DNA-containing polynucleotides and guides for the CRISPR type V system, and methods for making and using them

Abstract

The present disclosure provides a guide for use in a V-type CRISPR system, the guide comprising a ribonucleotide base and at least one deoxyribonucleotide base. Also described is a CRISPR Cas12 guide comprising at least one deoxyribonucleotide base, and a nucleoprotein complex of a V-type CRISPR-Cas12 protein and such a guide. Also disclosed are methods for producing and using deoxyribonucleotide-containing polynucleotides and guides, and methods for producing and using nucleoprotein complexes. Also disclosed are methods for manipulating cells using Cas12 chRDNA guide / nucleoprotein complexes to produce CAR-expressing cells; and the use of such CAR-expressing cells in adaptive cell therapy.

Description

Technical Field

[0001] Cross - Reference to Related Applications This application claims priority to all of U.S. Provisional Application No. 3 / 229,870, filed August 5, 2021; U.S. Provisional Application No. 63 / 127,648, filed December 18, 2020; and U.S. Provisional Application No. 63 / 093,459, filed October 19, 2020, which are hereby incorporated by reference in their entirety.

[0002] Statement Regarding Federally Sponsored Research or Development Not applicable

[0003] Sequence Listing This application is electronically filed in ASCII format and includes a sequence listing that is hereby incorporated by reference in its entirety. The ASCII copy was created on March 20, 2023, is named CBI039_30_SL.txt, and is 203,259 bytes in size.

[0004] The present disclosure generally relates to clustered regularly interspaced short palindromic repeat (CRISPR) systems. Specifically, the present disclosure relates to CRISPR polynucleotides and guides for use in CRISPR-Cas12 systems, which are designed to include ribonucleotide bases and one or more deoxyribonucleotide bases. The present disclosure further relates to a Cas12 guide / nuclear protein complex comprising a designed CRISPR Cas12 guide and a CRISPR-Cas12 protein, and the production of modified cells using such a Cas12 guide / nuclear protein complex. The present disclosure further relates to compositions comprising CRISPR polynucleotides, Cas12 guides, and Cas12 guide / nuclear protein complexes, as well as methods for producing and using them. Still further, the present disclosure relates to the production and therapeutic use of cells modified using the Cas12 guide / nuclear protein complex of the present disclosure, for example, in the generation of chimeric antigen receptor (CAR)-expressing cells for the treatment of cancer.

Background Art

[0005] Clustered regularly interspaced short palindromic repeat (CRISPR) and CRISPR-associated (Cas) protein systems are found in the genomes of many prokaryotes (bacteria and archaea). These systems provide adaptive immunity against foreign invaders (e.g., viruses, bacteriophages) in prokaryotes. In this way, the CRISPR system functions as a kind of immune system and helps protect prokaryotes from foreign invaders. See, for example, Non-Patent Document 1; Non-Patent Document 2; Non-Patent Document 3; Non-Patent Document 4; Non-Patent Document 5; Non-Patent Document 6; Non-Patent Document 7.

[0006] The CRISPR-Cas immune system has the following three main stages: (1) acquisition, (2) expression, and (3) interference. Acquisition involves cleaving the genomes of invading viruses and plasmids and integrating segments of genomic DNA (called protospacers) into the CRISPR locus of the host organism. The segments integrated into the host genome are known as spacers and mediate protection from subsequent attacks by the same (or sufficiently related) virus or plasmid. Expression involves the transcription of the CRISPR locus and subsequent enzymatic processing to generate short mature CRISPR RNAs, each containing a single spacer sequence. Interference is induced after the CRISPR RNA associates with Cas proteins to form an effector complex, which then targets complementary protospacers in foreign genetic elements to induce nuclease activity.

[0007] Various CRISPR-Cas systems are capable of DNA targeting (Class 1 type I; Class 2 types II and V), RNA targeting (Class 2 type VI), and combined DNA and RNA targeting (Class 1 type III) in their native hosts. See, e.g., Non-Patent Documents 8, 9, 10, and 11.

[0008] Type V systems are classified into several different subtypes, including, for example, V-A, V-B, V-C, V-D, V-E, V-F, V-G, V-H, V-I, V-J, V-K, and V-U. See, e.g., Non-Patent Documents 7 and 12. The V-A subtype encodes the Cas12a protein (formerly known as Cpf1). Cas12a has a RuvC-like nuclease domain that is homologous to each domain of the Cas9 protein but lacks the HNH nuclease domain present in the Cas9 protein.

[0009] The V-type system has been identified in several bacteria, including: Parcubacteria bacterium GWC2011_GWC2_44_17 (PbCpf1), Lachnospiraceae bacterium MC2017 (Lb3 Cpf1), Butyrivibrio proteoclasticus (BpCpf1), Peregrinibacteria bacterium GW2011_GWA_33_10 (PeCpf1), Acidaminococcus sp. BV3L6 (AsCpf1), Porphyromonas macacae (PmCpf1), Lachnospiraceae bacterium ND2006 (LbCpf1), Porphyromonas crevioricanis (PcCpf1), Prevotella disiens (PdCpf1), Moraxella bovoculi 237 (MbCpf1), Smithella sp. SC_K08D17 (SsCpf1), Leptospira inadai (LiCpf1), Lachnospiraceae bacterium MA2020 (Lb2Cpf1), Franciscella novicida U112 (FnCpf1), Candidatus methanoplasma termitum (CMtCpf1), and Eubacterium eligens (EeCpf1).

[0010] The CRISPR-Cas system provides a powerful tool for site-specific genome editing by deleting, inserting, mutating, or substituting specific nucleic acid sequences. These changes can be gene-specific or locus-specific. Genome editing can cleave target nucleic acids using site-specific nucleases such as Cas proteins and their cognate polynucleotides, thereby generating a modified site. In certain cases, this cleavage introduces a double-strand break (DSB) into the target DNA sequence. The DSB is repaired, for example, by non-homologous end joining (NHEJ), microhomology-mediated end joining (MMEJ), or homology-directed repair (HDR). HDR depends on the presence of a template for repair. In some examples of this genome editing, a donor polynucleotide or a portion thereof can be inserted at the break.

Prior Art Documents

Non-Patent Documents

[0011]

Non-Patent Document 1

Non-Patent Document 2

Non-Patent Document 3

Non-Patent Document 4

Non-Patent Document 5

Non-Patent Document 6

Non-Patent Document 7

[0012] The present disclosure is based on the discovery of novel polynucleotides and guides for use in type V CRISPR - Cas systems, which polynucleotides and guides contain ribonucleotide bases and one or more deoxyribonucleotide bases. The guides of the present disclosure enable robust on - target editing and low off - target genome editing when complexed with type V CRISPR - Cas proteins such as Cas12a.

[0013] This genome editing process is particularly useful for creating genetically modified cells useful in therapeutic applications. For example, by this genome editing process, immune cells (e.g., T cells) can be genetically modified to express a chimeric antigen receptor (CAR). Such CAR - expressing cells are useful, for example, in adoptive immunotherapy, in which CAR - expressing immune cells such as T cells (CAR - T cells) are injected into a patient to target cells expressing a target antigen recognized by the CAR (e.g., a foreign antigen or a cancer - related antigen).

[0014] Non-limiting examples of the present disclosure are as follows.

[0015] [1] A CRISPR guide molecule comprising a targeting region capable of binding to a target nucleic acid sequence, and an activation region capable of forming a complex with a Cas12 protein and a nuclear protein, the CRISPR guide molecule comprising ribonucleotide bases and at least one deoxyribonucleotide base.

[0016] [2] The CRISPR guide molecule according to [1], wherein at least one deoxyribonucleotide base is included in the activation region, the targeting region, or both.

[0017] [3] The CRISPR guide molecule according to [1], further comprising one or more base analogs selected from the group consisting of inosine, deoxyinosine, deoxyuracil, xanthosine, C3 spacer, 5-methyl dC, 5-hydroxybutyl-2'-deoxyuridine, 5-nitroindole, 5-methyl iso-deoxycytosine, iso-deoxyguanosine, deoxyuridine, and iso-deoxycytidine.

[0018] [4] The CRISPR guide molecule according to [1], further comprising one or more abasic sites.

[0019] [5]A CRISPR guide molecule comprising the RNA sequence UAAUUUCUACUCUUGUAGAUGAGUCUCUCAGCUGGUACAC, wherein at least one of the bases in the sequence is replaced with the corresponding deoxyribonucleotide base, and optionally, at least one of the bases in the sequence is replaced with a base analog or a desalting site; and a CRISPR guide molecule comprising the RNA sequence UAAUUUCUACUCUUGUAGAUAGUGGGGGUGAAUUCAGUGU, wherein at least one of the bases in the sequence is replaced with the corresponding deoxyribonucleotide base, and optionally, at least one of the bases in the sequence is replaced with a base analog or a desalting site, the CRISPR guide molecule according to [1], selected from the group consisting of:

[0020] [6]The amount of deoxyribonucleotide bases in the CRISPR guide molecule is 50% or less as a percentage of the total size of the CRISPR guide molecule, the CRISPR guide molecule according to [5].

[0021] [7]The amount of deoxyribonucleotide bases in the CRISPR guide molecule is 25% or less as a percentage of the total size of the guide molecule, the CRISPR guide molecule according to [6].

[0022] [8]The amount of deoxyribonucleotide bases in the targeting region is 25% or less as a percentage of the total size of the targeting region, the CRISPR guide molecule according to [5].

[0023] [9]The amount of deoxyribonucleotide bases in the targeting region is 5% or less as a percentage of the total size of the targeting region, the CRISPR guide molecule according to [8].

[0024]

[10] The amount of deoxyribonucleotide bases in the activation region is 50% or less as a percentage of the total size of the activation region, the CRISPR guide molecule according to [5].

[0025]

[11] The amount of deoxyribonucleotide bases in the activation region is 25% or less as a ratio of the total size of the activation region, the CRISPR guide molecule according to

[10] .

[0026]

[12] A CRISPR guide molecule according to [5] that can bind to a target nucleic acid sequence, form a complex with a Cas12 protein and a nuclear protein, and has a lower off-target activity compared to an RNA-only CRISPR guide molecule.

[0027]

[13] One or more of positions 1, 3, 7, 10, 12, 14, 15, 16, 17, 18, 19, 21, 28, 29, 30, 31, 32, 34, 35, 36, 37, 38, 39, and 40 in the sequence contain deoxyribonucleotide bases, the CRISPR guide molecule according to [5].

[0028]

[14] Fifteen or fewer of positions 1, 3, 7, 10, 12, 14, 15, 16, 17, 18, 19, 21, 28, 29, 30, 31, 32, 34, 35, 36, 37, 38, 39, and 40 in the sequence contain deoxyribonucleotide bases, the CRISPR guide molecule according to

[13] .

[0029]

[15] Twelve or fewer of positions 1, 3, 7, 10, 12, 14, 15, 16, 17, 18, 19, 21, 28, 29, 30, 31, 32, 34, 35, 36, 37, 38, 39, and 40 in the sequence contain deoxyribonucleotide bases, the CRISPR guide molecule according to

[14] .

[0030]

[16] An activation region containing the RNA sequence UAAUUUCUACUCUUGUAGAU, wherein at least one of the bases in the sequence is replaced with a corresponding deoxyribonucleotide base, and optionally, at least one of the bases in the sequence is replaced with a base analog or an abasic site, the CRISPR guide molecule according to [2] containing the activation region.

[0031]

[17] One or more of positions 1, 3, 7, 10, 12, 14, 15, 16, 17, 18, and 19 in the array contain deoxyribonucleotide bases, the CRISPR guide molecule described in

[16] .

[0032]

[18] Ten or fewer of positions 1, 3, 7, 10, 12, 14, 15, 16, 17, 18, and 19 in the array contain deoxyribonucleotide bases, the CRISPR guide molecule described in

[17] .

[0033]

[19] Eight or fewer of positions 1, 3, 7, 10, 12, 14, 15, 16, 17, 18, and 19 in the array contain deoxyribonucleotide bases, the CRISPR guide molecule described in

[18] .

[0034]

[20] A targeting region comprising the RNA sequence GAGUCUCUCAGCUGGUACAC, wherein at least one of the bases in the sequence is replaced with a corresponding deoxyribonucleotide base, and optionally, at least one of the bases in the sequence is replaced with a base analog or an abasic site, the CRISPR guide molecule described in [2].

[0035]

[21] One or more of positions 1, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, and 20 in the array contain deoxyribonucleotide bases, the CRISPR guide molecule described in

[20] .

[0036]

[22] Five or fewer of positions 1, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, and 20 in the array contain deoxyribonucleotide bases, the CRISPR guide molecule described in

[21] .

[0037]

[23] Three or fewer of positions 1, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, and 20 in the array contain deoxyribonucleotide bases, the CRISPR guide molecule described in

[22] .

[0038]

[24] A targeting region comprising the RNA sequence AGUGGGGGUGAAUUCAGUGU, wherein at least one of the bases in the sequence is replaced with the corresponding deoxyribonucleotide base, and optionally, at least one of the bases in the sequence is replaced with a base analog or an abasic site, the CRISPR guide molecule according to [2].

[0039]

[25] The CRISPR guide molecule according to

[24] , wherein one or more of positions 1, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, and 20 in the sequence contain deoxyribonucleotide bases.

[0040]

[26] The CRISPR guide molecule according to

[25] , wherein five or fewer of positions 1, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, and 20 in the sequence contain deoxyribonucleotide bases.

[0041]

[27] The CRISPR guide molecule according to

[26] , wherein three or fewer of positions 1, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, and 20 in the sequence contain deoxyribonucleotide bases.

[0042]

[28] The CRISPR guide molecule according to [5], comprising the sequence TAAUUUCUACUCUTGUAGAUGAGUCUCUCAGCUGGUACAC, wherein positions 2, 4, 5, 6, 8, 9, 11, 13, 16, 17, 18, 20, 22, 23, 24, 25, 26, 27, 28, 29, 30, 32, 33, 34, 35, 36, 37, 38, and 39 in the sequence contain ribonucleotide bases, and positions 1, 3, 7, 10, 12, 14, 15, 19, 21, 31, and 40 in the sequence contain deoxyribonucleotide bases.

[0043]

[29] The CRISPR guide molecule described in [5], which contains the sequence TAAUUUCUACUCUTGUAGAUAGUGGGGGUGAAUUCAGUGT, wherein positions 2, 4, 5, 6, 8, 9, 11, 13, 16, 17, 18, 20, 22, 23, 24, 25, 26, 27, 28, 29, 30, 32, 33, 34, 35, 36, 37, 38, and 39 in the sequence contain ribonucleotide bases, and positions 1, 3, 7, 10, 12, 14, 15, 19, 21, 31, and 40 in the sequence contain deoxyribonucleotide bases.

[0044]

[30] The activation region is 20 bases in length, and one or more of positions 1, 3, 7, 10, 12, 14, 15, 16, 17, 18, and 19 in the activation region sequence of 20 nucleotides contain deoxyribonucleotide bases, the CRISPR guide molecule described in [2].

[0045]

[31] Among positions 1, 3, 7, 10, 12, 14, 15, 16, 17, 18, and 19 in the sequence, no more than 10 contain deoxyribonucleotide bases, the CRISPR guide molecule described in

[30] .

[0046]

[32] Among positions 1, 3, 7, 10, 12, 14, 15, 16, 17, 18, and 19 in the sequence, no more than 8 contain deoxyribonucleotide bases, the CRISPR guide molecule described in

[31] .

[0047]

[33] The targeting region is 20 bases in length, and one or more of positions 1, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, and 20 in the targeting region sequence of 20 nucleotides contain deoxyribonucleotide bases, the CRISPR guide molecule described in [2].

[0048]

[34] Among positions 1, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, and 20 in the sequence, no more than 5 contain deoxyribonucleotide bases, the CRISPR guide molecule described in

[33] .

[0049]

[35] Among the 1st, 8th, 9th, 10th, 11th, 12th, 14th, 15th, 16th, 17th, 18th, 19th, and 20th positions in the

[34] array, three or fewer positions contain deoxyribonucleotide bases, and the CRISPR guide molecule described in

[34] .

[0050]

[36] A CRISPR nucleic acid / protein composition comprising the CRISPR guide molecule described in any one of [1] to

[35] and a Cas12 protein.

[0051]

[37] The CRISPR nucleic acid / protein composition described in

[36] , wherein the CRISPR guide molecule exists as a complex with the Cas12 protein.

[0052]

[38] The CRISPR nucleic acid / protein composition described in

[36] , wherein the Cas12 protein is a Cas12a protein.

[0053]

[39] The Cas12 protein contains a linker and an NLS-containing sequence that has at least 80% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 479 to 490 at the C-terminus, and the CRISPR nucleic acid / protein composition described in any one of

[36] to

[38] .

[0054]

[40] The CRISPR nucleic acid / protein composition described in

[39] , wherein the linker and NLS-containing sequence contains an amino acid sequence selected from the group consisting of SEQ ID NOs: 483, 485, 487, and 489.

[0055]

[41] A cell comprising the CRISPR guide molecule described in any one of [1] to

[35] .

[0056]

[42] The cell described in

[41] , further comprising a Cas12 protein.

[0057]

[43] The cell described in

[42] , wherein the Cas12 protein is a Cas12a protein.

[0058]

[44] The Cas12 protein contains a linker and an NLS-containing sequence that has at least 80% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 479 to 490 at the C-terminus, and the cell according to

[42] or

[43] .

[0059]

[45] The linker and NLS-containing sequence contains an amino acid sequence selected from the group consisting of SEQ ID NOs: 483, 485, 487, and 489, and the cell according to

[44] .

[0060]

[46] The CRISPR guide molecule is present in a complex with the Cas12 protein, and the cell according to any one of

[42] to

[45] .

[0061]

[47] The cell according to any one of

[41] to

[46] , which is a prokaryotic cell or a eukaryotic cell.

[0062]

[48] The cell according to

[47] , which is a eukaryotic cell selected from the group consisting of single-celled eukaryotes, eukaryotic cells, protozoan cells, plant-derived cells, algal cells, fungal cells, animal cells, invertebrate-derived cells, vertebrate-derived cells, mammalian-derived cells, stem cells, and progenitor cells.

[0063]

[49] The cell according to

[48] , which is a lymphocyte, a chimeric antigen receptor (CAR) T cell, a T cell receptor (TCR) cell, a TCR-engineered CAR-T cell, a tumor-infiltrating lymphocyte (TIL), a CAR TIL, a dendritic cell (DC), a CAR-DC, a macrophage, a CAR-macrophage (CAR-M), a natural killer (NK) cell, or a CAR-NK cell.

[0064]

[50] The cell according to

[49] , which is a CAR-T cell.

[0065]

[51] The cell according to any one of

[41] to

[50] , which further contains a donor polynucleotide.

[0066]

[52] A method for cleaving a target nucleic acid sequence, comprising contacting a first target nucleic acid sequence with a ribonucleoprotein complex comprising a catalytically active Cas12 protein and a first CRISPR guide molecule, wherein the first CRISPR guide molecule comprises a CRISPR guide molecule described in any one of [1] to

[35] , the targeting region of the first CRISPR guide molecule can hybridize to the first target nucleic acid sequence, and the ribonucleoprotein complex can cleave the first target nucleic acid sequence.

[0067]

[53] The method according to

[52] , further comprising preparing a donor polynucleotide.

[0068]

[54] The method according to

[53] , further comprising cleaving the target nucleic acid sequence to obtain a cleavage site and modifying the target nucleic acid sequence.

[0069]

[55] The method according to

[54] , wherein modifying comprises inserting at least a part of the donor polynucleotide at the cleavage site.

[0070]

[56] The method according to

[54] , wherein modifying comprises deleting one or more nucleotides at the cleavage site.

[0071]

[57] The method according to

[55] , wherein the target cell sequence is present in a cell.

[0072]

[58] The method according to

[57] , wherein the cell comprises a eukaryotic cell.

[0073]

[59] The method according to

[58] , wherein the donor polynucleotide comprises a CAR expression vector.

[0074]

[60] The method according to

[59] , further comprising introducing the CAR expression vector into the cell using a viral vector.

[0075]

[61] The method according to

[60] , wherein said introducing comprises transduction.

[0076]

[62] The obtained cells are those obtained by the method according to any one of

[57] to

[61] , including lymphocytes, CAR-T cells, TCR cells, TCR-engineered CAR-T cells, TIL, CAR TIL, dendritic cells, CAR-DC, macrophages, CAR-M, NK cells, or CAR-NK cells.

[0077]

[63] The first target nucleic acid sequence is present within a target gene encoding a protein selected from the group consisting of TRAC; TRBV; beta-2 microglobulin (B2M); PD1; PD-L1; CTLA-4; LAG-3; TIGIT; TIM3; HLA-E; HLA-A; HLA-B; HLA-C; HLA-DRA; ADAM17; BTLA; CD160; SIGLEC10; 2B4; LAIR1; CD52; CD96; VSIR; VISTA; KIR2DL1; KIR2DL2; KIR2DL3; CEACAM1; CBLB; CISH; IL-1R8; AHR; adenosine 2A receptor; GMCSF; VISTA; CII2A; and NKG2A, according to any one of

[52] to

[62] .

[0078]

[64] The CAR expression vector encodes a CAR comprising an extracellular ligand-binding domain, according to any one of

[59] to

[61] .

[0079]

[65] The CAR expression vector further encodes a hinge region, a transmembrane region, and one or more intracellular signaling regions, according to

[64] .

[0080]

[66] The extracellular ligand-binding domain comprises an immunoglobulin single-chain variable fragment (scFv), according to

[64] or

[65] .

[0081]

[67] The method according to

[66] , wherein the scFv can bind to a cell target selected from the group consisting of CD37, CD38, CD47, CD73, CD4, CS1, PD-L1, NGFR, ENPP3, PSCA, CD79B, TACI, VEGFR2, B7-H3, B7-H6, B-cell maturation antigen (BCMA), CD123, CD138, CD171 / L1CAM, CD19, CD20, CD22, CD30, CD33, CD70, CD371, CEA, Claudin 18.1, Claudin 18.2, CSPG4, EFGRvIII, EpCAM, EphA2, epidermal growth factor receptor, ErbB, ErbB2 (HER2), FAP, FRα, GD2, GD3, glypican 3, IL-11Rα, IL-13Rα2, IL13 receptor alpha, Lewis Y / LeY, mesothelin, MUC1, MUC16, NKG2D ligand, PD1, PSMA, ROR-1, SLAMF7, TAG72, ULBP and MICA / B proteins, VEGF2, and WT1.

[0082]

[68] The method according to

[67] , wherein the scFv can bind to a cell target selected from the group consisting of BCMA, CD19, CD20, CD22, CD47, CD371, ROR-1, EphA2, MUC16, glypican 3, PSCA, and Claudin 18.2.

[0083]

[69] The method according to

[68] , wherein the scFv can bind to BCMA.

[0084]

[70] The method according to

[68] , wherein the scFv can bind to CD371.

[0085] Contacting a second target nucleic acid sequence in a cell with a ribonucleoprotein complex comprising a catalytically active Cas12 protein and a second CRISPR guide molecule, wherein the second CRISPR guide molecule comprises a CRISPR guide molecule according to any one of [1] to

[35] capable of binding to a target nucleic acid sequence different from the first CRISPR guide molecule, the targeting region of the second CRISPR guide molecule is capable of hybridizing to the second target nucleic acid sequence, and the ribonucleoprotein complex is further capable of cleaving the second target nucleic acid sequence, the method according to any one of

[57] to

[62] and

[64] to

[70] .

[0086]

[72] The first and second target nucleic acid sequences are each independently present within a target gene encoding a protein selected from the group consisting of TRAC; TRBV protein; beta-2 microglobulin (B2M); PD1; PD-L1; CTLA-4; LAG-3; TIGIT; TIM3; HLA-E; HLA-A; HLA-B; HLA-C; HLA-DRA; ADAM17; BTLA; CD160; SIGLEC10; 2B4; LAIR1; CD52; CD96; VSIR; VISTA; KIR2DL1; KIR2DL2; KIR2DL3; CEACAM1; CBLB; CISH; IL-1R8; AHR; adenosine 2A receptor; GMCSF; VISTA; CII2A; and NKG2A, the method according to

[71] .

[0087]

[73] The donor polynucleotide comprises a CAR expression vector, the CAR comprises an extracellular ligand-binding domain, and the extracellular ligand-binding domain comprises an scFv, the method according to

[71] or

[72] .

[0088]

[74] The scFv is capable of binding to BCMA, the method according to

[73] .

[0089]

[75] The scFv is capable of binding to CD371, the method according to

[73] .

[0090]

[76] The method according to

[72] , wherein the first target nucleic acid sequence is present within the gene encoding the TRAC protein, and the second target nucleic acid sequence is present within the gene encoding the PD1 protein.

[0091]

[77] The method according to

[72] , wherein the first target nucleic acid sequence is present within the gene encoding the TRAC protein, and the second target nucleic acid sequence is present within the gene encoding the B2M protein.

[0092]

[78] Providing a second donor polynucleotide comprising a B2M-HLA-E fusion construct to the cell, wherein at least a part of the second donor polynucleotide comprising the B2M-HLA-E fusion construct is inserted at the cleavage site of the second target nucleic acid sequence, and the B2M-HLA-E fusion construct further comprises encoding a fusion protein comprising, from the N-terminus to the C-terminus, a B2M secretion signal, an HLA-G peptide signal sequence, a first linker sequence, a B2M sequence, a second linker sequence, and an HLA-E sequence, the method according to

[77] .

[0093]

[79] The method according to

[69] or

[74] , wherein the anti-BCMA scFv comprises a heavy chain variable region (VH) comprising the amino acid sequence of SEQ ID NO: 474 and a light chain variable region (VL) comprising the amino acid sequence of SEQ ID NO: 475.

[0094]

[80] The method according to

[79] , wherein the scFv further comprises a linker between VH and VL.

[0095]

[81] The method according to

[80] , wherein the linker comprises the amino acid sequence of SEQ ID NO: 476.

[0096]

[82] The method according to

[81] , wherein the scFv comprises the amino acid sequence of SEQ ID NO: 477.

[0097]

[83] The method according to

[64] or

[73] , wherein the CAR comprises a scFv comprising VH and VL; a transmembrane domain; a co-stimulatory domain; and an activation domain.

[0098]

[84] The transmembrane domain is the transmembrane domain derived from the T cell receptor alpha chain, T cell receptor beta chain, CD3ζ chain, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, ICOS, CD154, or GITR, the method described in

[83] .

[0099]

[85] The transmembrane domain is the method described in

[84] , which includes the transmembrane domain derived from CD8.

[0100]

[86] The costimulatory domain is the costimulatory domain derived from CD28, 4-1BB, GITR, ICOS-1, CD27, OX-40, or DAP10, the method described in

[83] .

[0101]

[87] The costimulatory domain is the method described in

[86] , which includes the 4-1BB costimulatory domain.

[0102]

[88] The activation domain is the method described in

[83] , which includes the CD3ζ activation domain.

[0103]

[89] The transmembrane domain includes the transmembrane domain derived from CD8, the costimulatory domain includes the 4-1BB costimulatory domain, and the activation domain includes the CD3ζ activation domain, the method described in

[83] .

[0104]

[90] VH includes the amino acid sequence of SEQ ID NO: 474, and VL includes the amino acid sequence of SEQ ID NO: 475, the method described in

[83] .

[0105]

[91] The polynucleotide sequence encoding CAR in the CAR expression vector has a leader sequence at the 5' end, the method described in any one of

[59] to

[62] ,

[64] to

[70] ,

[73] to

[75] , and

[78] to

[90] .

[0106]

[92] The leader sequence is the method described in

[91] that includes the nucleic acid sequence of SEQ ID NO: 478.

[0107]

[93] The CAR expression vector is the method described in

[91] that includes a promoter.

[0108]

[94] The promoter is the method described in

[93] that includes the MND promoter.

[0109]

[95] The Cas12 protein has at least 80% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 479 to 490 at the C-terminus and includes a linker and an NLS-containing sequence, and is the method described in any one of

[52] to

[94] .

[0110]

[96] The linker and NLS-containing sequence includes an amino acid sequence selected from the group consisting of SEQ ID NOs: 483, 485, 487, and 489, and is the method described in

[95] .

[0111]

[97] A cell produced by the method described in any one of

[57] to

[96] .

[0112]

[98] A CAR-T cell produced by the method described in any one of

[59] to

[96] .

[0113]

[99] The CAR-T cell described in

[98] , which is an allogeneic CAR-T cell.

[0114]

[0100] The CAR-T cell described in

[98] , which is an autologous CAR-T cell.

[0115]

[0101] A method for producing a CAR-T cell, which includes using T lymphocytes as cells and implementing the method described in any one of

[59] to

[96] .

[0116]

[0102] A method of adoptive cell therapy, which includes administering to a subject in need thereof a cell produced by the method described in any one of

[57] to

[96] .

[0117]

[0103] A method of adoptive cell therapy, comprising administering to a subject in need thereof CAR-T cells produced by the method described in any one of

[59] to

[96] .

[0118]

[0104] A method of killing BCMA-positive cancer cells, comprising contacting BCMA-positive cancer cells with CAR-T cells produced by the method described in any one of

[69] ,

[74] , and

[90] .

[0119]

[0105] The method according to

[0104] , wherein the BCMA-positive cancer cells include multiple myeloma cancer cells.

[0120]

[0106] The method according to

[0105] , wherein the multiple myeloma cancer cells include human cells.

[0121]

[0107] The method according to

[0104] , wherein the contacting is within the tumor.

[0122] A method for producing CAR-expressing cells, comprising contacting a first target nucleic acid in a cell with a ribonucleoprotein complex comprising a catalytically active Cas12 protein and a first CRISPR guide molecule, wherein the first CRISPR guide molecule comprises a CRISPR guide molecule described in any one of [1] to

[35] , the targeting region of the first CRISPR guide molecule can hybridize to the first target nucleic acid sequence, and the ribonucleoprotein complex can cleave the first target nucleic acid sequence; contacting a second target nucleic acid sequence in the same cell with a ribonucleoprotein complex comprising a catalytically active Cas12 protein and a second CRISPR guide molecule, wherein the second CRISPR guide molecule comprises a CRISPR guide molecule described in any one of [1] to

[35] that can bind to a target nucleic acid sequence different from the first CRISPR guide molecule, the targeting region of the second CRISPR guide molecule can hybridize to the second target nucleic acid sequence, and the ribonucleoprotein complex can cleave the second target nucleic acid sequence; and providing the cell with a donor polynucleotide comprising a CAR expression vector, wherein at least a part of the donor polynucleotide comprising the CAR expression vector can be inserted at the cleavage site in the first target nucleic acid sequence, and CAR comprises an extracellular ligand-binding domain.

[0123] The method according to

[0108] , wherein a donor polynucleotide comprising a CAR expression vector is introduced into a cell using a viral vector.

[0124] The method according to

[0108] , wherein the CAR expression vector further encodes a hinge region, a transmembrane region, and one or more intracellular signaling regions.

[0125] The method according to any one of

[0108] to

[0110] , wherein the first target nucleic acid sequence is present within the gene encoding the TRAC protein, and the second target nucleic acid sequence is present within the gene encoding the PD1 protein.

[0126]

[0112] The first target nucleic acid sequence is present within the gene encoding the TRAC protein, and the second target nucleic acid sequence is present within the gene encoding the B2M protein, the method according to any one of

[0108] ~

[0110] .

[0127]

[0113] The extracellular ligand-binding domain comprises an immunoglobulin single-chain variable fragment (scFv), the method according to any one of

[0108] ~

[0112] .

[0128]

[0114] The scFv can bind to BCMA, the method according to

[0113] .

[0129]

[0115] The scFv can bind to CD371, the method according to

[0113] .

