Humanized IL-4 and IL-4Rα animals

Abstract

To provide non-human animals (e.g. rodent, e.g. murine animal, e.g. mouse or rat) having non-human animal IL-4 and / or IL-4Rα gene humanized in whole or in part, or replaced with human IL-4 and / or IL-4Rα gene comprising a sequence each encoding a human or humanized IL-4 and / or IL-4Rα protein.SOLUTION: Provided are a non-human animal containing a nucleic acid sequence encoding an IL-4 and / or IL-4Rα protein containing a human sequence, a transgenic non-human animal containing the IL-4 and / or IL-4Rα genes that are wholly or partially human, a non-human animal expressing human or humanized IL-4 and / or IL-4Rα protein, and non-human animal having an endogenous non-human animal IL-4 and / or IL-4Rα gene substitution (whole or partial).SELECTED DRAWING: None

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to U.S. Provisional Patent Application No. 61 / 989,757, filed May 7, 2014, the entire contents of which are incorporated herein by reference.

[0002] Incorporation by reference of sequence listing The Sequence Listing, in the form of a 16 KB ASCII text file entitled 31260_SEQ.txt, created May 7, 2015, and submitted to the U.S. Patent and Trademark Office via EFS-Web, is incorporated herein by reference.

[0003] Disclosed herein are non-human animals containing nucleic acid sequences encoding IL-4 and / or IL-4Rα proteins, including human sequences. Also disclosed herein are transgenic non-human animals containing fully or partially human IL-4 and / or IL-4Rα genes. Non-human animals expressing human or humanized IL-4 and / or IL-4Rα proteins are also disclosed. Additionally, methods for making and using non-human animals containing human or humanized IL-4 and / or IL-4Rα nucleic acid sequences are disclosed. [Background technology]

[0004] IL-4 and IL-4Rα are therapeutic targets for treating various human diseases, disorders, and conditions associated with abnormal type 2 helper T (Th2) cells. Evaluation of the pharmacokinetics (PK) and pharmacodynamics (PD) of therapeutic molecules that specifically target human IL-4 or human IL-4Rα proteins is routinely performed in non-human animals, such as rodents (e.g., mice or rats). However, in certain non-human animals, these therapeutic molecules do not target endogenous IL-4 or IL-4Rα proteins, making it impossible to properly determine the PD of such therapeutic molecules.

[0005] Furthermore, evaluation of the therapeutic efficacy of human-specific IL-4 and IL-4Rα protein antagonists using various non-human animal models of diseases associated with abnormal Th2 cells is problematic in non-human animals in which such species-specific antagonists do not interact with endogenous IL-4 or IL-4Rα proteins.

[0006] Thus, there is a need for a non-human animal (e.g., a rodent, e.g., a murine animal, e.g., a mouse or rat) in which the IL-4 and / or IL-4Rα genes of the non-human animal have been wholly or partially humanized or have been replaced (e.g., at the endogenous non-human locus) with human IL-4 and / or IL-4Rα genes comprising sequences encoding human or humanized IL-4 and / or IL-4Rα proteins, respectively.

[0007] There is also a need for non-human animals that include IL-4 and / or IL-4Rα genes (e.g., humanized or human) in which the IL-4 and / or IL-4R genes are under the control of non-human regulatory elements (e.g., endogenous regulatory elements).

[0008] expressing human or humanized IL-4 protein in the blood, plasma, or serum at a concentration similar to the concentration of IL-4 protein present in the blood, plasma, or serum of a non-human animal of the same age that expresses functional IL-4 protein but does not contain a human or humanized IL-4 gene, and / or expressing functional IL-4Rα protein but does not contain a human or humanized IL-4 gene. There is also a need for humanized non-human animals that express human or humanized IL-4Rα protein on immune cells (e.g., B cells and T cells) at levels similar to the levels of IL-4Rα protein on immune cells (e.g., B cells and T cells) of age-matched non-human animals that do not contain the IL-4Rα gene. Summary of the Invention [Means for solving the problem]

[0009] Non-human animals are provided that contain nucleic acid sequences encoding IL-4 and / or IL-4Rα proteins that contain human sequences.

[0010] Transgenic non-human animals are provided that contain IL-4 and / or IL-4Rα genes that are fully or partially human.

[0011] Non-human animals that express human or humanized IL-4 and / or IL-4Rα proteins are provided.

[0012] Non-human animals are provided that have replacements (whole or partial) of the endogenous non-human animal IL-4 and / or IL-4Rα genes.

[0013] Non-human animals are provided that comprise humanization (full or partial) of IL-4 and / or IL-4Rα at the endogenous non-human IL-4 and / or IL-4Rα locus.

[0014] Non-human animals are provided that have a human or humanized IL-4 gene, which do not express endogenous IL-4 protein, and which express human or humanized IL-4 protein in their blood, plasma, or serum at concentrations similar to the concentrations of IL-4 protein present in the blood, plasma, or serum of age-matched non-human animals that express functional endogenous IL-4 protein but do not contain the human or humanized IL-4 gene.

[0015] A non-human animal having a human or humanized IL-4Rα gene is provided, which does not express endogenous IL-4Rα protein, and which expresses human or humanized IL-4Rα protein on immune cells (e.g., B cells and T cells) at levels similar to the levels of IL-4Rα protein present on immune cells (e.g., B cells and T cells) of an age-matched non-human animal that expresses functional endogenous IL-4Rα protein but does not contain the human or humanized IL-4Rα gene.

[0016] In one aspect, a non-human animal is provided that comprises a human or humanized IL-4 and / or IL-4Rα nucleic acid sequence.

[0017] In one aspect, a genetically modified non-human animal is provided that comprises a replacement of a gene encoding endogenous IL-4 and / or IL-4Rα at the endogenous IL-4 and / or IL-4Rα locus with a gene encoding a human or humanized IL-4 and / or IL-4Rα protein. A rodent (e.g., a mouse or rat) is provided that comprises a replacement of an endogenous IL-4 gene at the endogenous rodent IL-4 locus with a human IL-4 gene and / or a replacement of an endogenous IL-4Rα gene at the endogenous rodent IL-4Rα locus with a human IL-4Rα gene. In one embodiment, the rodent is a mouse. In one embodiment, the rodent is a rat.

[0018] In one aspect, a genetically modified rodent (e.g., mouse or rat) is provided that comprises humanization of an endogenous rodent IL-4 gene, the humanization comprising subcloning at least one locus of a human IL-4 gene at the endogenous rodent IL-4 locus to form a modified IL-4 gene. and a replacement of a rodent nucleic acid comprising at least one exon of a rodent IL-4 gene with a nucleic acid sequence comprising an exon of the rodent IL-4 gene, wherein expression of the modified IL-4 gene is under the control of rodent regulatory elements of the endogenous rodent IL-4 locus.

[0019] In one embodiment, the rodent is a mouse or a rat. In one embodiment, the rodent is a mouse. In one embodiment, the rodent is a rat.

[0020] In one embodiment, the modified IL-4 gene encodes a human or humanized IL-4 protein and comprises exons 1 through 4 starting from the ATG start codon of the human IL-4 gene.

[0021] In one embodiment, the rodent is a mouse that does not have the ability to express mouse IL-4 protein.

[0022] In one embodiment, the rodent is a mouse that expresses a mouse IL-4Rα protein encoded by an endogenous mouse IL-4Rα gene.

[0023] In one embodiment, the rodent is a mouse expressing a human or humanized IL-4Rα protein.

[0024] In one embodiment, the humanized IL-4Rα protein comprises the extracellular domain of a human IL-4Rα protein.

[0025] In one embodiment, the humanized IL-4Rα protein comprises the transmembrane and cytoplasmic domains of the mouse IL-4Rα protein.

[0026] In one embodiment, the rodent is a mouse comprising a replacement, at the endogenous mouse IL-4Rα locus, of a mouse nucleic acid comprising at least one exon of the mouse IL-4Rα gene with a nucleic acid sequence comprising at least one exon of the human IL-4Rα gene to form a modified IL-4Rα gene, wherein expression of the modified IL-4Rα gene is under the control of mouse regulatory elements of the endogenous mouse IL-4Rα locus.

[0027] In one embodiment, the rodent is a mouse, and a contiguous genomic fragment of the mouse IL-4 sequence comprising exons 1 through 4 starting from the ATG start codon of mouse IL-4 is identical to exons 1 through 4 starting from the ATG start codon of human IL-4. It has been replaced with a contiguous genomic fragment of the human IL-4 sequence containing exons 1 through 4.

[0028] In one embodiment, expression of the modified IL-4Rα gene encoding the human or humanized IL-4Rα protein is under the control of mouse regulatory elements of the endogenous mouse IL-4Rα locus.

[0029] In one aspect, a genetically modified rodent (e.g., a mouse or rat) is provided that comprises humanization of an endogenous rodent IL-4Rα gene, wherein the humanization comprises replacement of rodent nucleic acid comprising an exon of the rodent IL-4Rα gene with a nucleic acid sequence encoding at least one exon of the human IL-4Rα gene at the endogenous rodent IL-4Rα locus to form a modified (i.e., humanized) IL-4Rα gene, wherein expression of the modified, humanized IL-4Rα gene is under the control of rodent regulatory elements at the endogenous rodent IL-4Rα locus.

[0030] In one embodiment, the rodent is a mouse or a rat. In one embodiment, the rodent is a rat.

[0031] In one embodiment, the modified IL-4Rα gene encodes a human or humanized IL-4Rα protein and comprises exons 1 through 5 starting from the ATG start codon of the human IL-4Rα gene.

[0032] In one embodiment, the rodent is a mouse that is incapable of expressing mouse IL-4Rα protein.

[0033] In one embodiment, the rodent is a mouse that expresses mouse IL-4 protein encoded by an endogenous mouse IL-4 gene.

[0034] In one embodiment, the rodent is a mouse expressing a human or humanized IL-4 protein.

[0035] In one embodiment, the rodent is a mouse comprising a replacement of a mouse nucleic acid comprising an exon of the mouse IL-4 gene with a nucleic acid sequence encoding at least one exon of the human IL-4 gene at the endogenous mouse IL-4 locus to form a modified IL-4 gene, wherein expression of the modified IL-4 gene is under the control of mouse regulatory elements of the endogenous mouse IL-4 locus.

[0036] In one embodiment, the rodent is a mouse, and a contiguous genomic fragment of the mouse IL-4Rα sequence comprising exons 1 through 5 starting from the ATG start codon of IL-4Rα has been replaced with a contiguous genomic fragment of the human IL-4Rα sequence comprising exons 1 through 5 starting from the ATG start codon of human IL-4Rα.

[0037] In one aspect, a genetically modified rodent (e.g., a mouse or rat) expressing a human or humanized IL-4 protein is provided, wherein the rodent expressing the human or humanized IL-4 protein comprises a normal immune system, i.e., the number of immune cells (e.g., B cells and T cells) in the blood, plasma, or serum of the rodent expressing the human or humanized IL-4 protein is similar to the number of immune cells (e.g., B cells and T cells) in the blood, plasma, or serum of a rodent expressing functional endogenous IL-4 protein. In one embodiment, the rodent is a mouse. In one embodiment, the rodent is a rat.

[0038] In one aspect, a genetically modified rodent (e.g., a mouse or rat) is provided that expresses an IL-4 protein derived from a human or humanized IL-4 gene, wherein the rodent expresses the human or humanized IL-4 protein in its serum. In one embodiment, the rodent is a mouse. In one embodiment, the rodent is a rat.

[0039] In one embodiment, the serum of a rodent expressing human or humanized IL-4 protein has approximately the same level of IL-4 protein as a rodent expressing functional endogenous IL-4 protein (e.g., a wild-type mouse or rat). In one embodiment, the rodent is a mouse. In one embodiment, the rodent is a rat.

[0040] In one embodiment, the mouse expresses human or humanized IL-4 protein in its serum at a concentration of at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, or 200% of the level of IL-4 protein present in the serum of an age-matched mouse that expresses functional endogenous IL-4 protein but does not comprise a replacement of an endogenous IL-4 gene with a human IL-4 gene at the endogenous mouse IL-4 locus. do.

[0041] In one embodiment, the mouse expresses human or humanized IL-4 protein in its serum at a concentration of about 10% to about 200%, about 20% to about 150%, or about 30% to about 100% of the level of mouse IL-4 protein present in the serum of an age-matched mouse that expresses functional endogenous IL-4 protein but does not contain a replacement of the endogenous IL-4 gene with a human IL-4 gene at the endogenous mouse IL-4 locus.

[0042] In one aspect, a genetically modified rodent (e.g., a mouse or rat) is provided that expresses a human or humanized IL-4Rα protein on immune cells (e.g., B cells and T cells) at a level similar to the level of IL-4Rα protein present on immune cells (e.g., B cells and T cells) of an age-matched rodent that expresses functional endogenous IL-4Rα protein. In one embodiment, the rodent is a mouse. In one embodiment, the rodent is a rat.

[0043] In one aspect, a genetically modified rodent (e.g., a mouse or rat) is provided that expresses an IL-4Rα protein derived from the human IL-4Rα gene, wherein the rodent expresses the human or humanized IL-4Rα protein on immune cells (e.g., B cells and T cells). In one embodiment, the rodent is a mouse. In one embodiment, the rodent is a rat.

[0044] In one embodiment, immune cells (e.g., B cells and T cells) of a rodent expressing human or humanized IL-4Rα protein have approximately the same levels of IL-4Rα protein as immune cells (e.g., B cells and T cells) of a rodent (e.g., a wild-type mouse or rat) expressing functional endogenous IL-4Rα protein. In one embodiment, the rodent is a mouse. In one embodiment, the rodent is a rat.

[0045] In one embodiment, the mouse expresses human or humanized IL-4Rα protein on immune cells (e.g., B cells and T cells) in an amount that is at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, or 200% of the amount of IL-4Rα protein on immune cells (e.g., B cells and T cells) of an age-matched mouse that expresses functional endogenous IL-4Rα protein but does not comprise a replacement of the endogenous IL-4Rα gene with a human IL-4Rα gene at the endogenous mouse IL-4Rα locus.

[0046] In one embodiment, the mouse expresses human or humanized IL-4Rα protein on immune cells (e.g., B cells and T cells) in an amount that is about 10% to about 200%, about 20% to about 150%, or about 30% to about 100% of the amount of mouse IL-4Rα protein present on immune cells (e.g., B cells and T cells) of an age-matched mouse that expresses functional endogenous IL-4Rα protein but does not contain a replacement of the endogenous IL-4Rα gene with a human IL-4Rα gene at the endogenous mouse IL-4Rα locus.

[0047] In one aspect, a genetically modified rodent is provided that comprises a humanized IL-4Rα gene comprising a replacement of a rodent IL-4Rα ectodomain coding sequence with a human IL-4Rα ectodomain coding sequence, wherein the humanized IL-4Rα gene comprises a rodent IL-4Rα transmembrane sequence and a rodent IL-4Rα cytoplasmic sequence, wherein the humanized IL-4Rα gene is under the control of endogenous rodent IL-4Rα regulatory elements at the endogenous IL-4Rα locus, and wherein the rodent further comprises a humanized IL-4 gene encoding a human or humanized IL-4 protein, wherein the humanized IL-4 gene is under the control of endogenous rodent IL-4 regulatory elements at the endogenous IL-4 locus.

[0048] In one embodiment, the rodent is a mouse or a rat. In one embodiment, the rodent is a mouse. In one embodiment, the rodent is a rat.

[0049] In one embodiment, the mouse is incapable of expressing mouse IL-4 protein and is incapable of expressing mouse IL-4Rα protein.

