Method for producing nucleic acid oligomer

By using a dichloroacetic acid solution with controlled formaldehyde concentration and incorporating a non-nucleotide linker, the synthesis efficiency of nucleic acid oligomers is enhanced, resulting in improved yield and purity.

JP7698631B2Active Publication Date: 2025-06-25SUMITOMO CHEM CO LTD
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
JP2022510762
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2020-03-27
Filing Date
2021-03-26
Publication Date
2025-06-25
Estimated Expiration
2041-03-26

AI Technical Summary

Technical Problem

Conventional methods for synthesizing nucleic acid oligomers using dichloroacetic acid solutions yield unsatisfactorily low efficiency, necessitating an improvement in the production process.

Method used

The method involves using a dichloroacetic acid solution with a controlled formaldehyde concentration of 90×10^-6 or less, incorporating a non-nucleotide linker, and employing specific deprotection steps to enhance the synthesis efficiency of nucleic acid oligomers.

Benefits of technology

This approach significantly improves the yield of nucleic acid oligomers, achieving higher purity and yield rates compared to conventional methods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007698631000044
    Figure 0007698631000044
  • Figure 0007698631000001
    Figure 0007698631000001
  • Figure 0007698631000002
    Figure 0007698631000002
Patent Text Reader

Abstract

The present invention provides an efficient method for producing a nucleic acid oligomer. Specifically, the present invention provides a method for producing a nucleic acid oligomer represented by formula (2) (in the formula, the symbols are as defined in the description), said method including a step for reacting a nucleic acid oligomer represented by formula (1) (in the formula, the symbols are as defined in the description) with a dichloroacetic acid solution in which the molar ratio of formaldehyde to dichloroacetic acid (moles of formaldehyde / moles of dichloroacetic acid) is 90 × 10-6 or less.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application claims priority and the benefit thereof to Japanese Patent Application No. 2020-058880, filed on March 27, 2020, the entire contents of which are incorporated herein by reference. The present invention relates to a method for producing nucleic acid oligomers.

Background Art

[0002] In recent years, there has been increasing interest in the application of nucleic acid oligomers in the medical field. For example, nucleic acids that induce RNA interference (RNAi) such as antisense nucleic acids, aptamers, ribozymes, and siRNA are mentioned, and these are called nucleic acid pharmaceuticals.

[0003] Nucleic acid oligomers can be synthesized by solid-phase synthesis. The nucleic acid oligomers synthesized by extending the nucleic acid on a solid support are cut out from the solid support. Then, for nucleic acid oligomers containing ribose, the protecting group of the hydroxyl group at the 2'-position of ribose is deprotected and removed to produce the desired nucleic acid oligomers. In the solid-phase synthesis method, phosphoramidite of nucleoside (hereinafter referred to as "amidite") is used as a raw material, and it is known that the protecting group of the hydroxyl group at the 5'-position is deprotected using a dichloroacetic acid solution. However, the yield of nucleic acid oligomers synthesized using the conventional dichloroacetic acid solution is not always satisfactory, and the synthesis is not efficient (Patent Document 1).

Prior Art Documents

Patent Documents

[0004]

Patent Document 1

Summary of the Invention

Problems to be Solved by the Invention

[0005] An object of the present invention is to provide an efficient method for producing nucleic acid oligomers.

Means for Solving the Problem

[0006] As a result of intensive research to achieve the above object, the present inventors provide an efficient method for producing a nucleic acid oligomer, which comprises using a dichloroacetic acid solution having a formaldehyde concentration of a certain level or lower when synthesizing the nucleic acid oligomer, or using the dichloroacetic acid after improving its quality.

[0007] The present invention includes the following aspects, but is not limited thereto. 1. Formula (1):

Chemical formula

Chemical formula

Chemical formula

Chemical formula

Chemical formula

Chemical formula

Chemical formula

Chemical formula

Chemical formula

Effect of the Invention

[0008] The present invention provides an efficient method for producing a nucleic acid oligomer. By the production method of the present invention, an improvement in the yield of the produced nucleic acid oligomer can be expected.

Brief Description of the Drawings

[0009]

Figure 1

Embodiments for Carrying Out the Invention

[0010] A method for obtaining a nucleic acid oligomer represented by formula (2) by reacting a nucleic acid oligomer represented by formula (1) with a dichloroacetic acid solution having a formaldehyde concentration of a certain level or lower will be described.

[0011] The molar ratio of formaldehyde to dichloroacetic acid (formaldehyde mol / dichloroacetic acid mol) in the dichloroacetic acid solution of the present invention is usually 90×10 -6 or less, preferably 43×10 -6 or less, more preferably 22×10 -6 or less. Methods for measuring the formaldehyde concentration in the dichloroacetic acid solution include gas chromatography or high-performance liquid chromatography. In gas chromatography, formaldehyde is directly analyzed to calculate the concentration. In high-performance liquid chromatography, formaldehyde is reacted with acetylacetone, the amount of the obtained 3,5-diacetyl-1,4-dihydrolutidine is measured, and the concentration of formaldehyde is calculated.

[0012] The concentration of dichloroacetic acid in the dichloroacetic acid solution is usually 0.1 to 2.4 M, preferably 0.1 to 1.2 M, more preferably 0.1 to 0.6 M, and still more preferably 0.2 to 0.4 M.

[0013] As the diluting solvent for dichloroacetic acid, it is not particularly limited as long as it does not participate in the reaction, and examples thereof include dichloromethane, acetonitrile, aromatic organic solvents, water, or any mixed solvent. Preferably, at least one solvent selected from the group consisting of dichloromethane, acetonitrile, and aromatic organic solvents can be mentioned, and more preferably, an aromatic organic solvent can be mentioned. As the aromatic organic solvent, toluene can be mentioned.

[0014] The reaction temperature in the above reaction is preferably 0 to 40°C, and more preferably 10 to 30°C.

[0015] Formaldehyde in the dichloroacetic acid solution can be removed by azeotropy with any solvent or any mixed solvent. The azeotropic solvent is not particularly limited as long as it has a lower boiling point than dichloroacetic acid, and examples thereof include dichloromethane, acetonitrile, aromatic organic solvents, or any mixed solvent. Preferably, dichloromethane, acetonitrile, or an aromatic organic solvent can be mentioned, and more preferably, an aromatic organic solvent can be mentioned. As the aromatic organic solvent, toluene can be mentioned.

[0016] The boiling point of the azeotropic solvent is preferably 200°C or lower, and more preferably 194°C or lower.

[0017] For storing the dichloroacetic acid solution, glass containers, plastic containers, or metal containers can be used. As the plastic container, containers made of polyethylene, polypropylene, etc. can be used, and as the metal container, containers made of SUS, Hastelloy, etc. can be used. The oxidation solution can be stored in an air atmosphere or an inert gas atmosphere. As the inert gas, argon, nitrogen, carbon dioxide, helium, etc. can be used.

[0018] Examples of the nucleic acid compound having a protecting group at the 5'-hydroxyl group include the nucleic acid compound of the formula (1). Examples of the nucleic acid compound produced by reacting with a dichloroacetic acid solution include the nucleic acid compound represented by the formula (2). In the above formulas (1) and (2), as the compound represented by Q', which is independently the same or different and represents a methylene group bonded to the 4'-carbon atom of ribose, an ethylene group bonded to the 4'-carbon atom of ribose, or an ethylidene group bonded to the 4'-carbon atom of ribose, specifically, the structures represented by LNA-1, LNA-2, or LNA-3 of the following formula (7) can be mentioned.