[0130]

[0116] The anti-BCMA scFv comprises a heavy-chain variable region (VH) containing the amino acid sequence of SEQ ID NO: 474 and a light-chain variable region (VL) containing the amino acid sequence of SEQ ID NO: 475, the method according to

[0114] .

[0131]

[0117] The scFv further comprises a linker between VH and VL, the method according to

[0116] .

[0132]

[0118] The linker contains the amino acid sequence of SEQ ID NO: 476, the method according to

[0117] .

[0133]

[0119] The scFv contains the amino acid sequence of SEQ ID NO: 477, the method according to

[0114] .

[0134] To provide the cell with a second donor polynucleotide comprising a B2M-HLA-E fusion construct, wherein at least a part of the second donor polynucleotide comprising the B2M-HLA-E fusion construct can be inserted at the cleavage site of the second target nucleic acid sequence, and the B2M-HLA-E fusion construct further comprises encoding a fusion protein containing, from the N-terminus to the C-terminus, a B2M secretion signal, an HLA-G peptide signal sequence, a first linker sequence, a B2M sequence, a second linker sequence, and an HLA-E sequence, the method according to any one of

[0108] to

[0119] .

[0135] The CAR comprises a scFv containing VH and VL; a transmembrane domain; a co-stimulatory domain; and an activation domain, the method according to any one of

[0108] to

[0120] .

[0136] The transmembrane domain comprises a transmembrane domain derived from a T cell receptor alpha chain, a T cell receptor beta chain, a CD3ζ chain, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, ICOS, CD154, or GITR, the method according to

[0121] .

[0137] The transmembrane domain comprises a transmembrane domain derived from CD8, the method according to

[0122] .

[0138] The co-stimulatory domain comprises a co-stimulatory domain derived from CD28, 4-1BB, GITR, ICOS-1, CD27, OX-40, or DAP10, the method according to

[0121] .

[0139] The co-stimulatory domain comprises a 4-1BB co-stimulatory domain, the method according to

[0124] .

[0140] The activation domain comprises a CD3ζ activation domain, the method according to

[0121] .

[0141] The method according to

[0121] , wherein the transmembrane domain comprises a transmembrane domain derived from CD8, the costimulatory domain comprises a 4-1BB costimulatory domain, and the activation domain comprises a CD3ζ activation domain.

[0142] The method according to any one of

[0108] to

[0127] , wherein the CAR-expressing cell is a CAR-T cell.

[0143] The method according to

[0128] , wherein the CAR-T cell is an allogeneic CAR-T cell.

[0144] The method according to

[0128] , wherein the CAT-T cell is an autologous CAR-T cell.

[0145] The method according to any one of

[0108] to

[0130] , wherein the Cas12 protein complexed with the first CRISPR guide molecule and / or the Cas12 protein complexed with the second CRISPR guide molecule comprises a linker and an NLS-containing sequence having at least 80% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 479 to 490 at the C-terminus.

[0146] The method according to

[0131] , wherein the Cas12 protein complexed with the first CRISPR guide molecule and / or the Cas12 protein complexed with the second CRISPR guide molecule comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 483, 485, 487, and 489.

[0147] The method according to

[78] , wherein the second donor polynucleotide further comprises a P2A sequence at the N-terminus of the B2M-HLA-E fusion construct.

[0148] The method according to

[0120] , wherein the second donor polynucleotide further comprises a P2A sequence at the N-terminus of the B2M-HLA-E fusion construct sequence.

[0149] In some embodiments, the present invention provides a CRISPR guide molecule comprising a targeting region capable of binding to a target nucleic acid sequence and an activation region comprising the RNA sequence UAAUUUCUACUCUUGUAGAU containing at least one deoxyribonucleotide instead of a ribonucleotide, wherein the activation region can form a nuclear protein complex with a Cas12 protein. In some embodiments, one or more (e.g., ten or fewer) of positions 1, 3, 7, 10, 12, 14, 15, 16, 17, 18, and 19 in the activation region contain deoxyribonucleotide bases. In some embodiments, the molecule comprises one or more chemical modifications selected from the group consisting of base modifications including inosine, deoxyinosine, deoxyuracil, xanthosine, C3 spacer, 5-methyl dC, 5-hydroxybutyl-2'-deoxyuridine, 5-nitroindole, 5-methyl iso-deoxycytosine, iso-deoxyguanosine, deoxyuridine, iso-deoxycytidine, and abasic sites, and backbone modifications including phosphorothioate modifications.

[0150] In some embodiments, the targeting region of the CRISPR guide targets the B2M gene and comprises the RNA sequence AGUGGGGGUGAAUUCAGUGU, and optionally, at least one of the bases in this sequence is replaced with a base analog or an abasic site. In some embodiments, one or more (e.g., five or fewer) of positions 1, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, and 20 in the targeting region contain deoxyribonucleotide bases. In some embodiments, the targeting region can hybridize to a sequence selected from SEQ ID NOs: 51-133. In some embodiments, the CRISPR guide comprises a sequence selected from SEQ ID NOs: 212-231, 275-315, and 331-350. In some embodiments, the CRISPR guide comprises the sequence of SEQ ID NO: 416.

[0151] In some embodiments, the targeting region of the CRISPR guide targets the TRAC gene and contains the RNA sequence GAGUCUCUCAGCUGGUACAC, and optionally, at least one of the bases in this sequence is replaced with a base analog or abasic site. In some embodiments, one or more (e.g., five or fewer) of positions 1, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, and 20 in the targeting region contain deoxyribonucleotide bases. In some embodiments, the targeting region can hybridize to a sequence selected from SEQ ID NOs: 15-20. In some embodiments, the CRISPR guide contains a sequence selected from SEQ ID NOs: 233-252, 317-329, 491-492, and 508. In some embodiments, the CRISPR guide molecule further contains a chemical modification and contains a sequence selected from SEQ ID NOs: 512-517. In some embodiments, the CRISPR guide molecule contains the sequence of SEQ ID NO: 415.

[0152] In some embodiments, the targeting region targets the CISH gene and can hybridize to a sequence selected from SEQ ID NOs: 157-165. In some embodiments, the CRISPR guide contains a sequence selected from SEQ ID NO: 509 and SEQ ID NOs: 519-529.

[0153] In some embodiments, the targeting region targets the PDCD1 gene and can hybridize to a sequence selected from SEQ ID NOs: 135-155.

[0154] In some embodiments, the targeting region targets the CBLB gene and can hybridize to a sequence selected from SEQ ID NOs: 167-189. In some embodiments, the CRISPR guide contains the sequence of SEQ ID NO: 510.

[0155] In some embodiments, the invention is a CRISPR nucleic acid / protein composition comprising the CRISPR guide molecule described above and a Cas12 protein. In some embodiments, the Cas12 protein is a Cas12a protein comprising, at its C-terminus, a linker and a nuclear localization signal (NLS)-containing sequence having at least 80% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 479-490.

[0156] In some embodiments, the invention is a cell comprising the CRISPR nucleic acid / protein composition described above, the cell being a lymphocyte, a chimeric antigen receptor (CAR) T cell, a T cell receptor (TCR) cell, a TCR-engineered CAR-T cell, a tumor-infiltrating lymphocyte (TIL), a CAR TIL, a dendritic cell (DC), a CAR-DC, a macrophage, a CAR-macrophage (CAR-M), a natural killer (NK) cell, an induced pluripotent stem cell (iPSC), a cell differentiated from an iPSC cell, or a CAR-NK cell.

[0157] In some embodiments, the present invention is a method for producing chimeric antigen receptor (CAR)-expressing cells, comprising contacting a first target nucleic acid comprising a TRAC sequence in a cell with a catalytically active Cas12 protein, and a targeting region capable of binding to the first target nucleic acid sequence; and a ribonucleoprotein complex comprising a first CRISPR guide molecule having an activation region capable of forming a nuclear protein complex with the Cas12 protein, wherein the CRISPR guide molecule comprises ribonucleotide bases and at least one deoxyribonucleotide base in the activation region, the targeting region, or both, and the ribonucleoprotein complex is capable of cleaving the first target nucleic acid sequence; contacting a second target nucleic acid comprising a B2M sequence in the same cell with a catalytically active Cas12 protein, and a targeting region capable of binding to the second target nucleic acid sequence, and a ribonucleoprotein complex comprising a second CRISPR guide molecule having an activation region capable of forming a nuclear protein complex with the Cas12 protein, wherein the CRISPR guide molecule comprises ribonucleotide bases and at least one deoxyribonucleotide base in the activation region, the targeting region, or both, and the ribonucleoprotein complex is capable of cleaving the second target nucleic acid sequence; preparing a first donor polynucleotide encoding a CAR comprising a scFv, a transmembrane domain, a co-stimulatory domain, and an activation domain, wherein the CAR can be inserted into the cleavage site in the first target nucleic acid sequence; preparing a second donor polynucleotide encoding a B2M-HLA-E fusion construct comprising a B2M secretion signal, an HLA-G peptide signal sequence, a first linker sequence, a B2M sequence, a second linker sequence, and an HLA-E sequence, wherein the B2M-HLA-E fusion construct can be inserted into the cleavage site in the second target nucleic acid sequence; cleaving the first target nucleic acid sequence and inserting at least a portion of the first donor polynucleotide into the cleavage site; and cleaving the second target nucleic acid sequence and inserting at least a portion of the second donor polynucleotide into the cleavage site. In some embodiments, the second donor polynucleotide further comprises a P2A sequence at the 5' end of the B2M-HLA-E fusion construct.In some embodiments, the first donor polynucleotide comprises SEQ ID NO: 413. In some embodiments, the second donor polynucleotide comprises SEQ ID NO: 414.

[0158] In some embodiments, the scFv in the CAR can bind to a cell target selected from the group consisting of CD37, CD38, CD47, CD73, CD4, CS1, PD-L1, NGFR, ENPP3, PSCA, CD79B, TACI, VEGFR2, B7-H3, B7-H6, B-cell maturation antigen (BCMA), CD123, CD138, CD171 / L1CAM, CD19, CD20, CD22, CD30, CD33, CD70, CD371, CEA, Claudin 18.1, Claudin 18.2, CSPG4, EFGRvIII, EpCAM, EphA2, epidermal growth factor receptor, ErbB, ErbB2 (HER2), FAP, FRα, GD2, GD3, glypican 3, IL-11Rα, IL-13Rα2, IL13 receptor alpha, Lewis Y / LeY, mesothelin, MUC1, MUC16, NKG2D ligand, PD1, PSMA, ROR-1, SLAMF7, TAG72, ULBP and MICA / B proteins, VEGF2, and WT1. In some embodiments, the scFv can bind to BCMA and comprises a first variable region having the amino acid sequence of SEQ ID NO: 474, a second variable region having the amino acid sequence of SEQ ID NO: 475, and a linker between the first variable region and the second variable region having the amino acid sequence of SEQ ID NO: 476. In some embodiments, the scF comprises the amino acid sequence of SEQ ID NO: 477.

[0159] In some embodiments, the transmembrane domain of the CAR is derived from the T cell receptor α chain, T cell receptor β chain, CD3ζ chain, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, ICOS, CD154, or GITR. In some embodiments, the co-stimulatory domain of the CAR is derived from CD28, 4-1BB, GITR, ICOS-1, CD27, OX-40, or DAP 10. In some embodiments, the CAR comprises a transmembrane domain derived from CD8, a 4-1BB co-stimulatory domain, and a CD3ζ activation domain. In some embodiments, the vector comprising the CAR sequence comprises a leader sequence having the nucleic acid sequence of SEQ ID NO: 478.

[0160] In some embodiments, the catalytically active Cas12 protein used in the method comprises, at the C-terminus, a linker and a nuclear localization signal (NLS)-containing sequence having at least 80% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 479-490.

[0161] In some embodiments, the method comprises contacting a third target nucleic acid sequence in the same cell with a catalytically active Cas12 protein, and a third CRISPR guide molecule having a targeting region capable of binding to the third target nucleic acid sequence and an activation region capable of forming a nuclear protein complex with the Cas12 protein, wherein the CRISPR guide molecule comprises ribonucleotide bases and at least one deoxyribonucleotide base in the activation region, the targeting region, or both, and the nuclear protein complex is capable of cleaving the third target nucleic acid sequence; cleaving the third target nucleic acid sequence and deleting one or more nucleotides from the third target nucleic acid sequence at the cleavage site, wherein the third target nucleic acid sequence is selected from the PDCD gene, the kCISH gene, and the CBLB gene.

[0162] In some embodiments, the CAR-expressing cells are allogeneic CAR-T cells or autologous CAR-T cells produced from T cell lymphocytes.

[0163] In some embodiments, the invention is a CAR-expressing cell produced by the method described above, which is a cell selected from lymphocytes, CAR-T cells, TCR cells, TCR-engineered CAR-T cells, TIL, CAR TIL, dendritic cells, CAR-DC, macrophages, CAR-M, iPSC cells, cells differentiated from iPSC cells, NK cells, or CAR-NK cells.

[0164] In some embodiments, the invention is a method of adoptive cell therapy, which includes administering the CAR-expressing cells described above to a subject in need thereof. In some embodiments, this adoptive cell therapy includes killing BCMA-positive cancer cells (e.g., multiple myeloma cancer cells).

[0165] Incorporation by reference All patents, publications, and patent applications cited herein are incorporated herein by reference as if each individual patent, publication, or patent application was specifically and individually indicated to be incorporated by reference in its entirety for all purposes.

[0166] The features of the present disclosure are described in detail in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that illustrates exemplary embodiments in which the principles of the present disclosure are utilized, and to the accompanying drawings. The figures are not drawn to scale and are not proportional. The positions of the labels are approximate.

Brief Description of the Drawings

[0167]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

Figure 15

Figure 16

Figure 17

Modes for Carrying Out the Invention

[0168] It should be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. As used in this specification and the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a polynucleotide" includes one or more polynucleotides, and reference to "a vector" includes one or more vectors.

[0169] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although other methods and materials similar or equivalent to those described herein may be useful in the practice of the disclosure, the preferred materials and methods are described herein.

[0170] The terms "SITE-Seq®" and "SITE-Seq® assay" refer to a biochemical method for identifying the sequences of cleavage sites within genomic DNA generated using Cas9 programmed with single guide RNA (sgRNA). This assay is fully described in Cameron, P., et al., (2017). Mapping the genomic landscape of CRISPR-Cas9 cleavage. Nature Methods, 14(6), 600-606. https: / / doi.org / 10.1038 / nmeth.4284).

[0171] In view of the teachings of this specification, one of ordinary skill in the art may apply the conventional techniques of immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics, and recombinant polynucleotides, as taught, for example, by the following standard texts: Abbas et al. (Cellular and Molecular Immunology, 2017, 9th Edition, Elsevier, ISBN 978-0323479783); Butterfield et al. (Cancer Immunotherapy Principles and Practice, 2017, 1st Edition, Demos Medical, ISBN 978-1620700976); Kenneth Murphy (Janeway’s Immunobiology, 2016, 9th Edition, Garland Science, ISBN 978-0815345053); Stevens et al. (Clinical Immunology and Serology: A Laboratory Perspective, 2016, 4th Edition, Davis Company, ISBN 978-0803644663); E.A. Greenfield (Antibodies: A Laboratory Manual, 2014, 2nd Edition, Cold Spring Harbor Laboratory Press, ISBN 978-1-936113-81-1); R.I. Freshney (Culture of Animal Cells: A Manual of Basic Technique and Specialized Applications, 2016, 7th Edition, Wiley-Blackwell, ISBN 978-1118873656); C.A. Pinkert (Transgenic Animal Technology, 3rd Edition: A Laboratory Handbook, 2014, Elsevier, ISBN 978-0124104907); H.Hedrich (The Laboratory Mouse, 2012, 2nd Edition, Academic Press, ISBN 978-0123820082); Behringer et al. (Manipulating the Mouse Embryo: A Laboratory Manual, 2013, 4th Edition, Cold Spring Harbor Laboratory Press, ISBN 978-1936113019); McPherson et al. (PCR 2: A Practical Approach, 1995, IRL Press, ISBN 978-0199634248); J.M. Walker (Methods in Molecular Biology (Series), Humana Press, ISSN 1064-3745); Rio et al. (RNA: A Laboratory Manual, 2010, Cold Spring Harbor Laboratory Press, ISBN 978-0879698911); Methods in Enzymology (Series), Academic Press; Green et al. (Molecular Cloning: A Laboratory Manual, 2012, 4th Edition, Cold Spring Harbor Laboratory Press, ISBN 978-1605500560); G.T. Hermanson (Bioconjugate Techniques, 2013, 3rd Edition, Academic Press, ISBN 978-0123822390).

[0172] Clustered regularly interspaced short palindromic repeats (CRISPRs) and associated CRISPR-associated proteins (Cas proteins) constitute the CRISPR-Cas system. The classification of the CRISPR-Cas system has been repeated many times. Makarova et al. (Nat. Rev. Microbiol., 2020, 18:67-83) proposed a classification system that considered signature cas genes specific to individual types and subtypes of the CRISPR-Cas system. This classification also considered sequence similarity among multiple shared Cas proteins, phylogeny of the most conserved Cas proteins, gene organization, and the structure of the CRISPR array. This approach provided a classification scheme that divides the CRISPR-Cas system into two different classes: Class 1 and Class 2, as follows.

[0173] In Class 2, Type V systems, Cas12 is involved in the binding of crRNA and the target, as well as in the cleavage of the target nucleic acid. For example, the RuvC-like nuclease domain of Cas12a cleaves both strands of the target nucleic acid in a staggered configuration, generating 5' overhangs, which is in contrast to the blunt ends generated by Cas9 cleavage. These 5' overhangs may facilitate DNA insertion by homologous recombination.

[0174] As V-type crRNAs and other proteins related to target binding and cleavage, Cas12b (formerly C2c1) and Cas12c (formerly C2c3) can be mentioned. The Cas12b protein and the Cas12c protein are of a similar length to the CRISPR class 2 type II Cas9 protein and the CRISPR class 2 type V Cas12a protein, ranging from about 1,100 amino acids to about 1,500 amino acids. The C2c1 protein and the C2c3 protein also contain an RuvC-like nuclease domain and have a structure similar to Cas12a. The C2c1 protein is similar to the Cas9 protein in that it requires crRNA and tracrRNA for target binding and cleavage, but the optimal cleavage temperature is 50 °C. The C2c1 protein targets an AT-rich PAM, which, like Cas12a, is present at the 5' of the target sequence. See, for example, Shmakov et al. (Molecular Cell, 2015, 60(3): 385-397).

[0175] CRISPR type V subtypes contain Cas12 proteins and exhibit a wide range of sequence and size diversity, but Cas12 subtypes share a common evolutionary origin from the TnpB nuclease encoded by the IS605-like transposon. Due to the low sequence similarity of Cas12 proteins and the possibility of evolution through multiple independent recombination events, the classification of Cas12 proteins into their respective subtypes has led to multiple nomenclature rules. Table 1 represents the classification and names of type V Cas12 proteins, as well as their approximate sizes, guide requirements, preferred target polynucleotides, and representative origin organisms.

[0176]

Table 1

[0177] Cas12 homologs can be identified using sequence similarity search methods known to those of ordinary skill in the art. Typically, a Cas12 protein can interact with a cognate Cas12 guide to form a Cas12 guide / nuclear protein complex capable of binding to a target nucleic acid sequence. In some embodiments of the present disclosure, the Cas12 protein or its homolog is a Cas12a protein or its homolog.

[0178] Examples of Cas12a proteins include, but are not limited to, Cas12a from Parcubacteria bacterium GWC2011_GWC2_44_17 (PbCpf1), Ruminococcus bacterium MC2017 (Lb3Cpf1), Butyrivibrio proteoclasticus (BpCpf1), Peregrinibacteria bacterium GW2011_GWA_33_10 (PeCpf1), Acidaminococcus spp. BV3L6 (AsCpf1), Porphyromonas macacae (PmCpf1), Ruminococcus bacterium ND2006 (LbCpf1), Porphyromonas crevioricanis (PcCpf1), Prevotella disiens (PdCpf1), Moraxella bovoculi 237 (MbCpf1), Smithella spp. SC_K08D17 (SsCpf1), Leptospira inadai (LiCpf1), Ruminococcus bacterium MA2020 (Lb2Cpf1), Francisella novicida U112 (FnCpf1), Candidatus Methanoplasma termitum (CMtCpf1), and Eubacterium eligens (EeCpf1).

[0179] In type V systems, binding of the nucleic acid target sequence typically involves the Cas12 protein and crRNA, similar to cleavage of the nucleic acid target sequence. In type V systems, the RuvC-like nuclease domain of the Cas12 protein sequentially cleaves both strands of the nucleic acid target sequence (see Swarts et al. (Mol. Cell, 2017, 66:221-233)), generating 5' overhangs, which is in contrast to the blunt ends generated by Cas9 protein cleavage.

[0180] The Cas12 protein cleavage activity of the type V system can be independent of tracrRNA (e.g., type V-A); some type V systems require only a single crRNA with a stem-loop structure that forms an internal double-strand. The Cas12 protein binds to crRNA in a sequence-specific and structure-specific manner by recognizing the stem-loop and the sequence adjacent to the stem-loop (especially the 5'-nucleotide of the spacer sequence) that hybridizes to the nucleic acid target sequence. This stem-loop structure typically ranges from 15 to 22 nucleotides in length. Substitutions that disrupt this stem-loop duplex result in the loss of cleavage activity, while other substitutions that do not disrupt the stem-loop duplex do not result in the loss of cleavage activity. Certain type V systems (e.g., type V-F1, V-G, V-C, V-E (CasX), V-K, and V-B) require hybridization between crRNA and tracrRNA. See Yan et al. (Science, 2019, 363(6422):88-91).

[0181] "Guide" and "guide polynucleotide", as used herein, refer to one or more polynucleotides that form a nuclear protein complex with a Cas protein, which nuclear protein complex preferentially binds to a nucleic acid target sequence in the polynucleotide (as compared to a polynucleotide that does not contain the nucleic acid target sequence). Such guides can include: ribonucleotide bases (e.g., RNA), deoxyribonucleotide bases (e.g., DNA), combinations of ribonucleotide bases and deoxyribonucleotide bases (e.g., RNA / DNA), nucleotide analogs, modified nucleotides, and the like, as well as synthetic, naturally occurring, and non-naturally occurring modified backbone residues or linkages. Many such guides are known, for example, but not limited to, single guide RNAs (e.g., including small and truncated single guide RNAs), crNAs, dual guide RNAs, e.g., but not limited to, crRNA / tracrRNA molecules, and the like, and their use depends on the particular Cas protein. For example, a "type V CRISPR-Cas12 associated guide" is a guide that specifically associates with a cognate Cas12 protein to form a nuclear protein complex.

[0182] As used herein, "CRISPR polynucleotide" refers to a polynucleotide sequence that includes a portion of a guide molecule. In some embodiments, the CRISPR polynucleotide includes a targeting region and / or an activation region.

[0183] With respect to a guide molecule, "spacer", "spacer sequence", "spacer element", or "targeting region", as used herein, refers to a polynucleotide sequence that can specifically hybridize to a target nucleic acid sequence. The targeting region interacts with the target nucleic acid sequence through hydrogen bonds between complementary base pairs (i.e., paired bases). The targeting region binds to a selected nucleic acid target sequence. In some embodiments, the target sequence is a sequence within the genome of a cell, either in vitro, ex vivo (e.g., in the generation of CAR-T cells, etc.), or in vivo (e.g., when the composition is administered directly to a subject). A guide molecule can comprise, or consist of, any sequence selected to target any target sequence. Exemplary target sequences include those unique to the target genome. Thus, the targeting region is a nucleic acid target-binding sequence. The targeting region determines the site-specific binding and nuclease cleavage positions of the Cas12 protein. The variability in the functional length of the targeting region is known in the art.

[0184] As used herein, the term "activation region" refers to a portion of a polynucleotide that can associate or bind with a Cas12 polypeptide, such as a Cas12a polypeptide.

[0185] As used herein, the terms "abasic", "abasic site", "abasic nucleotide", "apurinic / apyrimidinic site", and "AP site" are used interchangeably and refer to a site in a nucleotide sequence that lacks a purine or pyrimidine base. In certain embodiments, the abasic site comprises a deoxyribose moiety. In other embodiments, the abasic site comprises a ribose moiety. In still further embodiments, the abasic site comprises a modified backbone (e.g., a phosphorothioate backbone or a morpholino backbone). Since the abasic site does not contain a nitrogenous base, it does not form a hydrogen base pair with the complementary nitrogenous base of a DNA or RNA nucleotide.

[0186] As used herein, the terms "base analog", "non-standard base", and "chemically modified base" refer to compounds that are structurally similar to the standard purine or pyrimidine bases found in DNA or RNA. Base analogs may contain modified sugars and / or modified nucleobases when compared to the purine or pyrimidine bases that occur naturally in DNA or RNA. In some embodiments, the base analog is inosine or deoxyinosine such as 2'-deoxyinosine. In other embodiments, the base analog is a 2'-deoxyribonucleoside, 2'-ribonucleoside, 2'-deoxyribonucleotide, or 2'-ribonucleotide, wherein the nucleobase is a modified base (e.g., xanthine, uridine, oxanine (oxanosine), 7-methylguanosine, dihydrouridine, 5-methylcytidine, C3 spacer, 5-methyl dC, 5-hydroxybutynyl-2'-deoxyuridine, 5-nitroindole, 5-methyl iso-deoxycytosine, iso-deoxyguanosine, deoxyuridine, iso-deoxycytidine, other 0-1 purine analogs, N-6-hydroxylaminopurine, nebularine, 7-deaza hypoxanthine, other 7-deazapurines, and 2-methylpurine). In some embodiments, the base analog is selected from the group consisting of 7-deaza-2'-deoxyinosine, 2'-aza-2'-deoxyinosine, PNA-inosine, morpholino-inosine, LNA-inosine, phosphoramidite-inosine, 2'-O-methoxyethyl-inosine, and 2'-OMe-inosine. The term "base analog" also includes, for example, 2'-deoxyribonucleoside, 2'-ribonucleoside, 2'-deoxyribonucleotide, or 2'-ribonucleotide, wherein the nucleobase is substituted hypoxanthine. For example, substituted hypoxanthine can be substituted with a halogen, e.g., fluorine or chlorine. In some embodiments, the base analog can be fluoroinosine or chloroinosine, e.g., 2-chloroinosine, 6-chloroinosine, 8-chloroinosine, 2-fluoroinosine, 6-fluoroinosine, or 8-fluoroinosine. In other embodiments, the base analog is deoxyuridine.In other embodiments, the base analogs are nucleic acid mimics (e.g., xeno nucleic acids and xenonucleic acids (XNA)).

[0187] As used herein, the term "CRISPR hybrid RNA / DNA guide" (chRDNA) refers to a polynucleotide guide molecule that includes a targeting region, and the polynucleotide includes RNA having DNA designed for this polynucleotide. In embodiments herein, the crRNA component of the Cas12a guide is chRDNA.

[0188] As used herein, the term "Cas12 chRDNA guide / nuclear protein complex" refers to a chRDNA guide molecule that complexes with a Cas12 protein to form a nuclear protein complex, and this nuclear protein complex can specifically bind to a nucleic acid target sequence complementary to the nucleic acid target binding sequence present in the chRDNA guide molecule. As used herein, the term "Cas12a chRDNA guide / nuclear protein complex" refers to a chRDNA guide molecule that complexes with a Cas12a protein to form a nuclear protein complex, and this nuclear protein complex can specifically bind to a nucleic acid target sequence complementary to the nucleic acid target binding sequence present in the chRDNA guide molecule.

[0189] As used herein, "stem element" or "stem structure" refers to two strands of nucleic acid that form a double-stranded region ("stem element"). "Stem-loop element" or "stem-loop structure" refers to a stem structure in which the 3' end sequence of one strand is covalently linked to the 5' end sequence of a second strand by a nucleotide sequence of typically single-stranded nucleotides ("stem-loop element nucleotide sequence"). In some embodiments, the loop element comprises a stem-loop element nucleotide sequence that is about 3 to about 20 nucleotides in length, preferably about 4 to about 10 nucleotides in length. In some embodiments, the stem-loop element nucleotide sequence is a single-stranded nucleotide sequence of unpaired nucleobases that do not interact via hydrogen bond formation to give rise to a stem element within the stem-loop element nucleotide sequence. The term "hairpin element" is also used herein to refer to a stem-loop structure. Such structures are well known in the art. Base pairing can be exact, but as is known in the art, stem elements do not require exact base pairing. Thus, a stem element may contain one or more base mismatches or unpaired bases. A stem-loop element may further comprise a pseudoknot structure.

[0190] "Linker element nucleotide sequence", "linker nucleotide sequence", and "linker polynucleotide" are used interchangeably herein and refer to a sequence of one or more nucleotides covalently attached to a first nucleic acid sequence (5'-linker nucleotide sequence - first nucleic acid sequence - 3'). In some embodiments, the linker nucleotide sequence connects two separate nucleic acid sequences to form a single polynucleotide (e.g., 5'-first nucleic acid sequence - linker nucleotide sequence - second nucleic acid sequence - 3'). Other examples of linker sequences include, but are not limited to, 5'-first nucleic acid sequence - linker nucleotide sequence - 3', and 5'-linker nucleotide sequence - first nucleic acid sequence - linker nucleotide sequence - 3'. In some embodiments, the linker element nucleotide sequence can be a single-stranded nucleotide sequence of unpaired nucleobases that do not interact with each other via hydrogen bond formation to produce a secondary structure (e.g., a stem-loop structure) within the linker element nucleotide sequence. In some embodiments, two single-stranded linker element nucleotide sequences can interact with each other via hydrogen bonds between the two linker element nucleotide sequences. In some embodiments, the linker element nucleotide sequence can be between about 1 and about 50 nucleotides in length, preferably between about 1 and about 15 nucleotides in length.

[0191] As used herein, the term "cognate" typically refers to a ribonucleoprotein complex that can specifically bind to a nucleic acid target sequence complementary to a nucleic acid target binding sequence present in one of a Cas12 protein (e.g., Cas12a) and one or more guides, and one or more type V CRISPR-Cas12-related guides (e.g., Cas12 chRDNA guides) that can form such a complex.

[0192] The terms "wild-type," "naturally occurring," and "unmodified" are used herein to mean the typical (or most common) form, appearance, phenotype, or strain that occurs in nature; for example, they are used to mean the typical form of a cell, organism, polynucleotide, protein, macromolecular complex, gene, RNA, DNA, or genome that exists in a natural source and is isolated from that source. A wild-type form, appearance, phenotype, or strain functions as the original parent before any intended modification. Thus, mutant forms, variant forms, engineered forms, recombinant forms, and modified forms are not wild-type forms.

[0193] When referring to a polypeptide, "isolated" means that the indicated molecule is separate from the whole organism in which it is found in nature, or that it exists in a state in which no other biological macromolecules of the same type are substantially present. The term "isolated" with respect to a polynucleotide refers to a nucleic acid molecule that lacks all or part of the sequences that are normally associated with it in nature; or to a sequence that is the same as that found in nature but has heterologous sequences associated with it; or to a molecule that is not associated with a chromosome.

[0194] As used herein, the term "purified" preferably means that at least 75% by weight, more preferably at least 85% by weight, more preferably at least 95% by weight, and most preferably at least 98% by weight of the same molecule is present.

[0195] The terms "engineered", "genetically engineered", "genetically modified", "recombinant", "modified", "not naturally occurring", and "non-natural" indicate an intentional human manipulation of the genome of an organism or cell. These terms encompass methods of genome modification, including genome editing as defined herein, as well as techniques for altering gene expression or inactivation, enzyme engineering, directed evolution, knowledge-based design, random mutagenesis methods, gene shuffling, codon optimization, and the like. Methods of gene manipulation are known in the art.

