Polymer-based cell labeling, barcoding, and aggregates

The use of capped cationic polymers for creating cationic barcodes addresses the inefficiencies of current cell labeling methods, enabling efficient and cost-effective multiplex barcoding of cell populations.

JP7692367B2Active Publication Date: 2025-06-13CHILDRENS HOSPITAL MEDICAL CENT CINCINNATI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2021570129
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2019-05-31
Filing Date
2020-05-29
Publication Date
2025-06-13
Estimated Expiration
2040-05-29

AI Technical Summary

Technical Problem

Current cell labeling methods using antibody-oligonucleotide pairs are cumbersome, costly, and time-consuming, requiring separate conjugation reactions for each cell type, which limits their efficiency and scalability.

Method used

The development of capped cationic polymers that can be used to create cationic barcodes for cell labeling, allowing for efficient and inexpensive multiplex barcoding by enabling nucleic acid barcodes to access the cytoplasm of cells.

Benefits of technology

This method enables rapid and cost-effective labeling of cell populations, allowing for correct identification of barcodes in 90% of cells derived from human liver organoids, and facilitates multiplexing of heterogeneous samples.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007692367000008
    Figure 0007692367000008
  • Figure 0007692367000009
    Figure 0007692367000009
  • Figure 0007692367000010
    Figure 0007692367000010
Patent Text Reader

Abstract

Existing single-cell analysis techniques generally have high resolution but are limited in the number of different experimental conditions possible. Disclosed herein are compositions and methods for multiplexed barcoding of heterogeneous populations of cells using cationic polymers to deliver nucleic acid barcodes to the cell population.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Cross - Reference to Related Applications This application claims the benefit of priority of U.S. Provisional Patent Application No. 62 / 855,448, filed on May 31, 2019, the entire disclosure of which is hereby incorporated by reference in its entirety.

[0002] Reference to Sequence Listing This application has been filed with an electronic sequence listing. The sequence listing was created on May 29, 2020, last modified, and provided as the file named CHMC63_022WOSeqListing.TXT, which is 1,305 bytes in size. The information of the electronic sequence listing is hereby incorporated by reference in its entirety.

[0003] Aspects of the present disclosure generally relate to cell barcoding techniques. These techniques utilize cationic polymers and synthetic nucleic acid molecules for efficient and inexpensive multiplex barcoding.

Background Art

[0004] Single cell genomics, transcriptomics, and proteomics analysis have revolutionized quantitative biology and applied medicine. Innovative techniques in high-throughput oligonucleotide sequencing have opened the way to a series of innovative strategies for the investigation in the treatment and isolation of specific cell types and subsequent downstream analysis. In single cell applications, current methodologies rely on single cell labeling using antibody-oligonucleotide pairs that tag cell populations with unique molecular identifiers that function as molecular barcodes. The DNA oligonucleotides are covalently bound to the surface of specific antibodies, and since these oligonucleotides do not have the inherent ability to bind primarily targeting the cell or protein of interest, these antibodies function as labeling mediators. Furthermore, direct conjugation is required for each combination of antibody and oligonucleotide pairing. To label five populations of the same cell type with five different unique molecular identifiers, five separate conjugation reactions are required. This need to create antibody-oligo pairs for all cell types can be cumbersome, costly, and time-consuming. Therefore, an improved method for cell labeling is currently needed. The prior art document information related to the invention of this application is as follows (including documents cited at the international stage after the international filing date and documents cited when national phase entry occurs in other countries). (Prior art document) (Patent document) (Patent document 1) US Patent Application Publication No. 2012 / 0149630 (Patent document 2) US Patent Application Publication No. 2015 / 0273071 (Patent document 3) US Patent Application Publication No. 2018 / 0250410 (Patent document 4) International Publication No. 2018 / 115852 (Non-patent document) (Non-patent document 1) Dunn "Cationic Nanoparticles for the Targeting and Delivery of Nucleic Acids to the Pulmonary Endothelium" University of Cincinnati. 02 November 2018 (02.11.2018) <https: / / etd.ohiolink.edu / pg_10?::NO:10:P10_ETD_SUBlD:175053#abstract-files>; pg.98,para 1,pg,103,pg.106,Table 5,pg.107,Figure 2-3,pg.119,para 1,pg.125,Figure 17,pg.126,Figure 18,pg.137,para 1 SUMMARY OF THE INVENTION

[0005] Some aspects of the present disclosure relate to methods of synthesizing capped cationic polymers. In some embodiments, the method comprises contacting a poly(ethylene glycol) diacrylate monomer and 3-amino-1-propanol to form a poly(ethylene glycol) diacrylate / 3-amino-1-propanol cationic polymer by Michael addition, wherein the molar ratio of the poly(ethylene glycol) diacrylate monomer to 3-amino-1-propanol is greater than 1 and the cationic polymer has acrylate termini; contacting the terminal acrylate groups of the cationic polymer with a capping molecule comprising an amine group to form a capped cationic polymer by Michael addition, wherein the capped cationic polymer does not contain any acrylate groups. In some embodiments, the poly(ethylene glycol) diacrylate monomer and 3-amino-1-propanol of step (a) are further contacted with di(trimethylolpropane) tetraacrylate, and the addition of di(trimethylolpropane) tetraacrylate results in the formation of a branched poly(ethylene glycol) diacrylate / di(trimethylolpropane) tetraacrylate / 3-amino-1-propanol cationic polymer comprising three or more terminal acrylate groups. In some embodiments, the capping molecule comprises one or more of 1,4-bis(3-aminopropyl)piperazine, spermine, polyethyleneimine, or 2,2-dimethyl-1,3-propanediamine, or any combination thereof.In some embodiments, the molar ratio of poly(ethylene glycol) diacrylate monomer to 3-amino-1-propanol is 1.01:1, 1.02:1, 1.03:1, 1.04:1, 1.05:1, 1.06:1, 1.07:1, 1.08:1, 1.09:1, 1.1:1, 1.11:1, 1.12:1, 1.13:1, 1.14:1, or 1.15:1, or about 1.01:1, about 1.02:1, about 1.03:1, about 1.04:1, about 1.05:1, about 1.06:1, about 1.07:1, about 1.08:1, about 1.09:1, about 1.1:1, about 1.11:1, about 1.12:1, about 1.13:1, about 1.14:1, or about 1.15:1, or any ratio within the range defined by any two of the foregoing ratios, such as 1.01:1 to 1.15:1, 1.01:1 to 1.1:1, 1.05:1 to 1.1:1, or 1.1:1 to 1.15:1.In some embodiments, the mass ratio of the cationic polymer to the capping molecule is 100:1, 100:2, 100:3, 100:4, 100:5, 100:6, 100:7, 100:8, 100:9, 100:10, 100:15, 100:20, 100:25, 100:30, 100:35, 100:40, 100:45, 100:50, 100:55, 100:60, 100:65, 100:70, 100:75, 100:80, 100:85, 100:90, 100:95, 100:100, 100:150, 100:200, 100:300, 100:400, or 100:500, or about 100:1, about 100:2, about 100:3, about 100:4, about 100:5, about 100:6, about 100:7, about 100:8, about 100:9, about 100:10, about 100:15, about 100:20, about 100:25, about 100:30, about 100:35, about 100:40, about 100:45, about 100:50, about 100:55, about 100:60, about 100:65, about 100:70, about 100:75, about 100:80, about 100:85, about 100:90, about 100:95, about 100:100, about 100:150, about 100:200, about 100:300, about 100:400, or about 100:500, or any ratio within the range defined by any two of the foregoing ratios, such as 100:1 to 100:500, 100:1 to 100:25, 100:10 to 100:100, or 100:100 to 100:500. In some embodiments, the capped cationic polymer is POLY1, POLY2, POLY3, POLY4, POLY5, POLY6, POLY7, or POLY8, or any combination thereof. In some embodiments, the cationic polymer and the capped cationic polymer are synthesized according to the ratios and components shown in Table 2.

[0006] Some aspects of the present disclosure relate to capped cationic polymers. In some embodiments, the capped cationic polymer is a capped cationic polymer synthesized by any one of the methods described herein. In some embodiments, the capped cationic polymer further comprises a fluorescent dye. In some embodiments, the fluorescent dye is DyLight 488, DyLight 550, or DyLight 650.

[0007] Some aspects of the present disclosure relate to labeling cells. In some embodiments, the method comprises contacting the cells with a cationic barcode, the cationic barcode comprising a cationic polymer and a nucleic acid barcode, the cationic polymer enabling the nucleic acid barcode to access the cytoplasm of the cells. In some embodiments, the nucleic acid is DNA or RNA. In some embodiments, the nucleic acid is single-stranded DNA (ssDNA). In some embodiments, the nucleic acid has a length of 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, or 5000 nucleotides in length, or a length within a range defined by any two of the foregoing lengths, e.g., 10-5000 nucleotides, 100-1000 nucleotides, 200-500 nucleotides, 10-500 nucleotides, or 400-5000 nucleotides in length. In some embodiments, the cationic polymer is any one of the cationic polymers described herein. In some embodiments, the cationic polymer is a cationic polymer synthesized by any one of the methods described herein. In some embodiments, the cells are part of a tissue, organoid, or spheroid, or any combination thereof. In some embodiments, the nucleic acid has the sequence of SEQ ID NOs: 2-4.

[0008] Some aspects of the present disclosure relate to methods of multiplex barcoding of cell populations. In some embodiments, the method comprises contacting a population of cells with one or more cationic barcodes, each of the cationic barcodes comprising a cationic polymer and a nucleic acid barcode of a unique sequence; and sequencing one or more of the cationic nucleic acid barcodes by single cell RNA-seq, thereby identifying individual cells as belonging to that population of cells by the sequence of the nucleic acid barcode of each individual cell. In some embodiments, the cationic polymer is any one of the cationic polymers described herein. In some embodiments, the cationic polymer is a cationic polymer synthesized by any one of the methods described herein. In some embodiments, the nucleic acid barcode is an ssDNA barcode, and sequencing of the nucleic acid barcode comprises amplifying the ssDNA barcode. In some embodiments, the nucleic acid barcode has the sequence of SEQ ID NOs: 2-4. In some embodiments, the population of cells is part of a tissue, organoid, or spheroid. In some embodiments, the population of cells is part of a liver organoid or a foregut spheroid. In some embodiments, the population of cells comprises two or more subpopulations of cells, each subpopulation of cells is derived from a unique individual, and the population of cells is formed by combining two or more subpopulations of cells. In some embodiments, contacting the population of cells comprises contacting each of two or more subpopulations of cells with a unique cationic barcode before the population of cells is formed by combining the two or more subpopulations of cells. In some embodiments, sequencing comprises sequencing the unique cationic barcode of each of two or more subpopulations of cells, thereby identifying individual cells as belonging to one of the two or more subpopulations of cells by the sequence of the nucleic acid barcode of each individual cell.

[0009] Embodiments of the present disclosure provided herein are illustrated by the following numbered alternatives. 1. A method for labeling cells, comprising the step of contacting the cells with a cationic polymer comprising nucleotides. 2. The method according to alternative 1, further comprising labeling the cells, tissue, or organoid aggregate with the polymer comprising nucleotides. 3. The method according to alternative 1 or 2, wherein the cationic polymer comprising nucleotides is terminated with a primary, secondary, tertiary amine, or quaternary ammonium cation. 4. The method according to any one of the preceding alternatives, wherein the nucleotide is single-stranded or double-stranded. 5. The method according to any one of the preceding alternatives, wherein the nucleotide is single-stranded and the polymer comprising nucleotides is used in DNA barcoding or FISH experiments. 6. The method according to any one of the preceding alternatives, wherein the nucleotide has a length of about 50 to about 50,000 base pairs. 7. The method according to any one of the preceding alternatives, wherein the nucleotide is single-stranded. 8. The method according to any one of the preceding alternatives, wherein the nucleotide is single-stranded. 9. The method according to any one of the preceding alternatives, wherein the cationic polymer is incorporated into cell components. 10. The method according to any one of the preceding alternatives, wherein the cationic polymer is incorporated into intracellular components. 11. The method according to any one of the preceding alternatives, comprising evaluating nucleotide binding by electrophoresis. 12. The method according to any one of the preceding alternatives, wherein the nucleotide functions as a barcode and quantifies the spatiotemporal distribution of the barcode in organoids, cells, or spheroids by flow cytometry, confocal microscopy, and combinations thereof. 13. The method according to any one of the preceding alternatives, wherein the nucleotide functions as a barcode and comprises amplifying the barcode, and the barcode comprises a tag. 14. The method according to any one of the preceding alternatives, wherein the nucleotide functions as a barcode for identifying one or more cell types. 15. The method according to any one of the preceding alternatives, wherein the nucleotide functions as a barcode and the barcode is used to identify the donor of the cell. 16. The method according to any one of the preceding alternatives, wherein the nucleotide functions as a barcode and the barcode is used to quantify one or more characteristics of the cell. 17. The method according to any one of the preceding alternatives, wherein the method does not include the use of an antibody. 18. A composition for labeling cells, comprising a cationic polymer synthesized from an acrylate monomer containing at least two acrylate functional groups and a small terminal amine-containing molecule. 19. The composition according to alternative 18, wherein the cationic polymer is a branched polymer. 20. The composition according to alternative 18 or 19, wherein the composition comprises a biological buffer, preferably a biological buffer of 10 mM to 25 mM, preferably having a pH of about 7.4. 21. The composition according to alternative 20, wherein the biological buffer is HEPES. 22. The method according to any one of alternatives 1 to 17, wherein the method is carried out at a pH of about 7 to about 8. 23. A method for preparing a polymer-nucleotide barcode, comprising: diluting a nucleotide ("DNA barcode") in a buffer to a concentration of about 1 μg to about 25 μL to form a nucleotide solution; providing a polymer according to any one of the preceding alternatives in an equal amount of buffer as that used in the dilution step to form a polymer solution; mixing the nucleotide solution with the polymer solution. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] In addition to the above features, additional features and variations will become readily apparent from the following drawings and the description of the exemplary embodiments. It should be understood that these drawings depict embodiments and are not intended to limit the scope.

Figure 1A

Figure 1B

Figure 1C

Figure 1D

Figure 1E

Figure 1F

Figure 2A

Figure 2B

Figure 2C

Figure 2D

Figure 2E

Figure 2F

Figure 3A

Figure 3B

Figure 3C

Figure 3D

Figure 3E

Figure 4A

Figure 4B

Figure 4C

DETAILED DESCRIPTION OF THE INVENTION

[0011] Disclosed herein are embodiments of a polymer-based molecular barcoding system (referred to as “POLY-seq”) synthesized with a low-cost, commercially available reagent that can bind to standard hashing oligonucleotides (“oligos”) in 10 minutes. The POLY-seq system successfully labels cells within a cell population. In some embodiments, the cell population is a foregut spheroid population, a hindgut spheroid population, or a human liver organoid population. This system achieves functional barcoding within 1 hour using standard hashing oligos and, in some embodiments, enables correct identification of barcodes in 90% of cells derived from human liver organoids prepared on a 10× Genomics single cell RNA-seq platform, providing an opportunity for multiplexing of heterogeneous samples pooled in a rapid and cost-effective manner.

[0012] Next-generation sequencing (NGS) provides a powerful tool for a detailed investigation of transcriptomes and genomic profiles without parallel. Single-cell technology provides the ability to analyze heterogeneous samples with high resolution. However, there is a caveat that there is only one experimental condition for each library preparation, and multiple library preparations are required, resulting in high costs for running multiple samples. For example, single-cell RNA sequencing (scRNA-seq) uses a dual barcode scheme such that all RNA strands captured for a single cell receive their own cell-specific barcode, and all RNA strands captured for sequencing receive their own strand-specific barcode. Larger sequencers have the ability to run multiple single-cell experiments in parallel at an appropriate sequencing depth, so in scRNA-seq preparation, a third experimental-specific index barcode is generally attached to pool and run multiple experiments in parallel. This multiplexing improves throughput and reduces the cost per read. However, since indexing is performed in the final step of library preparation, samples need to be prepared individually and receive individual indexes, which can be costly if individual samples can be pooled together at an appropriate read depth. This sample pooling prior to single-cell processing requires a methodology that can tag samples with heterogeneous barcodes readable by the NGS platform.