[0019]

Chemical formula

[0020] As the group having a structure composed of a solid support represented by Z and a linking group connecting the oxygen atom of the hydroxyl group at the 2'- or 3'-position of the ribose at the 3'-end of the solid support and the nucleic acid oligomer, more specifically, the structure represented by the following formula (8) can be mentioned.

Chemical formula

[0021]

Chemical formula

[0022] Linker may have, for example, the structure shown in the following formula (10), or may have a structure that does not have a hexamethylenediamino group portion in the structure of formula (10) and in which an aminopropyl group is bonded to Si. Or, Linker may have the structure shown in the following formula (11).

Chemical formula

[0023] Examples of the nucleosides (ribose and deoxyribose) contained in the nucleic acid oligomer used in the present invention include DNA, RNA, 2'-O-MOE (2'-O-methoxyethyl), 2'-O-Me, 2'-F RNA, and the above-mentioned LNA, but the nucleosides are not limited thereto.)

[0024] The method for synthesizing a nucleic acid oligomer by a solid-phase synthesis method including the deprotection step with the dichloroacetic acid solution typically includes the following steps.) (1) A step of deprotecting the 5'-hydroxyl group of a nucleoside having a protected hydroxyl group bonded to a solid support via a linker.) (2) A step of subjecting the 5'-hydroxyl group generated in the above step to a coupling reaction with a phosphoramidite compound to obtain a triester phosphite compound.) (3) A step of oxidizing the triester phosphite generated in the above step to convert it into a triester phosphate to produce an extended nucleic acid molecule, or an optional step of converting it into a triester thiophosphate.) (4) The above steps (1) to (3), namely, the deprotection step of the hydroxyl group at the 5'-position of the generated nucleic acid molecule, the coupling step of the hydroxyl group at the 5'-position and the amidite compound, and the oxidation step of the generated triester phosphite, are repeated any number of times to synthesize a nucleic acid molecule on a solid support, and (5) The nucleic acid molecule on the solid support generated in step (4) is subjected to a step of cleavage and deprotection to release it from the solid support and produce a nucleic acid oligomer with protecting groups removed. However, in the method for synthesizing the nucleic acid oligomer, a step of capping the hydroxyl group at the 5'-position where the coupling reaction with the phosphoramidite compound did not proceed may be included following step (2) or (3), or a capping step may be added during any step of the series of reaction cycles constituting step (4).

[0025] Step (5) above is more specifically carried out by performing the reactions of the following steps (5-1) and (5-2) in sequence on the nucleic acid molecule on the solid support generated in step (4), and then subjecting it to the reaction of step (5-3). Here, the implementation of the reaction in step (5-1) may be optional, and the implementation of the reaction in step (5-2) may use the method described in Japanese Patent No. 4705716. As a result, a nucleic acid oligomer with protecting groups removed from the nucleic acid molecule released from the solid support, or a nucleic acid oligomer with the hydroxyl group at the 5'-end protected, can be produced. (5-1) A reaction for deprotecting the protecting group of the hydroxyl group at the 5'-end of the nucleic acid molecule (5-2) A reaction for cleaving and releasing the nucleic acid molecule from the solid support, and (5-3) A reaction for deprotecting the protecting group of the hydroxyl group at the 2'-position or the 3'-position at the 3'-end of the ribose constituting the nucleic acid molecule.

[0026] The schemes of the above steps (1) to (5) are shown in FIG. 1. The deprotection reaction in step (1) or step (4) shown in FIG. 1 is carried out using the above dichloroacetic acid solution. The definitions of the substituents in the chemical formula in Scheme A are as defined above.

[0027] The nucleic acid compound of the formula (1) can be further extended by any chain length using a nucleotide-type or non-nucleotide-type linker by the amidite method and used for the production of the nucleic acid compound represented by the formula (3). After excising only the nucleic acid compound from the nucleic acid compound bound to the solid-phase carrier of the formula (3) to obtain the nucleic acid oligomer represented by the formula (4), it can be further deprotected to obtain the nucleic acid oligomer represented by the formula (5). Hereinafter, the substituents in each formula will be described in more detail.

[0028] B a A nucleobase optionally protected with a protecting group represented by and B c The nucleobase represented by is not particularly limited. Examples of the nucleobase include adenine, cytosine, guanine, uracil, thymine, 5-methylcytosine, pseudouracil, and 1-methylpseudouracil. Further, the nucleobase may be substituted with a substituent. Examples of such a substituent include a halogen atom such as a fluoro group, a chloro group, a bromo group, or an iodo group, an acyl group such as an acetyl group, an alkyl group such as a methyl group or an ethyl group, an arylalkyl group such as a benzyl group, an alkoxy group such as a methoxy group, an alkoxyalkyl group such as a methoxyethyl group, a cyanoalkyl group such as a cyanoethyl group, a hydroxy group, a hydroxyalkyl group, an acyloxymethyl group, an amino group, a monoalkylamino group, a dialkylamino group, a carboxy group, a cyano group, and a nitro group, and combinations of two or more of these substituents.

[0029] B aThe protecting group for the nucleobase, which may be protected by the protecting group represented by , is not particularly limited, and protecting groups used in known nucleic acid chemistry can be used. Such protecting groups include, for example, benzoyl group, 4-methoxybenzoyl group, 4-methylbenzoyl group, acetyl group, propionyl group, butyryl group, isobutyryl group, phenylacetyl group, phenoxyacetyl group, 4-tert-butylphenoxyacetyl group, 4-isopropylphenoxyacetyl group, and (dimethylamino)methylene group, etc., and combinations of two or more of these protecting groups.

[0030] B a More specifically,

Chemical formula

[0031] (In the above formula, R 4 represents a hydrogen atom, a methyl group, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group or a benzoyl group, R 5 represents a hydrogen atom, an acetyl group, an isobutyryl group or a benzoyl group, R 6 represents a hydrogen atom, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group or an isobutyryl group, R 7 represents a 2-cyanoethyl group, R 8 represents a hydrogen atom, a methyl group, a benzoyl group, a 4-methoxybenzoyl group or a 4-methylbenzoyl group, and R 9 represents a dimethylaminomethylene group.) represents a group represented by any of .

[0032] B c More specifically, as B aExamples include groups obtained by removing a protecting group from a specific example.

[0033] G 5 is preferably one of the following groups.

Chemical formula

[0034] R 1 , R 2 and R 3 are preferably such that one is a hydrogen atom and the remaining two are the same or different (preferably the same) alkoxy groups, and the alkoxy group is particularly preferably a methoxy group. More preferably, G 5 is a 4,4'-dimethoxytrityl group (DMTr group).

[0035] G 2 can be used without particular limitation as long as it can function as a protecting group for a hydroxyl group, and known protecting groups used in amidite compounds can be widely used. As G 2 , for example, alkyl group, alkenyl group, alkynyl group, cycloalkyl group, haloalkyl group, aryl group, heteroaryl group, arylalkyl group, cycloalkenyl group, cycloalkylalkyl group, cyclilylalkyl group, hydroxyalkyl group, aminoalkyl group, alkoxyalkyl group, heterocyclylalkenyl group, heterocyclylalkyl group, heteroarylalkyl group, silyl group, silyloxyalkyl group, mono-, di- or trialkylsilyl group, mono-, di- or trialkylsilyloxyalkyl group, etc. can be mentioned, and these may be substituted with one or more electron-withdrawing groups.