[0196] "Covalent bond", "covalently attached", "covalently bonded", "covalently linked", "covalently connected", and "molecular bond" are used interchangeably herein and refer to a chemical bond involving the sharing of a pair of electrons between atoms. Examples of covalent bonds include, but are not limited to, phosphodiester bonds and phosphorothioate bonds.

[0197] "Non-covalent bond", "non-covalently attached", "non-covalently bonded", "non-covalently linked", "non-covalent interaction", and "non-covalently connected" are used interchangeably herein and refer to any relatively weak chemical bond that does not involve the sharing of a pair of electrons. Multiple non-covalent bonds often stabilize the higher-order structure of macromolecules and mediate specific intermolecular interactions. Examples of non-covalent bonds include, but are not limited to, hydrogen bonds, ionic interactions (e.g., Na + Cl - ), van der Waals interactions, and hydrophobic bonds.

[0198] As used herein, "hydrogen bond", "hydrogen-base pair formation", and "hydrogen-bonded" are used interchangeably and refer to standard and non-standard hydrogen bonds including, but not limited to, "Watson-Crick hydrogen-bonded base pairs" (W-C hydrogen-bonded base pairs or W-C hydrogen bonds); "Hoogsteen hydrogen-bonded base pairs" (Hoogsteen hydrogen bonds); and "wobble hydrogen-bonded base pairs" (wobble hydrogen bonds). W-C hydrogen bonds (including reverse W-C hydrogen bonds) refer to purine-pyrimidine base pair bonds, i.e., adenine:thymine, guanine:cytosine, and uracil:adenine. Hoogsteen hydrogen bonds (including reverse Hoogsteen hydrogen bonds) refer to a distortion of base pair formation in nucleic acids in which two nucleic acid bases (one on each strand) are held together by hydrogen bonds in the major groove. This non-W-C hydrogen bond can allow a third strand to wrap around the double strand to form a triple-stranded helix. Wobble hydrogen bonds (including reverse wobble hydrogen bonds) refer to the pairing between two nucleotides in an RNA molecule that does not follow the Watson-Crick base pair rule. There are the following four major wobble base pairs: guanine:uracil, inosine (hypoxanthine):uracil, inosine:adenine, and inosine:cytosine. It is also known that wobble base interactions occur between inosine:thymine and inosine:guanine. Inosine bases and deoxyinosine bases can hydrogen bond with standard DNA and RNA bases and are thus referred to as "universal pairing bases". See, for example, Watkins et al. (Nucleic Acid Research, 2005, 33(19):6258-67). The rules of standard and non-standard hydrogen bonds are known to those skilled in the art.For example, see R.F. Gesteland (The RNA World, 3rd Edition (Cold Spring Harbor Monograph Series), 2005, Cold Spring Harbor Laboratory Press, ISBN 978-0879697396); R.F. Gesteland (The RNA World, 2nd Edition (Cold Spring Harbor Monograph Series), 1999, Cold Spring Harbor Laboratory Press, ISBN 978-0879695613); R.F. Gesteland (The RNA World, 1st Edition (Cold Spring Harbor Monograph Series), 1993, Cold Spring Harbor Laboratory Press, 978-0879694562) (for example, see Appendix 1: Structures of Base Pairs Involving at Least Two Hydrogen Bonds, I, Tinoco); W. Saenger (Principles of Nucleic Acid Structure, 1988, Springer International Publishing AG, ISBN 978-0-387-90761-1); S. Neidle (Principles of Nucleic Acid Structure, 2007, 1st Edition, Academic Press, ISBN 978-01236950791).

[0199] "Connect", "connected", and "connecting" are used interchangeably herein and refer to a covalent or non-covalent bond between two macromolecules (e.g., polynucleotides, proteins, and the like).

[0200] As used herein, the terms "nucleic acid sequence", "nucleotide sequence", and "oligonucleotide" are interchangeable and refer to a polymeric form of nucleotides. As used herein, the term "polynucleotide" refers to a polymeric form of nucleotides having one 5' end and one 3' end and may contain one or more nucleic acid sequences. Nucleotides can be deoxyribonucleotides (DNA), ribonucleotides (RNA), analogs thereof, or combinations thereof, and can be of any length. Polynucleotides can perform any function and can have various secondary and tertiary structures. These terms include known analogs of natural nucleotides, as well as nucleotides modified in the base, sugar, and / or phosphate moieties. Certain nucleotide analogs have the same base pairing specificity (e.g., similarity of the A-T base pair). A polynucleotide can contain one modified nucleotide or multiple modified nucleotides. Examples of modified nucleotides include fluorinated nucleotides, methylated nucleotides, chemically modified sugars, and nucleotide analogs. The nucleotide structure is modified either before or after the polymer is assembled. After polymerization, the polynucleotide is further modified, for example, by conjugation with a labeling component or a target binding component. A nucleotide sequence can incorporate non-nucleotide components. These terms also include nucleic acids containing synthetic, naturally occurring, and / or non-naturally occurring modified backbone residues or linkages and having binding properties similar to those of a reference polynucleotide (e.g., DNA or RNA). Examples of such analogs include, but are not limited to, phosphorothioates, phosphoramidates, methylphosphonates, chiral-methylphosphonates, 2-O-methyl ribonucleotides, peptide-nucleic acids (PNA), locked nucleic acids (LNA™) (Exiqon Woburn MA) nucleosides, glycol nucleic acids, bridged nucleic acids, and morpholino structures.

[0201] Peptide nucleic acid (PNA) is a synthetic homolog of nucleic acid in which the phosphate-sugar backbone of polynucleotide is replaced by a flexible pseudopeptide polymer. Nucleic acid bases are linked to this polymer. PNA has the ability to hybridize with complementary sequences of RNA and DNA with high affinity and specificity.

[0202] In phosphorothioate nucleic acid, a sulfur atom is substituted for a non-bridging oxygen in the phosphate backbone of the polynucleotide by a phosphorothioate (PS) bond. This modification causes the linkage between nucleotides to become resistant to nuclease degradation. In some embodiments, phosphorothioate bonds are introduced between the last 3 to 5 nucleotides of the 5'-terminal sequence or the 3'-terminal sequence of the polynucleotide sequence, inhibiting exonuclease degradation. Similarly, the placement of phosphorothioate bonds throughout the oligonucleotide helps reduce degradation by endonucleases.

[0203] Threose nucleic acid (TNA) is an artificial genetic polymer. The backbone structure of TNA contains repeating threose sugars linked by phosphodiester bonds. TNA polymers exhibit resistance to nuclease degradation. TNA can self-assemble into a double-stranded structure by base-pair hydrogen bonding.

[0204] The use of "reverse phosphoramidite" can introduce chain inversion into polynucleotides (see, for example, www.ucalgary.ca / dnalab / synthesis / -modifications / linkages). The 3'-3' linkage at the end of a polynucleotide stabilizes this polynucleotide against exonuclease degradation by generating an oligonucleotide with two 5'-OH ends but lacking a 3'-OH end. Typically, such a polynucleotide has a phosphoramidite group at the 5'-OH position and a dimethoxytrityl (DMT) protecting group at the 3'-OH position. Usually, the DMT protecting group is located on the 5'-OH and the phosphoramidite is located on the 3'-OH.

[0205] Unless otherwise indicated herein, polynucleotide sequences are shown in the conventional 5' to 3' direction.

[0206] As used herein, "sequence identity" generally refers to the percent identity of nucleotide bases or amino acids that are compared between a first polynucleotide or polypeptide and a second polynucleotide or polypeptide using an algorithm having various weighting parameters. The sequence identity between two polynucleotides or two polypeptides can be determined using sequence alignment by various methods and computer programs (e.g., BLAST, CS-BLAST, FASTA, HMMER, L-ALIGN, and the like) available via the World Wide Web at sites including, but not limited to, GENBANK (www.ncbi.nlm.nih.gov / genbank / ) and EMBL-EBI (www.ebi.ac.uk.). The sequence identity between two polynucleotide sequences or two polypeptide sequences is generally calculated using the standard default parameters of various methods or computer programs. A high degree of sequence identity between two polynucleotides or two polypeptides typically refers to about 90% identity to 100% identity over the length of the reference polypeptide, e.g., about 90% or more identity, preferably about 95% or more identity, more preferably about 98% or more identity. A moderate degree of sequence identity between two polynucleotides or two polypeptides typically refers to between about 80% identity and about 85% identity over the length of the reference polypeptide, e.g., about 80% or more identity, preferably about 85% or more identity. A low degree of sequence identity between two polynucleotides or two polypeptides typically refers to between about 50% identity and 75% identity over the length of the reference polypeptide, e.g., about 50% identity, preferably about 60% identity, more preferably about 75% identity. For example, a Cas12 protein (e.g., Cas12 containing amino acid substitutions) can have a low degree of sequence identity, a moderate degree of sequence identity, or a high degree of sequence identity over its length to a reference Cas12 protein (e.g., wild-type Cas12).As another example, a guide molecule can have low, medium, or high sequence identity over its length compared to a reference wild-type guide molecule that complexes with a reference Cas12 protein (e.g., a polynucleotide that forms a complex with Cas12 over its length).

[0207] As used herein, "hybridization," "hybridizes," or "hybridized" refers to the process of combining two complementary single-stranded nucleic acid (e.g., DNA or RNA) molecules to form a single double-stranded molecule (e.g., DNA / DNA, DNA / RNA, RNA / RNA) through hydrogen bonding. Hybridization stringency is typically determined by the hybridization temperature and the salt concentration of the hybridization buffer. For example, high stringency hybridization conditions are achieved by high temperature and low salt. Examples of salt concentration ranges and temperature ranges for different hybridization conditions are as follows: high stringency, about 0.01 M to about 0.05 M salt, hybridization temperature T m 5°C to 10°C lower than; medium stringency, about 0.16 M to about 0.33 M salt, hybridization temperature T m 20°C to 29°C lower than; and low stringency, about 0.33 M to about 0.82 M salt, hybridization temperature T m 40°C to 48°C lower than. The T of the double-stranded nucleic acid sequence mIt is calculated by standard methods well-known in the art. See, for example, Maniatis et al. (Molecular Cloning: A Laboratory Manual, 1982, Cold Spring Harbor Laboratory Press: New York); Casey et al. (Nucleic Acids Research, 1977, 4: 1539-1552); Bodkin et al. (Journal of Virological Methods, 1985, 10(1): 45-52); and Wallace et al. (Nucleic Acids Research, 1981, 9(4): 879-894). T m Algorithm prediction tools for estimating m are also widely available. High stringency conditions for hybridization typically refer to conditions under which a polynucleotide complementary to the target sequence hybridizes predominantly to the target sequence and substantially not to non-target sequences. Typically, the hybridization conditions are of medium stringency and preferably of high stringency.

[0208] As used herein, "complementarity" refers to the ability of a nucleic acid sequence to form hydrogen bonds with another nucleic acid sequence (e.g., via standard Watson-Crick base pairing). The percentage of complementarity indicates the percentage of residues in a nucleic acid sequence that can form hydrogen bonds with a second nucleic acid sequence. When two nucleic acid sequences have 100% complementarity, these two sequences are completely complementary, i.e., all consecutive residues of the first polynucleotide hydrogen bond with the same number of consecutive residues in the second polynucleotide.

[0209] As used herein, the term "corresponding deoxyribonucleotide base" with respect to a ribonucleotide base refers to a deoxyribonucleotide base (including, for example, a modified version or variant version of a standard deoxyribonucleotide base) that binds to the same base as this ribonucleotide base via complementary (Watson-Crick) base pairing. For example, in the case of ribonucleotide bases A, C, and G, the corresponding deoxyribonucleotide bases can be A, C, and G, respectively. In the case of ribonucleotide base U, the corresponding deoxyribonucleotide base can be, for example, T.

[0210] As used herein, "binding" refers to non-covalent interactions between macromolecules (e.g., between a protein and a polynucleotide, between a polynucleotide and a polynucleotide, or between a protein and a protein, and the like). Such non-covalent interactions are also referred to as "associating" or "interacting" (e.g., when a first macromolecule interacts with a second macromolecule, this first macromolecule binds non-covalently to the second macromolecule). Some of the binding interactions can be sequence-specific (the terms "sequence-specific binding", "binds sequence-specifically", "site-specific binding", and "binds site-specifically" are used interchangeably herein). Sequence-specific binding typically refers to one or more guide molecules that can form a complex with a protein (e.g., Cas12) and preferentially bind a nucleic acid sequence (e.g., a DNA sequence) containing a nucleic acid target sequence (e.g., a target DNA sequence) as compared to a second nucleic acid sequence (e.g., a second DNA sequence) that does not contain a nucleic acid target binding sequence (e.g., a DNA target binding sequence). Not all components of the binding interaction need to be sequence-specific (e.g., the contact between a protein and a phosphate residue in the DNA backbone). The binding interaction can be characterized by a dissociation constant (Kd). "Binding affinity" refers to the strength of the binding interaction. Increased binding affinity correlates with a lower KD.

[0211] As used herein, a Cas12 protein is said to "target" a polynucleotide if the Cas12 guide / nuclease complex binds to or cleaves the polynucleotide at a nucleic acid target sequence within the polynucleotide.

[0212] "Protospacer adjacent motif" or "PAM", as used herein, refers to a double-stranded nucleic acid sequence that includes a Cas12 protein-binding recognition sequence, and the amino acids of the Cas12 protein interact directly with this recognition sequence (e.g., the Cas12a protein interacts with PAM 5'-TTTN-3' or PAM 5'-TTTV-3'). The PAM sequence is present on the non-target strand and can be 5' or 3' of the target complementary sequence (e.g., in the CRISPR-Cas12a system, the PAM 5'-TTTN-3' sequence or the PAM 5'-TTTV-3' sequence is present on the non-target sequence and is 5' of the target complementary sequence). The PAM is recognized by the Cas12 effector protein (e.g., the Cas12a protein) prior to unwinding of the target sequence and hydrogen base pair formation between the target sequence and the nucleic acid target binding sequence.

[0213] "Target", "target sequence", "nucleic acid target sequence", "target nucleic acid sequence", and "on-target sequence" are used interchangeably herein to refer to a nucleic acid sequence that is fully or partially complementary to the nucleic acid target binding sequence (e.g., targeting region) of a Cas12 polynucleotide. Typically, the nucleic acid target binding sequence is selected to be 100% complementary to the nucleic acid target sequence to which binding of the Cas12 nuclease complex is directed, although a lower percentage of complementarity may be used to weaken binding to the nucleic acid target sequence.

[0214] When the nucleic acid target binding sequence is 100% complementary to the target sequence except for the abasic sites contained in the nucleic acid target binding sequence, this target nucleic acid is referred to as "on-target". On-target sequence binding refers to the binding of the Cas12 guide / nuclear protein complex to a nucleic acid sequence having 100% complementarity to the non-abasic site portion of the nucleic acid target binding sequence (spacer). When the nucleic acid target binding sequence (spacer) has less than 100% complementarity to the target sequence except for the abasic sites contained in this nucleic acid target binding sequence, this target sequence is referred to as "off-target". Off-target sequence binding refers to the binding of the Cas12 guide / nuclear protein complex to a nucleic acid sequence having less than 100% complementarity to the non-abasic site portion of the nucleic acid target binding sequence (spacer). The nucleic acid target sequence can be a double-stranded DNA molecule or a single-stranded DNA molecule. The target sequence can be a double-stranded DNA molecule or a single-stranded DNA molecule. The target sequence can be an RNA:DNA hybrid molecule. The target sequence can be present on the strand opposite to the PAM sequence.

[0215] As used herein, "double-strand break" (DSB) refers to the cleavage of both strands of a double-stranded segment of DNA. In some cases, when such cleavage occurs, one strand is said to have a "sticky end" where the nucleotides are exposed and not hydrogen-bonded to the nucleotides on the other strand. In other cases, a "blunt end" can occur where both strands remain fully base-paired to each other.

[0216] "Donor polynucleotide", "donor oligonucleotide", "donor template", "non-viral donor", and "non-viral template" are used interchangeably herein and can be double-stranded polynucleotides (e.g., DNA), single-stranded polynucleotides (e.g., DNA or RNA), or combinations thereof. A donor polynucleotide can include homology arms flanking an insertion sequence (e.g., a DSB in DNA). The homology arms on each side can vary in length. Parameters for the design and construction of donor polynucleotides are well known in the art. See, for example, Ran et al. (Nature Protocols, 2013, 8(11):2281-2308); Smithies et al. (Nature, 1985, 317:230-234); Thomas et al. (Cell, 1986, 44:419-428); Wu et al. (Nature Protocols, 2008, 3:1056-1076); Singer et al. (Cell, 1982, 31:25-33); Shen et al. (Genetics, 1986, 112:441-457); Watt et al. (PNAS, 1985, 82:4768-4772); Sugawara et al. (Journal of Molecular Cell Biology, 1992, 12(2):563-575); Rubnitz et al. (Journal of Molecular Cell Biology, 1984, 4(11):2253-2258); Ayares et al. (PNAS, 1986, 83(14):5199-5203); and Liskay et al. (Genetics, 1987, 115(1):161-167). In some embodiments, the donor polynucleotide includes a chimeric antigen receptor (CAR).

[0217] As used herein, "homology-directed repair" (HDR) refers to DNA repair that occurs in a cell, for example, during the repair of a DSB in DNA. HDR requires nucleotide sequence homology and uses a donor polynucleotide to repair the sequence in which the DSB (e.g., a DSB within a target DNA sequence) occurred. The donor polynucleotide generally has sequence homology with the sequence adjacent to the DSB that is necessary for the donor polynucleotide to function as a suitable template for repair. Through HDR, genetic information is transmitted, for example, from the donor polynucleotide to the target DNA sequence. If the donor polynucleotide sequence is different from the target DNA sequence and part or all of this donor polynucleotide is incorporated into this target DNA sequence, the target DNA sequence may be altered (e.g., insertion, deletion, or mutation) by HDR. In some embodiments, the entire donor polynucleotide, a part of the donor polynucleotide, or a copy of the donor polynucleotide is incorporated at the site of the target DNA sequence. For example, the donor polynucleotide can be used for the repair of a cleavage in the target DNA sequence, and through this repair, genetic information (e.g., a polynucleotide sequence) from the donor polynucleotide is transmitted at or near the site of the cleavage in the DNA. Thus, new genetic information (e.g., a polynucleotide sequence) can be inserted or copied at the target DNA sequence.

[0218] As used herein, "homology independent targeted integration" (HITI) refers to DNA repair that occurs in a cell, for example, during the repair of a DSB in DNA. Unlike HDR, HITI does not require nucleotide sequence homology and uses a donor polynucleotide to repair the sequence in which a DSB (e.g., a DSB in a target DNA sequence) has occurred. By HITI, genetic information is transmitted, for example, from a donor polynucleotide to a target DNA sequence. If the donor polynucleotide sequence is different from the target DNA sequence and some or all of this donor polynucleotide is integrated into this target DNA sequence, the target DNA sequence may be altered (e.g., inserted, deleted, or mutated) by HITI. In some embodiments, the entire donor polynucleotide, a portion of the donor polynucleotide, or a copy of the donor polynucleotide is integrated at a site in the target DNA sequence. For example, a donor polynucleotide can be used for the repair of a cleavage in a target DNA sequence, and this repair results in the transmission of genetic information (e.g., a polynucleotide sequence) from the donor polynucleotide at or near the site of the cleavage in the DNA. Thus, new genetic information (e.g., a polynucleotide sequence) can be inserted or copied at the target DNA sequence.

[0219] A "genomic region" is a segment of a chromosome in the genome of a host cell that is present on either side of a nucleic acid target sequence site or that also includes a portion of the nucleic acid target sequence site. The homology arms of a donor polynucleotide have sufficient homology to undergo homologous recombination with the corresponding genomic region. In some embodiments, the homology arms of the donor polynucleotide share significant sequence homology with the genomic region immediately adjacent to the nucleic acid target sequence site; it is recognized that the homology arms can be designed to have sufficient homology to a genomic region that is distant from the nucleic acid target sequence site.

[0220] As used herein, "non-homologous end joining" (NHEJ) refers to the repair of DSBs in DNA by direct ligation of one end of a break to the other end of the break, without the need for a donor polynucleotide. NHEJ is a DNA repair pathway available to cells for repairing DNA without using a repair template. NHEJ in the absence of a donor polynucleotide often results in random insertion or deletion of nucleotides at the site of the DSB.

[0221] "Microhomology-mediated end joining" (MMEJ) is a pathway for repairing DSBs in DNA. MMEJ involves deletions adjacent to the DSB and alignment of microhomologous sequences inside the cleavage site prior to ligation. MMEJ is genetically defined and requires, for example, the activity of CtIP, poly(ADP-ribose) polymerase 1 (PARP1), DNA polymerase theta (Pol θ), DNA ligase 1 (Lig 1), or DNA ligase 3 (Lig 3). Additional genetic components are known in the art. See, for example, Sfeir et al. (Trends in Biochemical Sciences, 2015, 40:701-714).

[0222] As used herein, "DNA repair" encompasses any process by which the cell machinery repairs damage to DNA molecules contained within the cell. Damage to be repaired includes single-strand breaks or double-strand breaks (DSBs). There are at least three mechanisms for repairing DSBs: HDR, NHEJ, and MMEJ. "DNA repair" is also used herein to refer to DNA repair resulting from human manipulation in which a target locus is modified, for example, by inserting, deleting, or substituting nucleotides (all of which represent forms of genome editing).

[0223] As used herein, "recombinant" refers to the process of exchange of genetic information between two polynucleotides.

[0224] As used herein, the terms "regulatory sequence", "regulatory element", and "control element" are interchangeable and refer to a polynucleotide sequence that is upstream (5' non-coding sequence), within, or downstream (3' non-coding sequence) of the polynucleotide target to be expressed. Regulatory sequences affect, for example, the timing of transcription, the amount or level of transcription, RNA processing or stability, and / or translation of the associated structural nucleotide sequence. Regulatory sequences include, for example, activator binding sequences, enhancers, introns, polyadenylation recognition sequences, promoters, transcription start sites, repressor binding sequences, stem-loop structures, translation initiation sequences, internal ribosome entry sites (IRES), translation leader sequences, transcription termination sequences (e.g., polyadenylation signals and polyU sequences), translation termination sequences, primer binding sites, and the like.

[0225] As regulatory elements, those that direct constitutive, inducible, or repressible expression of a nucleotide sequence in many types of hosts, and those that direct expression of a nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences) can be mentioned. In some embodiments, the vector comprises one or more pol III promoters, one or more pol II promoters, one or more pol I promoters, or combinations thereof. Examples of pol III promoters include, but are not limited to, the U6 promoter and the H1 promoter. Examples of pol II promoters include, but are not limited to, the Rous sarcoma virus (RSV) LTR promoter of retrovirus (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer: see, for example, Boshart et al. (Cell, 1985, 41: 521-530)), the SV40 promoter, the dihydrofolate reductase promoter, the β-actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EF1α promoter. Those skilled in the art will understand that the design of the expression vector may depend on factors such as the choice of host cell to be transformed, the desired level of expression, and the like. The vector is introduced into the host cell, whereby a transcript, protein, or peptide containing a fusion protein or peptide encoded by the nucleic acid sequence as described herein is produced.

[0226] "Gene", as used herein, refers to a polynucleotide sequence comprising exons and related regulatory sequences. A gene may further include introns and / or untranslated regions (UTRs).

[0227] As used herein, the term "operably linked" refers to polynucleotide sequences or amino acid sequences that are arranged so as to be functionally related to each other. For example, a regulatory sequence (e.g., a promoter or enhancer) is "operably linked" to a polynucleotide encoding a gene product if the regulatory sequence regulates or contributes to the regulation of transcription of the polynucleotide. An operably linked regulatory element is typically contiguous with the coding sequence. However, an enhancer can function even when separated from the promoter by up to several kilobases. Thus, some regulatory elements are operably linked to a polynucleotide sequence but may not be contiguous with this polynucleotide sequence. Similarly, translational regulatory elements contribute to the regulation of protein expression from a polynucleotide.

[0228] As used herein, "expression" refers to the transcription of a polynucleotide from a DNA template, for example, resulting in messenger RNA (mRNA) or other RNA transcripts (e.g., non-coding, e.g., structural or scaffold RNA). The term further refers to the process by which the transcribed mRNA is translated into a peptide, polypeptide, or protein. The transcript and the encoded polypeptide can be collectively referred to as a "gene product". When the polynucleotide is derived from genomic DNA, expression can include splicing of the mRNA in a eukaryotic cell.

[0229] A "coding sequence", or a sequence that "encodes" a selected polypeptide, is a nucleic acid molecule that is transcribed (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vitro or in vivo when placed under the control of suitable regulatory sequences. The boundaries of the coding sequence are determined by the start codon at the 5' end and the translation stop codon at the 3' end. A transcription termination sequence can be located 3' of the coding sequence.

[0230] As used herein, the term "modulate" refers to a change in the number, degree, or amount of a function. For example, the Cas12 guide / nuclear protein complex disclosed herein can modulate the activity of a promoter sequence by binding to a nucleic acid target sequence at or near the promoter. Depending on the effect that occurs after binding, the Cas12 guide / nuclear protein complex can induce, enhance, suppress, or inhibit the transcription of a gene operably linked to the promoter sequence. Thus, "modulation" of gene expression includes both gene activation and gene repression.

[0231] Modulation can be assayed by determining any characteristic that is directly or indirectly affected by the expression of the target gene. Such characteristics include, for example, changes in the level of RNA or protein, protein activity, product level, gene expression, or the activity level of a reporter gene. Thus, the terms "modulate the expression of", "inhibit the expression of", and "activate the expression of" a gene can refer to the ability of a Cas12 guide / nuclear protein complex to change, activate, or inhibit the transcription of the gene.

[0232] "Vector" and "plasmid", as used herein, refer to polynucleotide vehicles for introducing genetic material into cells. A vector may be linear or circular. A vector may contain replication sequences (e.g., origins of replication) that can cause replication of the vector in a suitable host cell. Upon transformation of a suitable host, the vector can replicate and function independently of the host genome or can be integrated into the host genome. The design of a vector depends particularly on the intended use and the host cell for which the vector is intended, and the design of vectors for specific uses and host cells is within the level of those skilled in the art. The four main types of vectors are plasmids, viral vectors, cosmids, and artificial chromosomes. Typically, a vector contains an origin of replication, a multiple cloning site, and / or a selectable marker. An expression vector typically contains an expression cassette. "Recombinant virus" means a virus that has been genetically altered, for example, by the addition or insertion of a heterologous nucleic acid construct into a viral genome or a part thereof.

[0233] As used herein, an "expression cassette" refers to a polynucleotide construct that has been produced using recombinant methods or by synthetic means and contains regulatory sequences operably linked to a selected polynucleotide to facilitate expression of the selected polynucleotide in a host cell. For example, the regulatory sequences can promote transcription of the selected polynucleotide in the host cell or can promote transcription and translation of the selected polynucleotide in the host cell. An expression cassette can be, for example, integrated into the genome of a host cell or present in a vector and can form an expression vector.

[0234] As used herein, a "targeting vector" is a recombinant DNA construct typically containing engineered DNA arms (homologous to genomic DNA) flanking elements of a target gene or nucleic acid target sequence (e.g., DSB). The targeting vector contains a donor polynucleotide. The elements of the target gene can be modified in several ways including deletions and / or insertions. An incomplete target gene can be replaced with a functional target gene or alternatively, a functional gene can be knocked out. Optionally, the donor polynucleotide of the targeting vector contains a selection cassette including a selectable marker to be introduced into the target gene. Targeting regions flanking or within the target gene can be used to affect the regulation of gene expression.

[0235] "Gene editing" or "genome editing", as used herein, means a type of genetic manipulation that causes a genetic modification (e.g., an insertion, deletion, or replacement of a nucleotide sequence or single base at a specific site in the cell genome). The term includes, but is not limited to, heterologous gene expression, insertion or deletion of genes or promoters, nucleic acid mutations, and disruptive gene modifications as defined herein.

[0236] As used herein, the term "between" includes the end values of a given range (e.g., between about 1 and about 50 nucleotides in length includes 1 nucleotide and 50 nucleotides).

[0237] As used herein, the term "amino acid" refers to both natural and synthetic (non-natural) amino acids and includes amino acid analogs, modified amino acids, peptidomimetics, glycine, and D or L optical isomers.

[0238] As used herein, the terms "peptide," "polypeptide," and "protein" are interchangeable and refer to a polymer of amino acids. A polypeptide can be of any length. A polypeptide may be branched, linear, interrupted by non-amino acids, and may contain modified amino acids. The term also refers to an amino acid polymer that has been modified, for example, by acetylation, disulfide bond formation, glycosylation, lipidation, phosphorylation, pegylation, biotinylation, cross-linking, and / or conjugation (e.g., with a labeling component or ligand). Unless otherwise indicated, polypeptide sequences are presented herein in the conventional N-terminal to C-terminal orientation. Polypeptides and polynucleotides can be produced using routine techniques in the field of molecular biology. Additionally, essentially any polypeptide or polynucleotide is available from commercial sources.

[0239] As used herein, the terms "fusion protein" and "chimeric protein" refer to a single protein created by linking two or more proteins, protein domains, or protein fragments that do not naturally occur together in a single protein.

[0240] The fusion protein may also include an epitope tag (e.g., a histidine tag, a FLAG® (Sigma Aldrich, St. Louis, MO) tag, a Myc tag), a reporter protein sequence (e.g., glutathione-S-transferase, beta-galactosidase, luciferase, green fluorescent protein, cyan fluorescent protein, yellow fluorescent protein), and / or a nucleic acid sequence binding domain (e.g., a DNA binding domain or an RNA binding domain). The fusion protein may include at least one nuclear localization sequence (NLS) (e.g., a simian virus 40 (SV40) NLS or a nucleoplasmin NLS). The fusion protein may also include an activator domain (e.g., a heat shock transcription factor, an NFKB activator), or a repressor domain (e.g., a KRAB domain). As described by Lupo et al. (Current Genomics, 2013, 14(4):268-278), the KRAB domain is a potent transcriptional repression module and is located within the amino-terminal sequence of most C2H2 zinc finger proteins. See, for example, Margolin et al. (PNAS, 1994, 91:4509-4513); and Witzgall et al. (PNAS, 1994, 91:4514-4518 (1994)). The KRAB domain typically binds to a corepressor protein and / or a transcription factor via protein-protein interactions, causing transcriptional repression of the gene to which the KRAB zinc finger protein (KRAB-ZFP) binds. See, for example, Friedman et al. (Genes & Development, 1996, 10:2067-2678). In some embodiments, a linker nucleic acid sequence is used to link two or more proteins, protein domains, or protein fragments.

[0241] As used herein, the term "nuclear localization sequence" (NLS) or "nuclear localization signal" refers to a polypeptide sequence of a protein that preferentially increases the intracellular localization of the protein to the cell nucleus. The NLS sequence is typically a stretch of positively charged amino acids located at the amino terminus ("N-terminus") of the protein, at the carboxyl terminus ("C-terminus") of the protein, or internally (or combinations thereof, i.e., one or more NLSs at the N-terminus and one or more NLSs at the C-terminus). The NLS sequence is linked to the protein either directly by a covalent bond or via a linker polypeptide. The length of the linker sequence can be optimized based on the structural properties of the protein (e.g., solvent accessibility of the termini, presence of other important functional peptide sequences at the termini, etc.) to ensure accessibility of the NLS sequence for binding and transport by the cognate importin protein. Additionally, the optimal linker length can be screened empirically (e.g., see Example 11). The NLS sequence can be fully synthetic or can be derived from an endogenous or exogenous protein sequence. Computational tools can be used to predict the NLS sequence in a protein (e.g., see moseslab.csb.utoronto.ca / NLStradamus / , or nls-mapper.iab.keio.ac.jp / cgi-bin / NLS_Mapper_form.cgi). Examples of NLS sequences are presented in Table 2.