[0013] One common approach to cell labeling uses barcode-conjugated antibodies. This method takes advantage of the specific labeling provided by the antibody to not only distinguish targets but also enable quantification of expression. Through the inherent barcoding heterogeneity derived from the specific labeling of multiple samples, this further enables sample multiplexing and superloading. Complementary techniques employ fatty acid modifications due to their non-selective incorporation into the cell membrane. This method aims to increase the ubiquity of targeting at the expense of the specificity juxtaposed with antibody labeling. Antibody-based barcoding methods enable quantification of cell surface protein expression or tagging of specific subpopulations, and lipid methods enable more universal barcode incorporation, but their preparation can be costly or time-consuming in the creation of custom libraries. Since the barcode is directly and covalently conjugated to the labeling mediator, flexibility is reduced, especially when custom sample barcodes serve for labeling heterogeneous populations for multiplexing applications. Other techniques rely on genetic diversity to drive demultiplexing through bioinformatics processing or expression of barcode sequences from the creation and generation of viral libraries. The viral method is convenient for long-term lineage tracking, but the generation and application of viral libraries with high transduction efficiency for sufficient barcode representation in multiplexing applications may limit short-term labeling. Thus, there is an opportunity to develop a fast, efficient, ubiquitously sample-specific barcoding tool that can create custom barcode pools with minimal preparation, greatly improve throughput, and reduce sequencing costs by multiplexing with the current common sample preparation strategy of one sample per experiment.

[0014] Polymer-based transfection technologies have been previously investigated for their ability to deliver a series of functional DNA and / or RNA encoding selected sequences, or for the modification of protein expression. Polymer vectors that employ charge-based methodologies operating on the general principle of ionic interactions bind to DNA / RNA through interaction with the anionic charges present in the nucleic acid backbone, depending on the cationic charge of the polymer, and interact with the cell surface. In previous applications focused on in vivo delivery and tracking of information distribution, it is based on this principle that enables the direct translation of polymers from transfection mediators to barcoding vectors. However, the optimization of the formulation for efficient single-cell multiplexing applications has not yet been fully investigated. Two distinct features of barcode systems applicable to sample multiplexing are universal binding, which is independent of sample heterogeneity, and importantly, binding fidelity. When utilizing sample multiplexing, regardless of how clearly the transcriptome or genome is sequenced, a particular cell needs to have a defined sample-specific barcode that can be identified in downstream bioinformatics processing. In heterogeneous samples, universal labeling helps provide a non-biased way to pool samples. Due to binding fidelity, when a cell is tagged with a sample-specific barcode, the barcoding vector remains bound to the original cell during multiplexing and does not move to other cells that would otherwise reduce the reliability of the sequenced cells being assigned to a particular sample. These two parameters were used as quantification metrics during the development of the POLY-seq vectors described herein.

[0015] In the following detailed description, reference is made to the accompanying drawings, which form a part hereof. In the drawings, unless the context otherwise requires, like reference numerals generally identify like components. The illustrative embodiments described in the detailed description, the drawings, and the claims are not meant to be limiting. Other embodiments may be utilized, and other changes may be made, without departing from the spirit or scope of the subject matter presented herein. The aspects of the disclosure generally described herein and illustrated in the figures can be arranged, substituted, combined, separated, and designed in a variety of different configurations, all of which are readily understood to be explicitly contemplated herein.

[0016] Unless otherwise defined, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. For the purposes of this disclosure, the following terms are described below.

[0017] The disclosure herein uses affirmative language to describe many embodiments. The disclosure also includes embodiments in which the subject matter, such as substances or materials, process steps and conditions of methods, protocols, or procedures, etc., are wholly or partially excluded.

[0018] The articles “a” and “an” are used herein to refer to one or more than one (e.g., at least one) of the grammatical objects of the article. By way of example, “an element” means one element or more than one element.

[0019] “About” means an amount, level, value, number, frequency, percentage, dimension, size, amount, weight, or length that varies by up to 10% from the amount, level, value, number, frequency, percentage, dimension, size, amount, weight, or length being referenced.

[0020] Throughout this specification, unless the context requires otherwise, the words "comprise", "comprises" and "comprising" are to be construed as indicating the inclusion of the stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements. "Consisting of" means including all of the terms that follow the phrase "consisting of". Thus, the phrase "consisting of" indicates that the listed elements are required or mandatory and that no other elements can be present. "Consisting essentially of" means including any elements listed before this phrase, with other elements limited to those that do not interfere with or contribute to the activity or action disclosed in relation to the listed elements. Thus, the phrase "consisting essentially of" indicates that the listed elements are required or mandatory, but other elements are optional and may or may not be present depending on whether they substantially affect the activity or action of the listed elements.

[0021] As used herein, the terms "individual", "subject", or "patient" have their ordinary and customary meaning as understood in the context of this specification and mean a human or non-human mammal, such as a dog, cat, mouse, rat, cow, sheep, pig, goat, non-human primate, or bird, such as a chicken, as well as other vertebrate or invertebrate animals. The term "mammal" is used in its ordinary biological sense. Thus, this specifically includes, but is not limited to, primates, including monkeys (chimpanzees, apes, monkeys) and humans, cows, horses, sheep, goats, pigs, rabbits, dogs, cats, rodents, rats, mice, guinea pigs, etc.

[0022] As used herein, the terms "effective amount" or "effective dosage" have their ordinary and customary meanings as understood in light of the specification, and refer to that amount of the described composition or compound that produces an observable effect. The actual dosage level of the active ingredient in the active composition of the presently disclosed subject matter can be varied so as to administer an amount of the active composition or compound that is effective to achieve the desired response for a particular subject and / or use. The dosage level selected will depend upon a variety of factors including, but not limited to, the activity of the composition, formulation, route of administration, combination with other drugs or treatments, the severity of the condition being treated, and the physical condition and history of the subject being treated. In some embodiments, a minimum dosage is administered, and if there is no dose-limiting toxicity, the dosage is increased to the minimum effective amount. The determination and adjustment of effective dosages, and the evaluation of how and when such adjustments are to be made, are contemplated herein.

[0023] As used herein, the terms "function" and "functional" have their plain and ordinary meanings as understood in light of the specification, and refer to biological, enzymatic, or therapeutic functions.

[0024] As used herein, the term "inhibit" has its general and ordinary meaning as understood in light of this specification and can refer to a decrease or prevention of biological activity. The decrease can be by about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%, about those, at least those, at least about those, less than those, or about less than those percentages, or by an amount within a range defined by any two of the foregoing values. As used herein, the term "delay" has its general and ordinary meaning as understood in light of this specification and refers to a delay, deferral, or postponement of a biological event to a time later than would otherwise be expected. The delay can be by about 0%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, about those, at least those, at least about those, less than those, or about less than those percentages, or by an amount of delay within a range defined by any two of the foregoing values. The terms inhibit and delay do not necessarily indicate 100% inhibition or delay. Partial inhibition or delay can be achieved.

[0025] As used herein, the term "isolated" has its ordinary and customary meaning as understood in light of the specification, and refers to a substance and / or entity that is (1) separated from at least some of the components with which it was associated when first produced (in nature and / or in an experimental environment), and / or (2) separated from at least some of the components with which it was associated when produced, prepared, and / or manufactured by human hand. An isolated substance and / or entity can be separated from about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, substantially 100%, or 100% of the other components with which it was first associated, or about those amounts, or at least those amounts, or less than those amounts, or about less than those amounts (or can be separated within a range including and / or spanning the foregoing values). In some embodiments, an isolated agent is about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, substantially 100%, or 100% pure, or at least as pure as those amounts, or less pure than those amounts, or about less pure than those amounts (or is pure within a range including and / or spanning the foregoing values). As used herein, an "isolated" substance can be "pure" (e.g., substantially free of other components). As used herein, the term "isolated cell" may refer to a cell that is not included in a multicellular organism or tissue.

[0026] As used herein, "in vivo" is given its ordinary and customary meaning as understood in light of the specification, and refers to the performance of a method within a living organism, typically an animal, a mammal including a human, and a plant, as contrasted with a tissue extract or a dead organism.

[0027] As used herein, "ex vivo" is given its ordinary and customary meaning as understood in light of the specification, and refers to the performance of a method outside of a living body with little change in natural conditions.

[0028] As used herein, "in vitro" is given its ordinary and customary meaning as understood in light of the specification and refers to the performance of methods outside of biological conditions, such as in a Petri dish or test tube.

[0029] As used herein, the terms "nucleic acid" or "nucleic acid molecule" have their general and ordinary meanings as understood in the context of this specification, and refer to polynucleotides such as deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), oligonucleotides, those that occur naturally intracellularly, fragments generated by polymerase chain reaction (PCR), and fragments generated by ligation, cleavage, endonuclease action, and exonuclease action. Nucleic acid molecules can be composed of monomers that are naturally occurring nucleotides (such as DNA and RNA), or analogs of naturally occurring nucleotides (e.g., enantiomeric forms of naturally occurring nucleotides), or a combination of both. Modified nucleotides can have changes in the sugar moiety and / or the pyrimidine or purine base moiety. Sugar modifications include, for example, substitution of one or more hydroxyl groups with halogen, alkyl, amine, and azide groups, or the sugar can be functionalized as an ether or ester. Further, the entire sugar moiety can be replaced with sterically and electronically similar structures such as azasugars and carbocyclic sugar analogs. Examples of base moiety modifications include alkylated purines and pyrimidines, acylated purines or pyrimidines, or other well-known heterocyclic substituents. Nucleic acid monomers can be joined by phosphodiester bonds or analogs of such bonds. Analogs of phosphodiester bonds include phosphorothioate, phosphorodithioate, phosphorosenoate, phosphorodiselenoate, phosphoranilothioate, phosphoranilidate, or phosphoramidate. The term "nucleic acid molecule" also includes so-called "peptide nucleic acids", which contain naturally occurring or modified nucleobases attached to a polyamide backbone. Nucleic acids can be either single-stranded or double-stranded. "Oligonucleotide" can be used interchangeably with nucleic acid and can refer to either double-stranded or single-stranded DNA or RNA.The nucleic acid(s) can be included in a nucleic acid vector or nucleic acid construct (e.g., plasmid, virus, retrovirus, lentivirus, bacteriophage, cosmid, fosmid, phagemid, bacterial artificial chromosome (BAC), yeast artificial chromosome (YAC), or human artificial chromosome (HAC)) for use in the amplification and / or expression of nucleic acid(s) in various biological systems. Typically, the vector or construct will also contain elements such as a promoter, enhancer, terminator, inducer, ribosome binding site, translation initiation site, start codon, stop codon, polyadenylation signal, origin of replication, cloning site, multiple cloning site, restriction enzyme site, epitope, reporter gene, selectable marker, antibiotic selectable marker, targeting sequence, peptide purification tag, or accessory gene, or any combination thereof, but not limited to these.

[0030] A nucleic acid or nucleic acid molecule can comprise one or more sequences encoding different peptides, polypeptides, or proteins. These one or more sequences can be adjacent within the same nucleic acid or nucleic acid molecule, or can be joined to any other sequence, for example, by a linker, a repeat, or extra nucleic acid between restriction enzyme sites, or by a nucleic acid of any length, or of about that length, or at least that length, or at least about that length, or less than that length, or less than about that length, defined by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, or 300 bases, or any length within the range defined by any two of the foregoing lengths. As used herein, the term "downstream" with respect to a nucleic acid has its ordinary and customary meaning as understood in light of the specification, and when the nucleic acid is double-stranded, refers to a sequence that is after the 3' end of a previous sequence on the strand containing the coding sequence (sense strand). As used herein, the term "upstream" with respect to a nucleic acid has its ordinary and customary meaning as understood in light of the specification, and when the nucleic acid is double-stranded, refers to a sequence that is before the 5' end of a subsequent sequence on the strand containing the coding sequence (sense strand). As used herein, the term "grouping" with respect to a nucleic acid has its ordinary and customary meaning as understood in light of the specification, and refers to two or more sequences that occur in proximity to each other, either directly or, for example, by a linker, a repeat, or extra nucleic acid between restriction enzyme sites, or by a nucleic acid of any length, or of about that length, or at least that length, or at least about that length, or less than that length, or less than about that length, defined by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, or 300 bases, or any length within the range defined by any two of the foregoing lengths, but generally do not occur between sequences encoding functional or catalytic polypeptides, proteins, or protein domains.

[0031] The nucleic acids described in this specification contain nucleobases. Primary, standard, natural, or unmodified bases are adenine, cytosine, guanine, thymine, and uracil. Other nucleobases include, but are not limited to, purine, pyrimidine, modified nucleobases, 5-methylcytosine, pseudouridine, dihydrouridine, inosine, 7-methylguanosine, hypoxanthine, xanthine, 5,6-dihydrouracil, 5-hydroxymethylcytosine, 5-bromouracil, isoguanine, isocytosine, aminoallyl bases, dye-labeled bases, fluorescent bases, or biotin-labeled bases.

[0032] As used herein, the terms "peptide", "polypeptide", and "protein" have their ordinary and customary meanings as understood in the context of this specification, and refer to macromolecules composed of amino acids linked by peptide bonds. Many functions of peptides, polypeptides, and proteins are known in the art, including, but not limited to, enzymes, structures, transport, defense, hormones, or signaling. Peptides, polypeptides, and proteins are often, but not always, biologically produced by ribosomal complexes using nucleic acid templates, although chemical synthesis can also be utilized. By manipulating nucleic acid templates, peptide, polypeptide, and protein mutations such as substitution, deletion, truncation, addition, duplication, or fusion of two or more peptides, polypeptides, and proteins can be performed. The fusion of these two or more peptides, polypeptides, or proteins can be adjacent within the same molecule, or can be joined to any other sequence that is, or is about, or at least, or at least about, or less than, or about less than, any length defined by the range between, or any two of, the lengths of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, or 300 bases, or any length between any two of the aforementioned lengths. As used herein, the term "downstream" with respect to a polypeptide has its ordinary and customary meaning as understood in the context of this specification, and refers to a sequence that is after the C-terminus of a previous sequence. As used herein, the term "upstream" with respect to a polypeptide has its ordinary and customary meaning as understood in the context of this specification, and refers to a sequence that is before the N-terminus of a subsequent sequence.

[0033] As used herein, the term "purity" of any given substance, compound, or material has its ordinary and customary meaning as understood in light of the specification, and refers to the actual abundance of the substance, compound, or material relative to the expected abundance. For example, a substance, compound, or material is at least 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% pure, including all decimals in between. Purity may be affected by unwanted impurities including, but not limited to, nucleic acids, DNA, RNA, nucleotides, proteins, polypeptides, peptides, amino acids, lipids, cell membranes, cell debris, small molecules, degradation products, solvents, carriers, vehicles, or contaminants, or any combination thereof. In some embodiments, the substance, compound, or material is substantially free of host cell proteins, host cell nucleic acids, plasmid DNA, contaminating viruses, proteasomes, host cell culture components, process-related components, mycoplasma, pyrogens, bacterial endotoxins, and exogenous infectious agents. Purity can be measured using techniques including, but not limited to, electrophoresis, SDS-PAGE, capillary electrophoresis, PCR, rtPCR, qPCR, chromatography, liquid chromatography, gas chromatography, thin layer chromatography, enzyme-linked immunosorbent assay (ELISA), spectroscopy, UV-visible spectroscopy, infrared spectroscopy, mass spectrometry, nuclear magnetic resonance, gravimetry, or titration, or any combination thereof.

[0034] As used herein, the term "yield" of any given substance, compound, or material has its ordinary and customary meaning as understood in light of the specification, and refers to the actual total amount of the substance, compound, or material relative to the expected abundance. For example, the yield of a substance, compound, or material is 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the expected total amount, about those amounts, at least those amounts, at least about those amounts, less than those amounts, or about less than those amounts, including all decimals therebetween. Yield can be affected by the efficiency of the reaction or process, unwanted side reactions, decomposition, the quality of the starting materials, compounds, or materials, or loss of the desired substance, compound, or material at any stage of manufacture.

[0035] As used herein, the term "w / w%" or "weight / weight %" has its ordinary and customary meaning as understood in light of the specification, and refers to the ratio expressed with respect to the weight of a component or agent relative to the total weight of the composition multiplied by 100. As used herein, the term "v / v%" or "volume / volume %" has its ordinary and customary meaning as understood in light of the specification, and refers to the ratio expressed with respect to the liquid volume of a compound, substance, component, or agent relative to the total liquid volume of the composition multiplied by 100.

