Targeting Ligands for Tau Pathology

Compositions with targeting ligands linked to liposomes provide early and accurate detection of tau pathology in Alzheimer's disease, overcoming the delays in conventional diagnosis by imaging hyperphosphorylated tau non-invasively, enabling pre-onset AD detection.

JP7702381B2Active Publication Date: 2025-07-03ALZECA BIOSCI +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
JP2022500781
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2019-07-08
Filing Date
2020-07-07
Publication Date
2025-07-03
Estimated Expiration
2040-07-07

AI Technical Summary

Technical Problem

Current methods for diagnosing Alzheimer's disease (AD) based on tau pathology are limited by the lag in detecting pathological tau concentrations, which often occur years after amyloid plaques, and existing tau markers in cerebrospinal fluid and blood are confounded by other factors, making early detection challenging.

Method used

Development of compositions comprising targeting ligands, such as aptamers, that specifically bind to cell surface markers of tau pathology, linked to liposomes containing imaging agents like MRI contrast agents, allowing for early detection of tau pathology without penetrating the cell membrane.

Benefits of technology

Enables early and accurate imaging of tau pathology, potentially diagnosing AD in its pre-onset stage, with high sensitivity and specificity, using MRI to detect hyperphosphorylated tau without the limitations of conventional methods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007702381000020
    Figure 0007702381000020
  • Figure 0007702381000021
    Figure 0007702381000021
  • Figure 0007702381000022
    Figure 0007702381000022
Patent Text Reader

Abstract

Methods and compositions for detecting tau pathology are described. The composition for detecting tau pathology comprises a targeting ligand that specifically binds to a cell surface marker of tau pathology, the targeting ligand being linked to a liposome containing an imaging agent. The composition can be used in a method for imaging tau pathology in a subject, comprising administering an effective amount of the composition to the subject and imaging at least a portion of the subject to determine whether the portion of the subject exhibits tau pathology. The composition can also be used to detect tau pathology in a biological sample obtained from the subject.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Cross - Reference to Related Applications This application claims the priority of U.S. Provisional Patent Application No. 62 / 871,380, filed on July 8, 2019, the entire content of which is incorporated herein by reference.

[0002] Sequence Listing The sequence listing is submitted electronically in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy created on July 7, 2020, is named Alzeca - 122_Sequence Listing_PCT_ST25.txt and is 47,652 bytes in size.

Background Art

[0003] Tau, a microtubule - associated protein, is essential for the etiology of Alzheimer's disease (AD) and other tauopathies. Tau is encoded by the MAPT gene. Six tau isoforms are generated by alternative splicing, and these isoforms differ in that the insertion of two inserts (0N, 1N, 2N) near the N - terminus and three or four repeat sequences (3R, 4R) corresponding to the conserved microtubule - binding domain near the C - terminus are controlled. The 4R:3R ratio of mRNA and protein is close to 1:1 in normal brain tissue but increases in pathological conditions.

[0004] Tau pathology occurs through several molecular changes such as phosphorylation, acetylation, ubiquitination, SUMOylation, glycation, nitration, and cleavage. However, all of these molecular changes are associated with abnormal phosphorylation, and it has been concluded that abnormal phosphorylation is the first step in tau pathology formation. Abnormal phosphorylation of tau leads to the formation of a pair of helical filaments that constitute most of the neurofibrillary changes seen in neurons that degenerate during the course of AD. These neurofibrillary changes, together with amyloid plaques, constitute two pathological features of AD.

[0005] The definitive diagnosis of AD according to the latest criteria supported by the National Institute on Aging and the Alzheimer's Association requires pathological amyloid and tau (A+, T+), where amyloid is measured with any of the approved PET imaging agents and tau is measured with an imaging agent or cerebrospinal fluid (CSF) levels. The time course of major biomarkers such as amyloid PET and CSF tau with disease progression has been studied for a long time. The latest research suggests that pathological tau concentrations lag several years behind pathological amyloid concentrations. By the time a significant increase in both markers is detected by conventional methods, the disease has generally already progressed. Furthermore, while the identification of amyloid plaques by PET tracers is objective and clear, tau markers in CSF and blood are confounded by many other factors, such as other medical conditions and treatments the patient is undergoing. Recently, proteomic analysis using artificial intelligence of serum biomarkers has received much attention, but its accuracy is only slight when compared to the gold standard of PET.

[0006] If tau pathology can be detected early, the diagnosis of AD could potentially be advanced by several years, perhaps to the pre-onset stage of the disease.

Summary of the Invention

[0007] Compositions for identifying tau pathology are provided, the compositions comprising a targeting ligand that specifically binds to a cell surface marker of tau pathology, the targeting ligand being linked to a liposome containing an imaging agent, such as a magnetic resonance imaging (MRI) contrast agent. In some embodiments, the targeting ligand comprises an aptamer or a stabilized aptamer. In some embodiments, the targeting ligand comprises a thioaptamer. In some embodiments, the targeting ligand comprises a DNA nucleotide sequence selected from one or more of Tau_1 (SEQ ID NO: 5), Tau_3 (SEQ ID NO: 6), Tau_9 (SEQ ID NO: 7), Tau_11 (SEQ ID NO: 8), Tau_10 (SEQ ID NO: 9), Tau_13 (SEQ ID NO: 10), Tau_8 (SEQ ID NO: 11), Tau_4 (SEQ ID NO: 12), Tau_17 (SEQ ID NO: 13), Tau_5 (SEQ ID NO: 14), Tau_21 (SEQ ID NO: 15), Tau_25 (SEQ ID NO: 16), Tau_7 (SEQ ID NO: 17), Tau_31 (SEQ ID NO: 18), Tau_42 (SEQ ID NO: 19), Tau_14 (SEQ ID NO: 20), Tau_19 (SEQ ID NO: 21), Tau_15 (SEQ ID NO: 22), Tau_56 (SEQ ID NO: 23), Tau_34 (SEQ ID NO: 24), Tau_23 (SEQ ID NO: 25), Tau_99 (SEQ ID NO: 26), and Tau_102 (SEQ ID NO: 27). In some embodiments, the cell surface marker of tau pathology comprises a cell surface marker of hyperphosphorylated tau. In some embodiments, the cell surface marker of tau pathology comprises a protein selected from keratin 6A (KRT6A), keratin 6B (KRT6B), heat shock protein (HSP), and vimentin (VIM). In some embodiments, the targeting ligand is determined to specifically bind to a cell surface marker of tau pathology using the systematic evolution of ligands by exponential enrichment (SELEX) method (in vitro selection method). In some embodiments, the targeting ligand is linked to a polyethylene glycol that is bound to a phospholipid that associates with the liposome.In some embodiments, the liposome comprises a membrane, and the membrane comprises a first phospholipid; a sterically bulky excipient capable of stabilizing the liposome; a second phospholipid derivatized with a first polymer; a third phospholipid derivatized with a second polymer, wherein the second polymer is bound to a targeting ligand; and an imaging agent encapsulated by or bound to the membrane.

[0008] Also provided is a method of imaging tau pathology in a subject, the method comprising administering to the subject a detectable effective amount of a targeting ligand-liposome conjugate comprising a targeting ligand that specifically binds to a cell surface marker of tau pathology, wherein the targeting ligand is bound to a liposome comprising an imaging agent, and imaging at least a portion of the subject to determine whether a portion of the subject exhibits tau pathology. In some embodiments, a portion of the subject comprises a portion of the subject's brain. In some embodiments, the imaging shows a level of tau pathology sufficient to diagnose the subject as being in the early stages of AD. In some embodiments, the method further comprises providing prophylaxis or treatment for AD to the subject. In some embodiments, the imaging agent is an MRI contrast agent, and the level of binding is determined using MRI.

[0009] Also provided is a method of detecting tau pathology, the method comprising contacting a biological sample with an effective amount of a targeting ligand-liposome conjugate comprising a targeting ligand that specifically binds to a cell surface marker of tau pathology, wherein the targeting ligand is bound to a liposome comprising a detectable label, washing the biological sample to remove unbound targeting ligand-liposome conjugate, and detecting tau pathology in the biological sample by determining the amount of detectable label remaining in the biological sample. In some embodiments, the biological sample is a sample comprising nerve cells.

[0010] Targeting compositions are also provided, which comprise a phospholipid linked to a polymer linked to a targeting ligand that specifically binds to a cell surface marker of tau pathology. In some embodiments, the targeting ligand is an aptamer or a stabilized aptamer. In some embodiments, the targeting ligand is a thioaptamer. In some embodiments, the aptamer or stabilized aptamer comprises a DNA nucleotide sequence selected from one or more of Tau_1 (SEQ ID NO: 5), Tau_3 (SEQ ID NO: 6), Tau_9 (SEQ ID NO: 7), Tau_11 (SEQ ID NO: 8), Tau_10 (SEQ ID NO: 9), Tau_13 (SEQ ID NO: 10), Tau_8 (SEQ ID NO: 11), Tau_4 (SEQ ID NO: 12), Tau_17 (SEQ ID NO: 13), Tau_5 (SEQ ID NO: 14), Tau_21 (SEQ ID NO: 15), Tau_25 (SEQ ID NO: 16), Tau_7 (SEQ ID NO: 17), Tau_31 (SEQ ID NO: 18), Tau_42 (SEQ ID NO: 19), Tau_14 (SEQ ID NO: 20), Tau_19 (SEQ ID NO: 21), Tau_15 (SEQ ID NO: 22), Tau_56 (SEQ ID NO: 23), Tau_34 (SEQ ID NO: 24), Tau_23 (SEQ ID NO: 25), Tau_99 (SEQ ID NO: 26), and Tau_102 (SEQ ID NO: 27).

[0011] Aptamers or stabilized aptamers are also provided, which comprise a DNA nucleotide sequence selected from one or more of Tau_1 (SEQ ID NO: 5), Tau_3 (SEQ ID NO: 6), Tau_9 (SEQ ID NO: 7), Tau_11 (SEQ ID NO: 8), Tau_10 (SEQ ID NO: 9), Tau_13 (SEQ ID NO: 10), Tau_8 (SEQ ID NO: 11), Tau_4 (SEQ ID NO: 12), Tau_17 (SEQ ID NO: 13), Tau_5 (SEQ ID NO: 14), Tau_21 (SEQ ID NO: 15), Tau_25 (SEQ ID NO: 16), Tau_7 (SEQ ID NO: 17), Tau_31 (SEQ ID NO: 18), Tau_42 (SEQ ID NO: 19), Tau_14 (SEQ ID NO: 20), Tau_19 (SEQ ID NO: 21), Tau_15 (SEQ ID NO: 22), Tau_56 (SEQ ID NO: 23), Tau_34 (SEQ ID NO: 24), Tau_23 (SEQ ID NO: 25), Tau_99 (SEQ ID NO: 26), and Tau_102 (SEQ ID NO: 27).

Brief Description of the Drawings

[0012] The present invention can be more easily understood by referring to the following drawings.