[0242] [Table 2]

[0243] "Moiety", as used herein, refers to a part of a molecule. A moiety can be a functional group or can describe a part of a molecule having multiple functional groups (e.g., sharing common structural features). The terms "moiety" and "functional group" are typically used interchangeably, although "functional group" can more specifically refer to a part of a molecule that includes some common chemical behavior. "Moiety" is often used as a structural description. In some embodiments, the 5' end, 3' end, or both the 5' and 3' ends (e.g., non-natural 5' and / or non-natural 3' ends in a first stem element) can include one or more moieties.

[0244] The terms "modified protein", "mutant protein", "protein variant", and "engineered protein", as used herein, typically refer to a protein that has been modified to include a non-natural sequence (i.e., a modified protein has a unique sequence compared to an unmodified protein).

[0245] "Transformation", as used herein, refers to the insertion of an exogenous polynucleotide into a host cell, regardless of the method used for insertion. For example, transformation can be by direct uptake, transfection, infection, and the like. The exogenous polynucleotide can be maintained as an unintegrated vector (e.g., episome) or can be integrated into the host genome.

[0246] "Host cell" refers to a cell that has been transformed or is transformable by an exogenous DNA sequence. A host cell can be derived from any organism having one or more cells. Examples of host cells include prokaryotic cells, eukaryotic cells, bacterial cells, archaeal cells, cells of unicellular eukaryotes, protozoan cells, cells derived from plants, algal cells, fungal cells (e.g., yeast cells, or cells derived from mushrooms), animal cells, cells derived from invertebrates, cells derived from vertebrates, such as cells derived from mammals (e.g., pigs, cows, goats, sheep, rodents, rats, mice, non-human primates, humans, etc.), but are not limited thereto. Furthermore, the host cell can be a stem cell or a progenitor cell, or can be a cell of the immune system (e.g., any of the cells of the immune system described herein). The host cell can be a human cell. For example, the host cell can be a lymphocyte or a stem cell such as a hematopoietic stem cell. Lymphocytes include T cells for cell-mediated cytotoxic adaptive immunity (e.g., CD4+ and / or CD8+ cytotoxic T cells); natural killer (NK) cells that function in cell-mediated cytotoxic innate immunity; and B cells for humoral antibody-driven adaptive immunity. Also included are hematopoietic stem cells that give rise to lymphoid lineage cells. In addition, CAR-T cells, T cell receptors (TCR) cells, e.g., TCR-engineered CAR-T cells, tumor-infiltrating lymphocytes (TIL), CAR TIL, CAR-NK cells, and the like can be modified using the techniques herein. In some embodiments, the human cells are outside the human body. In some embodiments, cells of a living organism's body (e.g., a human body) are manipulated ex vivo (i.e., outside the living body). Ex vivo often refers to a medical procedure in which an organ, cell, or tissue is removed from a living body (e.g., a human body) for treatment or surgery and then returned to the living body. In vivo often refers to a medical procedure in which an organ, cell, or tissue within a living body (e.g., a human body) is subjected to treatment or surgery.

[0247] The terms "subject", "individual", or "patient" are used interchangeably herein and refer to any member of the phylum Chordata, including humans and other primates, such as non-human primates, e.g., rhesus monkeys, chimpanzees, and other monkeys, as well as hominid species; agricultural animals, e.g., cows, sheep, pigs, goats, and horses; domesticated mammalian pets, e.g., dogs and cats; laboratory animals, e.g., rabbits, mice, rats, and guinea pigs; birds, e.g., domestic, wild, and game birds, e.g., chickens, turkeys, and other poultry birds, ducks, and geese; and the like, but are not limited thereto. The term does not indicate a particular age or sex. Thus, the term includes adult, young, and newly born individuals, including males and females. In some embodiments, the host cell is derived from a subject (e.g., lymphocytes, stem cells, progenitor cells, or tissue-specific cells). In some embodiments, the subject is a non-human subject.

[0248] The term "effective amount" or "therapeutically effective amount" of a composition or agent (e.g., the genetically engineered adoptive cells provided herein) refers to an amount of the composition or agent sufficient to effect the desired response. Preferably, the effective amount prevents, avoids, or eliminates one or more harmful side effects. Such a response is determined by the particular disease in question. For example, in a patient being treated for cancer using adoptive cell therapy, the desired response may include, prevent, avoid, or eliminate one or more of graft-versus-host disease (GvHD), host-versus-graft rejection, cytokine release syndrome (CRS), treatment or prevention of the effects of cytokine storm, and reduction of oncogenic transformation of the administered genetically modified cells. The exact dosage required will vary from subject to subject depending on the species, age, and general condition of the subject, the severity of the condition being treated, as well as the particular modified lymphocytes used, the mode of administration, and the like. The appropriate "effective" amount in any individual case can be determined by one of ordinary skill in the art using routine experimentation.

[0249] "Treatment" or "treating" of a particular disease (e.g., cancer symptoms or GvHD) includes the following: preventing the disease, e.g., in a subject who is susceptible to the disease but has not yet experienced or shown symptoms of the disease, preventing the progression of the disease or causing the disease to develop at a lower intensity; inhibiting the disease, e.g., reducing the rate of progression, suppressing the progression, or reversing the disease state; and / or alleviating the symptoms of the disease, e.g., reducing the number of symptoms experienced by the subject.

[0250] Cas12 guide The Cas12 chRDNA guide molecules of the present disclosure can form a nuclear protein complex with a cognate Cas12 protein such as Cas12a protein, and this complex can target a target sequence complementary to the targeting region (spacer sequence).

[0251] Figure 1A shows an example of an Acidaminococcus species BV3l6 Cas12a guide molecule comprising an activation region (Figure 1A, 101) comprising a stem-loop duplex (Figure 1A, 102); and a spacer sequence (Figure 1A, 103) comprising a target binding sequence (Figure 1A, 104). Figure 1B shows an alternative Cas12a guide molecule comprising an activation region (Figure 1B, 105) comprising a stem-loop duplex (Figure 1B, 106); and a spacer sequence (Figure 1B, 107) comprising a target binding sequence (Figure 1B, 108) and a 3' extension (Figure 1B, 109). The 3' extension (Figure 1B, 109) can be connected to the spacer sequence (Figure 1B, 107) via a linker sequence. Figure 1C shows an alternative Cas12a guide molecule comprising an activation region (Figure 1C, 110) comprising a stem-loop duplex (Figure 1C, 111), and a linker nucleotide (Figure 1C, 114), and a 5' extension (Figure 1C, 115); and a spacer sequence (Figure 1C, 112) comprising a target binding sequence (Figure 1C, 113).

[0252] In the Cas12 chRDNA guide molecule of the present disclosure, the targeting region can include DNA, RNA, or a mixture of DNA and RNA. In some embodiments, the targeting region can include both DNA and RNA. In certain embodiments, the targeting region can also include other base analogs, modified nucleotides, abasic sites, and the like, as well as synthetic, naturally occurring, and non-naturally occurring modified backbone residues or linkages, or combinations thereof.

[0253] In the Cas12 chRDNA guide molecule of the present disclosure, the activation region can include DNA, RNA, or a mixture of DNA and RNA. In some embodiments, the activation region can include both DNA and RNA. In certain embodiments, the activation region can also include other base analogs, modified nucleotides, abasic sites, and the like, as well as synthetic, naturally occurring, and non-naturally occurring modified backbone residues or linkages, or combinations thereof. In certain embodiments, the activation region is adjacent to the targeting region. In certain embodiments, the activation region is downstream of the targeting region. In certain embodiments, the activation region is upstream of the targeting region.

[0254] In some embodiments, the Cas12 chRDNA guide molecule of the present disclosure comprises a nucleic acid sequence comprising ribonucleotide bases and deoxyribonucleotide bases of about 2% or less, 3% or less, 4% or less, 5% or less, 6% or less, 7% or less, 8% or less, 9% or less, 10% or less, 11% or less, 12% or less, 13% or less, 14% or less, 15% or less, 16% or less, 17% or less, 18% or less, 19% or less, 20% or less, 21% or less, 22% or less, 23% or less, 24% or less, 25% or less, 26% or less, 27% or less, 28% or less, 29% or less, 30% or less, 31% or less, 32% or less, 33% or less, 34% or less, 35% or less, 36% or less, 37% or less, 38% or less, 39% or less, 40% or less, 41% or less, 42% or less, 43% or less, 44% or less, 45% or less, 46% or less, 47% or less, 48% or less, 49% or less, 50% or less, 55% or less, 60% or less, 65% or less, 70% or less, or 75% or less, or a variant or modified derivative thereof.

[0255] The Cas12 chRDNA guide of the present disclosure is, for example, 30 to 75 bases in length including the abasic site. In some embodiments, the Cas12 chRDNA guide is 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, or 75 bases in length including the abasic site. In some embodiments, the Cas12 chRDNA guide is 40 bases in length including the abasic site.

[0256] As used herein, "as a percentage of the full length" of a polynucleotide sequence (e.g., a Cas12 chRDNA guide, an activation region, or a targeting region) refers to the full length of the polynucleotide sequence including, for example, the abasic site, as well as modified bases and variant bases.

[0257] In some embodiments, the activation region is between 10 and 25 bases in length, including the abasic site. In some embodiments, the activation region is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 bases in length, including the abasic site. In some embodiments, the activation region is 20 bases in length, including the abasic site.

[0258] In some embodiments, the targeting region is between 10 and 30 bases in length, including the abasic site. In some embodiments, the targeting region is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bases in length, including the abasic site. In some embodiments, the targeting region is 20 bases in length, including the abasic site.

[0259] In the embodiments of the present specification, the activation region and / or the targeting region comprise ribonucleotide bases and one or more deoxyribonucleotide bases. The activation region and / or the targeting region may also include additional modifications including, in some embodiments, base analogs, modified nucleotides, abasic sites, or combinations thereof. In some embodiments, the activation region and / or the targeting region may include synthetic, naturally occurring, or non-naturally occurring modified backbone residues or linkages, or combinations thereof.

[0260] One or more deoxyribonucleotide bases may be present at any one or more positions in the targeting region. For example, in the case of a 30-base-long targeting region including an abasic site, one or more deoxyribonucleotide bases may be present at one or more of positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30. In the case of a smaller targeting region, these positions will correspondingly decrease. For example, in the case of a 20-base-long targeting region including an abasic site, one or more deoxyribonucleotide bases may be present at one or more of positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.

[0261] One or more additional modifications (e.g., base analogs, modified nucleotides, abasic sites, modified backbone residues or linkages, or combinations thereof) may be present at any one or more positions in the targeting region. For example, in the case of a 30-base-long targeting region including an abasic site, one or more additional modifications may be present at one or more of positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30. In the case of a smaller targeting region, these positions will correspondingly decrease. For example, in the case of a 20-base-long targeting region including an abasic site, one or more additional modifications may be present at one or more of positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.

[0262] One or more deoxyribonucleotide bases may be present at any one or more positions in the activation region. For example, in the case of an activation region 25 bases in length including an abasic site, one or more deoxyribonucleotide bases may be present at one or more of positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25. In the case of a smaller activation region, these positions will correspondingly decrease. For example, in the case of an activation region 20 bases in length including an abasic site, one or more deoxyribonucleotide bases may be present at one or more of positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.

[0263] One or more additional modifications (e.g., base analogs, modified nucleotides, abasic sites, modified backbone residues or linkages, or combinations thereof) may be present at any one or more positions in the activation region. For example, in the case of an activation region 25 bases in length including an abasic site, one or more additional modifications may be present at one or more of positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25. In the case of a smaller activation region, these positions will correspondingly decrease. For example, in the case of an activation region 20 bases in length including an abasic site, one or more additional modifications may be present at one or more of positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.

[0264] In some embodiments, the amount of deoxyribonucleotide bases is preferably 75% or less as a proportion of the total size of the Cas12 chRDNA guide including the abasic site. In some embodiments, the amount of deoxyribonucleotide bases is 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 24% or less, 23% or less, 22% or less, 21% or less, 20% or less, 19% or less, 18% or less, 17% or less, 16% or less, 15% or less, 14% or less, 13% or less, 12% or less, 11% or less, 10% or less, 9% or less, 8% or less, 7% or less, 6% or less, or 5% or less as a proportion of the total size of the Cas12 chRDNA guide including the abasic site.

[0265] In some embodiments, the amount of further modifications (e.g., base analogs, modified nucleotides, abasic sites, modified backbone residues or linkages, or combinations thereof) is preferably 75% or less as a proportion of the total size of the Cas12 chRDNA guide including the abasic site. In some embodiments, the amount of further modifications is 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 24% or less, 23% or less, 22% or less, 21% or less, 20% or less, 19% or less, 18% or less, 17% or less, 16% or less, 15% or less, 14% or less, 13% or less, 12% or less, 11% or less, 10% or less, 9% or less, 8% or less, 7% or less, 6% or less, or 5% or less as a proportion of the total size of the Cas12 chRDNA guide including the abasic site.

[0266] In some embodiments, the amount of deoxyribonucleotide bases is preferably 75% or less as a proportion of the total size of the targeting region including the abasic site. In some embodiments, the amount of deoxyribonucleotide bases is 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 24% or less, 23% or less, 22% or less, 21% or less, 20% or less, 19% or less, 18% or less, 17% or less, 16% or less, 15% or less, 14% or less, 13% or less, 12% or less, 11% or less, 10% or less, 9% or less, 8% or less, 7% or less, 6% or less, or 5% or less as a proportion of the total size of the targeting region including the abasic site.

[0267] In some embodiments, the amount of further modifications (e.g., base analogs, modified nucleotides, abasic sites, modified backbone residues or linkages, or combinations thereof) is preferably 75% or less as a percentage of the total size of the targeting region including abasic sites. In some embodiments, the amount of further modifications is 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 24% or less, 23% or less, 22% or less, 21% or less, 20% or less, 19% or less, 18% or less, 17% or less, 16% or less, 15% or less, 14% or less, 13% or less, 12% or less, 11% or less, 10% or less, 9% or less, 8% or less, 7% or less, 6% or less, or 5% or less as a percentage of the total size of the targeting region including abasic sites.

[0268] In some embodiments, the amount of deoxyribonucleotide bases is preferably 75% or less as a percentage of the total size of the activation region including abasic sites. In some embodiments, the amount of deoxyribonucleotide bases is 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 24% or less, 23% or less, 22% or less, 21% or less, 20% or less, 19% or less, 18% or less, 17% or less, 16% or less, 15% or less, 14% or less, 13% or less, 12% or less, 11% or less, 10% or less, 9% or less, 8% or less, 7% or less, 6% or less, or 5% or less as a percentage of the total size of the activation region including abasic sites.

[0269] In some embodiments, the amount of further modifications (e.g., base analogs, modified nucleotides, abasic sites, modified backbone residues or linkages, or combinations thereof) is preferably 75% or less as a percentage of the total size of the activation region including abasic sites. In some embodiments, the amount of further modifications is 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 24% or less, 23% or less, 22% or less, 21% or less, 20% or less, 19% or less, 18% or less, 17% or less, 16% or less, 15% or less, 14% or less, 13% or less, 12% or less, 11% or less, 10% or less, 9% or less, 8% or less, 7% or less, 6% or less, or 5% or less as a percentage of the total size of the activation region including abasic sites.

[0270] In some embodiments, the amount of deoxyribonucleotide bases in the activation region and / or targeting region is adjusted to provide a statistically significant difference, for example, compared to the corresponding activation region and / or targeting region that does not contain deoxyribonucleotide bases. In some embodiments, this statistically significant difference is a difference in on-target editing or off-target editing.

[0271] In some embodiments, the activation region and the targeting region each contain one or more deoxyribonucleotide bases. In some embodiments, the activation region contains one or more deoxyribonucleotide bases and the targeting region contains no deoxyribonucleotide bases (e.g., contains only RNA and / or modified ribonucleotides). In some embodiments, the targeting region contains one or more deoxyribonucleotide bases and the activation region contains no deoxyribonucleotide bases (e.g., contains only RNA and / or modified ribonucleotides).

[0272] In some embodiments, the activation region and the targeting region each contain one or more additional modifications (e.g., base analogs, modified nucleotides, abasic sites, modified backbone residues or linkages, or combinations thereof). In some embodiments, the activation region contains one or more additional modifications (e.g., base analogs, modified nucleotides, abasic sites, modified backbone residues or linkages, or combinations thereof), and the targeting region contains no additional modifications (i.e., contains only RNA or DNA). In some embodiments, the targeting region contains one or more additional modifications (e.g., base analogs, modified nucleotides, abasic sites, modified backbone residues or linkages, or combinations thereof), and the activation region contains no additional modifications (i.e., contains only RNA or DNA).

[0273] Figure 2 shows Cas12a protein (Figure 2, 206) bound to a cognate Cas12a chRDNA guide molecule (Figure 2, 204) that includes a target binding sequence (Figure 2, 205). The Cas12a chRDNA guide / nuclear protein complex unwinds a target polynucleotide that includes a target sequence, and the target binding sequence (Figure 2, 205) of the Cas12 chRDNA guide molecule is connected to the target sequence (Figure 2, 207) via hydrogen bonds (shown as vertical lines between polynucleotides in Figure 2). In Figure 2, the target polynucleotide includes a target strand (Figure 2, 201) that includes a target sequence (Figure 2, 207) and a non-target strand (Figure 2, 202) that includes a PAM sequence (Figure 2, 203). The PAM sequence (Figure 2, 203) typically occurs upstream (i.e., in the 5' direction) of the target sequence (Figure 2, 207) on the non-target strand (Figure 2, 202). Formation of hydrogen bonds between the target binding sequence (Figure 2, 205) of the Cas12a chRDNA guide molecule and the target sequence (Figure 2, 207) results in a staggered cleavage (Figure 2, 208) of the target strand (Figure 2, 201) and the non-target strand (Figure 2, 202).

[0274] Figures 3A-3I show various standard and non-standard nucleotides for use with the Cas12 chRDNA guide molecules of the present disclosure. Table 3 represents a series of labels used in Figures 3A-3I.

[0275]

Table 3

[0276] Figure 4 shows a Cas12a protein (Figure 4, 406) bound to a cognate Cas12a chRDNA guide molecule (Figure 4, 404) that includes a target binding sequence (Figure 4, 405), where the target binding sequence (Figure 4, 405) includes non-RNA nucleotides (Figure 4, 409), for example, standard and non-standard nucleotides represented in Figures 3B-3I. The Cas12a chRDNA guide / nuclear protein complex unwinds a target polynucleotide that includes a target sequence, and the target binding sequence (Figure 4, 405) of the Cas12 chRDNA guide molecule is connected to the target sequence (Figure 4, 407) via a hydrogen bond (Figure 4, represented by the vertical line between polynucleotides). In Figure 4, the target polynucleotide includes a target strand (Figure 4, 401) that includes a target sequence (Figure 4, 407) and a non-target strand (Figure 4, 402) that includes a PAM sequence (Figure 4, 403). The PAM sequence (Figure 4, 403) typically occurs upstream (i.e., in the 5' direction) of the target sequence (Figure 4, 407) on the non-target strand (Figure 4, 402). Formation of the hydrogen bond between the target binding sequence (Figure 4, 405) of the chRDNA guide molecule and the target sequence (Figure 4, 407) results in a staggered cleavage (Figure 4, 408) of the target strand (Figure 4, 401) and the non-target strand (Figure 4, 402).

[0277] Figure 5 shows an example of an Acidaminococcus sp. (strain BV3L6) Cas12a crRNA guide molecule that includes: an activation region (Figure 5, 501) that includes a stem-loop duplex (Figure 5, 502); and a spacer (Figure 5, 503) that includes a target binding sequence (Figure 5, 504). Each nucleotide position in the activation region (Figure 5, 501) and the spacer (Figure 5, 503) is labeled from the 5' end of this guide molecule, and the activation region and the target binding region each include RNA.

[0278] Figure 6 shows an example of an Acidaminococcus sp. (strain BV3L6) Cas12a chRDNA guide molecule that includes the following: an activation region (Figure 6, 601) that includes a stem-loop duplex (Figure 6, 602); and a spacer (Figure 6, 603) that includes a target binding sequence (Figure 6, 604). In the activation region (Figure 6, 601), each nucleotide position in the spacer (Figure 6, 603) is labeled from the 5' end of this guide molecule. The activation region includes a mixture of RNA (white fill) and DNA (gray fill), and the target binding region includes a mixture of RNA (white fill) and DNA (gray fill).

[0279] Figure 7 shows an example of an Acidaminococcus sp. (strain BV3L6) Cas12a chRDNA guide molecule that includes the following: an activation region (Figure 7, 701) that includes a stem-loop duplex (Figure 7, 702); and a spacer (Figure 7, 703) that includes a target binding sequence (Figure 7, 704). Each nucleotide position in the activation region (Figure 7, 701) and the spacer (Figure 7, 703) is labeled from the 5' end of this guide molecule. The activation region includes a mixture of RNA (white fill) and DNA (gray fill). The Cas12a chRDNA guide molecule further includes other non-standard nucleotides such as chemically modified sugar nucleotides (Figure 7, 705), abasic ribonucleotides (Figure 7, 706), deoxyribonucleotides with a chemically modified backbone (Figure 7, 707), ribonucleotides with a chemically modified backbone (Figure 7, 708), and abasic deoxyribonucleotides (Figure 7, 709).

[0280] Figure 8 shows the formation of a Cas12 chRDNA guide / nuclear protein complex, where the Cas12 protein (Figure 8, 801) binds to the Cas12 chRDNA guide molecule (Figure 8, 802) to form a Cas12 chRDNA guide / nuclear protein complex (Figure 8, 803). The Cas12 chRDNA guide / nuclear protein complex (Figure 8, 803) binds to a target polynucleotide (Figure 8, 804), which contains a target sequence complementary to the target binding sequence of the Cas12 chRDNA guide molecule, and hydrogen bonds occur between the target binding sequence of the Cas12 chRDNA guide molecule and the target sequence (Figure 8, 805).

[0281] Figure 9 shows the occurrence of insertions or deletions (indels) in a target polynucleotide by a Cas12 chRDNA guide / nuclear protein complex, where the Cas12 protein (Figure 9, 901) complexed with the Cas12 chRDNA guide molecule (Figure 9, 902) binds to a target polynucleotide (Figure 9, 903) containing a PAM (Figure 9, 904), and the target polynucleotide is cleaved by the Cas12 chRDNA guide / nuclear protein complex (Figure 9, 905). After targeting occurs, the Cas12 chRDNA guide / nuclear protein complex dissociates from the target polynucleotide (Figure 9, 906), and the target polynucleotide contains an upstream (i.e., 5' direction) strand (Figure 9, 907) and a downstream (i.e., 3' direction) strand (Figure 9, 908) relative to the PAM (Figure 9, 904). The intracellular DNA repair mechanism repairs the target polynucleotide through insertions or deletions of sequences around the cleavage site in the target polypeptide (Figure 9, 910). The upstream strand (Figure 9, 911) and the downstream strand (Figure 9, 912) are religated, and the edited target polynucleotide (Figure 9, 914) contains an indel (Figure 9, 913) at the cleavage site, and the edited target polynucleotide has a different sequence compared to the unedited target polynucleotide. In some embodiments, insertions or deletions (indels) occur in the target polynucleotide by the Cas12 chRDNA guide / nuclear protein complex intracellularly.

[0282] Figure 10 shows the integration of a donor polynucleotide sequence into a target polynucleotide. The Cas12 protein (Figure 10, 1001) complexed with the Cas12 chRDNA guide molecule (Figure 10, 1002) binds to the target polynucleotide (Figure 10, 1003) containing the PAM (Figure 10, 1004), and the target polynucleotide is cleaved by the Cas12 chRDNA guide / nuclear protein complex (Figure 10, 1005), indicating integration. After targeting occurs, the Cas12 chRDNA guide / nuclear protein complex dissociates from the target polynucleotide (Figure 10, 1006), and the target polynucleotide contains an upstream (i.e., 5' direction) strand (Figure 10, 1007) and a downstream (i.e., 3' direction) strand (Figure 10, 1008) relative to the PAM (Figure 10, 1004), giving rise to the donor polynucleotide (Figure 10, 1009). The intracellular DNA repair mechanism uses this donor polynucleotide (Figure 10, 1011) to repair the target polynucleotide (Figure 10, 1010). The resulting edited target polynucleotide (Figure 10, 1010) contains the donor sequence (Figure 10, 1011) at the target site. In some embodiments, the integration of the donor polynucleotide sequence into the target polynucleotide occurs intracellularly.

[0283] Figure 11 shows the nicking of a target polynucleotide. The Cas12 protein (Figure 11, 1101) complexed with the Cas12 chRDNA guide molecule (Figure 11, 1102) containing a DNA base in the target binding sequence (Figure 11, 1106) binds to the target polynucleotide (Figure 11, 1103) containing the PAM (Figure 11, 1104), and the target polynucleotide is nicked by the Cas12 chRDNA guide / nuclear protein complex such that a cut is made only in one strand of this target polynucleotide (Figure 11, 1105).

[0284] FIG. 12 shows the use of two nicking Cas12 chRDNA / nuclear protein complexes to generate a staggered double-strand break in a target polynucleotide, wherein a first Cas12 chRDNA guide / nuclear protein complex binds to an upstream (i.e., 5' direction) target sequence of the target polynucleotide (FIG. 12, 1201), a first cut is introduced into the target polynucleotide (FIG. 12, 1202), a second Cas12 chRDNA guide / nuclear protein complex binds to a downstream (i.e., 3' direction) target sequence of the target polynucleotide (FIG. 12, 1203), and a second cut is introduced into the target polynucleotide (FIG. 12, 1204). After tandem nicking occurs, the cleaved target polynucleotide includes an upstream (i.e., 5' direction) strand (FIG. 12, 1205) and a downstream (i.e., 3' direction) strand (FIG. 12, 1206) having 5' overhangs. A donor polynucleotide is generated, and the intracellular DNA repair mechanism uses this donor polynucleotide (FIG. 12, 1208) to repair the target polynucleotide (FIG. 12, 1207). The resulting edited target polynucleotide (FIG. 12, 1209) includes a donor sequence (FIG. 12, 1210) at the site where the tandem cuts were introduced. In some embodiments, the use of two nicking Cas12 chRDNA guide / nuclear protein complexes to generate a staggered DSB in a target polynucleotide occurs intracellularly.

[0285] FIG. 13 shows the positions in the target-binding sequence of an Acidaminococcus sp. (strain BV3L6) Cas12a chRDNA guide molecule that are suitable for DNA bases. The y-axis represents the normalized editing rate of multiple targets by DNA at a single position in the target-binding sequence (see Example 5) (error bars indicate standard deviation). The x-axis indicates the position of each position (from 5' to 3') in the target-binding sequence. The target-binding sequence is shown above the graph (FIG. 13, 1301), and the preferred positions for DNA base utilization (i.e., average normalized editing greater than 70%) are indicated by gray shading. The position of the Cas12a chRDNA activation region is also shown (FIG. 13, 1302).

[0286] Figure 14 shows the positions in the activation region of the Acidaminococcus sp. (strain BV3L6) Cas12a chRDNA guide molecule that are suitable for DNA bases (see Example 8). The y-axis represents the normalized editing rate of the guide molecule by DNA at a single position in the activation region. The x-axis indicates the position (from 5' to 3') of each position in the activation region. The activation region is shown on the left side of the graph (Figure 14, 1401), and the preferred positions for DNA base utilization (i.e., average normalized editing of more than 70%) are indicated by the gray shading. The positions of the Cas12a chRDNA guide target binding sequences are also shown (Figure 14, 1402).

[0287] Figures 15A and 15B show flow cytometry analysis of CAR-T cells engineered using the Cas12a / chRDA nuclear protein complex. Figure 15A shows the percentages of cells expressing anti-BCMA CAR (Figure 15A, 1501), TRAC protein (Figure 15A, 1502), and B2M protein (Figure 15A, 1503). The x-axis indicates untreated cells (Figure 15A, 1504), cells transfected with the Cas12a chRDNA guide / nuclear protein complex targeting both the TRAC gene and the B2M gene (Figure 15A, 1505), and cells transfected with both Cas12a chRDNA guide / nuclear protein complexes targeting both the TRAC gene and the B2M gene and transduced with two viruses containing DNA donors encoding the anti-BCMA CAR gene and the B2M-HLA-E fusion gene, respectively (Figure 15A, 1506). The y-axis represents the percentage of positive cells for various cell surface markers as measured by flow cytometry. Figure 15B shows the results of an in vitro cytotoxicity assay for anti-BCMA, B2M-HLA-E CAR-T cells (gray circles) and control TRAC KO T cells (black circles) against a BCMA-positive target cell line. The y-axis represents the killing rate of the target cells, and the x-axis indicates the E:T ratio used. Each data point represents the average of three co-culture wells at each E:T ratio.

[0288] Figures 16A and 16B show the cell editing activity of the Cas12a / chRDNA nuclear protein complex containing multiple linkers and nuclear localization sequence (NLS) arrangements. The y-axis of the graphs in Figures 16A and 16B indicates the editing rate as measured by next-generation sequencing. In Figure 16A, the x-axis indicates each linker NLS arrangement, and each data point represents a replicate of the measurement. In Figure 16B, the x-axis indicates the pmol concentrations of Cas12a and chRDNA guides (20:60 or 80:240 pmol) for the top four linker-NLS designs shown in Figure 16A and the "unoptimized" linker-NLS arrangement (Figure 16B, 1613). Each data point represents a unique guide target sequence and is the average value of three replicate measurements for each data point. Figure 17 shows the cell editing activity of the Cas12a chRDNA guide / nuclear protein complex with GS-SV40 (Figure 7, 1708; SEQ ID NO: 479) and (G4S)2-NPL (Figure 7, 1712; SEQ ID NO: 489) when co-delivering multiple Cas12a guides in a single transfection reaction. The y-axis of Figure 17 indicates the editing rate as measured by next-generation sequencing. In Figure 17, the x-axis indicates the target gene as the TRAC gene (Figure 17, 1701; SEQ ID NO: 36), B2M gene (Figure 17, 1702; SEQ ID NO: 62), CISH gene (Figure 17, 1703; SEQ ID NO: 158), or CBLB gene (Figure 17, 1704; SEQ ID NO: 171). The Cas12a chRDNA guide / nuclear protein complex was used as a single targeting complex per transfection (Figure 17, 1705, and Figure 17, 1709), as two targeting complexes per transfection (Figure 17, 1706, and Figure 17, 1710), or as four targeting complexes per transfection (Figure 17, 1707, and Figure 17, 1711). Each bar represents the average of 2 to 3 replicates.

[0289] Methods for designing specific Cas12 chRDNA guide molecules that can engineer deoxyribonucleotide bases and optionally further modifications (e.g., base analogs, modified nucleotides, abasic sites, modified backbone residues or linkages, or combinations thereof) are known. See, for example, Briner et al. (Molecular Cell, 2014, 56:333-339). To do so, first, identify the genomic sequence of the target gene. The exact region of the selected gene will depend on the specific application. For example, for activating or suppressing a target gene using, e.g., CRISPR activation or CRISPR interference, the Cas12 chRDNA guide / nuclear protein complex can target the promoter driving expression of the gene of interest. In the case of gene knockout, the Cas12 chRDNA guide molecule can be designed to target a 5’ constitutively expressed exon to reduce the chance of removal of the target region from the mRNA due to alternative splicing. The exon near the N-terminus can be targeted because a frameshift mutation here increases the likelihood of producing a non-functional protein product. Alternatively, cognate Cas12 chRDNA guide molecules can be designed to target exons encoding known essential protein domains. In this regard, non-frameshift mutations such as insertions or deletions are likely to alter the function of the protein if they occur in protein domains essential for the function of the protein. In the case of gene editing using HDR, the target sequence should be near the location of the desired edit. In this case, identify the location where the edit is desired and select a target sequence near it.