[0036] Cationic polymers and methods for their production As used herein, the term "cationic polymer" has its general and ordinary meaning as understood in the context of this specification and refers to a high molecular weight polymer compound that exhibits a positive (cationic) charge on its surface. In some embodiments, the positive charge is due to amine groups on the cationic polymer. The cationic polymer can be a linear polymer, a branched polymer, a randomly branched polymer, a dendrimer, a block polymer, or a graft polymer. In some embodiments, these different polymer structures can vary the properties of the cationic polymer. For the purpose of delivery to cells, the cationic polymer can bind to the negatively charged phosphate backbone of nucleic acids (e.g., DNA or RNA) to form a polymer / nucleic acid complex. The cationic polymer can also change the three-dimensional structure of the nucleic acid, for example, by compressing the nucleic acid or making it less accessible to nucleases. Cationic polymers are also selected according to qualities such as the number or density of cationic charges or regions, safety, toxicity, biodegradability, ease of use, ease of synthesis, efficiency of nucleic acid complex formation, efficiency of nucleic acid delivery, tendency to aggregate, ability for additional modification by functional groups, or cost, or any combination thereof. Although not fully understood, cationic polymers deliver complex nucleic acids to cells by interacting with the plasma membrane of the cell through charge interactions, internalization into the cell by endocytosis, and release of the nucleic acid into the cytoplasm. In the case of a nucleic acid payload intended for gene expression, these nucleic acids can either be directly translated by ribosomes (as in the case of RNA) or translocated to the nucleus and transcribed as episomes (as DNA). In the case of barcoding applications, the nucleic acid payload can be analyzed at any step of this process, such as by sequencing. Examples of cationic polymers known in the art include, but are not limited to, polyethyleneimine (PEI), poly-L-lysine (PLL), chitosan, DEAE-dextran, or polyamidoamine (PAMAM). Some cationic polymers can be combined with lipid-based transfection reagents to enhance delivery to cells.Examples of commercially available transfection reagents that may or may not contain a cationic polymer include, but are not limited to, Lipofectamine, TransIT, or Fugene.

[0037] Described herein is a method for synthesizing a cationic polymer. In some embodiments, the method includes using a diacrylate monomer and an alkanolamine. In some embodiments, the acrylate functional group of the diacrylate monomer and the amine functional group of the alkanolamine react according to a Michael addition reaction to form an acrylate - amino adduct. In some embodiments, the Michael addition is an aza - Michael addition. In some embodiments, the method includes reacting a plurality of diacrylate monomers with a plurality of alkanolamines to yield a diacrylate / alkanolamine polymer. In some embodiments, the diacrylate monomer is a poly(ethylene glycol) diacrylate (“D8”) monomer or a di(trimethylolpropane) tetraacrylate (“V5”) monomer, or both. In some embodiments, the diacrylate monomer is a linear diacrylate monomer. In some embodiments, the diacrylate monomer has the following structure.

Chemical formula

[0038] In some embodiments, the diacrylate monomer is a branched diacrylate monomer. In some embodiments, the diacrylate monomer has the following structure.

Chemical formula

[0039] In some embodiments, the poly(ethylene glycol) diacrylate is poly(ethylene glycol) diacrylate M nIt is = 250. In some embodiments, the alkanolamine is 3 - amino - 1 - propanol ("S3"). In some embodiments, the alkanolamine has the following structure

Chemical formula

[0040] In some embodiments, the method includes reacting a D8 monomer with an S3 monomer to yield a D8 / S3 polymer. In some embodiments, the method includes reacting D8 with S3 to yield a D8 / S3 polymer. In some embodiments, D8 and S3 are reacted by Michael addition. In some embodiments, the D8 / S3 polymer is produced by Michael addition by contacting D8 and S3. In some embodiments, the D8 / S3 polymer is a linear polymer. In some embodiments, the D8 / S3 polymer includes one or two acrylate groups. In some embodiments, the D8 / S3 polymer is a cationic polymer. In some embodiments, the amount of D8 is greater than the amount of S3. In some embodiments, D8 is more abundant than S3. In some embodiments, D8 is in excess. In some embodiments, the molar ratio of D8 to S3 is greater than 1. In some embodiments, the molar ratio of D8 to S3 is 1.01:1, 1.02:1, 1.03:1, 1.04:1, 1.05:1, 1.06:1, 1.07:1, 1.08:1, 1.09:1, 1.1:1, 1.11:1, 1.12:1, 1.13:1, 1.14:1, or 1.15:1, or any ratio within the range defined by any two of the foregoing ratios, e.g., 1.01:1 to 1.15:1, 1.01:1 to 1.1:1, 1.05:1 to 1.1:1, or 1.1:1 to 1.15:1, or about those, at least those, at least about those, less than those, or about less than those. In some embodiments, the molar ratio of D8 to S3 is 1.05:1, or about 1.05:1, or at least 1.05:1, or at least about 1.05:1, or less than or equal to 1.05:1, or about less than or equal to 1.05:1. In some embodiments, the molar ratio of D8 to S3 is 1.1:1, or about 1.1:1, or at least 1.1:1, or at least about 1.1:1, or less than or equal to 1.1:1, or about less than or equal to 1.1:1. In some embodiments, the method includes reacting a mixture of a D8 monomer and a V5 monomer with an S3 monomer to yield a D8 / V5 / S3 polymer.In some embodiments, the method includes contacting D8, V5, and S3 to yield a D8 / V5 / S3 polymer. In some embodiments, the D8 / V5 / S3 polymer is a cationic polymer. In some embodiments, the D8 / V5 / S3 polymer is a branched polymer. In some embodiments, the D8 / V5 / S3 polymer includes three or more terminal acrylate groups. In some embodiments, the amounts of D8 and V5 are greater than the amount of S3. In some embodiments, D8 and V5 are more abundant than S3. In some embodiments, D8 and V5 are in excess. In some embodiments, the molar ratio of D8 to S3 is greater than 1. In some embodiments, the molar ratio of D8 to S3 is 1.01:1, 1.02:1, 1.03:1, 1.04:1, 1.05:1, 1.06:1, 1.07:1, 1.08:1, 1.09:1, 1.1:1, 1.11:1, 1.12:1, 1.13:1, 1.14:1, or 1.15:1, or any ratio within the range defined by any two of the foregoing ratios, e.g., 1.01:1 to 1.15:1, 1.01:1 to 1.1:1, 1.05:1 to 1.1:1, or 1.1:1 to 1.15:1, or about those, at least those, at least about those, less than those, or about less than those. In some embodiments, the molar ratio of D8 to S3 is 1.05:1, or about 1.05:1, or at least 1.05:1, or at least about 1.05:1, or less than or equal to 1.05:1, or about less than or equal to 1.05:1. In some embodiments, the molar ratio of D8 to S3 is 1.1:1, or about 1.1:1, or at least 1.1:1, or at least about 1.1:1, or less than or equal to 1.1:1, or about less than or equal to 1.1:1. In some embodiments, the molar ratio of V5 to S3 is less than 1.In some embodiments, the molar ratio of V5 to S3 is 0.1:1, 0.2:1, 0.3:1, 0.4:1, 0.5:1, 0.6:1, 0.7:1, 0.8:1, 0.9:1, or 1:1, or any ratio within the range defined by any two of the foregoing ratios, for example, 0.1:1 to 1:1, 0.5:1 to 0.8:1, 0.1:1 to 0.5:1, or 0.5:1 to 1:1, or about those, at least those, at least about those, less than those, or about less than those. In some embodiments, the molar ratio of D8 to V5 is greater than 1. In some embodiments, the molar ratio of D8 to V5 is 1.1:1, 1.2:1, 1.3:1, 1.4:1, 1.5:1, 1.6:1, 1.7:1, 1.8:1, 1.9:1, or 2.0:1, or any ratio within the range defined by any two of the foregoing ratios, for example, 1.1:1 to 2.0:1, 1.3:1 to 1.8:1, 1.1:1 to 1.5:1, or 1.5:1 to 2.0:1, or about those, at least those, at least about those, less than those, or about less than those. In some embodiments, the molar ratios of D8, V5, and S3 are provided in Table 2.

[0041] In some embodiments, the cationic polymer synthesized by any one of the methods described herein has acrylate termini, and the cationic polymer contains one or more acrylate functional groups. In some embodiments, the one or more acrylate functional groups are further reacted. In some embodiments, the cationic polymer reacts with one or more capping molecules to form a capped cationic polymer. In some embodiments, the cationic polymer is contacted with one or more capping molecules to form a capped cationic polymer. In some embodiments, the one or more capping molecules contain an amine group. In some embodiments, the amine group of the one or more capping molecules reacts with the one or more acrylate functional groups by Michael addition. In some embodiments, the Michael addition is an aza-Michael addition. In some embodiments, one or more (e.g., at least 1, 2, 3, 4) of 1,4-bis(3-aminopropyl)piperazine (“C1”), spermine (“C2”), polyethyleneimine (“C3”), or 2,2-dimethyl-1,3-propanediamine (“C4”), or any combination thereof. In some embodiments, the capping molecule has the following structure

Chemical formula

[0042] In some embodiments, the cationic polymer and the capping molecule are contacted at a specific mass ratio. In some embodiments, the cationic polymer and the capping molecule are contacted at a mass ratio greater than 1. In some embodiments, the cationic polymer and the capping molecule are contacted at a mass ratio less than 1. In some embodiments, the cationic polymer and the capping molecule are contacted at a mass ratio of 100:1, 100:2, 100:3, 100:4, 100:5, 100:6, 100:7, 100:8, 100:9, 100:10, 100:15, 100:20, 100:25, 100:30, 100:35, 100:40, 100:45, 100:50, 100:55, 100:60, 100:65, 100:70, 100:75, 100:80, 100:85, 100:90, 100:95, 100:100, 100:150, 100:200, 100:300, 100:400, or 100:500, or any ratio within the range defined by any two of the foregoing ratios, for example, 100:1 to 100:500, 100:1 to 100:25, 100:1 to 100:100, 100:10 to 100:100, or 100:100 to 100:500, or about those, at least those, at least about those, less than or equal to those, or about less than or equal to those. In some embodiments, the cationic polymer and the capping molecule are contacted at a mass ratio provided in Table 2. In some embodiments, the capped cationic polymer does not contain any acrylate groups. In some embodiments, the capped cationic polymer is one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8) of vectors POLY1, POLY2, POLY3, POLY4, POLY5, POLY6, POLY7, or POLY8, or any combination thereof. In some embodiments, the capped cationic polymer is vector POLY1. In some embodiments, the capped cationic polymer is vector POLY2. In some embodiments, the capped cationic polymer is vector POLY3.In some embodiments, the capped cationic polymer is vector POLY4. In some embodiments, the capped cationic polymer is vector POLY5. In some embodiments, the capped cationic polymer is vector POLY6. In some embodiments, the capped cationic polymer is vector POLY7. In some embodiments, the capped cationic polymer is vector POLY8. In some embodiments, the capped cationic polymer is any one of the capped cationic polymers provided in Table 2. In some embodiments, the capped cationic polymer is a capped cationic polymer synthesized according to the molar ratio or mass ratio provided in Table 2.

[0043] In some embodiments, the cationic polymer is synthesized by mixing a diacrylate monomer disclosed herein with an amino alcohol (alkanoloamine) disclosed herein to form an uncapped acrylate - terminated cationic polymer. In some embodiments, the diacrylate monomer and the amino alcohol are reacted at a temperature of 10 °C, 20 °C, 30 °C, 40 °C, 50 °C, 60 °C, 70 °C, 80 °C, 85 °C, 86 °C, 87 °C, 88 °C, 89 °C, 90 °C, 91 °C, 92 °C, 93 °C, 94 °C, 95 °C, 96 °C, 97 °C, 98 °C, 99 °C, or 100 °C, or any temperature within a range defined by any two of the foregoing temperatures, e.g., 10 °C to 100 °C, 60 °C to 95 °C, 85 °C to 99 °C, 10 °C to 90 °C, or 85 °C to 100 °C, or about those, at least those, at least about those, less than those, or about less than those. In some embodiments, the diacrylate monomer and the amino alcohol are reacted at a temperature of 90 °C, or about 90 °C, or at least 90 °C, or at least about 90 °C, or less than 90 °C, or about less than 90 °C. In some embodiments, the diacrylate monomer and the amino alcohol are reacted for a time of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, or 48 hours, or any number of hours within a range defined by any two of the foregoing number of hours, e.g., 1 to 48 hours, 10 to 30 hours, 20 to 25 hours, 1 to 24 hours, or 24 to 48 hours, or about those, at least those, at least about those, less than those, or about less than those. In some embodiments, the diacrylate monomer and the amino alcohol are reacted for a time of 24 hours, or about 24 hours, or at least 24 hours, or at least about 24 hours, or less than 24 hours, or about less than 24 hours.

[0044] In some embodiments, an uncapped acrylate - terminated cationic polymer is capped by the addition of a capping molecule to form a capped cationic polymer, where the capping molecule is a molecule containing a primary or secondary amine. In some embodiments, the uncapped acrylate - terminated cationic polymer is reacted with the capping molecule at a temperature of 10°C, 20°C, 30°C, 40°C, 50°C, 60°C, 70°C, 80°C, 85°C, 86°C, 87°C, 88°C, 89°C, 90°C, 91°C, 92°C, 93°C, 94°C, 95°C, 96°C, 97°C, 98°C, 99°C, or 100°C, or any temperature within a range defined by any two of the aforementioned temperatures, for example, 10°C to 100°C, 60°C to 95°C, 85°C to 99°C, 10°C to 90°C, or 85°C to 100°C, or at a temperature that is about those, at least those, at least about those, less than those, or about less than those. In some embodiments, the uncapped acrylate - terminated cationic polymer is reacted with the capping molecule at a temperature of 50°C, or about 50°C, or at least 50°C, or at least about 50°C, or less than 50°C, or about less than 50°C. In some embodiments, the uncapped acrylate - terminated cationic polymer is reacted with the capping molecule for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, or 48 hours, or any number of hours within a range defined by any two of the aforementioned number of hours, for example, 1 to 48 hours, 10 to 30 hours, 20 to 25 hours, 1 to 24 hours, or 24 to 48 hours, or at a temperature that is about those, at least those, at least about those, less than those, or about less than those.In some embodiments, an uncapped acrylate-terminated cationic polymer is reacted with a capping molecule at a temperature that is 24 hours, or about 24 hours, or at least 24 hours, or at least about 24 hours, or 24 hours or less, or about 24 hours or less. In some embodiments, the capped cationic polymer is stored at a temperature that is -20°C, or about -20°C, or at least -20°C, or at least about -20°C, or -20°C or less, or about -20°C or less.

[0045] In some embodiments, the cationic polymer or the capped cationic polymer is conjugated to a fluorescent tag. In some embodiments, the cationic polymer or the capped cationic polymer is conjugated to a fluorescent tag using an amine-reactive conjugate. In some embodiments, the cationic polymer or the capped cationic polymer is conjugated using an N-hydroxysuccinimide ester conjugate. In some embodiments, the fluorescent tag comprises an N-hydroxysuccinimide ester functional group. In some embodiments, the fluorescent tag is DyLight 488, DyLight 550, or DyLight 650.

[0046] Described herein is a cationic polymer, a capped cationic polymer, or both, or a composition thereof. In some embodiments, the cationic polymer is a cationic polymer produced by any one of the methods described herein. In some embodiments, the capped cationic polymer is a capped cationic polymer produced by any one of the methods described herein. In some embodiments, the capped cationic polymer is one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8) of vectors POLY1, POLY2, POLY3, POLY4, POLY5, POLY6, POLY7, or POLY8, or any combination thereof. In some embodiments, the capped cationic polymer is vector POLY1. In some embodiments, the capped cationic polymer is vector POLY2. In some embodiments, the capped cationic polymer is vector POLY3. In some embodiments, the capped cationic polymer is vector POLY4. In some embodiments, the capped cationic polymer is vector POLY5. In some embodiments, the capped cationic polymer is vector POLY6. In some embodiments, the capped cationic polymer is vector POLY7. In some embodiments, the capped cationic polymer is vector POLY8. In some embodiments, the capped cationic polymer is any one of the capped cationic polymers provided in Table 2. In some embodiments, the capped cationic polymer is a capped cationic polymer synthesized according to the molar ratio or mass ratio provided in Table 2. In some embodiments, the cationic polymer or the capped cationic polymer, or both, further comprises a fluorescent dye. In some embodiments, the fluorescent dye is DyLight 488, DyLight 550, or DyLight 650, or any combination thereof.