[0036] G 2is preferably an alkyl group substituted with an electron-withdrawing group. Examples of the electron-withdrawing group include, for example, a cyano group, a nitro group, an alkylsulfonyl group, a halogen atom, an arylsulfonyl group, a trihalomethyl group, and a trialkylamino group, and preferably a cyano group.

[0037] G 2 As [it], particularly preferred are the following groups. [Chemical formula]

[0038] Said R 1 , R 2 , R 3 and G 2 In the definitions of, the alkyl group may be either linear or branched, preferably an alkyl group having 1 to 12 carbon atoms, more preferably an alkyl group having 1 to 6 carbon atoms. Specific examples of the alkyl group include, for example, a methyl group, an ethyl group, an n-propyl group, an isopropyl group, an n-butyl group, an isobutyl group, a tert-butyl group, an n-pentyl group, an isopentyl group, and a hexyl group. The alkyl group portion constituting the alkoxy group in the definition of the substituent has the same definition as the alkyl group here.

[0039] In the method of the present invention, the amidite compound can be used in a free state or in a salt state. Examples of salts of the amidite compound include, but are not limited to, base addition salts or acid addition salts. Specific examples of base addition salts include salts with inorganic bases such as sodium salts, magnesium salts, potassium salts, calcium salts, and aluminum salts; salts with organic bases such as methylamine, ethylamine, and ethanolamine; salts with basic amino acids such as lysine, ornithine, and arginine; and ammonium salts. Specific examples of acid addition salts include mineral acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, nitric acid, and phosphoric acid; organic acids such as formic acid, acetic acid, propionic acid, oxalic acid, malonic acid, malic acid, tartaric acid, fumaric acid, succinic acid, lactic acid, maleic acid, citric acid, methanesulfonic acid, trifluoromethanesulfonic acid, and ethanesulfonic acid; and acid addition salts with acidic amino acids such as aspartic acid and glutamic acid. The amidite compound also includes forms such as salts, hydrates, solvates, and crystal polymorphs.

[0040] R preferably represents a protected hydroxyl group. The protecting group when R represents a protected hydroxyl group, or the protecting group of the hydroxyl group represented by V, may be any that can be used in the amidite method. For example, in addition to the 2'-tert-butyldimethylsilyl (TBS) group, 2'-bis(2-acetoxy)methyl (ACE) group, 2'-(triisopropylsilyloxy)methyl (TOM) group, 2'-(2-cyanoethoxy)ethyl (CEE) group, 2'-(2-cyanoethoxy)methyl (CEM) group, 2'-para-toluenesulfonylethoxymethyl (TEM) group, 2'-EMM group (International Publication No. WO2006 / 022323), those described in International Publication No. WO2013 / 027843 and International Publication No. WO2019 / 208571 can also be used. V is preferably a 2'-tert-butyldimethylsilyl (TBS) group. Further, when the nucleic acid oligomer produced by the method of the present invention is ribonucleic acid (RNA), and thus ribose is contained in the nucleic acid oligomer, the protecting group represented by the above formula (6) is exemplified as a preferred protecting group for the hydroxyl group at the 2'-position of the ribose. More preferably, E WExamples of the protecting group represented by formula (12) having a cyano group as an electron-withdrawing group represented by are shown.

Chemical formula

[0041] The protecting group represented by formula (12) can be synthesized, for example, according to the descriptions in International Publication No. 2013 / 027843 and International Publication No. 2019 / 208571, and an amidite compound having such a protecting group can be used in the production of nucleic acid compounds. For the nucleic acid extension reaction, the amidite compound of formula (13) described in Scheme A of FIG. 1 is used.

[0042] Examples of the non-nucleotide linker include a linker composed of an amino acid skeleton (for example, the linker composed of an amino acid skeleton described in Japanese Patent No. 5157168 or Japanese Patent No. 5554881). Specifically, as non-limiting examples, for example, linkers represented by formula (A14-1) or (A14-2) or (A14-3) (for example, described in International Publication No. 2019 / 074110) are shown. In addition to these linkers, linkers described in International Publication No. 2012 / 005368, International Publication No. 2018 / 182008, or International Publication No. 2019 / 074110 are shown.

Chemical formula

[0043] Nucleotides and amidites in which the R group in formula (13) and the R' group in formula (5) are substituents other than hydroxyl groups can be produced from nucleosides synthesized by known methods described in, for example, Japanese Patent Publication No. 3745226, International Publication No. 2001 / 053528, or Japanese Unexamined Patent Application Publication No. 2014-221817 and known methods cited therein. Furthermore, they can be produced using commercially available products according to the methods described in the examples below or methods obtained by appropriately modifying these methods.

[0044] G 4 represents a hydrogen atom, an alkali metal ion, an ammonium ion, an alkylammonium ion, or a hydroxyalkylammonium ion. Examples of alkali metal ions include, for example, sodium ions and lithium ions. Examples of specific alkyl groups for alkylammonium ions include, for example, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, n-pentyl, isopentyl, and hexyl groups. More specifically, examples include, for example, diethylammonium ions, triethylammonium ions, tetrabutylammonium ions, hexylammonium ions, and dibutylammonium ions. Examples of specific hydroxyalkyl moieties for hydroxyalkylammonium ions include, for example, hydroxymethyl, hydroxyethyl, hydroxy-n-propyl, hydroxyisopropyl, hydroxy-n-butyl, and tris(hydroxymethyl). More specific examples of hydroxyalkylammonium ions include, for example, tris(hydroxymethyl)ammonium ions. G 4 preferably represents a hydrogen atom.

[0045] G 5 represents a hydrogen atom or a protecting group for the hydroxyl group. When it represents a protecting group, G 1 also represents the same protecting group. G 5When deprotected, it is a hydrogen atom, and in that case, the nucleotide compound is also subjected to a series of nucleic acid elongation reaction steps.

[0046] Y is preferably an oxygen atom.

[0047] W1 and X1 are preferably such that W1 represents an OZ group and X1 represents an R group.

[0048] W2 and X2 are preferably such that W2 represents a hydroxyl group and X2 represents an R group.

[0049] W3 and X3 are preferably each independently a hydroxyl group.

[0050] R’ is preferably a hydroxyl group.

[0051] The synthesis of the nucleic acid compound by the amidite method in the above steps (1) to (5) can be carried out by a generally known method (for example, the method described in the above Patent No. 5157168 or Patent No. 5554881) other than the deprotection step related to the present invention in step (1) or step (5) in the scheme of FIG. 1 to perform a nucleic acid elongation reaction. Each step will be described below.

[0052] (Nucleic Acid Elongation Reaction) As used herein, the "nucleic acid elongation reaction" means a reaction for elongating an oligonucleotide by sequentially binding nucleotides via a phosphodiester bond. The nucleic acid elongation reaction can be carried out according to the procedure of a general phosphoramidite method. The nucleic acid elongation reaction may be carried out using a nucleic acid automatic synthesizer that employs the phosphoramidite method.

[0053] The chain length of the nucleic acid oligomer may be, for example, 20 mer or more (i.e., n ≥ 19), 40 mer or more (i.e., n ≥ 39), 50 mer or more (i.e., n ≥ 49), 60 mer or more (i.e., n ≥ 59), 80 mer or more (i.e., n ≥ 79), 100 mer or more (i.e., n ≥ 99), 2 - 200 mer (i.e., 1 ≤ n ≤ 199), 10 - 150 mer (i.e., 9 ≤ n ≤ 149), 15 - 110 mer (i.e., 14 ≤ n ≤ 109).

