Protein that regulates nitrogen utilization efficiency and yield of plants, and its use

Abstract

The present invention provides a protein that regulates nitrogen utilization and yield in plants, and its use. Using transgenic and CRISPR-Cas9 technologies, trans-OsTCP19 rice and an OsTCP19 mutant rice were obtained, respectively. The results showed that trans-OsTCP19 rice plants exhibited reduced tillering and reduced nitrogen responsiveness compared with wild-type rice, whereas the OsTCP19 mutant rice plants exhibited increased tillering compared with wild-type rice. These findings suggest that the OsTCP19 protein plays a role in regulating plant yield and nitrogen utilization. This provides a basis for developing high-yield, high-nitrogen utilization varieties.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to a protein that regulates the nitrogen utilization rate and yield of plants and its use.

Background Art

[0002] Nitrogen is the most essential inorganic nutrient for plants. In agricultural production, continuous application of chemical fertilizers mainly nitrogen fertilizers has led to a significant increase in food production. However, excessive application of nitrogen fertilizers has caused a large amount of nitrogen fertilizers that crops did not absorb and utilize to flow into the atmosphere or water areas or remain in the soil, causing air pollution, eutrophication of surface water, acidification of the soil, etc., resulting in serious environmental damage. In addition, with the continuous increase in the world population, the demand for food will continue to increase in the future. Therefore, in order to develop agriculture sustainably, it is important to achieve the breeding goal of "reducing fertilizers and increasing efficiency" and improve the nitrogen-use efficiency (NUE) of crops. Rice is a staple crop widely cultivated in the world, and its application rate of nitrogen fertilizer far exceeds that of other crops. Therefore, identifying and utilizing NUE-related genes in rice is very important for agricultural production.

[0003] NUE is affected by a combination of various genetic and environmental factors and is a complex agricultural trait related to processes such as nitrogen absorption, translocation, assimilation, reuse, and subsequent growth and development. It is difficult to identify its phenotype using a single indicator. Therefore, it is difficult to clone and identify related functional genes using traditional genetic techniques, which has greatly restricted the development of breeding with high nitrogen utilization efficiency.

[0004] NUE can be defined as the yield per unit area of crops to which a certain amount of nitrogen has been applied. Since the yield of rice is determined by three factors: the number of tillers, the number of grains per panicle, and the 1000-grain weight, using the nitrogen responsiveness of these yield factors (the increase ratio from low nitrogen (LN) to high nitrogen (HN), i.e., (HN - LN) / LN) as the relative phenotypic value of NUE and cloning gene sites related to NUE is considered to have more practical value.

Summary of the Invention

[0005] The first object of the present invention is to provide a novel use of the OsTCP19 protein.

[0006] The present invention provides the use of the OsTCP19 protein in the regulation of tillering and / or yield and / or quality and / or nitrogen utilization efficiency and / or nitrogen responsiveness of plants.

[0007] The OsTCP19 protein is a protein represented by any one of the following A1) or A2) or A3) or A4): A1) A protein consisting of the amino acid sequence shown in SEQ ID NO: 3 in the Sequence Listing; A2) A fusion protein obtained by binding a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO: 3 in the Sequence Listing; A3) A protein in which one or more amino acid residues in the amino acid sequence shown in SEQ ID NO: 3 in the Sequence Listing are substituted and / or deleted and / or added, and which has the same function; A4) A protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more homology with the amino acid sequence defined in any one of A1) to A3) and having the same function is.

[0008] Here, SEQ ID NO: 3 in the Sequence Listing consists of 387 amino acid residues.

[0009] The tag is specifically shown in Table 1.

[0010] TIFF0007717147000001.tif68170

[0011] The protein shown in any one of the above A1) to A4) can be artificially synthesized, or can also be obtained by first synthesizing the gene encoding them and then biologically expressing them.

[0012] The second object of the present invention is to provide a novel use of a biological material related to the OsTCP19 protein.

[0013] The present invention relates to a biological material related to the OsTCP19 protein, any one of the following B1) to B4): B1) regulating tillering and / or yield and / or quality and / or nitrogen utilization rate and / or nitrogen responsiveness of plants, B2) cultivating transgenic plants showing an increase in tiller number and / or an increase in yield and / or an improvement in quality and / or an improvement in nitrogen utilization rate and / or an improvement in nitrogen Response responsiveness, B3) cultivating transgenic plants showing a decrease in tiller number and / or a decrease in yield and / or a decrease in quality and / or a decrease in nitrogen utilization rate and / or a decrease in nitrogen Response responsiveness, B4) plant breeding; provides use in Here, the biological material related to the OsTCP19 protein is any one of the following C1) to C8): C1) a nucleic acid molecule encoding the OsTCP19 protein, C2) an expression cassette containing the nucleic acid molecule according to C1), C3) a recombinant vector containing the nucleic acid molecule according to C1), C4) a recombinant vector containing the expression cassette according to C2), C5) a recombinant microorganism containing the nucleic acid molecule according to C1), C6) a recombinant microorganism containing the expression cassette according to C2), C7) a recombinant microorganism containing the recombinant vector according to C3), A recombinant microorganism containing the recombinant vector according to C8) C4) is as follows.