[0047] As used herein, the terms “barcode” and “barcoding” have their ordinary and customary meaning as understood in the context of this specification, and refer to the use of short nucleic acids having known sequences to label cells or cell components (e.g., genomic DNA, RNA, mRNA, miRNA, siRNA, proteins, peptides, polypeptides) and to identify cells or cell components by sequencing. In some embodiments, the nucleic acid is double-stranded DNA (dsDNA), single-stranded DNA (ssDNA), double-stranded RNA (dsRNA), or single-stranded RNA (ssRNA). The nucleic acid contains a unique barcode sequence, as well as one or more constant adapter sequences that are the same between different nucleic acid barcodes. Typically, the one or more constant adapter sequences are at both ends of the nucleic acid strand (i.e., the 5' and 3' ends) and are adjacent to the unique barcode sequence. Since these one or more constant adapter sequences are used as primer annealing regions, the same primer can be used for the entire set of different barcodes. Amplifying the barcode using a primer results in amplification of the unique barcode sequence, which is necessary to enable detection of the unique barcode sequence using current methods. The nucleic acid barcode can be modified or conjugated in some way, such as with an antibody, so that it can bind to different components of the cell. In the case of cell barcoding applications, one cell can be distinguished from another in a population or mixture of cells based on the amplified sequence of the unique barcode for each cell. As used herein, cationic polymers are used to deliver nucleic acid barcodes to cells within a cell population. While the cells have these barcodes, analysis of the cell population by single-cell sequencing techniques such as single-cell RNA sequencing (scRNA-seq) enables identification of individual cells and their transcriptome profiles, which are the components thereof. In some embodiments, the population of cells consists of two or more subpopulations of cells.By delivering different, unique barcodes to each of two or more subpopulations of cells and sequencing the barcodes, it becomes possible to identify cells as belonging to one of two or more subpopulations of cells even when the two or more subpopulations are mixed within a sample.

[0048] In some embodiments, the cationic polymer and the nucleic acid barcode are combined in solution to form a cationic barcode. In some embodiments, the cationic polymer and the nucleic acid barcode are combined at a weight ratio of cationic polymer:nucleic acid barcode of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80 w / w, or any w / w ratio within the range defined by any two of the aforementioned w / w ratios, such as a 1-80, 10-60, 20-50, 1-60, or 10-80 w / w ratio, or about those, at least those, at least about those, less than those, or less than about those w / w ratio. In some embodiments, the cationic polymer and the nucleic acid barcode are combined at a 2 w / w ratio. In some embodiments, the cationic polymer and the nucleic acid barcode are combined at a 5 w / w ratio. In some embodiments, the cationic polymer and the nucleic acid barcode are combined at a 10 w / w ratio. In some embodiments, the cationic polymer and the nucleic acid barcode are combined at a 20 w / w ratio. In some embodiments, the cationic polymer and the nucleic acid barcode are combined at a 40 w / w ratio. In some embodiments, the cationic polymer and the nucleic acid barcode are combined at a 60 w / w ratio. In some embodiments, the cationic polymer and the nucleic acid barcode are combined in an aqueous solution. In some embodiments, the cationic polymer and the nucleic acid barcode are combined in a growth medium. In some embodiments, the cationic polymer and the nucleic acid barcode are combined in mTeSR medium.

[0049] Described herein is a method of labeling or barcoding cells. In some embodiments, the method includes contacting the cells with a cationic barcode. In some embodiments, the cationic barcode includes a cationic polymer and a nucleic acid barcode. In some embodiments, the cationic polymer enables the nucleic acid barcode to access the cytoplasm of the cell. In some embodiments, the nucleic acid barcode is the nucleic acid barcode described herein and elsewhere. In some embodiments, the nucleic acid is DNA or RNA, or both. In some embodiments, the nucleic acid is ssDNA. In some embodiments, the nucleic acid is 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, or 5000 nucleotides in length, or any length within a range defined by any two of the foregoing lengths, e.g., 10-5000 nucleotides, 100-1000 nucleotides, 200-500 nucleotides, 10-500 nucleotides, or 400-5000 nucleotides in length, or about those lengths, at least those lengths, at least about those lengths, less than those lengths, or less than about those lengths. In some embodiments, the nucleic acid has the sequence of SEQ ID NOs: 2-4. In some embodiments, the cationic polymer is a cationic polymer produced by any one of the methods described herein. In some embodiments, the cationic polymer is a capped cationic polymer produced by any one of the methods described herein. In some embodiments, the cells are within a population of cells. In some embodiments, the cells are part of a tissue, organoid, or spheroid, or any combination thereof. In some embodiments, the cells are part of a liver organoid or a foregut spheroid.In some embodiments, the cells are part of a liver organoid. In some embodiments, the cells are contacted with a cationic barcode for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, or 48 hours, or any number of hours within a range defined by any two of the foregoing temperatures, e.g., 1 - 48 hours, 10 - 30 hours, 20 - 25 hours, 1 - 24 hours, or 24 - 48 hours, or about those, at least those, at least about those, less than those, or about less than those. In some embodiments, the method includes sequencing the cationic barcode. In some embodiments, the method includes sequencing the cationic barcode by single cell sequencing. In some embodiments, the method includes sequencing the cationic barcode by scRNA - seq.

[0050] Disclosed herein is a method for multiplex barcoding of cell populations. As described herein and elsewhere, it is advantageous to use barcodes to multiplex sequencing technologies in order to improve the throughput of data collection (e.g., running multiple samples within each run of sequencing). In some embodiments, the method includes contacting a population of cells with one or more cationic barcodes. In some embodiments, each of the one or more cationic barcodes includes a cationic polymer and a nucleic acid barcode of a unique sequence. In some embodiments, the cationic polymer is any cationic polymer described herein, or a cationic polymer synthesized by any one of the methods described herein. In some embodiments, the cationic polymer is any capped cationic polymer described herein, or a capped cationic polymer synthesized by any one of the methods described herein. In some embodiments, the capped cationic polymer is one or more (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8) of vectors POLY1, POLY2, POLY3, POLY4, POLY5, POLY6, POLY7, or POLY8, as disclosed herein, or any combination thereof. In some embodiments, the nucleic acid barcode is a DNA or RNA strand. In some embodiments, the nucleic acid barcode is single-stranded DNA (ssDNA). In some embodiments, the nucleic acid barcode is an ssDNA barcode. In some embodiments, the nucleic acid barcode is part of a barcode array known in the art. In some embodiments, the nucleic acid barcode is based on the CITE-seq hashing oligomer array. In some embodiments, the nucleic acid barcode has the sequences of SEQ ID NOs: 2-4. In some embodiments, the nucleic acid barcode is chemically synthesized. In some embodiments, the nucleic acid barcode includes one or more nucleic acid modifications as described herein. In some embodiments, after contacting the population of cells with one or more cationic barcodes, the method includes sequencing the nucleic acid barcodes of the one or more cationic barcodes.In some embodiments, sequencing of the nucleic acid barcode is by single cell RNA-seq (scRNA-seq). In some embodiments, sequencing of the nucleic acid barcode identifies individual cells as belonging to a population of cells. In some embodiments, individual cells are identified as belonging to a population of cells by the sequence of the nucleic acid barcode of the individual cell. In some embodiments, sequencing of the nucleic acid barcode includes amplifying the nucleic acid barcode. In some embodiments where the nucleic acid barcode is ssDNA, sequencing of the nucleic acid barcode includes amplifying the ssDNA barcode.

[0051] In some embodiments, the capped cationic polymer and the nucleic acid barcode are combined at a w / w ratio of the capped cationic polymer:nucleic acid barcode of 1 / 1, 2 / 1, 3 / 1, 4 / 1, 5 / 1, 6 / 1, 7 / 1, 8 / 1, 9 / 1, 10 / 1, 11 / 1, 12 / 1, 13 / 1, 14 / 1, 15 / 1, 16 / 1, 17 / 1, 18 / 1, 19 / 1, 20 / 1, 21 / 1, 22 / 1, 23 / 1, 24 / 1, 25 / 1, 26 / 1, 27 / 1, 28 / 1, 29 / 1, or 30 / 1 μg / μg, or any ratio within the range defined by any two of the foregoing ratios, for example, a w / w ratio of the capped cationic polymer:nucleic acid barcode of 1 / 1 to 30 / 1, 10 / 1 to 25 / 1, 15 / 1 to 20 / 1, 1 / 1 to 20 / 1, or 15 / 1 to 30 / 1, or about those, at least those, at least about those, less than those, or less than about those. In some embodiments, for a population of cells, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 μg of the capped cationic polymer is used, or any mass within the range defined by any two of the foregoing masses, for example, 1 to 50 μg, 10 to 40 μg, 20 to 30 μg, 1 to 30 μg, or 20 to 50 μg of the capped cationic polymer is used. In some embodiments, the capped cationic polymer and the nucleic acid barcode are combined in a growth medium. In some embodiments, the growth medium is HCM.In some embodiments, the capped cationic polymer and the nucleic acid barcode are complexed over a time period of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 minutes, or any time within a range defined by any two of the aforementioned temperatures, e.g., 1 - 30 minutes, 10 - 25 minutes, 15 - 20 minutes, 1 - 20 minutes, or 10 - 30 minutes, or about those, at least those, at least about those, less than those, or about less than those. In some embodiments, the complexed capped cationic polymer and nucleic acid barcode are contacted with a population of cells. In some embodiments, the population of cells is a liver organoid. In some embodiments, the complexed capped cationic polymer and nucleic acid barcode are reacted with the population of cells for a time period of 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, or 120 hours, or any time within a range defined by any two of the aforementioned times, e.g., 10 - 120 hours, 30 - 100 hours, 20 - 50 hours, 10 - 30 hours, or 50 - 120 hours, or about those, at least those, at least about those, less than those, or about less than those. In some embodiments, the cellular association of the complexed capped cationic polymer and the diffusion barcode occurs prior to a time period of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 hours, or any amount of time within a range defined by any two of the aforementioned temperatures, e.g., 1 - 12 hours, 2 - 10 hours, 2 - 4 hours, or 1 - 5 hours, or about those, at least those, at least about those, less than those, or about less than those, after contact. In some embodiments, the complexed capped cationic polymer and nucleic acid barcode are co-localized with cell lysosomes. In some embodiments, the population of cells is dissociated into a single cell suspension. In some embodiments, the single cell suspension is sequenced by single cell sequencing.In some embodiments, the single cell suspension is sequenced by scRNA-seq.

[0052] In some embodiments, barcoding the cell population with the capped cationic polymers described herein results in labeling of 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the cells, or any percentage within a range defined by any two of the foregoing percentages, e.g., 50% - 100%, 80 - 95%, 85% - 94%, 50% - 90%, or 80% - 100%, or about those, or at least those, or at least about those, or less than those, or about less than those. In some embodiments, the sequencing is accurate to 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or any percentage within a range defined by any two of the foregoing percentages, e.g., 50% - 100%, 80 - 95%, 85% - 94%, 50% - 90%, or 80% - 100%, or about those, or at least those, or at least about those, or less than those, or about less than those.

[0053] In some embodiments, the cell population is prepared, obtained, or derived from two or more individuals. In some embodiments, this cell population is a "pooled population". In some embodiments, the cell population is defined by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 individuals, or any number of individuals within the range defined by any two of the aforementioned numbers, e.g., 1 to 1000 individuals, 10 to 500 individuals, 50 to 100 individuals, 1 to 200 individuals, or 50 to 1000 individuals, or about those, at least those, at least about those, less than those, or about less than those individuals, and is prepared, obtained, or derived therefrom. In some embodiments, the cell population is derived from iPSCs from two or more individuals. In some embodiments, the cell population is derived from iPSCs by synchronizing iPSCs from two or more individuals under synchronization conditions to obtain synchronized iPSCs. In some embodiments, the iPSCs are differentiated after synchronization. In some embodiments, the iPSCs are differentiated into definitive endoderm, foregut spheroids, organoids, or liver organoids, or any combination thereof, after synchronization. In some embodiments, the cell population is part of a tissue, organoid, or spheroid, or any combination thereof. In some embodiments, the cell population is a tissue, organoid, or spheroid, or any combination thereof. In some embodiments, the cell population is part of a liver organoid or a foregut spheroid, or both. In some embodiments, the cell population is an organoid or a foregut spheroid, or both. In some embodiments, the cell population is part of a liver organoid or is a liver organoid.

[0054] In some embodiments, the population of cells from two or more individuals is an organoid (a "pooled organoid"). In some embodiments, the pooled organoid is prepared, obtained, or derived from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 individuals, or any number of individuals within a range defined by any two of the foregoing numbers, e.g., 1 to 1000 individuals, 10 to 500 individuals, 50 to 100 individuals, 1 to 200 individuals, or 50 to 1000 individuals, or about those numbers, at least those numbers, at least about those numbers, less than those numbers, or less than about those numbers. In some embodiments, the population of cells from two or more individuals is an organoid derived from iPSCs from two or more individuals. In some embodiments, the organoid is derived from iPSCs by synchronizing iPSCs from two or more individuals under synchronization conditions to obtain synchronized organoids. In some embodiments, the organoid is a liver organoid, a stomach organoid, an intestinal organoid, a brain organoid, a lung organoid, an esophageal organoid, a bone organoid, a cartilage organoid, a bladder organoid, a vascular organoid, an endocrine organoid, or a sensory organoid, or any combination thereof. The pooled organoids and methods of making and using them are discussed in PCT Publication No. WO2018 / 191673, which is hereby incorporated by reference in its entirety.

[0055] In some embodiments, the cell population comprises two or more subpopulations of cells. In some embodiments, each of the two or more subpopulations of cells is derived from a unique individual. In some embodiments, the cell population is formed by combining two or more subpopulations of cells. In some embodiments, the two or more subpopulations include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 subpopulations, or any number of subpopulations within a range defined by any two of the foregoing numbers, for example, 1 to 1000 subpopulations, 10 to 500 subpopulations, 50 to 100 subpopulations, 1 to 200 subpopulations, or 50 to 1000 subpopulations, or about those, at least those, at least about those, less than those, or less than about those subpopulations. In some embodiments, the two or more subpopulations are derived from 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 individuals, or any number of individuals within a range defined by any two of the foregoing numbers, for example, 1 to 1000 individuals, 10 to 500 individuals, 50 to 100 individuals, 1 to 200 individuals, or 50 to 1000 individuals, or about those, at least those, at least about those, less than those, or less than about those individuals. In some embodiments, contacting the cell population with one or more cationic barcodes includes contacting the cell population with two or more cationic barcodes. In some embodiments, contacting the cell population with one or more cationic barcodes includes contacting the cell population with the same number of cationic barcodes as the number of subpopulations present. In some embodiments, the cell population is contacted with at least one more cationic barcode than the number of subpopulations present.In some embodiments, a population of cells is contacted with a number of cationic barcodes that is defined by 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 cationic barcodes, or a number of cationic barcodes within a range defined by any two of the foregoing numbers of cationic barcodes, e.g., 2 to 1000 cationic barcodes, 10 to 500 cationic barcodes, 50 to 100 cationic barcodes, 1 to 200 cationic barcodes, or 50 to 1000 cationic barcodes, or about those, at least those, at least about those, less than those, or less than about those. In some embodiments, a population of cells is contacted with a number of cationic barcodes that is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 more than the number of subpopulations present, or any number of cationic barcodes that is more than the number of subpopulations present, e.g., 1 to 20 more, 5 to 15 more, 10 to 12 more, 1 to 10 more, or 10 to 20 more than the subpopulations present in the population of cells, or about those, at least those, at least about those, less than those, or less than about those.