[0050] In one embodiment, the rodent regulatory elements or sequences of the endogenous rodent IL-4 locus and / or rodent IL-4Rα locus are derived from a mouse or rat.

[0051] In one embodiment, the rodent regulatory elements or sequences are endogenous rodent regulatory elements or sequences of the rodent IL-4 locus and / or the rodent IL-4Rα locus.

[0052] In one aspect, a non-human animal (e.g., a rodent, e.g., a mouse or rat) is provided that expresses human or humanized IL-4 and / or IL-4Rα protein, wherein the non-human animal expresses the human or humanized IL-4 and / or IL-4Rα protein from an endogenous non-human IL-4Rα locus and / or an endogenous non-human IL-4Rα locus. In one embodiment, the non-human animal is a rodent. In one embodiment, the rodent is a mouse. In one embodiment, the rodent is a rat.

[0053] In one aspect, a genetically modified mouse is provided that expresses a human or humanized IL-4 protein from an endogenous mouse IL-4 locus, wherein the endogenous mouse IL-4 gene has been replaced, in whole or in part, with a human IL-4 gene.

[0054] In one embodiment, approximately 6.3 kb of contiguous mouse genomic nucleic acid of the endogenous mouse IL-4 locus, including exon 1 starting from the ATG start codon through exon 4 (including the 3' untranslated region) and a portion of the 3' region downstream of exon 4, is removed and replaced with approximately 8.8 kb of human IL-4 nucleic acid sequence, including exon 1 starting from the ATG start codon through exon 4 (including the 3' untranslated region) and a portion of the 3' region downstream of exon 4 of the human IL-4 gene. In a specific embodiment, the human IL-4 nucleic acid sequence replacing the mouse genomic nucleic acid includes exon 1 starting from the ATG start codon through exon 4 and a portion of the 3' region downstream of exon 4 of the human IL-4 gene of human BAC RP11-17K19. In certain embodiments, the modified IL-4 gene comprises the mouse IL-4 5' regulatory element and human IL-4 exon 1 through exon 4 (ie, the IL-4 protein coding sequence) starting from the ATG start codon.

[0055] In one aspect, a genetically modified mouse is provided that comprises a nucleotide sequence encoding a human or humanized IL-4 protein, wherein the nucleotide sequence encoding the human or humanized IL-4 protein replaces, in whole or in part, an endogenous nucleotide sequence encoding the endogenous mouse IL-4 protein.

[0056] In one aspect, a genetically modified mouse is provided that expresses a human or humanized IL-4Rα protein from the endogenous mouse IL-4Rα locus, wherein the endogenous mouse IL-4Rα gene has been replaced, in whole or in part, with a human IL-4Rα gene.

[0057] In one embodiment, approximately 7.1 kb of contiguous mouse genomic nucleic acid of the endogenous mouse IL-4Rα locus, including exon 1 starting from the ATG start codon through exon 5 and a portion of intron 5, is deleted and replaced with approximately 15.6 kb of human IL-4Rα nucleic acid sequence, including exon 1 starting from the ATG start codon through exon 5 and a portion of intron 5 of the human IL-4Rα gene. In a specific embodiment, the mouse genomic nucleic acid is replaced with The human IL-4α nucleic acid to be replaced comprises exon 1 starting from the ATG start codon of the human IL-4α gene of human BAC RP11-16E24 through exon 5 and a portion of intron 5. In a specific embodiment, the human IL-4Rα nucleic acid to be replaced with the mouse genomic nucleic acid comprises the entire human IL-4Rα extracellular domain coding sequence.

[0058] In one aspect, a method for making a humanized IL-4 rodent is provided, comprising replacing a rodent IL-4 gene sequence encoding a rodent IL-4 protein with a human IL-4 nucleic acid sequence comprising one or more exons of the human IL-4 gene sequence to form a modified humanized IL-4 gene encoding a human or humanized IL-4 protein, wherein the replacement is made at an endogenous rodent IL-4 locus, and the humanized IL-4 gene sequence comprising one or more exons of the human IL-4 gene sequence, wherein the humanized IL-4 gene sequence encoding the human or humanized IL-4 protein, is operably linked to rodent regulatory elements or sequences (e.g., 5' and / or 3' regulatory elements) of the endogenous rodent IL-4 locus.

[0059] In one embodiment, the rodent is a mouse or a rat. In one embodiment, the rodent is a mouse. In one embodiment, the rodent is a rat.

[0060] In one embodiment, the rodent regulatory elements or sequences are of mouse origin, hi one embodiment, the rodent regulatory elements or sequences are of rat origin.

[0061] In one embodiment, the rodent regulatory element or sequence is an endogenous rodent regulatory element or sequence of the rodent IL-4 locus. In one embodiment, the rodent is a mouse. In one embodiment, the rodent is a rat.

[0062] In one embodiment, the human IL-4 nucleic acid sequence that replaces the rodent IL-4 gene sequence comprises at least one exon of the human IL-4 gene sequence. In other embodiments, the human IL-4 nucleic acid sequence that replaces the rodent IL-4 gene sequence comprises at least two or at least three exons of the human IL-4 gene sequence. In one embodiment, the human IL-4 nucleic acid sequence that replaces the rodent IL-4 gene sequence comprises all four exons of the human IL-4 gene sequence. In one embodiment, the rodent is a mouse. In one embodiment, the rodent is a rat.

[0063] In one embodiment, the human IL-4 nucleic acid sequence that replaces the rodent IL-4 gene sequence is human IL-4 (e.g., by the nucleic acid set forth in GenBank Accession No. NM_000589.3s). The human IL-4 protein encoded by the IL-4 gene is about 85%, 90%, 95%, 96%, 97%, 98%, or about 99% identical to the human IL-4 protein encoded by the IL-4 gene.

[0064] In one embodiment, the substitution is made in an endogenous rodent IL-4 locus, and a humanized IL-4 gene sequence comprising one or more exons of a human IL-4 gene sequence, wherein the humanized IL-4 gene sequence encodes a human or humanized IL-4 protein, is operably linked to endogenous rodent regulatory elements or sequences (e.g., 5' and / or 3' regulatory elements) of the endogenous rodent IL-4 locus.

[0065] In one aspect, a method for producing a humanized IL-4 mouse is provided, comprising replacing a mouse IL-4 gene sequence encoding a mouse IL-4 protein with a human IL-4 gene sequence to form a modified humanized IL-4 gene encoding a human or humanized IL-4 protein.

[0066] In one embodiment, the substitution is made in the endogenous mouse IL-4 locus, resulting in The humanized IL-4 gene encoding the human or humanized IL-4 protein to be produced is operably linked to mouse regulatory elements or sequences (e.g., 5' and / or 3' regulatory elements) of the endogenous mouse IL-4 locus.

[0067] In one embodiment, the substitution is made in the endogenous mouse IL-4 locus, and the humanized IL-4 gene encoding the human or humanized IL-4 protein is operably linked to endogenous mouse regulatory elements or sequences (e.g., 5' and / or 3' regulatory elements) of the endogenous mouse IL-4 locus.

[0068] In one aspect, a method for producing a humanized IL-4Rα rodent is provided, comprising replacing a rodent IL-4Rα gene sequence encoding the rodent IL-4Rα protein with a human IL-4Rα nucleic acid sequence comprising one or more exons of the human IL-4Rα gene sequence to form a modified humanized IL-4Rα gene encoding a human or humanized IL-4Rα protein, wherein the replacement is made in the endogenous rodent IL-4Rα locus, and the humanized IL-4Rα gene sequence comprising one or more exons of the human IL-4Rα gene sequence, wherein the humanized IL-4Rα gene sequence encoding the human or humanized IL-4Rα protein, is operably linked to rodent regulatory elements or sequences (e.g., 5' and / or 3' regulatory elements) of the endogenous rodent IL-4Rα locus.

[0069] In one embodiment, the rodent is a mouse or a rat. In one embodiment, the rodent is a mouse. In one embodiment, the rodent is a rat.

[0070] In one embodiment, the rodent regulatory elements or sequences are of mouse origin, hi one embodiment, the rodent regulatory elements or sequences are of rat origin.

[0071] In one embodiment, the rodent regulatory element or sequence is an endogenous rodent regulatory element or sequence of the rodent IL-4Rα locus. In one embodiment, the rodent is a mouse. In one embodiment, the rodent is a rat.

[0072] In one embodiment, the human IL-4Rα nucleic acid sequence that replaces the rodent IL-4Rα gene sequence comprises at least one exon of the human IL-4Rα gene sequence. In other embodiments, the human IL-4Rα nucleic acid sequence that replaces the rodent IL-4αR gene sequence comprises at least two, three, four, five, six, seven, or eight exons of the human IL-4Rα gene sequence. In one embodiment, the human IL-4Rα nucleic acid sequence that replaces the rodent IL-4Rα gene sequence comprises all nine exons of the human IL-4Rα gene sequence. In one embodiment, the rodent is a mouse. In one embodiment, the rodent is a rat.

[0073] In one embodiment, the human IL-4Rα nucleic acid sequence that replaces the rodent IL-4Rα gene sequence encodes a protein that is about 85%, 90%, 95%, 96%, 97%, 98%, or about 99% identical to human IL-4Rα (e.g., the human IL-4Rα protein encoded by the nucleic acid set forth in GenBank Accession No. NM_000418.3).

[0074] In one embodiment, the human IL-4Rα nucleic acid sequence that replaces the rodent IL-4Rα gene sequence comprises at least one exon of the human IL-4Rα gene sequence that encodes the extracellular domain of the human IL-4Rα protein. In other embodiments, the human IL-4Rα nucleic acid sequence that replaces the rodent IL-4Rα gene sequence comprises at least two, three, or four exons of the human IL-4Rα gene sequence that encodes the extracellular domain of the human IL-4Rα protein. In one embodiment, the human IL-4Rα nucleic acid sequence that replaces the rodent IL-4Rα gene sequence comprises all five exons of the human IL-4Rα gene sequence that encodes the extracellular domain of the human IL-4Rα protein. In one embodiment, the rodent is a mouse. In one embodiment, the rodent is a rat.

[0075] In one embodiment, the human or humanized IL-4Rα gene sequence that replaces the rodent IL-4Rα gene sequence is a human IL-4Rα protein (e.g., GenBank Accession No. The human IL-4Rα protein encoded by the nucleic acid designated NM_000418.3 The extracellular domain of the IL-4Rα protein is about 85%, 90%, 95%, 96%, 97%, 98%, or about 99% identical to the extracellular domain.

[0076] In one embodiment, the substitution is made in the endogenous rodent IL-4Rα locus, and a humanized IL-4Rα gene sequence comprising one or more exons of the human IL-4Rα gene sequence, wherein the humanized IL-4Rα gene sequence encodes a human or humanized IL-4Rα protein, is operably linked to endogenous rodent regulatory elements or sequences (e.g., 5' and / or 3' regulatory elements) of the endogenous rodent IL-4Rα locus.

[0077] In one embodiment, a method for generating a humanized IL-4Rα mouse is provided, comprising replacing a mouse IL-4Rα gene sequence encoding the mouse IL-4Rα protein with a human IL-4Rα nucleic acid sequence to form a modified humanized IL-4Rα gene encoding a human or humanized IL-4Rα protein.

[0078] In one embodiment, the substitution is made in the endogenous mouse IL-4Rα locus, and the humanized IL-4Rα gene encoding the human or humanized IL-4Rα protein is operably linked to mouse regulatory elements or sequences (e.g., 5' and / or 3' regulatory elements) of the endogenous mouse IL-4Rα locus.

[0079] In one embodiment, the substitution is made in the endogenous mouse IL-4Rα locus, and the humanized IL-4Rα gene encoding the human or humanized IL-4Rα protein is operably linked to endogenous mouse regulatory elements or sequences (e.g., 5' and / or 3' regulatory elements) of the endogenous mouse IL-4Rα locus.

[0080] In various aspects, the genetically modified non-human animals (e.g., rodents, e.g., mice or rats) described herein contain genetic modifications in their germline.

[0081] In one aspect, a non-human animal (e.g., rodent, e.g., mouse or rat) embryo is provided that includes a genetic modification as described herein.

[0082] In one aspect, a non-human animal (e.g., rodent, e.g., mouse or rat) host embryo is provided that comprises a donor cell that includes a genetic modification as described herein.

[0083] In one aspect, a pluripotent or totipotent non-human animal (e.g., rodent, e.g., mouse or rat) cell is provided that comprises a genetic modification as described herein. In one embodiment, the cell is a rodent cell. In one embodiment, the cell is a mouse cell. In one embodiment, the cell is a rodent ES cell. In one embodiment, the cell is a mouse ES cell.

[0084] In one aspect, a non-human animal (e.g., a rodent, e.g., a mouse or rat) egg is provided, wherein the non-human animal egg comprises an ectopic non-human animal chromosome, and the ectopic non-human animal chromosome comprises a genetic modification as described herein. In one embodiment, the non-human animal is a rodent. In one embodiment, the rodent is a mouse. In one embodiment, the rodent is a rat.

[0085] In one embodiment, the gene is genetically modified to include the human IL-4 gene or the human IL-4Rα gene. The modified mouse embryos, eggs, or cells are from a C57BL strain of mouse selected from C57BL / A, C57BL / An, C57BL / GrFa, C57BL / KaLwN, C57BL / 6, C57BL / 6J, C57BL / 6ByJ, C57BL / 6NJ, C57BL / 10, C57BL / 10ScSn, C57BL / 10Cr, and C57BL / Ola. In another embodiment, the mouse is a 129 strain selected from the group consisting of strains that are 129P1, 129P2, 129P3, 129X1, 129S1 (e.g., 129S1 / SV, 129S1 / Svlm), 129S2, 129S4, 129S5, 129S9 / SvEvH, 129S6 (129 / SvEvTac), 129S7, 129S8, 129T1, 129T2 (see, e.g., Festing et al. (1999) Revised nomenclature for strain 129 mice, Mammalian Genome 10:836; see also, Auerbach et al. (2000) Establishment and Chimera Analysis of 129 / SvEv- and C57BL / 6-Derived (See also Mouse Embryonic Stem Cell Lines). In a specific embodiment, the genetically modified mouse is a mix of the aforementioned 129 strain and the aforementioned C57BL / 6 strain. In another specific embodiment, the mouse is a mix of the aforementioned 129 strains, or a mix of the aforementioned BL / 6 strains. In a specific embodiment, the 129 strain in the mix is ​​the 129S6 (129 / SvEvTac) strain. In another embodiment, the mouse is a BALB strain, e.g., a BALB / c strain. In yet another embodiment, the mouse is a mix of a BALB strain and another of the aforementioned strains. In one embodiment, the mouse is a Swiss mouse or a Swiss Webster mouse.

[0086] In various aspects, the non-human animal comprising a human or humanized IL-4R and / or IL-4 nucleic acid sequence is selected from mammals and birds. In one embodiment, the non-human animal is a mammal. In one embodiment, the mammal is a murine.

[0087] In one embodiment, a method for screening for human-specific IL-4 or IL-4Rα antagonists is provided. The method is useful for identifying potential therapeutic agents and evaluating therapeutic efficacy. The method includes administering an agent to a genetically modified rodent in which IL-4 and IL-4Rα have been doubly humanized as described herein, determining the effect of the agent on a biological function mediated by the IL-4 / IL-4Rα signaling pathway, and identifying the agent as a human-specific IL-4 or IL-4Rα antagonist if the agent antagonizes the function mediated by the IL-4 / IL-4Rα signaling pathway in the genetically modified rodent.

