivatives (e.g., mephalen, colambucil, mechlorethamine (nitrogen mustard), and thiotepa), steroids and combinations (e.g., betamethasone sodium phosphate), and others (e.g., dicarbazine, asparaginase, mitotane, vincristine sulfate, vinblastine sulfate, and etoposide).

[0180] In additional embodiments, the compositions of the invention described herein can be administered in combination with cytokines, including but not limited to IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-10, IL-12, IL-13, IL-15, anti-CD40, CD40L, and TNF-α, that may be administered with the compositions.

[0181] In additional embodiments, the compositions described herein can be administered in combination with other therapeutic or prophylactic regimens, such as, for example, radiation therapy.

[0182] In some embodiments, the compositions described herein can be administered in combination with other immunotherapeutic agents, including, but not limited to, simtuzumab, abagovomab, adecatumumab, afutuzumab, alemtuzumab, altumomab, amatuximab, anatumomab, arcitumomab, bavituximab, bectumomab, sirolimus ... b), bevacizumab, bivatuzumab, blinatumomab, brentuximab, cantuzumab, catumaxomab, cetuximab, sitatuzumab, cixutumumab, clivatuzumab, conatumumab, daratumumab Daratumab, drozitumab, duligotumab, dusigitumab, detumomab, dacetuzumab, dalotuzumab, ecromeximab, elotuzumab, ensituximab, ertumaxomab, etaracizumab zumab, farletuzumab, ficlatuzumab, figitumumab, flanvotumab, futuximab, ganitumab, gemtuzumab, girentuximab, glembatumumab, ibritumomab, igovomab,imgatuzumab, indatuximab, inotuzumab, intetumumab, ipilimumab, iratumumab, labetuzumab, lexatumumab, lintuzumab, lorvotuzumab, lucatumumab, mapatumumab, matuzumab (matuzumab), milatuzumab, minretumomab, mitumomab, moxetumomab, narnatumab, naptumomab, necitumumab, nimotuzumab, nofetumomab, ocaratuzumab, ofatumumab, olaratumab b), onartuzumab, oportuzumab, oregovomab, panitumumab, parsatuzumab, patritumab, pemtumomab, pertuzumab, pintumomab, pritumumab, racotumomab, radretumab, rilotumumab lotumumab, rituximab, robatumumab, satumomab, sibrotuzumab, siltuximab, solitomab, tacatuzumab, taplitumomab, tenatumomab, teprotumumab, tigatuzumab, tositumomab,These include trastuzumab, tucotuzumab, ublituximab, veltuzumab, vorsetuzumab, votumumab, zalutumumab, CC49, and 3F8.

[0183] The present invention provides a method of treating cancer in a patient by administering two antibodies that bind to the same epitope of the PD-1 protein, or alternatively, two different epitopes of the PD-1 protein. Alternatively, cancer can be treated by administering a first antibody that binds to PD-1 and a second antibody that binds to a protein other than PD-1. In other embodiments, cancer can be treated by administering a bispecific antibody that binds to PD-1 and also to a protein other than PD-1. For example, the protein other than PD-1 includes, but is not limited to, IL-12, IL-12R, IL-2, IL-2R, IL-15, IL-15R, IL-7, IL-7R, IL-21, or IL-21R. For example, the protein other than PD-1 can be a tumor-associated antigen, and the protein other than PD-1 can also be a cytokine.

[0184] In some embodiments, the invention provides for the administration of anti-PD-1 antibodies alone or with an additional antibody that recognizes another protein other than PD-1, along with cells capable of achieving or enhancing an immune response. For example, these cells can be peripheral blood mononuclear cells (PBMCs), or any cell type found in PBMCs, such as cytotoxic T cells, macrophages, and natural killer (NK) cells.

[0185] In addition, the present invention provides for the administration of an antibody that binds to the PD-1 protein and other therapeutic agents, including anti-neoplastic agents such as small molecules, growth factors, cytokines, or biomolecules such as peptides, peptidomimetics, peptoids, polynucleotides, lipid-derived mediators, small biogenic amines, hormones, neuropeptides, and proteases. Small molecules include, but are not limited to, inorganic molecules and small organic molecules. Suitable growth factors or cytokines include IL-2, GM-CSF, IL-12, and TNF-α. Small molecule libraries are known in the art. (See Lam, Anticancer Drug Des., 12:145, 1997.)

[0186] Chimeric antigen receptor (CAR) T cell therapy Also provided herein are cell therapies, such as chimeric antigen receptor (CAR) T cell therapy. CAR T cell therapy redirects a patient's T cells to kill tumor cells, for example, by exogenous expression of a CAR on the T cells. A CAR can be a transmembrane fusion protein that links the antigen recognition domain of an antibody to the intracellular signaling domain of a T cell receptor and co-receptor. For example, suitable cells can be used that are capable of secreting (or alternatively engineered to express) an anti-PD-1 antibody described herein that will secrete the anti-PD-1 antibody of the present invention. The secreted anti-PD-1 "payload" can be, for example, a minibody, ScFv, IgG molecule, bispecific fusion molecule, and other antibody fragments described herein.

[0187] Solid tumors offer unique challenges for CAR-T therapy. Some barriers to the efficacy of CAR-T in solid tumors include heterogeneous antigen expression, poor tissue homing, activation, persistence, and an immunosuppressive tumor microenvironment. Unlike hematological cancers, tumor-associated target proteins are overexpressed between tumors and healthy tissues, resulting in T cell killing of on-target / off-tumor in healthy tissues. Furthermore, immunosuppression in the tumor microenvironment (TME) limits the activation of tumor-killing CAR-T cells. After such contact or manipulation, the cells can be introduced into a cancer patient in need of treatment. The cancer patient can have any of the types of cancer disclosed herein. The cells (e.g., T cells) can be, for example, but are not limited to, tumor-infiltrating T lymphocytes, CD4+ T cells, CD8+ T cells, or combinations thereof.

[0188] Exemplary CARs and CAR factories useful in embodiments of the present invention include, for example, those disclosed in PCT / US2015 / 067225 and PCT / US2019 / 022272, each of which is incorporated herein by reference in its entirety. For example, CAR-T cells can be generated according to methods known in the art using lentiviral systems (via transduction), retroviral systems (via transfection (electroporation)), and transposon systems (via PiggyBac). Useful promoters of payloads that can be used to generate CAR-Ts include, for example, constitutive promoters (the promoter is the same as for CAR-T, such as EF1a, then IRES or 2A), inducible promoters (the promoter is different from that of CAR-T, such as NFAT, IL-2 prom), and engineered promoters (such as PD-1 locus "knock-in" of cytokines and / or promoters under the control of endogenous promoters). In one embodiment, the PD-1 antibodies or PD-1 fusion proteins discussed herein can be used in the construction of multispecific antibodies or as a payload for CAR-T cells. For example, in one embodiment, the anti-PD-1 antibodies or PD-1 fusion proteins discussed herein can be used for targeting CARS (i.e., as a targeting moiety). In one embodiment, the anti-PD-1 antibodies or PD-1 fusion proteins discussed herein can be used as a payload secreted by CAR-T cells. In another embodiment, the anti-PD-1 antibodies or PD-1 fusion proteins discussed herein can be used as a targeting moiety, and different PD-1 antibodies targeting different epitopes can be used as payloads. In another embodiment, the payload can be an immune-modulating antibody payload. In some embodiments, the PD-1 antibodies or PD-1 fusion proteins described herein for use in CAR-T compositions are not high affinity PD-1 antibodies (e.g., so that the antibody does not bind strongly to its PD-1 target).For example, the PD-1 antibodies or PD-1 fusion proteins described herein can be used as payloads secreted by CAR-T cells with two targeting moieties (e.g., tumor-associated surface antigens) selected for a particular cancer (i.e., MSLN and MUC1 for ovarian cancer). Non-limiting examples of tumor-associated surface antigens include ErbB2 (HER2 / neu), carcinoembryonic antigen (CEA), epithelial cell adhesion molecule (EpCAM), epidermal growth factor receptor (EGFR), MUC1, MSLN, CD19, CD20, CD30, CD40, CD22, RAGE-1, MN-CA, and IL-1. IX, RET1, RET2 (AS), prostate specific antigen (PSA), TAG-72, PAP, p53, Ras, prostein, PSMA, survivin, 9D7, prostate cancer tumor antigen-1 (PCTA-1), GAGE, MAGE, mesothelin, β-catenin, TGF-βRII, BRCA1 / 2, SAP-1, HPV-E6, HPV-E7 (also see PCT / US2015 / 067225 and PCT / US2019 / 022272, which are incorporated by reference in their entirety for additional tumor-associated surface antigens). Exemplary armored CAR-T cells are listed in the following table. TIFF0007680968000040.tif132154