[0013]

Figure 1

[0014]

Figure 2

[0015]

Figure 3

[0016]

Figure 4

[0017]

Figure 5

[0018]

Figure 6

[0019]

Figure 7

[0020]

Figure 8

[0021]

Figure 9

[0022]

Figure 10

[0023] To illustrate the present invention, some embodiments of the present invention will now be described in more detail. Refer to the drawings summarized above. Those skilled in the art will recognize that the embodiments provided herein have many useful alternatives that fall within the scope of the present invention.

Mode for Carrying Out the Invention

[0024] Detailed Description The present disclosure provides methods and compositions for detecting tau pathology. The composition for detecting tau pathology includes a targeting ligand that specifically binds to a cell surface marker of tau pathology, and the targeting ligand is linked to a liposome containing an imaging agent. Refer to FIG. 1. The present composition can be used in a method for imaging tau pathology in a subject, which includes administering to the subject an effective amount of the present composition and imaging at least a part of the subject to determine whether that part of the subject exhibits tau pathology. The present composition can also be used to detect tau pathology in a biological sample obtained from a subject.

[0025] Definitions Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In case of conflict, this specification, including definitions, will control.

[0026] Unless otherwise specified, "a", "an", "the", "one or more of", and "at least one" are used interchangeably. The singular forms "a", "an", and "the" include their plural forms.

[0027] The description of a numerical range by endpoints includes all numerical values included within that range (e.g., 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.80, 4, 5, etc.).

[0028] The term "about", when referring to a value or amount of mass, weight, time, volume, concentration, or percentage, means an inclusion of a variation of ±10% from the specified amount.

[0029] The terms "comprising" and "including" are intended to be equivalent and open-ended.

[0030] The expression "consisting essentially of" means that a composition or method may include additional ingredients and / or steps, but only to the extent that the additional ingredients and / or steps do not substantially change the basic and novel characteristics of the claimed composition or method.

[0031] The expression "selected from the group consisting of" means an inclusion of a mixture of the described group.

[0032] The "effective amount" or "detectable effective amount" of a composition means an amount sufficient to detect the presence of a cell surface marker associated with tau pathology, or an amount sufficient to obtain an acceptable image using clinically available equipment. The detectable effective amount of a detection agent or imaging agent may be administered in more than one injection. The detectable effective amount of a detection agent or imaging agent may vary depending on factors such as the degree of sensitivity of the individual, the age, sex, weight of the individual, the specific response of the individual, and dosimetry. Also, the detectable effective amount of a detection agent or imaging agent may vary depending on factors related to the equipment and film. Optimizing such factors is well within the skill level of those in the art. The amount of the imaging agent used for diagnostic purposes and the time of the imaging examination depend on the specific imaging agent used, the weight of the patient, the nature and severity of the condition being treated, the nature of the therapeutic treatment the patient has received, and the specific response of the patient. Ultimately, the attending physician determines the amount of the imaging agent to be administered to an individual patient and the time of the imaging examination.

[0033] The term "diagnosis" includes determining the nature of a disease in a subject, and determining the severity and likelihood of the disease or the onset of the disease, the likely outcome of recovery (prognosis), or both. Also included in "diagnosis" is diagnosis from the perspective of reasonable treatment, and diagnosis leads to treatment such as the initial selection of treatment, changes in treatment (e.g., adjustment of dosage and / or administration regimen).

[0034] The term "antigen" refers to a molecule or part of a molecule that can bind to a targeting ligand. An antigen can usually also cause an animal to produce an antibody that can bind to the epitope of that antigen. An antigen can have one or more epitopes. The above specific reaction means that an antigen reacts highly selectively with its corresponding antibody and does not react with a number of other antibodies that can be induced by other antigens.

[0035] The term "epitope" refers to any part of a molecule that can be recognized and bound by a targeting ligand such as an antibody or an aptamer. Generally, an epitope includes surface groups of a chemically active molecule such as amino acids or sugar side chains, and has a specific three-dimensional structure and specific charge characteristics.

[0036] "Specifically binds" refers to a targeting ligand that binds to a target structure, and the targeting ligand binds to the target structure or its subunit, but does not bind to a biological molecule that is not the target structure, or the targeting ligand binds preferentially at least to the target structure. A targeting ligand (e.g., an aptamer or an antibody) that specifically binds to a target structure or its subunit may not cross-react with biological molecules outside the target structure family. A targeting ligand specific for tau pathology can be a targeting ligand that can bind to its specific protein with a specific affinity between about 10 -8 M and about 10 -11 M. In some embodiments, an antibody or antibody fragment is about 10 -7 M, 10 -8 M, 10-9 M, 10 -10 M or 10 -11 Greater than M, approximately 10 -8 M, 10 -11 M, 10 -9 M, and 10 -10 Between M, and approximately 10 -10 M to 10 -11 Binds to an antigen selected by specific affinity between M. In some embodiments, the specific activity is measured as specific activity using a competitive binding assay as described in Ausubel FM, (1994). Current Protocol in Molecular Biology. Chichester: John Wiley and Sons (hereinafter "Ausubel") (the contents of which are incorporated herein by reference).

[0037] The term "polynucleotide" refers to nucleic acid sequences including DNA, RNA, microRNA, and can refer to double-stranded or single-stranded markers. Polynucleotides can also refer to synthetic variants with alternative sugars such as locked nucleic acids.

[0038] Imaging of tau pathology Imaging hyperphosphorylated tau is a new approach for identifying tau pathology. Previous attempts to image tau pathology have targeted the aggregated protein itself. Although hyperphosphorylation of tau is recognized as a key to forming paired helical filaments and ultimately tangles of tau, markers of hyperphosphorylation as a surrogate or precursor of tau pathology have not been investigated. The inventors have identified hyperphosphorylated neuronal cells and their anatomical distribution in the brain, which serve as novel, highly sensitive, and specific markers for future tau pathology.

[0039] The proposed imaging agent does not require cell membrane permeability because it targets the cell surface marker of tau hyperphosphorylation. Tau is an intracellular protein, and tau tangles mainly exist intracellularly, but there is an exception that after neuron death, tau tangles remain as "ghost tangles". Therefore, imaging markers indicating tau pathology have inevitably had to penetrate the neuron cell membrane and then bind to the target. Of course, the only exception is to bind to ghost tangles. Thus, all tau imaging agents have been restricted by membrane permeability. Binding to ghost tangles is only a sign of neuron death, which is the progression state of the disease. The compositions and methods described in the claims eliminate the need to penetrate the cell membrane and open the door to nanoparticle readouts that have high signals but are difficult to encapsulate in cells.

[0040] Identifying such cell surface markers can shed new light on the biology of tau fibrillation and tangle formation. The inventors screened thioaptamers in a "black box" mode without knowing what the binding target was. As a result, it was found that thioaptamers that specifically bind to hyperphosphorylated cells bind to KRT6A, KRT6B, HSP, and VIM.

[0041] Tau has numerous phosphorylation sites. For example, the longest isoform, tau441, has 80 serine / threonine sites and 5 tyrosine sites that can be phosphorylated. Neurofibrillary tangles have been shown to contain more than 40 phosphorylated tau. Phosphorylation of tau is mediated by several kinases such as GSK3β, CDK-5, CaMKII, PKA, MARK p110, etc. Phosphorylation sites of tau include S199-202 / T205, T231, T212 / S214, S396, etc., and are marked by AT8, AT180, AT100, PHF-1 antibodies. Phosphorylation is a continuous process, and each time phosphorylation occurs at a specific site, important binding pockets are exposed and the molecule is thought to be prepared for the next event. The S396 / PHF-1 site is generally thought to be phosphorylated in the later stage of the process and is mainly associated with a pair of helical filaments and tangles. However, recent observations suggest that under certain conditions, the S396 / PHF-1 site may be phosphorylated earlier than the S199-202 / T205 (AT8 staining) site.

[0042] Dephosphorylation of tau is mediated by protein phosphatases, among which PP2A accounts for more than 70% of the function. In the brains of AD patients, the activity of PP2A has been shown to be less than 50% of normal, suggesting that this imbalance between kinase activity and phosphatase activity is greatly involved in the cascade of hyperphosphorylation of tau and the formation of neurofibrillary tangles. See Figure 2. Therefore, PP2A was inhibited in neuron surrogates, and a thioaptamer conjugated to payload nanoparticles was used to identify this surface marker in the hyperphosphorylated state.

[0043] Composition for identifying tau pathology In one aspect, a composition for identifying tau pathology is provided, which composition includes a targeting ligand that specifically binds to the cell surface marker of tau pathology, and this targeting ligand is conjugated to liposomes containing an imaging agent.

[0044] In some embodiments, the cell surface marker of tau pathology is the cell surface marker of hyperphosphorylated tau. Tau pathology refers to abnormal tau proteins that cause tauopathy. Tau pathology is caused by the hyperphosphorylation of tau protein. Normal tau contains 2-3 moles of phosphate per mole of protein, while hyperphosphorylated tau protein contains much more phosphate than that. Hyperphosphorylated tau causes the formation of neurofibrillary tangles. Tau protein exists intracellularly and is difficult to detect directly. However, the present inventors have identified cell surface markers (i.e., epitopes) associated with underlying tau pathology. In some embodiments, these cell surface markers are epitopes identified using the Cell-SELEX method that uses neurons or cell models of neurons showing tau pathology as targets of target ligands (e.g., aptamers). In some embodiments, the cell surface marker of tau pathology includes proteins selected from KRT6A, KRT6B, HSP, and VIM.

[0045] Targeting ligand As used herein, the term "targeting ligand" includes any molecule that can be linked to a liposome for the purpose of targeting a specific target, particularly for the purpose of recognizing tau pathology. Examples of suitable targeting ligands include, but are not limited to, antibodies, antibody fragments, aptamers, and stabilized aptamers. In some embodiments, the targeting ligand can be an aptamer or a stabilized aptamer that specifically binds to the cell surface marker of tau pathology.

[0046] The targeting ligand of the present invention can specifically bind to cells showing tau pathology. Specific binding means a binding that discriminates between a selected target and other potential targets and binds to the selected target with substantial affinity. Substantial affinity refers to a targeting ligand having a binding dissociation constant of at least about 10 -8 mol / m 3 although in other embodiments, the targeting ligand is at least about 10 -9mol / m 3 and about 10 -10 mol / m 3 and about 10 -11 mol / m 3 or at least about 10 -12 mol / m 3 and can have a binding dissociation constant of.

[0047] In some embodiments, the targeting ligand is an aptamer. An aptamer is a nucleic acid that binds to a specific target molecule or cellular structure with high specificity and affinity through interactions other than Watson-Crick base pairing. Suitable aptamers may be single-stranded RNA, DNA, modified nucleic acids, or mixtures thereof. Also, the aptamer may be in a linear or circular form. In some embodiments, the aptamer is single-stranded DNA, and in other embodiments, it is single-stranded RNA.