[0054] The deprotection step in step (1) is a step of deprotecting the protecting group of the 5'-hydroxyl group at the end of the oligonucleotide chain supported on the solid phase carrier. As common protecting groups, 4,4'-dimethoxytrityl group (DMTr group), 4-monomethoxytrityl group, and 4,4',4''-trimethoxytrityl group are used. Deprotection can be carried out using an acid. Examples of the acid for deprotection include trifluoroacetic acid, dichloroacetic acid, trifluoromethanesulfonic acid, trichloroacetic acid, methanesulfonic acid, hydrochloric acid, acetic acid, and p-toluenesulfonic acid, etc.

[0055] The condensation step of the project (2) is a reaction in which a nucleoside phosphoramidite represented by the following formula (13) described in Scheme A of FIG. 1 is bonded to the 5'-hydroxyl group at the end of the oligonucleotide chain deprotected by the deprotection step. As the phosphoramidite used for nucleic acid elongation, an amidite compound represented by the formula (13) or (A9) to (A12) is used. In addition, other usable phosphoramidites include 2'-OMe, 2'-F, 2'-O-tert-butyldimethylsilyl group, 2'-O-methoxyethyl group, 2'-H, and 2'-fluoro-2'-deoxy-β-D-arabinofuranosyl group. As the nucleoside phosphoramidite, one in which the 5'-hydroxyl group is protected by a protecting group (e.g., DMTr group) is used. The condensation step can be carried out using an activator or condensing agent that activates the nucleoside phosphoramidite. Examples of the activator or condensing agent include 5-benzylthio-1H-tetrazole (BTT) (also referred to as 5-benzylmercapto-1H-tetrazole), 1H-tetrazole, 4,5-dicyanoimidazole (DCI), 5-ethylthio-1H-tetrazole (ETT), N-methylbenzimidazolium triflate (N-MeBIT), benzimidazolium triflate (BIT), N-phenylimidazolium triflate (N-PhIMT), imidazolium triflate (IMT), 5-nitrobenzimidazolium triflate (NBT), 1-hydroxybenzotriazole (HOBT), or 5-(bis-3,5-trifluoromethylphenyl)-1H-tetrazole.

[0056] The nucleoside phosphoramidite represented by the formula (13) described in Scheme A of FIG. 1 (hereinafter referred to as amidite) is as follows. Formula:

Chemical formula

[0057] After the condensation step, the unreacted 5'-hydroxyl group may be capped as appropriate. Capping can be carried out using a known capping solution such as acetic anhydride-tetrahydrofuran solution or phenoxyacetic anhydride / N-methylimidazole solution.

[0058] The oxidation step in step (3) is a step of converting the phosphite group formed by the condensation step into a phosphate group or a thiophosphate group. This step is a reaction of converting trivalent phosphorus to pentavalent phosphorus using an oxidizing agent, and can be carried out by reacting an oxidizing agent with the oligonucleic acid derivative supported on the solid phase carrier. When converting the phosphite group into a phosphate group, for example, iodine can be used as the "oxidizing agent". The oxidizing agent can be prepared and used at a concentration of 0.005 to 2 M. Water can be used as the oxygen source for oxidation, and pyridine, N-methylimidazole (NMI), N-methylmorpholine, or triethylamine can be used as the base for promoting the reaction. The solvent is not particularly limited as long as it does not participate in the reaction, and examples include acetonitrile, tetrahydrofuran (THF), or a mixed solvent of these in any ratio. For example, iodine / water / pyridine / acetonitrile, or iodine / water / pyridine, or iodine / water / pyridine / NMI, or iodine / water / pyridine / THF can be used. The reaction temperature is preferably 5°C to 50°C. The reaction time is usually appropriately 1 minute to 30 minutes. The amount of the reagent used is preferably 1 to 100 mol, more preferably 1 to 10 mol, per 1 mol of the compound supported on the solid phase carrier.

[0059] When converting a triester group of phosphorous acid to a triester group of thiophosphoric acid, as the "oxidizing agent", for example, sulfur, 3H-1,2-benzodithiol-3-one-1,1-dioxide (Beaucage reagent), 3-amino-1,2,4-dithiazole-5-thione (ADTT), 5-phenyl-3H-1,2,4-dithiazol-3-one (POS), [(N,N-dimethylaminomethylene)amino]-3H-1,2,4-dithiazoline-3-thione (DDTT), and phenylacetyl disulfide (PADS) can be used. The oxidizing agent can be diluted with an appropriate solvent so as to have a concentration of 0.001 to 2 M and then used. The solvent used for the reaction is not particularly limited as long as it does not participate in the reaction. For example, dichloromethane, acetonitrile, pyridine, or a mixed solvent of any ratio thereof can be mentioned. The oxidation step may be carried out after the capping operation, or conversely, the capping operation may be carried out after the oxidation step, and this order is not limited.

[0060] In step (5-1), the protecting group of the 5'-hydroxyl group of the nucleotide introduced at the end of the elongation may be used for column purification using the protecting group of the 5'-hydroxyl group as a tag after cleavage from the solid support and deprotection of the protecting group described below. After column purification, the protecting group of the 5'-hydroxyl group may be deprotected.

[0061] In step (5-2), the step of deprotecting the phosphate protecting group, after the synthesis of the nucleic acid having the desired sequence is completed, an amine compound is allowed to act to deprotect the protecting group of the phosphate moiety. Examples of the amine compound include diethylamine described in Japanese Patent No. 4705716.

[0062] In step (5-2), the cleavage of the nucleic acid oligomer having the desired chain length on the solid support from the solid support is usually carried out using concentrated aqueous ammonia as a cleavage agent.

[0063] Furthermore, ammonia or an amine compound is used to cleave and recover an oligonucleotide chain from a solid-phase carrier, for example. Examples of the amine compound include methylamine, ethylamine, isopropylamine, ethylenediamine, or diethylamine.

[0064] In step (5-3), the protecting group of the hydroxyl group at the 2'-position or 3'-position of the ribose of the nucleic acid compound (4) excised from the solid-phase carrier in step (5-2) can be removed according to the methods described in International Publication No. WO2006 / 022323, International Publication No. WO2013 / 027843, or International Publication No. WO2019 / 208571, and a deprotected nucleic acid oligomer (5) can be obtained.

[0065] Examples of the nucleic acid oligomer that can be produced using the production method of the present invention include nucleic acid oligomers in which the nucleosides contained in the nucleic acid oligomer are RNA, DNA, RNA having 2'-O-MOE, 2'-O-Me, 2'-F, and LNA, but are not limited thereto. For example, examples of various nucleosides described in Xiulong, Shen et al., Nucleic Acids Research, 2018, Vol. 46, No. 46, 1584-1600, and Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558 can be mentioned. Preferably, the nucleic acid oligomer produced by the method of the present invention is RNA.