[0189] In one embodiment, a bispecific (or dual-targeted) CAR-T is provided. In another embodiment, the CAR-T is an engineered cell comprising a chimeric antigen receptor, the chimeric antigen receptor comprising an extracellular ligand-binding domain specific for a first antigen and a second antigen on the surface of a cancer cell, the first antigen comprising CXCR4 and the second antigen comprising CLDN4, or the first antigen comprising CAIX and the second antigen comprising CD70, or the first antigen comprising MUC1 and the second antigen comprising Msln. For example, an anti-PD-1 antibody or a PD-1 fusion protein as described herein (such as an anti-PD1-scIL12 fusion as described herein) can be used as a payload for the CAR-T as described herein. In one embodiment, a CXCR4 / CLDN4 dual-targeted CAR-T with an anti-PD1-scIL12 fusion payload can be used for breast cancer. In one embodiment, a CAIX / CD70 dual-targeting CAR-T with an anti-PD1-scIL12 fusion payload can be used for clear cell renal cell carcinoma (ccRCC). In one embodiment, a MUC1 / Msln dual-targeting CAR-T with an anti-PD1-scIL12 fusion payload can be used for ovarian cancer.

[0190] Diagnostic Assays Anti-PD-1 antibodies can be used diagnostically, e.g., to monitor the development or progression of cancer, e.g., as part of a clinical trial procedure to determine the effectiveness of a given therapeutic and / or prophylactic regimen.

[0191] In some embodiments, for diagnostic purposes, the anti-PD-1 antibodies of the invention are linked to a detectable moiety to provide a method for detecting cancer cells, e.g., in a subject at risk for or afflicted with cancer.

[0192] The detectable moiety can be directly conjugated to the antibody or fragment, or indirectly, for example, by using a fluorescent secondary antibody. Direct conjugation can be achieved, for example, by standard chemical conjugation of a fluorophore to the antibody or antibody fragment, or through genetic engineering. Chimeras, or fusion proteins containing an antibody or antibody fragment bound to a fluorescent or bioluminescent protein, can be constructed. For example, Casadei et al. (Proc Natl Acad Sci US A. 1990 Mar; 87 (6): 2047-51) describe a method for making a vector construct that can express the fusion protein gene of aequorin and antibody in mammalian cells.

[0193] As used herein, the term "labeled" with respect to a probe or antibody can encompass direct labeling of the probe or antibody by binding (i.e., physically linking) a detectable substance to the probe or antibody, and indirect labeling of the probe or antibody by reactivity with another reagent that is directly labeled. Examples of indirect labeling include detection of a primary antibody using a fluorescently labeled secondary antibody, and end-labeling a DNA probe with biotin so that it can be detected with fluorescently labeled streptavidin. The term "biological sample" is intended to include tissues, cells, and biological fluids isolated from a subject, as well as tissues, cells, and biological fluids present within a subject. That is, the detection method of the present invention can be used to detect cells expressing PD-1 in biological samples in vitro and in vivo. For example, in vitro techniques for detection of PD-1 include enzyme-linked immunosorbent assay (ELISA), Western blotting, immunoprecipitation, and immunofluorescence. Additionally, in vivo techniques for detection of PD-1 include introducing a labeled anti-PD-1 antibody into a subject. For example, the antibody can be labeled with a radioactive marker whose presence and location in a subject can be detected by standard imaging techniques.

[0194] For "targeted" conjugates, i.e., conjugates that contain a targeting moiety, which is a molecule or feature designed to localize the conjugate within a subject or animal at a specific site(s), localization can refer to a state when an equilibrium is essentially achieved between the bound "localized" entity and the unbound "free" entity within the subject. The rate at which such equilibrium is achieved depends on the route of administration. For example, a conjugate administered by intravenous injection can achieve localization within minutes of injection. On the other hand, an orally administered conjugate may take several hours to achieve localization. Alternatively, localization can simply refer to the location of the entity within a subject or animal at a selected period of time after the entity is administered. As another example, localization is achieved when the moiety becomes distributed after administration.

[0195] It is understood that a reasonable estimate of the time to achieve localization can be made by those skilled in the art.Furthermore, the state of localization as a function of time can be tracked by imaging detectable moieties (e.g., luminescent conjugates) according to the method of the present invention, such as with a photodetector device.The "photodetector device" used should be sensitive enough to allow imaging weak light from within a mammal in a reasonable time and to use the signal from such device to construct an image.

[0196] In cases where it is possible to use extremely bright light-generating moieties and / or detect light-generating fusion proteins localized near the surface of the object or animal being imaged, "night vision" goggles or standard highly sensitive video cameras such as Silicon Intensified Tube (SIT) cameras (e.g., from Hammamatsu Photonic Systems, Bridgewater, NJ) can be used. More typically, however, more sensitive light detection methods are required.

[0197] At extremely low light levels, the photon flux per unit area becomes so low that the imaged scene appears discontinuous. Instead, it is represented by individual photons that differ from each other both temporally and spatially. When viewed on a monitor, such an image appears as twinkling points of light, each representing a single detected photon. By accumulating these detected photons over time in a digital image processor, an image can be acquired and constructed. In contrast to conventional cameras where an intensity value is assigned to the signal at each image point, in photon counting imaging, the amplitude of the signal is not important. The goal is simply to detect the presence of the signal (photon) and count the occurrence of the signal at its location over time.

[0198] The at least two types of photodetector devices described below can generate signals that can detect individual photons and be analyzed by an image processor. The noise-reducing photodetector device achieves sensitivity not by amplifying the photon signal, but by reducing the background noise of the photon detector. The noise is mainly reduced by cooling the detector array. The device includes a charge-coupled device (CCD) camera called a "backside-thinned" cooled CCD camera. In more sensitive devices, the cooling is achieved using liquid nitrogen, for example, by setting the temperature of the CCD array to about -120 °C. "Backside-thinned" refers to an ultra-thin backplate that reduces the path length that photons travel until they are detected, thereby increasing the quantum efficiency. A particularly sensitive backside-thinned cryogenic CCD camera is the Series 200 camera, "TECH 512", available from Photometries, Ltd. (Tucson, Ariz.).