[0088] In one embodiment, the agent comprises an immunoglobulin variable domain that binds to IL-4 or IL-4Rα. In one embodiment, the agent specifically binds to human IL-4 or IL-4Rα but does not bind to rodent IL-4 or IL-4Rα. In one embodiment, the agent is an antibody. In a specific embodiment, the agent is an antibody that specifically binds to human IL-4Rα but does not bind to rodent IL-4Rα.

[0089] In one embodiment, the screening method utilizes a doubly humanized mouse expressing human IL-4 protein and a humanized IL-4Rα protein, where the humanized IL-4Rα protein comprises the extracellular domain of the human IL-4Rα protein linked to the transmembrane and cytoplasmic domains of the endogenous mouse IL-4Rα protein, and where the mouse does not express murine IL-4 or murine IL-4Rα.

[0090] In some embodiments, the method of screening involves inducing a disease associated with IL-4 / IL-4Rα signaling in a doubly humanized rodent as described herein, administering an agent to the rodent, and determining whether the agent ameliorates the disease. and if the agent ameliorates the disease, identifying the agent as a human-specific IL-4 or IL-4Rα antagonist suitable for treating the disease.

[0091] In some embodiments, the disease associated with IL-4 / IL-4Rα signaling is airway inflammation, which can be induced in rodents by intranasal administration of an allergen (e.g., house dust mite extract) one or more times over a period of time. The effectiveness of the agent can be determined by measuring whether administration of the agent results in a reduction in the degree of airway inflammation (e.g., as indicated by mucus accumulation, infiltrating cells in bronchoalveolar lavage fluid, and / or levels of total circulating IgE).

[0092] In some embodiments, the disease associated with IL-4 / IL-4Rα signaling is skin inflammation or atopic dermatitis, which can be induced in rodents by creating skin damage and exposing the damaged skin to an allergen (e.g., bacterial toxin or dust mite extract) for a period of time, one or more times. The effectiveness of the agent can be determined by measuring whether skin inflammation is reduced as a result of administration of the agent.

[0093] In a further embodiment, a triply humanized non-human animal whose IL-4, IL-4Rα, and IL-33 genes have been humanized as described herein is used to evaluate the pharmacodynamics (PD) and therapeutic efficacy of a compound or combination of compounds.

[0094] Each of the aspects and embodiments described herein can be used together unless expressly or obviously excluded from the context of the embodiment or aspect. In certain embodiments, for example, the following are provided: (Item 1) A rodent comprising humanization of an endogenous rodent IL-4R gene, wherein the humanization comprises replacement of a rodent nucleic acid comprising an exon of an IL-4 gene with a nucleic acid sequence comprising at least one exon of a human IL-4 gene at the endogenous rodent IL-4 locus to form a modified IL-4 gene, wherein expression of the modified IL-4 gene is under the control of rodent regulatory elements at the endogenous rodent IL-4 locus. (Item 2) 2. The rodent of item 1, wherein the rodent is a mouse or a rat. (Item 3) 2. The rodent of item 1, wherein the modified IL-4 gene encodes a human or humanized IL-4 protein and comprises exons 1 to 4 starting from the ATG start codon of the human IL-4 gene. (Item 4) 2. The rodent of item 1, wherein the rodent is a mouse that does not have the ability to express mouse IL-4 protein. (Item 5) 2. The rodent according to item 1, wherein the rodent is a mouse that expresses a mouse IL-4Rα protein encoded by an endogenous mouse IL-4Rα gene. (Item 6) 2. The rodent of item 1, wherein the rodent is a mouse expressing human or humanized IL-4Rα protein. (Item 7) 7. The mouse according to item 6, wherein the humanized IL-4Rα protein comprises the extracellular domain of the human IL-4Rα protein. (Item 8) 8. The mouse according to item 7, wherein the humanized IL-4Rα protein comprises the transmembrane domain and cytoplasmic domain of the mouse IL-4Rα protein. (Item 9) 7. The mouse of item 6, wherein the mouse comprises a replacement of mouse nucleic acid comprising an exon of the mouse IL-4Rα gene with a nucleic acid sequence encoding at least one exon of the human IL-4Rα gene at the endogenous mouse IL-4Rα locus to form a modified IL-4Rα gene, wherein expression of the modified IL-4Rα gene is under the control of mouse regulatory elements at the endogenous mouse IL-4Rα locus. (Item 10) 2. The rodent according to Item 1, wherein the rodent is a mouse, and a contiguous genomic fragment of the mouse IL-4 sequence comprising exons 1 to 4 starting from the ATG start codon of mouse IL-4 has been replaced with a contiguous genomic fragment of the human IL-4 sequence comprising exons 1 to 4 starting from the ATG start codon of human IL-4. (Item 11) 2. The rodent of item 1, wherein the rodent expresses human or humanized IL-4 protein in its serum at a concentration of at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, or 200% of the level of mouse IL-4 protein present in the serum of an age-matched mouse that expresses functional endogenous mouse IL-4 protein but does not contain the substitution. (Item 12) 2. The rodent according to Item 1, wherein the rodent is a mouse that expresses human IL-4 protein in its serum at a concentration of about 10% to about 200%, about 20% to about 150%, or about 30% to about 100% of the level of mouse IL-4 protein present in the serum of a mouse of the same age that expresses functional endogenous mouse IL-4 protein but does not contain the substitution. (Item 13) A rodent comprising humanization of an endogenous rodent IL-4Rα gene, wherein the humanization comprises replacement of a rodent nucleic acid comprising an exon of the rodent IL-4Rα gene with a nucleic acid sequence comprising at least one exon of the human IL-4Rα gene at the endogenous rodent IL-4Rα locus to form a humanized IL-4Rα gene, wherein expression of the humanized IL-4Rα gene is under the control of rodent regulatory elements at the endogenous rodent IL-4Rα locus. (Item 14) 14. The rodent of item 13, wherein the rodent is a mouse or a rat. (Item 15) 14. The rodent according to Item 13, wherein the humanized IL-4Rα gene encodes a human or humanized IL-4Rα protein and comprises exons 1 to 5 starting from the ATG start codon of the human IL-4Rα gene. (Item 16) Item 14. The rodent according to Item 13, wherein the rodent is a mouse that does not have the ability to express mouse IL-4Rα protein. (Item 17) 14. The rodent of item 13, wherein the rodent is a mouse that expresses mouse IL-4 protein encoded by an endogenous mouse IL-4 gene. (Item 18) 18. The mouse of item 17, wherein the rodent is a mouse that expresses human or humanized IL-4 protein. (Item 19) the mouse comprises a replacement of a mouse nucleic acid comprising an exon of the mouse IL-4 gene with a nucleic acid sequence comprising at least one exon of the human IL-4 gene at the endogenous mouse IL-4 locus to form a modified IL-4 gene, wherein expression of the modified IL-4 gene is under the control of mouse regulatory elements of the endogenous mouse IL-4 locus. Item 19. The mouse according to item 18. (Item 20) 14. The rodent according to Item 13, wherein the rodent is a mouse, and a contiguous genomic fragment of the mouse IL-4Rα sequence comprising exons 1 to 5 starting from the ATG start codon of mouse IL-4Rα has been replaced with a contiguous genomic fragment of the human IL-4Rα sequence comprising exons 1 to 5 starting from the ATG start codon of human IL-4Rα. (Item 21) 14. The rodent according to Item 13, wherein the rodent expresses human or humanized IL-4Rα protein on either B cells and / or T cells in an amount that is at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, or 200% of the level of mouse IL-4Rα protein present on either B cells and / or T cells of an age-matched mouse that expresses functional endogenous mouse IL-4Rα protein but does not contain the substitution. (Item 22) Item 14. The rodent according to Item 13, wherein the rodent expresses human or humanized IL-4Rα protein on either B cells and / or T cells in an amount that is about 10% to about 200%, about 20% to about 150%, or about 30% to about 100% of the level of mouse IL-4Rα protein present on either B cells and / or T cells of an age-matched mouse that expresses functional endogenous mouse IL-4Rα protein but does not contain the substitution. (Item 23) 1. A method for producing a humanized rodent, comprising replacing a rodent IL-4 nucleic acid sequence with a human IL-4 nucleic acid sequence comprising one or more exons of the human IL-4 gene to form a modified IL-4 gene encoding a human or humanized IL-4 protein, wherein the replacement is at an endogenous rodent IL-4 locus, and the modified IL-4 gene sequence comprising one or more exons of the human IL-4 gene sequence is operably linked to rodent regulatory elements or sequences at the endogenous rodent IL-4 locus. (Item 24) 24. The method of claim 23, wherein the rodent is a mouse or a rat. (Item 25) 24. The method of claim 23, wherein the rodent regulatory element or sequence is derived from a mouse or rat. (Item 26) 24. The method of claim 23, wherein the rodent regulatory element or sequence is an endogenous rodent regulatory element or sequence of the rodent IL-4 locus. (Item 27) 24. The method of claim 23, wherein the human IL-4 nucleic acid sequence that replaces the rodent IL-4 nucleic acid sequence comprises at least one exon of the human IL-4 gene sequence. (Item 28) 28. The method of claim 27, wherein the human IL-4 nucleic acid sequence that replaces the rodent IL-4 nucleic acid sequence comprises at least two or at least three exons of the human IL-4 gene sequence. (Item 29) 29. The method of claim 28, wherein the human IL-4 nucleic acid sequence that replaces the rodent IL-4 nucleic acid sequence comprises all four exons of the human IL-4 gene sequence. (Item 30) 24. The method of claim 23, wherein the substitution is in an endogenous rodent IL-4 locus and the human IL-4 nucleic acid sequence comprising one or more exons of the human IL-4 gene sequence is operably linked to endogenous rodent regulatory elements or sequences of the endogenous rodent IL-4 locus. Law. (Item 31) A method for producing a humanized IL-4 mouse, comprising replacing a mouse IL-4 nucleic acid sequence with a human IL-4 nucleic acid to form a modified IL-4 gene encoding a human or humanized IL-4 protein. (Item 32) 32. The method of claim 31, wherein the substitution is in the endogenous mouse IL-4 locus and the modified gene encoding a human or humanized IL-4 protein is operably linked to endogenous mouse regulatory sequences. (Item 33) 32. The method of claim 31, wherein the substitution is in the endogenous mouse IL-4 locus and the modified gene encoding a human or humanized IL-4 protein is operably linked to endogenous mouse regulatory sequences. (Item 34) A method for producing a humanized rodent, comprising replacing a rodent IL-4Rα nucleic acid sequence with a human IL-4Rα nucleic acid sequence comprising one or more exons of the human IL-4Rα gene sequence to form a modified IL-4Rα gene encoding a human or humanized IL-4Rα protein, wherein the replacement is in an endogenous rodent IL-4Rα locus, and the modified IL-4Rα gene encoding the human or humanized IL-4Rα protein is operably linked to rodent regulatory elements or sequences at the endogenous rodent IL-4Rα locus. (Item 35) 35. The method of claim 34, wherein the rodent is a mouse or a rat. (Item 36) 35. The method of claim 34, wherein the rodent regulatory element or sequence is derived from a mouse or rat. (Item 37) 35. The method of claim 34, wherein the rodent regulatory element or sequence is an endogenous rodent regulatory element or sequence of the rodent IL-4Rα locus. (Item 38) 38. The method of Item 37, wherein the human IL-4Rα gene sequence that replaces the rodent IL-4Rα gene sequence comprises at least one exon of the human IL-4Rα gene sequence. (Item 39) 39. The method of Item 38, wherein the human IL-4Rα nucleic acid sequence that replaces the rodent IL-4Rα nucleic acid sequence comprises at least two, three, four, five, six, seven, or eight exons of the human IL-4Rα gene sequence. (Item 40) 40. The method of Item 39, wherein the human IL-4Rα nucleic acid sequence that replaces the rodent IL-4Rα nucleic acid sequence comprises all nine exons of the human IL-4Rα gene sequence. (Item 41) 35. The method of Item 34, wherein the substitution is in an endogenous rodent IL-4Rα locus, and the modified IL-4Rα gene encoding a human or humanized IL-4Rα protein is operably linked to endogenous rodent regulatory elements or sequences at the endogenous rodent IL-4Rα locus. (Item 42) A method for producing a humanized mouse, comprising replacing a mouse exon encoding the extracellular domain of mouse IL-4Rα with a human genomic fragment encoding the extracellular domain of human IL-4Rα to form a humanized IL-4Rα gene. (Item 43) 43. The method of Item 42, wherein the substitution is in the endogenous mouse IL-4Rα locus and the humanized IL-4Rα gene is operably linked to mouse regulatory sequences. (Item 44) 43. The method of Item 42, wherein the substitution is in the endogenous mouse IL-4Rα locus and the humanized IL-4Rα gene is operably linked to an endogenous mouse regulatory sequence. (Item 45) 1. A rodent comprising a humanized IL-4Rα gene and a humanized IL-4 gene, wherein the humanized IL-4Rα gene results from the replacement of a sequence encoding a rodent IL-4Rα extracellular domain with a sequence encoding a human IL-4Rα extracellular domain, the humanized IL-4Rα gene comprises a sequence encoding a rodent IL-4Rα transmembrane domain and a sequence encoding a rodent IL-4Rα cytoplasmic domain, the humanized IL-4Rα gene is under the control of endogenous rodent IL-4Rα regulatory elements at the endogenous rodent IL-4Rα locus, and the humanized IL-4 gene encodes a human or humanized IL-4 protein, and the humanized IL-4 gene is under the control of endogenous rodent IL-4 regulatory elements at the endogenous rodent IL-4R locus. (Item 46) 46. ​​The rodent of item 45, wherein the rodent is a mouse or a rat. (Item 47) 46. ​​The rodent according to item 45, wherein the rodent is a mouse that does not have the ability to express mouse IL-4 protein and does not have the ability to express mouse IL-4Rα protein. (Item 48) 46. ​​The rodent of paragraph 45, wherein the rodent regulatory elements or sequences of the endogenous rodent IL-4 locus and / or the endogenous rodent IL-4Rα locus are derived from a mouse or a rat. (Item 49) 46. ​​The rodent of paragraph 45, wherein the rodent regulatory element or sequence is an endogenous rodent regulatory element or sequence of the rodent IL-4 locus and / or rodent IL-4Rα locus. (Item 50) A method for screening for a human-specific IL-4 or IL-4Rα antagonist, comprising: providing a doubly humanized IL-4 and IL-4Rα mouse; Inducing pulmonary inflammation in the mouse; administering an agent to the mouse; determining whether the agent reduces lung inflammation; identifying the agent as a human-specific IL-4 or IL-4Rα antagonist based on its ability to reduce lung inflammation; A method comprising: (Item 51) 51. The method of item 50, wherein the degree of lung inflammation is determined by measuring mucus accumulation in the airways, eosinophilic infiltrating cells in bronchoalveolar lavage fluid, and / or total circulating IgE. (Item 52) A method for screening for a human-specific IL-4 or IL-4Rα antagonist, comprising: providing a doubly humanized IL-4 and IL-4Rα mouse; Inducing skin inflammation in the mouse; administering an agent to the mouse; determining whether the agent reduces skin inflammation; identifying the agent as a human-specific IL-4 or IL-4Rα antagonist based on its ability to reduce skin inflammation; A method comprising: (Item 53) 53. The method of Item 50 or 52, wherein the humanized IL-4Rα gene results from the replacement of a sequence encoding a murine IL-4Rα extracellular domain with a sequence encoding a human IL-4Rα extracellular domain, wherein the humanized IL-4Rα gene is under the control of endogenous murine IL-4Rα regulatory elements at the endogenous murine IL-4Rα locus; and the humanized IL-4 gene encodes a human or humanized IL-4 protein, wherein the humanized IL-4 gene is under the control of endogenous rodent IL-4 regulatory elements at the endogenous rodent IL-4R locus. [Brief explanation of the drawings]