[0048] The function of an aptamer is independent of the nucleic acid sequence itself and rather is based on the secondary and tertiary structures formed by the polynucleotide, and thus aptamers are preferably considered non-coding sequences. The binding between the nucleic acid ligand and the target molecule is determined by the three-dimensional structure of the aptamer rather than by nucleic acid base pairs. In solution, the nucleotide strands form intramolecular interactions that fold the molecule into a complex three-dimensional shape. This shape allows the nucleic acid ligand to bind tightly to the surface of the target molecule. In addition to exhibiting significant specificity, nucleic acid ligands generally bind to their targets with extremely high affinity. For example, the majority of anti-protein nucleic acid ligands have equilibrium dissociation constants in the femtomolar to low nanomolar range.

[0049] The length of the aptamer suitable for use as a targeting ligand is not particularly limited, and includes aptamers having about 10 to about 200 nucleotides, about 100 nucleotides or less, about 50 nucleotides or less, about 40 nucleotides or less, or about 35 nucleotides or less. In some embodiments, the aptamer has a size of about 15 to about 40 nucleotides. Further, in almost all known cases, various structural motifs involved in non-Watson-Crick type interactions involved in aptamer binding, such as hairpin loops, symmetric and asymmetric bulges, and pseudoknots, can be formed with nucleic acid sequences of 30 nucleotides or less.

[0050] In some embodiments, the aptamer is a stabilized aptamer that includes chemical modifications to enhance its stability. Modifications include, but are not limited to, those that provide additional charge, polarity, hydrophobicity, hydrogen bonding, electrostatic interactions, and flexibility to the nucleic acid ligand base or the entire nucleic acid ligand. Such modifications include sugar modifications at the 2-position, pyrimidine modifications at the 5-position, purine modifications at the 8-position, modifications at exocyclic amines, substitution of 4-thiouridine, substitution of 5-bromo or 5-iodouracil, backbone modifications, phosphorothioate or alkyl phosphate modifications, methylation, combinations of unusual base pairs such as isocytidine and isoguanidine which are isobases, etc., but are not limited to these. Modifications can also include 3' and 5' modifications such as capping. In certain embodiments, the nucleic acid ligand includes an RNA molecule modified with 2'-fluoro (2'-F) at the sugar moiety of pyrimidine residues.

[0051] Suitable stabilizing aptamers can further include nucleotide analogs such as, for example, xanthine or hypoxanthine, 5-bromouracil, 2-aminopurine, deoxyinosine, or methylated cytosines such as 5-methylcytosine, N4-methyldeoxycytosine. Also included are methylated nucleic acids, such as 2'-O-methRNA, peptide nucleic acids, locked nucleic acids, modified peptide nucleic acids, etc., bases of polynucleotide mimics, and any other structural moiety that acts substantially like a nucleotide or base, such as showing base complementarity to one or more bases occurring in DNA or RNA.

[0052] In some embodiments, the stabilizing aptamer includes a thioaptamer. A thioaptamer is an aptamer in which one or both of the non-bridging oxygen atoms are replaced with sulfur. The substitution from oxygen to sulfur not only increases the stability of the aptamer but also, in some cases, its binding affinity.

[0053] Typically, a targeting ligand (e.g., an aptamer) is conjugated to a liposome containing an imaging agent. However, a further aspect of the invention is directed to the aptamer itself. In some embodiments, the aptamer comprises a stabilized aptamer. In further embodiments, the stabilized aptamer is a thioaptamer. In some embodiments, the aptamer or stabilized aptamer specifically binds to tau pathology. Examples of suitable aptamers include those comprising a DNA nucleotide sequence selected from, in some examples consisting of, the group consisting of: Tau_1 (SEQ ID NO: 5), Tau_3 (SEQ ID NO: 6), Tau_9 (SEQ ID NO: 7), Tau_11 (SEQ ID NO: 8), Tau_10 (SEQ ID NO: 9), Tau_13 (SEQ ID NO: 10), Tau_8 (SEQ ID NO: 11), Tau_4 (SEQ ID NO: 12), Tau_17 (SEQ ID NO: 13), Tau_5 (SEQ ID NO: 14), Tau_21 (SEQ ID NO: 15), Tau_25 (SEQ ID NO: 16), Tau_7 (SEQ ID NO: 17), Tau_31 (SEQ ID NO: 18), Tau_42 (SEQ ID NO: 19), Tau_14 (SEQ ID NO: 20), Tau_19 (SEQ ID NO: 21), Tau_15 (SEQ ID NO: 22), Tau_56 (SEQ ID NO: 23), Tau_34 (SEQ ID NO: 24), Tau_23 (SEQ ID NO: 25), Tau_99 (SEQ ID NO: 26), and Tau_102 (SEQ ID NO: 27).

[0054] In some embodiments, the aptamer is positioned between two primer nucleotide sequences that facilitate amplification of the aptamer sequence, for example by polymerase chain reaction (PCR). For example, in some embodiments, the DNA nucleotide sequence of the aptamer is positioned between the sequences GATATGTCTAGAGCCTCAGATCA (SEQ ID NO: 1) and CGGAGTTATGTTAGCAGTAGC (SEQ ID NO: 2). In other embodiments, the DNA nucleotide sequence of the aptamer is positioned between the sequences CGC TCG ATA GAT CGA GCT TCG (SEQ ID NO: 3) and GTC GAT CAC GCT CTA GAG CAC (SEQ ID NO: 4).

[0055] Selection of Aptamer In some embodiments, aptamers or stabilized aptamers that specifically bind to cell surface markers of tau pathology can be identified using the SELEX method. Suitable nucleic acid ligands can be identified using any method known in the art, such as SELEX described by Gold et al. (U.S. Patent No. 5,270,163), the content of which is incorporated herein by reference in its entirety. Other methods for identifying nucleic acid ligands are shown by Gilman et al. (U.S. Patent Application No. 2011 / 0104667), the content of which is incorporated herein by reference in its entirety. The identification of suitable aptamers is shown in the examples herein.

[0056] SELEX is a strategy developed to identify nucleic acids that can bind to target molecules with high affinity and specificity by their three-dimensional conformations. This technique involves identifying rare nucleic acid molecules with high affinity for the target molecule from a pool of random nucleic acids. This process is completed iteratively by repeating subsequent selection and amplification. This method has been found to be extremely useful for the isolation of tight-binding oligonucleotide ligands (aptamers) for many target molecules, such as nucleic acid-binding proteins, non-nucleic acid-binding proteins, and certain small molecules. Since SELEX can repeat the selection cycle using PCR, it is an efficient screening method.

[0057] The SELEX process generally involves defining a target molecule, such as a protein, small molecule, supramolecular structure, etc. A library of random oligonucleotides (~1x10 15 oligonucleotides) is created. This pool of random DNA generally has primer binding sites at the ends of each oligonucleotide, providing an efficient way to search for oligonucleotides that bind to the target molecule and amplify them by PCR. The target molecule is exposed to the oligonucleotide "library", and a small number of oligonucleotides in the library bind to the target, thereby defining the target-specific aptamer. Unbound oligonucleotides are separated from the bound oligonucleotides.

[0058] The method for identifying an aptamer may include separating, in a single step, a nucleic acid that binds to a target molecule with the greatest affinity from a nucleic acid that binds to the target molecule with a lower affinity and a nucleic acid that does not bind to the target molecule, thereby identifying the nucleic acid ligand of the target molecule. In the selective separation protocol, conditions are generated such that a nucleic acid that binds to the target molecule with a lower affinity and a nucleic acid that does not bind to the target molecule cannot form a complex with the target molecule or can form a complex with the target molecule only for a short time. In contrast, the conditions of the separation protocol allow a nucleic acid that binds to the target molecule with the greatest affinity to form a complex with the target molecule and / or bind to the target molecule for the longest time, thereby separating, in a single step, the nucleic acid having the greatest affinity for the target molecule, i.e., the nucleic acid ligand, from the remaining nucleic acids in the candidate mixture.

[0059] Separation can be achieved by any of a number of methods that can selectively separate, in a single step, a nucleic acid that binds to a target molecule with the greatest affinity from a nucleic acid that binds to the target molecule with a lower affinity and a nucleic acid that does not bind to the target molecule. Suitable separation procedures include HPLC gradient elution and gel electrophoresis.

[0060] After incubation, the mixture is washed with a buffer to remove unbound target molecules. The beads having the bound target molecules are then incubated with the candidate mixture of nucleic acids. The beads having the bound target molecules can be loaded onto an HPLC column before incubation with the candidate mixture. Loading the beads having the bound target molecules onto an HPLC column before incubation with the candidate mixture causes the incubation of the candidate mixture with the target molecule to occur on the column.

[0061] After incubating the candidate mixture with the target molecule bound to beads for a time sufficient for the formation of bead / target molecule / nucleic acid complexes, an HPLC elution gradient is applied to the column to obtain the nucleic acid ligand of the target molecule. During the elution process, the effluent is enriched in nucleic acid ligands with higher affinity for the target molecule, and ultimately the final fraction will be the fraction containing the nucleic acid ligand with the highest affinity for the target molecule.

[0062] In some embodiments, aptamers or stabilized aptamers that specifically bind to cell surface markers of tau pathology can be identified using the Cell-SELEX method. Cell-SELEX selects aptamers by using complex whole cells as targets. Next, a counter-selection strategy is used to isolate aptamer sequences that interact only with the target cells and not with the control cells. This process allows for the selection of a group of cell-specific aptamers in a relatively short period of time, even when it is not known which target molecules are present on the cell surface or which membrane molecules play an important role in the detected pathological condition.

[0063] In some embodiments, aptamers or stabilized aptamers that specifically bind to cell surface markers of tau pathology can be identified using the conjugate-SELEX method. Conjugate-SELEX is a modified version of the basic SELEX procedure that evaluates the affinity of the entire conjugate of the aptamer and liposome rather than evaluating the aptamer alone.

[0064] Sequencing After immobilization, the sequence of the aptamer may be determined. The sequence determination may be by any method known in the art. DNA sequencing techniques include classical dideoxy sequencing reactions (Sanger method) using labeled terminators or primers and gel separation on slabs or capillaries, sequencing by synthesis using reversibly terminated labeled nucleotides, pyrosequencing, 454 sequencing, allele-specific hybridization to a library of labeled oligonucleotide probes, allele-specific hybridization to a library of labeled clones followed by synthesis by ligation, real-time monitoring of the incorporation of labeled nucleotides during the polymerization step, polony sequencing, SOLiD sequencing, etc. The sequence determination may be by any method known in the art. See, for example, Sanger et al. (Proc Natl Acad Sci USA, 74(12):5463-67, 1977), Maxam et al. (Proc Natl Acad Sci, 74:560-564, 1977), Drmanac et al. (Nature Biotech., 16:54-58, 1998). These documents describe examples of conventional ensemble sequencing techniques. Also see Lapidus et al. (U.S. Patent No. 7,169,560), Quake et al. (U.S. Patent No. 6,818,395), Harris et al. (U.S. Patent No. 7,282,337), Quake et al. (U.S. Patent Application No. 2002 / 0164629), and Braslaysky et al. (PNAS (USA), 100:3960-3964, 2003). These documents describe examples of single-molecule sequencing by synthesis techniques. The entire content of each of these documents is hereby incorporated by reference in its entirety into this specification.