[0199] "Photon amplification devices" amplify photons before they hit the detection screen. This class includes CCD cameras equipped with intensifier tubes, such as microchannel intensifier tubes. Microchannel intensifier tubes typically contain a metal array of channels perpendicular to and coextensive with the detection screen of the camera. The microchannel array is placed between the sample, subject, or animal to be imaged and the camera. Most of the photons that enter the channels of the array contact the side of the channel before exiting. A voltage applied across the array results in the ejection of many electrons from each photon collision. Electrons from such collisions exit their channel of origin in a "shotgun" pattern and are detected by the camera.

[0200] Even higher sensitivity can be achieved by placing intensifying microchannel arrays in series, so that electrons generated in the first stage in turn result in an amplified signal of electrons in the second stage. However, the increase in sensitivity is achieved at the expense of spatial resolution, which decreases with each additional stage of amplification. An exemplary microchannel intensifier-tube-based single-photon detection device is the C2400 series available from Hamamatsu.

[0201] Image processors process signals generated by photodetector devices that count photons to construct an image that can be displayed on a monitor or printed on a video printer, for example. Such image processors are typically sold as part of a system that includes the highly sensitive photon-counting camera described above, and are therefore available from the same sources. Image processors are usually connected to a personal computer, such as an IBM-compatible PC or an Apple Macintosh (Apple Computer, Cupertino, Calif), which may or may not be included as part of a purchased imaging system. Once the images are in the form of digital files, they can be manipulated and printed by a variety of image processing programs (such as "ADOBE PHOTOSHOP", Adobe Systems, Adobe Systems, Mt. View, Calif., etc.).

[0202] In one embodiment, the biological sample contains protein molecules from the test subject. One exemplary biological sample is a peripheral blood leukocyte sample isolated by conventional means from a subject.

[0203] The present invention also encompasses kits for detecting the presence of PD-1 or PD-1 expressing cells in a biological sample. For example, the kit can include a labeled compound or agent (e.g., an anti-PD-1 scFv or monoclonal antibody) capable of detecting cancer or tumor cells in a biological sample, a means for determining the amount of PD-1 in the sample, and a means for comparing the amount of PD-1 in the sample with a standard. The standard, in some embodiments, is a non-cancerous cell or a cell extract thereof. The compound or agent can be packaged in a suitable container. The kit can further include instructions for using the kit to detect cancer in a sample.

[0204] Other embodiments Although the present invention has been described in conjunction with a detailed description thereof, the foregoing description is intended to be illustrative, and not limiting, of the scope of the invention, which is defined by the appended claims. Other aspects, advantages, and modifications are within the scope of the appended claims.

[0205] The invention is further described in the following examples, which do not limit the scope of the invention described in the claims. EXAMPLES

[0206] Examples are provided below to facilitate a more complete understanding of the present invention. The following examples illustrate exemplary ways of making and carrying out the present invention. However, the scope of the present invention is not limited to the specific embodiments disclosed in these examples, and are for illustrative purposes only, since alternative methods can be used to obtain similar results.

[0207] Example 1 - PMPL Panning The PD-1 antibodies of the present invention (e.g., P4-B3 and P4-B7) were discovered via PMPL panning. Briefly, PD-1 was expressed genetically fused to a C-terminal C9 tag (TETSQVAPA). Expi293 cells were transiently transfected and then lysed. The lysate was clarified and PD-1 protein was captured using 1D4 (anti-C9 tag) conjugated magnetic beads. The beads were then dialyzed in a lipid solution to form a lipid bilayer around the beads, simulating the cell membrane and increasing the stability of the protein. These beads were then used for panning.

[0208] Example 2 - Minibody Binding Curves Minibody binding curves were performed on transfected cells (see Figure 4). Binding curves for P4-B3 minibody were generated using cells transfected with human or cynomolgus PD1. Human variants were performed twice, whereas negative control and cynomolgus were performed once. Curves were generated on Expi293 cells 48 hours after transfection. Human variant curves were normalized based on expression levels by commercial antibody staining, but cynomolgus variants were not. Normalization was not performed on cynomolgus variants because the commercial antibody used has not been reported to bind to cynomolgus PD-1.

[0209] Example 3 - Octet binding curves of different antibody formats of P4-B3 Streptavidin sensors were loaded with 3ug / ml of biotinylated PD-1. A maximum concentration of 50nM was used for all formats of P4-B3, with 3 / 4 serial dilutions performed. Kinetic calculations were performed using Octet Red software and are shown in Figure 5. According to the EMEA evaluation report (EMEA / H / C / 003820 / 0000), the reported KD of Pembro is 2.9E-11M, which is comparable to the results obtained from experiments with Pembro.

[0210] Example 4 - PD-L1 competition assay SA sensors were loaded with 3ug / ml PD-1 and incubated with various concentrations (50-0nM) of Pembro (IgG) or P4-B3 (IgG or minibody), followed by 5ug / ml PD-L1. In Figure 6, the red curve represents the maximum amount of PD-L1 binding to a PD-1 functionalized sensor with no antibody loaded. As shown in Figure 6, the P4-B3 antibody appears to block a significant portion of PD-L1 binding, although it shifts slightly upon addition of PD-L1. The curve does not include the antibody loading step, but instead shows the step of conjugating PD-L1. The original antibody conjugation step is shown in detail in Figure 5.

[0211] Example 5 - IgG ELISA ELISA plates were coated with soluble PD1 at 1ug / ml for 2 hours at 37°C. Plates were then washed and blocked with 2% BSA / PBS for 1 hour at 37C. Blocking solution was removed and 3-fold serial dilutions of antibody starting at 6ug / ml were added to each well (100ul) in 2% milk-PBST. Plates were then incubated at room temperature with gentle shaking, washed 6 times with PBS-T and secondary anti-human Fc-HRP (1:150k, Bethyl) was added. Plates were again incubated at room temperature with gentle shaking for 1 hour and then washed 6 times with PBS-T. TMB substrate was added and plates were incubated at 30°C for 10 minutes to promote the HRP reaction. Signal was then quenched with TMB stop solution and read at 450nm. See top graph in Figure 7.

[0212] The same protocol described herein was applied to the bottom graph of Figure 7, except that plates were coated with 3-fold serial dilutions of antigen starting at 6ug / ml. Antibody was then added to all wells at a constant concentration of 1ug / ml.

[0213] Example 6 - PD1 FACS using anti-PD1 IgG T cells were cultured for 48 hours in complete DMEM (293FT medium) with or without 5ug / ml PHA. Pembrolizumab and P4-B3 antibodies were detected with Biolegend's anti-human IgG Fc APC (cat. no. 409306). As shown in Figure 8, the P4-B3 PD-1 antibody shows a similar binding pattern to pembrolizumab and the control anti-PD1 antibody.

[0214] Example 7 - PD1-PDL1 Bioassay A Promega PD1-PDL1 bioassay (J1250) was performed using a PD-1 antibody of the invention (P4-B3) and the commercially available antibodies pembrolizumab and nivolumab (Figure 9).

[0215] Constructs tested were: (a) IgG1: WT monomer, (b) LALA: monomer, hexamer, and mutant 3, (c) sIgG4: monomer and hexamer, control: mAb11 LALA monomer.

[0216] All samples were performed in triplicate, except for mAb11.

[0217] Fold induction: RLU stimulated / RLU unstimulated (no Ab) (Figure 10).