[0056] In some embodiments, a population of cells is formed by combining two or more sub-populations of cells (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 50, 100, 500, 1000 cells). In some embodiments, a population of cells is formed by combining two or more sub-populations of cells when the two or more sub-populations of cells are in a single cell suspension. In some embodiments, the two or more sub-populations of cells to be combined are a single cell suspension. In some embodiments, the two or more sub-populations of cells to be combined are iPSCs. In some embodiments, the two or more sub-populations of cells to be combined are foregut spheroids. In some embodiments, the two or more sub-populations of cells to be combined are dissociated foregut spheroids. In some embodiments, the two or more sub-populations of cells to be combined are liver organoids. In some embodiments, the two or more sub-populations of cells to be combined are dissociated liver organoids. In some embodiments, the two or more sub-populations of cells are cells that are synchronized with each other. In some embodiments, each of the two or more sub-populations of cells is contacted with one or more (e.g., at least 1, 2, 3, 4, 5) cationic barcodes. In some embodiments, each of the one or more cationic barcodes is unique among the cationic barcodes that contact the same sub-population of cells and among the cationic barcodes that contact different sub-populations of cells. In some embodiments, each of the two or more sub-populations of cells is contacted with one or more cationic barcodes before they are combined to form a population of cells. In some embodiments, contacting each of the two or more sub-populations of cells before they are combined to form a population of cells results in each sub-population of cells having a different set of one or more cationic barcodes having unique sequences. In some embodiments, after contacting the two or more sub-populations of cells with one or more unique cationic barcodes, the two or more sub-populations of cells are combined to form a population of cells. In some embodiments, the unique one or more cationic barcodes for each of the two or more sub-populations of cells in the population of cells are sequenced.In some embodiments, sequencing one or more unique cationic barcodes of each of two or more subpopulations of cells identifies individual cells as belonging to one of the two or more subpopulations of cells in a population of cells. In some embodiments, individual cells are identified as belonging to one of the subpopulations of cells among two or more subpopulations of cells by the sequence of the nucleic acid barcode of the individual cell.

[0057] In some embodiments, a population of cells comprising two or more (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 50, 100, 500, 1000) subpopulations of cells is an organoid. In some embodiments, the organoid is a liver organoid. In some embodiments, a population of cells comprising two or more (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 50, 100, 500, 1000) subpopulations of cells is a liver organoid. In some embodiments, the organoid is formed from cells derived from 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 individuals, or any number of individuals within a range defined by any two of the foregoing numbers, e.g., 1 to 1000 individuals, 10 to 500 individuals, 50 to 100 individuals, 1 to 200 individuals, or 50 to 1000 individuals, or about those, at least those, at least about those, less than those, or about less than those. In some embodiments, the organoid is formed from iPSCs, embryonic endoderm, or foregut spheroids, or any combination thereof. In some embodiments, the organoid is formed from iPSCs, embryonic endoderm, or foregut spheroids from cells derived from two or more individuals. In some embodiments, the organoid is formed from two or more subpopulations of cells, and the subpopulations of cells are iPSCs, embryonic endoderm, or foregut spheroids. In some embodiments, the subpopulations of cells are synchronized. In some embodiments, each of the subpopulations of cells is contacted with one or more (e.g., at least 1, 2, 3, 4, 5) cationic barcodes prior to pooling to form the organoid. In some embodiments, the organoid comprises two or more subpopulations comprising different cationic barcodes. In some embodiments, by sequencing the cationic barcodes of the organoid, individual cells of the organoid are identified as belonging to one of two or more subpopulations of cells.In some embodiments where the organoid is a liver organoid, the individual cells are further specified as hepatocytes, stellate cells, or bile duct cells, or any combination thereof. In some embodiments, the individual cells are specified based on the expression of one or more (e.g., at least 1, 2, 3, 4, 5) of HNF4α, ASGR1, CEBPA, RBP4, COL1A2, SPARC, TAGLN, KRT7, TACSTD2, or SPPI, or a combination thereof.

[0058] Stem cells As used herein, the term "totipotent stem cell" (also known as an omnipotent stem cell) refers to a stem cell that can differentiate into embryonic and extraembryonic cell types. Such cells can build a complete and viable organism. These cells are produced from the fusion of an egg and a sperm cell. The cells produced by the first few divisions of a fertilized egg are also totipotent.

[0059] As used herein, the term "embryonic stem cell (ESC)" is generally abbreviated as ES cell and has its ordinary and customary meaning as understood in the context of this specification, and refers to a pluripotent cell derived from the inner cell mass of a blastocyst, which is an early embryo. For the purposes of this disclosure, the term "ESC" may be used in a broad sense to include embryonic germ cells.

[0060] As used herein, the term "pluripotent stem cell (PSC)" has its general and ordinary meaning as understood in the context of this specification and encompasses any cell that can differentiate into cells derived from any of the three germ layers (germ epithelium), including substantially all cell types of the body, namely, the endoderm (inner lining of the stomach, digestive tract, lungs), mesoderm (muscle, bone, blood, urogenital), and ectoderm (epidermal tissue and nervous system). A PSC can be a descendant of the inner cell mass cells of a preimplantation blastocyst or may be obtained by inducing non-pluripotent stem cells, such as adult somatic cells, by forcing the expression of certain genes. Pluripotent stem cells can be derived from any suitable source. Examples of sources of pluripotent stem cells include mammalian sources including human, rodent, porcine, and bovine.

[0061] As used herein, the term "induced pluripotent stem cell (iPSC)" is also generally abbreviated as iPS cell and has its general and ordinary meaning as understood in the context of this specification, and refers to a type of pluripotent stem cell artificially obtained from normally non-pluripotent stem cells, such as adult somatic cells, by inducing the "forced" expression of specific genes. HiPSC refers to human iPSC. In some methods known in the art, iPSC can be obtained by transfection of non-pluripotent cells such as adult fibroblasts with certain stem cell-related genes. Transfection can be achieved by viral transduction using viruses such as retroviruses or lentiviruses. The transfected genes can include the master transcriptional regulators Oct-3 / 4 (POU5F1) and Sox2, although other genes can also improve the efficiency of induction. After 3 to 4 weeks, a small number of transfected cells begin to become morphologically and biochemically similar to pluripotent stem cells and are usually isolated by morphological selection, doubling time, or reporter gene and antibiotic selection. As used herein, iPSC includes first-generation iPSC, second-generation iPSC in mice, and human induced pluripotent stem cells. In some methods, a retroviral system is used to transform human fibroblasts into pluripotent stem cells using four highly important genes, Oct3 / 4, Sox2, Klf4, and c-Myc. In other methods, a lentiviral system is used to transform somatic cells with OCT4, SOX2, NANOG, and LIN28.Genes whose expression is induced in iPSCs include, but are not limited to, Oct-3 / 4 (POU5F1), certain members of the Sox gene family (e.g., Sox1, Sox2, Sox3, and Sox15); certain members of the Klf family (e.g., Klf1, Klf2, Klf4, and Klf5), certain members of the Myc family (e.g., C-myc, L-myc, and N-myc);, Nanog, LIN28, Tert, Fbx15, ERas, ECAT15-1, ECAT15-2, Tcl1, β-catenin, ECAT1, Esg1, Dnmt3L, ECAT8, Gdf3, Fth117, Sal14, Rex1, UTF1, Stella, Stat3, Grb2, Prdm14, Nr5a1, Nr5a2, E-cadherin, or any combination thereof.

[0062] As used herein, the term "progenitor cell" has its ordinary and customary meaning as understood in light of this specification and includes any cell that can be used in the methods described herein, through which one or more progenitor cells acquire the ability to either self-renew or differentiate into one or more specialized cell types. In some embodiments, the progenitor cell is pluripotent or has the ability to become pluripotent. In some embodiments, the progenitor cell is subjected to treatment with external factors (e.g., growth factors) to acquire pluripotency. In some embodiments, the progenitor cell can be a totipotent (or omnipotent) stem cell, a pluripotent stem cell (induced or non-induced), a multipotent stem cell, an oligopotent stem cell, and a unipotent stem cell. In some embodiments, the progenitor cell can be derived from an embryo, infant, child, or adult. In some embodiments, the progenitor cell can be a somatic cell that is subjected to a treatment such that pluripotency is conferred via genetic manipulation or protein / peptide treatment. Progenitor cells include embryonic stem cells (ESC), embryonal carcinoma cells (EC), and epiblast stem cells (EpiSC).

[0063] In some embodiments, one step is to obtain stem cells that are pluripotent or can be induced to become pluripotent. In some embodiments, the pluripotent stem cells are derived from embryonic stem cells, and these embryonic stem cells are derived from the totipotent cells of the early mammalian embryo and are capable of unlimited undifferentiated proliferation in vitro. Embryonic stem cells are pluripotent stem cells derived from the inner cell mass of the blastocyst, which is an early-stage embryo. Methods for inducing embryonic stem cells from blastocysts are well known in the art. Human embryonic stem cell H9 (H9-hESC) is used in the exemplary embodiments described in this application, but it will be understood by those skilled in the art that the methods and systems described herein are applicable to any stem cell.

[0064] Additional stem cells that can be used in embodiments according to the present disclosure include, but are not limited to, those obtained from databases administered by the National Stem Cell Bank (NSCB), the Human Embryonic Stem Cell Research Center at the University of California, San Francisco (UCSF), the Wi Cell Research Institute's WISC cell Bank, the University of Wisconsin Stem Cell and Regenerative Medicine Center (UW-SCRMC), Novocell, Inc. (San Diego, Calif), Cellartis AB (Goteborg, Sweden), ES Cell International Pte Ltd (Singapore), the Technion at the Israel Institute of Technology (Haifa, Israel), and the Stem Cell Database hosted by Princeton University and the University of Pennsylvania, including but not limited to those described in the databases. Exemplary embryonic stem cells that can be used in embodiments according to the present disclosure include SA01 (SA001), SA02 (SA002), ES01 (HES-1), ES02 (HES-2), ES03 (HES-3), ES04 (HES-4), ES05 (HES-5), ES06 (HES-6), BG01 (BGN-01), BG02 (BGN-02), BG03 (BGN-03), TE03 (13), TE04 (14), TE06 (16), UC01 (HSF1), UC06 (HSF6), WA01 (HI), WA07 (H7), WA09 (H9), WA13 (H13), WA14 (H14), including but not limited to these.Exemplary human pluripotent cell lines include, but are not limited to, TkDA3-4, 1231A3, 317-D6, 317-A4, CDH1, 5-T-3, 3-34-1, NAFLD27, NAFLD77, NAFLD150, WD90, WD91, WD92, L20012, C213, 1383D6, FF, ESH1, 72.3, or 317-12 cells.

[0065] In developmental biology, cell differentiation is the process by which less specialized cells become more specialized cell types. As used herein, the term "directed differentiation" describes the process by which less specialized cells become a particular specialized target cell type. The particularity of the specialized target cell type can be determined by any applicable method that can be used to define or alter the fate of the initial cells. Exemplary methods include, but are not limited to, genetic manipulation, chemical treatment, protein treatment, and nucleic acid treatment.

[0066] In some embodiments, adenoviruses can be used to transport the four necessary genes and result in iPSCs that are substantially identical to embryonic stem cells. Since adenoviruses do not combine their own genes with the target host, the risk of creating tumors is eliminated. In some embodiments, non-viral-based technologies are used to generate iPSCs. In some embodiments, reprogramming can be achieved via plasmids with very low efficiency and without using any viral transfection system at all. In other embodiments, direct delivery of proteins is used to generate iPSCs, thus eliminating the need for viruses or genetic modification. In some embodiments, generation of mouse iPSCs is possible using similar methodologies. Repeated treatment of cells with specific proteins carried to the cells via polyarginine anchors was sufficient to induce pluripotency. In some embodiments, expression of pluripotency-inducing genes can also be increased by treating somatic cells with FGF2 under hypoxic conditions.

[0067] As used herein, the term "feeder cell" has its ordinary and customary meaning as understood in the context of this specification, and refers to cells that support the growth of pluripotent stem cells, such as by secreting growth factors into the culture medium or displaying them on the cell surface. Feeder cells are generally adherent cells and may cease to proliferate. For example, feeder cells can be arrested in growth by irradiation (e.g., gamma rays), mitomycin-C treatment, electrical pulses, or mild chemical fixation (e.g., formaldehyde or glutaraldehyde). However, feeder cells do not necessarily stop growing. Feeder cells can serve purposes such as secretion of growth factors, display of growth factors on the cell surface, detoxification of the culture medium, or synthesis of extracellular matrix proteins. In some embodiments, feeder cells are syngeneic or xenogeneic to the supported target stem cells, which can affect downstream applications. In some embodiments, feeder cells are mouse cells. In some embodiments, feeder cells are human cells. In some embodiments, feeder cells are mouse fibroblasts, mouse embryonic fibroblasts, mouse STO cells, mouse 3T3 cells, mouse SNL 76 / 7 cells, human fibroblasts, human dermal fibroblasts, human skin fibroblasts, human adipose mesenchymal cells, human bone marrow mesenchymal cells, human amniotic mesenchymal cells, human amniotic epithelial cells, human umbilical cord mesenchymal cells, human fetal muscle cells, human fetal fibroblasts, or human adult fallopian tube epithelial cells. In some embodiments, conditioned media prepared from feeder cells are used instead of or in combination with feeder cell co-culture. In some embodiments, feeder cells are not used during the growth of target stem cells.

[0068] The liver is an important organ that provides many essential metabolic functions, such as the detoxification and coagulation of exogenous compounds, and the production of lipids, proteins, ammonium, and bile. Primary hepatocytes are highly polarized metabolic cell types that form a bile canalicular structure with microvilli-lined channels and separate the peripheral circulation from the bile acid secretion pathway. In vitro reconstitution of a patient's liver can provide applications including regenerative therapy, drug discovery, and drug toxicity studies. Existing methodologies using primary hepatocytes are mainly due to the lack of essential anatomical structures, but show very poor functionality, which limits their practical use in the pharmaceutical industry. The formation of liver organoids containing luminal structures with internalized microvilli and mesenchymal cells, and showing hepatocyte types such as hepatocytes, stellate cells, Kupffer cells, and liver endothelial cells, and methods for their preparation and use have been previously described in PCT Publications WO2018 / 085615, WO2018 / 085622, WO2018 / 085623, and WO2018 / 226267, each of which is hereby expressly incorporated by reference in its entirety.

[0069] In some embodiments, the ESCs, germ cells, or iPSCs are cultured in a growth medium that supports the growth of stem cells. In some embodiments, the ESCs, germ cells, or iPSCs are cultured in a stem cell growth medium. In some embodiments, the stem cell growth medium is RPMI 1640, DMEM, DMEM / F12, Advanced DMEM, hepatocyte culture medium (HCM), StemFit, mTeSR1, or mTeSR Plus medium. In some embodiments, the stem cell growth medium contains fetal bovine serum (FBS). In some embodiments, the stem cell growth medium contains FBS at a concentration of 0%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20%, or any ratio within a range defined by any two of the aforementioned concentrations, such as 0% to 20%, 0.2% to 10%, 2% to 5%, 0% to 5%, or 2% to 20%, or about those, at least those, at least about those, less than those, or about less than those. In some embodiments, the stem cell growth medium does not contain xenogeneic components. In some embodiments, the growth medium contains one or more small molecule compounds, activators, inhibitors, or growth factors. In some embodiments, the stem cells are grown on a feeder cell substrate. In some embodiments, the stem cells are not grown on a feeder cell substrate. In some embodiments, the stem cells are grown on plates coated with laminin. In some embodiments, the stem cells are grown with supplementation of FGF2 or a ROCK inhibitor (e.g., Y-27632), or both.

[0070] In some embodiments, PSCs are cultured under feeder cell-free conditions. In some embodiments, PSCs are cultured in mTeSR medium. In some embodiments, PSCs are passaged when they reach a culture density that is 60%, 70%, 80%, 90%, or 100%, about those, at least those, at least about those, less than those, or about less than those. In some embodiments, PSCs are cultured with a ROCK inhibitor and Laminin-511.

[0071] Any method for generating definitive endoderm (DE) from pluripotent cells (e.g., iPSCs or ESCs) is applicable to the methods described herein. Exemplary methods are disclosed, for example, in U.S. Patent No. 9,719,068. In some embodiments, iPSC cells are used to generate definitive endoderm.

[0072] In some embodiments, one or more growth factors are used in the differentiation process from pluripotent stem cells to DE cells. In some embodiments, the one or more growth factors used in the differentiation process include growth factors from the TGF-beta superfamily. In some embodiments, the one or more growth factors include the Nodal / Activin and / or BMP subgroups of the TGF-beta superfamily of growth factors. In some embodiments, the one or more growth factors are selected from the group consisting of Nodal, Activin A, Activin B, BMP4, or any combination thereof. In some embodiments, the PSCs are contacted with one or more growth factors for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, or 240 hours, or any number of hours within a range defined by any two of the aforementioned number of days, e.g., 1 - 240 hours, 20 - 120 hours, 30 - 50 hours, 1 - 100 hours, or 50 - 240 hours, or about those, at least those, at least about those, less than those, or about less than those. In some embodiments, the PSCs are contacted with one or more growth factors at a concentration of 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 ng / mL, or any concentration within a range defined by any two of the aforementioned concentrations, e.g., 10 - 1000 ng / mL, 50 - 800 ng / mL, 100 - 500 ng / mL, 10 - 200 ng / mL, or 100 - 1000 ng / mL, or about those, at least those, at least about those, less than those, or about less than those.In some embodiments, the concentration of one or more growth factors is maintained at a constant level throughout the period of contact. In some embodiments, the concentration of one or more growth factors varies during the period of contact. In some embodiments, one or more growth factors are dissolved in a growth medium. In some embodiments, a cell population rich in definitive endoderm cells is used. In some embodiments, definitive endoderm cells are isolated or substantially purified. In some embodiments, the isolated or substantially purified definitive endoderm cells express more of one or more (e.g., at least one, three) of the SOX17, FOXA2, or CXRC4 markers than one or more (e.g., at least one, three, five) of the OCT4, AFP, TM, SPARC, or SOX7 markers.