[0065] The inventors of the present invention have identified aptamers that specifically bind to tau pathology. Examples of these aptamers are listed in Table 1. Accordingly, in some embodiments, the aptamer or stabilized aptamer comprises a DNA nucleotide sequence selected from the following, which includes those selected from the group consisting of: Tau_1 (SEQ ID NO: 5), Tau_3 (SEQ ID NO: 6), Tau_9 (SEQ ID NO: 7), Tau_11 (SEQ ID NO: 8), Tau_10 (SEQ ID NO: 9), Tau_13 (SEQ ID NO: 10), Tau_8 (SEQ ID NO: 11), Tau_4 (SEQ ID NO: 12), Tau_17 (SEQ ID NO: 13), Tau_5 (SEQ ID NO: 14), Tau_21 (SEQ ID NO: 15), Tau_25 (SEQ ID NO: 16), Tau_7 (SEQ ID NO: 17), Tau_31 (SEQ ID NO: 18), Tau_42 (SEQ ID NO: 19), Tau_14 (SEQ ID NO: 20), Tau_19 (SEQ ID NO: 21), Tau_15 (SEQ ID NO: 22), Tau_56 (SEQ ID NO: 23), Tau_34 (SEQ ID NO: 24), Tau_23 (SEQ ID NO: 25), Tau_99 (SEQ ID NO: 26), and Tau_102 (SEQ ID NO: 27). In further embodiments, the aptamer or stabilized aptamer comprises the DNA nucleotide sequence Tau_1 (SEQ ID NO: 5), Tau_3 (SEQ ID NO: 6), or both.

Table 1-1

Table 1-2

[0066] In some embodiments, the targeting ligand is an antibody that specifically binds to tau pathology. As used herein, the term "antibody" means a type of protein that is produced by B cells activated after stimulation by an antigen, can specifically bind to the antigen, and thereby can promote an immune response in a biological system. A complete antibody typically includes four subunits, usually two heavy chains and two light chains. The term antibody includes natural and synthetic antibodies, including but not limited to monoclonal antibodies, polyclonal antibodies, or fragments thereof. Suitable antibodies include IgA, IgD, IgG1, IgG2, IgG3, IgM, etc. Suitable fragments include Fab, Fv, Fab’, F(ab’)2, etc. A monoclonal antibody is an antibody that specifically binds to a single specific spatial and polar organization of an epitope and is thereby defined as being complementary. In some forms, monoclonal antibodies can also have the same structure. A polyclonal antibody refers to a mixture of different monoclonal antibodies. In some forms, a polyclonal antibody can be a mixture of monoclonal antibodies in which at least two of the monoclonal antibodies bind to different antigenic epitopes. The different antigenic epitopes can be on the same target, different targets, or combinations thereof. Antibodies can be prepared by techniques well known in the art, such as methods of immunizing a host and collecting serum (polyclonal), or methods of preparing continuous hybridoma cell lines and collecting secreted proteins (monoclonal).

[0067] Targeting ligand conjugate In some embodiments, a targeting ligand (e.g., an aptamer) is conjugated to a liposome or other vehicle to deliver an imaging agent or a detection agent to a target. For example, an imaging agent or a detection agent can be encapsulated within the liposome. Using such techniques, the tau pathology-specific aptamer of the present invention conjugated to a liposomal vehicle can provide targeted delivery of an imaging agent or a detection agent to cells expressing tau pathology. In some embodiments, a single targeting ligand is conjugated to the liposome. In other embodiments, multiple targeting ligands are conjugated to the liposome (e.g., Tau_1 and Tau-3).

[0068] As used herein, "liposome" refers to a vesicular structure composed of lipids. Lipids typically have a tail group containing a long hydrocarbon chain and a hydrophilic head group. The lipids are arranged to form a lipid bilayer (i.e., a membrane) having an aqueous environment suitable for containing the agent to be delivered (e.g., an imaging agent) inside. Such liposomes present an outer surface that includes a suitable targeting ligand that specifically binds to a cell surface marker of tau pathology. A suitable liposomal platform can be, for example, the "ADx" platform of Alzeca Biosciences, which includes hydrogenated soy L-α-phosphatidylcholine (HSPC), cholesterol (Chol), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-(methoxy(polyethylene glycol)-2000) (DSPE-mPEG2000) and Gd(III)-DSPE-DOTA (wherein Gd(III)-DOTA, a macrocyclic gadolinium imaging moiety, is conjugated to the phospholipid 1,2-distearoyl-sn-glycero-3-phosphorylethanolamine (DSPE)), and a moiety used to conjugate the targeting ligand, DSPE-PEG-3400 (1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[maleimide(polyethylene glycol)-3400]).

[0069] In some embodiments, the membrane of the liposome may be composed of at least three types of phospholipids. The membrane may include an unmodified first phospholipid. Suitable first phospholipids include those disclosed in U.S. Patent Nos. 7,785,568 and 10,537,649, each of which is incorporated herein by reference in its entirety. In one embodiment, the first phospholipid is HSPC. The membrane may include a second phospholipid that may be derivatized with a first polymer. Suitable polymer-derivatized second phospholipids include those disclosed in U.S. Patent Nos. 7,785,568 and 10,537,649. In one embodiment, the second phospholipid derivatized with the first polymer is DSPE-mPEG2000. The membrane may include a third phospholipid derivatized with a second polymer, and the second polymer is ultimately bound to a targeting ligand. Suitable polymer-derivatized third phospholipids include those disclosed in U.S. Patent Nos. 7,785,568 and 10,537,649. In one embodiment, the third phospholipid derivatized with the second polymer is DSPE-PEG-3400.

[0070] In some embodiments, the membrane may include a sterically bulky excipient that can stabilize the liposome. Suitable excipients include those disclosed in U.S. Patent Nos. 7,785,568 and 10,537,649. In one embodiment, the sterically bulky excipient that can stabilize the liposome is cholesterol.

[0071] In some embodiments, the phospholipid moiety in the phospholipid-polymer-targeting ligand conjugate can be represented by the following structural formula.

Chemical formula

[0072] In some embodiments, the polymer moiety in the phospholipid-polymer-targeting ligand conjugate is a polyol. The structural units forming the polymer containing the polyol include monomeric polyols such as pentaerythritol, ethylene glycol, and glycerin. Examples of polymers containing polyol include polyesters, polyethers, and polysaccharides. Examples of suitable polyethers include diols of the general formula HO-(CH2CH2O) p -H where p≧1, such as diols including polyethylene glycol, polypropylene glycol, poly(tetramethylene ether) glycol, etc., but not limited thereto. Suitable polysaccharides include cyclodextrin, starch, glycogen, cellulose, chitin, and β-glucan, but not limited thereto. Examples of suitable polyesters include polycarbonate, polybutyrate, polyethylene terephthalate, etc., but not limited thereto, and all are terminated with hydroxyl end groups. Exemplary polymers containing polyol include polymers having a molecular weight of about 500,000 Da or less, such as about 300 to about 100,000 Da.

[0073] In some embodiments, the polymer portion of the phospholipid-polymer-targeting ligand conjugate comprises a hydrophilic poly(alkylene oxide) polymer. The hydrophilic poly(alkylene oxide) contains from about 10 to about 100 repeating units and may have a molecular weight in the range of, for example, about 500 to 10,000 Da. The hydrophilic poly(alkylene oxide) may include, for example, poly(ethylene oxide), poly(propylene oxide), and the like. The polymer portion in the phospholipid-polymer-targeting ligand conjugate may be linked to the phospholipid portion via an amide group or a carbamate group. Also, the polymer portion in the phospholipid-polymer-targeting ligand conjugate may be linked via amide, carbamate, poly(alkylene oxide), triazole, combinations thereof, and the like. For example, the polymer portion in the phospholipid-polymer-targeting ligand conjugate can be represented by any of the following structural formulas.

Chemical formula

[0074] In some embodiments, the phospholipid-polymer portion in the phospholipid-polymer-targeting ligand conjugate can be represented by any of the following structural formulas.

Chemical formula

[0075] The targeting ligand (e.g., an aptamer) may be connected to one or more polymer (e.g., PEG) moieties of the phospholipid-polymer-targeting ligand conjugate with or without using one or more linkers. The PEG moiety may be any type of PEG moiety (linear, branched, multi-branched, star-shaped, comb-shaped, or dendrimer) and may have any molecular weight. Also, the same or different linkers may be used or no linker may be used to connect the same or different PEG moieties to the aptamer. Commonly known linkers include, but are not limited to, amine, thiol, azide, etc., and may contain a phosphate group. For example, in some embodiments, the targeting ligand is linked to polyethylene glycol that is bound to a phospholipid that associates with the liposome.

[0076] In some embodiments, the liposome comprises a membrane, and the membrane comprises a first phospholipid selected from HSPC, DPPC, DSPE, DSPC, and DPPE; cholesterol; DPPC, DSPE, DSPC, and / or DPPE derivatized with PEG; a targeting ligand that specifically binds to a cell surface marker of tau pathology; and an imaging agent encapsulated by or bound to the membrane. In further embodiments, the targeting ligand is a thioaptamer and the imaging agent is an MRI contrast agent.

[0077] In some aspects, the present invention provides a targeting composition. The targeting composition comprises a phospholipid bound to a polymer bound to a targeting ligand that specifically binds to a cell surface marker of tau pathology. The phospholipid can be any of the phospholipids described herein. In some embodiments, the phospholipid comprises one or more of DPPC, DSPE, DSPC, and DPPE. Similarly, the polymer can be any of the polymers described herein (e.g., a polyol). In some embodiments, the polymer is polyethylene glycol.

[0078] Imaging agent or detection agent The composition for detecting tau pathology described in this specification may include an imaging agent or a detection agent. The imaging agent or detection agent is generally bound to the liposomal portion of the composition. The imaging agent or detection agent can be retained within the liposome or can be bound to the liposome. In one embodiment, the imaging agent or detection agent is linked to a polymer linked to a phospholipid that binds to the membrane forming the liposome. In one embodiment, the imaging agent or detection agent is linked to a polymer linked to a phospholipid that binds to the membrane forming the liposome and contains Gd(III)-DSPE-DOTA.

[0079] In some embodiments, the composition for detecting tau pathology includes a detection agent. Examples of detection agents include GFP, biotin, cholesterol, dyes such as fluorescent dyes, electrochemically active reporter molecules, and radionuclides suitable for, for example, PET (positron emission tomography) detection, such as 18 F, 11 C, 13 N, 15 O, 82 Rb or 68 compositions containing radioactive residues such as Ga.

[0080] In some embodiments, the composition for detecting tau pathology includes an imaging agent. The imaging agent is different from the detection agent in that it is suitable for use in an imaging method that can not only indicate the presence of tau pathology but also create and display an image of the region of tissue showing tau pathology. Examples of imaging agents include near-infrared imaging agents, positron emission tomography-imaging agents, single-photon emission tomography agents, fluorescent compositions, radioisotopes, MRI contrast agents, and the like.