[0066] Typical examples of the nucleic acid oligomer that can be used in the production method of the present invention are shown below in addition to the examples described in the examples, but are not limited thereto. Hereinafter, in the description of the sequence, U represents uridine, C represents cytidine, A represents adenosine, and G represents guanosine. Examples include nucleic acid oligomers having the following sequences (A) and (B) described in International Publication No. WO2019 / 060442. Array (A): 5’-AUGGAAUmACUCUUGGUUmACdTdT-3’ (Antisense) (SEQ ID NO: 1) 21mer Array (B): 5’-GUmAACmCmAAGAGUmAUmUmCmCmAUmdTdT-3’ (Sense) (SEQ ID NO: 2) 21mer In Arrays (A) and (B), Um represents 2'-O-methyluridine, Cm represents 2'-O-methylcytidine, and dT represents thymidine. Examples include the nucleic acid oligomers described in Nucleic Acids Research, 2019, Vol. 47, No.2, 546 - 558 by Daniel O'Reilly et al. (see page 553). As a typical example, a nucleic acid oligomer having the following Array (C) is mentioned. Array (C): 5’-AGAGCCAGCCUUCUUAUUGUUUUAGAGCUAUGCUGU-3’ (SEQ ID NO: 3) 36mer Examples include the nucleic acid oligomers described in Japanese Patent No. 4965745. As a typical example, a nucleic acid oligomer having the following Array (D) is mentioned. Array (D): 5’-CCAUGAGAAGUAUGACAACAGCC-P-GGCUGUUGUCAUACUUCUCAUGGUU-3’ (SEQ ID NO: 4, 5) 49mer In Array (D), “P” is represented by the partial structure delimited by a wavy line in the following formula (A5). Note that the description of SEQ ID NO: 4 in the Sequence Listing shows the base sequence of the following Array (D1) from the 5'-end of Array (D) to before “P”, and the description of SEQ ID NO: 5 shows the base sequence of the following Array (D2) from after “P” to the 3'-end of Array (D). Array (D1): 5’-CCAUGAGAAGUAUGACAACAGCC-3’ (SEQ ID NO: 4) 23mer Array (D2): 5’-GGCUGUUGUCAUACUUCUCAUGGUU-3’ (SEQ ID NO: 5) 25mer Examples include the nucleic acid oligomer having the following Array (E) described in Nucleic Acids Research, 2019, Vol. 47, No. 2: 547. Array (E): 5’-ACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU-3’ (SEQ ID NO: 6), 67mer Examples include nucleic acid oligomers having the following sequence (F) described in JP-T-2015-523856, page 173. Array (F): 5’-GUUUUCCCUUUUCAAAGAAAUCUCCUGGGCACCUAUCUUCUUAGGUGCCCUCCCUUGUUUAAACCUGACCAGUUAACCGGCUGGUUAGGUUUUU-3’ (SEQ ID NO: 7), 94mer Examples include nucleic acid oligomers described in JP-T-2017-537626. Typical examples include nucleic acid oligomers having the following sequences (G), (H), (I), and (J). Array (G): 5’-AGUCCUCAUCUCCCUCAAGCGUUUUAGAGCUAGUAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3’ (SEQ ID NO: 8), 100mer Array (H): 5’-GCAGAUGUAGUGUUUCCACAGUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU-3’ (SEQ ID NO: 9), 113mer Array (I): 5’-dAdGdTdCdCdTdCdAdTdCdTdCdCdCdTdCdAdAdGdCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU-3’ (SEQ ID NO: 10), 113mer In Array (I), dT represents thymidine, dC represents 2'-deoxycytidine, dA represents 2'-deoxyadenosine, and dG represents 2'-deoxyguanosine. Array (J): 5’-AmsGmsUmsCCUCAUCUCCCUCAAGCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUmsUmsUmsU-3’ (SEQ ID NO: 11), 113-mer In Array (J), Um represents 2'-O-methyluridine, Am represents 2'-O-methyladenosine, Gm represents 2'-O-methylguanosine, and s represents a phosphorothioate modification.

Example

[0067] Hereinafter, the present invention will be described in more detail by way of examples, but the present invention is not limited to these examples. <Measurement method> First, various measurement methods used in the following tests are shown below.

[0068] The purity of the oligonucleotide was measured using HPLC. The HPLC measurement conditions are shown in Table 1 below. (Measurement method 1: Measurement of oligonucleotide purity)

Table 1

[0069] (Measurement method 2: Measurement of oligonucleotide yield) The OD of the crude product 260 was measured. OD 260 represents the absorbance at UV 260 nm per 10 mm optical path length in a 1 mL solution (pH = 7.5). Since it is generally known that for RNA, 1 OD = 40 μg, the yield was calculated based on the measured value of the above OD 260 .

[0070] (Measurement method 3: Measurement of formaldehyde concentration) For the method of measuring the formaldehyde concentration in a dichloroacetic acid solution, there are a gas chromatography method or a high performance liquid chromatography method. In the gas chromatography method, formaldehyde is directly analyzed to calculate the concentration. In the high performance liquid chromatography method, formaldehyde is reacted with acetylacetone, the amount of the obtained 3,5-diacetyl-1,4-dihydrolutidine is measured, and the concentration of formaldehyde is calculated.

[0071] <Preparation of Dichloroacetic Acid Solution> The dichloroacetic acid solutions with different formaldehyde concentrations used in the following tests were prepared by first preparing a dichloroacetic acid solution with a low formaldehyde concentration and then adding an aqueous formaldehyde solution to the obtained dichloroacetic acid solution.

[0072] <Solid Phase Synthesis of Oligonucleotides> Sequence (I): 5’-GGCACCGAGUCGGUGCUUUU-3’ (SEQ ID NO: 12), 20mer Sequence (II): 5’-AAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3’ (SEQ ID NO: 13), 50mer Sequence (III): 5’-AUAACUCAAUUUGUAAAAAAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3’ (SEQ ID NO: 14), 100mer In the arrays (I), (II), and (III), "A" is represented by the partial structure delimited by a wavy line in the following formula (A1). "C" is represented by the partial structure delimited by a wavy line in the following formula (A2). "G" is represented by the partial structure delimited by a wavy line in the following formula (A3). U is represented by the partial structure delimited by a wavy line in the following formula (A4). Note that the "U" at the 3' end is represented by the partial structure delimited by a wavy line in the following formula (A8). Also, in array (I), the "G" at the 5' end is represented by the partial structure delimited by a wavy line in the following formula (A6), and in arrays (II) and (III), the "A" at the 5' end is represented by the partial structure delimited by a wavy line in the following formula (A7).

[0073]

Chem.

[0074]

Chem.

[0075]

Chem.

[0076]

Chem.

[0077]

Chem.

[0078]

Chem.

[0079]

Chem.

[0080] [Chemical formula]

[0081] As a solid support, Controlled Pore Glass (CPG) was used, and as a nucleic acid synthesizer, NTS M-4MX-E (manufactured by Nippon Techno Service Co., Ltd.) was used. By the phosphoramidite solid-phase synthesis method, the oligonucleotides consisting of the sequences (I), (II), and (III) were synthesized from the 3'-end to the 5'-end. The synthesis was carried out on an approximately 1 μmol scale. Also, for the synthesis, the uridine EMM amidite (A11) described in Example 2 of US2012 / 0035246, the cytidine EMM amidite (A9) described in Example 3, the adenosine EMM amidite (A12) described in Example 4, and the guanosine EMM amidite (A10) described in Example 5 were used. As a deblocking solution, a 3% dichloroacetic acid toluene solution was used, as a condensing agent, 5-benzylmercapto-1H-tetrazole was used, as an oxidizing agent, an iodine solution was used, and as a capping solution, a phenoxyacetic anhydride solution and an N-methylimidazole solution were used.

[0082] [Chemical formula]

[0083] [Chemical formula]

[0084] [Chemical formula]

[0085] [Chemical formula]

[0086] Next, specific production examples of oligonucleotides (nucleic acid oligomers) produced by the production method of the present invention are shown. Here, the oligonucleotides produced by the production method of the present invention in the following examples are oligonucleotides having the above sequences (I), (II), and (III). In addition, the uridine derivatives described in the following examples and comparative examples mean compounds represented by the following structural formula. The circle shown in the following structural formula schematically represents CPG.