[0218] Example 8 - Anti-PD-1 cross-reactivity Many anti-PD-1 antibodies cannot cross-react with mouse and human PD-1 (Pembro and Nivo are not cross-reactive). See Fessas, Petros et al. “A molecular and preclinical comparison of the PD-1-targeted T-cell checkpoint inhibitors nivolumab and pembrolizumab” Seminars in oncology vol.44,2(2017):136-140. Also see Tan JBL, Chen C, Chen K, Preclinical Characterization of GLS-010(AB122):A Fully Human Clinical-Stage anti-PD-1 Antibody.” Poster, Arcus Biosciences; Burova, Elena et al. “Characterization of the Anti-PD-1 Antibody REGN2810 and Its Antitumor Activity in HumanPD-1Knock-In Mice” Large Molecule Therapeutics, 2017. Also see Li, Dong et al. “Epitope mapping reveals the binding mechanism of a functional antibody cross-reactive to both human and murine programmed death 1” mAbs vol.9,4(2017):628-637.

[0219] The antibodies of the present invention (eg, P4-B3) are cross-reactive.

[0220] Expi293 cells transiently transfected with 3E5 were suspended in 100ul of MACS buffer and added to each well. Then, 50ul of each antibody dilution was mixed with the cells and the plate was incubated for 30 minutes at 4°C. After incubation, the plate was washed twice with MACS buffer and incubated with 1ul / well of anti-human Fc-APC (Biolegend #409306). The plate was incubated for 25 minutes at 4°C and washed three times before sample analysis was performed.

[0221] As shown in Figure 16, P4-B3 has moderate affinity for mouse PD-1, which distinguishes it from Pembro and Nivo.

[0222] Example 9 - Affinity Maturation Yeast library generation First, cut and paste the P4-B3 scFv from the pFarber vector (phage display) into the pCTCON2 vector (yeast display). Then, create a library according to two methods implemented in the art: (1) cleavage / ligation in bacteria and transforming yeast with intact plasmid, and (2) homologous recombination in yeast with linearized vector + PCR fragment. The cleavage / ligation method (method (1) described herein) results in a very small library size, low efficiency of ligation / bacterial transformation, and very low efficiency of transformation into yeast. However, homologous recombination (method (2) described herein) results in a very small library size, low efficiency of ligation / bacterial transformation, and very low efficiency of transformation into yeast. 6 ~10 7 A library of mutants was obtained.

[0223] Error-prone mutations The Agilent GeneMorph II Random Mutagenesis Kit was used, which is designed to vary the mutation rate based on the original template DNA. TIFF0007680968000041.tif41128

[0224] External primers (approximately 50-60 bp overlap with pCTCON2 vector): (a) pCTCON2-HR-Fwd: GAGGAGGCTCTGGTGGAGGCGGTAGCGGAGGCGGAGGGTCGGCTAGCTGGGCCCAGCCGG (b) pCTCON2-HR-Rev: ACACTGTTGTTATCAGATCTCGAGCTATTACAAGTCCTCTTCAGAAAATAAGCTTTTGTTC

[0225] Internal primers (45 bp overlap with heavy or light chain fragment): (a) G4S-Fwd: GGTGGCGGCGGTTCCGGAGGTGGTGGTTCTGGCGGTGGTGGCAGC (b) G4S-Rev: GCTGCCACCACCGCCAGAACCACCACCTCCGGAACCGCCGCCACC

[0226] Error-prone mutagenesis strategies (a) PCR the entire scFv fragment using external primers. This strategy allows for mutations in the linker region, which is undesirable. (b) PCR the heavy and light chains separately using external and G4S primers, and use the G4S linker as the third overlap point for three-piece homologous recombination. This strategy protects the linker from mutations, but requires three-piece homologous recombination and may be less efficient than two-piece.

[0227] Both procedures were used with different amounts of template DNA. The template for the whole scFv PCR was the pCTCON4 vector into which P4-B3 had been cloned (approximately 1 / 10 of the template is the target sequence). The template for the heavy / light chain separate PCRs was the P4-B3 PCR fragment (approximately 1 / 2 of the template is the target sequence).

[0228] Templates used: for whole scFv PCR: 4ug, 2ug, 1ug, 0.5ug, for separate heavy / light chain PCR: 450ng, 50ng (2 reactions each).

[0229] *PCR was performed for 33 cycles to increase DNA yield.

[0230] Creating a library The protocol described in Benatuil et al., “An improved yeast transformation method for the generation of very large human antibody libraries,” Protein Eng Des Sel. 2010 Apr;23(4):155-9 was followed.

[0231] General protocol: EBY100 yeast cells were inoculated into 100 ml of YPD medium at OD600=0.3 and grown at 30C for approximately 5-6 hours until OD600=1.6. Cells were harvested by centrifugation, washed twice with 50 ml of chilled ddH2O and resuspended in 50 ml of chilled electroporation buffer (1M sorbitol / 1 mM CaCl 2 ) for 30 min. The cells were then conditioned in 20 ml of 0.1 M LiAc / 10 mM DTT by shaking at 30 C for 30 min. The cells were harvested and washed with 50 ml of chilled electroporation buffer. After pelleting, the cells were resuspended in a final volume of 1 ml, which is adequate for two transformations.

[0232] Total scFv PCR: 4.8ug of insert was obtained and mixed with 4ug of linearized vector (NcoI / BamHI).

[0233] H / L chain PCR: 4.1 ug of HC and 3.5 ug of LC were obtained and reduced to 3 ug of linearized vector (NcoI / BamHI).

[0234] The vector and fragment of interest were mixed, precipitated with EtOH, and the volume reduced (to less than 50ul). 400ul of electrocompetent yeast cells were transformed using a Biorad at 2.5kV, 25uF. Cells were harvested in 1:1 YPD:1M sorbitol, cells were spun down for 1 hour, washed with SDCAA, and resuspended in 250ml SDCAA for each transformation.

[0235] Titers: (a) whole scFv library: approx. 5.2E6 members, (b) individual H / L chains: approx. 5.8E6 members.

[0236] After two passages, colonies were plated out and subjected to sequencing (96 colonies per library). Total scFv library: 56 / 96 (58.33%) had at least one mutation. H / L chain separate libraries: 42 / 96 (43.75%) had at least one mutation.

[0237] Effective library sizes: (a) total scFv library: approximately 2.9E6 members, (b) separate H / L chains: approximately 2.1E6 members.

[0238] Library sorting strategies Two staining methods were used: (1) standard staining to look for improved binding (shifted to the upper right quadrant during FACS analysis), (2) a kinetic strategy looking for improved off-rates.

[0239] In dynamic staining, the library is stained with labeled antigen at a concentration 10 times its Kd, washed, and then incubated with an increasing volume of unlabeled antigen at a concentration 100 times its Kd. Incubating the sample in a large volume prevents dissociating antigens from rebinding to yeast. Furthermore, adding a high concentration of unlabeled antigen will displace the labeled antigen that has been turned off with unlabeled antigen.

[0240] In the case of dynamic staining, the staining time depends on the time constant (τ). τ = (k on [Ag] 0 +koff ) -1

[0241] where k = on rate (M^-1s^-1), k = off rate (s^-1), and [Ag] = initial antigen concentration (M).

[0242] Octet measurements give kon=6.85E4, koff=6.45E-5, and Kd=9.4E10 for the P4-B3 scfv.

[0243] Equilibrium binding with 3τ is 95% and with 5τ 99% binding.

[0244] The staining protocol was performed according to Cherf and Cochran, “Applications of Yeast Surface Display for Protein Engineering,” Methods Mol Biol. 2015;1319:155-75.