[0290] In some embodiments, the Cas12 chRDNA guide molecule can be designed such that the Cas12 chRDNA guide / nuclear protein complex can bind outside the cleavage site of the Cas12 protein. In this case, the target nucleic acid cannot interact with the Cas12 chRDNA guide / nuclear protein complex, and the target nucleic acid is excised (e.g., released from the Cas12 chRDNA guide / nuclear protein complex). In some embodiments, the Cas12 chRDNA guide molecule can be designed such that the Cas12 chRDNA guide / nuclear protein complex can bind inside the cleavage site of the Cas12 protein. In this case, the target nucleic acid can interact with the Cas12 chRDNA guide / nuclear protein complex, and the target nucleic acid can bind (e.g., can bind to the Cas12 chRDNA guide / nuclear protein complex).

[0291] The Cas12 chRDNA guide molecule can be designed such that the Cas12 chRDA guide / nuclear protein complex can hybridize to multiple positions within the nucleic acid sample. Multiple Cas12 chRDNA guide / nuclear protein complexes can be contacted with the nucleic acid sample. The multiple Cas12 chRDNA guide / nuclear protein complexes can include Cas12 chRDNA guide molecules designed to hybridize to the same sequence. The multiple Cas12 chRDNA guide / nuclear protein complexes can include Cas12 chRDNA guide molecules designed to hybridize to different target sequences.

[0292] Target arrays can be present at different positions within the target nucleic acid. These positions can contain the same or similar target nucleic acid sequences. These positions can contain different nucleic acid sequences. These positions are defined according to their distance from each other. These positions are less than 10 kilobases (Kb) apart, less than 8 Kb apart, less than 6 Kb apart, less than 4 Kb apart, less than 2 Kb apart, less than 1 Kb apart, less than 900 nucleotides apart, less than 800 nucleotides apart, less than 700 nucleotides apart, less than 600 nucleotides apart, less than 500 nucleotides apart, less than 400 nucleotides apart, less than 300 nucleotides apart, less than 200 nucleotides apart, or less than 100 nucleotides apart.

[0293] The Cas12a chRDNA guide / nuclear protein complex can cleave the target nucleic acid, and as a result, excise a target nucleic acid that can be of the following lengths: a length of less than 10 kilobases (Kb), a length of less than 8 Kb, a length of less than 6 Kb, a length of less than 4 Kb, a length of less than 2 Kb, a length of less than 1 Kb, a length of less than 900 nucleotides, a length of less than 800 nucleotides, a length of less than 700 nucleotides, a length of less than 600 nucleotides, a length of less than 500 nucleotides, a length of less than 400 nucleotides, a length of less than 300 nucleotides, a length of less than 200 nucleotides, or a length of less than 100 nucleotides.

[0294] The Cas12 chRDNA guide / nuclear protein complex can bind to fragmented target nucleic acids that can be less than 10 kilobases (Kb) in length, less than 8 Kb in length, less than 6 Kb in length, less than 4 Kb in length, less than 2 Kb in length, less than 1 Kb in length, less than 900 nucleotides in length, less than 800 nucleotides in length, less than 700 nucleotides in length, less than 600 nucleotides in length, less than 500 nucleotides in length, less than 400 nucleotides in length, less than 300 nucleotides in length, less than 200 nucleotides in length, or less than 100 nucleotides in length.

[0295] The Cas12 chRDNA guide molecules of the present disclosure can be synthesized in vitro by known methods such as chemical methods in solution or on a solid support, or, in some cases, can be produced recombinantly. A single manufacturing technique or synthetic technique, or a combination of manufacturing and synthetic techniques, can be used, and in these techniques, deoxyribonucleotide bases and / or modifications can be introduced at one or more positions over the length of the sequence.

[0296] In some embodiments, the Cas12 chRDNA guide molecule, its targeting region, or its activation region is designed to contain deoxyribonucleotide bases (and / or modified deoxyribonucleotide bases) at certain positions when compared to a reference Cas12 chRDA guide molecule, reference targeting region, or reference activation region (each composed of ribonucleotide bases).

[0297] In some embodiments, the reference Cas12a chRDNA guide molecule comprises the following RNA sequence: UAAUUUCUACUCUUGUAGAUGAGUCUCUCAGCUGGUACAC. Examples of the Cas12a chRDNA guide molecules of the present disclosure (designed based on this reference RNA sequence) include Cas12 chRDNA guide molecules having one or more deoxyribonucleotide bases at one or more of positions 1, 3, 7, 10, 12, 14, 15, 16, 17, 18, 19, 21, 28, 29, 30, 31, 32, 34, 35, 36, 37, 38, 39, and 40. In some embodiments, 23 or fewer, 22 or fewer, 21 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer, or 1 of these enumerated positions is a deoxyribonucleotide base. In some embodiments, all of the one or more deoxyribonucleotide bases in the targeting region form standard base pairs with the target sequence. In some embodiments, at least one of the one or more deoxyribonucleotide bases in the targeting region does not form a standard base pair with the target sequence.

[0298] In some embodiments, the reference Cas12a chRDNA guide molecule comprises the following RNA sequence: UAAUUUCUACUCUUGUAGAUAGUGGGGGUGAAUUCAGUGU. Examples of the Cas12 chRDNA guide molecules of the present disclosure (designed based on this reference RNA sequence) include Cas12a chRDNA guide molecules having one or more deoxyribonucleotide bases at one or more of positions 1, 3, 7, 10, 12, 14, 15, 16, 17, 18, 19, 21, 28, 29, 30, 31, 32, 34, 35, 36, 37, 38, 39, and 40. In some embodiments, 23 or fewer, 22 or fewer, 21 or fewer, 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer, or 1 of these enumerated positions is a deoxyribonucleotide base. In some embodiments, all of the one or more deoxyribonucleotide bases in the targeting region form standard base pairs with the target sequence. In some embodiments, at least one of the one or more deoxyribonucleotide bases in the targeting region does not form a standard base pair with the target sequence.

[0299] In some embodiments, the reference activation region comprises the following RNA sequence: UAAUUUCUACUCUUGUAGAU. Examples of the deoxyribonucleotide base-containing activation regions of the present disclosure (designed based on this reference RNA sequence) include activation regions having one or more deoxyribonucleotide bases at one or more of positions 1, 3, 7, 10, 12, 14, 15, 16, 17, 18, and 19. In some embodiments, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer, or 1 of these enumerated positions is a deoxyribonucleotide base.

[0300] In some embodiments, the reference targeting region comprises the following RNA sequence: GAGUCUCUCAGCUGGUACAC. Examples of the deoxyribonucleotide base-containing targeting regions of the present disclosure (designed based on this reference RNA sequence) include targeting regions having one or more deoxyribonucleotide bases at one or more of positions 1, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, and 20. In some embodiments, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer, or 1 of these enumerated positions are deoxyribonucleotide bases.

[0301] In some embodiments, the reference targeting region comprises the following RNA sequence: AGUGGGGGUGAAUUCAGUGU. Examples of the deoxyribonucleotide base-containing targeting regions of the present disclosure (designed based on this reference RNA sequence) include targeting regions having one or more deoxyribonucleotide bases at one or more of positions 1, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, and 20. In some embodiments, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer, or 1 of these enumerated positions are deoxyribonucleotide bases.

[0302] In some embodiments, the activation region has the sequence TrAArUrUrUCrUrACrUCrUTGrUrArGArU (where "r" precedes a ribonucleotide base; the absence of "r" preceding a base indicates a deoxyribonucleotide base).

[0303] In some embodiments, the targeting region has the sequence GrArGrUrCrUrCrUrCrAGrCrUrGrGrUrArCrAC (where "r" precedes a ribonucleotide base; the absence of "r" preceding a base indicates a deoxyribonucleotide base).

[0304] In some embodiments, the targeting region has the sequence ArGrUrGrGrGrGrGrUrGArArUrUrCrArGrUrGT (where "r" precedes a ribonucleotide base; the absence of "r" preceding a base indicates a deoxyribonucleotide base).

[0305] In some embodiments, the Cas12a chRDNA guide has the sequence TrAArUrUrUCrUrACrUCrUTGrUrArGArUGrArGrUrCrUrCrUrCrAGrCrUrGrGrUrArCrAC (where "r" precedes a ribonucleotide base; the absence of "r" preceding a base indicates a deoxyribonucleotide base).

[0306] In some embodiments, the Cas12a chRDNA guide has the sequence TrAArUrUrUCrUrACrUCrUTGrUrArGArUArGrUrGrGrGrGrGrUrGArArUrUrCrArGrUrGT (where "r" precedes a ribonucleotide base; the absence of "r" preceding a base indicates a deoxyribonucleotide base).

[0307] Cas12 protein The Cas12 proteins of the present disclosure include, but are not limited to, wild-type Cas12 proteins derived from type V CRISPR-Cas systems, modified Cas12 proteins, variants of Cas12 proteins, Cas12 orthologs, and combinations thereof. In some embodiments, the Cas12 protein is a wild-type Cas12a protein, a modified Cas12a protein, a variant of the Cas12a protein, a Cas12a ortholog, or a combination thereof.

[0308] The Cas12 protein can be modified. Such modification may include modification to amino acids. Such modification may also change the primary amino acid sequence and / or also the secondary, tertiary, and / or quaternary amino acid structures. In some embodiments, one or more amino acid sequences of the Cas12 protein can be changed without significantly affecting the structure or function of this Cas12 protein. The type of mutation may not be important if the change occurs in a region of the protein that is not important (for example, an unimportant region). Depending on the position of replacement, the mutation may not significantly affect the biological properties of the resulting variant. For example, the properties and functions of a particular Cas12 variant can be of the same type as those of the wild-type Cas12.

[0309] In some cases, whether a mutation can have a decisive impact on the structure and / or function of the Cas12 protein can be determined using sequence and / or structural alignment. Sequence alignment can identify similar and / or dissimilar regions of the polypeptide (for example, conserved, non-conserved, hydrophobic, hydrophilic, etc.). In some cases, regions within the sequence of interest that are similar to other sequences are suitable for modification. In other cases, regions within the sequence of interest that are not similar to other sequences are suitable for modification. For example, sequence alignment can be performed by database search, pairwise alignment, multiple sequence alignment, genome analysis, motif discovery, benchmarking, and / or programs such as BLAST, CS-BLAST, HHPRED, psi-BLAST, LALIGN, PyMOL, and SEQALN. Structural alignment can be performed by programs such as Dali, PHYRE, Chimera, COOT, O, and PyMOL. Alignment can be performed by database search, pairwise alignment, multiple sequence alignment, genome analysis, motif discovery, or benchmarking, or any combination thereof.

[0310] Cas12 proteins typically consist of six domains corresponding to the REC1, REC2, PAM-interacting (PI), nuclease (Nuc), Wedge (WED), and RuvC domains. See, for example, Yamano et al. (Cell, 2016, 165(4):949-962). The WED domain and the RuvC domain may have a triple sequence structure interrupted by sequences from other domains. For example, the Acidaminococcus species Cas12a WED domain sequence is interrupted by the REC1, REC2, and PI domain sequences. In addition, certain subtypes of Cas12 proteins include a bridging helix domain adjacent to or occurring between RuvC domain sequences.

[0311] The regions of the Cas12 protein can be modified to regulate the activity of the Cas12 protein. For example, the regions of the Acidaminococcus species (strain BV3L6) Cas12a protein corresponding to the residues of the PI domain (598-718) and the WED domain (526-597 and 719-883) can be modified to change the PAM specificity. See, for example, Toth et al. (Nucleic Acid Research, 2020, 48(7):3722-3733). The regions in the Acidaminococcus species (strain BV3L6) Cas12a protein corresponding to the residues of the REC1 (24-319) and REC2 (320-526) domains can be modified to change the kinetics of target association and cleavage. The regions of the REC1 (226-304) and REC2 (368-435) domains directly interact with the target binding sequence and the PAM distal end of the target sequence and are engineered to modify the efficiency of cleavage of the target sequence. The regions of the Nuc domain (1066-1261) and the RuvC domain (940-956, 957-1065, and 1261-1307) can be modified to change the cleavage efficiency of the target strand, the non-target strand, or both the target strand and the non-target strand of the target sequence. Manipulation of these regions can include introduction of mutations, replacement with corresponding regions from other Cas12 orthologs, deletions, insertions, etc.

[0312] The modified Cas12 protein can be used in combination with a Cas12 chRDNA guide molecule to alter the activity or specificity of the Cas12 protein. In some cases, the Cas12 protein can be modified to enhance activity or specificity when complexed with a Cas12 chRDNA guide molecule, and such Cas12 modifications occur in the domains of REC1, REC2, RuvC, WED, and / or Nuc. In some cases, the Cas12 protein can be modified to enhance activity or specificity when complexed with a Cas12 chRDNA guide molecule, and such Cas12a modifications occur in regions of 226-304, 368-435, 940-956, 978-1158, 1159-1180, and 1181-1298 (numbering based on the Acidaminococcus sp. Cas12a sequence).

[0313] Such mutations can be generated by site-directed mutagenesis. Mutations include substitutions, additions, deletions, or any combination thereof. In some cases, the mutation converts the amino acid being mutated to alanine. In other cases, the mutation converts the amino acid being mutated to another amino acid (e.g., glycine, serine, threonine, cysteine, valine, leucine, isoleucine, methionine, proline, phenylalanine, tyrosine, tryptophan, aspartic acid, glutamic acid, asparagine, glutamine, histidine, lysine, or arginine). The mutation converts the amino acid being mutated to a non-natural amino acid (e.g., selenomethionine). The mutation converts the amino acid being mutated to an amino acid mimic (e.g., a phosphate mimic). The mutation can be a conservative mutation. For example, the mutation converts the amino acid being mutated to an amino acid similar in size, shape, charge, polarity, higher-order structure, and / or rotamer to the amino acid being mutated (e.g., cysteine / serine mutation, lysine / asparagine mutation, histidine / phenylalanine mutation).

[0314] In some embodiments, the Cas12 protein is an nCas12 protein. The nCas12 protein is a variant of the Cas12 protein lacking nuclease activity and is also referred to as "nickase Cas12" or "Cas12-nickase". Such molecules lack some of the endonuclease activity and thus can introduce a nick only in one strand of the target nucleic acid. See, for example, Jinek et al. (Science, 2012, 337:816-821). This is achieved, for example, by introducing mutations into the RuvC nuclease domain. Non-limiting examples of such modifications include D917A, E1006A, and D1225A to the RuvC nuclease domain of the F. novicida Cas12a protein. It is understood that mutations of other catalytic residues to reduce the activity of the RuvC nuclease domain can also be performed by those skilled in the art. The resulting nCas12 protein is unable to cleave double-stranded DNA but retains the ability to complex with the guide molecule, bind to the target DNA sequence, and introduce a nick in only one strand of the target DNA. Targeting specificity is determined by the binding of the Cas12 protein to the PAM sequence and the complementary base pairing of the guide molecule to the genomic locus. In some embodiments of the present disclosure, the nCas12 protein is an nCas12a protein.

[0315] In some embodiments, the Cas12 protein is a dCas12 protein. The dCas12 protein is a variant of the Cas12 protein that is inactivated as a nuclease and is also referred to as a "catalytically inactive Cas12 protein", "enzymatically inactive Cas12", "catalytically dead Cas12", or "dead Cas12". Such molecules lack endonuclease activity and are thus used to guide gene regulation in an RNA-dependent manner. See, for example, Jinek et al. (Science, 2012, 337: 816-821). One of ordinary skill in the art can perform mutations of catalytic residues to remove the activity of the RuvC domain. The resulting dCas12 protein is unable to cleave double-stranded DNA but retains the ability to complex with a guide molecule and bind to a target DNA sequence. Targeting specificity is determined by the binding of the Cas12 protein to the PAM sequence and the complementary base pairing of the guide molecule to the genomic locus. In some embodiments of the present disclosure, the dCas12 protein is a dCas12a protein.

[0316] Certain Cas12 protein subtypes lack nuclease activity due to inactivation of the RuvC-like nuclease domain or deletion of part or all of the RuvC-like nuclease domain. One such subtype, the V-K type and related protein Cas12k, is instead related to the Tn7-like transposable elements tnsB, tnsC, and tniQ. See, for example, Strecker et al. (Science 2019, 364(6448): 48-53). Cas12k retains the ability to complex with a guide molecule and bind to a target DNA sequence, and the related Tn7-like proteins promote the translocation of RNA-guided DNA sequences. In some embodiments of the present disclosure, the Cas12 chRDNA guide / nuclear protein complex is a Cas12k chRDNA guide / nuclear protein complex.

[0317] Other amino acid modifications include glycosylated forms of amino acids, aggregating conjugates with other molecules, and covalent conjugates with unrelated chemical entities (e.g., PEGylated molecules). Covalent variants can be produced by linking a functional group to a group found in the amino acid chain or the N-terminal or C-terminal residue. In some cases, allelic variants and species variants are also included as mutated site-specific polypeptides.

[0318] In certain embodiments, the Cas12 protein can be a fusion protein or chimeric protein comprising a first domain derived from the Cas12 protein and a second domain derived from a different protein such as the Csy4 protein. Fusion modification to the Cas12 protein confers additional activity to the modified Cas12 protein. Such activities include nuclease activity that modifies a polypeptide (e.g., histone) associated with a nucleic acid target sequence, methyltransferase activity, demethylase activity, DNA repair activity, DNA damage activity, deamination activity, dismutase activity, alkylation activity, depurination activity, oxidation activity, pyrimidine dimer formation activity, integrase activity, transposase activity, ribonuclease activity, polymerase activity, ligase activity, helicase activity, photolyase activity, glycosylase activity, acetyltransferase activity, deacetylase activity, kinase activity, phosphatase activity, ubiquitin ligase activity, reverse transcriptase activity, deubiquitination activity, adenylation activity, deadenylation activity, SUMOylation activity, desumoylation activity, ribosylation activity, deribosylation activity, and / or myristoylation activity or demyristoylation activity.

[0319] In certain embodiments, the Cas12 protein can include one or more NLS sequences (e.g., added to and / or inserted within the Cas12 protein sequence). The NLS sequence can be located, for example, at the N-terminus, at the C-terminus, within the Cas12 protein (e.g., Cas12a protein), or can include combinations thereof (e.g., one or more NLSs at the N-terminus and one or more NLSs at the C-terminus).

[0320] In certain embodiments, the Cas12 protein comprising the Cas12a protein can include multiple NLS sequences, e.g., at least 2, at least 3, at least 4, or at least 5 NLS sequences. The multiple NLS sequences can be present at a single terminus of the Cas12a protein (e.g., the NLS sequences are present only at the N-terminus or C-terminus) or can be present at both termini (e.g., one or more NLS sequences at the N-terminus and one or more NLS sequences at the C-terminus). The NLS sequence can be fully synthetic, modified, or can be derived from an endogenous or exogenous protein sequence. In some embodiments, the Cas12 protein comprising the Cas12a protein can include an NLS sequence selected from SV40 large T antigen, nucleoplasmin, 53BP1, VACM-1 / CUL5, CXCR4, VP1, ING4, IER5, ERK5, UL79, EWS, Hrp1, cMyc(1), cMyc(2), mouse c-able IV, Matα2, and MINIYO, or can be modified from or derived from this NSL sequence.

[0321] In some embodiments, the Cas12 protein comprising the Cas12a protein may comprise an NLS sequence selected from any of SEQ ID NOs: 04, 05, and 493 - 507, or may be modified from or derived from this NLS sequence. The modified or derived NLS sequence may, with respect to a reference NLS sequence (e.g., an NLS sequence selected from any of SEQ ID NOs: 04, 05, and 493 - 507), include, for example, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer, or 1 amino acid substitution; 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer, or 1 amino acid deletion, and / or 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer, or 1 amino acid addition.

[0322] In some embodiments, the NLS sequence may have at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to an NLS sequence selected from any of SEQ ID NOs: 04, 05, and 493 - 507.

[0323] The NLS sequence may be covalently attached directly or via a linker polypeptide (e.g., to the Cas12 protein, to another NLS sequence, or to a fusion peptide sequence attached to the Cas12 protein). The length of the linker sequence is optimized according to the structural characteristics of a particular Cas12 protein (e.g., solvent accessibility at the termini, the presence of other important functional peptide sequences at the termini, etc.) to ensure access of the NLS sequence for binding and transport by the cognate importin protein. Additionally, as described in Example 11 herein, it is also possible to empirically screen for the desired linker length.

[0324] In some embodiments, the NLS sequence is covalently attached via a linker sequence comprising one or more amino acids to, for example, a Cas12 protein, to another NLS sequence, or to a fusion peptide sequence attached to a Cas12 protein. In some embodiments, the linker sequence comprises at least one glycine, serine, and / or threonine residue. In some embodiments, the linker sequence comprises at least one glycine residue and at least one serine residue. In some embodiments, the linker sequence comprises a plurality of glycine residues and at least one serine residue. In some embodiments, the linker sequence consists of or comprises a GS sequence. In some embodiments, the linker sequence consists of or comprises a GGGGS sequence. In some embodiments, the linker sequence consists of or comprises a GGGGSGGGGS sequence.

[0325] In some embodiments, the Cas12a protein comprises at least one linker sequence and at least one NLS sequence at its C-terminus. In some embodiments, this at least one NLS sequence is selected from the sequences of SV40 large T antigen and nucleoplasmin, or sequences modified from or derived from them.

[0326] In certain embodiments, the Cas12a protein comprises a GGGGSGGGGS linker sequence and a nucleoplasmin NLS sequence at its C-terminus, and the nucleoplasmin NLS sequence is located on the C-terminal side of the GGGGSGGGGS linker sequence.

[0327] In certain embodiments, the Cas12a protein includes, at its C-terminus, at least one GS linker sequence, an SV40 large T antigen NLS sequence, and a nucleoplasmin NLS sequence, and the nucleoplasmin NLS sequence is located on the C-terminal side of the SV40 large T antigen NLS sequence. In some of these embodiments, a first GS linker sequence is present on the N-terminal side of the SV40 large T antigen NLS sequence, and a second GS linker sequence is present between the SV40 large T antigen NLS sequence and the nucleoplasmin NLS sequence.

[0328] In certain embodiments, the Cas12a protein includes, at its C-terminus, a GS linker sequence, a GGGGSGGGGS linker sequence, an SV40 large T antigen NLS sequence, and a nucleoplasmin NLS sequence, and the nucleoplasmin NLS sequence is located on the C-terminal side of the SV40 large T antigen NLS sequence. In some of these embodiments, the GGGGSGGGGS linker sequence is present on the N-terminal side of the SV40 large T antigen NLS sequence, and the GS linker sequence is present between the SV40 large T antigen NLS sequence and the nucleoplasmin NLS sequence.

[0329] In certain embodiments, the Cas12a protein includes, at its C-terminus, a GGGGSGGGGS linker sequence and an SV40 large T antigen NLS sequence, and the SV40 large T antigen NLS sequence is located on the C-terminal side of the GGGGSGGGGS linker sequence.

[0330] In some embodiments, the Cas12a protein includes a linker and an NLS-containing sequence at its C-terminus. In some embodiments, this linker and NLS-containing sequence includes or consists of an amino acid sequence selected from SEQ ID NOs: 479-490. In some embodiments, this linker and NLS-containing sequence includes or consists of an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence selected from SEQ ID NOs: 479-490.

[0331] The cognate Cas12 chRDNA guide / nuclear protein complex can also be produced using methods well known in the art. The Cas12 protein component can be produced recombinantly and then the Cas12 chRDNA guide molecule and the Cas12 protein can be combined and complexed using methods known in the art. See, for example, Example 2, which provides a non-limiting example of a method for constructing a nuclear protein complex comprising a guide molecule / Cas12 protein.

[0332] In addition, cell lines that constitutively express the Cas12 protein can be developed and transfected with the Cas12 chRDNA guide component, and the complex can be purified from the cells using standard purification techniques such as, but not limited to, affinity, ion exchange, and size exclusion chromatography. See, for example, Jinek et al. (Science, 2012, 337:816-821).

[0333] According to known methods, Cas12 protein can be produced using an expression cassette encoding the Cas12 protein. The expression cassette typically contains regulatory sequences that function in the host cell into which the expression cassette is introduced. The regulatory sequences are involved in one or more of the following: regulation of transcription, post-transcriptional regulation, and regulation of translation. The expression cassette can be present in an expression vector and introduced into a variety of host cells, including bacterial cells, yeast cells, plant cells, and mammalian cells.

[0334] Cas12 protein can be produced with a vector (e.g., an expression vector) containing a polynucleotide encoding the Cas12 protein. Vectors useful for the production of Cas12 protein include plasmids, viruses (including phages), and integratable nucleic acid fragments (i.e., fragments that can be integrated into the host genome by homologous recombination). The vector can replicate and function independently of the host genome or, in some cases, be integrated into the genome itself. Suitable replicating vectors contain a replicon and control sequences derived from a species compatible with the intended expression host cell. In some embodiments, the polynucleotide encoding the Cas12 protein is operably linked to an inducible promoter, a repressive promoter, or a constitutive promoter. The expression vector can also contain a polynucleotide encoding a protein tag (e.g., a polyHis tag, a hemagglutinin tag, a fluorescent protein tag, a bioluminescent tag, a nuclear localization tag). The coding sequence of such a protein tag can be fused to the coding sequence or be included in the expression cassette (e.g., a targeting vector).

[0335] General methods for constructing expression vectors are known in the art. Expression vectors for most host cells are commercially available. There are several commercially available software products designed to facilitate the selection and construction of appropriate vectors such as insect cell vectors for transformation of insect cells and gene expression in insect cells, bacterial plasmids for transformation of bacteria and gene expression in bacterial cells, yeast plasmids for transformation of cells and gene expression in yeast and other fungi, mammalian vectors for transformation of mammalian cells and gene expression in mammalian cells or mammals, viral vectors for transformation of cells and gene expression (including retroviral, lentiviral, and adenoviral vectors), etc., as well as methods for facilitating the cloning of such polynucleotides. For example, SnapGene™ (GSL Biotech LLC, Chicago, Ill.; snapgene.com / resources / plasmid_files / your_time_is_valuable / ) provides a wide list of vectors, individual vector sequences, and vector maps, as well as commercial sources for many vectors. A number of mammalian vectors suitable for use are commercially available (e.g., from Life Technologies, Grand Island, NY; NeoBiolab, Cambridge, MA; Promega, Madison, WI; ATUM, Menlo Park, CA; Addgene, Cambridge, MA).

[0336] Vectors derived from mammalian viruses can also be used to express the Cas12 protein component of the present method in mammalian cells. Examples of such vectors include vectors derived from viruses such as adenovirus, adeno-associated virus, parvovirus, herpes virus, polyomavirus, cytomegalovirus, lentivirus, retrovirus, vaccinia, and simian virus 40 (SV40). See, for example, Kaufman et al. (Mol. Biotech., 2000, 16: 151-160); and Cooray et al. (Methods Enzymol., 2012, 507: 29-57). Regulatory sequences operably linked to the Cas12 protein coding sequence include activator binding sequences, enhancers, introns, polyadenylation recognition sequences, promoters, repressor binding sequences, stem-loop structures, translation initiation sequences, translation leader sequences, transcription termination sequences, translation termination sequences, primer binding sites, and the like. Commonly used promoters are CMV, MND, EF1a, SV40, PGK1 (mouse or human), Ubc, CAG, CaMKIIa, and beta-Act, which are constitutive mammalian promoters, and others are known in the art. See, for example, Khan et al. (Advanced Pharmaceutical Bulletin, 2013, 3: 257-263). Additionally, mammalian RNA polymerase III promoters, including H1 and U6, can be used.

[0337] For the expression of gene products, many mammalian cell lines, including HEK 293 (human embryonic kidney) and CHO (Chinese hamster ovary), are utilized. These cell lines can be transfected by standard methods (e.g., using calcium phosphate or polyethyleneimine (EPI), or electroporation). Other typical mammalian cell lines include, but are not limited to, HeLa, U2OS, 549, HT1080, CAD, P19, NIH 3T3, L929, N2a, human embryonic kidney 293 cells, MCF-7, Y79, SO-Rb50, Hep G2, DUKX-X11, J558L, and baby hamster kidney (BHK) cells. Such cells are examples of cells used to produce Cas12 protein.

[0338] A vector can be introduced into a prokaryote and propagated therein. Prokaryotic vectors are well known in the art. Typically, a prokaryotic vector includes an origin of replication suitable for the target host cell (e.g., oriC from Escherichia coli (E. coli), pUC from pBR322, pSC101 from Salmonella), the 15A origin (derived from p15A), and a bacterial artificial chromosome. The vector may include a selectable marker (e.g., a gene encoding resistance to ampicillin, chloramphenicol, gentamicin, and kanamycin). Zeocin™ (Life Technologies, Grand Island, NY) can be used for selection in bacterial, fungal (including yeast), plant, and mammalian cell lines. Thus, a vector having only one drug resistance gene for Zeocin™ for selection operations in several organisms can be designed. Useful promoters are known for protein expression in prokaryotes, for example, T5, T7, Rhamnose (inducible), Arabinose (inducible), and PhoA (inducible). In addition, the T7 promoter is widely used in vectors that also encode T7 RNA polymerase. Prokaryotic vectors may also include ribosome binding sites of various strengths, and secretion signals (e.g., mal, sec, tat, ompC, and pelB). In addition, the vector may include an RNA polymerase promoter for the expression of NATNA. Transcription termination sequences for prokaryotic RNA polymerases are also well known (e.g., the transcription termination sequence from Streptococcus pyogenes (S. pyogenes)).

[0339] Protein expression in prokaryotes is frequently carried out in E. coli by vectors containing a constitutive or inducible promoter that directs the expression of a fusion or non-fusion protein. However, protein expression using other prokaryotic systems is within the scope of the present disclosure.

[0340] In some embodiments, the vector is a yeast expression vector. Examples of vectors for expression in Saccharomyces cerevisiae include, but are not limited to, pYepSec1, pMFa, pJRY88, pYES2, and picZ. Methods for gene expression in yeast cells are known in the art. See, for example, Christine Guthrie and Gerald R. Fink, "Guide to Yeast Genetics and Molecular and Cell Biology, Part A" in Methods in Enzymology, 2004, Volume 194, Elsevier Academic Press, San Diego, CA. Typically, expression of a protein-coding gene in yeast requires a promoter operably linked to the coding region of interest and a transcription terminator. Various yeast promoters can be used to construct expression cassettes for gene expression in yeast.

[0341] Genome editing of cells using the Cas12 chRDNA guide / nuclear protein complex Delivery of the Cas12 chRDNA guide molecule, Cas12 protein, and Cas12 chRDNA guide / nuclear protein complex of the present disclosure to cells in vitro, ex vivo, or in vivo can be achieved by several methods known to those skilled in the art. Non-limiting methods for introducing these components into cells include viral vector delivery, sonoporation, cell squeezing, electroporation, nucleofection, lipofection, particle gun technology, microprojectile bombardment, or chemicals (e.g., cell-penetrating peptides).

[0342] In some embodiments, electroporation can be used to deliver the Cas12 chRDNA guide molecules of the present disclosure into cells. Electroporation can also be used to deliver the Cas12 chRDNA guide / nuclear protein complexes of the present disclosure. In these methods, the chRDNA guide molecules or Cas12 chRDNA guide / nuclear protein complexes are mixed with the target cells in an electroporation buffer to form a suspension. Then, an electric pulse is applied to this suspension at an optimal voltage, thereby temporarily forming pores in the phospholipid bilayer of the cell membrane and enabling charged molecules (such as nucleic acids and proteins) to be transported into the cells through these pores. Reagents and equipment for performing electroporation are commercially available.

[0343] Example 3 shows the nucleofection of activated T cells with a Cas12 guide / nuclear protein complex. Example 5 shows the nucleofection of activated T cells with a Cas12 chRDNA guide / nuclear protein complex.