[0014] In the above use, the nucleic acid molecule according to C1) is a DNA molecule according to any one of the following 1) to 5): 1) The genomic DNA molecule shown in SEQ ID NO: 1 in the sequence listing; 2) The cDNA molecule shown in SEQ ID NO: 2 in the sequence listing; 3) A DNA molecule derived from rice, which has a homology of 98% or more with the DNA sequence defined in 1) or 2) and encodes a protein related to the tiller number and / or yield and / or quality and / or nitrogen utilization rate and / or nitrogen responsiveness of plants; 4) A DNA molecule that hybridizes with the DNA sequence defined in 1) or 2) under stringent conditions and encodes a protein related to the tiller number and / or yield and / or quality and / or nitrogen utilization rate and / or nitrogen responsiveness of plants; 5) A DNA molecule that has a homology of 90% or more with the DNA sequence defined in 1) or 2) and encodes a protein related to the tiller number and / or yield and / or quality and / or nitrogen utilization rate and / or nitrogen responsiveness of plants is as follows.

[0015] Those skilled in the art can easily mutate the nucleotide sequence encoding the OsTCP19 protein according to the present invention by known methods such as directed evolution and point mutation. Any artificially modified nucleotide having a homology of 75% or more with the nucleotide sequence encoding the OsTCP19 protein, as long as it encodes the OsTCP19 protein and has the same function, is a sequence derived from the nucleotide sequence according to the present invention and equivalent to the present invention.

[0016] As used herein, the term "homology" means sequence similarity to a natural nucleic acid sequence. "Homology" includes nucleotide sequences having 75% or more, or 85% or more, or 90% or more, or 95% or more homology with the nucleotide sequence encoding the protein consisting of the amino acid sequence shown in SEQ ID NO: 3 of the present invention. Evaluation of homology can be performed by the naked eye or by computer software. When using computer software, the homology between two or more sequences can be expressed as a percentage (%), and can be used to evaluate the homology between related sequences.

[0017] The above 90% or more homology may be 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more homology.

[0018] In the above use, under stringent conditions, hybridization and membrane washing are carried out twice at 68°C for 5 minutes each in a solution of 2xSSC and 0.1% SDS, and further, hybridization and membrane washing are carried out twice at 68°C for 15 minutes each in a solution of 0.5xSSC and 0.1% SDS; or hybridization and membrane washing are carried out at 65°C in a solution of 0.1xSSPE (or 0.1xSSC) and 0.1% SDS.

[0019] In the above use, the vector may be a plasmid, cosmid, phage, or viral vector.

[0020] By inserting the nucleic acid molecule into an expression vector, a recombinant vector capable of expressing the protein can be obtained. When constructing a recombinant vector using the nucleic acid molecule, before it transcribes the start nucleotide, any one of an enhanced, constitutive, tissue-specific, or inducible promoter may be added. These may be used alone, or in combination with other plant promoters. Further, when constructing a recombinant expression vector using the nucleic acid molecule, enhancers such as a translation enhancer or a transcription enhancer may be used. These enhancer regions may be, for example, the ATG start codon or an adjacent region start codon, etc., but it is necessary to be the same as the reading frame of the coding sequence so as to correctly translate the entire sequence. The sources of the translation control signal and the start codon are wide-ranging and may be natural or synthetic. The translation initiation region can be derived from the transcription initiation region or the structural gene. To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed. For example, a gene encoding an enzyme or a luminescent compound that causes a color change and can be expressed in plants (such as the GUS gene, the luciferase gene, etc.), an antibiotic marker having drug resistance (such as the gentamycin marker, the kanamycin marker, etc.), or a chemical reagent resistance marker gene (such as a herbicide resistance gene, etc.) may be added to the plant expression vector. For the safety of transgenic plants, the plants can be screened and transformed under stress conditions without adding any selectable marker gene. In a specific embodiment of the present invention, the recombinant vector is gOsTCP19. The gOsTCP19 is a recombinant vector obtained by inserting the DNA fragment shown in SEQ ID NO: 1 between the BamHI cleavage site and the HindIII cleavage site of the vector pCAMBIA2300-ocs.

[0021] The microorganism in the above use may be yeast, bacteria, algae or fungi, and may be, for example, Agrobacterium. The recombinant microorganism is a microorganism containing the above recombinant vector. In a specific embodiment of the present invention, the recombinant microorganism is Agrobacterium AGL1 containing the above recombinant vector.

[0022] In the above use, the regulation of the plant yield is embodied in the regulation of the number of plant tillers, and the regulation of the plant nitrogen utilization rate is embodied in the regulation of the plant nitrogen responsiveness. The regulation of the plant tillering and / or yield and / or quality and / or nitrogen utilization rate and / or nitrogen responsiveness is that when the content and / or activity of OsTCP19 protein in the plant decreases, the number of plant tillers and / or yield and / or quality and / or nitrogen utilization rate and / or nitrogen responsiveness increases or improves; when the content and / or activity of OsTCP19 protein in the plant improves, the number of plant tillers and / or yield and / or quality and / or nitrogen utilization rate and / or nitrogen responsiveness decreases or deteriorates, which is embodied.