[0073] In some embodiments, definitive endoderm cells are contacted with one or more modulators of the signaling pathways described herein. In some embodiments, definitive endoderm cells are treated with one or more modulators of the signaling pathway for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48 hours, or for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 days, or for any number of hours or days within the range defined by any two of the foregoing numbers of days or hours, e.g., 1 hour to 20 days, 20 hours to 10 days, 1 hour to 48 hours, 1 day to 20 days, 1 hour to 5 days, or 24 hours to 20 days, or about those, at least those, at least about those, less than those, or about less than those. In some embodiments, the concentration of one or more growth factors in the signaling pathway is maintained at a constant level throughout the period of contact. In some embodiments, the concentration of one or more modulators of the signaling pathway varies during the period of contact.

[0074] In some embodiments, to differentiate embryonic endoderm into foregut spheroids, embryonic endoderm cells are contacted with one or more modulators of the FGF pathway and the Wnt pathway. In some embodiments, cell components associated with the Wnt and / or FGF signaling pathways, such as natural inhibitors, antagonists, activators, or agonists of the pathway, can be used to effect inhibition or activation of the Wnt and / or FGF signaling pathways. In some embodiments, siRNA and / or shRNA targeting cell components associated with the Wnt and / or FGF signaling pathways can be used to inhibit or activate these pathways.

[0075] Fibroblast growth factor (FGF) is a family of growth factors involved in angiogenesis, wound healing, and embryonic development. FGF is a heparin-binding protein, and it has been shown that interaction with cell surface-associated heparan sulfate proteoglycans is essential for FGF signaling. FGF plays an important role in the processes of proliferation and differentiation of a wide variety of cells and tissues. In humans, 22 members of the FGF family have been identified, all of which are structurally related signaling molecules. Members FGF1 to FGF10 all bind to fibroblast growth factor receptor (FGFR). FGF1 is also known as acidic, and FGF2 is also known as basic fibroblast growth factor (bFGF). Members FGF11, FGF12, FGF13, and FGF14, also known as FGF homologous factors 1 to 4 (FHF1 to FHF4), have been shown to have distinct functional differences compared to FGF. These factors have significant sequence homology, but they do not bind to FGFR and are involved in intracellular processes unrelated to FGF. This group is also known as "iFGF". Members FGF15 to FGF23 are newer and less characterized. FGF15 is the mouse ortholog of human FGF19 (thus, there is no human FGF15). Human FGF20 was identified based on homology with Xenopus FGF-20 (XFGF-20). In contrast to the local activity of other FGFs, FGF15 / FGF19, FGF21, and FGF23 have more systemic effects. In some embodiments, the FGF used is one or more (e.g., at least 1, 3, 5) of FGF1, FGF2, FGF3, FGF4, FGF4, FGF5, FGF6, FGF7, FGF8, FGF8, FGF9, FGF10, FGF11, FGF12, FGF13, FGF14, FGF15 (FGF19, FGF15 / FGF19), FGF16, FGF17, FGF18, FGF20, FGF21, FGF22, FGF23. In some embodiments, the FGF used is FGF4.In some embodiments, the embryonic endoderm is contacted with FGF at a concentration of 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, or 2000 ng / mL, or any concentration within a range defined by any two of the foregoing concentrations, for example, 10 - 2000 ng / mL, 50 - 1500 ng / mL, 500 - 100 ng / mL, 10 - 1000 ng / mL, or 500 - 2000 ng / mL, or about those, at least those, at least about those, less than those, or less than about those.

[0076] In some embodiments, to differentiate the embryonic endoderm into foregut spheroids, the embryonic endoderm is contacted with a Wnt protein or activator. In some embodiments, the embryonic endoderm is contacted with a glycogen synthase kinase 3 (GSK3) inhibitor. The GSK3 inhibitor acts to activate the Wnt pathway. In some embodiments, the embryonic endoderm is contacted with the GSK3 inhibitor, CHIR99021. In some embodiments, the embryonic endoderm is contacted with CHIR99021 at a concentration of 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 μM of CHIR99021, or any concentration within a range defined by any two of the foregoing concentrations, for example, 0.1 - 10 μM, 0.4 - 6 μM, 1 - 5 μM, 0.1 - 1 μM, or 0.5 - 10 μM of CHIR99021, or about those, at least those, at least about those, less than those, or less than about those.

[0077] In some embodiments, the foregut spheroids differentiate into liver organoids. In some embodiments, the foregut spheroids are differentiated into liver organoids by contacting the foregut spheroids with retinoic acid (RA). In some embodiments, the foregut spheroids are contacted with RA and 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 μM of RA, or any concentration within a range defined by any two of the foregoing concentrations, for example, 0.1-10 μM, 0.4-6 μM, 1-5 μM, 0.1-1 μM, or 0.5-10 μM of RA, or about those, at least those, at least about those, less than those, or about less than those concentrations.

[0078] In some embodiments, one or more of induced pluripotent stem cells, definitive endoderm, foregut spheroids, or liver organoids, or any combination thereof, are prepared according to the methods described in PCT Publications WO2018 / 085615, WO2018 / 191673, WO2018 / 226267, WO2019 / 126626, WO2020 / 023245, WO2020 / 056158, and WO2020 / 069285, each of which is hereby incorporated by reference in its entirety and expressly incorporated for the purpose of producing induced pluripotent stem cells, definitive endoderm, foregut spheroids, liver organoids, or any combination thereof.

Example

[0079] Some aspects of the above-described embodiments are disclosed in more detail in the following examples, which are in no way intended to limit the scope of the present disclosure. Those skilled in the art will understand that many other embodiments are within the scope of the present disclosure as described above in this specification and in the claims.

[0080] Example 1. Synthesis and Characterization of POLY-seq Polymers A polymer set was created using commercially available reagents, and single cells were ubiquitously tagged with single-stranded DNA (ssDNA) barcodes, enabling rapid and cost-effective multiplexing of single-cell NGS technology.

[0081] The synthesis and application scheme of the POLY-seq vector are detailed in Figure 1A. Acrylate monomers mixed with amino alcohol are heated to form uncapped acrylate end vectors. The vectors are capped by the addition of primary or secondary amines containing small molecules, thereby conferring the ability of the POLY-seq vector to bind to ssDNA barcodes and adhere to cells (labeled cells) in a cell-type-independent manner. Next, the labeled cells can be processed using standard single-cell techniques. All of the respective reagents are commercially available (Figure 1B). 11H NMR was used to confirm the presence of terminal acrylate groups after the formation of acrylate-terminated products. The resonance peaks of these groups were observed at δ 6.2 - 5.6 and disappeared when the binding with the capping reagent was successfully carried out (Figure 1C). The effects on cell viability were evaluated using ESH1, 72.3, and 1383D6 iPSCs. The onset of a significant decrease in CTG luminescence starting at 50 μg / mL, p < 0.001, n = 3 was found in polymers containing branched V5 monomers with capping groups C2 and C3 (POLY2 and POLY3 respectively) (Figure 1D). The results were summarized for ESH1 and 1383D6 iPSCs (Figure 1E). To test the ability of the capped vector to bind and retain the ssDNA barcode, the vector and the barcode were first mixed and allowed to bind for 10 minutes in 25 mM HEPES pH 7.4. After binding, the vector was loaded onto a 2.5% agarose gel and electrophoresed at 150 V. It was found that the ability to bind to the single-stranded DNA barcode used in the cell hashing experiment depends on the capping reagent and the backbone structure (Figure 1F). Vectors capped with molecules C2 and C3 were found to retain the ssDNA barcode more easily during gel electrophoresis than vectors capped with C1 or C4. Furthermore, the mass ratio (w / w) at which complete barcode retention was observed decreased significantly when branched acrylate V5 was included (POLY2 vs POLY6, POLY3 vs POLY7).

[0082] Example 2. The POLY-seq vector specifically targets cells The function of rapidly binding and retaining ssDNA barcodes is an important function, but the vector should also have the function of targeting cells. For this purpose, vectors POLY1 - POLY4 were selected for the quantification of cell targeting. The targeting tendency of the POLY-seq vectors was first tested using FACS analysis of labeled foregut and hindgut spheroids. The gating analysis of single cells isolated on day 4 is shown in Figure 2A. Variations in the degree of total and double labeling were observed to depend on the vector formulation (Figure 2B). A significant decrease in the total targeting rate was observed on day 14, but no significant difference was seen within the first 7 days of co-culture, indicating the longevity of labeling fidelity. Vector POLY3 provided the highest degree of double labeling and was significantly higher than POLY1, POLY2, and POLY4 starting from the first time point (p < 0.01, n = 3) (Figure 2B). Labeling fidelity was summarized by confocal imaging. Spheroids fused after labeling with POLY2 showed clear labeling with visible boundaries (Figure 2F). The utility of vector POLY2 in the binding of human liver organoids was further investigated using FACS analysis of single cells isolated from mixed cultures (Figure 2C). Vector POLY2 was selected based on its performance in barcode binding and cell targeting. The total labeling rate of vector POLY2 was 98.2 ± 0.8% of the cells isolated from the HLO culture (Figure 2D). Very few double-labeled cells were found in this mixed culture by FACS analysis. To examine the spatial distribution of the POLY-seq vectors bound to cells, DyLight 488-conjugated vectors were incubated with the HLO culture. Confocal analysis revealed strong co-localization of POLY2 and POLY3 with lysosomes, while POLY4 showed relatively low internalization in three houses, reflecting the weak labeling found by flow cytometry (Figure 2E). These results suggest a correlation between the ability of each vector to bind to the barcode and interact with cells.

[0083] Example 3. The POLY-seq vector delivers an amplifiable barcode To test the ability of the POLY-seq vector to deliver barcodes that are amplified by the standard 10× Chromium workflow and read by a common next-generation sequencer, three HLO samples were individually tagged with three different barcodes using vector POLY2 one hour prior to running on the 10× Chromium platform. Single-cell analysis of barcode HLOs containing all the arrayed barcodes revealed high labeling across all three populations with an overall level of labeling approaching 90%, reflecting the targeting rate observed during the first FACS analysis (Figures 3A - B). The sequencing accuracy for all three barcodes was 94%. Importantly, the uniformity of labeling across multiple clusters was verified by UMAP analysis using a high clustering sensitivity that indicates unbiased labeling. All cells of sample E2 were grouped into 13 clusters and juxtaposed with cells containing only correct barcode reads (Figure 3C). Analyses of samples E3 and E4 were performed similarly (Figure 3C). The barcode uniformity between clusters was confirmed in all three samples, and the average labeling per cluster for samples E2, E3, and E4 was found to be 89 ± 3.4%, 86 ± 4.8%, and 81 ± 5.9%, respectively (Figure 3D). This decrease in labeling rate by single-cell sequencing compared to flow analysis is due to the shortened labeling time (1 hour vs. 24 hours) used during single-cell preparation and provides an opportunity to directly evaluate the potential impact of POLY2 labeling on gene expression measured by DESeq2. Perturbations to transcription measured by labeling were examined using singlet and negatively labeled cells, and both populations were compared using a series of genes, housekeeping (ACTB, GAPDH, PGK1), cell health related to autophagy and apoptosis (CASP3, CASP9, MAPK8, TP53), cell cycle cyclins (CCND1, CCNE1, CCNB1, CCNA2), mitochondria (MT-ATP8, MT-ND1, MT-CYB, MT-CO1), and human liver organoids (ALB, RBP4, CDH1, ASGR1).Labeling was found not to change transcriptome expression among these populations (Figure 3E, Table 1).

Table 1

[0084] Example 4. POLY-seq barcodes identify multiple population lineages within HLOs Since multicellularity has been demonstrated in the HLO culture system, the possibility of heterologous barcodes was further demonstrated through the identification of HLO lineages. Hepatocytes identified by hepatocyte nuclear factor 4 alpha (HNF4α), asialoglycoprotein receptor 1 (ASGR1), CCAAT enhancer-binding protein alpha (CEBPA), and retinol-binding protein 4 (RBP4); stellate cells identified by collagen type 1, alpha 2 (COL1A2), secreted protein acidic and cysteine-rich (SPARC), and transgelin (TAGLN); and cholangiocytes identified by keratin 7 (KRT7), epithelial glycoprotein-1 (TACSTD2), and secreted phosphoprotein 1 (SPP1) had a significant degree of representation among the barcoded populations (Figure 4A). Examination of barcode representation found that they were uniformly expressed within these populations (Figure 4B). Finally, regarding the ability of POLY-seq to successfully barcode cells through a wide range of expressed unique genes, single-labeled cells were split into high and low UMI fractions at a cutoff of 1350 as in previous analyses (Figure 4C). Seurat clustering clearly identified populations between both fractions. The high and low UMI fractions were highly represented by the POLY-seq barcodes, with populations identified as single-labeled cells at an average of 83 ± 4.7% and 88 ± 4.6%, respectively, reflecting previous barcoding performance using lipid-based methods.

[0085] Example 5. Observation of the POLY-seq technique As disclosed herein, a cationic polymer was prepared as a vector capable of binding to nucleic acids for delivery. The polymer was synthesized by Michael addition using commercially available acrylate-terminated monomers and alkanolamines. Vectors POLY2 and POLY3 showed a significant decrease (p<0.001) in CTG luminescence starting at a concentration of 50 μg / mL over a 24-hour period, while neither POLY1 nor POLY4 showed any perceivable perturbation to viability over the concentrations tested (Figure 1D, E), functioning as a reference point to understand potential toxicity from long-term labeling. For successful delivery of nucleic acids into cells, the vector needs to possess at least two properties, the ability to retain the bound DNA / RNA and the ability to bind, and must remain bound to the cells for a significant period of time. Gel electrophoresis was used to investigate the ability of the POLY-seq vectors to rapidly bind to nucleic acids such as CITE-seq hashing ssDNA barcodes and the ability to retain it. Vectors capped with monomers having branched acrylate monomers (V5) and containing high densities of primary and secondary amines (C2, C3) most readily bound to and retained the ssDNA barcode under physiological pH. The onset of complete binding for vectors POLY2 and POLY3 was observed at w / w = 10 and 5, respectively, as indicated by the reversal of DNA migration. Conversely, vectors made only of the diacrylate monomer D8 and alkanolamine S3 (POLY5 - POLY8) showed a dramatic decrease in binding activity (Figure 1F). Thus, successful ssDNA binding is a combination of the branched architecture and the cap type. Vectors made with branched acrylates (POLY1 - POLY4) showed a greater tendency to bind to ssDNA and were therefore selected for further investigation regarding cell targeting.

[0086] Quantification of cell targeting was achieved by tracking fluorescently labeled vectors in the foregut / hindgut boundary fusion system of the model using flow cytometry. The ratio of cell labeling between vectors POLY1 - POLY3 showed no significant difference in the first 7 days, suggesting the fidelity of binding. Vector POLY3 provided the highest total labeling but showed a significant degree of double labeling juxtaposed with the other three vectors at all time points. Interestingly, vector POLY4 showed the ability to bind to cells although it could not retain the ssDNA barcode when electrophoresed. Based on ssDNA binding efficiency and cell targeting performance, POLY2 was considered the main candidate for single cell barcoding applications in human liver organoid (HLO) cultures. FACS analysis revealed that almost all cells from the HLO samples were tagged with POLY2 and there was no appreciable double labeling detectable 24 hours after mixing individually tagged cultures. Confocal analysis of fluorescence-conjugated POLY-seq revealed formulation-dependent co-localization within lysosomes 3 hours after incubation with the culture system. Since lysosome sequestration is generally associated with the maturation or fusion of late endosomes from early endosomes transported from clathrin-dependent, dynamin-dependent endocytosis or micropinocytosis, it suggests that cell association of vectors POLY2 and POLY3 occurs readily prior to this point. The mechanism of internalization is molecularly unknown, but this selective association provides an opportunity for investigation into time-dependent endosome / lysosome organelle trafficking.