[0245] Briefly, high affinity protein variants were isolated from yeast display libraries by FACS. Following transformation of yeast cells with the gene library and induction of surface expression, two main strategies are used to differentially label the displayed library prior to screening: 1) In the equilibrium binding strategy, the library is bound to the K predicted for the highest affinity mutants. D 2) In the kinetic binding strategy, the library is incubated with ligand concentrations 5-10 times higher than the equilibrium affinity, resulting in near saturation for tight binding mutants and partial labeling for weak equilibrium affinity mutants; and 2) in the kinetic binding strategy, the library is incubated with ligand as described for the equilibrium binding strategy, but unbound ligand is removed by washing, and the library is then incubated with a 100-fold excess of unlabeled ligand or with a sufficient excess volume of buffer to prevent rebinding of dissociated ligand.

[0246] In this second incubation step, excess unlabeled ligand or a large excess of incubation volume prevents rebinding of dissociated labeled ligand. Thus, proteins are differentiated based on their dissociation rate constant (koff), with variants with the slowest koff retaining the greatest proportion of prebound labeled ligand. Addition of fluorescently labeled anti-epitope tag antibodies allows normalization of yeast surface expression levels by binding and allows isolation of the highest affinity variants by FACS. The pool of selected yeast clones can be grown in culture for either analysis or subsequent rounds of sorting, or DNA from these clones can be isolated, subjected to mutagenesis, and used to transform new batches of yeast for directed evolution of proteins. Components of the yeast display platform, such as Aga1p, Aga2p, HA and c-myc epitope tags, as well as detection antibodies shown in Figure 17, are omitted for clarity.

[0247] Library Sorting Libraries were sorted on a Sony 800, recovering approximately 1000 clones per sample. Samples were sorted for clones with increased and decreased binding (mapping key residues). Selected cells were plated and a few dozen were grown and all were sequenced. Standard and dynamic staining was used, focusing on separate libraries for H / L chains. TIFF0007680968000042.tif72128

[0248] Selected cells were seeded on SDCAA plates and incubated at 30°C for 3 days. Colonies were then picked, grown in fresh SDCAA medium, and sequenced to identify significant mutations. Unique clones from sequencing were then inoculated onto fresh SGCAA (induced by galactose) and after 36 hours samples were stained to generate binding curves.

[0249] EBY100 yeast cultures were induced for 1.5 days at 30°C. 1E6 cells were spun down and various dilutions of antigen were added to the wells in PBS. Plates were incubated for 2 hours at room temperature with shaking. Plates were washed with PBS and 0.1ug / ml streptavidin-APC (Biolegend) was added to each well. Plates were incubated for 25 minutes at room temperature with shaking, then washed and read on a FACSCalibur.

[0250] Clones 2, 7, 10, and 14 were derived from a random mutagenesis library of P4-B3 (anti-PD1) and sorted for high binding (shifted upwards on the y=x axis). HL clones were generated by error-prone methods for H and L chains separately and then recombined by homologous recombination via linker sequences. HL Dynamic 1 was derived from a dynamic staining approach where the library was incubated with 10× Kd labeled antigen followed by a prolonged incubation with 100-fold excess of unlabeled antigen in a volume 10 times that of the original stain. P4-B3wt was not positive at this stage, but several clones were present in the popped-up library (see Figure 20). The experiment was repeated with appropriate concentrations and only clones with curves shifted to the left were used (see Figure 21).

[0251] Other clones identified but not characterized TIFF0007680968000043.tif71136

[0252] scFv positives are clones that showed increased binding (no upward shift on x=y axis), primarily by representing lower binding to cMyc but higher binding to PD-1.

[0253] scFv negatives are clones that showed reduced binding compared to WT.

[0254] In addition to cloning HLkin1, HL-7, and HL-14 into the minibody vector, double (Mut+2:HLkin1+HL-7) and triple (Mut+3:HLkin1+HL-7+HL-14) combination mutants were generated to determine whether additive effects were observed (see Figures 23 and 24).

[0255] For example, K D The measurement results were as follows: PD1#3 approx. 1E-10M P4-B3 WT approx. 1E-9M Mut+2(HLkin1+HL-7) approx. 3E-11M Mut+3(HLkin1+HL-7+HL-14) Approx. 3E-12M HLkin-1 approx. 6E-11M

[0256] We also cloned anti-PD-1 single chain IL12 fusions (bispecific antibodies). Four constructs were generated: (1) light chain fusion, (2) light chain F2A fusion, (3) heavy chain fusion, and (4) heavy chain F2A fusion. The fusions are linked with a flexible linker, and F2A has a self-cleaving peptide variant, allowing anti-PD-1 and scIL12 to go in different directions as needed.

[0257] Example 10 - PD1 bioassay with IgG The Promega PD1-PDL1 bioassay (J1250) was performed using PD-1 antibodies of the invention (e.g., P4-B3 and variants described herein) and the commercially available antibodies pembrolizumab and nivolumab (Figure 33).

[0258] Nivo (green triangle) reaches about 5-6 fold induction, which is similar to previous experiments. In the scFv-Fc experiments, Mut+2, Mut+3, HLkin-1, and HL-7 all showed higher induction compared to Nivo. When converted to IgG, the combo mutant (Mut+2 / Mut+3) maintains better performance than Nivo and functions at a level comparable to Pembro, but shows slightly lower activity in single (HLkin-1 / HL-7). The original P4-B3 IgG significantly underperforms all antibody IgGs. Clone scFv-6 is a double mutant derived from a yeast library, with mutations in two light chains. As can be seen, it is an improvement over P4-B3 WT, but is significantly inferior to commercially available and other mutant antibodies.

[0259] Example 11 - Construct design and killing assays Design of aPD1-scIL12 fusions P4-B3 Mut±3 scIL12 fused to IgG1: Generate single chain IL12 fusions with IgG1 heavy or light chains. Use either a (G4S)2 linker that keeps scIL12 linked to the IgG, or a self-cleaving F2A peptide that allows separation of the two molecules. All experiments are performed with IL12 fused to the G4S linker. Work with F2A is performed. Due to the length of IL12 and the efficiency and cost of gene synthesis, constructs were cloned first using a stuffer sequence to add the correct restriction enzyme sites. The following protocol is as described in Jiang et al., (1999) Infect Immun. Jun; 67(6): 2996-3001, Lode et al., (1999) Proc Natl Acad Sci US A. Jul 20; 96(15): 8591-6, Peng et al (1999) J Immunol. Jul 1; 163(1): 250-8, and Yu et al. (2012) PLoS One. 7(11): e50438. doi: 10.1371 / journal.pone.0050438. Epub 2012 Nov 28.

[0260] Cloning strategy using stuffer FIG. 44 shows the cloning steps used to generate aPD1-scIL12 fusion starting with P4-B3 Mut+3 and ending with G4S-scIL12 HC fusion (heavy chain fusions can be generated this way for any antibody construct, for kappa LC antibodies the restriction enzyme cloning sites will need to be modified but the overall strategy is the same). When making the HC F2A version the same procedure is followed except that the F2A stuffer synthetic fragment is used (scIL12 can be inserted with XbaI / BamHI after cutting the F2A stuffer fragment with NheI / BamHI). In some embodiments heavy chain fusions can be made using the exact same restriction sites for any IgG vector but the light chain restriction enzyme site and light chain constant region used with the stuffer are specific for lambda light chain. To add a fusion to a kappa light chain the restriction enzyme site needs to be changed and the light chain constant region changed to kappa to match the kappa vector instead of the lambda vector.