[0344] A Cas12 chRDNA guide / nuclear protein complex can be used to cleave or bind to a target nucleic acid. A Cas12 chRDNA guide molecule can be introduced into a cell together with a Cas12 protein, thereby forming a Cas12 chRDNA guide / nuclear protein complex. The Cas12 chRDNA guide / nuclear protein complex can hybridize to a target nucleic acid containing a PAM. In one embodiment, the present disclosure is a method of binding to a nucleic acid target sequence in a polynucleotide (e.g., double-stranded DNA (dsDNA)), comprising preparing one or more Cas12 chRDNA guide / nuclear protein complexes for introduction into a cell, and delivering the Cas12 nuclear protein complex into the cell, thereby promoting contact between the Cas12 chRDNA guide / nuclear protein complex and the target polynucleotide sequence. In one embodiment, the first Cas12 chRDNA guide / nuclear protein complex comprises a Cas12 chRDNA guide molecule having a first targeting region element complementary to a first nucleic acid target sequence in the polynucleotide, and the second Cas12 chRDNA guide / nuclear protein complex comprises a Cas12 chRDNA guide molecule having a second targeting region complementary to a second nucleic acid target sequence in the polynucleotide. Contact between the Cas12 chRDNA guide / nuclear protein complex and the polynucleotide causes the Cas12 chRDNA guide / nuclear protein complex to bind to the nucleic acid target sequence in the polynucleotide. In one embodiment, in the polynucleotide, the first Cas12a chRDNA guide / nuclear protein complex binds to the first nucleic acid target sequence; the second Cas12a chRDNA guide / nuclear protein complex binds to the second nucleic acid target sequence.

[0345] Can such a method of binding to a nucleic acid target sequence be carried out in vitro (e.g., during a biochemical reaction or in cultured cells; in some embodiments, the cultured cells are human cultured cells that remain in the culture medium and are not introduced into humans), in vivo (e.g., in the cells of a living organism, provided that in some embodiments, the organism is a non-human organism), or ex vivo (e.g., cells removed from a subject, provided that in some embodiments, the subject is a non-human subject)?

[0346] Delivery of the Cas12 chRDNA guide molecules, Cas12 proteins, and Cas12 chRDNA guide / nuclear protein complexes of the present disclosure to cells can be achieved by packaging this component into a biological compartment. The biological compartment containing this component can be administered in vivo (e.g., in the cells of a living organism, provided that in some embodiments, the organism is a non-human organism). Examples of biological compartments include, but are not limited to, viruses (lentivirus, adenovirus), nanospheres, liposomes, quantum dots, nanoparticles, microparticles, nanocapsules, vesicles, polyethylene glycol particles, hydrogels, and micelles.

[0347] For example, the biological compartment can include liposomes. Liposomes can be self-assembling structures that include one or more lipid bilayers, each of which can include two monolayers containing amphipathic lipid molecules oriented in opposite directions. Amphipathic lipids can include a polar (hydrophilic) head group covalently linked to one or two or more nonpolar (hydrophobic) acyl or alkyl chains. Due to the energetically unfavorable contact between the hydrophobic acyl chains and the surrounding aqueous medium, the amphipathic lipid molecules are arranged such that the polar head groups are oriented towards the surface of the bilayer and the acyl chains are oriented towards the interior of the bilayer, effectively blocking the contact between the acyl chains and the aqueous environment.

[0348] Examples of preferred amphiphilic compounds used in liposomes include phospholipids and sphingolipids, and representative examples thereof include phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, phosphatidylglycerol, palmitoyloleoylphosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine, dimyristoylphosphatidylcholine (DMPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylcholine, distearoylphosphatidylcholine (DSPC), dilinoleoylphosphatidylcholine, egg sphingomyelin, or any combination thereof.

[0349] Biological compartments can contain nanoparticles. The nanoparticles can have a diameter of about 40 nanometers to about 1.5 micrometers, about 50 nanometers to about 1.2 micrometers, about 60 nanometers to about 1 micrometer, about 70 nanometers to about 800 nanometers, about 80 nanometers to about 600 nanometers, about 90 nanometers to about 400 nanometers, or about 100 nanometers to about 200 nanometers. In some cases, as the size of the nanoparticles increases, the release rate is delayed or extended, and as the size of the nanoparticles decreases, the release rate increases.

[0350] In certain embodiments, the Cas12 chRDNA guide / nuclear protein complex is packaged into a biological compartment. In some cases, a nucleic acid encoding Cas12 and a chemically synthesized chRDNA guide are packaged into a biological compartment. In some cases, an mRNA encoding Cas12 and a chemically synthesized chRDNA guide are packaged into a biological compartment.

[0351] Various methods for assessing and / or quantifying the interaction between a nucleic acid sequence and a polypeptide are known in the art, including, but not limited to, chromatin immunoprecipitation (ChIP) assays, DNA electrophoretic mobility shift assays (EMSA), DNA pull-down assays, and microplate capture and detection assays. Commercially available kits, materials, and reagents are available for performing many of these methods and can be obtained, for example, from the following suppliers: Thermo Scientific (Wilmington, DE), Signosis (Santa Clara, CA), Bio-Rad (Hercules, CA), and Promega (Madison, WI). A common approach for detecting the interaction between a polypeptide and a nucleic acid sequence is EMSA (see, e.g., Hellman L.M. et al., Nature Protocols 2(8):1849-1861 (2007)).

[0352] In another embodiment, the present disclosure is a method of cleaving a nucleic acid target sequence in a polynucleotide (e.g., a single-strand break in dsDNA or a double-strand break in dsDNA), the method comprising preparing one or more Cas12 chRDNA guide / nuclear protein complexes for introduction into a cell, and delivering the Cas12 chRDNA guide / nuclear protein complex into the cell, thereby facilitating contact between the Cas12 chRDNA guide / nuclear protein complex and the polynucleotide. In one embodiment, a first Cas12 chRDNA guide / nuclear protein complex comprising a first Cas12 chRDNA guide molecule having a first targeting region complementary to a first nucleic acid target sequence in the polynucleotide; and a second Cas12 chRDNA guide / nuclear protein complex comprising a second Cas12 chRDNA guide molecule having a second targeting region complementary to a second nucleic acid target sequence in the polynucleotide are introduced into the cell. This contact results in cleavage of the nucleic acid target sequence in the polynucleotide (e.g., dsDNA) by the Cas12 chRDNA guide / nuclear protein complex. In one embodiment, the first Cas12a chRDNA guide / nuclear protein complex binds to a first nucleic acid target sequence in dsDNA and cleaves the first strand of this dsDNA; the second Cas12a chRDNA guide / nuclear protein complex binds to a second nucleic acid target sequence in dsDNA and cleaves the second strand of this dsDNA. In some embodiments, the nucleic acid target sequence is DNA or genomic DNA. Such methods of binding to nucleic acid target sequences are performed in vitro, in cells (e.g., in cultured cells), ex vivo (e.g., stem cells removed from a subject), and in vivo.

[0353] The target nucleic acid sequence is appropriately selected, for example, based on a desired position in a polynucleotide sequence or genome and / or a polynucleotide sequence or gene sequence in the genome that is to be deleted or disrupted.

[0354] In additional embodiments for cleaving a nucleic acid target sequence in a polynucleotide, a donor polynucleotide may also be introduced into the cell to facilitate integration of at least a portion of this donor polynucleotide into the genomic DNA of the cell. Typically, the donor polynucleotide is in proximity to the site-specific target nucleic acid cleavage such that insertion (e.g., homologous recombination) of the donor polynucleotide into the site of the double-strand break is enhanced. In some cases, the donor polynucleotide is in proximity to the site of the double-strand break in the target nucleic acid by binding to the Cas12 protein (e.g., Cas12a) that generates the double-strand break.

[0355] The donor polynucleotide sequence is appropriately selected, for example, based on the desired modification being pursued. For example, the donor polynucleotide may encode all or a portion of a protein of interest. In some embodiments, the donor polynucleotide may encode a CAR.

[0356] The present disclosure further encompasses delivery of a donor polynucleotide to a cell by a virus, wherein the donor polynucleotide encodes a CAR.

[0357] In some embodiments, the donor polynucleotide can be single-stranded. In some embodiments, the donor polynucleotide can be double-stranded. In some embodiments, the donor DNA can be small circular. In some embodiments, the donor polynucleotide can be a plasmid. In some embodiments, the plasmid can be supercoiled. In some embodiments, the donor polynucleotide is methylated. In some embodiments, the donor polynucleotide is not methylated. The donor polynucleotide can include modifications. Modifications include, but are not limited to, those described herein, such as biotinylation, chemical conjugates, and synthetic nucleotides.

[0358] Therapeutic Compositions, Applications, and Methods The Cas12 chRDNA guide molecules of the present disclosure, and Cas12 chRDNA guide / nuclear protein complexes, can be used in the production of modified cells (e.g., CAR-expressing cells). Such modified cells can be used, for example, in the field of cell therapy (e.g., treatment or prevention of diseases by administration of cells), and in particular, can be used in adoptive cell therapy. Cells administered in such a manner can be, for example, genetically modified adoptive cells. The genetic modification can be introduced into adoptive cells by the Cas12 chRDNA guide molecules and Cas12 chRDNA guide / nuclear protein complexes disclosed herein using one or more delivery techniques. The present disclosure encompasses, for example, the modification and administration of cells that are autologous or allogeneic with respect to the recipient to whom they are administered. As used herein, the term "allogeneic" refers to different individuals of the same species that are not genetically identical. For example, allogeneic cells refer to cells derived from different individuals that are of the same species but not genetically identical (with respect to the recipient to whom the cells are administered). In contrast, the term "autologous" refers to the same individual. For example, autologous cells administered to an individual refer to cells (modified or unmodified, or modified or unmodified progeny thereof) derived from that same individual.

[0359] "Adoptive cells" refer to cells that are genetically modified for use in cell therapy treatments. Examples of adoptive cells include, but are not limited to, stem cells, induced pluripotent stem cells, embryonic stem cells, umbilical cord blood stem cells, lymphocytes, natural killer cells, fibroblasts, endothelial cells, epithelial cells, pancreatic progenitor cells, and the like.

[0360] "Stem cells" refer to cells that have the ability of self-renewal (i.e., the ability to repeat the cell division cycle while maintaining an undifferentiated state). Stem cells can be totipotent, pluripotent, multipotent, oligopotent, or unipotent. Stem cells are embryonic stem cells, fetal stem cells, amniotic stem cells, adult stem cells, or induced pluripotent stem cells.

[0361] "Induced pluripotent stem cells" (iPSCs) refer to a type of pluripotent stem cells artificially induced from non-pluripotent cells (typically somatic cells). In some embodiments, the somatic cells are human somatic cells. Examples of somatic cells include, but are not limited to, dermal fibroblasts, bone marrow-derived mesenchymal cells, cardiomyocytes, keratinocytes, hepatocytes, gastric cells, neural stem cells, lung cells, kidney cells, spleen cells, and pancreatic cells. Further examples of somatic cells include cells of the immune system, and examples of such cells of the immune system include B cells, dendritic cells, granulocytes, innate lymphoid cells, megakaryocytes, monocytes / macrophages, bone marrow-derived suppressor cells, NK cells, T cells, thymocytes, and hematopoietic stem cells, but are not limited to these. Pluripotent stem cells can differentiate into multiple cell types, including somatic cells, NK cells, NK-like cells, T cells, T cell-like cells, NK-T cells, NK-T cell-like cells, dendritic cells, dendritic-like cells, macrophages, and macrophage-like cells. Pluripotent stem cells can be edited by a Cas12 chRDNA guide / nuclear protein complex before or after differentiation. iPSCs can be further modified before or after differentiation by introduction of exogenous genes or sequences such as sequences encoding CARs into the genome.

[0362] "Hematopoietic stem cells" refer to undifferentiated cells having the ability to differentiate into hematopoietic cells such as lymphocytes.

[0363] "Lymphocytes" refer to leukocytes (white blood cells) that are part of the vertebrate immune system. Similarly included in the term "lymphocytes" are hematopoietic stem cells that give rise to lymphocyte cells. Lymphocytes include, for example, T cells of cell-mediated cytotoxic adaptive immunity, such as CD4+ and / or CD8+ cytotoxic T cells; alpha / beta T cells and gamma / delta T cells; regulatory T cells, such as Treg cells; natural killer (NK) cells that function in cell-mediated cytotoxic innate immunity; and B cells for humoral antibody-driven adaptive immunity; NK / T cells; cytokine-induced killer cells (CIK cells); and antigen-presenting cells (APCs), such as dendritic cells. Lymphocytes can be mammalian cells such as human cells.

[0364] Similarly included within the term "lymphocyte", as used herein, are T cell receptor engineered T cells (TCRs) that are genetically engineered to express one or more specific naturally occurring or engineered T cell receptors capable of recognizing a protein or (glyco)lipid antigen of a target cell. Small fragments of these antigens (e.g., peptides or fatty acids) are transferred to the target cell surface and presented to the T cell receptor as part of the major histocompatibility complex (MHC). Binding of the T cell receptor to the antigen-loaded MHC activates the lymphocyte.

[0365] Tumor infiltrating lymphocytes (TILs) are also included within the term "lymphocyte" as used herein. TILs are immune cells that have infiltrated the environment both inside and outside of a tumor (the "tumor microenvironment"). TILs are typically isolated from tumor cells and the tumor microenvironment and selected in vitro for high reactivity against tumor antigens. TILs are grown in vitro under conditions that overcome the effects of tolerance present in vivo and then introduced into a subject for treatment.

[0366] The term "lymphocyte" also includes genetically modified T cells and NK cells (e.g., those modified to produce a chimeric antigen receptor (CAR) on the surface of the T cell or NK cell (CAR-T cells and CAR-NK cells)).

[0367] Lymphocytes can be isolated from a subject (e.g., a human subject), for example, from blood or a solid tumor, such as in the case of TILs, or from lymphoid organs (e.g., the thymus, bone marrow, lymph nodes, and mucosa-associated lymphoid tissue). Techniques for isolating lymphocytes are well known in the art. For example, lymphocytes can be isolated from peripheral blood mononuclear cells (PBMCs), which are separated from whole blood using, for example, Ficoll, a hydrophilic polysaccharide that separates blood layers, and density gradient centrifugation. Typically, an anticoagulant or defibrinated blood sample is layered on top of the Ficoll solution and centrifuged to form different layers of cells. The bottom layer contains red blood cells (erythrocytes), which are either recovered by the Ficoll medium or agglutinated and allowed to settle completely to the bottom. The next layer mainly contains granulocytes, which also move downward through the Ficoll-paque solution. The next layer contains lymphocytes, which are typically present at the interface between plasma and the Ficoll solution, along with monocytes and platelets. To isolate the lymphocytes, this layer is recovered, washed with a salt solution to remove platelets, Ficoll, and plasma, and then centrifuged again.

[0368] As another technique for isolating lymphocytes, biopanning can be mentioned, in which the cell population is isolated from a solution by binding the cells of interest to an antibody-coated plastic surface. The unwanted cells are then removed by treatment with specific antibodies and complement. In addition, fluorescence-activated cell sorter (FACS) analysis can be used to detect and count lymphocytes. FACS analysis uses a flow cytometer that separates labeled cells based on differences in light scattering and fluorescence.

[0369] Regarding TIL, lymphocytes are isolated from tumors and expanded, for example, in high-dose IL-2, and selected using a cytokine release co-culture assay against either autologous tumor or an HLA-matched tumor cell line. For rapid expansion, a medium can be selected that has evidence of increased specific reactivity compared to allogeneic non-MHC-matched controls, and then introduced into a subject to treat cancer. See, for example, Rosenberg et al. (Clin. Cancer Res., 2011, 17:4550-4557); Dudley et al. (Science, 2002, 298:850-854); Dudley et al. (J. Clin. Oncol., 2008, 26:5233-5239); and Dudley et al. (J. Immunother., 2003, 26:332-342).

[0370] Once isolated, lymphocytes can be characterized with respect to specificity, frequency, and function. As an assay that is frequently used, the ELISPOT assay that measures the frequency of T cell responses can be mentioned.

[0371] After isolation, lymphocytes can be activated using techniques well known in the art to promote proliferation and differentiation into specialized effector lymphocytes. As surface markers of activated T cells, for example, CD3, CD4, CD8, PD1, IL2R, and the like can be mentioned. Activated cytotoxic lymphocytes can kill target cells after binding to cognate receptors on the surface of the target cells. As surface markers of NK cells, for example, CD16, CD56, and the like can be mentioned.

[0372] After isolation and optionally activation, lymphocytes can be modified using the Cas12 chRDNA guide / nuclear protein complex of the present disclosure for use in adoptive T cell immunotherapy. Adoptive immunotherapy typically uses a patient's immune cells (autologous cells) to treat cancer. However, the method that gives rise to adoptive immunotherapy can also use third-party donor cells (allogeneic cells), resulting in an "off-the-shelf" therapy.

[0373] Thus, in some embodiments, the lymphocytes used in adoptive immunotherapy are isolated from a subject, modified ex vivo, and then reintroduced into the same subject. This technique is known as "autologous lymphocyte therapy."

[0374] Alternatively, lymphocytes can be isolated, modified ex vivo, and introduced into another subject. This technique is known as "allogeneic lymphocyte therapy."

[0375] In certain embodiments, the Cas12 chRDNA guide / nuclear protein complex is used in the manufacture of a therapeutic composition comprising allogeneic cells. In preferred embodiments, the allogeneic cells are T cells. In more preferred embodiments, the T cells express a CAR. In even more preferred embodiments, the CAR targets an antigen associated with cancer.

[0376] In some embodiments, T cells can be modified to enable a safer and more efficient allogeneic therapy. For example, the T cell receptor alpha constant (TRAC) is a protein-coding gene that forms part of the alpha-beta TCR. Thus, selected mutations in TRAC, and knockout of TRAC expression, can help to eliminate GvHD during allogeneic cell therapy. See, for example, Poirot et al. (Cancer Res., 2015, 75:3853-3864). It has been found that tumor rejection can occur by introducing a CD19-specific CAR into the TRAC locus using the CRISPR-Cas9 system. See, for example, Eyquem et al. (Nature, 2017, 543:113). Similarly, the T cell receptor beta constant (TRBC) is also targeted to prevent the expression of the alpha-beta TCR. See, for example, Ren et al. (Clin. Cancer Res., 2017, 23:2255-2266).

[0377] Programmed cell death protein 1 (PD1, also known as PDCD1 and CD279) is a cell surface receptor that plays an important role in promoting self-tolerance by downregulating the immune system and suppressing T cell inflammatory activity. PDCD1 binds to its cognate ligand, "programmed death ligand 1" (PD-L1, also known as CD274 and B7 homolog 1 (B7-H1)). PD1 prevents autoimmunity through a dual mechanism that promotes programmed cell death (apoptosis) of antigen-specific T cells in lymph nodes while simultaneously reducing apoptosis of anti-inflammatory suppressive T cells (regulatory T cells). Through these mechanisms, binding of PD-1 to PD1 inhibits the immune system, thus preventing autoimmune disorders but also preventing the immune system from killing cancer cells. Therefore, mutating or knocking out the production of PD1 may be beneficial for T cell therapy.

[0378] PD1 is an example of an "immune checkpoint" molecule. Immune checkpoint molecules serve to downregulate or inhibit the immune response. Immune checkpoint molecules include, but are not limited to, PD1, cytotoxic T lymphocyte antigen 4 (also known as CTLA-4, CD152), LAG3 (also known as CD223), Tim3 (also known as HAVCR2), BTLA (also known as CD272), BY55 (also known as CD160), TIGIT (also known as IVSTM3), LAIR1 (also known as CD305), SIGLEC10, 2B4 (also known as CD244), PPP2CA, PPP2CB, PTPN6, PTPN22, CD96, CRTAM, SIGLEC7, SIGLEC9, TNFRSF10B, TNFRSF10A, CASP8, CASP10, CASP3, CASP6, CASP7, FADD, FAS, TGFBRII, TGFRBRI, SMAD2, SMAD3, SMAD4, SMAD10, SKI, SKIL, TGIF1, IL10RA, IL10RB, HMOX2, IL6R, IL6ST, EIF2AK4, CSK, PAG1, SIT1, FOXP3, PRDM1, BATF, GUCY1A2, GUCY1A3, GUCY1B2, and GUCY1B3. In some embodiments, the Cas12 chRDNA guide / nuclear protein complex of the present disclosure is used to inactivate one or more immune checkpoint molecules. In some embodiments, the inactivation of one or more immune checkpoint molecules is combined with the inactivation of one or more TCR components as described above.

[0379] Beta-2 microglobulin (B2M) is a component of MHC class I molecules present on nucleated cells. Beta-2 microglobulin is released from cells such as tumor cells into the blood and is essential for the construction and expression of the HLA I complex. However, the expression of HLA on the surface of allogeneic T cells causes rapid rejection by the T cells of the host immune system. Therefore, disrupting the expression of beta-2 microglobulin is also desirable for improving the efficiency of allogeneic T cell therapy. In addition, the lack of expression of MHC class I molecules on allogeneic T cells causes clearance by the host immune system. Therefore, it is desirable to present only a subset of HLA molecules (preferably HLA-E) on the surface of the cells.

[0380] Additional genes can be targeted to the same targets as the Cas12 chRDNA guides disclosed herein to enhance the effectiveness of adoptive immunotherapy. Non-limiting examples of preferred genes and chromosomal locations (hg38 genome assembly) are shown in Table 4.

[0381]

Table 4-1

Table 4-2

[0382] In some embodiments, the Cas12 chRDNA guides disclosed herein are used to target the gene encoding TRAC intracellularly. In some embodiments, the Cas12 chRDNA guides disclosed herein are used to target the gene encoding PD1 intracellularly. In some embodiments, the Cas12 chRDNA guides disclosed herein are used to target the gene encoding B2M intracellularly. In some embodiments, the Cas12 chRDNA guides disclosed herein are used to target the gene encoding TRAC and the gene encoding B2M intracellularly.

[0383] Cells modified using the Cas12 chRDNA / nuclear protein complex of the present disclosure can be used, for example, in adoptive cell therapy for the treatment of cancer. In some embodiments, the modified cells are genetically modified lymphocytes. Such genetically modified lymphocytes (e.g., CAR-T cells) can be used to treat various types of cancer in a subject, including prostate cancer; ovarian cancer; cervical cancer; colorectal cancer; intestinal cancer; testicular cancer; skin cancer; lung cancer; thyroid cancer; bone cancer; breast cancer; bladder cancer; uterine cancer; vaginal cancer; pancreatic cancer; liver cancer; kidney cancer; brain cancer; spinal cord cancer; oral cancer, parotid gland tumor; blood cancer; lymphoma, e.g., B-cell lymphoma; and leukemia, etc., but are not limited thereto. Preferably, an effective amount of the modified cells is used for such treatment.

[0384] Table 5 lists representative B-cell leukemias and lymphomas treatable using adoptive cells (e.g., CAR-T cells) produced using the Cas12 chRDNA guide / nuclear protein complex of the present disclosure. It should be understood that lymphocytes modified by the Cas12 chRDNA guide / nuclear protein complex disclosed herein are not limited to the treatment of the diseases listed in Table 5.

[0385]

Table 5

[0386] In other embodiments, other cell proliferative disorders can be treated using adoptive cells (e.g., CAR-T cells) produced using the Cas12 chRDNA guide / nuclear protein complex of the present disclosure, including pre-cancerous conditions; blood disorders; and immune disorders, e.g., autoimmune diseases, including, but not limited to, Addison's disease, celiac disease, type 1 diabetes, Graves' disease, Hashimoto's disease, inflammatory bowel disease, multiple sclerosis, psoriasis, rheumatoid arthritis, scleroderma, and systemic lupus erythematosus.

[0387] The adoptive cell therapy treatment described herein can be combined with one or more additional treatments selected from the group consisting of antibody therapy, chemotherapy, cytokine therapy, dendritic cell therapy, gene therapy, hormone therapy, laser phototherapy, and radiation therapy, either simultaneously or at different times.

[0388] Administration of the modified cells of the present disclosure to a subject can be carried out in any convenient manner (e.g., by aerosol inhalation, injection, oral ingestion, transfusion, implantation, or transplantation). The compositions described herein can be administered to a patient subcutaneously, intradermally, intratumorally, intra-articularly, intramedullary, intramuscularly, by intravenous or intralymphatic injection, or intraperitoneally.

[0389] In one embodiment, the modified cell composition of the present disclosure is preferably administered by intravenous injection. This administration can include administration of 10 4 ~10 9 cells per kg body weight (preferably 10 5 ~10 6 cells / kg body weight). The cells can be administered in one or more doses. In some embodiments, an effective amount of the modified cells is administered as a single dose. In other embodiments, an effective amount of the cells is administered as multiple doses over a period of time. Determination of the optimal range of the effective amount of a given cell type for a particular disease or condition is within the skill of the art.

[0390] Chimeric antigen receptor (CAR) cells In some embodiments, the adoptive cells are CAR-expressing cells. A CAR is a receptor engineered to recognize and bind a specific antigen or epitope. This receptor is chimeric because it combines both an antigen-binding function and a T cell activation function into a single receptor. A CAR is typically a fusion protein comprising an extracellular ligand-binding domain capable of binding to an antigen, a transmembrane domain, and at least one intracellular signaling domain. The extracellular ligand-binding domain may comprise a single-chain variable fragment (scFv) comprising the fusion of two or more variable regions connected by one or more linkers. A CAR may further comprise a hinge region. A CAR may also be referred to as a "chimeric receptor," "T body," or "chimeric immunoreceptor (CIR).

[0391] In some embodiments, the CAR can be a TRUCK, universal CAR, self-driving CAR, Armored CAR, self-destructing CAR, conditional CAR, marked CAR, TenCAR, dual CAR, or sCAR.

[0392] TRUCK (T cells redirected for universal cytokine killing) co-expresses a chimeric antigen receptor (CAR) and an anti-tumor cytokine. Cytokine expression is either constitutive or induced by T cell activation. When targeted by CAR specificity, local production of pro-inflammatory cytokines mobilizes endogenous immune cells to the tumor site and enhances the anti-tumor response.

[0393] Universal allogeneic CAR-T cells are engineered to no longer express the endogenous T cell receptor (TCR) and / or major histocompatibility complex (MHC) molecules, thereby preventing graft-versus-host disease (GVHD) or rejection, respectively.

[0394] Self-driving CAR co-expresses a CAR that binds to a tumor ligand and a chemokine receptor, thereby enhancing tumor homing.

[0395] CAR-T cells engineered to be resistant to immunosuppression (armed CARs) are genetically modified by immune checkpoint switch receptors to no longer express various immune checkpoint molecules (e.g., cytotoxic T lymphocyte-associated antigen 4 (CTLA4), or programmed cell death protein 1 (PD1)), or are administered with monoclonal antibodies that block immune checkpoint signaling.

[0396] Self-destructing CARs are designed using RNA delivered by electroporation to encode the CAR. Alternatively, inducible apoptosis of T cells is achieved based on ganciclovir binding to thymidine kinase in genetically modified lymphocytes, or on a more recently described system of activation of human caspase 9 by a small molecule dimerizer.

[0397] Conditional CAR-T cells, by default, do not respond until the addition of a small molecule to complete the circuit or are switched "off", allowing for complete transduction of both signal 1 and signal 2, thereby activating the CAR-T cells. Alternatively, T cells are engineered to express an adapter-specific receptor that has affinity for a secondary antibody administered later that is directed against the target antigen.

[0398] Marked CAR-T cells express the CAR and a tumor epitope to which an existing monoclonal antibody agent binds. In settings of unacceptable adverse effects, administration of the monoclonal antibody removes the CAR-T cells, alleviating symptoms without further off-tumor effects.

[0399] Tandem CAR (TanCAR) T cells express a single CAR that has different affinities and contains two linked scFvs fused to one or more intracellular co-stimulatory domains and a CD3ζ signaling domain. Activation of TanCAR-T cells requires the presence of only one type of antigen on the target cell, but the presence of both antigens promotes synergistic activation. In certain embodiments, the scFvs of TanCAR comprise a heavy chain variable region (VH) and a light chain variable region (VL), a pair of two heavy chain variable regions (VH), or a pair of two light chain variable regions (VL). In another embodiment, the two scFvs of TanCAR can occur in a stacked configuration. In yet another embodiment, the two scFvs of TanCAR can occur consecutively or in a loop configuration. In certain embodiments, at least one of the scFvs of the tandem CAR is an anti-CD20 scFv, and another scFv is selected to target a specific antigen of cancer cells such as an anti-BCMA scFv, an anti-CD19 scFv, an anti-CD30 scFv, an anti-CD22 scFv, an anti-CD70 scFv, an anti-ROR1 scFv, or an anti-kappa light chain scFv.

[0400] Dual CAR-T cells express the following two separate CARs with different ligand-binding targets; one CAR contains only the CD3ζ domain and the other CAR contains only the co-stimulatory domain. Co-expression of both targets on the tumor is required for activation of dual CAR-T cells.

[0401] Safety CAR (sCAR) consists of an extracellular scFv fused to a cell inhibitory domain, and sCAR-T cells co-expressing a standard CAR are activated only when they encounter target cells that have the standard CAR target but lack the sCAR target.

[0402] The extracellular (antigen recognition) domain of the CAR is preferably a single-chain antibody, more preferably a scFv. In one embodiment, the antigen-binding domain comprises a scFv. However, any suitable moiety that binds to a given target with high affinity can be used as the antigen recognition region. The extracellular domain of the CAR capable of binding to an antigen can be, for example, any oligopeptide or polypeptide capable of binding to a specific antigen.

[0403] Depending on the desired antigen to be targeted, the CARs of the present disclosure can be engineered to include an appropriate antigen-binding moiety that is specific for this desired antigen target. For example, when BCMA is the desired antigen to be targeted, an antibody or antibody fragment (e.g., scFv) targeting BCMA can be used as the antigen-binding moiety incorporated into the CARs of the present disclosure.

[0404] Preferred cell targets and the CAR scFv / binding proteins targeting them are listed in Table 6.

[0405]

Table 6-1

Table 6-2

[0406] In certain embodiments, the cell target to which the CAR binds is more preferably selected from BCMA, CD19, CD20, CD22, CD47, CD79b, CD371, ROR-1, EphA2, MUC16, glypican 3, PSCA, and claudin 18.2.

[0407] In an even more preferred embodiment, the cell target to which the CAR binds is BCMA.

[0408] In an even more preferred embodiment, the cell target to which the CAR binds is CD371.

[0409] The intracellular domain of the CAR can be an oligopeptide or polypeptide known to function as a domain that transmits signals to cause activation or inhibition of biological processes in cells. This intracellular domain can include an activation domain that includes all or part of the intracellular signaling domain of the T cell receptor (TCR) and / or co-receptor, as long as it transmits an effector function signal. The cytoplasmic signaling sequence that regulates the primary activation of the stimulatory TCR complex can include a signaling motif known as an immunoreceptor tyrosine-based activation motif (ITAM). Examples of ITAMs that include cytoplasmic signaling sequences include those derived from CD8, CD3ζ, CD3δ, CD3γ, CD3ε, CD32 (FcγRIIa), DAP10, DAP12, CD79a, CD79b, FcγRIγ, FcγRIIIγ, FcεRIβ (FCERIB), and FcεRIγ (FCERIG).

[0410] In a preferred embodiment, the activation domain of the intracellular signaling domain is derived from CD3ζ.

[0411] The intracellular signaling domain of the CAR of the present disclosure can be designed to include an activation domain, such as the CD3ζ signaling domain, by itself or in combination with any other desired cytoplasmic domain useful in the context of the CAR of the present disclosure. For example, the intracellular signaling domain of the CAR can include an activation domain, such as a CD3ζ chain moiety, in addition to a co-stimulatory domain. This co-stimulatory domain refers to the portion of the CAR that includes the intracellular domain of a co-stimulatory molecule.