[0023] The third object of the present invention is to provide a novel use of a substance that inhibits OsTCP19 protein activity, a substance that inhibits the expression of the gene encoding OsTCP19 protein, or a substance that knocks out the gene encoding OsTCP19 protein.

[0024] The present invention provides the use of a substance that inhibits OsTCP19 protein activity, a substance that inhibits the expression of the gene encoding OsTCP19 protein, or a substance that knocks out the gene encoding OsTCP19 protein in cultivating transgenic plants showing an increase in the number of tillers and / or an increase in yield and / or an improvement in quality and / or an improvement in nitrogen utilization rate and / or an improvement in nitrogen Response responsiveness.

[0025] Furthermore, the substance is a CRISPR-Cas9 system, the CRISPR-Cas9 system includes a Cas9 protein and an sgRNA, and the sgRNA targets the sequence of the gene encoding the OsTCP19 protein, or its upstream promoter sequence, or its non-coding region sequence, or its downstream regulatory region sequence.

[0026] Furthermore, the target sequences of the sgRNA are the DNA molecules shown in SEQ ID NO: 4 and the DNA molecules shown in SEQ ID NO: 5. The CRISPR-Cas9 system is an OsTCP19 CRISPR / Cas9 knockout vector. The OsTCP19 CRISPR / Cas9 knockout vector contains two sgRNAs, denoted as sgRNA1 and sgRNA2, respectively. The target sequence of the sgRNA1 is the DNA molecule shown in SEQ ID NO: 4, and the target sequence of the sgRNA2 is the DNA molecule shown in SEQ ID NO: 5.

[0027] A fourth object of the present invention is to provide a method for cultivating a transgenic plant showing an increase in tiller number and / or an increase in yield and / or an improvement in quality and / or an improvement in nitrogen utilization efficiency and / or an improvement in nitrogen Response tolerance.

[0028] The method for cultivating a transgenic plant showing an increase in tiller number and / or an increase in yield and / or an improvement in quality and / or an improvement in nitrogen utilization efficiency and / or an improvement in nitrogen Response tolerance provided by the present invention is as follows: D1) or D2): D1) A method including the step of inhibiting the activity of the OsTCP19 protein in a target plant to obtain a transgenic plant having an increase in tiller number and / or an increase in yield and / or an improvement in quality and / or an improvement in nitrogen utilization efficiency and / or an improvement in nitrogen Response tolerance, or Step of obtaining a transgenic plant showing an increase in the number of tillers and / or an increase in yield and / or an improvement in quality and / or an improvement in nitrogen use efficiency and / or an improvement in nitrogen Response by inhibiting the expression of the gene encoding the OsTCP19 protein in the target plant or knocking out the gene encoding the OsTCP19 protein in the target plant.

[0029] Furthermore, the method of knocking out the gene encoding the OsTCP19 protein in the target plant includes the step of introducing the CRISPR-Cas9 system into the target plant.

[0030] Even further, the CRISPR-Cas9 system is the OsTCP19 CRISPR / Cas9 knockout vector.

[0031] A fifth object of the present invention is to provide a method for cultivating a transgenic plant showing a decrease in the number of tillers and / or a decrease in yield and / or a decrease in quality and / or a decrease in nitrogen use efficiency and / or a decrease in nitrogen Response sex.

[0032] The method for cultivating a transgenic plant showing a decrease in the number of tillers and / or a decrease in yield and / or a decrease in quality and / or a decrease in nitrogen use efficiency and / or a decrease in nitrogen Response sex provided by the present invention includes the step of increasing the activity and / or content of the OsTCP19 protein in the target plant to obtain a transgenic plant showing a decrease in the number of tillers and / or a decrease in yield and / or a decrease in quality and / or a decrease in nitrogen use efficiency and / or a decrease in nitrogen Response sex.

[0033] Furthermore, the decrease in nitrogen responsiveness is specifically embodied in the fact that the nitrogen responsiveness of tillers of the transgenic plant is lower than that of the target plant. The calculation formula for the nitrogen responsiveness of the tillers is as follows: (number of tillers in the high-nitrogen treatment group - number of tillers in the low-nitrogen treatment group) / number of tillers in the low-nitrogen treatment group. The high-nitrogen treatment group is fertilized with 1.5 kg of urea per 100 m 2 and the low-nitrogen treatment group is fertilized with 0.5 kg of urea per 100 m 2 .

[0034] The method for increasing the activity and / or content of the OsTCP19 protein in the target plant is to overexpress the OsTCP19 protein in the target plant. The method of overexpression is a method of introducing a gene encoding the OsTCP19 protein into the target plant.

[0035] Furthermore, the gene encoding the OsTCP19 protein is a DNA molecule shown in SEQ ID NO: 1. The gene encoding the OsTCP19 protein is introduced into the target plant by the recombinant vector gOsTCP19.

[0036] The transgenic plant obtained by preparing according to any one of the above methods is also included in the scope of the present invention.

[0037] The last object of the present invention is to provide the CRISPR-Cas9 system.