[0087] [Chemical formula]

[0088] (Example 1) Using Controlled Pore Glass (CPG) carrying 0.98 μmol of uridine derivative and amidites represented by formula (A9), formula (A10), formula (A11), or formula (A12), the nucleic acid oligomer shown in sequence (I) was automatically synthesized from the 3'-side to the 5'-side by NTS M-4MX-E (manufactured by Nippon Techno Service Co., Ltd.). The procedure for automatic synthesis was as follows: First, a 3% dichloroacetic acid toluene solution was fed to the CPG to deprotect the trityl protecting group at the 5'-position. At this time, the formaldehyde concentration in the dichloroacetic acid solution used can be measured by measuring method 3, and the molar ratio of formaldehyde to dichloroacetic acid in the dichloroacetic acid solution (formaldehyde mol / dichloroacetic acid mol) was 43×10 -7Subsequently, various amidites and 5-benzylmercapto-1H-tetrazole as a condensing agent were fed to CPG, and a coupling reaction was allowed to proceed at the 5'-hydroxyl group. Subsequently, an oxidation solution containing 50 mM iodine was fed to convert the phosphite group to a phosphate group. Subsequently, a 0.1 M phenoxyacetic anhydride acetonitrile solution and a 10% N-methylimidazole / 10% 2,6-lutidine acetonitrile solution were used as capping solutions to cap the reaction points where coupling did not proceed. After repeating these steps a total of 19 times, the protecting group (DMTr group) at the 5'-terminal base was deprotected with a 3% dichloroacetic acid toluene solution, and a nucleic acid oligonucleotide having the sequence shown in sequence (I) was synthesized on the CPG support. Thereafter, 1.5 mL of 28% aqueous ammonia and 0.5 mL of ethanol were flowed into the CPG support carrying 0.98 μmol of the oligonucleotide, and the mixture was incubated at 40 °C for 4 hours to release the nucleic acid oligomer from the solid support, and then the solvent was removed by concentration. Next, the free oligonucleotide was dissolved in 1.5 mL of dimethyl sulfoxide, 1.0 mL of acetonitrile, 20 μL of nitromethane and a stir bar were added, and then 2.08 mL of a 1 M solution of tetra-n-butylammonium fluoride (TBAF) in dimethyl sulfoxide that had been dehydrated with molecular sieve 4A was flowed in at room temperature with stirring by a stirrer, and the mixture was incubated at 33 °C for 4 hours to deprotect the 2'-EMM protecting group. Thereafter, the nucleic acid oligomer product was obtained by precipitation. For the obtained product, the purity of the oligonucleotide was measured using the method described in the above measurement method 1, and as a result, the purity was 76.2%. Further, when the yield of the oligonucleotide was measured using the method described in the above measurement method 2, the yield was 4032 μg, and when converted to the yield per CPG carrying 1.00 μmol of the uridine derivative, it was 4114 μg. The results are shown in Table 2.

[0089] (Example 2) In the experiment of Example 1, Controlled Pore Glass (CPG) carrying 1.02 μmol of the uridine derivative and the molar ratio of formaldehyde to dichloroacetic acid (formaldehyde mol / dichloroacetic acid mol) was 90×10-6 A nucleic acid oligomer of SEQ ID NO: (I) was obtained in the same manner except that a 3% toluene solution of dichloroacetic acid was used. As a result of measuring the purity of the oligonucleotide using the method described in Measurement Method 1, the purity of the product was 75.0%. Further, when the yield of the oligonucleotide was measured using the method described in Measurement Method 2, the yield was 4147 μg, which was 4066 μg when converted to the yield per CPG carrying 1.00 μmol of the uridine derivative. The results are shown in Table 2.

[0090] (Reference Example 1) In the experiment of Example 1, Controlled Pore Glass (CPG) carrying 1.03 μmol of the uridine derivative, and the molar ratio of formaldehyde to dichloroacetic acid (moles of formaldehyde / moles of dichloroacetic acid) was 20×10 -5 A nucleic acid oligomer of SEQ ID NO: (I) was obtained in the same manner except that a 3% toluene solution of dichloroacetic acid was used. As a result of measuring the purity of the oligonucleotide using the method described in Measurement Method 1, the purity of the product was 73.8%. Further, when the yield of the oligonucleotide was measured using the method described in Measurement Method 2, the yield was 3979 μg, which was 3863 μg when converted to the yield per CPG carrying 1.00 μmol of the uridine derivative. The results are shown in Table 2.

[0091] (Example 3) Using Controlled Pore Glass (CPG) carrying 1.03 μmol of the uridine derivative and an amidite represented by formula (A9), formula (A10), formula (A11), or formula (A12), the nucleic acid oligomer represented by SEQ ID NO: (II) was automatically synthesized from the 3'-end to the 5'-end by NTS M-4MX-E (manufactured by Nippon Techno Service Co., Ltd.). The procedure for the automated synthesis was as follows: First, a 3% toluene solution of dichloroacetic acid was fed to the CPG to deprotect the trityl protecting group at the 5'-position. At this time, the formaldehyde concentration in the dichloroacetic acid solution used can be measured by Measurement Method 3, and the molar ratio of formaldehyde to dichloroacetic acid (moles of formaldehyde / moles of dichloroacetic acid) in the dichloroacetic acid solution was 43×10-7 This was the case. Subsequently, various amidites and 5-benzylmercapto-1H-tetrazole as a condensing agent were fed to CPG, and a coupling reaction was allowed to proceed at the 5'-position hydroxyl group. Subsequently, an oxidation solution containing 50 mM iodine was fed to convert the phosphite group to a phosphate group. Subsequently, a 0.1 M phenoxyacetic anhydride acetonitrile solution and a 10% N-methylimidazole / 10% 2,6-lutidine acetonitrile solution were used as capping solutions to cap the reaction points where coupling did not proceed. After repeating these steps a total of 49 times, the protecting group (DMTr group) at the 5'-terminal base was deprotected with a 3% dichloroacetic acid toluene solution, and a nucleic acid oligonucleotide having the sequence shown in Sequence (II) was synthesized on the CPG support. Thereafter, 1.5 mL of 28% aqueous ammonia and 0.5 mL of ethanol were flowed into the CPG support carrying 1.03 μmol of the oligonucleotide, and the mixture was incubated at 40 °C for 4 hours to release the nucleic acid oligomer from the solid support, and then the solvent was removed by concentration. Next, the free oligonucleotide was dissolved in 1.5 mL of dimethyl sulfoxide, 1.0 mL of acetonitrile, 20 μL of nitromethane and a stir bar were added, and then 2.08 mL of a dimethyl sulfoxide solution of 1 M tetra-n-butylammonium fluoride (TBAF) that had been dehydrated with molecular sieve 4A was flowed in at room temperature with stirring by a stirrer, and the mixture was incubated at 33 °C for 4 hours to deprotect the 2'-EMM protecting group. Thereafter, the nucleic acid oligomer product was obtained by precipitation operation. For the obtained product, the purity of the oligonucleotide was measured using the method described in the above Measurement Method 1, and as a result, the purity was 50.8%. Also, when the yield of the oligonucleotide was measured using the method described in the above Measurement Method 2, the yield was 9156 μg, and when converted to the yield per CPG carrying 1.00 μmol of the uridine derivative, it was 8889 μg. The results are shown in Table 2.