[0087] Apart from having the ability to conjugate barcodes and tag cells, the functional delivery of ssDNA barcodes by some systems ultimately depends on uniquely readable sequences that are correctly captured and amplified by single-cell preparation techniques for the system to be considered useful. The polymeric vectors described herein have qualities efficient for barcode conjugation, cell labeling, and retention, and delivered readable barcodes that could be identified during scRNA-seq after in situ labeling for 1 hour in a very uniform manner. When juxtaposing barcode-free cells (negative) with singly labeled cells (singlets), no differences were seen in the distribution of unique genes per cell (UMI) or total RNA, and in general transcriptome expression. This suggests that the POLY-seq barcode does not interfere with the preparation and analysis of single-cell libraries and does not perturb cell physiology at the transcriptional level. Furthermore, POLY-seq uniformly labeled heterogeneous populations and quantified both the labeling rate and barcode representation. The cost estimate for synthesizing vector POLY2 is 3 adenines / mg. 10 μg was used per HLO sample. The ability to rapidly conjugate and deliver ssDNA barcodes to cells without the need for specific intracellular vesicle isolation, fluorescent labeling, and covalent conjugates provides the POLY-seq system with the opportunity to inexpensively generate custom barcoded pools for multiplexing applications, saving considerable time and sequencing costs.

[0088] Example 6. Materials and Methods Synthetic Materials: The following materials were purchased from Sigma-Aldrich and used without further purification: poly(ethylene glycol) diacrylate, M n = 250; ≥92%, di(trimethylolpropane) tetraacrylate; 3-amino-1-propanol, ≥99%, 1,4-bis(3-aminopropyl)piperazine, ≥99%; spermine, ≥99%; polyethyleneimine, M n=600; 2,2-Dimethyl-1,3-propanediamine, ≥99%; DMSO, ≥99%; DMSO-d containing 0.03% (v / v) TMS 6 99.9 atom % D.

[0089] Polymer synthesis: The POLY-seq vector was synthesized in a two-step process using the reagents described herein via Michael addition. The acrylate-terminated monomer, alkanolamine monomer, and capping agent were first dissolved in anhydrous DMSO at 200 mg / mL. The reagents were uniformly mixed at defined ratios in a 12 × 75 mm glass culture tube and reacted at 90 °C for 20 h to form the acrylate-terminated product (POLY-ac). The temperature was kept constant using a silicone oil bath. The amine conjugation of the terminal acrylate groups was achieved in the second step by the addition of the capping agent. The terminal acrylate conjugate was continued at 50 °C for 24 h to produce the final POLY-seq polymer vector (Table 2). An aliquot of the final product was maintained at -20 °C for long-term storage. Dissolution of the polymer for application testing was achieved by direct dilution of the concentrated DMSO stock to final concentrations of 1 and 10 mg / mL in 25 mM HEPES buffer (pH 7.4). All DyLight reagents were dissolved in DMSO to a final concentration of 10 mg / mL. DyLight conjugation was achieved through mixing the NHS-activated DyLight fluorophore with the 10 mg / mL POLY-seq vector under vortexing to a final concentration of 40 μg DyLight per mg of polymer.

[0090] List of acrylate, amine monomer, and capping molecules: Acrylate monomer: Poly(ethylene glycol) diacrylate, M n = 250 (“D8”); Di(trimethylolpropane) tetraacrylate (“V5”).

[0091] Alkanolamine: 3-Amino-1-propanol (“S3”) Capping molecules: 1,4-bis(3-aminopropyl)piperazine ("C1"), spermine ("C2"), polyethyleneimine, M n =600 ("C3"), 2,2-dimethyl-1,3-propanediamine ("C4").

Table 2

[0092] NMR: NMR was performed on a Bruker Ascend 600 MHz spectrometer. A 5 mg aliquot of the acrylate-terminated or capped vector was dissolved directly in deuterated DMSO-d6 for sample acquisition. Free induction decay files were processed with Mnova.

[0093] Cell culture / cytotoxicity: Human embryonic stem cell clone H1 was provided by the WiCell Institute. iPSC clone 1383D6 was donated by Kyoto University. iPSC clone 72.3 was provided by the CCHMC Pluripotent Stem Cell Facility. Stem cells were maintained according to protocols known in the art with minor modifications or as described herein. All stem cells were maintained in 5% CO 2 2 at 37 °C using mTeSR (Stem Cell Technologies) under feeder-free conditions. Cells were passaged when they reached a 70% confluence density by Accutase (Thermo Fisher) dissociation and seeded overnight in 6-well Falcon (Corning) plates supplemented with 10 μg / mL of Y-27632 (ROCK inhibitor) and 5 μg / mL of laminin-511. The mTeSR medium supplemented with Y-27632 / laminin-511 was replaced with mTeSR after overnight attachment and exchanged with fresh mTeSR medium daily.

[0094] Toxicity screening was performed in white 96-well plates (Corning). Single cell suspensions from passage plates were isolated using Accutase. Cells were plated in individual wells in mTeSR supplemented with Y-27632 and laminin-511 at an initial density of 20,000 cells / well and maintained in mTeSR until reaching a confluence density of 80 - 90%. The POLY-seq polymer was diluted in mTeSR and applied to the cells for 24 hours. Cell viability was determined by an ATP-based CellTiter-Glo (CTG) 3D viability assay (Promega).

[0095] Flow cytometry Foregut and hindgut cultures were grown according to methods known in the art or as described herein. Following establishment of the lines, the cultures were then tagged overnight at a concentration of 20 μg / mL with a DyLight-conjugated POLY-seq vector, and the foregut and hindgut cultures received different DyLight colors (488 nm for the foregut and 650 nm for the hindgut), respectively. After tagging, the cells were washed twice with DMEM / F-12 (Thermo Fisher) to remove unbound POLY-seq vector. Single cell suspensions were isolated and seeded into ultra-low attachment U-bottom 96-well plates at a volume of 20,000 cells per well in mTeSR supplemented with Y-27632 and laminin-511. The plates were centrifuged briefly at 160 × g for 2 minutes to pellet the cells. Spheroids were allowed to form overnight. After formation, a single spheroid tagged with POLY-seq-DyLight 488 was plated with a single spheroid tagged with POLY-seq-DyLight 650 and allowed to fuse overnight. The fused spheroids were maintained as described above. On days 1, 4, 7, and 14 post-fusion, the spheroids were digested at 37°C with gentle pipetting using a mixture of 0.9× Accutase + 1.0× TrypLE Express. The extent of total and dual labeling was quantified using flow cytometry.

[0096] HLO culture Human liver organoids (HLOs) were generated according to methods known in the art with minor modifications or as described herein. To establish the endoderm, iPSCs were seeded onto a 6-well plate (Corning) of mTeSR supplemented with Y-27632 and laminin-511. The next day, the medium was changed to mTeSR only. On day 2, the medium was switched to RPMI-1640 (Life Technologies) containing 100 ng / mL of activin A (R&D Systems) and 50 ng / mL of bone morphogenetic protein 4 (BMP4; R&D Systems). This constitutes day 1 (D1) of differentiation. On day 2 (D2), the medium was switched to RPMI-1640 + 100 ng / mL of activin A + 0.2% knockout serum replacement (KOSR; Thermo Fisher). On day 3 (D3), the medium was switched to RPMI-1640 + 100 ng / mL of activin A + 2.0% KOSR. Between days 4 - 6 (D4 - 6), the medium was switched to Advanced DMEM / F12 + B27 (Life Technologies) + N2 (Gibco) + 500 ng / mL of fibroblast growth factor 4 (FGF-4; R&D Systems) and 3 μM of CHIR99021 (R&D Systems) and exchanged daily. On D7, a single cell suspension was isolated using Accutase. The cells were washed and resuspended in growth factor Matrigel with 50,000 cells / 50 μL of Matrigel. 50 μL droplets were seeded onto a 6-well plate (VWR). From D7 - 10, the medium was switched to enriched medium (EP): Advanced DMEM / F12 (Gibco) + 2% B-27 (Gibco) + 1% N2 (Gibco) + 1% HEPES (1 M, Gibco) + 1% Pen / Strep (Thermo Fisher) + 1% L-glutamine (Thermo Fisher) + 3 μM of CHIR99021 (R&D Systems) + 5 ng / mL of FGF2 (R&D Systems) + 10 ng / mL of VEGF (Life Technologies) + 20 ng / mL of EGF (R&D Systems) + 0.5 μM of A83-01 (Tocris) + 50 μg / mL of ascorbic acid (Sigma) and exchanged on D7 and D9.In D11 - 14, the medium was switched to Advanced DMEM / F12 + 2% B - 27 + 1% N2 + 1% HEPES (1M) + 1% Pen / Strep + 1% L - glutamine + 2μM retinoic acid (Sigma) and changed on D11 and D13. The medium was switched to hepatocyte culture medium (HCM; Lonza) + 10 ng / mL hepatocyte growth factor (HGF; Peprotech) + Oncostatin M and changed every other day. HLOs were used between D21 - D24. HLOs were individually tagged with the POLY - seq vector conjugated with either DyLight 488, 550, or 650 overnight in HCM, washed twice, and mixed for 24 hours before flow analysis. The mixed cultures were gently pipetted and digested at 37°C using a mixture of 0.9×Accutase + 1.0×TrypLE Express. The extent of total and dual labeling was quantified using flow cytometry.

[0097] Immunofluorescence: HLOs were incubated with the DyLight - conjugated POLY - seq vector diluted in HCM for 1 - 24 hours before live imaging. F - actin staining was achieved using SiR - actin (Cytoskeleton, Inc.) at a concentration of 250 nM for 3 hours or 500 nM for 1 hour. Mitochondria were stained using tetramethylrhodamine, methyl ester (TMRM; Thermo Fisher) at a concentration of 1 μM for at least 1 hour. Lysosomes were stained with LysoTracker Blue DND - 22 (Thermo Fisher) at a concentration of 1 μM for at least 1 hour.

[0098] Cell tagging for 10× genomics sequencing: POLY2 was mixed with 10x - compatible DNA - barcoded oligomers based on the CITE - seq cell - hashing oligomer structure (Table 3) synthesized by Integrated DNA Technologies at a mass ratio of 10 μg of vector / 1 μg of oligomer. First, 10 μg of POLY2 was diluted in 50 μL of HCM, and 1 μg of barcoded oligomer was diluted in a separate 50 - μL aliquot. The barcoding oligomer was quickly mixed by pipetting into POLY2 immediately after dilution and left to stand for 10 minutes to form a POLY - seq vector that could be used immediately. Then, the vector was diluted into HLO aliquots to a final concentration of 10 μg of vector / 500 μL HCM. The HLO was tagged at 37 °C for 1 hour. The HLO was washed twice to remove the barcoding vector from the supernatant and passaged into single cells with a mixture of Accutase / TrypLE Express (Gibco). Debris was removed from the single - cell suspension with a 40 - μM filter, adjusted to a final concentration of 1000 cells / μL with HCM, loaded onto a Chromium chip, and processed on 10x Genomics according to the Chromium Single Cell 3’ Reagent Kits v3. The barcode was amplified using a 3’ phosphorothioate - stabilized additive primer with the sequence: 5’ - GTGACTGGAGTTCAGACGTGTGC*T*C - 3’ (SEQ ID NO: 1). After cDNA amplification, the barcode sequence was separated from the cDNA derived from full - length mRNA according to the CITE - seq protocol and PCR - amplified using standard P5 / P7 adapters containing the i7 index. The prepared scRNA - seq library was run on a NovaSeq 6000 system. The separated barcode library was run individually on a NextSeq 550 system. Cellranger was used to align the scRNA - seq reads to the hg19 human genome and incorporate the barcode reads. Uniform Manifold Approximation and Projection (UMAP) creation, clustering, and barcode representation were performed with Loupe provided by 10x Genomics.The identification of singlets / doublets was performed using Seurat v3.1, which prefilters cells, excluding cells with transcriptomes composed of >25% mitochondrial counts, and including cells with 100 - 10,000 individually identified genes. Differential expression of the transcriptome was calculated in Seurat using DESeq2 (Bioconductor v3.11), log. 2 (1.1) Fold change prefilter and 1000 cells per subsample were used for the calculation.

Table 3

[0099] In at least some of the foregoing embodiments, one or more elements used in an embodiment can be used interchangeably in another embodiment, except where such replacement is not technically feasible. Those skilled in the art will understand that various other omissions, additions, and modifications can be made to the methods and structures described herein without departing from the scope of the claimed subject matter. All such modifications and changes are intended to be included within the scope of the subject matter as defined by the appended claims.

[0100] Regarding the use of substantially all plural and / or singular terms herein, those skilled in the art can rephrase from plural to singular and / or from singular to plural as appropriate for the context and / or application. For clarity, various singular / plural replacements can be explicitly described herein.

[0101] In general, those skilled in the art will understand that the terms used in this specification and in particular in the appended claims (e.g., the body of the appended claims) are generally intended to be "open" terms (e.g., the term "including" should be construed as "including but not limited to", the term "having" should be construed as "having at least", the term "include" should be construed as "including but not limited to", etc.). Where a specific number of detailed descriptions of the claims being introduced is intended, those skilled in the art will further understand that such intention is explicitly detailed in the claim, and where no such detailed description exists, no such intention exists. For example, for the purpose of assisting understanding, the following appended claims may include the use of introductory phrases "at least one" and "one or more" to introduce the detailed description of the claims. However, the use of such phrases should not be construed to mean that the introduction of the detailed description of the claim by the indefinite article "a" or "an", even if the same claim includes the introductory phrases "one or more" or "at least one" and the indefinite article "a" or "an", limits any particular claim including the detailed description so introduced to an embodiment including only one such detailed description (e.g., "a" and / or "an" should be construed to mean "at least one" or "one or more"), and the same applies to the use of the definite article used to introduce the detailed description of the claim. In addition, where a specific number of detailed descriptions of the claims being introduced is explicitly detailed, such detailed description should be construed to mean at least the number detailed (e.g., the mere detailed description of "two detailed descriptions" without other modifying phrases means at least two detailed descriptions or two or more detailed descriptions), which those skilled in the art will recognize.Furthermore, when conventions similar to “at least one of A, B, and C, etc.” are used, typically, such syntax is intended to have the meaning that one of ordinary skill in the art would understand this convention (e.g., “a system having at least one of A, B, and C” would include, but not be limited to, a system having only A, only B, only C, A and B together, A and C together, B and C together, and / or A, B, and C together, etc.). When conventions similar to “at least one of A, B, or C, etc.” are used, typically, such syntax is intended to have the meaning that one of ordinary skill in the art would understand this convention (e.g., “a system having at least one of A, B, or C” would include, but not be limited to, a system having only A, only B, only C, A and B together, A and C together, B and C together, and / or A, B, and C together, etc.). One of ordinary skill in the art will further understand that in any of the specification, claims, or drawings, substantially any disjunctive and / or disjunctive phrase presenting two or more alternative terms is intended to cover the possibility of including one of the terms, any of the terms, or both terms. For example, the phrase “A or B” would be understood to include the possibilities of “A” or “B” or “A and B”.

[0102] In addition, when features or aspects of the present disclosure are described by a Markush group, one of ordinary skill in the art will recognize that the present disclosure is thereby also described by any individual member or subgroup of members of the Markush group.

[0103] As would be understood by one of ordinary skill in the art, for all purposes, including in terms of written description, all ranges disclosed herein encompass all possible subranges and combinations of these subranges. Any range listed can be readily recognized as fully descriptive and allowing for the same range to be broken down into at least 2, 3, 4, 5, 10, etc. As a non-limiting example, each range discussed herein can be readily broken down into a lower third, a middle third, and an upper third, etc. As would be understood by one of ordinary skill in the art, all words such as "up to," "at least," "greater than," "less than," etc. refer to ranges that include the recited numbers and that can subsequently be broken down into subranges as discussed above. Finally, as would be understood by one of ordinary skill in the art, a range includes each individual member. Thus, for example, a group having 1-3 items refers to a group having 1, 2, or 3 items. Similarly, a group having 1-5 items refers to a group having 1, 2, 3, 4, or 5, etc. items, and so forth.