[0038] The cultivation of transgenic plants showing an increase in the number of tillers and / or an increase in yield and / or an improvement in quality and / or an improvement in nitrogen utilization efficiency and / or nitrogen Response responsiveness by the CRISPR-Cas9 system, or its use in plant breeding is also included in the scope of the present invention.

[0039] In any one of the above uses or methods, the plant may be a monocotyledon or a dicotyledon. Further, the monocotyledon may be a plant of the Poaceae family. Even further, the plant of the Poaceae family is specifically rice (for example, Zhonghua 11, a rice variety).

Brief Description of the Drawings

[0040]

Figure 1

Figure 2

Figure 3

Modes for Carrying Out the Invention

[0041] The following examples are for better understanding of the present invention, but do not limit the present invention. The experimental methods in the following examples are general unless otherwise specified. The test materials used in the following examples are all purchased from general biochemical reagent stores unless otherwise specified. In the quantitative tests in the following examples, three repeated experiments were set up in each case, and the results were averaged.

[0042] Zhonghua 11 is described in the following document: Ma Y, Liu L, Zhu C, Sun C, Xu B, Fang F, Tang J, Luo A, Cao S, Li G, Qian Q, Xue Y, Chu C (2009) Molecular analysis of rice plants harboring a multi-functional T-DNA tagging system, J. Genet. Genomics 36(5):267-276. The public can obtain it from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. This biological material is only used for repeating the experiments related to the present invention and should not be used for other purposes.

[0043] pCAMBIA2300-ocs is described in the following document: Wang W, Hu B, Yuan D, Liu Y, Che R, Hu Y, Ou S, Zhang Z, Wang H, Li H, Jiang Z, Zhang Z, Gao X, Qiu Y, Meng X, Liu Y, Bai Y, Liang Y, Wang Y, Zhang L., Li L, Mergen S, Jing H, Li J, and Chu C (2018) Expression of nitrate transporter OsNRT1.1A / OsNPF6.3 confers high yield and early maturation in rice. Plant Cell, 30(3): 638-651. The public can obtain it from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. This vector is only used for repeating the experiments related to the present invention and should not be used for other purposes.

[0044] pYLsgRNA-U3, pYLsgRNA-U6a and pYLCRISPR / Cas9P ubi-H vectors are all described in the following reference: Ma X, Zhang Q, Zhu Q, et al. A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. Mol. Plant. 2015;8(8):1274-1284. The public can obtain them from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. The vectors are only used for repeating the experiments related to the present invention and should not be used for other purposes.

[0045] Agrobacterium tumefaciens AGL1 strain is described in the following reference: Wang W, Hu B, Yuan D, Liu Y, Che R, Hu Y, Ou S, Zhang Z, Wang H, Li H, Jiang Z, Zhang Z, Gao X, Qiu Y, Meng X, Liu Y, Bai Y, Liang Y, Wang Y, Zhang L, Li L, Mergen S, Jing H, Li J, and Chu C (2018) Expression of the nitrate transporter OsNRT1.1A / OsNPF6.3 confers high yield and early maturation in rice. Plant Cell, 30(3): 638-651. The public can obtain it from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. The vector is only used for repeating the experiments related to the present invention and should not be used for other purposes.

[0046] Example 1 Acquisition of trans-OsTCP19 Rice and Detection of Its Tillering I. Acquisition of trans-OsTCP19 Rice 1. Construction of Recombinant Expression Vector (1) Gene Cloning Using the genomic DNA of Zhonghua 11 (ZH11) as a template, PCR amplification was performed using the primer pair gOsTCP19-F / gOsTCP19-R (this gOsTCP19-F / gOsTCP19-R primer pair contains the junction of two restriction enzyme cleavage sites, BamHI and HindIII, and the vector sequence used for subsequent homologous recombination), and a DNA fragment with a size of 3844 bp was obtained. The nucleotide sequence thereof is shown in SEQ ID NO: 1 in the Sequence Listing. Here, positions 1-1944 in SEQ ID NO: 1 are the promoter of the OsTCP19 gene, positions 1945-2240 are the 5' UTR sequence of the OsTCP19 gene, positions 2241-3404 are the coding region sequence of the OsTCP19 gene, positions 3405-3654 are the 3' UTR sequence of the OsTCP19 gene, and positions 3655-3844 are the downstream sequence of the OsTCP19 gene. The primer sequences are as follows in detail. gOsTCP19-F: 5’-CGGTACCCGG GGATCC ATCTATGTCGAGAGGTGCGG-3’; gOsTCP19-R: 5’-GGCCAGTGCC AAGCTT AGAGTGGCAGATCGAATGGA-3’。

[0047] A BamHI restriction enzyme cleavage site is added to the 5' end of the gOsTCP19-F primer sequence, and a HindIII restriction enzyme cleavage site (underlined) is added to the 5' end of the gOsTCP19-R primer sequence. The bold sequences in the gOsTCP19-F / gOsTCP19-R primer sequences are the sequences in the vector and are used for subsequent homologous recombination to construct the vector. The italicized sequence in the gOsTCP19-F primer sequence is the nucleotide sequence of positions 1-20 in SEQ ID NO: 1, and the italicized sequence in the gOsTCP19-R primer sequence is the sequence reverse complementary to the nucleotide sequence of positions 3825-3844 in SEQ ID NO: 1.