[0261] When making the light chain, similar steps can be followed as outlined in Figure 44, but the AvrII and EcoRI sites can be used instead of NheI / BamHI to insert the stuffer. scIL12 can then be inserted with XbaI / EcoRI.

[0262] Protein expression See, for example, FIG.

[0263] Kinetic binding study of aPD1-scIL12 fusion protein An Octet assay was performed to measure the binding affinity of P4-B3 WT vs. Mut+2 and Mut+3 to PD-1 (Figure 46). PD-1 was loaded at 2 μl / ml onto the streptavidin sensor in row AG and the negative control H5 biotin was loaded at 2 μl / ml onto row H. Antibodies were diluted in 2-fold serial dilutions. Improved off-rates (flatter slope) were observed for Mut+2 and +3 compared to WT. The lower curve for Pembro is an artifact of the Octet sensor.

[0264] Octet assays were performed to measure the binding affinity of P4-B3 mut+3 HC and LC scIL12 constructs to PD-1. PD-1 was loaded at 2 μl / ml onto the streptavidin sensor in row AG and negative control H5 biotin was loaded at 2 μl / ml onto row H. Fusion proteins were diluted in 2-fold serial dilutions. The HC fusion is the graph on the left in FIG. 47 and the LC fusion is the graph on the right in FIG. 47. The anti-PD1 IL12 fusion shows similar binding curves when compared to P4-B3 Mut+3 in FIG. 46 and the addition of the IL12 fusion does not compromise the improved off-rate.

[0265] Assessment of the biological activity of aPD1-scIL12 fusion protein by IL12 cytokine reporter assay IL12 binding to the native heterodimeric IL12R results in signaling through TyK2, JAK2, and STAT4, increasing the production of IFNγ. Invivogen engineered the IL12 pathway to link STAT4 production to an inducible SEAP reporter gene and stably transduced it into 293T cells (Figure 48). When supernatants from IL12-induced 293T-IL12 cells were mixed with Quanti-Blue reagent, the solution turned blue in the presence of SEAP, which could be quantified by measuring absorbance at 620-655 nm. Invivogen Cat #: hkb-il12.

[0266] The functionality of IL12 fusions was tested using the HEK-Blue IL12 reporter assay from Invivogen. Carrier-free IL12 from Biolegend was used as a positive control. In this experiment, it can be seen that our generated scIL12 and aPD1-LC-IL12 fusions have higher levels of activity compared to Biolegend IL12. The aPD1-HC-IL12 fusion shows a 2-fold shift to the left compared to the LC fusion and scIL12.

[0267] Negative controls used: P4-B3 Mut+3 IgG1, pembroluzimab, CD70-mFc, and media only wells were all negative.

[0268] Assessment of the biological activity of aPD1-scIL12 fusion protein by CART killing assay A Celigo-based killing assay was set up to test the effect of IL12 fusions on T cell killing activity. In this experiment, anti-CAIX CARs were used in both 4-1BB format and CD28-mat against CAIX+BFP cells. The A716-41BB CAR was used as a negative control since it does not target CAIX. BioIL12 is recombinant IL12 purchased from Biolegend.

[0269] Constructs tested: aPD1P4-B3 Mut+3 with HC or LC scIL12 fusions, aPD1P4-B3 Mut+3 alone, and scIL12 alone. Pembrolizumab + bioIL12 was also tested to replicate the separate administration of aPD1 and IL12. This experiment was designed to test the effect of IL12 on CARs using media only. The plate layout for the killing assay is shown in Figure 50.

[0270] Killing activity was measured by counting the change in BFP cell number on days 0, 1, and 2 via a Celigo image cytometer. At the end of day 2, supernatants were collected for cytokine ELISAs (IL2, TNFα, IFNγ). For cytokine ELISAs, supernatants were diluted 1:5 (TNFα), 1:40 (IL2), or 1:50 (IFNγ). TNFα and IL2 ELISAs were from BioLegend, and IFNγ was from Invitrogen.

[0271] Viral transduction efficiency: Three types of CAR T cells were generated using different lentiviral vectors. The CARs were generated to provide T cells already designed to kill for use in killing assays. Both G36-41BB and G36-CD28 target CAIX+ tumor cells, whereas A716-41BB targets BCMA. This provides both target-specific killing and a control, as CAIX+ tumor cells are used in the killing assays and A716-41BB cannot kill CAIX+ cells. Without being bound by theory, it is believed that this is also observed in the killing assays, as the G36-CD28 CAR shows a stronger and more rapid response than G36-41BB. G36-41BB → Donor O: 58.4% G36-CD28→donor O: 45.5% A716-41BB → Donor O: 32.6%

[0272] Bulk T cells were added to each well to normalize transduction efficiency. T cells were not sorted prior to use. Transduction efficiency was measured 3 days after transduction by GFP expression.

[0273] T cells were isolated from one donor (designated donor O) and incubated with TransAct overnight. The next day, they were used to transduce by spinoculation and DEAE at an MOI of 20. One day after transduction, T cells were washed and resuspended in fresh medium containing IL-21 for treatment.

[0274] A killing assay was performed with CAR T cells (Figure 50 shows the plate setup). CAIX+ cells were added to each well. All three CARs and non-transduced cells were added to the plate alone or in combination with various antibodies to observe their differences in effect. LC and HC fusions were added to corresponding wells, as well as anti-PD1, Pembro, IL-12, and a combination of Pembro and bioIL12. When the plate was read, extensive clustering and killing of tumor cells was observed.

[0275] Even at an E:T ratio of 1.25:1, the G36 CAR shows significant killing activity (Figure 41). Addition of aPD1-HS scIL12 fusion increases killing activity compared to aPD1 in both G36-41BB or CD28 CAR T cells. There is also a shift in A716 killing (non-specific killing) with addition of scIL12 fusion compared to aPD1 alone (Figure 51).

[0276] When the killing curves of G36-41BB alone and G36-41BB+scIL12 alone are added, all the lines "clump" at the top of the killing curves (Figure 52).

[0277] Cytokine ELISA Cytokine values ​​are shown as OD450 measurements. aPD1 refers to P4-B3 Mut+3 antibody in IgG1 WT mono format (can be fused to scIL12). Pembro refers to pembrolizumab.

[0278] A716-41BB was treated like all G36-41BB CARS and used as a control. For G36-CD28, non-transduced T cells were used as a control and were not treated with cytokines or antibodies. Cytokine ELISAs compared untreated CARs (media only) versus treatment options.

[0279] IL12 constructs have a significant effect on G36-41BB T cells at each E:T ratio. At E:T ratios of 2.5:1 and 1.25:1, they have a moderate effect on G36-CD28 T cells (except for CD28 at 1:1.25 ratio) (Figure 43). G36-41BB alone or in combination with anti-PD1 produces only small amounts of IL2, but the addition of IL12 significantly increases IL-2 secretion, which is further enhanced by treatment with aPD1-HCscIL12 or aPD1-LCscIL12 (Figure 53).

[0280] The scIL12 fusion pairs produce similar effects for both 41BB and CD28 constructs. In this IFNγ assay, scIL12 induces increased IFNγ secretion compared to CART cells alone. aPD1 itself also has a variable effect on IFNγ secretion, with a slight inhibitory effect seen in some samples. Addition of either aPD1-IL12 fusion increases IFNγ production for both 41BB and CD28-based CARs compared to CAR alone, aPD1 alone, or scIL12 alone (Figure 54). The aPD1 HC IL12 fusion is generally superior to aPD1 LC IL12, but in most conditions both aPD1 scIL12 fusions are superior to CART alone (Figure 54).