[0092] (Example 4) In the experiment of Example 3, except for using a 3% dichloroacetic acid toluene solution in which the molar ratio of formaldehyde to dichloroacetic acid (moles of formaldehyde / moles of dichloroacetic acid) is 90×10 -6 a nucleic acid oligomer of sequence (II) was obtained in the same manner. Using the method described in Measurement Method 1, the purity of the oligonucleotide was measured. As a result, the purity of the product was 47.8%. Also, when the yield of the oligonucleotide was measured using the method described in Measurement Method 2, the yield was 9378 μg, which was 8931 μg when converted to the yield per CPG carrying 1.00 μmol of the uridine derivative. The results are shown in Table 2.

[0093] (Reference Example 2) In the experiment of Example 3, except for using a 3% dichloroacetic acid toluene solution in which the molar ratio of formaldehyde to dichloroacetic acid (moles of formaldehyde / moles of dichloroacetic acid) is 20×10 -5 a nucleic acid oligomer of sequence (II) was obtained in the same manner. Using the method described in Measurement Method 1, the purity of the oligonucleotide was measured. As a result, the purity of the product was 42.8%. Also, when the yield of the oligonucleotide was measured using the method described in Measurement Method 2, the yield was 9307 μg, which was 8864 μg when converted to the yield per CPG carrying 1.00 μmol of the uridine derivative. The results are shown in Table 2.

[0094] (Example 5) Using Controlled Pore Glass (CPG) loaded with 0.99 μmol of a uridine derivative and an amidite represented by formula (A9), formula (A10), formula (A11), or formula (A12), the nucleic acid oligomer shown in sequence (III) was automatically synthesized from the 3'-end to the 5'-end using NTS M-4MX-E (manufactured by Nippon Techno Service Co., Ltd.). The procedure for the automatic synthesis was as follows: First, a 3% dichloroacetic acid toluene solution was fed to the CPG to deprotect the trityl protecting group at the 5'-position. At this time, the formaldehyde concentration in the dichloroacetic acid solution used can be measured by measurement method 3, and the molar ratio of formaldehyde to dichloroacetic acid in the dichloroacetic acid solution (formaldehyde mol / dichloroacetic acid mol) is 43×10 -7Subsequently, various amidites and 5-benzylmercapto-1H-tetrazole as a condensing agent were fed to CPG to cause a coupling reaction at the 5'-hydroxyl group. Subsequently, an oxidation solution containing 50 mM iodine was fed to convert the phosphite group to a phosphate group. Subsequently, a 0.1 M phenoxyacetic anhydride acetonitrile solution and a 10% N-methylimidazole / 10% 2,6-lutidine acetonitrile solution were used as capping solutions to cap the reaction sites where coupling did not proceed. After repeating these steps a total of 99 times, the protecting group (DMTr group) at the 5'-terminal base was deprotected with a 3% dichloroacetic acid toluene solution, and a nucleic acid oligonucleotide having the sequence shown in sequence (III) was synthesized on the CPG support. Thereafter, 1.5 mL of 28% aqueous ammonia and 0.5 mL of ethanol were flowed into the CPG support carrying 1.03 μmol of the oligonucleotide, and the mixture was incubated at 40 °C for 4 hours to release the nucleic acid oligomer from the solid support, and then the solvent was removed by concentration. Next, the free oligonucleotide was dissolved in 1.5 mL of dimethyl sulfoxide, 1.0 mL of acetonitrile, 20 μL of nitromethane and a stir bar were added, and then 2.08 mL of a 1 M solution of tetra-n-butylammonium fluoride (TBAF) in dimethyl sulfoxide that had been dehydrated with molecular sieve 4A was flowed in at room temperature with stirring by a stirrer, and the mixture was incubated at 33 °C for 4 hours to deprotect the 2'-EMM protecting group. Thereafter, the nucleic acid oligomer product was obtained by a precipitation operation. For the obtained product, the purity of the oligonucleotide was measured using the method described in the above measurement method 1, and as a result, the purity was 33.1%. Also, when the yield of the oligonucleotide was measured using the method described in the above measurement method 2, the yield was 12889 μg, and when converted to the yield per CPG carrying 1.00 μmol of the uridine derivative, it was 13019 μg. The results are shown in Table 2.

[0095] (Example 6) In the experiment of Example 5, except for using a 3% dichloroacetic acid toluene solution with a molar ratio of formaldehyde to dichloroacetic acid (moles of formaldehyde / moles of dichloroacetic acid) of 90×10 -6 a nucleic acid oligomer of sequence (III) was obtained in the same manner. Using the method described in Measurement Method 1, the purity of the oligonucleotide was measured, and the result showed that the purity of the product was 29.7%. Also, using the method described in Measurement Method 2, the yield of the oligonucleotide was measured, and the yield was 13375 μg. When converted to the yield per CPG carrying 1.00 μmol of the uridine derivative, it was 12861 μg. The results are shown in Table 2.

[0096] (Reference Example 3) In the experiment of Example 5, except for using a 3% dichloroacetic acid toluene solution with a molar ratio of formaldehyde to dichloroacetic acid (moles of formaldehyde / moles of dichloroacetic acid) of 20×10 -5 a nucleic acid oligomer of sequence (III) was obtained in the same manner. Using the method described in Measurement Method 1, the purity of the oligonucleotide was measured, and the result showed that the purity of the product was 26.4%. Also, using the method described in Measurement Method 2, the yield of the oligonucleotide was measured, and the yield was 12675 μg. When converted to the yield per CPG carrying 1.00 μmol of the uridine derivative, it was 12803 μg. The results are shown in Table 2.

[0097] (Example 7) The molar ratio of formaldehyde to dichloroacetic acid (moles of formaldehyde / moles of dichloroacetic acid) is 25×10 -5To 30 g of a dichloroacetic acid solution, 300 mL of toluene was added, and using an evaporator, toluene and formaldehyde were azeotropically distilled off at 40°C to obtain 34 g of a slightly yellow oily dichloroacetic acid solution. When the formaldehyde contained in the obtained dichloroacetic acid solution was analyzed by the method described in Measurement Method 3, the molar ratio of formaldehyde to dichloroacetic acid was 43×10 -7 was obtained.

[0098]

Table 2

[0099] From the results in Table 2 above, when the dichloroacetic acid solution of the present invention with a formaldehyde concentration below a certain level was used, nucleic acid oligomers were obtained in a high yield as compared with the case where the dichloroacetic acid solutions of Reference Example 1, Reference Example 2, and Reference Example 3 were used.

Industrial Applicability

[0100] The present invention provides an efficient method for producing nucleic acid oligomers. Further, an improvement in the yield of nucleic acid oligomers produced according to the method for producing nucleic acid oligomers can be expected.

Sequence Listing Free-Text

[0101] SEQ ID NOs: 1 to 14 in the sequence listing represent the base sequences of oligonucleotides produced according to the production method of the present invention.