[0048] (2) Construction of the expression vector The DNA fragment containing the OsTCP19 gene and having a full length of 3844 bp obtained in step (1) was inserted between the BamHI cleavage site and the HindIII cleavage site of the vector pCAMBIA2300-ocs to obtain the recombinant expression vector gOsTCP19.

[0049] 2. Obtaining transgenic rice The recombinant expression vector gOsTCP19 obtained in step 1 was transformed into Agrobacterium tumefaciens AGL1 strain by the heat shock method, and screened to obtain a recombinant Agrobacterium strain containing gOsTCP19. The callus of Zhonghua 11 was infected with the recombinant Agrobacterium strain containing gOsTCP19. The specific transformation and screening methods refer to "YI Zili, CAO Shouyun, WANG Li, HE Jie, CHU Chengcai, TANG Zuoshu, ZHOU Puhua, TIAN Wenzhong, Study on increasing the frequency of rice transformation by Agrobacterium tumefaciens, Journal of Genetics, 2001, 28(4):352-358", and finally transgenic rice was obtained. The obtained transgenic rice is T0 generation transgenic rice. The seeds of T0 generation plants were harvested to obtain T1 generation transgenic rice.

[0050] According to the method for obtaining T1 generation transgenic rice, the empty vector pCAMBIA2300-ocs was transformed into Zhonghua 11 to obtain control plants of the empty vector.

[0051] 3. Identification of transgenic rice 1) Identification by PCR The genomic DNA of the T1 generation transgenic rice obtained in step 2 was extracted. PCR identification was performed using primers F1 and R1 for the NptII gene. As a result, plants containing the NptII gene (the size of the PCR product is about 500 bp), that is, positive transgenic rice, were found and named trans-OSTCP19 rice. The primer sequences are specifically as follows. F1: 5'-TCCGGCCGCTTGGGTGGAGAG-3'; R1: 5'-CTGGCGCGAGCCCCTGATGCT-3'.

[0052] 2) Analysis at the transcription level (RNA expression level) As experimental materials, all T1 generation positive transgenic rice strains obtained in step (1) and the wild-type rice variety Zhonghua 11 were used. Total RNA was extracted from each material and reverse-transcribed to obtain cDNA. Furthermore, using the obtained cDNA as a template, real-time quantitative fluorescence PCR for the OsTCP19 gene was performed to detect the expression level at the transcription level of the OsTCP19 gene in each material. The experiment was repeated 3 times and the results were averaged. OsActin1 was used as an internal standard gene. The primer sequences used for detecting the OsTCP19 gene and the OsActin1 gene are as follows: OsTCP19-qF: 5'-GACAGTGTACCGTGGCGT-3'; OsTCP19-qR: 5'-CGCCGGGAAGTTCATGAAAT-3'; OsActin1-F: 5'-ACCATTGGTGCTGAGCGTTT-3'; OsActin1-R: 5'-CGCAGCTTCCATTCCTATGAA-3'.

[0053] OsTCP19-qF is the nucleotide sequence at positions 864-881 in Sequence 2, and OsTCP19-qR is a sequence reverse complementary to the nucleotide sequence at positions 896-915 in Sequence 2.

[0054] Based on the results of real-time quantitative fluorescence PCR detection of the expression level of the OsTCP19 gene in each experimental material, two T1 generation strains with medium and high expression, named TO1 and TO2 respectively, were selected for subsequent study, and the detection results of the expression levels of TO1 and TO2 are shown in Fig. 1b (the empty vector control is consistent with the control phenotype of Zhonghua 11, so it is omitted in Fig. 1b). Compared with the non-transgenic wild-type rice variety Zhonghua 11, the expression level of the OsTCP19 gene was significantly increased at the transcriptional level in TO1 and TO2 of the T1 generation trans-OsTCP19 rice strains.

[0055] II. Detection of tillering of trans-OsTCP19 rice 1. Detection of the number of tillers of trans-OsTCP19 rice Under normal conditions, during the reproductive growth period, the number of tillers of the T1 generation trans-OsTCP19 rice strains TO1 and TO2, the control plants of Zhonghua 11, and the control plants of the empty vector were counted for 16 individual plants of each material.

[0056] The results are shown in Fig. 1a and Fig. 1c (the empty vector control is consistent with the control phenotype of Zhonghua 11, so it is omitted in Fig. 1a and Fig. 1c). Compared with the control plants of Zhonghua 11 and the control of the empty vector, the number of tillers of the T1 generation trans-OsTCP19 rice strains TO1 and TO2 decreased significantly. Here, compared with the control plants of Zhonghua 11, the average number of tillers of TO1 decreased from 6.3 to 4.2. Compared with the control plants of Zhonghua 11, the average number of tillers of TO2 decreased from 6.3 to 3.3.