[0281] The scIL12 fusions do not significantly affect TNFα production by the G36-41BB construct, but there is a significant increase in TNFα production by the G36-CD28 construct. In this experiment, the HC fusions had a greater effect on TNFα production than either IL12 alone or the LC fusions. However, all IL-12 samples appear to exceed basal TNFα production by the G36-CD28 cells.

[0282] Example 12 - Mixed Lymphocyte Reaction (MLR) Protocol CD14+ monocytes were isolated using Miltenyi CD14+ microbeads. Cells were cultured in Miltenyi Mo-DC medium (pre-prepared medium containing GM-CSF+IL4). After culturing the cells for 5 days, TNF-α (1000U / ml), IL-1β (5ng / ml), IL-6 (10ng / ml), prostaglandin E2 (PGE2) (1μM) were added and the cells were cultured for 2 days to allow DC maturation. T cells were isolated on the day of the MLR experiment (CD4+ negative selection kit StemCell). 100,000 T cells and 10,000 MoDC cells were used per well for the MLR. Antibodies were added at various concentrations and the cultures were incubated for 5 days.

[0283] Supernatants were saved for ELISA screening (e.g., IL2 and IFNγ). For FACS analysis, cells were stained with CD4-FITC, PD1-PE, LAG3-BV421, TIM3-APC Cy7.

[0284] MLR Pembro vs P4-B3mut+3 IgG4. Two T cell donors and two DC donors were used. The titles of the graphs in Figures 59 and 60 indicate the cytokine measured, the T cell donor, and the DC donor. IL2 T2 DCV corresponds to the IL2 assay, T cell donor 2, DC donor V.

[0285] The P4-B3mut+3 antibody in sIgG4 format was tested against the commercial formulations of pembrolizumab and F10-sIgG4 (negative control). As shown in Figures 59 and 60, the addition of either P4-B3mut+3 or pembrolizumab significantly increases cytokine production compared to F10.

[0286] MLR PD-1 / IL12 fusion. One T cell donor and two DC donors were used. Graph titles in Figures 65 and 66 indicate the cytokine measured, T cell donor, scIL12 construct, and DC donor. T2 DCV HC IL2 data corresponds to the IL2 assay, T cell donor 2, DC donor V, and scIL12 HC fusion pair.

[0287] The P4-B3mut+3 antibody in LALA format, with or without scIL12 fusion to either the heavy or light chain, was tested against F10 in a similar format. As shown in Figures 59 and 60, the addition of either P4-B3mut+3 increases cytokine production compared to F10. The addition of scIL12 fusions significantly increases IFN-γ but not IL2. The effects were similar for heavy and light chain fusions. The PD-1 / IL12 fusions described herein activate T cells and increase expression of IFNγ but not IL2.

[0288] Example 13 - Masked IL-12 constructs Two "masked" PD-1 / IL12 constructs are shown in Figures 67 and 68. Figure 67 shows an intact MMP9 cleavage site for the protease MMP9 between the P35 and P40 subunits of IL-12. The other construct in Figure 68 shows a mutated protease cleavage site between the P35 and P40 subunits of IL-12.

[0289] Proteases are proteins that, in some cases, cleave proteins in a sequence-specific manner. Proteases include, but are not limited to, serine proteases, cysteine ​​proteases, aspartic acid proteases, threonine proteases, glutamic acid proteases, metalloproteases, aspartic peptide lyases, serum proteases, cathepsin, cathepsin B, cathepsin C, cathepsin D, cathepsin E, cathepsin K, cathepsin L, kallikrein, hK1, hK10, hK15, plasmin, collagenase, type IV collagenase, stromelysin, factor Xa, chymotrypsin-like proteases, trypsin-like proteases, elastase-like proteases, subtilisin-like proteases, actinidain, bromelan, calpain, caspase, caspase-3, Mi These include rl-CP, papain, HIV-1 protease, HSV protease, CMV protease, chymosin, renin, pepsin, matriptase, legumain, plasmepsin, nepenthesin, metalloexopeptidases, metalloendopeptidases, matrix metalloproteases (MMPs), MMP1, MMP2, MMP3, MMP8, MMP9, MMP13, MMP11, MMP14, urokinase plasminogen activator (uPA), enterokinase, prostate specific antigen (PSA, hK3), interleukin-1β converting enzyme, thrombin, FAP (FAP-α), dipeptidyl peptidase, and dipeptidyl peptidase IV (DPPIV / CD26). A "protease cleavage site" can refer to an amino acid sequence that can be cleaved by a protease, such as, for example, a matrix metalloproteinase (MMP) or furin. Non-limiting examples of linkers and protease cleavage sites known to those of skill in the art that can be used to construct the anti-PD-1-IL-12 fusions described herein are described in U.S. Patent No. 9,708,412, U.S. Patent Application Publication Nos. 2018 / 0134789 and 2020 / 0148771, and PCT Publication No. WO 2019 / 051122, each of which is incorporated by reference in its entirety. In some embodiments, the protease cleavage site is recognized by a protease disclosed in Table X herein.

[0290] Table X: Proteases and protease cleavage sites TIFF0007680968000044.tif220150TIFF0007680968000045.tif229150

[0291] For example, the anti-PD-1-IL-12 fusions described herein contain at least one protease cleavage site that includes an amino acid sequence that is cleaved by at least one protease. In some embodiments, the anti-PD-1-IL-12 fusions described herein contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more protease cleavage sites that are cleaved by at least one protease. Non-limiting examples of such cleavage sites include (GPLGIAGQ) or (AVRWLLTA), which may be cleaved by metalloproteinases, as well as (RRRRRR), which may be cleaved by furin. In therapeutic applications, the protease cleavage site can be cleaved by a protease produced by a target cell, such as a cancer cell or an infected cell, or a pathogen. In some embodiments described herein, the linker can include a protease cleavage site. Such linkers that contain a protease cleavage site are, in certain embodiments, susceptible to proteases (such as MMPs, furin, cathepsin B, etc.) that are present in particular tissues or subcellular compartments. Exemplary sequences of such protease cleavable linkers include, but are not limited to, (PLGLWA), (RVLAEA), (EDVVCCSMSY), (GGIEGRGS), where n is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, which are recognized by MMP-1, and (GFLG), where n is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, which are recognized by furin. In some embodiments, the linker containing a protease cleavage site plays a role in masking / unmasking (e.g., activation) of the IL-12 targeting domain binding protein. In some embodiments, the binding protein can be other cytokines, etc., as described herein.In some embodiments, the inducible target binding protein upon activation by protease cleavage is 100 kD or less, 75 kD or less, 50 kD or less, 25 kD or less, 20 kD or less, 15 kD or less, 10 kD or less, or 5 kD or less. Prior to cleavage and activation, the target binding protein is in certain embodiments 100 kD or less, 75 kD or less, 50 kD or less, 25 kD or less, 20 kD or less, 15 kD or less, 10 kD or less, or 5 kD or less.