[0095] [Figure 1]FIG. 1 depicts (not to scale) the receptors for IL-4 and IL-13 signaling and the mechanism of action of dupilumab, a neutralizing fully human monoclonal antibody that specifically binds to the human IL-4 receptor alpha chain (IL-4Rα). [Figure 2A] Figures 2A-2B illustrate (not to scale) the strategy for humanizing the IL-4 (Il4) and IL-4Rα (Il4ra) loci. (2A) As shown, the mouse IL-4 gene (top), spanning the coding region from exon 1 starting at the ATG start codon through exon 4 (including the 3' untranslated region), and a portion of the 3' region downstream of exon 4, is removed and replaced with a loxP-introduced hygro selection cassette, loxP, and the coding region from exon 1 starting at the ATG codon through exon 4 (including the 3' untranslated region) and a portion of the 3' region downstream of exon 4 of the human IL-4 gene (bottom). [Figure 2B] Figures 2A-2B illustrate (not to scale) the strategy for humanizing the IL-4 (Il4) and IL-4Rα (Il4ra) loci. (2B) As shown, the mouse IL-4Rα gene (top), spanning the coding region from exon 1 starting at the ATG start codon through exon 5, and a portion of intron 5, was deleted and replaced with the coding region from exon 1 starting at the ATG start codon through exon 5 and a portion of intron 5 of the human IL-4Rα gene (bottom), and a loxP-inserted neo selection cassette. [Figure 3] FIG. 3 shows the expression of humanized IL-4Rα protein on B and T cells from doubly humanized IL-4 / IL-4Rα (Il4hu / hu / Il4rahu / hu) mice. [Figure 4] FIG. 4 shows ligand specificity and receptor functionality for IL-4 and IL-13 using primary cells derived from humanized IL4Rα (Il4ra hu / hu) mice. [Figure 5]FIG. 5 shows IL-4-dependent IgE production in vivo in wild-type mice, but not in humanized IL4Rα (Il4rahu / hu) mice. [Figure 6] FIG. 6 shows that the dose-dependent induction of mIgE production by IL-4 in ex vivo mouse B cells (left panel) is blocked in a dose-dependent manner by dupilumab (right panel). [Figure 7] FIG. 7 shows that dupilumab prevents IL-25-induced lung disease in vivo in humanized IL4Rα (Il4ra hu / hu) mice in a dose-dependent manner. [Figure 8] Figure 8 shows the experimental design for evaluating the therapeutic efficacy of dupilumab using doubly humanized IL-4 and IL-4Rα (IL-4hu / hu / IL-4Rhu / hu) mice in a house dust mite extract (HDM)-induced lung inflammation model. "REGN668" refers to a human monoclonal antibody directed against human IL-4Rα, also known as dupilumab. "REGN129" refers to mouse sol IL-13Rα2-Fc, which is a fusion protein between the extracellular domain of mouse IL-13R2α and Fc. [Figure 9] FIG. 9 shows the experimental design for evaluating the therapeutic efficacy of dupilumab in an HDM-induced lung inflammation model using doubly humanized IL-4 and IL-4Rα (IL-4hu / hu / IL-4Rhu / hu) mice and an isotype control antibody. [Figure 10A] Figures 10A-10C illustrate the strategy for humanization of the mouse IL-33 locus. Figure 10A illustrates that the mouse IL-33 gene (top), spanning the coding region from exon 2 starting at the ATG start codon through the stop codon in exon 8, is deleted and replaced with the coding region from exon 2 starting at the ATG codon through exon 8 (including the 3' untranslated region) of the human IL-33 gene (bottom). [Figure 10B]Figures 10A-10C illustrate the strategy for humanization of the mouse IL-33 locus. Figure 10B shows the humanized IL-33 allele of mouse ES cell clone MAID 7060, which contains a loxP neomycin selection cassette. [Figure 10C] Figures 10A-10C illustrate the strategy for humanizing the mouse IL-33 locus. Figure 10C shows the humanized IL-33 allele of mouse ES cell clone MAID 7061, in which the neomycin selection cassette has been removed, a loxP and cloning site (77 bp) remains downstream of the human IL-33 sequence, and the mouse 3'UTR is retained downstream of the loxP site. DETAILED DESCRIPTION OF THE INVENTION

[0096] IL-4 and IL-4Rα as therapeutic targets Allergic diseases are a range of conditions that are occurring at an accelerating rate, especially in developed countries. Atopic dermatitis, asthma, and allergic rhinitis are the most common inflammatory conditions among allergic patients, who often suffer from multiple clinical manifestations. The pathogenesis of allergies is associated with an abnormal immune response to exogenous antigens (Mueller et al. (2002) Structure, binding, and antagonists in the IL-4 / IL-13 receptor system, Biochim Biophys Acta 1592:237-250).

[0097] Overproduction of antigen-specific IgE is an essential component in the development of allergic inflammation, and aberrant type 2 helper T cell (Th2) polarization contributes to the increased IgE response.

[0098] Interleukin-4 (IL-4) and interleukin-13 (IL-13), originally identified from activated T cells, are major Th2 cytokines that play a central role in initiating and maintaining immune and inflammatory responses in allergy.

[0099] IL-4 and IL-13 signaling are mediated by two distinct receptor complexes that share a common subunit, the IL-4 receptor alpha (IL-4Rα), which may contribute to overlapping biological responses between these two cytokines (see Figure 1).

[0100] Receptors for interleukin-4 / 13 signaling and the mechanism of action of dupilumab. IL-4Rα forms two distinct heterodimeric receptor complexes that mediate the biological functions of IL-4 and IL-13 in a tissue- and response-specific manner. The type I receptor, consisting of IL-4Rα and the common cytokine receptor gamma chain (γC), is unique for IL-4. The type II receptor, formed between IL-4Rα and IL-13Rα1, is the primary receptor for IL-13, but it also functions for IL-4. Furthermore, IL-13 binds to a second highest affinity receptor, IL-13Rα2, which is generally recognized as a decoy receptor or potentially has profibrotic effects in its full-length form.

[0101] Dupilumab is an antagonistic monoclonal antibody against human IL-4Rα that inhibits the biological activities induced by IL-4 and IL-13. Dupilumab blocks IL-4 signaling by preventing IL-4 binding to the receptor subunit, whereas its inhibitory effect on IL-13 signaling may be mediated by interfering with dimeric receptor interactions.

[0102] Dupilumab, a fully human monoclonal antibody directed against the common IL-4R α subunit, was developed at Regeneron Pharmaceuticals, Inc. using VelocImmune® mice. Dupilumab is in clinical trials for the treatment of moderate to severe asthma and moderate to severe atopic dermatitis.

[0103] Evaluating the efficacy of dupilumab in murine models poses multiple challenges: (a) dupilumab does not recognize the cognate murine IL-4 receptor, and (b) there is a lack of functional interaction between the murine IL-4 protein and the human IL-4 receptor.

[0104] IL-4 gene and protein The IL-4 gene encodes the secreted IL-4 protein, which plays an important role in the activation of B cells as well as other cell types (see Figure 1).

[0105] Human IL-4. NCBI gene ID: 3565; primary source: HGNC:6014; RefSeq transcript: NM_000589.3; UniProt ID: P05112; genome assembly: GRCh37; location: chr5:132,009,743-132,018,576 + strand.

[0106] The human IL-4 gene is located at 5q31.1 on chromosome 5. The human IL-4 gene has four exons and encodes a precursor polypeptide 153 amino acids in length, including a 24 amino acid signal peptide and a 129 amino acid mature IL-4 protein.

[0107] Mouse IL-4. NCBI Gene ID: 16189; Primary Source: MGI:96556; RefSeq Transcript: NM_021283.2; UniProt ID: P07750; Genome Assembly: GRCm38; Location: chr11:53,612,350-53,618,606 -strand.

[0108] The mouse IL-4 gene is located at 1131.97 cM on chromosome 11. The mouse IL-4 gene has four exons and encodes a precursor polypeptide 140 amino acids in length, including a 20 amino acid signal peptide and a 120 amino acid mature IL-4 protein.

[0109] IL-4Rα gene and protein The IL-4Rα gene encodes the transmembrane receptor IL-4Rα protein, which is expressed primarily on B and T cells and is the receptor for IL-4 and IL-13 proteins (see Figure 1).

[0110] Human IL-4Rα. NCBI Gene ID: 3566; Primary Source: MGI:6015; RefSeq Transcript: NM_000418.3; UniProt ID: P24394; Genome Assembly: GRCh37; Location: chr16:27,351,525-27,367,111 + strand.

[0111] The human IL-4Rα gene is located on chromosome 16 at 16p12.1-p11.2. The human IL-4Rα gene has nine coding exons and encodes an 825-amino acid precursor polypeptide, including a 25-amino acid signal peptide and an 800-amino acid mature IL-4Rα protein, the first 207 amino acid residues of which constitute the extracellular region. The extracellular region (i.e., extracellular domain) of the human IL-4Rα protein is encoded by coding exons 1 through 5 of the human IL-4Rα gene.

[0112] Mouse IL-4Rα. NCBI Gene ID: 16190; Primary Source: MGI:105367; RefSeq Transcript: NM_001008700.3; UniProt ID: P16382; Genome Assembly: GRCm38; Location: chr11:125,565,655-125,572,745 + strand.

[0113] The mouse IL-4Rα gene is located at 768.94 cM on chromosome 7. The mouse IL-4Rα gene has nine coding exons and encodes an 810-amino acid precursor polypeptide, including a 25-amino acid signal peptide and a 785-amino acid mature IL-4Rα protein, the first 208 amino acid residues of which constitute the extracellular region. The extracellular region (i.e., extracellular domain) of the mouse IL-4Rα protein is encoded by coding exons 1 through 5 of the mouse IL-4Rα gene.

[0114] Species specificity of IL-4 and IL-4Rα proteins As shown herein, mouse IL-4 is functional in wild-type mice, but human IL-4 is not, and conversely, humanized IL-4Rα (IL4ra hu / hu ) Human IL-4 is functional in mice, but mouse IL-4 is not. (See, e.g., Andrews et al. al.(2001)Reconstitution of a functional See also human type II IL-4 / IL-13 receptor in mouse B cells: demonstration of species specificity, J Immunol. 166:1716-1722).

[0115] Species specificity of human IL-4 and IL-4Rα inhibitors Candidate therapeutic molecules that target IL-4 or IL-4Rα proteins are typically evaluated for pharmacokinetics (PK) and pharmacodynamics (PD) in non-human animals (e.g., rodents, e.g., mice or rats). Such therapeutic molecules are also tested for in vivo therapeutic efficacy in non-human animals (e.g., rodents, e.g., mice or rats) that are models of human diseases, disorders, and conditions associated with aberrant Th2 cells.

[0116] However, therapeutic molecules specific for human IL-4 or IL-4Rα protein (e.g., human-specific IL-4 or IL-4Rα inhibitors) cannot be adequately evaluated for PD or in vivo therapeutic efficacy in rodents, particularly mice, due to the lack of a target for these therapeutic molecules. Due to the species specificity of the IL-4 protein described above, this problem cannot be overcome even by using transgenic non-human animals (e.g., rodents, e.g., mice or rats) expressing human IL-4 or IL-4Rα protein.

[0117] Thus, in various embodiments, to evaluate the PD and in vivo therapeutic efficacy of human-specific IL-4 or IL-4Rα protein antagonists or inhibitors in non-human animals (e.g., rodents, e.g., mice or rats), it is desirable to replace endogenous IL-4 and / or IL-4Rα protein with human IL-4 and / or IL-4Rα protein.

[0118] Furthermore, in various embodiments, to avoid potential problems of over- or under-expression of the human IL-4 and / or IL-4Rα protein, it is desirable to insert the human IL-4 and / or IL-4Rα gene into the genome of the non-human animal (e.g., a rodent, e.g., a mouse or rat) at the locus of the endogenous IL-4 and / or IL-4Rα gene, and to express the human IL-4 and / or IL-4Rα protein in the non-human animal (e.g., a rodent, e.g., a mouse or rat) at least partially under the control of endogenous IL-4 and / or IL-4Rα regulatory elements.

[0119] Genetically modified non-human animals Provided herein are genetically modified non-human animals in which an endogenous IL-4 gene and / or IL-4Rα gene has been replaced, in whole or in part, with a human IL-4 nucleic acid and / or a human IL-4Rα nucleic acid at the endogenous IL-4 locus and / or IL-4Rα locus to form a modified IL-4 gene and / or IL-4Rα gene encoding a human or humanized IL-4 and / or IL-4Rα protein.

[0120] As used herein, the phrase "non-human animal" refers to any vertebrate organism that is not a human. In some embodiments, the non-human animal is a mammal. In certain embodiments, the non-human animal is a rodent, such as a rat or a mouse.

[0121] In one aspect, a genetically modified rodent (e.g., mouse or rat) is provided in which a human IL-4 nucleic acid has replaced, in whole or in part, the endogenous rodent IL-4 gene at the endogenous IL-4 locus.

[0122] The replacement involves replacing at least one exon, i.e., one or more exons, of the rodent IL-4 gene with a human nucleic acid comprising at least one exon of the human IL-4 gene. In some embodiments, a contiguous rodent genomic fragment comprising exons 1 through 4 starting from the ATG start codon of the rodent IL-4 gene is replaced with a contiguous human genomic fragment comprising exons 1 through 4 starting from the ATG start codon of the human IL-4 gene. In a specific embodiment, the rodent is a mouse, and an approximately 6.3 kb contiguous mouse genomic fragment at the endogenous mouse IL-4 locus, comprising exons 1 through 4 (including the 3' untranslated region) starting from the ATG start codon and a portion of the 3' region downstream of exon 4, is deleted and replaced with an approximately 8.8 kb human IL-4 nucleic acid sequence comprising exons 1 through 4 (including the 3' untranslated region) starting from the ATG start codon and a portion of the 3' region downstream of exon 4 of the human IL-4 gene.

[0123] In some embodiments, the replacement results in a modified, humanized IL-4 gene at the endogenous IL-4 gene locus, and expression of the modified IL-4 gene is under the control of endogenous regulatory elements at the endogenous IL-4 locus. As used herein, the term "regulatory elements" refers to transcriptional regulatory sequences, including both 5' transcriptional regulatory sequences, such as promoters, enhancers, and repression elements, and 3' transcriptional regulatory sequences, such as transcription termination sequences. In some embodiments, expression of the modified IL-4 gene is under the control of endogenous 5' regulatory elements. In other embodiments, expression of the modified IL-4 gene is under the control of endogenous 3' regulatory elements. In certain embodiments, expression of the modified IL-4 gene is under the control of endogenous 5' and 3' regulatory elements.

[0124] The modified humanized IL-4 gene generated at the endogenous IL-4 locus encodes a human or humanized IL-4 protein. The term "humanized" refers to a portion of a gene or protein found in a non-human animal (e.g., a rodent such as a mouse or rat). "IL-4" refers to a nucleic acid or protein that contains a portion or sequence that differs from that found in a non-human animal, but instead contains a portion or sequence that corresponds to (is identical to) a portion or sequence of a corresponding human gene or protein. A modified, humanized IL-4 gene is a nucleic acid or protein that contains a portion or sequence that corresponds to (is identical to) a portion or sequence of a human IL-4 protein (e.g., GenBank Accession No. NM_000589.3) and at least The sequences may encode IL-4 proteins that are 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical, or 100% identical.