[0057] 2. Detection of the nitrogen responsiveness of tillering of trans-OsTCP19 rice Furthermore, under high-nitrogen and low-nitrogen conditions (low nitrogen: 50 kg ha -1 , high nitrogen: 150 kg ha -1) We counted the tiller numbers of the T1 generation trans - OsTCP19 rice strains TO1 and TO2, the control plants of Zhonghua 11, and the control plants of the empty vector, and calculated the nitrogen response values of the tillers. Specific treatment procedures: In the field experiment, two nitrogen fertilizer gradients (high nitrogen and low nitrogen) were set up. Here, the high - nitrogen treatment group was fertilized with 1.5 kg of urea per 100 m 2 and the low - nitrogen treatment group was fertilized with 0.5 kg of urea per 100 m 2 . The nitrogen response value of the tiller = (the number of tillers in the high - nitrogen treatment group - the number of tillers in the low - nitrogen treatment group) / the number of tillers in the low - nitrogen treatment group. For each material, 16 individual plants were counted under both conditions.

[0058] The results are shown in Figure 2. The T1 generation trans - OsTCP19 rice strains TO1 and TO2 had significantly lower tiller numbers than the control plants of Zhonghua 11 and the control of the empty vector under both low - nitrogen and high - nitrogen conditions (Figure 2a and 2b). Here, under low - nitrogen conditions, compared with the control plants of Zhonghua 11, the average tiller number of TO1 decreased from 5.1 to 3.4, while the average tiller number of TO2 decreased from 5.1 to 2. Under high - nitrogen conditions, compared with the control plants of Zhonghua 11, the average tiller number of TO1 decreased from 9.5 to 5.5, while the average tiller number of TO2 decreased from 9.5 to 2.5. Furthermore, compared with the control plants of Zhonghua 11 and the control of the empty vector, the nitrogen responsiveness of the T1 generation trans - OsTCP19 rice strains TO1 and TO2 was significantly decreased. Here, compared with the control plants of Zhonghua 11, the average nitrogen response value of the tillers of TO1 decreased from 0.8 to 0.4, while the average nitrogen response value of the tillers of TO2 decreased from 0.8 to 0.3 (Figure 2c).

[0059] Example 2: Obtaining of the OsTCP19 mutant of rice and detection of its tillers I. Obtaining of the OsTCP19 mutant of rice 1. Design of sgRNA Array 1 was used as the reference array, and in the OsTCP19 coding region, two pairs of sgRNA primer sequences, namely OsTCP19-U3F / OsTCP19-U3R and OsTCP19-U6aF / OsTCP19-U6aR, were designed respectively. The primer sequences are as follows: OsTCP19-U3F: 5’-ggcAGAGTAGCCATGGATGTCAC-3’; OsTCP19-U3R: 5’-aaacGTGACATCCATGGCTACTCT-3’; OsTCP19-U6aF: 5’-gccGAGCTCGGGCACAAGACCGA-3’; OsTCP19-U6aR: 5’-aaacTCGGTCTTGCCCGAGCT-3’.

[0060] To facilitate subsequent ligation, a ggc connector was added to the 5'-end of the OsTCP19-U3F primer sequence, an aaac connector was added to the 5'-end of the OsTCP19-U3R primer sequence, a gcc connector was added to the 5'-end of the OsTCP19-U6aF primer sequence, and an aaac connector was added to the 5'-end of the OsTCP19-U6aR primer sequence.

[0061] OsTCP19-U3F is the nucleotide sequence at positions 2232-2251 in Array 1, and OsTCP19-U3R is a sequence reverse complementary to the nucleotide sequence at positions 2232-2251 in Array 1. OsTCP19-U6aF is the nucleotide sequence at positions 2505-2524 in Array 1, and OsTCP19-U3R is a sequence reverse complementary to the nucleotide sequence at positions 2505-2524 in Array 1.

[0062] 2. Construction of knockout vector 1) The primer pair of OsTCP19-U3F / OsTCP19-U3R was denatured and annealed to obtain the OsTCP19-U3F / R dimer product. The primer pair of OsTCP19-U6aF / OsTCP19-U6aR was denatured and annealed to obtain the OsTCP19-U6aF / R dimer product. 2) The dimer product of OsTCP19-U3F / R was ligated to the pYLsgRNA-U3 vector, and the dimer product of OsTCP19-U6aF / R was ligated to the pYLsgRNA-U6a vector to obtain two intermediate vectors respectively. Then, according to the steps in the reference: Ma X, Zhang Q, Zhu Q, et al. A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. Mol Plant. 2015;8(8):1274-1284., both of the two intermediate vectors were ligated to the pYLCRISPR / Cas9P ubi -H end vector by the cut-and-join method to obtain a dual-target OsTCP19 CRISPR / Cas9 knockout vector. The dual-target OsTCP19 CRISPR / Cas9 knockout vector contains two sgRNAs designated as sgRNA 1 and sgRNA 2. The target sequence of sgRNA 1 is AGAGTAGCCATGGATGTCAC (sequence 4), and the target sequence of sgRNA 2 is GAGCTCGCGACAAGACCGA (sequence 5).