Claims

1. Formula (1): 【Chemical 1】 (wherein, G 2 represents a protecting group for a hydroxyl group, B a each independently represents a nucleobase which may be protected with a protecting group and which may be the same or different R 1 , R 2 and R 3 each independently represents the same or different hydrogen atom or an alkoxy group, R each independently represents the same or different, a protected hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group, Q' each independently represents the same or different, a methylene group bonded to the 4'-carbon atom of ribose, an ethylene group bonded to the 4'-carbon atom of ribose, or an ethylidene group bonded to the 4'-carbon atom of ribose, Y each independently represents the same or different, an oxygen atom or a sulfur atom, n represents any integer from 1 to 200, W 1 represents an OZ group, and X 1 represents an R group, or W 1 represents an OV group and X 1 represents an OZ group V represents a protecting group for a hydroxyl group, Z is a group having a structure composed of a solid-phase carrier and a linking group. And when n is an integer of 2 or more, in the nucleic acid oligomer represented by formula (1), a non-nucleotide linker may be incorporated between each nucleotide.) The nucleic acid oligomer represented by , and a dichloroacetic acid solution having a molar ratio of formaldehyde to dichloroacetic acid (moles of formaldehyde / moles of dichloroacetic acid) of 90×10 -6 including a step of reacting with a dichloroacetic acid solution that is as follows, Formula (2): 【Chemical 2】 (wherein, G 2 、B a 、R, Y, X 1 、W 1 and n are as described above, and, As defined in formula (1), a non-nucleotide linker may be incorporated between nucleotides.) A method for producing a nucleic acid oligomer represented by the formula:

2. The step according to claim 1, further comprising the step of removing the group represented by Z from the nucleic acid oligomer represented by formula (2) generated in the step, and the step of removing the protecting groups for the hydroxyl group and the nucleobase, formula (2'): 【Chemical Formula 3】 (wherein, Y and n are as defined above, B c each independently represents the same or different nucleobases, G 4 each independently represents the same or different hydrogen atom, alkali metal ion, ammonium ion, alkylammonium ion, or hydroxyalkylammonium ion, R' each independently represents the same or different, a hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group, Q' is as defined above, X 3 and W 3 each independently represents a hydroxyl group, or X 3 represents an R' group and W 3 represents a hydroxyl group.) A method for producing a nucleic acid oligomer represented by the formula:

3. The nucleic acid oligomer represented by formula (2) is optionally chain-extended by the amidite method to give formula (3): [Chemical Formula 4] (wherein, G 2 , B a , R, Y, X 1 and W. 1 is as described above, G 5 is 【Chemical Formula 5】 represents a protecting group for a hydroxyl group as shown, or a hydrogen atom, R 1 , R 2 and R 3 are as described above, m is an integer satisfying m ≥ n.) A step of obtaining a nucleic acid compound represented by the formula, and From the compound represented by formula (3) to formula (4): 【Chemical Formula 6】 (wherein, G 5 , R, Y and m are as described above, G 4 each independently represents the same or different hydrogen atom, alkali metal ion, ammonium ion, alkylammonium ion, or hydroxyalkylammonium ion, B C each independently represents the same or a different nucleobase, X 2 represents a hydroxyl group, and W 2 represents an OV group, or X 2 represents an R group and W 2 represents a hydroxyl group V represents a protecting group for a hydroxyl group.) A step of cleaving the compound represented by the formula, Further deprotecting the compound represented by formula (4) to give formula (5): 【Chemical Formula 7】 (wherein, G 4 , B c , Y and m are as described above, R' each independently represents the same or different, a hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group, Q' is as defined above, X 3 and W 3 each independently represents a hydroxyl group, or X 3 represents an R' group and W 3 represents a hydroxyl group.) The production method according to claim 1, further comprising a step of producing a nucleic acid oligomer represented by the formula:

4. The production method according to any one of claims 1 to 3, wherein the non-nucleotide linker is a linker composed of an amino acid skeleton.

5. The production method according to claim 4, wherein the linker composed of an amino acid skeleton is a linker having a structure selected from the group consisting of the following formulas (A14-1), (A14-2), and (A14-3). [Chemical Formula 8] (In the formula, Y is as described above.)

6. The production method according to any one of claims 1 to 5, wherein the dichloroacetic acid solution contains at least one solvent selected from the group consisting of dichloromethane, acetonitrile, and aromatic organic solvents.

7. The molar ratio of formaldehyde to dichloroacetic acid (moles of formaldehyde / moles of dichloroacetic acid) in the dichloroacetic acid solution is 43×10 -6 The production method according to any one of claims 1 to 6, wherein the molar ratio is as follows.

8. The molar ratio of formaldehyde to dichloroacetic acid (formaldehyde mol / dichloroacetic acid mol) in the dichloroacetic acid solution is 22×10 -6 The production method according to any one of claims 1 to 6, wherein the molar ratio is 22×10

9. The production method according to any one of claims 1 to 8, wherein the nucleic acid oligomer is ribonucleic acid (RNA).

10. The production method according to any one of claims 1 to 8, wherein the nucleic acid oligomer is ribonucleic acid (RNA), and the protecting group for the hydroxyl group at the 2'-position of the ribose is a protecting group represented by formula (6). Formula (6): 【Chemical Formula 9】 (In the formula, q represents an integer of any one of 1 to 5, R a and R b each independently represents the same or different methyl group, ethyl group or hydrogen atom, the * mark represents the bonding point with the oxygen atom derived from the hydroxyl group at the 2'-position of ribose, and E W represents an electron-withdrawing group.)

11. R a and R b are simultaneously hydrogen atoms, and E W is a cyano group, the production method according to claim 10.

12. The production method according to any one of claims 1 to 11, wherein the nucleic acid oligomer is an oligomer having a chain length of 40 or more.

13. The production method according to any one of claims 1 to 11, wherein the nucleic acid oligomer is an oligomer having a chain length of 50 or more.

14. The production method according to any one of claims 1 to 11, wherein the nucleic acid oligomer is an oligomer having a chain length of 60 or more.

15. The production method according to any one of claims 1 to 11, wherein the nucleic acid oligomer is an oligomer having a chain length of 80 or more.

16. The production method according to any one of claims 1 to 11, wherein the nucleic acid oligomer is an oligomer having a chain length of 100 or more.

17. The molar ratio of formaldehyde to dichloroacetic acid (moles of formaldehyde / mol of dichloroacetic acid) is 90×10 -6 or less, a dichloroacetic acid solution.

18. The molar ratio of formaldehyde to dichloroacetic acid (moles of formaldehyde / mol of dichloroacetic acid) is 43×10 -6 The dichloroacetic acid solution according to claim 17, wherein the molar ratio is 43×10

19. The molar ratio of formaldehyde to dichloroacetic acid (moles of formaldehyde / mol of dichloroacetic acid) is 22×10 -6 The dichloroacetic acid solution according to claim 17, wherein the molar ratio is as follows.

20. The method for producing a dichloroacetic acid solution according to any one of claims 17 to 19, comprising a step of azeotropically distilling and removing formaldehyde from a solution containing an unpurified dichloroacetic acid solution containing formaldehyde and a solvent that azeotropes with formaldehyde to obtain a purified dichloroacetic acid solution.

21. The production method according to claim 20, wherein the boiling point of the azeotropic solvent is 194°C or lower.

22. The production method according to claim 20 or 21, wherein the azeotropic solvent is dichloromethane, acetonitrile, or an aromatic organic solvent.

23. The production method according to claim 22, wherein the aromatic organic solvent is toluene.

24. A method for producing a nucleic acid oligomer, comprising the step of purifying a dichloroacetic acid solution according to claim 20 and the step according to any one of claims 1 to 3 using the purified dichloroacetic acid solution obtained in the step.

Citation Information

Patent Citations

  • Improved methods for synthesis of oligonucleotides

    WO1999043694A1

  • Single-stranded nucleic acid molecule having nitrogen-containing alicyclic skeleton

    WO2012017919A1

  • Single-stranded nucleic acid molecule having amino acid backbone

    WO2013103146A1

  • Single-chain nucleic acid molecule having delivery function and gene expression control ability

    WO2016158809A1

  • Artificial single guide RNA and use thereof

    WO2017131237A1