[0412] Co-stimulatory molecules are molecules other than antigen receptors or their ligands that are required for an efficient response of lymphocytes to antigens. Examples of such co-stimulatory molecules, all or part of which are used in the co-stimulatory domain of the CAR of the present disclosure, include CD27, CD28, 4-1BB (CD137), OX40, CD30, CD40, ICOS-1, GITR, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, and B7-H3.

[0413] In a preferred embodiment, the CAR comprises a co-stimulatory domain derived from at least 4-1BB.

[0414] The transmembrane domain can be derived from either a natural or synthetic source. When the source is natural, this domain can be derived from any membrane-bound or transmembrane protein. For example, the transmembrane region can be derived from the alpha, beta, or zeta chain of the T cell receptor, CD28, CD3ζ, CD3ε, CD45, CD4, CD5, CD8 (e.g., CD8α, CD8β), CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, or CD154, KIRDS2, OX40, CD2, CD27, LFA-1 (CD11a, CD18), ICOS (CD278), 4-1BB (CD137), GITR, CD40, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), CD160, CD19, IL2Rβ, IL2Rγ, IL7Rα, ITGA1, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, TNFR2, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, and the transmembrane regions of PAG / Cbp (i.e., can at least include a part thereof).

[0415] Alternatively, the transmembrane domain can be synthetic, in which case the transmembrane domain will mainly contain hydrophobic residues such as leucine and valine. In some cases, triplets of phenylalanine, tryptophan, and valine are found at each end of the synthetic transmembrane domain. Short oligopeptide linkers or polypeptide linkers, such as 2 to 10 amino acids in length, can form the linkage between the transmembrane domain and the endoplasmic domain of the CAR.

[0416] In a preferred embodiment, the transmembrane domain is derived from CD8.

[0417] In some embodiments, the CAR has multiple transmembrane domains, which can be repeats of the same transmembrane domain or different transmembrane domains.

[0418] The hinge region can include a variable-length polypeptide hinge such as one or more amino acids, a CD8 moiety, or an IGg4 region, and combinations thereof.

[0419] In a preferred embodiment, the hinge region is derived from CD8.

[0420] The CAR can also be incorporated into TIL, NK cells, macrophages, dendritic cells, induced pluripotent stem cells (iPSCs), or TCRs to obtain CAR-TIL, CAR-NK cells, CAR-M, CAR-DC, and TCR-engineered CAR-T cells, respectively. For descriptions of CAR-T cells, methods for manufacturing CAR-T cells, and their uses, see, for example, Brudno et al. (Nature Rev. Clin. Oncol., 2018, 15: 31-46); Maude et al. (N. Engl. J. Med., 2014, 371: 1507-1517); and Sadelain et al. (Cancer Disc., 2013, 3: 388-398).

[0421] In some embodiments, the CAR expression cassette has been transduced into the recipient cells, and this cassette is incorporated into the Cas12 protein-mediated cleavage site. Example 9 of this specification shows the transduction of primary cells with an adeno-associated virus (AAV) vector containing the CAR cassette.

[0422] In some embodiments, the CAR expression cassette includes a promoter for driving CAR expression. Commonly used promoters include the constitutive mammalian promoters CMV, MND, EF1a, SV40, PGK1 (mouse or human), Ubc, CAG, CaMKIIa, and beta-Act, and others known in the art. See, for example, Khan et al. (Advanced Pharmaceutical Bulletin, 2013, 3:257-263). Alternatively, the CAR expression cassette may include a ribosome skipping sequence (also referred to as a self-cleaving peptide) and is introduced in-frame into the endogenous expression gene. Commonly used ribosome skipping sequences include T2A, P2A, E2A, and F2A. For an explanation of ribosome skipping sequences and their use, see, for example, Chng et al. (MAbs, 2015, 7(2):403-412). Similarly, non-CAR expression cassettes may include similar promoters or ribosome skipping sequences.

[0423] In certain embodiments, a Cas12 chRDNA guide / nuclear protein complex is used to treat a genetic disorder caused by a pathogenic autosomal "dominant negative" mutation present on a patient's single allele. In some cases, the underlying genetic mutation can be a single nucleotide polymorphism (SNP) on one of the alleles. The chRDNA guide / nuclear protein complex can be engineered to target the SNP allele but not the wild-type allele, such that only the SNP allele is disrupted. See, for example, Example 7, which provides non-limiting examples of methods for designing a Cas12a chRDNA guide / nuclear protein complex to target a wild-type sequence that can reduce editing at off-target sequences containing the SNP.

[0424] In some embodiments, without modifying the wild-type allele, a Cas12 chRDNA guide / nuclear protein complex can be used to selectively edit (e.g., can knockout or can revert to wild-type by homology-directed repair) the SNP-containing allele. In some embodiments, such editing disrupts the gene. In other embodiments, such editing can revert the allele to the "wild-type" state, for example, by homology-directed repair. For example, several genetic diseases that result in progressive vision loss are caused by pathogenic autosomal "dominant negative" mutations. Examples of SNP correction strategies for dominant negative diseases include targeting SNP mutations in the rhodopsin gene that cause retinitis pigmentosa (see, e.g., Li et al. (CRISPR J., 2018, 1(1):55-64)); targeting SNP mutations in the transforming growth factor, beta-induced (TGFBI) gene that cause corneal dystrophy (see, e.g., Christie et al. (Scientific Reports, 2017, 7(1):16174)), but are not limited thereto.

[0425] The Cas12 chRDNA guide / nuclear protein complex of the present disclosure is delivered, for example, to ocular tissues affected by pathogenic "dominant negative" gene mutations on autosomes. In some embodiments, the chRDNA guide / nuclear protein complex is designed to selectively disrupt disease alleles without targeting wild-type alleles in order to treat underlying pathologies. Such diseases include, but are not limited to, macular dystrophy, rod-cone dystrophy, cone-rod dystrophy, or choroidoretinopathy. It is understood that the Cas12 chRDNA guide / nuclear protein complexes disclosed herein are not limited to the treatment of genetic diseases that cause progressive vision loss.

[0426] Experiment Non-limiting embodiments of the present disclosure are shown in the following examples. Efforts have been made to ensure accuracy regarding the numbers used (e.g., amounts, concentrations, rates of change, and the like), but some experimental errors and deviations should be taken into account. Unless otherwise indicated, temperatures are in degrees Celsius and pressures are at or near atmospheric pressure. These examples are presented for illustrative purposes only, and it should be understood that the inventors do not intend to limit the scope that they consider to be various embodiments of the present disclosure. Not all of the following steps described in each example are necessary, nor does the order of the steps in each example have to be as presented. As used herein, unless otherwise described, "r" preceding a nucleotide indicates RNA, and all other nucleotides are DNA (see, for example, Tables 15 and 17). Phosphorothioate linkages are represented between adjacent bases 「*」 as shown.

Example

[0427] Production of cytotoxic T cells (CD4+ and C8+) from PBMCs, and culturing of primary cells This example shows the production of CD4+ cells and CD8+ cells from donor peripheral blood mononuclear cells (PBMCs).

[0428] CD4+ and CD8+ T cells were essentially produced from donor PBMCs as follows. T cells were isolated from peripheral blood mononuclear cells (PBMCs) using RoboSep-S (STEMCELL Technologies Cambridge, MA) and EasySep™ Human T cell Isolation Kit (STEMCELL Technologies, Cambridge, MA), and activated in the presence of anti-CD3 / CD28 beads (Dynabeads™; Gibco 11132D) in ImmunoCult-XF Complete Medium (ImmunoCult-XF T Cell Expansion Medium (STEMCELL Technologies, Cambridge, MA), CTS Immune Cell SR (Gibco A2596102), antibiotic-antimycotic (100X, Corning 30-004-Cl)) supplemented with recombinant human (rh) IL-2 (100 units / mL) for 3 days. After 3 days, the beads were removed by magnetic separation, and the cells were grown for 1 day in ImmunoCult-XF Complete Medium supplemented with IL-2 (100 units / mL).

Example

[0429] Cloning, Expression, Production, and Construction of Cas12a Guide / Protein Complex This example describes a method for cloning, expressing, and purifying the Cas12a guide / protein complex, and a method for producing the Cas12a guide component.

[0430] A. Cloning of Cas12 Protein The catalytically active Cas12a protein sequence of Acidaminococcus sp. (strain BV3L6) (SEQ ID NO: 1) was codon-optimized for expression in E. coli cells. A glycine-serine linker and one nuclear localization sequence (NLS) (SEQ ID NO: 4) were added to the C-terminus. The oligonucleotide sequence encoding the Cas12a-NLS protein (referred to as AsCas12a and Cas12a protein in the following examples) was provided to a commercial manufacturer for synthesis. The DNA sequence was then cloned into an appropriate bacterial expression vector using standard cloning methods.

[0431] B. Expression and purification of Cas12a protein The AsCas12a protein was expressed in E. coli using an expression vector and purified essentially as described, for example, by Swarts et al. (Molecular Cell, 2017, 66:221-233) using affinity chromatography, ion exchange, and size exclusion chromatography.

[0432] C. Production of Cas12a guide component The Cas12a guide was produced by ligating a targeting region to a specific Cas12a guide activation region. The targeting region or spacer preferably contained a 20-nucleotide target binding sequence. The target binding sequence was complementary to the target sequence that occurred downstream (in the 3' direction) of 5'-TTTV or 5'-TTTN PAM. Exemplary Cas12a guide activation region sequences are SEQ ID NO: 6, SEQ ID NO: 8, and SEQ ID NO: 10 for Acidaminococcus sp., L. bacterium, and F. novicida Cas12a species, respectively.

[0433] The Cas12a guide sequences (e.g., crRNA and chRDNA) were provided to a commercial manufacturer for synthesis.

[0434] A guide RNA component (e.g., crRNA) can be produced by in vitro transcription from this dsDNA template by incorporating a T7 promoter at the 5' end of the double-stranded (ds) DNA template sequence (e.g., T7 Quick High Yield RNA Synthesis Kit; New England Biolabs, Ipswich, MA).

[0435] D. Construction of the Cas12a guide / nuclear protein complex Acidaminococcus species Cas12a (AsCas12a) tagged with a C-terminal nuclear localization sequence (NLS) was recombinantly expressed in E. coli and purified using chromatography methods. The nuclear protein complex was formed at a concentration of Cas12a protein 80 pmol: guide 240 pmol unless otherwise stated. Before construction with the Cas12a protein, each of the guide components (e.g., crRNA or chRDNA) was adjusted to the desired total concentration (240 pmol) in a final volume of 1 μl, incubated at 95°C for 2 minutes, removed from the thermocycler, and equilibrated to room temperature. The Cas12a protein was diluted to the appropriate concentration in a final volume of 1.5 μl with binding buffer (60 mM TRIS-acetate, 150 mM potassium acetate, 30 mM magnesium acetate, pH 7.9), mixed with 1 μl of the guide component, and subsequently incubated at 37°C for 10 minutes.

Example

[0436] Nucleofection of T cells (CD4+ and CD8+) from PBMCs by the Cas12a guide / nuclear protein complex This example describes the nucleofection of activated T cells by the Cas12a guide / nuclear protein complex.

[0437] The Cas12a guide / nuclear protein complex of Example 2 was transfected into primary activated T cells (CD4+ and CD8+) (produced as described in Example 1) using the Nucleofector™ 96 Well Shuttle System (Lonza, Allendale, NJ). The Cas12a guide / nuclear protein complex was dispensed into individual wells of a 96-well plate at a final volume of 2.5 μl. The suspended T cells were pelleted by centrifugation at 200 × g for 10 minutes, washed with calcium- and magnesium-free phosphate-buffered saline (PBS), and the cell pellet was resuspended in 10 ml of calcium- and magnesium-free PBS. The cells were counted using a Countess® II Automated Cell Counter (Life Technologies; Grand Island, NY).

[0438] 2.2×10 7 cells were transferred to a 15 ml conical tube and pelleted. The PBS was aspirated and the cells were resuspended at 2 × 10 5 ~1×10 6Cells were resuspended in Nucleofector™ P4 or P3 (Lonza, Allendale, NJ) solution to a density of cells / ml. Next, 20 μl of the cell suspension was added to each well containing 2.5 μl of the Cas12a guide / nuclear protein complex, and the total volume from each well was transferred to the wells of a 96-well Nucleocuvette™ Plate (Lonza, Allendale, NJ). The plate was placed on a Nucleofector™ 96-well Shuttle (Lonza, Allendale, NJ) and the cells were transfected using the CA137 Nucleofector™ program (Lonza, Allendale, NJ). After nucleofection, 77.5 μl of ImmunoCult-XF Complete Medium supplemented with IL-2 (100 units / mL) was added to each well, and the total volume of the transfected cell suspension was transferred to a 96-well cell culture plate containing 100 μl of pre-warmed ImmunoCult-XF Complete Medium supplemented with IL-2 (100 units / mL). This plate was transferred to a tissue culture incubator and maintained at 37 °C in 5% CO2 for 48 hours, after which downstream analysis was performed.

Example

[0439] Targeting of human genes with Cas12a guide / nuclear protein complexes This example describes the design and use of Cas12a guide / nuclear protein complexes for targeting genes encoding the human T cell alpha constant region (TRAC), beta-2-microglobulin (B2), programmed cell death 1 (PDCD1), cytokine-induced SH2-containing protein (CISH), and Cbl proto-oncogene B (CBL-B) in human T cells.

[0440] A. Design of AsCas12a crRNA guides All 20-nucleotide sequences downstream (in the 3' direction) of the 5'-TTTV PAM motif in the coding regions of the genes encoding human TRAC, B2M, PDCD1, CISH, and CBL-B were selected for targeting (SEQ ID NOs: 12 to 189). The target selection criteria included, but were not limited to, homology to other regions in the genome; G-C content; melting temperature; and the presence of homopolymers within the spacer.

[0441] The identified 20-nucleotide sequences were added downstream (in the 3' direction) of the AsCas12a activation region sequence (SEQ ID NO: 6).

[0442] The sequences were provided to a commercial manufacturer for synthesis. Subsequently, individual Cas12a guide / nuclear protein complexes were produced as described in Example 2 and transfected into primary T cells as described in Example 3.

[0443] B. Determination of Genome Editing Efficiency (1) Generation of Target dsDNA Sequences for Deep Sequencing gDNA was isolated from nucleofected primary T cells 48 hours after transfection using a Cas12a guide / nuclear protein complex and 50 μL of QuickExtract™ DNA Extraction Solution (Epicentre, Madison, WI) per well, followed by incubation at 37°C for 10 minutes, 65°C for 30 minutes, and 95°C for 3 minutes to stop the reaction. The isolated gDNA was diluted with 50 μL of sterile water and the samples were stored at -80°C.

[0444] The first PCR was performed using isolated gDNA at 1× concentration with Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs, Ipswich, MA), and primers designed to amplify the region around the Cas12a target were used at 0.5 μM each, with 3.75 μL of gDNA used in a final volume of 10 μL. Amplification was carried out with an initial cycle at 98 °C for 1 minute, 35 cycles of 10 seconds at 98 °C, 20 seconds at 60 °C, and 30 seconds at 72 °C; and a final extension at 72 °C for 2 minutes. The PCR reaction was diluted 1:100 with water.

[0445] A unique set of index primers for barcoding PCR was used to facilitate multiplex sequencing of each sample. Barcoding PCR was performed using a reaction mixture containing Q5 Hot Start High-Fidelity 2X Master Mix at 1× concentration (New England Biolabs, Ipswich, MA), primers at 0.5 μM each, and 1 μL of the first PCR diluted 1:100 in a final volume of 10 μL. This reaction mixture was amplified as follows: 98 °C for 1 minute; followed by 12 cycles of 10 seconds at 98 °C, 20 seconds at 60 °C, and 30 seconds at 72 °C; and a final extension reaction at 72 °C for 2 minutes.

[0446] (2) SPRIselect purification The PCR reactions were pooled and transferred to a single microcentrifuge tube for SPRIselect (Beckman Coulter, Pasadena, CA) bead-based purification of the amplification products for sequencing.

[0447] To the amplification product, 0.9 volumes of SPRIselect beads were added, mixed, and incubated at room temperature for 10 minutes. The microcentrifuge tube was placed on a magnetic tube stand until the solution cleared. The supernatant was removed and discarded, and the remaining beads were washed with 1 volume of 85% ethanol and incubated at room temperature for 30 seconds. After incubation, the ethanol was aspirated and the beads were air-dried at room temperature for 10 minutes. The microcentrifuge tube was removed from the magnetic stand, 0.25 volumes of Qiagen EB buffer (Qiagen, Venlo, Netherlands) were added to the beads, mixed vigorously, and incubated at room temperature for 2 minutes. The microcentrifuge tube was returned to the magnet and incubated until the solution cleared, and the supernatant containing the purified amplification product was dispensed into a clean microcentrifuge tube. The purified amplification product was quantified using a Nanodrop™ 2000 System (Thermo Scientific, Wilmington, DE), and the library quality was analyzed using a Fragment Analyzer™ System (Advanced Analytical Technologies, Ames, IA) and a DNF-910 dsDNA Reagent Kit (Advanced Analytical Technologies, Ames, IA).

[0448] (3) Deep sequencing settings The pooled amplification products were normalized to a concentration of 4 nM calculated from the Nanodrop™ 2000 System value and the average size of the amplification products. The library was analyzed on a MiSeq Sequencer (Illumina, San Diego, CA) and a MiSeq Reagent Kit v2 (Illumina, San Diego, CA) over 300 cycles with two 151-cycle paired-end runs and two 8-cycle index reads.

[0449] (4) Deep sequencing data analysis The identity of the results in the array determination data was determined based on the index barcode sequences adapted to the amplification products in barcode PCR. To process the MiSeq data, for example, a computer script that executes the following tasks was used: a. Aligned the reads to the human genome (build GRCh38 / 38) using Bowtie (bowtie-bio.sourceforge.net / index.shtml) software; b. Compared the aligned reads with the predicted wild-type genomic locus sequences and discarded the reads that did not align to any part of the wild-type locus; c. Aggregated the reads that matched the wild-type sequence; d. Classified and aggregated the reads with indels (base insertions or deletions) by indel type; and e. Divided the total indel reads by the sum of the wild-type reads and indel reads to obtain the ratio of mutant reads.

[0450] The genomic editing efficiency of the obtained Cas12a guide / nuclear protein complex was determined by identifying the indel sequences in the region targeted by the Cas12a guide / nuclear protein complex. The results of this intracellular editing experiment are shown in Table 7.

[0451]

Table 7-1

Table 7-2

Table 7-3

Table 7-4

[0452] From the data shown in Table 7, it is demonstrated that the Cas12a crRNA / nuclear protein complex enables on-editing of multiple genes in human primary T cells. Other genes such as those described elsewhere in this specification can be similarly targeted using the AsCas12a protein or other Cas12a proteins (e.g., L. bacterium or F. novicida).

Example

[0453] Engineering of Cas12a chRDNA molecules having DNA in the target binding sequence The following examples illustrate the engineering of AsCas12a chRDNA guide molecules for containing DNA bases in the target binding sequence.

[0454] A. In silico Cas12a chRDNA guide design A 20-nucleotide target binding sequence of the AsCas12a guide was selected for engineering, and individual DNA bases were utilized at each position in the target binding sequence. The positions of the DNA bases in the target binding sequence of the AsCas12a chRDNA guide molecule are shown in Table 8 (DNA bases are indicated by "d", RNA bases are indicated by "R", and the control crRNA is also shown).

[0455]

Table 8

[0456] Three target sequences (B2M-tgt12, B2M-tgt1, B2M-intron-tgt12) in the gene encoding human B2M, a target sequence (TRAC-tgt12) in the gene encoding human TRAC, and a target sequence (DNMT1-tgt1) in the gene encoding human DNA methyltransferase 1 (DNMT1) were selected for editing. Each target's Cas12a chRDNA guide containing a target binding sequence with a single DNA base at each position (see Table 8), and the Cas12a chRNA control sequence, were provided to a commercial manufacturer for synthesis.

[0457] B. Cell Transfection and Analysis Individual Cas12a guide / nuclear protein complexes for screening were produced essentially as described in Example 2. The nuclear protein complexes were transfected into primary T cells as described in Example 3, and the resulting genomic editing efficiency of the Cas12a guide / nuclear protein complexes was determined as described in Example 4. The results of this intracellular editing experiment are shown in Table 9.

[0458]

Table 9-1

Table 9-2

Table 9-3

[0459] From the editing results in Table 9, it is demonstrated that Cas12a chRDNA guide molecules containing DNA in the spacer can edit at a rate equivalent to that of crRNA across multiple targets (comparison of SEQ ID NO: 21 and SEQ ID NO: 224; SEQ ID NO: 232 and SEQ ID NO: 234, or SEQ ID NO: 274 and SEQ ID NO: 293). For each target, the editing rate of the chRDNA guide design in Table 9 was normalized to the editing rate of the crRNA. The average normalized editing rate is shown in Figure 13, where the position within the target binding sequence is plotted as a function of the average normalized editing. Preferred positions of DNA base utilization (i.e., average normalized editing greater than 70%) are indicated by gray shading and include positions 1, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, and 20. Using the data presented in this example, as well as the data in Table 9 and Figure 13, it is possible to determine which positions within the target binding sequence of the Cas12a guide can be edited as DNA.

Example

[0460] Cas12a chRDNA Guide Molecules Having Multiple DNA Bases in the Target Binding Sequence This example describes the design and testing of Cas12a chRDNA guide molecules having multiple DNA bases in the target binding sequence.

[0461] A. In silico design of Cas12a chRDNA guides The sequences of 20 nucleotides of three targets (B2M-tgt12, B2M-tgt1, B2M-intron-tgt12) in the gene encoding human B2M, the target (TRAC-tgt12) in the gene encoding human TRAC, and the target (DNMT1-tgt1) in the gene encoding human DNA methyltransferase 1 were selected for editing. For each target, 1 to 7 nucleotides of DNA were designed into the target binding sequence of each AsCas12a guide. The design criteria for the positions of the DNA bases included, but were not limited to, past single-position screening data (see Table 5), prior consensus of positions tolerant to DNA (see Table 13), the distance between individual DNA bases in the target binding sequence, and the known positions of mismatches in the off-target sequences. The Cas12a chRDNA guide design and the crRNA control sequence were provided to a commercial manufacturer for synthesis.

[0462] B. Cell transfection and analysis Individual Cas12a guide / nuclear protein complexes for screening were produced essentially as described in Example 2. The Cas12a guide / nuclear protein complexes were transfected into primary T cells as described in Example 3, and the resulting genomic editing efficiency of the Cas12a guide / nuclear protein complexes was determined as described in Example 4. The results of this intracellular editing experiment and the positions of the DNA bases in the target binding sequence of each Cas12a chRDNA guide are shown in Table 10.

[0463]

Table 10-1

Table 10-2

[0464] From the editing results in Table 10, it is demonstrated that Cas12a chRDNA guide molecules containing multiple DNA bases in the target binding array can edit across multiple targets at a ratio equivalent to that of crRNA (comparison of SEQ ID NO: 316 and SEQ ID NO: 321; SEQ ID NO: 330 and SEQ ID NO: 335, or SEQ ID NO: 345 and SEQ ID NO: 347).

Example

[0465] Reduction of off-target editing by Cas12a chRDNA guide This example describes the identification of Cas12a off-targets using the SITE-Seq® assay (Cameron, P. et al. (2017). Mapping the genomic landscape of CRISPR-Cas9 cleavage. Nature Methods, 14(6), 600-606. https: / / doi.org / 10.1038 / nmeth.4284) and the reduction of the off-target editing rate of Cas12a chRDNA guides compared to Cas12a crRNA guides.

[0466] A. SITE-Seq® assay Human primary T cells were grown as described in Example 1. After cell growth in 50 ml conical tubes, high molecular weight genomic DNA (gDNA) was extracted from human primary T cells using the Blood and Cell Culture DNA Maxi Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol.

[0467] Twenty nucleotide targets in the genes encoding human Ribosomal Protein L32 (RPL32) (RPL32-tgt1) and the gene encoding DNMT1 (DNMT1-tgt1) were selected for evaluation using the SITE-Seq® assay (Cameron, P. et al. (2017). Nature Methods, 14(6), 600-606). Each Cas12a guide component was serially diluted to the corresponding nuclear protein concentration, incubated at 95°C for 2 minutes, and then slowly returned to room temperature over 5 minutes. Cas12a nuclear protein complexes against the RPL32 target (SEQ ID NO: 375) and the DNMT1 target (SEQ ID NO: 404) were formed by combining the incubated Cas12a guide and Cas12a protein in a 3:1 ratio in cleavage reaction buffer (60 mM TRIS-acetate, 150 mM potassium acetate, 30 mM magnesium acetate, pH 7.9) and incubated at 37°C for 10 minutes. Individual cleavages of 10 μg of genomic DNA (gDNA) occurred at six Cas12a guide / nuclear protein complex concentrations (8 nM, 16 nM, 32 nM, 48 nM, 64 nM, 96 nM, and 128 nM) in a total volume of 50 μL. Negative control reactions (0 nM) were assembled in parallel, which contained no nuclear protein complex. All cleavage reactions, including the negative control, were assembled in triplicate in a 96-well format plate. The cleavage reactions were incubated at 37°C for 4 hours.

[0468] Library production and sequencing were performed essentially as described by Cameron et al. (Nature Meth., 2017, 14:600 - 606) except for the dA-tailing step after nuclear protein complex cleavage. Due to Cas12a nuclear protein complex cleavage resulting in staggered (5’ overhang) ends, an additional enzymatic end repair step was required. The added volumes remained the same, but the original dA-tailing kit components were replaced with the End Prep Enzyme Mix (3 μL) and 10x End Repair Reaction Buffer (5 μL) components of the NEBNext® Ultra™ End Repair / dA-Tailing Modul from New England BioLabs (NEB #E7442L). The samples were incubated at 20 °C for 30 minutes and then at 65 °C for 30 minutes, and the standard procedure was resumed. NGS sequencing was performed using the Illumina NextSeq platform (Illumina, San Diego, CA), and approximately 3 million reads were obtained for each sample. Any site recovered by the SITE-Seq® assay (Cameron, P. et al. (2017). Nature Methods, 14(6), 600 - 606) where the off-target motif was not located within 1 nucleotide of the cleavage site was discarded as a false positive. The number of target sites recovered from the SITE-Seq® off-target assay experiments is shown in Table 11.

[0469]

Table 11

[0470] From the data shown in Table 11, the SITE-Seq® assay (Cameron, P. et al. (2017). Mapping the genomic landscape of CRISPR-Cas9 cleavage. Nature Methods, 14(6), 600 - 606) is demonstrated to recover the biological off-targets of Cas12 guides for further intracellular evaluation.

[0471] Intracellular verification of sites recovered by the B.SITE-Seq (registered trademark) off-target assay To measure the frequency of indels at the SITE-Seq (registered trademark) off-target sites shown in Table 11, targeted deep sequencing analysis was performed on a subset of sites recovered in the RPL32 sample and the DNMT1 sample for the lowest (e.g., 8 nM and 16 nM) Cas12a nuclear protein complex concentrations. Two off-target sites (SEQ ID NO: 371 and SEQ ID NO: 372) from the RPL32 sample, and a single off-target in DNMT1 (SEQ ID NO: 374) were selected for assessment of the intracellular off-target editing rate by crRNA. Forward amplification product primers and reverse amplification product primers were designed for each off-target site and obtained from a commercial manufacturer.

[0472] Human primary T cells were cultured as described in Example 1. The RPL32 (SEQ ID NO: 375) and DNMT1 (SEQ ID NO: 404) Cas12a nuclear protein complexes were produced essentially as described in Example 2. The nuclear protein complexes were transfected into primary T cells as described in Example 3, and the genomic editing efficiency of the resulting Cas12a guide / nuclear protein complexes was determined as described in Example 4. The untransfected input pool of cells was used as the wild-type reference. Variant reads (indel%) were defined as any non-reference variant call within 20 base pairs (bp) of the cleavage site. Sites with low sequencing coverage (less than 1,000 reads in total for samples treated with the Cas12a nuclear protein complex, or less than 200 reads in the reference sample), or with variant calls greater than 2% in the reference sample were discarded. Sites were aggregated as cellular off-targets if more than 0.1% variant reads had accumulated in total for samples treated with the Cas12a nuclear protein complex. The results of targeted deep sequencing of the recovered SITE-Seq® (Cameron, P. et al. (2017). Nature Methods, 14(6), 600 - 606) off-target sites are shown in Table 12, with mismatched nucleotides underlined.

[0473]

Table 12

[0474] From the data shown in Table 12, it is demonstrated by the SITE-Seq® assay that off-targets edited in T cells by the Cas12a crRNA guide are recovered.

[0475] In silico design of C.chRDNA guides Twenty nucleotide targets in the genes encoding human RPL32 (RPL32-tgt1) and DNMT1 (DNMT1-tgt1) were selected for editing. For each target, 1 to 4 nucleotides of DNA were designed into the target binding sequences of each AsCas12a chRDNA guide. The design criteria for the positions of DNA bases included, but were not limited to, past single-position screening data (see Table 5), prior consensus of positions tolerant to DNA (see Table 13), the distance between individual DNA bases in the target binding sequence, and the known positions of mismatches in the off-target sequences. The Cas12a chRDNA guides and the Cas12a crRNA control sequences were provided to a commercial manufacturer for synthesis.

[0476] D. Cell Transfection and Analysis Individual Cas12a guide / nuclear protein complexes were produced essentially as described in Example 2. This nuclear protein complex was transfected into primary T cells as described in Example 3, and the resulting genomic editing efficiency of the Cas12a guide / nuclear protein complex was determined as described in Example 4. Results of this on-target and off-target (see Table 12) cell editing experiment for the RPL32 target (Table 13) and the DNMT1 target (Table 14), as well as the positions of DNA bases in the target binding sequences of each Cas12a chRDNA guide, are shown. In addition, Cas12a chRDNA guide molecules having abasic deoxyribose sites were also tested, and the positions of the abasic sites are indicated by dN.

[0477]

Table 13-1

Table 13-2

[0478]

Table 14

[0479] From the editing results of Tables 13 and 14, it is demonstrated that even at sites with a single nucleotide mismatch (see, for example, Table 12, SEQ ID NO: 371 and SEQ ID NO: 372), the Cas12a chRDNA guide molecule can reduce editing at off-target sites. (Comparison of the results in Table 13 of off-target editing between SEQ ID NO: 375 and SEQ ID NO: 391; SEQ ID NO: 375 and SEQ ID NO: 394; comparison of the results in Table 14 of off-target editing between SEQ ID NO: 404 and SEQ ID NO: 408; or SEQ ID NO: 404 and SEQ ID NO: 412).

Example

[0480] Cas12a chRDNA guide molecule having DNA bases in the activation region This example describes the design and testing of an AsCas12a chRDNA guide molecule having DNA bases in the activation region.

[0481] In-silico design of A.chRDNA guide The 20-nucleotide activation region of the AsCas12a guide was selected for manipulation, and at each position in this activation region, individual DNA bases were utilized. The positions of the DAN bases in the activation region of the AsCas12a guide are shown in Table 15.

[0482]

Table 15

[0483] The target (SEQ ID NO: 361) in the gene encoding human DNMT1 was selected for editing. The DNMT target binding sequence was added downstream (i.e., in the 3' direction) of the activation region sequence containing a single DNA base at each position (see Table 15). The sequence was provided to a commercial manufacturer for synthesis.

[0484] B. Cell transfection and analysis Individual Cas12a guide / nuclear protein complexes for screening were produced essentially as described in Example 2. The nuclear protein complexes were transfected into primary T cells as described in Example 3, and the resulting genomic editing efficiency of the Cas12a guide / nuclear protein complexes was determined as described in Example 4. The results of this intracellular editing experiment are shown in Table 16.