[0063] 3. Obtaining of OsTCP19 mutants in rice The knockout vector OsTCP19-CRISPR obtained in Step 2 was transformed into Agrobacterium tumefaciens strain AGL1 by the heat shock method and screened to obtain a recombinant Agrobacterium strain containing OsTCP19-CRISPR. The callus of Zhonghua 11 was infected with the recombinant Agrobacterium strain containing OsTCP19-CRISPR. The specific transformation and screening methods refer to "Yi Zili, Cao Shouyun, Wang Li, He Jie (Note: 'Si' in the gold edition), Chu Chengcai, Tang Zuoshun, Zhou Puhua, Tian Wenzhong, Study on Increasing the Frequency of Rice Transformation by Agrobacterium, Journal of Genetics, 2001, 28(4):352-358", and finally, transgenic rice of the T0 generation was obtained.

[0064] 4. Identification of OsTCP19 mutants in rice The transgenic rice of the T0 generation obtained in Step 3 was detected by PCR and sequencing. The specific steps are as follows. The genomic DNA of the transgenic rice of the T0 generation obtained in Step 3 was extracted, and PCR identification was performed using the primers OsTCP19-CRF and OsTCP19-CRR for the OsTCP19 gene, and the PCR product was sequenced to obtain a transgenic strain with the OsTCP19 gene mutated. The primer sequences are as follows: OsTCP19-CRF: 5’-TCTTTCTAGCTCTACCGGCG-3’; OsTCP19-CRR: 5’-CGCCGGGAAGTTCATGAAAT-3’.

[0065] Here, OsTCP19-CRF is the nucleotide sequence at positions 2052-2071 in SEQ ID NO: 1, and OsTCP19-CRR is a sequence reverse complementary to the nucleotide sequence at positions 3136-3155 in SEQ ID NO: 1.

[0066] As identified by sequencing, a total of two mutant pure lines of the OsTCP19 gene were obtained in the T0 generation of transgenic rice, which were named the OsTCP19 mutant T-cr1 of rice and the OsTCP19 mutant T-cr2 of rice, respectively.

[0067] When the OsTCP19 mutant T-cr1 of rice in the T0 generation was compared with the genomic DNA of the wild-type rice Zhonghua 11, the differences were that in the gene encoding the OsTCP19 protein, two chromosomes all had a single-base deletion mutation, and due to the position of the deletion mutation at the 2521st position in Sequence 1, the function of OsTCP19 was lost or decreased.

[0068] When the OsTCP19 mutant T-cr2 of rice in the T0 generation was compared with the genomic DNA of the wild-type rice Zhonghua 11, the differences were that in the gene encoding the OsTCP19 protein, two chromosomes all had a single-base insertion mutation and a 204-base deletion mutation, and the position of the base insertion of the insertion mutation was located between the 2521st position and the 2249th position in Sequence 1, and due to the position of the deletion mutation at the 2319-2522nd positions in Sequence 1, the function of OsTCP19 was lost or decreased.

[0069] Seeds of the OsTCP19 mutants T-cr1 and T-cr2 of rice in the T0 generation were obtained, and the OsTCP19 mutants T-cr1 and T-cr2 of rice in the T1 generation were obtained and used for the following tiller detection.

[0070] II. Tiller Detection of the OsTCP19 Mutant of Rice Under normal conditions, during the reproductive growth period, for the tiller numbers of the OsTCP19 mutants T-cr1 and T-cr2 of rice and the Zhonghua 11 control plants in the T1 generation, each material was statistically analyzed with 24 individual plants respectively.

[0071] The results are shown in Fig. 3. Compared with the control plants of the middle flower, the tiller numbers of the OsTCP19 mutants T-cr1 and T-cr2 of rice both increased significantly. Here, the average tiller number of the OsTCP19 mutant T-cr1 of rice increased from 6.8 to 8.8, and that of T-cr2 increased from 6.8 to 9.2.

[0072] The above are only preferred embodiments of the present invention. For those skilled in the art, without departing from the technical principle of the present invention, some improvements and modifications such as gene editing optimization for the OsTCP19 promoter regulatory sequence or the OsTCP19 gene itself can be made, and it should be noted that these improvements and modifications should also be regarded as within the scope of the rights of the present invention.

Industrial Applicability

[0073] The present invention provides an OsTCP19 protein related to plant yield and nitrogen utilization rate, and obtains trans-OsTCP19 rice and the OsTCP19 mutant of rice by transgenic technology and CRISPR-Cas9 technology respectively. From the experiments, it was found that compared with wild-type rice, the trans-OsTCP19 rice had a decreased tiller number and a reduced nitrogen responsiveness, while the OsTCP19 mutant of rice had an increased tiller number compared with wild-type rice. As can be seen from this, the OsTCP19 protein is responsible for regulating plant yield and nitrogen utilization rate. This forms the basis for breeding high-yield and high-nitrogen utilization rate varieties.