[0081] In some embodiments, the imaging agent is an MRI contrast agent. Detecting diseases using MRI is often difficult because the diseased area has a similar signal intensity compared to the surrounding healthy tissue. In the case of MRI, the imaging agent is sometimes also called a contrast agent. The MRI contrast agent may be a non-radioactive MRI contrast agent and may be at least one of encapsulated by a membrane or bound to a membrane. For example, the non-radioactive MRI contrast agent may be encapsulated by a membrane and bound to the membrane, for example, to provide a dual contrast agent liposome. The liposome composition may have a relaxation rate (mM -1 s -1 ) of at least about one or more per particle of about 100,000, 125,000, 150,000, 165,000, 180,000, 190,000, and 200,000. Detecting the liposome formulation can include, for example, using MRI in a magnetic field range between about 1T and about 3.5T, or between about 1.5 and about 3T. The non-radioactive MRI contrast agent may contain gadolinium. Suitable non-radioactive MRI contrast agents may include Gd(III)-DSPE-DOTA and (diethylenetriaminepentaacetic acid)-bis(stearylamide), gadolinium salt (Gd-DTPA-BSA). Also, gadolinium paramagnetic chelates such as GdDTPA, GdDOTA, GdHPDO3A, GdDTPA-BMA, GdDTPA-BSA are well-known suitable MRI contrast agents. See U.S. Patent No. 5,676,928 issued to Klaveness et al. The content thereof is incorporated herein by reference in its entirety.

[0082] Method for imaging or detecting tau pathology In another aspect, the present invention provides a method for imaging tau pathology in a subject. The method includes administering to the subject a detectable effective amount of a targeting ligand-liposome conjugate comprising a targeting ligand that specifically binds to a cell surface marker of tau pathology, wherein the targeting ligand is bound to a liposome comprising an imaging agent, and imaging at least a portion of the subject to determine whether that portion of the subject exhibits tau pathology.

[0083] The term "subject" refers to an animal such as a vertebrate or invertebrate. In some embodiments, the subject is a mammal, including primates (including apes and humans), equids (e.g., horses), canids (e.g., dogs), felids, various domesticated livestock (e.g., artiodactyls such as suids, pigs, goats, sheep, etc.), as well as domesticated pets and animals kept in zoos, but is not limited thereto. In some embodiments, the subject is a human subject. In some embodiments, the subject is a subject at increased risk of developing AD. Risk factors for Alzheimer's disease include genetic predisposition, smoking, diabetes, a history of head trauma, depression, hypertension, etc. See Burns A, Iliffe S., BMJ., 338:b158(2009).

[0084] The targeting ligand-liposome conjugate can comprise any of the features described herein. For example, in some embodiments, the targeting ligand is an aptamer or a stabilized aptamer, and in further embodiments, the targeting ligand is a thioaptamer. In even further embodiments, the aptamer or stabilized aptamer used in the method is selected from Tau_1 (SEQ ID NO: 5), Tau_3 (SEQ ID NO: 6), Tau_9 (SEQ ID NO: 7), Tau_11 (SEQ ID NO: 8), Tau_10 (SEQ ID NO: 9), Tau_13 (SEQ ID NO: 10), Tau_8 (SEQ ID NO: 11), Tau_4 (SEQ ID NO: 12), Tau_17 (SEQ ID NO: 13), Tau_5 (SEQ ID NO: 14), Tau_21 (SEQ ID NO: 15), Tau_25 (SEQ ID NO: 16), Tau_7 (SEQ ID NO: 17), Tau_31 (SEQ ID NO: 18), Tau_42 (SEQ ID NO: 19), Tau_14 (SEQ ID NO: 20), Tau_19 (SEQ ID NO: 21), Tau_15 (SEQ ID NO: 22), Tau_56 (SEQ ID NO: 23), Tau_34 (SEQ ID NO: 24), Tau_23 (SEQ ID NO: 25), Tau_99 (SEQ ID NO: 26), and Tau_102 (SEQ ID NO: 27), and includes those selected from the group consisting of the foregoing, and comprises a DNA nucleotide sequence.

[0085] In some embodiments, the present invention can provide a method for generating an image of a tissue region of a subject by administering to the subject a detectable effective amount of a composition for detecting tau pathology and generating an image of a part of the subject (i.e., a tissue region) in which the composition containing the imaging agent is distributed. To generate an image of a tissue region, it is necessary for a detectable effective amount of the imaging agent to reach the tissue region of the subject, but it is not necessary for the imaging agent to localize only in this region. However, in some embodiments, the composition containing the imaging agent is locally targeted or administered so as to mainly exist in the tissue region of interest. Examples of images include two-dimensional cross-sectional views and three-dimensional images. In some embodiments, a computer is used to analyze the data generated by the imaging agent to generate a visual image. The tissue region or part of the subject can be an organ of the subject such as the brain, heart, lung, or blood vessel. In other embodiments, a part of the subject can be a tissue region known to contain nerve cells such as the brain. Examples of imaging methods include optical imaging, fluorescence imaging, computed tomography, positron emission tomography, single photon emission computed tomography, and MRI. Any other suitable type of imaging method known to those skilled in the art is contemplated.

[0086] In some embodiments, the imaging agent is an MRI contrast agent, and the level of binding is determined using MRI. MRI is a medical application of nuclear magnetic resonance that uses a strong magnetic field, magnetic field gradients, and radio waves to form images of the anatomical and physiological processes of the body and generate images of a part of the subject. MRI is commonly used in neuroimaging, cardiovascular imaging, musculoskeletal imaging, liver imaging, gastrointestinal imaging, etc. In imaging anatomical structures and blood flow by MRI, various properties of tissues and blood provide natural contrast, so a contrast agent is not required. However, when taking more special images, an exogenous contrast agent may be administered. For a review of neuroimaging techniques, see Mehrabian et al. (Front Oncol., 9:440 (2019)).

[0087] In another aspect of the present invention, a method for detecting tau pathology can be provided. The method comprises contacting a biological sample with an effective amount of a targeting ligand-liposome conjugate comprising a targeting ligand that specifically binds to a cell surface marker of tau pathology, wherein the targeting ligand is bound to a liposome comprising a detectable label, washing the biological sample to remove unbound targeting ligand-liposome conjugate, and detecting tau pathology in the biological sample by determining the amount of detectable label remaining in the biological sample.

[0088] The targeting ligand-liposome conjugate can comprise any of the features described herein. For example, in some embodiments, the targeting ligand is an aptamer or a stabilized aptamer, while in further embodiments, the targeting ligand is a thioaptamer. In yet further embodiments, the aptamer or stabilized aptamer used in the method is selected from Tau_1 (SEQ ID NO: 5), Tau_3 (SEQ ID NO: 6), Tau_9 (SEQ ID NO: 7), Tau_11 (SEQ ID NO: 8), Tau_10 (SEQ ID NO: 9), Tau_13 (SEQ ID NO: 10), Tau_8 (SEQ ID NO: 11), Tau_4 (SEQ ID NO: 12), Tau_17 (SEQ ID NO: 13), Tau_5 (SEQ ID NO: 14), Tau_21 (SEQ ID NO: 15), Tau_25 (SEQ ID NO: 16), Tau_7 (SEQ ID NO: 17), Tau_31 (SEQ ID NO: 18), Tau_42 (SEQ ID NO: 19), Tau_14 (SEQ ID NO: 20), Tau_19 (SEQ ID NO: 21), Tau_15 (SEQ ID NO: 22), Tau_56 (SEQ ID NO: 23), Tau_34 (SEQ ID NO: 24), Tau_23 (SEQ ID NO: 25), Tau_99 (SEQ ID NO: 26), and Tau_102 (SEQ ID NO: 27), and includes those selected from the group consisting of the foregoing, and comprises a DNA nucleotide sequence.

[0089] Means for detecting a label are well known to those skilled in the art. For example, when the label is a radioactive label, scintillation counters and photographic films such as autoradiography can be mentioned as detection means. Also, when the label is a fluorescent label, it can be detected by exciting the phosphor with light of an appropriate wavelength and detecting the resulting fluorescence. Fluorescence can be visually detected using a photographic film, an electronic detector such as a charge-coupled device (CCD) or a photomultiplier tube. Similarly, an enzyme label can be detected by providing an appropriate substrate for the enzyme and detecting the resulting reaction product. By comparing the level of the detected label with a control level, it can be determined whether the biological sample shows an increase in the level of the cell surface marker of tau pathology.

[0090] Biological samples can be from mammalian body fluids, sera such as blood (including whole blood, as well as its plasma and serum), CSF (cerebrospinal fluid), urine, sweat, saliva, tears, lung secretions, breast aspirate, prostatic fluid, semen, feces, cervical scrape, cysts, amniotic fluid, intraocular fluid, mucus, moisture in exhaled breath, animal tissues, cell lysates, tumor tissues, hair, skin, buccal swabs, nails, bone marrow, cartilage, prions, bone meal, earwax, etc., and also from external or stored sources such as tumor samples (i.e., fresh, frozen, or paraffin-embedded). Samples such as body fluids and sera obtained during the course of a clinical trial are also suitable. In some embodiments, the biological sample includes a sample containing nerve cells such as CSF or a nerve (e.g., brain) tissue sample.

[0091] Biological samples can be fresh or stored. Samples can be stored for various lengths of time, such as 1 hour, 1 day, 1 week, 1 month, or over 1 month. Biological samples can be those obtained explicitly for use in the methods of the present invention or samples obtained for another purpose that can be subsampled for the assays of the present invention. In some embodiments, it is useful to pretreat the biological sample by filtration, centrifugation, or other methods to remove impurities or other undesirable substances that may interfere with the analysis of the biological sample.

[0092] In some embodiments, the method includes obtaining a biological sample from a subject. The method for obtaining a biological sample varies depending on the type of biological sample to be obtained, and such methods are well known to those skilled in the art. For example, a sample of brain tissue can be obtained using stereotactic brain biopsy, while a sample of cerebrospinal fluid can be obtained via lumbar puncture.

[0093] Alzheimer's disease In some embodiments, the imaging shows a level of tau pathology sufficient to diagnose that the subject has AD. In further embodiments, the method indicates that the subject has early-stage AD, an increased risk of developing AD, or both. A level of tau pathology sufficient to diagnose that the subject has AD or early AD can result from the presence of an increased level of a cell surface marker (e.g., an increased level of hyperphosphorylation) that reflects an increased level of tau phosphorylation within cells (e.g., neurons). Examples of cell surface markers that reflect an increased level of tau phosphorylation include KRT6A, KRT6B, HSP, VIM, and the like.

[0094] AD is a chronic neurodegenerative disease that usually starts slowly and gradually worsens over time, causing 60 - 70% of dementia cases. AD is characterized by the loss of neurons and synapses in the cerebral cortex and certain subcortical regions. This loss causes significant atrophy of the affected areas, such as degeneration of the temporal lobe, parietal lobe, and parts of the frontal lobe and cingulate gyrus. AD is a protein misfolding disease (proteopathy) caused by the accumulation of abnormally folded amyloid-beta protein and tau protein plaques in the brain.