[0125] Genetically modified rodents with a total or partial replacement of the endogenous rodent IL-4 gene with a human IL-4 nucleic acid at the endogenous IL-4 locus can be homozygous or heterozygous for the replacement. In some embodiments, the genetically modified rodent is heterozygous for the replacement, i.e., only one of the two copies of the endogenous rodent IL-4 gene is replaced with a human IL-4 nucleic acid. In other embodiments, the genetically modified rodent is homozygous for the replacement, i.e., both copies of the endogenous rodent IL-4 gene are replaced with a human IL-4 nucleic acid.

[0126] The genetically modified rodent expresses human or humanized IL-4 protein in its serum. In some embodiments, the genetically modified rodent does not express endogenous rodent IL-4 protein. In one embodiment, the serum of a rodent expressing human or humanized IL-4 protein has approximately the same level of IL-4 protein as a rodent that expresses functional endogenous IL-4 protein, e.g., a wild-type rodent (e.g., a rodent that expresses functional endogenous IL-4 protein but does not contain a total or partial replacement of the endogenous IL-4 gene at the endogenous IL-4 locus with a human IL-4 nucleic acid). "Approximately the same level" means a level that is within 25%, 20%, 15%, 10%, 5%, or less in either direction (i.e., greater or less) of the level in the wild-type rodent. In other embodiments, the rodent expresses human or humanized IL-4 protein in serum at a concentration that is at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, or 200% of the level of IL-4 protein present in the serum of an age-matched rodent that expresses functional endogenous IL-4 protein but does not comprise a full or partial replacement of the endogenous IL-4 gene with a human IL-4 nucleic acid at the endogenous IL-4 locus.

[0127] In some embodiments, a genetically modified rodent having a full or partial replacement of an endogenous rodent IL-4 gene with a human IL-4 nucleic acid and expressing a human or humanized IL-4 protein in its serum has a normal immune system, i.e., the number of immune cells (e.g., B cells and T cells) in the blood, plasma, or serum of a rodent expressing a human or humanized IL-4 protein is similar to the number of immune cells (e.g., B cells and T cells) in the blood, plasma, or serum of a rodent that expresses a functional endogenous IL-4 protein but does not have a full or partial replacement of the endogenous rodent IL-4 gene with a human IL-4 nucleic acid.

[0128] In a further embodiment, a genetically modified rodent having a total or partial replacement of an endogenous rodent IL-4 gene with a human IL-4 nucleic acid and expressing a human or humanized IL-4 protein also comprises a total or partial replacement of the endogenous rodent IL-4Rα gene with a human IL-4Rα nucleic acid at the endogenous IL-4Rα locus, and as a result, also expresses a human or humanized IL-4Rα protein.

[0129] In another aspect, a genetically modified rodent (e.g., a mammalian rodent) is provided in which the endogenous rodent IL-4Rα gene has been replaced in whole or in part with a human IL-4Rα nucleic acid at the endogenous IL-4Rα locus. For example, a mouse or rat) is provided.

[0130] The replacement involves the replacement of at least one exon, i.e., one or more exons, of a rodent IL-4Rα gene with a human nucleic acid comprising at least one exon of the human IL-4Rα gene. In some embodiments, the replacement involves the replacement of at least one exon of a rodent IL-4Rα gene encoding the rodent extracellular domain with at least one of the exons of the human IL-4Rα gene encoding the human extracellular domain. In some embodiments, the replacement involves the replacement of at least two, three, or four of the five exons encoding the extracellular domain of the human IL-4Rα gene with a human nucleic acid comprising at least two, three, or four of the five exons encoding the extracellular domain of the human IL-4Rα gene. In other embodiments, a contiguous rodent genomic fragment comprising exons 1 through 5 starting from the ATG start codon of the rodent IL-4Rα gene is replaced with a genomic fragment comprising exons 1 through 5 starting from the ATG start codon of the human IL-4Rα gene. In a specific embodiment, the rodent is a mouse, and an approximately 7.1 kb contiguous mouse genomic fragment of the endogenous mouse IL-4Rα locus, including exons 1 through 5 starting from the ATG start codon and a portion of intron 5, is deleted and replaced with an approximately 15.6 kb human IL-4Rα nucleic acid sequence, including exons 1 through 5 starting from the ATG start codon and a portion of intron 5 of the human IL-4Rα gene.

[0131] In some embodiments, the replacement results in a modified, humanized IL-4Rα gene at the endogenous IL-4Rα gene locus, and expression of the modified IL-4Rα gene is under the control of endogenous regulatory elements of the endogenous IL-4Rα locus.

[0132] The modified humanized IL-4Rα gene formed at the endogenous IL-4Rα locus encodes a human or humanized IL-4Rα protein. In some embodiments, the modified humanized IL-4Rα gene encodes a human IL-4Rα protein (e.g., GenBank Human IL-4 protein encoded by the nucleic acid designated Accession No. NM_000418.3 The modified IL-4Rα gene encodes an IL-4Rα protein that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical, or 100% identical, to the extracellular domain of a human IL-4Rα protein (e.g., a human IL-4 protein encoded by the nucleic acid set forth in GenBank Accession No. NM_000418.3). In other embodiments, the modified IL-4Rα gene encodes a humanized IL-4Rα protein comprising an extracellular domain that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical, or 100% identical, to the extracellular domain of a human IL-4Rα protein (e.g., a human IL-4 protein encoded by the nucleic acid set forth in GenBank Accession No. NM_000418.3). In certain embodiments, the transmembrane and cytoplasmic domains of the humanized IL-4Rα protein are identical to the transmembrane and cytoplasmic domains of an endogenous rodent IL-4Rα protein.

[0133] Genetically modified rodents having a total or partial replacement of the endogenous rodent IL-4Rα gene with a human IL-4Rα nucleic acid at the endogenous IL-4Rα locus can be homozygous or heterozygous for the replacement. In some embodiments, the genetically modified rodent is heterozygous for the replacement, i.e., only one of the two copies of the endogenous rodent IL-4Rα gene has been replaced with a human IL-4Rα nucleic acid. In other embodiments, the genetically modified rodent is homozygous for the replacement, i.e., both copies of the endogenous rodent IL-4Rα gene have been replaced with a human IL-4Rα nucleic acid.

[0134] The genetically modified rodents disclosed herein express human or humanized IL-4Rα protein on immune cells (e.g., B cells and T cells). In some embodiments, the genetically modified rodents do not express endogenous rodent IL-4Rα protein. In one embodiment, immune cells of a rodent expressing human or humanized IL-4Rα protein express functional endogenous IL-4Rα protein in a manner similar to that of a wild-type rodent that expresses functional endogenous IL-4Rα protein but does not express human or humanized IL-4Rα protein. In other embodiments, the rodent expresses human or humanized IL-4Rα protein on immune cells at levels that are at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, or 200% of the amount of IL-4Rα protein present on immune cells of an age-matched rodent that expresses functional endogenous IL-4Rα protein but does not contain a replacement of the endogenous IL-4Rα gene in whole or in part with a human IL-4Rα nucleic acid.

[0135] In some embodiments, a genetically modified rodent that has a full or partial replacement of an endogenous rodent IL-4Rα gene with a human IL-4Rα nucleic acid and expresses a human or humanized IL-4Rα protein has a normal immune system, i.e., the number of immune cells (e.g., B cells and T cells) in the blood, plasma, or serum of a rodent that expresses a human or humanized IL-4Rα protein is similar to the number of immune cells (e.g., B cells and T cells) in the blood, plasma, or serum of a wild-type rodent (e.g., a rodent that expresses a functional endogenous IL-4Rα protein and does not have a full or partial replacement of the endogenous rodent IL-4Rα gene with a human IL-4Rα nucleic acid).

[0136] In some embodiments, genetically modified rodents that have a full or partial replacement of the endogenous rodent IL-4Rα gene with a human IL-4Rα nucleic acid and express a human or humanized IL-4Rα protein have the ability to mediate IL-4-dependent and IL-13-dependent signaling, and function in mediating IL-4-dependent and IL-13-dependent signaling. For example, a humanized IL-4Rα protein having the extracellular domain of the human IL-4Rα protein expressed on immune cells of a genetically modified rodent interacts with human IL-4 and mediates human IL-4-dependent signaling through the formation of a type I receptor (see FIG. 1). Such a humanized IL-4Rα protein having the extracellular domain of the human IL-4Rα protein also interacts with human and mouse IL-13 and mediates IL-13-dependent signaling through the formation of a type II receptor (see FIG. 1). The functionality of the humanized IL-4Rα protein expressed in genetically modified rodents was confirmed by measuring IL-4Rα expression using primary B cells derived from the genetically modified rodents. The activity of antibodies against IgE-induced IgE class switching can be assessed in a variety of assays known in the art, including those specifically described in the Examples below, such as an assay measuring IgE class switching induced by IgE-induced IgE class switching.

[0137] In a further embodiment, a genetically modified rodent having a total or partial replacement of an endogenous rodent IL-4Rα gene with a human IL-4Rα nucleic acid and expressing a human or humanized IL-4Rα protein also comprises a total or partial replacement of an endogenous rodent IL-4 gene with a human IL-4 nucleic acid at the endogenous IL-4 locus, and as a result, also expresses a human or humanized IL-4 protein.

[0138] In a further aspect, a doubly humanized rodent (e.g., mouse or rat) is provided in which its endogenous rodent IL-4 gene has been replaced, in whole or in part, with a human IL-4 nucleic acid at the endogenous IL-4 locus, and its endogenous rodent IL-4Rα gene has also been replaced, in whole or in part, with a human IL-4Rα nucleic acid at the endogenous IL-4Rα locus. Such doubly humanized rodents can be homozygous or heterozygous for each humanized replacement. In certain embodiments, the doubly humanized rodent is homozygous for both humanized IL-4 and humanized IL-4Rα.

[0139] The genetic modification to the endogenous rodent IL-4 gene in the doubly humanized rodent comprises a total or partial replacement of the endogenous rodent IL-4 gene with a human IL-4 nucleic acid. The doubly humanized rodent includes the modifications or substitutions described herein above for genetically modified rodents having a human IL-4Rα nucleic acid. Similarly, the genetic modifications to the endogenous rodent IL-4Rα gene in the doubly humanized rodent include the modifications or substitutions described herein above for genetically modified rodents having a total or partial replacement of the endogenous rodent IL-4Rα gene with a human IL-4Rα nucleic acid. Thus, the features disclosed above for the humanization of rodent IL-4 genes and for the humanization of rodent genes, respectively, are expressly incorporated herein for the doubly humanized rodent.

[0140] In certain embodiments, a doubly humanized rodent (e.g., a mouse or rat) is provided that expresses a human IL-4 protein and a humanized IL-4Rα protein, wherein the humanized IL-4Rα protein comprises the extracellular domain of the human IL-4Rα protein and the transmembrane and cytoplasmic domains of the rodent's endogenous IL-4Rα protein. In certain embodiments, expression of the human IL-4 protein and the humanized IL-4Rα protein is under the control of endogenous rodent regulatory sequences at the endogenous rodent IL-4 locus and the rodent IL-4Rα locus, respectively.

[0141] In some embodiments, the doubly humanized rodent has a normal immune system (i.e., has about the same number of immune cells as a wild-type rodent), has about the same level of IL-4 protein in its serum as a wild-type rodent, and expresses about the same amount of IL-4Rα protein on its immune cells as a wild-type rodent, where a wild-type rodent is a rodent that expresses functional endogenous IL-4 protein and IL-4Rα protein but does not express human or humanized IL-4 protein or IL-4Rα protein.

[0142] In certain embodiments, the doubly humanized rodent exhibits a functional IL-4 signaling pathway. By "functional IL-4 signaling pathway" is meant that both a human or humanized IL-4 protein and a human or humanized IL-4Rα protein are expressed in the doubly humanized rodent and interact with each other in the doubly humanized rodent, thereby effectively mediating downstream signaling and achieving the biological activities of the normal IL-4 signaling pathway. The biological activities of the normal IL-4 signaling pathway are described herein above and illustrated in FIG. 1 and include those mediated through type I receptors, such as initiation and maintenance of Th2 differentiation, B cell activation and growth, and class switching to IgE and IgG4, and those mediated through type II receptor signaling, such as goblet cell hyperplasia, subepithelial fibrosis, and tissue remodeling. For example, functional IL-4 signaling pathways in doubly humanized rodents are manifested by an inflammatory phenotype characterized by increased IgE in the circulation, airway inflammation, and / or eosinophilic infiltrating cells in response to, for example, dust mite exposure. The phenotype is also observed in wild-type rodents without double humanization.

[0143] Methods for creating genetically modified non-human animals Genetically modified non-human animals, such as rodents, can be produced using methods known in the art. For example, targeting vectors can be produced containing human nucleic acid (such as the entire or partial human IL-4 or IL-4Rα gene) flanked by upstream and downstream regions homologous to the non-human animal. The targeting construct may also contain a drug selection cassette (e.g., a loxP-introduced hygro selection cassette, which can be subsequently removed by a transient Cre expression vector) located 3' to the human nucleic acid. The targeting vector can be introduced into the genome of non-human animal cells, such as embryonic stem (ES) cells (e.g., mouse ES cells), by, for example, electroporation. Appropriately targeted ES cell clones can then be introduced into early embryos (e.g., 8-cell stage mouse embryos). Non-human animals derived entirely from the appropriately targeted ES cells can be identified, for example, based on allele analysis. For non-human animals for which suitable genetically modifiable ES cells are not readily available, non-human animals containing genetic modifications as described herein can be produced. Other methods can be employed to produce embryos, including, for example, modifying the genome of a non-ES cell (e.g., a fibroblast or an induced pluripotent cell) and using nuclear transfer to introduce the modified genome into a suitable cell, e.g., an oocyte, and gestation of the modified cell (e.g., a modified oocyte) into a non-human animal under conditions suitable for the formation of an embryo.

[0144] Methods using genetically modified non-human animals In one aspect, the genetically modified IL-4 and / or IL-4Rα non-human animals disclosed herein are used to evaluate the pharmacodynamics (PD) and therapeutic efficacy of human-specific IL-4 and / or IL-4Rα antagonists, such as neutralizing anti-IL-4 and / or anti-IL-4Rα antibodies (e.g., dupilumab), in various disease models, as further exemplified in the Examples below.

[0145] In some embodiments, the present invention provides methods for screening for human-specific IL-4 or IL-4Rα antagonists using the doubly humanized IL-4 and IL-4Rα mice disclosed herein.

[0146] An "IL-4 or IL-4Rα antagonist" refers to a molecule (e.g., an antibody) that blocks, suppresses, or inhibits one or more biological functions mediated by IL-4 or IL-4Rα. A "human-specific IL-4 or IL-4Rα antagonist" refers to an antagonist specific for human IL-4 or IL-4Rα that has substantially no effect on rodent IL-4 or IL-4Rα.

[0147] In a specific embodiment, the screening method utilizes a doubly humanized mouse expressing human IL-4 protein and a humanized IL-4Rα protein, where the humanized IL-4Rα protein comprises the extracellular domain of the human IL-4Rα protein linked to the transmembrane and cytoplasmic domains of the endogenous mouse IL-4Rα protein, and the mouse does not express mouse IL-4 or mouse IL-4Rα.

[0148] In some embodiments, a method of screening for a human-specific IL-4 or IL-4Rα antagonist comprises administering an agent to a genetically modified rodent that has been doubly humanized for IL-4 and IL-4Rα as described herein, determining the effect of the agent on a biological function mediated by the IL-4 / IL-4Rα signaling pathway, and identifying the agent as a human-specific IL-4 or IL-4Rα antagonist if the agent antagonizes the function mediated by the IL-4 / IL-4Rα signaling pathway in the genetically modified rodent.