[0104] While various aspects and embodiments are disclosed herein, other aspects and embodiments will be apparent to those of ordinary skill in the art. The various aspects and embodiments disclosed herein are for purposes of illustration and are not intended to be limiting, with the true scope and spirit being indicated by the following claims.

[0105] All references cited herein, including, but not limited to, published and unpublished applications, patents, and literature references, are incorporated herein by reference in their entirety and made a part of this specification. To the extent that the publications and patents or patent applications incorporated by reference conflict with the disclosure contained in the specification, the specification supersedes and / or is intended to take precedence over such conflicting material.

[0106] References Shapiro, E., Biezuner, T. & Linnarsson, S. 2013, "Single-cell sequencing-based technologies will revolutionize whole-organism science", Nature Reviews Genetics, vol. 14, no. 9, pp. 618-630. Picelli, S., Bjorklund, ÅK., Faridani, O.R., Sagasser, S., Winberg, G. & Sandberg, R. 2013, "Smart-seq2 for sensitive full-length transcriptome profiling in single cells", Nature methods, vol. 10, no. 11, pp. 1096-1098. Navin, N., Kendall, J., Troge, J., Andrews, P., Rodgers, L., McIndoo, J., Cook, K., Stepansky, A., Levy, D. & Esposito, D. 2011, "Tumour evolution inferred by single-cell sequencing", Nature, vol. 472, no. 7341, pp. 90. Buettner, F., Natarajan, K.N., Casale, F.P., Proserpio, V., Scialdone, A., Theis, F.J., Teichmann, S.A., Marioni, J.C. & Stegle, O. 2015, "Computational analysis of cell-to-cell heterogeneity in single-cell RNA-sequencing data reveals hidden subpopulations of cells", Nature biotechnology, vol. 33, no. 2, pp. 155. Zheng, G.X., Terry, J.M., Belgrader, P., Ryvkin, P., Bent, Z.W., Wilson, R., Ziraldo, S.B., Wheeler, T.D., McDermott, G.P. & Zhu, J. 2017, "Massively parallel digital transcriptional profiling of single cells", Nature communications, vol. 8, no.1, pp.1-12. Stoeckius, M., Hafemeister, C., Stephenson, W., Houck-Loomis, B., Chattopadhyay, P.K., Swerdlow, H., Satija, R. & Smibert, P. 2017, "Simultaneous epitope and transcriptome measurement in single cells", Nature methods, vol. 14, no.9, pp.865. Stoeckius, M., Zheng, S., Houck-Loomis, B., Hao, S., Yeung, B.Z., Mauck, W.M., Smibert, P. & Satija, R. 2018, "Cell Hashing with barcoded antibodies enables multiplexing and doublet detection for single cell genomics", Genome biology, vol. 19, no.1, pp.1-12. Weber, R.J., Liang, S.I., Selden, N.S., Desai, T.A. & Gartner, Z.J. 2014, "Efficient targeting of fatty-acid modified oligonucleotides to live cell membranes through stepwise assembly", Biomacromolecules, vol. 15, no.12, pp.4621-4626. McGinnis, C.S., Patterson, D.M., Winkler, J., Conrad, D.N., Hein, M.Y., Srivastava, V., Hu, J.L., Murrow, L.M., Weissman, J.S. & Werb, Z.2019, "MULTI-seq: sample multiplexing for single-cell RNA sequencing using lipid-tagged indices", Nature methods, vol. 16, no.7, pp.619. Kang, H.M., Subramaniam, M., Targ, S., Nguyen, M., Maliskova, L., McCarthy, E., Wan, E., Wong, S., Byrnes, L.& Lanata, C.M. 2018, "Multiplexed droplet single-cell RNA-sequencing using natural genetic variation", Nature biotechnology, vol. 36, no.1, pp.89. Guo, C., Kong, W., Kamimoto, K., Rivera-Gonzalez, G.C., Yang, X., Kirita, Y.& Morris, S.A. 2019, "CellTag Indexing: genetic barcode-based sample multiplexing for single-cell genomics", Genome biology, vol. 20, no.1, pp.90. Kebschull, J.M., da Silva, P.G., Reid, A.P., Peikon, I.D., Albeanu, D.F. & Zador, A.M. 2016, "High-throughput mapping of single-neuron projections by sequencing of barcoded RNA", Neuron, vol. 91, no.5, pp.975-987. Kebschull, J.M. & Zador, A.M. 2018, "Cellular barcoding: lineage tracing, screening and beyond", Nature methods, vol. 15, no.11, pp.871-879. Kester, L.& van Oudenaarden, A.2018, "Single-cell transcriptomics meets lineage tracing", Cell Stem Cell, vol. 23, no.2, pp.166-179. Yin, H., Kanasty, R.L., Eltoukhy, A.A., Vegas, A.J., Dorkin, J.R. & Anderson, D.G. 2014, "Non-viral vectors for gene-based therapy", Nature Reviews Genetics, vol. 15, no.8, pp.541-555. Gao, Y., Huang, J., O’Keeffe Ahern, J., Cutlar, L., Zhou, D., Lin, F. & Wang, W. 2016, "Highly Branched Poly (β-amino esters) for Non-Viral Gene Delivery: High Transfection Efficiency and Low Toxicity Achieved by Increasing Molecular Weight", Biomacromolecules, vol. 17, no.11, pp.3640-3647. Kim, H.J., Kim, A., Miyata, K. & Kataoka, K. 2016, "Recent progress in development of siRNA delivery vehicles for cancer therapy", Advanced Drug Delivery Reviews, vol. 104, pp.61-77. Wang, H., Jiang, Y., Peng, H., Chen, Y., Zhu, P. & Huang, Y. 2015, "Recent progress in microRNA delivery for cancer therapy by non-viral synthetic vectors", Advanced Drug Delivery Reviews, vol. 81, pp.142-160. Dunn, A.W., Kalinichenko, V.V. & Shi, D. "Highly Efficient In Vivo Targeting of the Pulmonary Endothelium Using Novel Modifications of Polyethylenimine: An Importance of Charge", Advanced healthcare materials, pp.1800876. Dahlman, J.E., Kauffman, K.J., Xing, Y., Shaw, T.E., Mir, F.F., Dlott, C.C., Langer, R., Anderson, D.G. & Wang, E.T. 2017, "Barcoded nanoparticles for high throughput in vivo discovery of targeted therapeutics", Proceedings of the National Academy of Sciences, vol. 114, no.8, pp.2060-2065. Paunovska, K., Gil, C.J., Lokugamage, M.P., Sago, C.D., Sato, M., Lando, G.N., Gamboa Castro, M., Bryksin, A.V. & Dahlman, J.E. 2018, "Analyzing 2000 in vivo drug delivery data points reveals cholesterol structure impacts nanoparticle delivery", ACS nano, vol. 12, no.8, pp.8341-8349. Marino, G., Niso-Santano, M., Baehrecke, E.H. & Kroemer, G.2014, "Self-consumption: the interplay of autophagy and apoptosis", Nature reviews Molecular cell biology, vol. 15, no.2, pp.81-94. Kale, J., Osterlund, E.J. & Andrews, D.W. 2018, "BCL-2 family proteins: changing partners in the dance towards death", Cell Death & Differentiation, vol. 25, no.1, pp.65-80. Koike, H., Iwasawa, K., Ouchi, R., Maezawa, M., Giesbrecht, K., Saiki, N., Ferguson, A., Kimura, M., Thompson, W.L. & Wells, J.M. 2019, "Modelling human hepato-biliary-pancreatic organogenesis from the foregut-midgut boundary", Nature, vol. 574, no.7776, pp.112-116. Ouchi, R., Togo, S., Kimura, M., Shinozawa, T., Koido, M., Koike, H., Thompson, W., Karns, R.A., Mayhew, C.N. & McGrath, P.S. 2019, "Modeling steatohepatitis in humans with pluripotent stem cell-derived organoids", Cell metabolism, vol. 30, no.2, pp.374-384. e6. MacParland, S.A., Liu, J.C., Ma, X., Innes, B.T., Bartczak, A.M., Gage, B.K., Manuel, J., Khuu, N., Echeverri, J.& Linares, I.2018, "Single cell RNA sequencing of human liver reveals distinct intrahepatic macrophage populations", Nature communications, vol. 9, no.1, pp.1-21. Luzio, J.P., Pryor, P.R. & Bright, N.A. 2007, "Lysosomes: fusion and function", Nature reviews Molecular cell biology, vol. 8, no.8, pp.622-632. Mayor, S.& Pagano, R.E. 2007, "Pathways of clathrin-independent endocytosis", Nature reviews Molecular cell biology, vol. 8, no.8, pp.603. McMahon, H.T. & Boucrot, E.2011, "Molecular mechanism and physiological functions of clathrin-mediated endocytosis", Nature reviews Molecular cell biology, vol. 12, no.8, pp.517.

Claims

**Claim 1** A method for synthesizing a capped cationic polymer, comprising: (a) contacting a poly(ethylene glycol) diacrylate monomer and 3-amino-1-propanol to form a cationic polymer comprising poly(ethylene glycol) diacrylate / 3-amino-1-propanol by Michael addition, wherein the molar ratio of the poly(ethylene glycol) diacrylate monomer to 3-amino-1-propanol is greater than 1, and the cationic polymer has acrylate termini; (b) contacting the terminal acrylate groups of the cationic polymer with a capping molecule to form the capped cationic polymer by Michael addition, wherein each capping molecule contains an amine group capable of reacting with an acrylate group by Michael addition, and the capped cationic polymer does not contain any acrylate groups. A method comprising the above steps. **Claim 2** The method according to claim 1, wherein the poly(ethylene glycol) diacrylate monomer and 3-amino-1-propanol in step (a) are further contacted with di(trimethylolpropane) tetraacrylate, and the contact with the di(trimethylolpropane) tetraacrylate results in the formation of a cationic polymer comprising branched poly(ethylene glycol) diacrylate / di(trimethylolpropane) tetraacrylate / 3-amino-1-propanol having three or more terminal acrylate groups. **Claim 3** The method according to claim 1 or 2, wherein the capping molecule comprises one or more of 1,4-bis(3-aminopropyl)piperazine, spermine, polyethyleneimine, or 2,2-dimethyl-1,3-propanediamine, or any combination thereof. **Claim 4** The method according to any one of claims 1 to 3, wherein the molar ratio of the poly(ethylene glycol) diacrylate monomer to 3-amino-1-propanol is from 1.01:1 to 1.1:

1. **Claim 5** The method according to any one of claims 1 to 4, wherein the mass ratio of the cationic polymer to the capping molecule is from 100:100 to 100:

500. **Claim 6** The capped cationic polymer is Poly(ethylene glycol) diacrylate, di(trimethylolpropane) tetraacrylate, 3-amino-1-propanol, 1,4-bis(3-aminopropyl)piperazine, wherein the molar ratio of poly(ethylene glycol) diacrylate:di(trimethylolpropane) tetraacrylate:3-amino-1-propanol is 1.05:0.7:1, and the mass ratio of poly(ethylene glycol) diacrylate, di(trimethylolpropane) tetraacrylate to 1,4-bis(3-aminopropyl)piperazine is about 100:75, poly(ethylene glycol) diacrylate, di(trimethylolpropane) tetraacrylate, 3-amino-1-propanol, 1,4-bis(3-aminopropyl)piperazine, Poly(ethylene glycol) diacrylate, di(trimethylolpropane) tetraacrylate, 3-amino-1-propanol, spermine, wherein the molar ratio of poly(ethylene glycol) diacrylate:di(trimethylolpropane) tetraacrylate:3-amino-1-propanol is 1.05:0.7:1, and the mass ratio of poly(ethylene glycol) diacrylate, di(trimethylolpropane) tetraacrylate to spermine is about 100:75, poly(ethylene glycol) diacrylate, di(trimethylolpropane) tetraacrylate, 3-amino-1-propanol, spermine, Poly(ethylene glycol) diacrylate, di(trimethylolpropane) tetraacrylate, 3-amino-1-propanol, polyethyleneimine, wherein the molar ratio of poly(ethylene glycol) diacrylate:di(trimethylolpropane) tetraacrylate:3-amino-1-propanol is 1.05:0.7:1, and the mass ratio of poly(ethylene glycol) diacrylate, di(trimethylolpropane) tetraacrylate to polyethyleneimine is about 150:250, poly(ethylene glycol) diacrylate, di(trimethylolpropane) tetraacrylate, 3-amino-1-propanol, polyethyleneimine, Poly(ethylene glycol) diacrylate, di(trimethylolpropane) tetraacrylate, 3-amino-1-propanol, 2,2-dimethyl-1,3-propanediamine, wherein the molar ratio of poly(ethylene glycol) diacrylate:di(trimethylolpropane) tetraacrylate:3-amino-1-propanol is 1.05:0.7:1, and the mass ratio of poly(ethylene glycol) diacrylate, di(trimethylolpropane) tetraacrylate to 2,2-dimethyl-1,3-propanediamine is about 100:50, poly(ethylene glycol) diacrylate, di(trimethylolpropane) tetraacrylate, 3-amino-1-propanol, 2,2-dimethyl-1,3-propanediamine, Poly(ethylene glycol) diacrylate, 3-amino-1-propanol, 1,4-bis(3-aminopropyl)piperazine, wherein the molar ratio of poly(ethylene glycol) diacrylate:3-amino-1-propanol is 1.1:1, and the mass ratio of poly(ethylene glycol) diacrylate to 1,4-bis(3-aminopropyl)piperazine is about 100:10, poly(ethylene glycol) diacrylate, 3-amino-1-propanol, 1,4-bis(3-aminopropyl)piperazine, Poly(ethylene glycol) diacrylate, 3-amino-1-propanol, spermine, wherein the molar ratio of poly(ethylene glycol) diacrylate:3-amino-1-propanol is 1.1:1, and the mass ratio of poly(ethylene glycol) diacrylate to spermine is about 100:10, poly(ethylene glycol) diacrylate, 3-amino-1-propanol, spermine, Poly(ethylene glycol) diacrylate, 3-amino-1-propanol, polyethyleneimine, wherein the molar ratio of poly(ethylene glycol) diacrylate:3-amino-1-propanol is 1.1:1, and the mass ratio of poly(ethylene glycol) diacrylate to polyethyleneimine is about 100:20, poly(ethylene glycol) diacrylate, 3-amino-1-propanol, polyethyleneimine, Poly(ethylene glycol) diacrylate, 3-amino-1-propanol, 2,2-dimethyl-1,3-propanediamine, wherein the molar ratio of poly(ethylene glycol) diacrylate to 3-amino-1-propanol is 1.1:1, and the mass ratio of poly(ethylene glycol) diacrylate to 2,2-dimethyl-1,3-propanediamine is about 100:10, poly(ethylene glycol) diacrylate, 3-amino-1-propanol, 2,2-dimethyl-1,3-propanediamine, or, any combination thereof, The method according to any one of claims 1 to 4.

7. The method according to any one of claims 1 to 6, wherein the capped cationic polymer further comprises a fluorescent dye.

8. A method for labeling cells, comprising: synthesizing the capped cationic polymer according to the method according to any one of claims 1 to 7; and contacting the cells in vitro with a cationic barcode, wherein the cationic barcode comprises the capped cationic polymer and a nucleic acid barcode, and the capped cationic polymer enables the nucleic acid barcode to access the cytoplasm of the cells, the contacting. A method comprising.

9. A method for labeling cells, comprising: synthesizing the capped cationic polymer according to the method according to any one of claims 1 to 7; and contacting a population of cells in vitro with one or more cationic barcodes, each of the cationic barcodes comprising the capped cationic polymer and a nucleic acid barcode of a unique sequence, the contacting; and sequencing the nucleic acid barcodes of the one or more cationic barcodes by single-cell RNA-seq, thereby identifying individual cells as belonging to the population of cells by the sequence of the nucleic acid barcodes of the individual cells. A method comprising.

10. The method according to claim 9, wherein the population of cells is part of a tissue, organoid, or spheroid.

11. The method according to claim 10, wherein the population of cells is part of a liver organoid or a foregut spheroid.

12. The method according to any one of claims 9 to 11, wherein the population of cells comprises two or more subpopulations of cells, each subpopulation of cells is derived from a unique individual, and the population of cells is formed by combining the two or more subpopulations of cells.

13. Contacting the population of cells comprises contacting each of the two or more subpopulations of cells with a unique cationic barcode before the population of cells is formed by combining the two or more subpopulations of cells. The method according to claim 12.