[0095] AD is mostly diagnosed at a moderate stage. Generally, the symptoms of AD are cognitive impairment or deficit, including dementia confirmed by medical and psychological examinations, problems in at least two fields of mental function, progressive loss of memory and other mental functions, etc. In particular, in that case, the symptoms start between the ages of 40 and 90, there are no other diseases explaining the dementia, and there are no other diseases mimicking dementia such as hypothyroidism, overmedication, drug-drug interactions, vitamin B12 deficiency, and depression. As the disease progresses, the symptoms include language problems, disorientation (including getting lost easily), mood swings, loss of motivation, inability to manage self-care, behavioral problems, etc. In some embodiments, the methods and compositions described herein provide detection of early-stage AD that may be present before one or more of these symptoms appear. Thus, in some embodiments, the method is used to diagnose a subject who does not exhibit other symptoms of AD.

[0096] In some embodiments, the method further includes providing prevention or treatment of AD to the subject. Prevention of AD includes lifestyle and dietary changes that reduce the risk of developing AD. For example, intellectual activities such as reading, playing board games, solving puzzles, playing musical instruments, learning a second language, and even regular social interaction lead to a reduced risk of developing AD. Similarly, healthy diets such as Japanese cuisine and Mediterranean cuisine are associated with reducing the risk of AD onset.

[0097] Also, several drugs have been discovered that can be used to treat cognitive function problems associated with AD. These include acetylcholinesterase inhibitors such as tacrine, rivastigmine, galantamine, donepezil, and the NMDA receptor antagonist memantine. Fepridine A is a promising therapeutic agent for AD, and atypical antipsychotics can be used to suppress aggression and psychosis in AD patients.

[0098] Pharmaceutical composition In some embodiments, the compositions described herein are delivered as pharmaceutical compositions. The pharmaceutical compositions comprising the compositions of the present invention are prepared according to standard techniques and further comprise a pharmaceutically acceptable carrier. Generally, normal saline is employed as the pharmaceutically acceptable carrier. Other suitable carriers include, for example, water, buffered water, isotonic solutions (e.g., dextrose), 0.4% saline, 0.3% glycine, etc., and glycoproteins for enhancing stability, such as albumin, lipoprotein, globulin, etc. These compositions may be sterilized by conventional well-known sterilization techniques. The resulting aqueous solutions may be packaged for use, or may be filtered aseptically and lyophilized, and the lyophilized formulations are combined with sterile aqueous solutions prior to administration. The present compositions may contain pharmaceutically acceptable auxiliary substances necessary to approximate physiological conditions, such as pH adjusters, buffers, tonicity adjusters, etc., and may contain, for example, sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, etc. Further, the liposome compositions of the present invention can be suspended in a suspension containing a lipid protectant that protects the lipid from free radical damage and lipid peroxidation damage during storage. Lipophilic free radical quenchers, such as α-tocopherol, and water-soluble iron-specific chelating agents, such as deferoxamine, etc. are preferred.

[0099] The concentration of the liposome composition of the present invention in a pharmaceutical formulation can vary widely, from less than about 0.05% to usually or at least about 2 - 5% up to 10 - 30% by weight, and will be selected mainly according to the specific administration method chosen, depending mainly on the liquid volume, viscosity, etc. For example, in order to reduce the fluid load associated with treatment, the concentration may be increased. The amount of the composition to be administered depends on the specific aptamer used, the condition of the disease being treated, and the judgment of the clinician. Generally, the amount of the composition to be administered is an amount sufficient to deliver a therapeutically effective dose of nucleic acid. The amount of the composition required to deliver a therapeutically effective amount can be determined by those skilled in the art. General dosage amounts are generally about 0.01 - about 50 mg of nucleic acid per kg of body weight, preferably about 0.1 - about 10 mg of nucleic acid / kg body weight, and most preferably about 2.0 - about 5.0 mg of nucleic acid / kg body weight. When administered to mice, the dosage is typically 50 - 100 μg for a 20 g mouse.

[0100] Kit In some embodiments, the present invention also provides a kit for preparing the liposome complex / composition described above. Such a kit can be prepared from readily available materials and reagents as described above. For example, such a kit can include any one or more of the following materials: liposomes, nucleic acids (condensed or uncondensed), hydrophilic polymers, hydrophilic polymers derivatized with targeting ligands such as aptamers, and instructions. Depending on the intended user of the kit and the specific needs of the user, a wide variety of kits and components can be prepared. For example, the kit can include any one of a number of targeting moieties for targeting the complex to a specific cell type as described above.

[0101] It can include instruction materials for the preparation and use of the liposome complex. The instruction materials typically include, but are not limited to, written or printed materials. Any medium capable of storing such instructions and communicating them to the end user is contemplated. Such media include, but are not limited to, electronic storage media (e.g., magnetic disks, tapes, cartridges, chips), optical media (e.g., CD ROM), etc. Such media may also include the address of an Internet site that provides such instruction materials.

[0102] In various embodiments, the instructions can direct the user to perform any of the method steps described herein. For example, the instructions may direct the user to diagnose the risk that a subject will develop AD by detecting the presence of tau pathology using the target liposome composition described herein.

[0103] Examples are included to more clearly illustrate specific embodiments of the invention. However, within the scope of the invention, there are a wide variety of other embodiments that should not be limited to the specific examples described herein.

Examples

[0104] Example 1 - Identification of Ligand and Target Well-known elegant methods for identifying cell surface markers include the phage display technique (Koivunen et al. J Biol Chem 268, 20205-20210 (1993)) and cell-SELEX: a method for screening DNA aptamers against cellular targets. Shangguan, et al., Chembiochem 8, 603-606 (2007). The inventors of the present invention used cell-SELEX to identify aptamers that bind to hyperphosphorylated SH-SY5Y cells (neuroblastoma cell line) differentiated into a neuronal phenotype. Figure 3 shows an overview of the screening and identification of thioaptamers. Treatment of SH-SY5Y cells with retinoic acid induces a neuronal phenotype with axonal and neurite structures (Figure 3A). Treatment with okadaic acid, a potent inhibitor of PP2A, reveals that hyperphosphorylation is induced from nuclear pTau Thr205 / Ser202 stained with the AT8 antibody (upper panel of Figure 3B) and cytoplasmic pTau Ser396 stained with the PHF-1 antibody (lower panel of Figure 3B).

[0105] Cell SELEX for neuronal cells was performed in "black box" mode, and thioaptamers binding to the cell membrane were separated by differential centrifugation and amplified by PCR using primers specific for the leader sequence. The starting thioaptamer library incorporated a 30-base random sequence bracketed by two primer regions (5'-GATATGTCTAGAGCCTCAGATCA-(N30)-CGGAGTTATGTTAGCAGTAGC-3' SEQ ID NO: 28) 10 15It was a member library. In rounds 13 and 21, it included two negative SELEX steps involving screening cells treated with retinoic acid and not treated with okadaic acid, thereby simulating "normal" or "non - hyperphosphorylated" neurons. In these steps, the supernatant, i.e., the thioaptamers that did not bind to the cell membrane or were not internalized, were separated for amplification, thus ensuring that the thioaptamers that continued the screening selectively bound only to hyperphosphorylated neurons. The top 250 sequences identified in cycle 26 are shown in Table 2 described at the end of Example 1. Next, NextGen sequencing of the aptamers remaining in rounds 26 of Cell SELEX (Figure 3C) and the selected intermediate rounds (1, 5, 10, 13, 17, 19, 21, 23, 26) was performed using the IonTorrent® method and Ion318® chips, followed by sequence alignment using the Aptaligner code. Lu et al., Biochemistry 53, 3523 - 3525 (2014). The top 20 sequences were classified into three different structural families (dendrogram in Figure 3E). At round 10, the thioaptamer Tau_2 (SEQ ID NO: 218) (orange bar) dominated the library, but after the negative screening in round 13, Tau_2 (SEQ ID NO: 218) substantially disappeared and was overtaken by Tau_1 (blue bar) etc., and evidence of the success of the negative screening strategy is shown in Figure 3D. The M - fold structures of Tau_1 (SEQ ID NO: 5), Tau_3 (SEQ ID NO: 6), and Tau_17 (SEQ ID NO: 13) showed significant similarity, indicating that they consistently bind to a selective target. Tau_1 (SEQ ID NO: 5) and Tau_3 (SEQ ID NO: 6) were synthesized as de novo sequences and avidly bound to the membrane and axonal processes when exposed to hyperphosphorylated SH - SY5Y cells (Figures 3G and 3H).

[0106] The target proteins of thioaptamers Tau_1 (SEQ ID NO: 5), Tau_3 (SEQ ID NO: 6), Tau_4 (SEQ ID NO: 12), and Tau_5 (SEQ ID NO: 14) were identified by affinity pulldown using the thioaptamers as capture reagents, followed by mass spectrometry. As a control, R4, a scrambled DNA sequence, was used. Hyperphosphorylated neuron-converted SH-SY5Y cells at 90-95% confluence were washed with ice-cold PBS buffer and incubated individually with biotinylated thioaptamers and R4 (each at 24 mM) for 2 hours at 4°C with gentle stirring in PBS (Dulbecco's PBS containing calcium chloride and magnesium chloride). After incubation, the cells were cross-linked with 1% formaldehyde for 10 minutes at room temperature. Cross-linking with formaldehyde was quenched with glycine. The cells were scraped out of the flask, washed, lysed in lysis buffer, and treated with a protease inhibitor mixture. The lysate was freeze-thawed on ice for 30 minutes and clarified by centrifugation at 10,000 g for 2 minutes at 4°C.

[0107] To extract the cross-linked protein, an equal amount of cell lysate was incubated with pre-washed streptavidin magnetic beads at room temperature for 1 hour with continuous rotation. Proteolysis was performed on the beads to separate the target protein, and the sample was processed for mass spectrometry analysis. Each sample was analyzed in three replicates. The raw data files were processed using Mascot Distiller to create Mascot Generic Format and searched against the SwissProt_2012_01 (Human) database using the Mascot search engine v2.3.02 running on the in-house server. Proteins present in the pull-down of the control (R4) were ignored in the pull-down of the test thioaptamer. The remaining ones were considered unique hits. As a result, Tau_1 was shown to bind avidly to HSPD1 (emPAI > 6) and KRT6A / KRT6B (emPAI ~ 0.38 each). Tau_3 was shown to bind avidly to VIM (emPAI = 2.7) and HSPD1 (emPAI ~ 0.62). Tau_4 was shown to bind to HSPD1 (emPAI ~ 1.08) and KRT6A (emPAI ~ 0.79). In the VisANT database, as shown in Figure 4, a relationship was obtained between each of these and tau. The identification of HSPs indirectly confirms that the cell model is actually misfolding. The redistribution of VIM in the cytoskeleton and membrane has been described in association with the formation of tau agrisomes. However, no studies have been conducted on its mechanism. The association between keratin 9 and tau pathology has been pointed out instead of KRT6A / KRT6B.