[0149] In one embodiment, the agent comprises an immunoglobulin variable domain that binds to IL-4 or IL-4Rα. In one embodiment, the agent specifically binds to human IL-4 or IL-4Rα but not to rodent IL-4 or IL-4Rα. In one embodiment, the agent is an antibody. In a specific embodiment, the agent is an antibody that specifically binds to human IL-4Rα but not to rodent IL-4Rα.

[0150] In one embodiment, the screening method utilizes a doubly humanized mouse expressing human IL-4 protein and a humanized IL-4Rα protein, where the humanized IL-4Rα protein comprises the extracellular domain of the human IL-4Rα protein linked to the transmembrane and cytoplasmic domains of the endogenous mouse IL-4Rα protein, and the mouse does not express murine IL-4 or murine IL-4Rα.

[0151] In some embodiments, the method of screening comprises double-hit screening as described herein. The method includes inducing a disease associated with IL-4 / IL-4Rα signaling in a simulated rodent, administering an agent to the rodent, determining whether the agent ameliorates the disease, and, if so, identifying the agent as a human-specific IL-4 or IL-4Rα antagonist suitable for treating the disease.

[0152] "Disease associated with IL-4 / IL-4Rα signaling" refers to a disease in which a biological function mediated by IL-4 / IL-4Rα signaling is implicated. Examples of diseases associated with IL-4 / IL-4Rα signaling include inflammatory diseases or disorders such as asthma, atopic dermatitis, chronic obstructive pulmonary disease (COPD) (which may be at least partially caused by tobacco smoke), inflammatory bowel disease, multiple sclerosis, arthritis, allergic rhinitis, eosinophilic esophagitis, and psoriasis. Asthma can be eosinophilic or non-eosinophilic asthma, and can be steroid-sensitive or steroid-resistant asthma.

[0153] In some embodiments, the disease associated with IL-4 / IL-4Rα signaling is airway inflammation, which can be induced in rodents by intranasally administering an allergen (e.g., house dust mite extract) one or more times over a period of time. The effectiveness of the agent can be determined by measuring whether the degree of airway inflammation (e.g., as indicated by mucus accumulation, eosinophilic infiltrates in bronchoalveolar lavage fluid, total circulating IgE levels, and / or changes in expression profiles measurable by microarray expression analysis) is reduced as a result of administration of the agent. The allergen used to induce airway inflammation and the agent being tested can be administered simultaneously or at different times. In some embodiments, the allergen is administered to the rodent in one or multiple doses, and the agent being tested is administered to the rodent after the rodent has been challenged with the allergen at least once.

[0154] In some embodiments, the disease associated with IL-4 / IL-4Rα signaling is skin inflammation or atopic dermatitis, which can be induced in rodents by creating skin damage and exposing the damaged skin to an allergen (e.g., bacterial toxin or dust mite extract) for a period of time, one or more times. The effectiveness of the agent can be determined by measuring whether skin inflammation is reduced as a result of administration of the agent.

[0155] In a further embodiment, a triply humanized non-human animal (i.e., a non-human animal whose IL-4, IL-4Rα, and IL-33 genes have been humanized) is used to evaluate the pharmacodynamics (PD) and therapeutic efficacy of candidate compounds, such as, for example, a human-specific IL-4 and / or IL-4Rα antagonist, and a human-specific IL-33 antagonist.

[0156] An "IL-33 antagonist" refers to a molecule (e.g., an antibody) that blocks, suppresses, or inhibits one or more biological functions or signal transduction mediated by IL-33. A "human-specific IL-33 antagonist" refers to an antagonist that is specific for human IL-33 and has substantially no effect on rodent IL-33. IL-33 is known to stimulate signal transduction through ST2 and IL-1 RAcP, which is attenuated in the presence of an antagonist, such as an IL-33 antibody. Inhibition of IL-33 signal transduction through ST2 and IL-1 RAcP can be determined by assaying IL-33 signaling in in vitro or in vivo assays, such as those described in U.S. Patent Application Publication No. 2014 / 0271658 A1 (the entire contents of which are incorporated herein by reference). For example, assays such as those described in U.S. Patent Application Publication No. 2014 / 0271658 A1 can be used to assess the effect of antibodies to IL-33 on lung inflammation in allergen-sensitized animals homozygous for expression of human IL-33. IL-33 antibodies that are effective as IL-33 antagonists should show a trend toward a reduction in inflammatory cells in the lungs and a reduction in cytokines such as IL-4 and IL-5. is.

[0157] In a specific embodiment, a triply humanized non-human animal is used herein to evaluate candidate compounds, wherein the triply humanized animal is a triply humanized mouse that expresses human IL-4 protein, a humanized IL-4Rα protein comprising the extracellular domain of human IL-4Rα protein linked to the transmembrane and cytoplasmic domains of mouse IL-4Rα protein, and a human IL-33 protein, wherein the mouse does not express mouse IL-4, mouse IL-4Rα, or mouse IL-33.

[0158] In some embodiments, the triply humanized non-human animals are used to evaluate the pharmacodynamics (PD) and therapeutic efficacy of candidate compounds, such as, for example, human-specific IL-4 and / or IL-4Rα antagonists, or human-specific IL-33 antagonists. For example, a human-specific IL-4 antibody, a human-specific IL-4Rα antibody, and a human-specific IL-33 antibody can be individually tested in the triply humanized animal (such as a rodent (e.g., mouse or rat)), and their PD profiles and therapeutic efficacy can be evaluated and compared.

[0159] In other embodiments, the triply humanized non-human animal is used to evaluate the efficacy of a combination of compounds (e.g., a combination of a human-specific IL-4 and / or IL-4Rα antagonist antibody and a human-specific IL-33 antagonist antibody) compared to the efficacy of the compounds when used individually, e.g., to determine whether the combination of compounds exhibits a synergistic therapeutic effect. In a specific embodiment, the combination of a human-specific IL-4 antibody and a human-specific IL-33 antibody is tested in the triply humanized non-human animal. In another specific embodiment, the combination of a human-specific IL-4Rα antibody and a human-specific IL-33 antibody is tested in the triply humanized non-human animal.

[0160] To evaluate candidate compounds or combinations of compounds, diseases associated with IL-4 / IL-4Rα signaling and IL-33 signaling can be induced in the triple-humanized animals. Examples of diseases associated with IL-4 / IL-4Rα signaling and IL-33 signaling include inflammatory diseases or disorders such as asthma, atopic dermatitis, chronic obstructive pulmonary disease (COPD) (which may be at least partially caused by cigarette smoke), inflammatory bowel disease, multiple sclerosis, arthritis, allergic rhinitis, eosinophilic esophagitis, and psoriasis. The asthma may be eosinophilic or non-eosinophilic asthma, and may be steroid-sensitive or steroid-resistant asthma. The effects of compounds or combinations of compounds can be evaluated in the same manner as in the IL-4 / IL-4Rα double-humanized animals described herein above.

[0161] The present invention is further illustrated by the following non-limiting examples. [Example]

[0162] Example 1 Replacement of the endogenous mouse IL-4 gene with the human IL-4 gene The 8.8 kb human IL-4 gene, containing the coding portion of the human IL-4 gene from exon 1 starting from the ATG start codon to exon 4 (including the 3' untranslated region) and a portion of the 3' region downstream of exon 4, replaced the 6.3 kb murine IL-4 gene locus spanning the coding portion of the human IL-4 gene from exon 1 starting from the ATG start codon to exon 4 (including the 3' untranslated region) and a portion of the 3' region downstream of exon 4. See Figure 2A.

[0163] Targets for replacing the mouse IL-4 gene with the human IL-4 gene in a single targeting step The recombinant constructs were synthesized using VelociGene® genetic engineering technology (Valenzuela et al.(2003)High-throughput engineering The mouse IL-4 DNA was constructed using the mouse genome coupled with high-resolution expression analysis, Nature Biotech, 21(6):652-659. Mouse IL-4 DNA and human IL-4 DNA were obtained from bacterial artificial chromosome (BAC) clones bMQ-41A12 and RP11-17K19, respectively. Briefly, a targeting construct generated by gap repair cloning and linearized with Sbfl, containing 8.8 kb of human IL-4 sequence (genomic coordinates: GRCh37:chr5:132,009,743-132,018,576 (+strand)) spanning from the ATG codon in exon 1 to exon 4 (including the 3' untranslated region) and a portion of the 3' region downstream of exon 4, and upstream and downstream homology arms of mouse IL-4 flanked by a loxP-introduced hygro selection cassette, was electroporated into F1H4 mouse embryonic stem (ES) cells (C57BL / 6x129F1 hybrid). Correctly targeted ES cells (MAID 879) were further electroporated with a transient Cre expression vector to remove the drug selection cassette. Targeted ES cell clones without the drug cassette (MAID 1553) were introduced into 8-cell stage SW mouse embryos by the VelociMouse® method (U.S. Patent Nos. 7,294,754, 7,576,259, 7,659,442, and Poueymirou et al. (2007) F0 generation). mice that are essentially fully derived (See Nature Biotech. 25(1):91-99.) VelociMice® (F0 mice derived entirely from donor ES cells) carrying a humanized IL-4 gene were identified by genotyping for loss of mouse alleles and gain of human alleles using a modified allele assay (Valenzuela (see et al. (2003)).

[0164] Correctly targeted ES cell clones were identified by a loss-of-native allele (LONA) assay (Valenzuela et al. 2003), in which the copy number of the native, unmodified IL-4 gene was determined by two TaqMan™ quantitative polymerase chain reactions (qPCR) specific for sequences within the mouse IL-4 gene targeted for deletion. The qPCR assay included the following primer-probe set (written 5' to 3'): upstream forward primer, CATGCACGGA GATGGATGTG (SEQ ID NO: 1); upstream reverse primer, GACCCCTCAG GTCCACTTAC C (SEQ ID NO: 2); upstream probe, FAM-AACGTCCTCA CAGCAACGA-MGB (SEQ ID NO: 3); downstream forward primer, GTGCCCAGGT GTGCTCATG (SEQ ID NO: 4); downstream reverse primer, CGCCTGCCTC CTCACTTTAT C (SEQ ID NO: 5); downstream probe, FAM-ATCTGCTTCA CCATCCACT-MGB (SEQ ID NO: 6); where FAM refers to 5-carboxyfluorescein fluorescent probe and BHQ refers to a black hole quencher type fluorescent quencher (Biosearch Technologies). DNA purified from ES cell clones that had taken up and integrated the targeting vector into their genome was combined with TaqMan™ Gene Expression Master Mix (Life Technologies) according to the manufacturer's recommendations in a 384-well PCR plate (MicroAmp™ Optical 384-Well Reaction Plate, Life Technologies) and analyzed using an Applied Biosystems Prism 7900HT (which collects fluorescence data during the PCR process and determines the threshold cycle (Ct), the fractional PCR cycle at which accumulated fluorescence reaches a pre-set threshold). ) were cycled. Two qPCRs, one for upstream and downstream IL-4-specific qPCRs and one for a non-target reference gene, were performed for each DNA sample. The difference in Ct value (ΔCt) between each IL-4-specific qPCR and each reference gene qPCR was calculated, and then the difference between each ΔCt and the median ΔCt for all assayed samples was calculated to obtain a ΔΔCt value for each sample. The copy number of the IL-4 gene in each sample was calculated using the following formula: copy number = 2 × 2 -ΔΔCt A correctly targeted clone that has lost one of its native copies will have an IL-4 gene copy number equal to 1. Confirmation that the human IL-4 gene sequence replaced the deleted mouse IL-4 gene sequence in the humanized allele was confirmed by a TaqMan™ qPCR assay containing the following primer-probe set (written 5' to 3'): human forward primer, GCCTGGACCA AGACTCTGT (SEQ ID NO: 7); human reverse primer, ACCGTGGGAC GGCTTCTTAC (SEQ ID NO: 8); human upstream probe, FAM-CACCGAGTTG ACCGTAACAG ACATC-BHQ (SEQ ID NO: 9). Verification that the hygro selection cassette, along with the human IL-4 gene sequence, had been inserted into the humanized allele was confirmed by a TaqMan™ qPCR assay containing the following primer-probe set (written 5' to 3'): hygro forward primer, TGCGGCCGAT CTTAGCC (SEQ ID NO: 10); hygro reverse primer, TTGACCGATT CCTTGCGG (SEQ ID NO: 11); hygro probe, FAM-ACGAGCGGGT TCGGCCCATT C-BHQ (SEQ ID NO: 12).

[0165] For mice derived from the targeted ES cells, DNA purified from tail biopsies was assayed to determine their IL-4 genotype, and the same LONA assay was used to confirm that the humanized IL-4 allele was transmitted through the germline. Two pups heterozygous for the replacement were mated to generate mice homozygous for replacement of the endogenous mouse IL-4 gene with the human IL-4 gene. Pups homozygous for the replacement were used for phenotyping.

[0166] The upstream junction between the murine IL-4 locus and the sequence containing the human IL-4 gene is [ka] where the human IL-4 sequence is shown in italics and the IL-4 coding sequence is shown in brackets. The downstream junction of the sequence containing the human IL-4 gene and the loxP-introduced hygro selection cassette is [ka] where the human IL-4 sequence is shown in italics and the IL-4 coding sequence is shown in brackets. The downstream junction of the loxP-introduced hygro selection cassette sequence with the murine IL-4 locus is [ka] where the hygro cassette sequence is shown in italics.

[0167] Example 2 Replacement of the endogenous mouse IL-4Rα extracellular domain gene sequence with the human IL-4Rα extracellular domain gene sequence The 15.6 kb human IL-4Rα gene, including exons 1 starting from the ATG start codon through exon 5 and part of intron 5, replaced the 7.1 kb murine IL-4Rα gene locus spanning coding exon 1 starting from the ATG start codon through exon 5 and part of intron 5. Mouse exons 6 to 9 were retained, and only exons 1 to 5 (i.e., the extracellular domain) were humanized. See Figure 2B.

[0168] Targeting constructs for replacing the mouse IL-4Rα gene with the human IL-4Rα gene in a single targeting step were prepared using VelociGene® genetic engineering technology (Valenzuela et al. (2003) High-throughput engineering of the mouse genome coupled with high-resolution expression analysis, Nature Biotech, 21(6):652-659). Mouse IL-4Rα DNA and human IL-4Rα DNA were obtained from bacterial artificial chromosome (BAC) clones RP23-136G14 and RP11-166E24, respectively. Briefly, a targeting construct generated by gap repair cloning and linearized with NotI containing 15.6 kb of human IL-4Rα sequence spanning from the ATG codon in exon 1 to exon 5 and part of intron 5 (genomic coordinates: GRCh37:chr16:27,351,525-27,367,111 (+strand)) and upstream and downstream homology arms of the mouse IL-4Rα gene flanked by a loxP-inserted neo selection cassette was electroporated into F1H4 mouse embryonic stem (ES) cells (C57BL / 6 × 129F1 hybrid). Correctly targeted ES cells (MAID 803) were further electroporated with a transient Cre expression vector to remove the drug selection cassette. Targeted ES cell clones without the drug cassette (MAID 1444) were introduced into 8-cell stage SW mouse embryos using the VelociMouse® method (see U.S. Patent Nos. 7,294,754, 7,576,259, 7,659,442, and Poueymirou et al. (2007) F0 generation mice that are essentially fully derived from the donor gene-targeted ES cells allowing immediate phenotypic analyses, Nature Biotech. 25(1):91-99). VelociMice® (F0 mice entirely derived from donor ES cells) carrying the humanized IL-4Rα gene were identified by genotyping for loss of mouse alleles and gain of human alleles using a modified allele assay (Valenzuela, et al.). (see et al. (2003)).