[0485] [Table 16]

[0486] From the editing results in Table 16, it is demonstrated that Cas12a chRDNA having DNA in the activation region can edit at a rate equivalent to that of crRNA across multiple targets (comparison of SEQ ID NO: 438 and SEQ ID NO: 445; SEQ ID NO: 438 and SEQ ID NO: 450, or SEQ ID NO: 438 and SEQ ID NO: 457). The editing rates of the chRDNA designs in Table 16 were normalized to the editing rates of the crRNA. The average normalized editing rates are shown in Figure 14, with the positions within the activation region plotted as a function of the average normalized editing. Preferred positions of DNA base utilization (i.e., average normalized editing greater than 70%) are indicated by gray shading and include positions 1, 3, 5, 7, 9, 10, 12, 13, 14, 15, 16, 17, 18, and 19.

[0487] D. chRDNA having multiple DNA bases in the activation region Based on the results shown in Table 10, individual DNA positions were combined into the design of an activation region containing multiple DNA bases. The design of the activation region of the AsCas12a guide and the positions of the DNA bases are shown in Table 17.

[0488] [Table 17]

[0489] The design of the activation regions shown in Table 17 was combined with a target sequence of 20 nucleotides in the gene encoding human TRAC that was designed to have DNA nucleotides in the target binding region (SEQ ID NO: 321). The TRAC target binding sequence was added downstream (i.e., in the 3' direction) of the activation region sequence shown in Table 17, and the chRDNA design and crRNA control sequences were provided to a commercial manufacturer for synthesis.

[0490] E. Cell Transfection and Analysis Individual Cas12a guide / nuclear protein complexes for screening were produced essentially as described in Example 2. The Cas12a guide / nuclear protein complexes were transfected into primary T cells as described in Example 3, and the resulting genome editing efficiency of the Cas12a guide / nuclear protein complexes was determined as described in Example 4. The results of this intracellular editing experiment, as well as the positions of the DNA bases in the activation region and target binding sequence of each chRDNA, are shown in Table 18.

[0491] [Table 18]

[0492] From the editing results in Table 18, it is demonstrated that Cas12a chRDNA guide molecules having DNA in both the activation region and the target binding sequence can edit at a rate equivalent to that of crRNA (comparison of SEQ ID NO: 466 and SEQ ID NO: 467; SEQ ID NO: 466 and SEQ ID NO: 468, or SEQ ID NO: 466 and SEQ ID NO: 469). [Example]

[0493] Cloning of AAV Donor Cassettes, AAV Production, and AAV Transduction of Primary Cells This example describes the design of DNA donor cassettes and cloning into AAV vectors, the production of AAV, the delivery of Cas12a chRDNA guide / nuclear protein complexes to primary cells, and the transduction of primary cells with AAV for site-specific integration of CAR expression cassettes into primary cells.

[0494] AAV can be designed to deliver a DNA donor polynucleotide to mammalian cells. When AAV delivery is combined with a genomic cleavage event and the DNA donor polynucleotide in AAV is flanked by homology arms, the DNA donor polynucleotide can be seamlessly inserted into the genomic cleavage site by HDR, as described, for example, in Eyquem et al. (Nature, 2017, 543:113-117).

[0495] A. In silico design of AAV donor cassettes and rAAV production The design of the CAR receptor has been described. See, for example, Kochenderfer et al. (J. Immunotherapy, 2009, 32:689-702). The CAR construct was designed to include an N-terminal secretion signal (CD8a signal peptide), an scFv portion specific for BCMA, followed by a CD8 hinge region and transmembrane portion, a 4-1BB effector region, a CD3ζ effector region, and a C-terminal BGH polyadenylation signal sequence. A mammalian promoter sequence was inserted upstream of the CAR polynucleotide. A target site was selected at the endogenous TRAC locus (SEQ ID NO: 23) for site-specific insertion of the DNA donor polynucleotide into the host cell genome after site-specific cleavage. Next, 500 bp-long homology arms were identified 5' and 3' of the cleavage site. The 5' homology arm and 3' homology arm were added to the ends of the DNA donor polynucleotide, and the DNA donor polynucleotide was oriented in the reverse direction (i.e., 3' to 5') with respect to the homology arms. The resulting DNA donor polynucleotide is shown in SEQ ID NO: 413.

[0496] The design of B2M and the alpha chain of the HLA class I histocompatibility antigen E (HLA-E) is described. See, for example, Gornalusse et al. (Nature Biotechnology, 2017, 35(8):765-772). The fusion construct was designed with an N-terminal B2M secretion signal, followed by a peptide sequence from HLA-G, a first linker sequence, the B2M sequence, a second linker sequence, the HLA-E sequence, and a C-terminal BGH polyadenylation signal sequence. An EF1α mammalian promoter sequence was inserted upstream of the B2M-HLA-E polynucleotide. A target site in the endogenous B2M locus was selected for site-specific insertion of the DNA donor polynucleotide into the host cell genome after site-specific cleavage (SEQ ID NO: 62). Next, 500 bp long homologous arms 5' and 3' of the cleavage site were identified. The 5' homologous arm and 3' homologous arm were added to the ends of the DNA donor polynucleotide, and the DNA donor polynucleotide was oriented in the opposite direction to the homologous arms (i.e., 3' to 5'). The resulting DNA donor polynucleotide is shown in SEQ ID NO: 414.

[0497] The oligonucleotide sequence encoding the DNA donor polynucleotide was provided to a commercial manufacturer for synthesis into a suitable recombinant AAV (rAAV) plasmid. An rAAV plasmid containing SEQ ID NO: 413 and another rAAV plasmid containing SEQ ID NO: 414 were provided to a commercial manufacturer for packaging into two separate AAV6 viruses.

[0498] Transduction of primary T cells with B.rAAV Primary activated T cells were obtained from PBMC as described in Example 1. A Cas12a chRDNA guide / nuclear protein complex targeting the genes encoding TRAC (SEQ ID NO: 415) and B2M (SEQ ID NO: 416) was produced as described in Example 2. T cells were transfected with the Cas12a chRDNA guide / nuclear protein complex targeting TRAC (SEQ ID NO: 425), and between 1 minute and 4 hours after nucleofection, the cells were given 1×10 6T cells were infected with AAV6 virus packaged with the CAR donor sequence (SEQ ID NO: 413) at an MOI of 6 . T cells were also transfected with a Cas12a chRDNA guide / nuclear protein complex targeting B2M (SEQ ID NO: 416), and between 1 minute and 4 hours after nucleofection, the cells were infected with AAV6 virus packaged with the B2M-HLA-E donor sequence (SEQ ID NO: 414) at an MOI of

[0499] The transfected T cells were cultured in ImmunoCult-XF Complete Medium (STEMCELL Technologies, Cambridge, MA) supplemented with IL-2 (100 units / mL) 24 hours after transduction. The next day, the transduced T cells were transferred to 50 mL conical tubes and centrifuged at 300 × g for approximately 7 - 10 minutes to pellet the cells. The supernatant was discarded, the pellet was gently resuspended, and the T cells were pooled to a suitable volume of ImmunoCult-XF Complete Medium (STEMCELL Technologies, Cambridge, MA) supplemented with IL-2 (100 units / mL). 6 The counted T cells were resuspended in ImmunoCult-XF Complete Medium (STEMCELL Technologies, Cambridge, MA) supplemented with IL-2 (100 units / mL) at 1 × 10

[0500] C. Expression of anti-BCMA, B2M-HLA-E CAR-T cells In vitro characterization of anti-BCMA, B2M-HLA-E CAR-T cells, and controls (TRAC knockout (KO) and B2M KO), as well as wild-type T cells, was performed 7 days after transduction.

[0501] Anti-BCMA CAR expression using recombinant BCMA protein conjugated to phycoerythrin (PE); expression of TRAC using an anti-TCR a / b specific antibody conjugated to Alexa Fluor® 647 (ThermoFisher Scientific, Waltham, MA), or expression of B2M using an anti-B2M specific antibody conjugated to PE was evaluated by flow cytometry. The results of the flow cytometry analysis are shown in Figure 15A, showing the percentages of CAR positive (Figure 15A, 1501), TRAC positive (Figure 15A, 1502), and B2M positive (Figure 15A, 1503) for untreated cells (wild-type T cells, Figure 15A, 1504), cells transfected with only both Cas12a chRDNA guide / nuclear protein complexes (TRAC KO / B2M KO; Figure 15A, 1505), and cells transfected with both Cas12a chRDNA guide / nuclear protein complexes and transduced with both viruses (anti-BCMA, B2M-HLA-E CAR-T; Figure 15A, 1506). The y-axis represents the percentage of positive cells as measured by FACS for various cell surface markers. The results are also shown in Table 19.

[0502]

Table 19

[0503] D. Cytotoxicity of anti-BCMA, B2M-HLA-E CAR T cells in vitro The cytotoxicity of anti-BCMA, B2M-HLA-E CAR T cells against multiple myeloma NCI-H929 cell lines presenting BCMA antigen was evaluated in vitro. TRAC KO T cells were used as a control for CAR-mediated killing. Briefly, target cells (NCI-H929(T)) were labeled with CellTrace™ Violet (CTV; Thermo Fisher C34557) to distinguish them from effector anti-BCMA, B2M-HLA-E CAR-T (E), and the cells were co-cultured at E:T ratios of 0:1, 1:20, 1:10, 1:5, 1:3, 1:1, 3:1, and 10:1 (3 co-culture wells / E:T ratio). Cytotoxicity was measured by gating on the CTV cell population (target cells) and live cells with propidium iodide (PI) after 48 hours of co-culture. Data were analyzed by flow cytometry (Intellicyt iQue Screener Plus). Specific lysis was calculated using the following formula for each well: Specific lysis = 1 - (number of live target cells in test sample / number of live target cells in control sample).

[0504] The results of the in vitro cytotoxicity assay for anti-BCMA, B2M-HLA-E CAR-T cells (gray circles) and control TRAC KO T cells (black circles) are shown in Figure 15B. The y-axis represents the percentage of target cell death, and the x-axis indicates the E:T ratio used. The data shown in Figure 15B are also shown in Table 20.

[0505]

Table 20

[0506] The results shown in Figure 15B and Table 20 demonstrate that CAR-T cells produced using Cas12a chRDNA guide molecules can kill target cells antigen-specifically.

[0507] Using the methods shown herein, other cells can be produced using Cas12a chRDNA guide molecules for the site-specific introduction of donor polynucleotides comprising chimeric antigen receptors (CARs). Additional donor polynucleotides expressing non-CAR polypeptides (i.e., B2M-HLA-E fusion constructs) can likewise be introduced using the guidance herein.

Example

[0508] Generation of anti-BCMA CAR-T with endogenous B2M promoter-driven expression of B2M-HLA-E fusion This example describes the design of AAV-mediated transduction of primary cells for the site-specific alteration of the CAR polynucleotide and B2M-HLA-E polynucleotide expression cassette at the Cas12a chRDNA-mediated cleavage site in the genome of primary cells.

[0509] A. In silico design of AAV donor cassette and rAAV production The anti-BCMA CAR was designed as described in Example 9.

[0510] The donor cassette polynucleotide of the P2A-B2M-HLA-E fusion construct was designed with a polynucleotide encoding an N-terminal B2M secretion signal, followed by a polynucleotide encoding an HLA-G-derived peptide sequence, a polynucleotide encoding a first linker sequence, a polynucleotide encoding a B2M sequence, a polynucleotide encoding a second linker sequence, a polynucleotide encoding an HLA-E sequence, and a polynucleotide encoding a C-terminal BGH polyadenylation signal sequence. Upstream of B2M-HLA-E, a polynucleotide encoding a P2A ribosome skipping sequence was inserted to allow expression of the fusion construct to be under the control of the endogenous B2M promoter. A target site in the endogenous B2M locus was selected (SEQ ID NO: 62) for site-specific insertion of the DNA donor polynucleotide into the host cell genome after site-specific cleavage. Next, 500 base pair-long homologous arms 5' and 3' of the cleavage site were identified. The 5' homologous arm and the 3' homologous arm were added to the 5' and 3' ends of the DNA donor polynucleotide, and the DNA donor polynucleotide was oriented in the forward direction (i.e., 5' to 3') relative to the homologous arms. The resulting DNA donor polynucleotide is shown in SEQ ID NO: 479.

[0511] The oligonucleotide sequence encoding the DNA donor polynucleotide was provided to a commercial manufacturer for synthesis into a suitable recombinant AAV (rAAV) plasmid. An rAAV plasmid containing SEQ ID NO: 413 and another rAAV plasmid containing SEQ ID NO: 479 were provided to a commercial manufacturer for packaging into two separate AAV6 viruses.

[0512] Transduction of primary T cells with B. rAAV Naive activated T cells were obtained from PBMCs as described in Example 1. A Cas12a chRDNA guide / nuclear protein complex targeting the genes encoding TRAC (SEQ ID NO: 415) and B2M (SEQ ID NO: 416) was produced as described in Example 2. The T cells were transfected with a Cas12a chRDNA guide / nuclear protein complex targeting TRAC (SEQ ID NO: 425), and between 1 minute and 4 hours after nucleofection, the cells were infected with AAV6 virus packaged with the CAR donor sequence (SEQ ID NO: 413) at an MOI of 1×10 6 . In addition, the T cells were transfected with a Cas12a chRDNA guide / nuclear protein complex targeting B2M (SEQ ID NO: 416), and between 1 minute and 4 hours after nucleofection, the cells were infected with AAV6 virus packaged with the P2A-B2M-HLA-E donor sequence (SEQ ID NO: 479) at an MOI of 1×10 6 . The T cells were cultured in ImmunoCult-XF Complete Medium (STEMCELL Technologies, Cambridge, MA) supplemented with IL-2 (100 units / mL) 24 hours after transduction. The next day, the transduced T cells were transferred to 50 mL conical tubes and centrifuged at 300×g for approximately 7 - 10 minutes to pellet the cells. The supernatant was discarded, the pellet was gently resuspended, and the T cells were pooled in an appropriate amount of ImmunoCult-XF Complete Medium (STEMCELL Technologies, Cambridge, MA) supplemented with IL-2 (100 units / mL).

[0513] The counted T cells were resuspended in ImmunoCult-XF Complete Medium (STEMCELL Technologies, Cambridge, MA) supplemented with IL-2 (100 units / mL) at 1×10 6 cells / mL and seeded into T-175 suspension flasks as needed (the maximum volume per flask is 250 mL).

[0514] C. Expression of anti-BCMA CAR and B2M-HLA-E on CAR-T cells The in vitro characterization of anti-BCMA, P2A-B2M-HLA-E CAR-T cells, and controls (TRAC knockout (KO) and B2M KO), as well as wild-type T cells, was performed 7 days after transduction.

[0515] CAR-T cells were evaluated by flow cytometry for the expression of anti-BCMA CAR using a recombinant BCMA protein conjugated to phycoerythrin (PE); the expression of TRAC using an anti-TCR a / b specific antibody conjugated to Alexa Fluor® 647 (ThermoFisher Scientific, Waltham, MA), or the expression of B2M using an anti-B2M specific antibody conjugated to PE. The results of the flow cytometry analysis are shown in Table 21, indicating the percentages of CAR-positive, TRAC-positive, and B2M-positive for untreated cells (wild-type T cells), cells transfected with only both Cas12a chRDNA guide / nuclear protein complexes (TRAC KO / B2M KO), and cells transfected with both Cas12a chRDNA guide / nuclear protein complexes and transduced with both viruses (anti-BCMA, B2M-HLA-E CAR-T).

[0516]

Table 21

[0517] The results shown in Table 21 demonstrate Cas12a chRDNA guide-mediated KO of endogenous TRAC and B2M expression, as well as AAV6-mediated introduction and endogenous expression of the anti-BCMA CAR donor cassette, and endogenous B2M promoter-driven expression of the exogenous B2M-HLA-E donor cassette.

[0518] Using the methods shown in this specification, Cas12 chRDNA guide designs for other targets can be identified. The activation regions and target binding sequences of other Cas12 chRDNA guides can be screened in the same manner as the methods described in this specification.

Example

[0519] Cas12a guide / nuclear protein complex with alternative linker-NLS structure This example describes the design and comparison of Cas12a guide / nuclear protein complexes with different linker and nuclear localization signal (MLS) structures, compared to the "non-optimized" design with the glycine-serine linker and simian vacuolar virus 40 large T antigen NLS (SV40; SEQ ID NO: 04) used in previous examples of this application.

[0520] A. In silico design of Cas12a linker-NLS sequences The Acidaminococcus sp. (strain BV3L6) Cas12a protein (SEQ ID NO: 01) was selected for manipulation, and two NLS sequences, SV40 (SEQ ID NO: 04) and nucleoplasmin sequence (NPL; SEQ ID NO: 05), were selected for covalent addition to the Cas12a protein using either a pair of glycine-serine (GS) or glycine-glycine-glycine-glycine-serine (G4S) amino acid linkers. Designs containing two NLSs with variable linkers were also created for testing. The designs of the linker-NLS sequences are shown in Table 22.

[0521]

Table 22

[0522] The NLS sequences shown in Table 22 were cloned into the C-terminus of the Acidaminococcus sp. (strain BV3L6) Cas12a protein (SEQ ID NO: 01), and the recombinant proteins were expressed as described in Example 2.

[0523] Cell Activity of B. Cas12a Linker-NLS Design The purified recombinant Cas12a protein containing the linker-NLS sequences shown in Table 22 was complexed with a chRDNA guide (SEQ ID NO: 467) targeting the TRAC gene as described in Example 2 and transfected into primary T cells as described in Example 3. Forty-eight hours after transfection, the resulting genomic editing efficiency of each Cas12a guide / nuclear protein complex was determined as described in Example 4. The results of this cell editing experiment are shown in FIG. 16A and Table 23.

[0524] [Table 23]

[0525] From the data shown in FIG. 16A and Table 23 of this example, it is shown that alternative linker and NLS sequences can increase editing compared to a design having a single GS-SV40 NLS structure.

[0526] C. Cell Activity of Alternative Cas12a Linker-NLS Sequences across Targets The top four Cas12a linker-NLS constructs shown in Table 23 (SEQ ID NO: 489, SEQ ID NO: 485, SEQ ID NO: 487, and SEQ ID NO: 483), and the "non-optimized" design (SEQ ID NO: 479) were selected for comparison using a mixed panel of crRNA and chRDNA. The targeting regions containing the positions of the DAN bases in the chRDNA design are shown in Table 24.

[0527] [Table 24]

[0528] The targeting regions shown in Table 24 were added to the 3' end of the activation region (SEQ ID NO: 459) and provided to a commercial manufacturer for synthesis.

[0529] Individual Cas12a linker-NLS constructs complexed with each guide were produced essentially as described in Example 2, with the modification that the complexes were assembled at two concentrations of Cas12a to guide of 20:60 and 80:240 pmol for each combination of Cas12a linker-NLS and guide. Cas12a guide / nuclear protein complexes were transfected into primary T cells as described in Example 3, and the resulting genomic editing efficiency of the Cas12a guide / nuclear protein complexes was determined as described in Example 4.

[0530] The results of editing of Cas12a linker-NLS constructs complexed with guides, shown in Table 24, are shown in Figure 16B, as well as in Tables 25 and 26.

[0531]

Table 25

[0532]

Table 26

[0533] From the data shown in Figure 16B and Tables 25 and 26, improved activity of various NLS constructs across multiple targets in human primary T cells is demonstrated (see, e.g., the average editing of Figure 16B 1613 compared to the average editing of Figure 16B, Figure 16B 1616, or Figure 16B 1617). Alternative NLS sequences, linkers, and Cas nucleases can be screened in a manner similar to the methods described herein.

Example

[0534] Multiplexing with Cas12a chRDNA Guide / Nuclear Protein Complexes This example describes the co-delivery (multiplexing) of multiple Cas12a chRDNAs into cells in a single transfection reaction and the comparison of the multiplex editing rates of Cas12a chRDNA guide / nuclear protein complexes with GS-SV40 (SEQ ID NO: 479: "non-optimized NLS") and (G4S)2-NPL (SEQ ID NO: 489: "optimized NLS").

[0535] A. In silico design of Cas12a chRDNA linker-NLS sequences The Acidaminococcus sp. (strain BV3L6) Cas12a protein (SEQ ID NO: 01) was engineered with either the first C-terminal linker-NLS sequence (SEQ ID NO: 479) or the second C-terminal linker-NLS sequence (SEQ ID NO: 489), and the Cas12a recombinant protein was expressed as described in Example 2.

[0536] B. Cellular multiplexing activity of Cas12a linker-NLS The purified recombinant Cas12a protein containing either the linker-NLS sequence SEQ ID NO: 479 or the linker-NLS sequence SEQ ID NO: 489 was complexed with either the TRAC targeting chRDNA (SEQ ID NO: 508), the B2M targeting chRDNA gene (SEQ ID NO: 416), the CISH targeting chRDNA (SEQ ID NO: 509), or the CBLB targeting chRDNA (SEQ ID NO: 510) as described in Example 2, with the change that this complex was constructed at a 40:80 pmol ratio of Cas12a to guide. Each Cas12a chRDNA guide / nuclear protein complex was used as a single targeting complex; both the TRAC and B2M targeting Cas12a chRDNA guide / nuclear protein complexes combined in one mix; both the CISH and CBLB targeting Cas12a chRDNA guide / nuclear protein complexes combined in one mix; or all of the TRAC, B2M, CISH, and CBLB targeting Cas12a chRDNA guide / nuclear protein complexes combined in one mix. Each Cas12a chRDNA / nuclear protein composition was transfected into primary T cells as described in Example 3. Forty-eight hours after transfection, the resulting genomic editing efficiency of each Cas12a chRDNA / nuclear protein complex was determined as described in Example 4. The results of this cell editing experiment are shown in FIG. 17 and Table 27.

[0537]

Table 27

[0538] Data shown in FIGS. 17 and 27 demonstrate improved activity of the linker-NLS construct when used for multiplexing in primary human T cells. For example, see the average editing of FIGS. 17, 1707 by the non-optimized GS-SV40 linker-NLS (SEQ ID NO: 479, FIG. 17 1708), and the average editing of FIGS. 17, 1711 by the optimized (G4)2-NPL linker NLS (SEQ ID NO: 489, FIG. 17, 1712). Alternative NLS sequences, linkers, Cas12 nucleases, and multiplexing targets can be screened in a manner similar to the methods described herein.

Example

[0539] Editing by Cas12a chRDNA guide / nuclear protein complexes containing chemical modifications This example describes the cellular editing activity of Cas12a chRDNA containing phosphorothioate chemical modifications in the activation and targeting regions of the Cas12a guide RNA.

[0540] A. In silico design of Cas12a chRDNA with chemical modifications The TRAC target-12 sequence (SEQ ID NO: 316) was selected for manipulation. Two phosphorothioate bonds were designed at the 5' end of the Cas12a guide (i.e., the 5' terminal nucleotide of the activation region), and two phosphorothioate bonds were designed at the 3' end of the Cas12a guide (i.e., the 3' terminal nucleotide of the targeting region). Subsequently, a series of Cas12a guides with DNA bases in the activation region were designed in addition to the phosphorothioate modifications that protect the termini. The sequences of Cas12a chRDNA with chemical modifications are shown in Table 28. This sequence was provided to a commercial manufacturer for synthesis (the positions of the listed phosphorothioate bonds and DNA bases correspond to the numbers shown in FIG. 5).

[0541]

Table 28

[0542] B. Cell Transfection and Analysis Individual Cas12a guide / nuclear protein complexes were produced essentially as described in Example 2. The nuclear protein complexes were transfected into primary T cells as described in Example 3, and the resulting genomic editing efficiency of the Cas12a guide / nuclear protein complexes was determined as described in Example 4. The results of this intracellular editing experiment are shown in Table 29.

[0543] [Table 29]

[0544] From the data shown in Table 29, the editing activity of Cas12a guides containing phosphorothioate linkages alone, or phosphorothioate linkages and either DNA bases, is demonstrated. This guide can robustly edit in human primary T cells compared to all-RNA guides (i.e., see the average edit in Table 29 of SEQ ID NO: 511 compared to the average edits of SEQ ID NO: 512 or SEQ ID NO: 515). Alternative combinations and positions of chemical modifications can be screened in the same manner as the methods described herein. [Example]

[0545] Transfection of Human Induced Pluripotent Stem Cells with Cas12a chRDNA / Nuclear Protein Complexes This example describes the cell editing of human induced pluripotent stem cells (iPSCs) with Cas12a chRDNA / nuclear protein complexes.

[0546] A. In Silico Design of chRDNA Guides The AsCas12a guide sequence (SEQ ID NO: 509) targeting the CISH gene containing DNA bases in the guide activation region was selected for further manipulation and introduction of additional DNA bases into the targeting region (SEQ ID NO: 518 - SEQ ID NO: 529). The sequence was provided to a commercial manufacturer for synthesis.

[0547] B. Cell Transfection and Analysis Individual Cas12a guide / nuclear protein complexes were produced essentially as described in Example 2. The nuclear protein complexes were transfected into primary T cells as described in Example 3.

[0548] iPSCs were handled and transfected in the same manner as the methods for handling and transfecting primary T cells described in Example 3, with the following modifications. The iPSCs were cultured in mTeSR-plus medium (STEMCELL Technologies, Cambridge, MA) supplemented with a Rho-associated coiled-coil containing protein kinase inhibitor ("ROCKi", MilliporeSigma, Burlington, MA) at a final concentration of 10 μM for 3 hours at 37°C prior to transfection. The mTeSR-plus / ROCKi medium was removed, and the iPSCs were washed with 10 mL of PBS, followed by the addition of 3 mL of Accutase (STEMCELL Technologies, Cambridge, MA), and the cells were incubated at 37°C for 5 - 10 minutes. Then, 7 mL of mTeSR-pulse and ROCKi were added to the cells, and the cells were mixed and counted. The cells were then centrifuged, the medium was removed, the cells were washed with 10 mL of PBS, and centrifuged again to remove the PBS. The cells were resuspended in Nucleofector™ P3 (Lonza, Allendale, NJ) solution to a density of 2 × 10 5 cells / mL and mixed with the Cas12a chRDNA guide / nuclear protein complex and transfected using the pulse code CA158. The resulting genome editing efficiency of the Cas12a guide / nuclear protein complex was determined as described in Example 4 and is shown in Table 29.

[0549] [Table 30]

[0550] From the data shown in Table 29, it is demonstrated that the Cas12a chRDNA guide / nuclear protein complex can be used for the manipulation of human iPSCs. Other cell types can be edited in the same manner as the methods described herein.

[0551] As will be apparent to those skilled in the art, various modifications and variations can be made to the above-described embodiments without departing from the spirit and scope of the present disclosure. Such modifications and changes are within the scope of the present disclosure.

Claims

**Claim 1** A CRISPR guide molecule, comprising: a targeting region capable of binding to a target nucleic acid sequence; an activation region having deoxyribonucleotides instead of ribonucleotides at three or more positions among positions 1, 3, 7, 10, 12, 14, 15, and 19 in the activation region, the activation region comprising the RNA sequence UAAUUU CUA CUC UUG UAG AU (SEQ ID NO: 6) and being capable of forming a nuclear protein complex with a Cas12 protein; and an activation region comprising the RNA sequence UAAUUU CUA CUC UUG UAG AU (SEQ ID NO: 6) having deoxyribonucleotides instead of ribonucleotides at three or more positions among positions 1, 3, 7, 10, 12, 14, 15, and 19 in the activation region, the activation region being capable of forming a nuclear protein complex with a Cas12 protein; and a CRISPR guide molecule comprising the activation region. **Claim 2** The CRISPR guide molecule according to claim 1, comprising one or more phosphorothioate chemical modifications. **Claim 3** The CRISPR guide molecule according to claim 1, wherein the targeting region targets the B2M gene and comprises the RNA sequence AGUGGGGGUGAAUUCAGUGU (SEQ ID NO: 211), and one or more of positions 1, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, and 20 in the targeting region comprise deoxyribonucleotide bases. **Claim 4** The CRISPR guide molecule according to claim 3, comprising the sequence of SEQ ID NO:

416. **Claim 5** The CRISPR guide molecule according to claim 1, wherein the targeting region targets the TRAC gene and comprises the RNA sequence GAGUCUCUCAGCUGG UACAC (SEQ ID NO: 232), and one or more of positions 1, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, and 20 in the targeting region comprise deoxyribonucleotide bases. **Claim 6** The CRISPR guide molecule according to claim 5, comprising the sequence of SEQ ID NO:

508. **Claim 7** The CRISPR guide molecule according to claim 5, comprising the sequence of SEQ ID NO:

415. **Claim 8** The CRISPR guide molecule according to claim 1, wherein the targeting region targets the CISH gene and comprises an RNA sequence capable of hybridizing to a human genomic sequence selected from SEQ ID NOs: 156-165, and one or more of positions 1, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, and 20 in the targeting region comprise deoxyribonucleotide bases. **Claim 9** The targeting region targets the PDCD1 gene and contains an RNA sequence capable of hybridizing to a human genomic sequence selected from SEQ ID NOs: 134 to 155, wherein one or more of positions 1, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, and 20 in the targeting region contain deoxyribonucleotide bases. The CRISPR guide molecule according to claim 1.

10. The targeting region targets the CBLB gene and contains an RNA sequence capable of hybridizing to a human genomic sequence selected from SEQ ID NOs: 166 to 189, wherein one or more of positions 1, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, and 20 in the targeting region contain deoxyribonucleotide bases. The CRISPR guide molecule according to claim 1.

11. A CRISPR nucleic acid / protein composition comprising: The CRISPR guide molecule according to claim 1; A Cas12 protein; and A CRISPR nucleic acid / protein composition comprising the same.

12. The Cas12a protein comprises the amino acid sequence of SEQ ID NO:

1. The CRISPR nucleic acid / protein composition according to claim 11.

13. A method for producing allogeneic chimeric antigen receptor (CAR)-expressing cells, comprising: a) contacting a first target nucleic acid containing a TRAC sequence in a cell with the first CRISPR nucleic acid / protein composition according to claim 11, which comprises a CRISPR guide molecule of SEQ ID NO: 508 or 415, wherein the first CRISPR nucleic acid / protein complex is capable of cleaving the first target nucleic acid sequence; b) contacting a second target nucleic acid sequence containing a B2M sequence in the same cell with the second CRISPR nucleic acid / protein composition according to claim 11, which comprises a CRISPR guide molecule of SEQ ID NO: 416, wherein the second CRISPR nucleic acid / protein complex is capable of cleaving the second target nucleic acid sequence; c) preparing a first donor polynucleotide encoding a CAR comprising a scFv, a transmembrane domain, a co-stimulatory domain, and an activation domain, wherein the CAR can be inserted into the cleavage site in the first target nucleic acid sequence; d) preparing a second donor polynucleotide encoding a B2M-HLA-E fusion construct comprising a B2M secretion signal, an HLA-G peptide signal sequence, a first linker sequence, a B2M sequence, a second linker sequence, and an HLA-E sequence, wherein the B2M-HLA-E fusion construct can be inserted into a cleavage site in the second target nucleic acid sequence; e) cleaving the first target nucleic acid sequence and inserting at least a portion of the first donor polynucleotide into the cleavage site; and f) cleaving the second target nucleic acid sequence and inserting at least a portion of the second donor polynucleotide into the cleavage site, comprising, wherein a)-f) are performed in vitro, method.

14. The method according to claim 13, wherein the second donor polynucleotide comprises the polynucleotide sequence set forth in SEQ ID NO:

414.

15. The method according to claim 13, wherein the CAR comprises a transmembrane domain derived from CD8, a 4-1BB co-stimulatory domain or a CD28 co-stimulatory domain, and a CD3ζ activation domain. ​

Images