[0108] The thioaptamers Tau_1 (SEQ ID NO: 5), Tau_3 (SEQ ID NO: 6), Tau_4 (SEQ ID NO: 12), and Tau_5 (SEQ ID NO: 14) were each individually synthesized with a 3’ Cy3 tag and incubated with the brain tissue of P301S mice, followed by counterstaining with either the pTau antibody AT100 (indicating late phosphorylation) or AT8 (indicating early phosphorylation). Tau_3 showed the strongest staining and bound to the hippocampal tissue with a high correlation with the AT100 antibody (Figure 5A), but had no correlation with AT8 (Figure 5B) and did not stain normal brain tissue (Figure 5C). Thus, Tau_3 is suitable as a marker for tau phosphorylation.

Table 2-1

Table 2-2

Table 2-3

Table 2-4

Table 2-5

Table 2-6

Table 2-7

Table 2-8

Table 2-9

Table 2-10

Table 2-11

Table 2-12

Table 2-13

[0109] Example 2: MRI Visualization of Hyperphosphorylated Neurons In Vivo in a P301S Mouse Model of Tau Deposition Using Gadolinium-Loaded Thioaptamer-Targeted Liposome Nanoparticles In vitro and ex vivo studies such as those described above have identified Tau_3 as a suitable candidate thiolaptamer that binds to AT100-positive (indicating late hyperphosphorylation) hyperphosphorylated neurons. Therefore, the inventors decided to test the ability of the Tau_3 (SEQ ID NO: 6) aptamer in targeting payload nanoparticles to the tau pathological site in a mouse model of AD tauopathy (P301S). Furthermore, although nanoparticles targeting Tau_1 (SEQ ID NO: 5) did not show in vitro binding to mouse brain tissue, they were tested because they were most frequently seen in the SELEX screen in a pTau-specific manner. Aptamers with an amine-terminus that can be conjugated to the 3'-end were synthesized and conjugated to liposomes with carboxyl groups (HSPC: cholesterol: DSPE-DOTA-Gd: DSPE-PEG3400-COOH: MPEG2000DSPE: PE-rhodamine, molar ratio of 31.3:40:25:0.5:3:0.2) using carbodiimide chemistry (EDC + sulfo-NHS). More specifically, first, the lipid conjugate was dissolved in t-butanol, hydrated with saline to a total lipid concentration of 50 mM, extruded through nucleopore track etch membranes of 400 nm and 200 nm, then dialyzed against PBS, and concentrated using a hygroscopic gel to a total lipid concentration of 100 mM to prepare liposomes. These liposomes (5 mL) were activated with 2 mM EDC and 3 mM sulfo-NHS (equivalent to a 10-fold excess of EDC), followed by the addition of 500 μL of aptamer (total 1 μmole) at pH 7.5 and reaction at room temperature for 2 hours. After storing overnight at 4°C, the liposomes were dialyzed against PBS at pH 7.5 using a 1000 kDa cutoff to remove free aptamer. After dialysis, the liposomes were concentrated to 1.9 mL using a 3000 Da cutoff spin column and assayed with a nanodrop to quantify the aptamer concentration. It was estimated that approximately 400 thiolaptamer molecules were attached to each liposome. These procedures have been described in recent publications, which are hereby incorporated by reference in their entirety.Mu, Q. et al., Mol Ther Nucleic Acids 5, e382 (2016); Mann et al., Oncotarget 2, 298-304 (2011).

[0110] In MRI, P301S mice at 2 months, 6 months, and 9 months of age, and age-matched non-transgenic littermates were examined. In this model, intracellular tau pathology begins to develop at 6 months of age, and full-blown intracellular and extracellular (ghost) pathology develops at 9 months of age. In this way, the inventors tested the pre-pathology, pathology onset, and advanced pathology stages of the disease. The pre-scan was collected immediately before injection according to the following sequence: T2-weighted FSE (2 averages) - scan time: 12 minutes (anatomical reference scan) TR = 6500, TE = 80, slice Thk = 1.2 mm, matrix = 192x192, NEX = 2 FA = 90, slices = 16, FOV = 30 mm. T1-weighted SE (4 averages) - scan time: 14 minutes. TR = 260, TE = 8.8, slice Thk = 1.2 mm, matrix = 192x192, NEX = 4 FA = 90, slices (2D / 3D) = 8 / 16, FOV = 30 mm. T1-weighted GRE (5 flip angles) - scan time: 7 minutes. TR = 20, TE = 3.6, slice Thk = 1.2 mm, matrix = 192x192, NEX = 1 FA = [8 15 25 35 45 70]°, slices = 16, FOV = 30 mm.

[0111] Next, animals were treated with either Tau_1 (SEQ ID NO: 5) aptamer-targeted liposomes, Tau_3 (SEQ ID NO: 6) aptamer-targeted liposomes, or non-targeted PEGylated control liposome formulations containing all of the remaining components (Gd chelate conjugate, rhodamine, and matrix lipid). The liposome dose was 250 μL per mouse, adjusted to a total Gd of 0.2 mmol per kg body weight. After confirming the presence of the contrast agent by a short "scout scan", the animals recovered from anesthesia were returned to their cages, and the contrast agent was circulated, exuded, and allowed to bind to the target over 4 days. After 96 hours (after the contrast agent had disappeared from circulation, the remaining contrast agent must be bound or sequestered in some way), all animals were imaged in the same sequence as above, and then the animals were sacrificed and the brain, liver, spleen, and kidneys were harvested for follow-up analysis. Histological examination of spleen and liver tissues showed accumulation of the contrast agent (visualized by rhodamine signal), but no obvious signs of toxicity were seen.

[0112] Both Tau_1 (SEQ ID NO: 5)- and Tau_3 (SEQ ID NO: 6)-targeted liposomes appeared to bind to the cerebral cortex, hippocampus, and parts of the thalamus and hypothalamus in young (2-month-old) P301s transgenic animals, but not in wild-type littermates (Figure 5). Similar results were obtained at older ages. To quantify the accuracy of prediction by the Tau_1 (SEQ ID NO: 5)- and Tau_3 (SEQ ID NO: 6)-targeted liposome formulations, signal enhancement was calculated for 1.2-mm-thick slices in brain regions (including the cerebral cortex, hippocampus, and hypothalamus) near section 55 of the Paxinos atlas. A 45° GRE sequence was used for this purpose because it was thought to give the best signal. Another study showed that the scan-to-scan variation (95% confidence interval) in baseline signal intensity on different days in the same animals was about 5%. Therefore, the change in signal intensity was quantified in six steps for all 20 animals covering all three age groups for each comparison.

[0113] 1: Definitely negative (< -10%), 2: Probably negative (-5% to -10%), 3: Potentially negative (0 to -5%), 4: Potentially positive (0 to +5%), 5: Probably positive (+5% to +10%), 6: Definitely positive (> +10%).

[0114] Using the JROCFIT calculator, with the genotype as the gold standard, the ROC curve was calculated together with the prediction accuracy, sensitivity, and specificity. In P301S mice, synaptic tau pathology begins at 3 months after birth, intracellular filaments begin at around 6 months, and neurofibrillary tangles begin to develop at around 9 months. At 2 months after birth, tau pathology is hardly visible. Surprisingly, even in 2 - month - old mice, nanoparticles targeting the aptamer showed a positive signal by MRI with an estimated accuracy of 80% (sensitivity ~57%, specificity ~92%). This is an unprecedented result in that nanoparticles targeting the aptamer can predict the onset of tau pathology before the formation of intracellular tangles.

[0115] Example 3 - Quantification of Signals from T1 Maps Since multiple flip - angle images were acquired, the actual T1 values of the pre - contrast and post - contrast images were calculated. The signal equation for the spoiled gradient echo sequence is as follows. [Number] Here, k is a scaling factor, and [H] is a function of the spin density. Assuming that the spin density is constant, TE is short with respect to T2, and it is consistent with a T1 - weighted sequence, T1 can be estimated by the well - known method of non - linear fitting of signals at multiple flip angles. *

[0116] ​The advantage of this method is that although the intensity of the T1-weighted signal itself is not quantitatively related to the concentration of the contrast agent, the 1 / ΔT1 value is directly proportional to the concentration, and the proportionality constant is equal to the molar relaxation rate of the T1 shortening agent. Therefore, the local contrast agent concentration can be estimated, and local administration can be quantified by this method. Furthermore, the T1 map is also a marker indicating the localization of the drug. Since the T1 map efficiently considers information at all flip angles, it can emphasize changes that are not obvious at a single flip angle. As shown in Figure 7, in the image with a 45° flip angle, mainly the thalamus / hypothalamus is emphasized, but in the T1 map, the T1 of the hippocampus is significantly shortened.

[0117] Example 4: MRI Visualization of Hyperphosphorylated Neurons In Vivo in a P301S Mouse Model of Tau Deposition Using Gadolinium-Loaded Thioaptamer-Targeted Liposome Nanoparticles Two types of liposome preparations (“ADx-Tau1” and “ADx-Tau3”) were prepared and in vivo tests were conducted. The ADx-Tau1 preparation contained the amine-terminated Tau-1 (SEQ ID NO: 5) aptamer (5’- / 5AmMC6 / CGC TCG ATA GAT CGA GCT TCG CCC ACG GTC TCC GCT CCA CAA GTT CAC GTC GAT CAC GCT CTA GAG CAC TG-3’-SEQ ID NO: 256). The ADx-Tau3 preparation contained the amine-terminated Tau_3 (SEQ ID NO: 6) aptamer (5’- / 5AmMC6 / CGC TCG ATA GAT CGA GCT TCG CCC ACG GTC TCC GCT CCA CAA GTC CAC GTC GAT CAC GCT CTA GAG CAC TG-3’-SEQ ID NO: 257). The aptamers were synthesized to have an amine terminus conjugable at the 3’ end and were linked to liposomes containing DSPE-PEG3400-COOH using known carbodiimide chemistry (EDC + sulfo-NHS). The lipid composition and molar ratio (%) used in the production of the ADx-Tau preparation were HSPC:cholesterol:DSPE-mPEG2000:DSPE-PEG3400-COOH:DSPE-DOTA-Gd = 31.5:40:3:0.5:25. Approximately 250 - 500 molecules of the Tau_1 aptamer and approximately 150 - 400 molecules of the Tau_3 aptamer were bound to the liposomes.

[0118] As a control, a non-targeted ADx-Tau formulation without a targeting aptamer ("ADx-Un") was also prepared (prepared without including DSPE-PEG3400-COOH in the lipid bilayer) and included in the in vivo tests.

[0119] The efficacy of the ADx-Tau formulation was verified in a P301S mouse model of tauopathy. Animals (wild-type and transgenic) underwent ADx-Tau-compatible MRI at an early age (2-3 months old) to detect any pre-tauopathy. Histological analysis of brain sections showed that in transgenic mice aged ≥7 months, fibrillar tau was deposited in the cerebral cortex, hippocampus, and brainstem.