[0169] Correctly targeted ES cell clones were identified by a loss-of-native allele (LONA) assay (Valenzuela et al. 2003). In this assay, the copy number of the native, unmodified IL-4Rα gene was determined by two TaqMan™ quantitative polymerase chain reactions (qPCR) specific for sequences within the mouse IL-4Rα gene targeted for deletion. The qPCR assay included the following primer-probe set (written 5' to 3'): upstream forward primer, CCGCTGGCAT GTGTATTGTG (SEQ ID NO: 16); upstream reverse primer, TGAGTGTGGG ACCCTCAAGA G (SEQ ID NO: 17); upstream probe, FAM-TGACCCAAGC CCTACATGGC CACT-BHQ (SEQ ID NO: 18); downstream forward primer, TGAGGAGAGC TCACGGGAAT C (SEQ ID NO: 19); downstream reverse primer, ACCCATCTCC TGCGTTTCTG (SEQ ID NO: 20); downstream probe, FAM-TTGACACGCC AGCTACACTG CTCCA-BHQ (SEQ ID NO: 21); where FAM refers to a 5-carboxyfluorescein fluorescent probe and BHQ refers to a black hole quencher-type fluorescent quencher (Biosearch Technologies). DNA purified from ES cell clones that had taken up and integrated the targeting vector into their genomes was combined with TaqMan™ Gene Expression Master Mix (Life Technologies) in a 384-well PCR plate (MicroAmp™ Optical 384-Well Reaction Plate, Life Technologies) according to the manufacturer's recommendations and cycled in an Applied Biosystems Prism 7900HT (which collects fluorescence data during the PCR process and determines the threshold cycle (Ct), the fractional PCR cycle at which accumulated fluorescence reaches a preset threshold). Two qPCRs, one specific for upstream and downstream IL-4Rα and one for a non-target reference gene, were performed for each DNA sample. The difference in Ct values ​​(ΔCt) between each IL-4Rα-specific qPCR and each reference gene qPCR was calculated, and then the difference between each ΔCt and the median ΔCt for all assayed samples was calculated to obtain a ΔΔCt value for each sample. The copy number of the IL-4Rα gene in each sample was calculated using the following formula: copy number = 2 × 2 -ΔΔCtA correctly targeted clone that has lost one of its native copies will have an IL-4Rα gene copy number equal to 1. Confirmation that the human IL-4Rα gene sequence replaced the deleted mouse IL-4Rα gene sequence in the humanized allele was confirmed by a TaqMan™ qPCR assay containing the following primer-probe set (written 5' to 3'): human forward primer, ACCTGCGTCT CCGACTACAT G (SEQ ID NO: 22); human reverse primer, GAGCTCGGTG CTGCAATTG (SEQ ID NO: 23); human probe, FAM-TGGGACCATT CATCTTCCAC TCGCA-BHQ (SEQ ID NO: 24). Confirmation that the neo selection cassette, along with the human IL-4Rα gene sequence, was inserted into the humanized allele was confirmed by a TaqMan™ qPCR assay containing the following primer-probe set (written 5' to 3'): neo forward primer, GGTGGAGAGG CTATTCGGC (SEQ ID NO: 25); neo reverse primer, GAACACGGCG GCATCAG (SEQ ID NO: 26); neo probe, FAM-TGGGCACAAC AGACAATCGG CTG-BHQ (SEQ ID NO: 27).

[0170] For mice derived from the targeted ES cells, DNA purified from tail biopsies was assayed to determine their IL-4Rα genotype, and the same LONA assay was used to confirm that the humanized IL-4Rα allele had been transmitted through the germline. Two pups heterozygous for the replacement were mated to generate mice homozygous for replacement of the endogenous mouse IL-4Rα gene with the human IL-4Rα gene. Pups homozygous for the replacement were used for phenotyping.

[0171] The upstream junction between the murine IL-4Rα locus and the sequence containing the human IL-4Rα gene is [ka] where the human IL-4Rα sequence is shown in italics and the IL-4Rα coding sequence is underlined. The downstream junction of the sequence containing the human IL-4Rα gene and the loxP-introduced neo selection cassette is [ka] where the human IL-4Rα sequence is shown in italics and the cassette sequence is shown in lowercase. The downstream junction with the locus is 5'- tattgttttg ccaagttcta attccatcag acctcgacct gcagccccta gataacttcg tataatgtat gctatacgaa gttatcctag gttggagctc TCTGTAGCCA GGTAACCAAG GGTCCCAGGG GAACCCCCAG TGTGGACGCG GACTGCACAT GACACAGGGC GGCCTCCCA TTCATGACTG TTTTTCTCCT TGCAG(ACTTC CAGCTGCCCC TGATACAGCG CCTTCCACTG GGGGTCACCA TCTCCTGCCT CTGCATCCCG TTGTTTTGCC TGTTCTGTTA CTTCAGCATT ACCAA)GTGAG TTCCTGCTTT GGCTGGTGTC TCTGGCTGGC CCTTCAGCAG TGCTCTCAGA GGTCACAGTC ATTGTGCTGG It was designed to be within the sequence CTGAGAAAAG (SEQ ID NO: 30), where the mouse IL-4Rα coding sequence is shown in brackets and the neo cassette sequence is shown in lowercase.

[0172] Example 3 Generation of doubly humanized IL-4 / IL-4Rα mice Doubly humanized IL-4 / IL-4Ra (IL4 hu / hu / Il4ra hu / hu ) mice were generated as follows: ES cell clone MAID 803, containing a humanized IL-4Rα gene and a loxP-transfected neo cassette, was electroporated with a Cre expression vector, and the loxP-transfected neo cassette was removed to generate ES cell clone MAID 1444, containing a humanized IL-4Rα gene without a drug selection cassette (see Example 2). The same targeting construct used to generate ES cell clone MAID 879 (see Example 1), containing a humanized IL-4 gene and a loxP-transfected hygro cassette, was electroporated into ES cell clone MAID 1444 to generate 879 Het / 1444 Het (Il4 + / hu / Il4ra + / hu ) ES cells were generated, which were then electroporated with a Cre expression vector to remove the loxP-transduced hygro cassette, generating an ES cell clone (MAID 1553 / 1444) containing the humanized IL-4 gene and the humanized IL-4Rα gene. To generate doubly humanized IL-4 / IL-4Rα mice, the ES cell clone MAID 1553 / 1444 without the drug cassette was introduced into 8-cell SW mouse embryos.

[0173] Example 4 Efficacy evaluation of dupilumab, a fully human IL-4Rα mAb, in mice with human IL-4 gene replacement and human IL4Rα gene replacement method VelociGene® technology was used to generate genetically modified mice both for replacement of the mouse full-length IL-4 locus with 8.8 kb of human IL-4 genomic sequence (see Example 1 and FIG. 2A), and for replacement of the extracellular region (i.e., extracellular domain) of the mouse IL-4Rα (CD124) gene with a corresponding 15.6 kb fragment of human IL-4Rα genomic DNA (see Example 2 and FIG. 2B).

[0174] Mice carrying a homozygous humanized IL-4Rα gene were examined for human gene expression and function. To determine the expression of human IL-4Rα by humanized mice, spleen cells from wild-type and humanized mice were collected and treated with mouse CD3, mouse CD19, human CD124, and fluorescently labeled antibodies against mouse CD124 for fluorescence-activated cell sorting (FACS) analysis. (See, e.g., Blaeser et al. (2003) Targeted inactivation of the IL-4 receptor a chain I4R motif promotes allergic airway inflammation, J Exp Med 198(8):1189-1200.)

[0175] To demonstrate ligand specificity and receptor functionality, primary cells derived from humanized IL-4Rα mice were used. Bone marrow-derived macrophages were generated using femoral bone marrow cells from wild-type and humanized IL-4Rα mice and cultured for 7 days in DMEM containing 10% fetal bovine serum plus 20% L-cell conditioned medium.

[0176] Cells were then treated individually with 20 ng / mL of mouse IL-4, mouse IL-13, human IL-4, human IL-13, or vehicle diluted in culture medium for 20 hours. Quadruplicate samples from each condition were collected for gene expression analysis.

[0177] Total RNA from these samples was extracted and amplified into cRNA by incorporating Cy3-CTP. Cy3-labeled cRNA from each sample was then hybridized to a custom Agilent array consisting of 43,538 60-nt oligos covering the mouse transcriptome. Data were extracted from the scanned array images using Agilent Feature Extraction Software 9.5.

[0178] Differentially expressed genes between experimental groups were identified using Student's t-test (p<0.05, variation ratio≧1.5). Expression clusters of these genes were generated using the Pearson correlation clustering algorithm from GeneSpring GX7.3.

[0179] Humanized IL-4Rα (IL4ra hu / hu ) The neutralizing effect of dupilumab on IL-4 was assessed using an in vitro IgE class switching assay using primary B cells isolated from mice.

[0180] For the expression of murine IL-25 in vivo, wild-type (WT) and humanized IL-4Rα (IL4ra hu / hu ) Mice received large volumes of naked plasmid DNA solution via hydrodynamic gene delivery (see, e.g., Liu et al. (1999) Hydrodynamics-based transfection in animals by systemic administration of plasmid DNA, Gene Therapy 6:1258-1266). After 8 days, peripheral blood was collected and serum murine IgE (mIgE) levels were measured using a commercially available ELISA kit (R&D systems, Minnesota, USA).

[0181] Purified primary B cells derived from humanized mouse splenocytes were activated with bacterial LPS and mixed with increasing amounts of recombinant human IL-4 to induce immunoglobulin class switching during 7-day culture. For antibody blocking experiments, purified B cells were incubated with increasing doses of dupilumab for 30 minutes, followed by 7-day culture with 0.167 nM recombinant human IL-4. IgE production in the absence of IL-4 or with an isotype control mAb is indicated by (◇) and (△), respectively. Murine IgE levels in culture supernatants were measured using a commercially available ELISA kit (see, e.g., Moon et al. (1989) Regulation of IgG1 and IgE synthesis by interleukin 4 in mouse B cells, Scand I Immunol 30:355-361).

[0182] Interleukin-25 (IL-25) is a cytokine produced by Th2 cells, whose main activity is mediated through the production of IL-4 and IL-13, and induces tissue-specific symptoms such as increased mucus production and goblet cell hyperplasia in the lungs (Fort et al. (2001) IL-25 induces IL-4, IL-5, and IL-13 and Th2-associated pathologies in vivo, Immunity 15(6):985-995).

[0183] Lack of IL-13 protects animals from IL-25-induced symptoms in target organs. Therefore, we used an IL-25-driven pulmonary inflammation model to evaluate the pharmacodynamic properties (PD) of dupilumab in vivo in mice containing the humanized IL-4 gene and / or the humanized IL-4Rα gene.

[0184] Humanized IL-4Rα (IL4ra hu / hu IL-25-induced inflammation was measured in mice by measuring mucus accumulation in the lungs. was used to characterize the PD response of dupilumab to the type II receptor.

[0185] On day 0, WT and humanized IL-4Rα (IL4ra hu / hu Mice received hydrodynamic delivery of a murine IL-25 expression vector and were subsequently injected with dupilumab or isotype control mAb at the indicated doses. Additional antibody doses were administered every other day for a total of four doses. On day 8, lung tissue was collected from euthanized mice, and processed lung sections were stained with periodic acid-Schiff staining and scored for pathological changes in a blinded fashion.

[0186] result Humanized IL-4Rα mice were characterized to show: (a) doubly humanized IL-4 / IL-4Rα (IL4 hu / hu / Il4ra hu / hu ) Expression of human IL-4Rα on primary cells derived from mice (see Figure 3), (b) humanized IL-4Rα (IL4ra hu / hu ) altered IL-4 ligand specificity in mice (see Figure 4), and (c) humanized IL-4Rα (IL4ra hu / hu ) Functionality of the IL-13 pathway in mice (see Figure 4).

[0187] on gated B and T cell populations As shown in Figure 3, where the labeling profile of IL-4Rα (CD124) is shown and the shaded area indicates the distribution of the corresponding unstained cell population, wild-type and humanized IL-4Rα (IL4ra hu / hu ) mice express similar amounts of IL-4Rα protein on B cells (CD19 + , CD3 - ) and T cells (CD19 - , CD3 + ) is expressed on

[0188] As shown in Figure 4 (left), the wild type (Il4ra + / + ) mice respond to mouse IL-4 but not human IL-4, and respond to both mouse and human IL-13. As shown in Figure 4 (right), humanized IL-4Rα (IL4ra hu / hu ) Mice respond to human IL-4 but not mouse IL-4 and respond to both mouse and human IL-13.

[0189] This data shows that IL-4, but not IL-13, inhibits the activity of wild-type and humanized IL-4Rα (IL4ra hu / hu ) shows that it exhibits species specificity in mice.

[0190] As shown in Figure 5, the role of IL-4 as a major factor mediating IgE class switching was confirmed by humanized IL-4Rα (Il4ra hu / hu ) supported by the lack of an increase in circulating IgE levels after murine IL-25 gene delivery in mice.

[0191] The dupilumab monoclonal antibody has been studied in vitro and in vivo.

[0192] As shown in Figure 6, dupilumab inhibited the activity of humanized IL-4Rα (IL4ra hu / hu )Ma It blocks human IL-4-induced IgE production in cultures of primary mouse B cells.

[0193] As shown in Figure 7, dupilumab dose-dependently reduced IL-25-induced pulmonary symptoms at 10 mg / kg and above (reduced mucus-related symptoms at 25 mg / kg).

[0194] conclusion The above results demonstrate the pharmacological activity of dupilumab, a fully human anti-human IL-4Rα monoclonal antibody, in a genetically engineered mouse model of cytokine-induced inflammation.

[0195] The generation of genetically modified mice carrying human IL-4 and / or IL-4Rα gene replacements provides a powerful tool for assessing the function of gene orthologs and the in vivo efficacy of antibody candidates with limited cross-species cross-reactivity.

[0196] Example 5 House dust mite extract (HDM)-induced pulmonary inflammation model Chronic airway inflammation was induced in doubly humanized IL-4 and IL-R4α mice by intranasal exposure to house dust mite (HDM) extract (Greer Laboratories). Briefly, mice were first sensitized by intranasal instillation of HDM suspension (20 μl at a concentration of 2.5 μg / mL) for 10 days. After a 2-week recovery period, mice were re-challenged by intranasal HDM application three times a week between weeks 5 and 12. Treatment with dupilumab (anti-IL4Rα antibody) by subcutaneous injection was administered twice a week starting from week 7 until the end of the experiment at week 12. Tissue samples were collected for further analysis. The experimental design is illustrated in Figure 8.

[0197] Demonstration of the therapeutic efficacy of dupilumab in an HDM-induced airway inflammation model using doubly humanized IL-4 and IL-4Rα mice Using the protocol described above, doubly humanized IL-4 and IL-4Rα (IL-4 hu / hu / IL-4R hu / hu) mice induced airway disease. Histological analysis of lung tissue showed that intranasal instillation of HDM caused increased mucus production in the airways. Dupilumab treatment reduced mucus accumulation in HDM-exposed mice. Analysis of infiltrating cells in bronchoalveolar lavage fluid (BALF) showed that the number of eosinophils was increased by HDM instillation and decreased by dupilumab treatment. HDM treatment in humanized mice elevated total circulating IgE, suggesting an active IL-4 signaling pathway. Dupilumab treatment reduced IgE levels. In contrast, IL13R2α-Fc, a comparator molecule that only antagonizes IL-13 without interfering with IL-4 signaling, had comparable activity in reducing mucus accumulation and preventing eosinophil infiltration. Nevertheless, differential effects on circulating IgE levels were detected between dupilumab and the IL-13 antagonist IL13R2α-Fc. Blockade of the IL-13 pathway alone was insufficient to reduce HDM-induced IgE levels, whereas dupilumab reduced the production of IgE, a major pathogenic mediator of allergy, by blocking both the IL-4 and IL-13 pathways.