[0292] A protease cleavage site as described herein is a polypeptide having a sequence that is recognized and cleaved in a sequence-specific manner. The anti-PD-1-IL-12 fusions as described herein can comprise a protease cleavage site that is sequence-specifically recognized by a matrix metalloprotease (MMP), e.g., MMP9. In some embodiments, the protease cleavage site recognized by MMP9 comprises a polypeptide having the amino acid sequence PR(S / T)(L / I)(S / T). In some embodiments, the protease cleavage site recognized by MMP9 comprises a polypeptide having the amino acid sequence LEATA. In some embodiments, the protease cleavage site is sequence-specifically recognized by MMP11. In some embodiments, the protease cleavage site recognized by MMP11 comprises a polypeptide having the amino acid sequence GGAANLVRGG.

[0293] For example, the MMP9 / mutation site forms a pseudo-linker of 7 amino acids, as opposed to the 15 amino acids originally present in the G4S repeat linker. Without being bound by theory, by shortening the linker, IL-12 is unable to fold into a dimeric form, and therefore activity is greatly reduced. In one embodiment, the MMP9 / mutation site forms a pseudo-linker of 6 amino acids. In one embodiment, the MMP9 / mutation site forms a pseudo-linker of 5 amino acids. In one embodiment, the MMP9 / mutation site forms a pseudo-linker of 4 amino acids. In one embodiment, the MMP9 / mutation site forms a pseudo-linker of 3 amino acids. In one embodiment, the MMP9 / mutation site forms a pseudo-linker of 2 amino acids. In some embodiments, the pseudo-linker site can be formed according to techniques routinely used by those of skill in the art, resulting in pseudo-linkers of 14, 13, 12, 11, 10, 9, or 8 amino acids in length (see Eckhard et al. (2016) Matrix Biology, 49:37-60, incorporated by reference in its entirety). For example, upon reaching the tumor site, localized proteases can cleave the linker, releasing the P35 subunit to form the heterodimer. Without being bound by theory, the 7aa linker is short enough to inhibit folding, and once the second monomer is released, the subunits can assemble properly.

[0294] In some embodiments, MMP9 is selected because the cleavage sequence and recombinant protease are readily available to one of skill in the art. In other embodiments, cleavage sites can be optimized / selected for various cancer indications (see, e.g., Al-Alem L, Curry TE Jr. Ovarian cancer: involvement of the matrix metalloproteinases. Reproduction. 2015; 150(2): R55-R64; Wang, S., Jia, J., Liu, D. et al. Matrix Metalloproteinase Expressions Play Important role in Prediction of Ovarian Cancer Outcome. Sci Rep 9, 11677 (2019); Ren F, Tang R, Zhang X, et al. Overexpression of MMP Family Members Functions as Prognostic Biomarker for Breast Cancer Patients: A Systematic Review and Meta-Analysis. PLoS One. 2015; 10(8): e0135544, each of which is incorporated by reference in its entirety). For example, if an ovarian cancer overexpresses MMP2 but not MMP9, the linker / cleavage sequence would be altered accordingly.

[0295] equivalent Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, numerous equivalents to the specific substances and procedures specifically described herein which are considered to be within the scope of the invention and covered by the appended claims.

Claims

1. 1. An isolated multispecific antibody or antigen-binding fragment thereof that binds to human programmed cell death 1 (PD-1) protein and interleukin-12 (IL-12) receptor, (a) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28, or (b) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28, or (c) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 79, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28, or (d) a VH CDR1 comprising the amino acid sequence of SEQ ID NO:78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO:19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO:21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO:24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO:26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO:28, or (e) a VH CDR1 comprising the amino acid sequence of SEQ ID NO:78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO:19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO:21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO:24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO:80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO:28; or (f) a VH CDR1 comprising the amino acid sequence of SEQ ID NO:78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO:19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO:79, a VL CDR1 comprising the amino acid sequence of SEQ ID NO:24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO:80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO:

28. and further comprising a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO:

129.

2. an isolated multispecific antibody or antigen-binding fragment thereof, wherein the antibody binds to PD-1, and comprises a heavy chain and a light chain, wherein the heavy chain comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, and a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO: 1, and the light chain comprises a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO: 2, and wherein the antibody binds to an interleukin-12 (IL-12) receptor, and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129; or an isolated multispecific antibody or antigen-binding fragment thereof, wherein the antibody binds to PD-1, and comprises a heavy chain and a light chain, wherein the heavy chain comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, and a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO: 1, and the light chain comprises a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO: 11, and wherein the antibody binds to an interleukin-12 (IL-12) receptor, and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129; or an isolated multispecific antibody or antigen-binding fragment thereof, wherein the antibody binds to PD-1, and comprises a heavy chain and a light chain, wherein the heavy chain comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, and a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 79, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO: 12, and the light chain comprises a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO: 2, and wherein the antibody binds to an interleukin-12 (IL-12) receptor, and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129; or an isolated multispecific antibody or antigen-binding fragment thereof, wherein the antibody binds to PD-1, and comprises a heavy chain and a light chain, wherein the heavy chain comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO:78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO:19, and a VH CDR3 comprising the amino acid sequence of SEQ ID NO:21, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO:13, and the light chain comprises a VL CDR1 comprising the amino acid sequence of SEQ ID NO:24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO:26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO:28, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO:2, and wherein the antibody binds to an interleukin-12 (IL-12) receptor, and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO:129; or an isolated multispecific antibody or antigen-binding fragment thereof, wherein the antibody binds to PD-1, and comprises a heavy chain and a light chain, wherein the heavy chain comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO:78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO:19, and a VH CDR3 comprising the amino acid sequence of SEQ ID NO:21, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO:13, and the light chain comprises a VL CDR1 comprising the amino acid sequence of SEQ ID NO:24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO:80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO:28, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO:11, and wherein the antibody binds to an interleukin-12 (IL-12) receptor, and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO:129; or 1. An isolated multispecific antibody, or antigen-binding fragment thereof, wherein the antibody binds to PD-1, comprising a heavy chain and a light chain, wherein the heavy chain comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO:78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO:19, and a VH CDR3 comprising the amino acid sequence of SEQ ID NO:79, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO:15, and the light chain comprises a VL CDR1 comprising the amino acid sequence of SEQ ID NO:24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO:80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO:28, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO:11, and wherein the antibody binds to an interleukin-12 (IL-12) receptor, and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO:

129.

3. A nucleic acid encoding the antibody of claim 1 or 2.

4. A pharmaceutical composition comprising the antibody or antigen-binding fragment thereof described in claim 1 or 2 and a pharma- ceutically acceptable carrier or excipient.

5. 3. An isolated cell comprising one or more polynucleotides encoding the antibody or antigen-binding fragment thereof of claim 1 or 2.

6. A vector comprising the nucleic acid of claim 3.

7. A cell comprising the vector described in claim 6.

8. 5. A kit comprising the pharmaceutical composition of claim 4, a syringe, needle or applicator for administering the at least one antibody to a subject, and instructions for use.

9. 3. An engineered cell comprising a chimeric antigen receptor, the chimeric antigen receptor comprising an extracellular ligand binding domain specific for an antigen on the surface of a cancer cell, the antigen comprising PD-1, and the extracellular ligand binding domain comprising the antibody or antigen-binding fragment thereof of claim 1 or 2.

10. 10. The engineered cell of claim 9, wherein the engineered cell comprises a T cell, an NK cell, or an NKT cell.

11. 5. The pharmaceutical composition of claim 4, further comprising at least one additional therapeutic agent.

12. The pharmaceutical composition of claim 11 , wherein the therapeutic agent is a toxin, a radiolabel, an siRNA, a small molecule, or a cytokine.

13. 11. The engineered cell of claim 10, wherein the T cells are CD4+, CD8+, CD3+ pan T cells, or any combination thereof.

Images