[0120] MRI was performed using a 1T permanent magnet scanner (M7 system, Aspect Imaging, Shoham, Israel). The mice were anesthetized with 2.5% isoflurane, placed on a custom-made bed with a face cone, and continuously anesthetized by inhalation (1 - 2% isoflurane). Respiratory rate was monitored by a pneumatically controlled pressure pad placed under the abdomen of the mice. MR images were acquired using the following sequences and scan protocols: (1) T1-weighted spin echo (T1w-SE) sequence (repetition time (TR) = 260 ms, echo time (TE) = 8.5 ms, number of slices = 16, voxel size = 0.16×0.16×1.2 mm, scan time = 8 minutes), (2) fast spin echo inversion recovery (FSE-IR) approximating a T1w-fluid attenuated inversion recovery (T1w-FLAIR) sequence (TR = 13500 ms, TE = 86 ms, TI = 2000 ms, slices = 6, Voxel Size: 0.16x0.16x2.4 mm). The reason for using a 1T scanner is that the magnetic field strength is close to the commonly used clinical 1.5T, enhancing the translational relevance of these small animal studies, and the relaxivity of Gd nanoparticles is high at low magnetic field strength. Delayed post-contrast scans were acquired 4 days after intravenous administration of the contrast agents (ADx-Tau1, ADx-Tau3, ADx-Un). Pre- and post-contrast scans were performed with the above parameters using both the T1w-SE and FSE-IR sequences. Subsequently, the mice were aged to 7 - 9 months, euthanized, and postmortem brain tissue examinations were performed using the AT100 antibody to confirm pTau pathology.

[0121] To account for variability between mice and potential artifacts due to positioning or MR equipment factors, the mean and standard deviation of the MR signal intensity of all wild-type and transgenic mice were determined for both the T1w-SE and FSE-IR sequences. Cutoff threshold signal intensities set 2 standard deviations above the mean were estimated for both sequences and expressed as a percentage of the mean signal intensity: 5.1% (FSE-IR) and 5.6% (T1w-SE).

[0122] Qualitative and quantitative analysis of MRI images was performed using OsiriX (version 5.8.5, 64-bit) and MATLAB (version 2015a). Brain extraction was performed using a combination of thresholding and manual segmentation in OsiriX. The signal change between the pre-contrast image and the post-contrast delayed image was evaluated through quantification of the signal intensity in the cortical region near the center of the image stack. Tau-positive mice were identified by evaluating the signal enhancement between the pre- and post-contrast delayed evaluations of the cerebral cortex and hippocampus. The change in signal between the pre- and post-contrast images was quantified by integrating the signals in the region of interest (ROI) containing the cortical tissue of the central slice of the MRI volume. In the delayed MR images of tau-positive mice (determined by genotype and the manifestation phenotype of ataxia and / or hind limb paralysis at 7-9 months postnatal) enabled by ADx-Tau, if signal enhancement above the signal dispersion threshold was observed, it was counted as a true positive result. Conversely, if signal enhancement below the signal dispersion threshold was seen between the pre- and post-contrast delayed images of tau-negative mice, it was considered a true negative result. To evaluate the sensitivity and specificity of ADx-Tau, an ROC curve was created using a six-point ordinal scale. Sensitivity was determined by the ratio of the number of true positives identified by MRI to the total number of true positives. Specificity was determined by the ratio of the number of true negatives confirmed by MRI to the total number of true negatives. Accuracy was determined as the area under the curve (AUC) of the empirical ROC curve.

[0123] In 2-month-old transgenic mice in which tau deposition has not yet occurred, enhancement of the MR signal is observed after injection of either ADx-Tau1 or ADx-Tau3, but little enhancement is seen in wild-type mice (Figure 8). No enhancement of the MR signal was observed in transgenic mice administered a non-target formulation (ADx-Un). When cortical brain sections of P301S were stained with AT100, the pTau level was elevated compared to wild-type mice (Figure 9). The ADx-Tau1 and ADx-Tau3 aptamer-targeted particles were detected with an accuracy of approximately 75% using the FSE-IR sequence, with the expressed phenotypes of ataxia and / or hindlimb paralysis at 7-9 months after birth as the gold standard, compared to genotype confirmation (Figure 10).

[0124] The complete disclosure content of all patents, patent applications, publications, and electronically available materials cited herein is incorporated by reference. The foregoing detailed description and examples are provided only to clarify understanding. No unnecessary limitations should be understood therefrom. The present invention is not limited to the exact details shown and described, since modifications obvious to those skilled in the art are included in the invention as defined by the claims.

Sequence Listing Free-Text

[0125] SEQ ID NOs: 1 to 257 <223> Synthetic

Claims

**Claim 1** A composition for identifying tau pathology, the composition comprising a targeting ligand, the targeting ligand comprising a DNA nucleotide sequence consisting of Tau_1 (SEQ ID NO: 5), the targeting ligand specifically binding to a cell surface marker of tau pathology, and the targeting ligand being linked to a liposome containing an imaging agent. **Claim 2** The composition according to claim 1, wherein the targeting ligand comprises an aptamer. **Claim 3** The composition according to claim 1, wherein the cell surface marker of tau pathology comprises a cell surface marker of hyperphosphorylated tau. **Claim 4** The composition according to claim 1, wherein the targeting ligand is determined to specifically bind to a cell surface marker of tau pathology using the systematic evolution of ligands by exponential enrichment (SELEX) method. **Claim 5** The composition according to claim 1, wherein the cell surface marker of tau pathology comprises a protein selected from KRT6A, KRT6B, HSP, and VIM. **Claim 6** The composition according to claim 1, wherein the imaging agent comprises a magnetic resonance imaging (MRI) contrast agent. **Claim 7** The liposome comprises a membrane, and the membrane comprises: A first phospholipid; Cholesterol; A second phospholipid derivatized with a first polymer; A third phospholipid derivatized with a second polymer, wherein the second polymer is bound to the targeting ligand; and An imaging agent encapsulated in or bound to the membrane The composition according to claim 1. **Claim 8** The first phospholipid comprises HSPC; The second phospholipid derivatized with a first polymer comprises DSPE-PEG; The third phospholipid derivatized with a second polymer, wherein the second polymer is bound to the targeting ligand, comprises DSPE-PEG bound to Tau_1 (SEQ ID NO: 5); and The imaging agent comprises DSPE-DOTA-Gd. The composition according to claim 7. **Claim 9** The first phospholipid comprises HSPC; The second phospholipid derivatized with a first polymer comprises DSPE-PEG2000; The third phospholipid derivatized with a second polymer, wherein the second polymer is bound to the targeting ligand, comprises DSPE-PEG3400 bound to Tau_1 (SEQ ID NO: 5); and The imaging agent contains DSPE-DOTA-Gd, The composition according to claim 7.

10. The composition according to claim 9, wherein HSPC:cholesterol:DSPE-mPEG2000:DSPE-PEG3400:DSPE-DOTA-Gd = a ratio of about 31.5:about 40:about 3:about 0.5:about 25.

11. The composition according to claim 9, further comprising about 250 to 500 molecules of Tau_1 (SEQ ID NO: 5).

12. A targeting composition comprising a lipid linked to a polymer linked to a targeting ligand, wherein the targeting ligand comprises a DNA nucleotide sequence consisting of Tau_1 (SEQ ID NO: 5), and the targeting ligand specifically binds to a cell surface marker of tau pathology, said targeting composition.

13. The targeting composition according to claim 12, wherein the targeting ligand comprises an aptamer.

14. An aptamer or stabilized aptamer comprising a DNA nucleotide sequence consisting of Tau_1 (SEQ ID NO: 5).

15. The aptamer or stabilized aptamer according to claim 14, wherein the DNA nucleotide sequence is located between SEQ ID NO: 1 and SEQ ID NO:

2.

16. A composition for identifying tau pathology, the composition comprising a targeting ligand, the targeting ligand comprising a DNA nucleotide sequence consisting of Tau_3 (SEQ ID NO: 6), the targeting ligand specifically binding to a cell surface marker of tau pathology, and the targeting ligand being linked to a liposome containing an imaging agent, said composition.

17. The composition according to claim 16, wherein the targeting ligand comprises an aptamer.

18. The composition according to claim 16, wherein the cell surface marker of tau pathology comprises a cell surface marker of hyperphosphorylated tau.

19. The composition according to claim 16, wherein the targeting ligand is determined to specifically bind to a cell surface marker of tau pathology using the systematic evolution of ligands by exponential enrichment (SELEX) method.

20. The composition according to claim 16, wherein the cell surface marker of tau pathology comprises a protein selected from KRT6A, KRT6B, HSP, and VIM.

21. The composition according to claim 16, wherein the imaging agent comprises a magnetic resonance imaging (MRI) contrast agent.

22. The liposome comprises a membrane, and the membrane is: The first phospholipid; Cholesterol; The second phospholipid derivatized with the first polymer; The third phospholipid derivatized with the second polymer, wherein the second polymer is bound to a targeting ligand; and An imaging agent encapsulated in or bound to a membrane The composition according to claim 16, comprising.

23. The first phospholipid comprises HSPC; The second phospholipid derivatized with the first polymer comprises DSPE-PEG, The third phospholipid derivatized with the second polymer, wherein the second polymer is bound to a targeting ligand, comprises DSPE-PEG bound to Tau_3 (SEQ ID NO: 6); and The imaging agent comprises DSPE-DOTA-Gd, The composition according to claim 22.

24. The first phospholipid comprises HSPC; The second phospholipid derivatized with the first polymer comprises DSPE-PEG2000; The third phospholipid derivatized with the second polymer, wherein the second polymer is bound to a targeting ligand, comprises DSPE-PEG3400 bound to Tau_3 (SEQ ID NO: 6); and The imaging agent comprises DSPE-DOTA-Gd, The composition according to claim 22.

25. The composition according to claim 24, wherein HSPC: Cholesterol: DSPE-mPEG2000: DSPE-PEG3400: DSPE-DOTA-Gd = about 31.5: about 40: about 3: about 0.5: about 25.

26. The composition according to claim 24, further comprising about 250 to 500 molecules of Tau_3 (SEQ ID NO: 6).

27. A targeting composition comprising a phospholipid linked to a polymer linked to a targeting ligand, wherein the targeting ligand comprises a DNA nucleotide sequence consisting of Tau_3 (SEQ ID NO: 6), and the targeting ligand specifically binds to a cell surface marker of tau pathology. The targeting composition described above.

28. The targeting composition according to claim 27, wherein the targeting ligand comprises an aptamer.

29. An aptamer or stabilized aptamer comprising a DNA nucleotide sequence consisting of Tau_3 (SEQ ID NO: 6).

30. The aptamer or stabilized aptamer according to claim 29, wherein the DNA nucleotide sequence is located between SEQ ID NO: 1 and SEQ ID NO: 2.

Citation Information

Patent Citations

  • MRI Imaging of Amyloid Plaques Using Liposomes

    JP2017532378A

  • Tau protein-binding DNA aptamers with capture / detection and therapeutic utilities in tauopathy-related neurodegenerative disorders

    US20190101529A1