Claims

1. Use of the OsTCP19 protein in the regulation of tillering and / or nitrogen responsiveness in plants, wherein the OsTCP19 protein is a protein represented by any one of the following A1) or A2): A1) A protein consisting of the amino acid sequence shown in SEQ ID NO: 3 in the Sequence Listing; A2) A fusion protein obtained by binding a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO: 3 in the Sequence Listing, and the regulation is any one of the following: B1) Cultivating a transgenic plant showing an increase in the number of tillers; B2) Cultivating a transgenic plant showing a decrease in the number of tillers and / or a decrease in nitrogen responsiveness, including the plant being rice. Use

2. Use of a biological material related to the OsTCP19 protein in any one of the following B1) to B2): B1) Cultivating a transgenic plant showing an increase in the number of tillers; B2) Cultivating a transgenic plant showing a decrease in the number of tillers and / or a decrease in nitrogen responsiveness, wherein the biological material related to the OsTCP19 protein is any one of the following C1) to C8): C1) A nucleic acid molecule encoding the OsTCP19 protein; C2) An expression cassette containing the nucleic acid molecule according to C1); C3) A recombinant vector containing the nucleic acid molecule according to C1); C4) A recombinant vector containing the expression cassette according to C2); C5) A recombinant microorganism containing the nucleic acid molecule according to C1); C6) A recombinant microorganism containing the expression cassette according to C2); C7) A recombinant microorganism containing the recombinant vector according to C3); C8) A recombinant microorganism containing the recombinant vector according to C4), and the OsTCP19 protein is a protein represented by any one of the following A1) or A2): A1) A protein consisting of the amino acid sequence shown in SEQ ID NO: 3 in the Sequence Listing; A2) A fusion protein obtained by binding a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO: 3 in the Sequence Listing, and the plant being rice. Use

3. The use according to claim 2, characterized in that the nucleic acid molecule according to C1) is a DNA molecule according to any one of the following 1) or 2): 1) A genomic DNA molecule shown in SEQ ID NO: 1 in the Sequence Listing; 2) A cDNA molecule shown in SEQ ID NO: 2 in the Sequence Listing.

4. ​ Use of a substance that inhibits the activity of the OsTCP19 protein in cultivating a transgenic plant showing an increase in the number of tillers, or N2) Use of a substance that inhibits the expression of the gene encoding the OsTCP19 protein or a substance that knocks out the gene encoding the OsTCP19 protein in cultivating a transgenic plant showing an increase in the number of tillers wherein the OsTCP19 protein is a protein represented by any one of the following A1) or A2): A1) A protein consisting of the amino acid sequence shown in SEQ ID NO: 3 in the Sequence Listing, A2) A fusion protein obtained by binding a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO: 3 in the Sequence Listing, and the plant is rice, the substance is the CRISPR-Cas9 system, the CRISPR-Cas9 system contains a Cas9 protein and an sgRNA, and the sgRNA targets the sequence of the gene encoding the OsTCP19 protein or its upstream promoter sequence or its non-coding region sequence or its downstream regulatory region sequence, and the target sequences of the sgRNA are the DNA molecule shown in SEQ ID NO: 4 and the DNA molecule shown in SEQ ID NO:

5.

5. A method for cultivating a transgenic plant showing an increase in the number of tillers according to the following D1) or D2): D1) A method comprising the step of inhibiting the activity of the OsTCP19 protein in a target plant to obtain a transgenic plant showing an increase in the number of tillers, or D2) A method comprising the step of inhibiting the expression of the gene encoding the OsTCP19 protein in a target plant or knocking out the gene encoding the OsTCP19 protein in a target plant to obtain a transgenic plant showing an increase in the number of tillers wherein the OsTCP19 protein is a protein represented by any one of the following A1) or A2): A1) A protein consisting of the amino acid sequence shown in SEQ ID NO: 3 in the Sequence Listing, A2) A fusion protein obtained by binding a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO: 3 in the Sequence Listing, and the plant is rice, A method for knocking out the gene encoding the OsTCP19 protein in a target plant includes the step of introducing a CRISPR-Cas9 system into the target plant, wherein the CRISPR-Cas9 system includes a Cas9 protein and an sgRNA, and the sgRNA targets the sequence of the gene encoding the OsTCP19 protein or its upstream promoter sequence or its non-coding region sequence or its downstream regulatory region sequence, The target sequences of the sgRNA are the DNA molecules shown in SEQ ID NO: 4 and the DNA molecules shown in SEQ ID NO:

5. Claim 6 A method for cultivating a transgenic plant showing a decrease in tiller number and / or a decrease in nitrogen responsiveness, which includes the step of increasing the activity and / or content of the OsTCP19 protein in the target plant to obtain a transgenic plant showing a decrease in tiller number and / or a decrease in nitrogen responsiveness, The OsTCP19 protein is a protein represented by any one of the following A1) or A2): A1) A protein consisting of the amino acid sequence shown in SEQ ID NO: 3 in the Sequence Listing, A2) A fusion protein obtained by binding a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO: 3 in the Sequence Listing, wherein The plant is rice. Claim 7 A CRISPR-Cas9 system comprising a Cas9 protein and an sgRNA, wherein the target sequences of the sgRNA are the DNA molecules shown in SEQ ID NO: 4 and the DNA molecules shown in SEQ ID NO:

5. Claim 8 Use of the CRISPR-Cas9 system according to Claim 7 in cultivating a transgenic plant showing an increase in tiller number, wherein the plant is rice.

Images