[0198] In a separate set of experiments, doubly humanized IL-4 and IL-4Rα (IL-4Rα) were assayed using the same protocol as above, except that different controls were used. hu / hu / IL-4R hu / hu Airway disease was induced in mice. These experiments used an isotype control antibody of the same IgG isotype as dupilumab. The experimental design is illustrated in Figure 9. mRNA was purified from total RNA using the Dynabeads mRNA kit (Life Tech) and analyzed using the Scriptseq RNA Library Prep kit. Strand-specific RNA-seq libraries were prepared from mRNA using a 33-bp read length sequencing kit (Illumina). Libraries were sequenced using a HiSeq 2000 (Illumina) with a read length of 33 bp, and gene expression levels were extracted from raw reads using the Clcbio (Qiagen) RNA-Seq workflow. Differentially expressed genes between experimental groups were identified using a Student's t-test (p<0.05, variation ratio ≥1.5). Expression clusters of these genes were generated using the Pearson correlation clustering algorithm in GeneSpring GX7.3. HDM was found to induce variations in pulmonary gene expression in doubly humanized IL-4 and IL-4Rα mice, and these variations were blocked by dupilumab. Serum samples were collected from euthanized mice at the end of the treatment period. Serum murine IgE levels were measured using a commercially available ELISA kit (R&D systems). Statistical analysis was performed using a standard one-way ANOVA.

[0199] Example 6 Antigen-induced skin inflammation model Chronic dermatitis in doubly humanized IL-4 and IL-4Rα mice was induced using the following procedure. The hair on the backs of humanized mice was shaved with electric clippers, followed by minor wounding with adhesive tape to disrupt the skin barrier. Gauze patches soaked in a solution of allergen (e.g., ovalbumin plus bacterial toxins or dust mite extract) were applied to the skin for one week, followed by a two-week recovery period. This procedure was repeated three times over a total of seven weeks to induce atopic dermatitis-like skin lesions. Treated mice exhibited elevated IgE levels, itching, and thickened epithelium, typical symptoms of atopic dermatitis.

[0200] Example 7 Characterization of the PK profile of an anti-human IL-4Rα antibody in mice expressing humanized IL-4Rα This example describes experiments performed to evaluate the PK profiles of REGN668 (a human monoclonal antibody directed against human IL-4Rα, also known as "dupilumab") and the control antibody REGN646 (a monkey surrogate, anti-mfIL-4R non-binding control antibody).

[0201] The mice used in these experiments were MAID 1444 (homozygous for humanized IL-4Rα, or "IL-4Rα Humin," in which the IL-4Rα extracellular domain is human and the transmembrane and cytoplasmic domains are murine) and strain-matched (75% C57BL / 6, 25% 129Sv) wild-type ("WT") mice aged 20-23 weeks. Study groups included a total of 40 male and female mice, with a cohort size of 5 homozygous and 5 strain-matched WT mice per drug / dose. Antibody (in PBS buffer) was administered to mice at 10 mg / kg via subcutaneous injection. For analysis, blood samples were collected on the day of injection (time point "0" or day 0), 6 hours after injection, and on days 1, 3, 7, 10, 14, 21, and 30.

[0202] Circulating drug (i.e., REGN668 or REGN646) levels were determined by total human antibody analysis using an ELISA immunoassay. Briefly, goat anti-human IgG polyclonal antibody (Jackson ImmunoResearch, #109-005-098) was coated onto a 96-well plate to capture human antibodies in the serum being tested. Plate-bound antibodies were then detected using horseradish peroxidase-conjugated goat anti-human IgG polyclonal antibody (Jackson ImmunoResearch, #109-035-098) and TMB substrate (BD Pharmingen). Serum samples were diluted at concentrations ranging from 1:100 to 1:243,000. Each sample was serially diluted in six steps, and the reference standard for each antibody was serially diluted in 12 steps. Serum concentrations of drug antibodies were calculated based on the reference standard curve generated using Graphpad Prism software.

[0203] IL-4Rα compared to wild-type mice with only mouse IL-4Rα protein The half-life of REGN 668 was found to be shorter in Humln mice. This difference in PK profile can be explained by target-mediated interaction and clearance between the monoclonal antibody and the human IL-4α receptor. Therefore, mice expressing human or humanized IL-4Rα provide a suitable simulation for characterizing the PK properties of anti-human IL-4Rα antibodies (e.g., dupilumab) in preclinical mouse models.

[0204] Uses of humanized IL-4 and / or IL-4Rα mice Humanized IL-4 and / or IL-4Rα are useful for assessing the pharmacodynamics (PD) of human-specific IL-4 and / or IL-4Rα antagonists (e.g., neutralizing anti-IL-4 antibodies and / or anti-IL-4Rα antibodies, e.g., dupilumab).

[0205] Pharmacokinetic (PK) and PD assays in humanized IL-4 and / or IL-4Rα mice are performed according to standard procedures known in the art.

[0206] Humanized IL-4 and / or IL-4Rα mice are useful for testing the in vivo therapeutic efficacy of human-specific IL-4 and / or IL-4Rα antagonists (e.g., neutralizing anti-IL-4 and / or anti-IL-4Rα antibodies, e.g., dupilumab) in various disease models known in the art, for example, as set forth herein above.

[0207] Example 8 Replacement of the endogenous mouse IL-33 gene with the human IL-33 gene Mouse IL-33 gene (NCBI gene ID: 77125, primary source: MGI:1924375; RefSeq transcript: NM_001164724.1; UniProt ID: Q8BVZ5; genome assembly: NCBI37 / mm9; location: chr19:29,999,604-30,035,205 + strand) has eight exons and encodes a protein of 266 amino acids (GenBank Accession No. NP_001158196.1).

[0208] The human IL-33 gene (NCBI Gene ID: 90865, primary source: HGNC:16028; RefSeq transcript: NM_033439.3; UniProt ID: O95760; genome assembly: GRCh37 / hg19; location: chr9:6,215,149-6,257,983 + strand) also has eight exons and encodes a 270 amino acid protein (GenBank Accession No. NP_254274.1).

[0209] A 16,333 bp human genomic segment containing exon 2 starting from the ATG start codon through exon 8 (including the 3' untranslated region) of the human IL-33 gene replaced the 9,381 bp murine IL-33 gene locus spanning exon 2 starting from the ATG start codon through the coding portion of exon 8, including the stop codon. See Figure 10A.

[0210] Targeting constructs for replacing the mouse IL-33 gene with a human IL-33 genomic segment in a single targeting step were generated using VelociGene® genetic engineering technology (Valenzuela et al. (2003) High-throughput engineering). A human IL-4 genome segment was constructed using a recombinant IL-33 vector (see, "Engineering of the mouse genome coupled with high-resolution expression analysis," Nature Biotech, 21(6):652-659) similar to the procedure described in Example 1 above for replacing the mouse IL-4 gene with a human IL-4 genome segment, except that mouse and human IL-33 DNA were obtained from bacterial artificial chromosome (BAC) clones bMQ-350I18 and CTD-3015M15, respectively, and the targeting vector contained a loxP neomycin selection cassette (Figure 10B).

[0211] A correctly targeted ES cell clone (MAID 7060) was identified by a loss-of-native allele (LONA) assay (Valenzuela et al. 2003), in which the number of copies of the native, unmodified IL-33 gene was determined by two TaqMan™ quantitative polymerase chain reactions (qPCR) specific for sequences within the mouse IL-33 gene targeted for deletion. The qPCR assay included the following primer-probe set (listed 5' to 3'): Upstream ("mTU"): forward primer, TTGGACTAGTAACAAGAAGGGTAGCA (SEQ ID NO: 31); reverse primer, CCTTTCCCATCACCCTCTAACTT (SEQ ID NO: 32); Probe (MGB), AGCTCTGGTGGACAGA (SEQ ID NO: 33); Downstream (“mTD”): forward primer, TCTCTGCCAAGCTGCTTATCC (SEQ ID NO: 34); reverse primer, GGCTGCATGGAAGAGGTGAA (SEQ ID NO: 35); Probe (MGB), CTCTCCACAAATCG (SEQ ID NO: 36).

[0212] Confirmation that the human IL-33 gene sequence replaced the mouse IL-33 gene sequence in the humanized allele was confirmed by a TaqMan™ qPCR assay containing the following primer-probe set (written 5' to 3'): Upstream (“hTU”) forward primer, CAGGCAGGAATAGCTGAGATAATCT (SEQ ID NO: 37); reverse primer, TGTGGAGCAAAAAGTGGTTGAT (SEQ ID NO: 38); Probe (MGB), CCTGTGAATAGTGATAAAC (SEQ ID NO: 39); Downstream ("hTD"): forward primer, CAGTTCCAAACGATAGGCTCAA (SEQ ID NO: 40); reverse primer, ATAATTCTGTGAAGCATCTGGTCTTC (SEQ ID NO: 41); Probe (MGB), CTAGAGCTGCTAGTAAAA (SEQ ID NO: 42).

[0213] The upstream junction between the murine IL-33 locus and the sequence containing the human IL-33 gene (indicated by "I" in Figure 10B) [ka] The downstream junction of the sequence containing the human IL-33 genomic sequence and the loxP neomycin selection cassette (designated "II" in Figure 10B) is [ka] The downstream junction between the sequence of the loxP neo selection cassette and the murine IL-33 locus (indicated as "III" in Figure 10C) is 5'-AGCCCCTAG A TAACTTCGTA TAATGTATGC TATACGAAGT TAT GCTAGTA ACTATAACGG TCCTAAGGTA GCGAGCTAGC / CGCCTGTGCG TTCTGGGTTG AATGACTTAA TGCTTCCAAC TGAAGAAAGG GTAACAGAGA GAAAGAAAGC CATTCTTGGC-3' (SEQ ID NO: 45), where the junction is indicated by the " / " symbol and the loxP site is underlined.

[0214] The correctly targeted ES cells (MAID 7060) were further electroporated with a transient Cre expression vector to remove the drug selection cassette, resulting in an ES cell clone (MAID 7061) lacking the drug cassette. The upstream junction in these MAID 7061 ES cells (indicated by "I" in Figure 18C) is identical to that in MAID 7060 ES cells. The downstream junction (indicated by "II" in Figure 18C) is identical to that in MAID 7060 ES cells. [ka] where the 3' human IL-33 sequence is italicized up to the first " / " symbol, the murine IL-33 3' sequence is italicized from after the second " / " symbol, and the loxP site is underlined.

[0215] Appropriately targeted ES cells (MAID 7060 or MAID 7061) were introduced into 8-cell stage SW mouse embryos by the VelociMouse® method (U.S. Patent Nos. 7,294,754, 7,576,259, 7,659,442, and Poueymirou et al. (2007) F0 generation). mice that are essentially fully derived (See Nature Biotech. 25(1):91-99, allowing immediate phenotypic analyses from the donor gene-targeted ES cells.) VelociMice® (F0 mice derived entirely from donor ES cells) carrying the humanized IL-33 gene were identified by genotyping for loss of mouse alleles and gain of human alleles using a modification of an allele assay (see Valenzuela et al. (2003)). Mice derived from the targeted ES cells were assayed on DNA purified from tail biopsies to determine their IL-33 genotype, and the same LONA assay was used to confirm that the humanized IL-33 allele was transmitted through the germline. Two pups heterozygous for the replacement were bred to generate mice homozygous for replacement of the endogenous mouse IL-33 gene with the human IL-33 gene.

Claims

1. A rodent embryonic stem (ES) cell, (i) replacement of a genomic fragment of a rodent IL-4Rα gene at the endogenous rodent IL-4Rα locus with a genomic fragment of a human IL-4Rα gene to form a humanized IL-4Rα gene; the genomic fragment of the rodent IL-4Rα gene comprises from the ATG start codon of coding exon 1 to coding exon 5 of the rodent IL-4Rα gene; the genomic fragment of the human IL-4Rα gene comprises from the ATG initiation codon of coding exon 1 to coding exon 5 of the human IL-4Rα gene; the humanized IL-4Rα gene comprises the ATG initiation codon of coding exon 1 through coding exon 5 of the human IL-4Rα gene and coding exons 6 to 9 of the rodent IL-4Rα gene; expression of the humanized IL-4Rα gene is under the control of rodent IL-4Rα regulatory elements in the endogenous rodent IL-4Rα locus; and (ii) replacement of a genomic fragment of a rodent IL-4 gene at an endogenous rodent IL-4 locus with a genomic fragment of a human IL-4 gene to form a humanized IL-4 gene; the genomic fragment of the rodent IL-4 gene comprises from the ATG initiation codon of exon 1 to exon 4 of the rodent IL-4 gene; the genomic fragment of the human IL-4 gene comprises the ATG initiation codon of exon 1 to exon 4 of the human IL-4 gene; A rodent ES cell, wherein expression of the humanized IL-4 gene is under the control of rodent regulatory elements in the endogenous rodent IL-4 locus.

2. The rodent ES cell of claim 1 , wherein the rodent ES cell is a mouse ES cell.

3. The rodent ES cell of claim 1 , wherein the rodent ES cell is a rat ES cell.

4. A rodent embryo comprising the rodent ES cell of claim 1.

5. The rodent embryo of claim 4 , wherein the rodent ES cells are mouse ES cells and the rodent embryo is a mouse embryo.

6. The rodent embryo of claim 4 , wherein the rodent ES cells are rat ES cells and the rodent embryo is a rat embryo.

7. A method for producing genetically modified rodent ES cells, comprising: replacing a genomic fragment of a rodent IL-4Rα gene at an endogenous rodent IL-4Rα locus with a genomic fragment of a human IL-4Rα gene to form a humanized IL-4Rα gene; and replacing a genomic fragment of a rodent IL-4 gene in the endogenous rodent IL-4 locus with a genomic fragment of a human IL-4 gene to form a humanized IL-4 gene, thereby obtaining the genetically modified rodent ES cells. Including, the genomic fragment of the rodent IL-4Rα gene comprises from the ATG start codon of coding exon 1 to coding exon 5 of the rodent IL-4Rα gene; the genomic fragment of the human IL-4Rα gene comprises from the ATG initiation codon of coding exon 1 to coding exon 5 of the human IL-4Rα gene; the humanized IL-4Rα gene comprises the ATG initiation codon of coding exon 1 through coding exon 5 of the human IL-4Rα gene and coding exons 6 to 9 of the rodent IL-4Rα gene; expression of the humanized IL-4Rα gene is under the control of rodent IL-4Rα regulatory elements in the endogenous rodent IL-4Rα locus; and the genomic fragment of the rodent IL-4 gene comprises from the ATG initiation codon of exon 1 to exon 4 of the rodent IL-4 gene; the genomic fragment of the human IL-4 gene comprises the ATG initiation codon of exon 1 to exon 4 of the human IL-4 gene; The method, wherein expression of the humanized IL-4 gene is under the control of rodent regulatory elements in the endogenous rodent IL-4 locus.

8. The method of claim 7, wherein the rodent ES cells are mouse ES cells.

9. The method of claim 7, wherein the rodent ES cells are rat ES cells.

Images