Composition for preventing or treating liver cancer containing modified RT-LET7 as an active ingredient

Abstract

The present invention relates to a pharmaceutical composition for preventing or treating liver cancer, comprising modified RT-LET7 or modified RT-LET7 bound to a hepatocyte targeting moiety as an active ingredient, and the modified RT-LET7 according to the present invention has the effect of increasing the inhibition of Let-7i-5p expression, increasing the inhibition of liver cancer cell growth, increasing the expression of TSP1, and increasing the phagocytic activity of macrophages, as compared to the existing RT-LET7, which is an antisense microRNA (AS-miRNA) that inhibits Let-7i-5p. In addition, the modified RT-LET7 is bound to a hepatocyte targeting moiety to increase the delivery to liver cancer cells, thereby significantly improving the therapeutic effect of liver cancer, and may be usefully used as a pharmaceutical composition for preventing and treating liver cancer or an immunological anticancer agent for preventing or treating CD47-positive liver cancer.

Description

[Technical Field]

[0001] The present invention relates to a pharmaceutical composition for preventing or treating liver cancer, and more particularly to a pharmaceutical composition for preventing or treating liver cancer, which contains, as an active ingredient, a modified RT-LET7 that is an inhibitor of Let-7i-5p expression, or a modified RT-LET7 equipped with a delivery system. [Background technology]

[0002] Liver cancer is the fifth most common cancer worldwide, but it is an aggressive cancer with the third highest mortality rate (Ahn J, Flamm SL Hepatocellular carcinoma Dis Mon 2004;50:556-573). Curative surgery is only feasible for approximately 15% to 25% of patients, and many liver cancer patients die relatively quickly from locally advanced or metastatic disease (Roberts LR, Gores GJ Hepatocellular carcinoma: molecular pathways and new therapeutic targets Semin Liver Dis 2005;25:212-225). Hepatitis B virus, hepatitis C virus, and aflatoxin B1 are well-known to be major causes of liver cancer. However, the overall survival rate of liver cancer patients has not increased significantly over the past 20 years, and the mechanisms of liver cancer development and progression remain poorly understood (Bruix J, et al. Focus on hepatocellular carcinoma Cancer Cell 2004;5:215-219). To date, molecular targeted therapy has been shown to be effective in treating mature liver cancer (Shen YC, Hsu C, Cheng AL. Molecular targeted therapy for advanced hepatocellular carcinoma: current status and future perspectives J Gastroenterol;45:794-807). However, it remains unclear how these genetic alterations cause the clinical characteristics observed in individual liver cancer patients.

[0003] Histone deacetylases (HDACs) can bind to gene promoters, often as corepressors or in multi-protein transcriptional complexes, where they regulate transcription by modifying chromatin without directly binding to DNA (Thiagalingam S, Cheng KH, Lee HJ, Mineva N, Thiagalingam A, Ponte JF Histone deacetylases: unique players in shaping the epigenetic histone code Ann NY Acad Sci 2003;983:84-100). There are 18 encoded human HDACs, which are classified into class I (HDACs 1, 2, 3, and 8), class II (HDACs 4, 5, 6, 7, 9, and 10), class III (SIRTs 1-7), and class IV (HDAC 11) enzymes (Yang XJ, Seto E. The Rpd3 / Hda1 family of lysine deacetylases: from bacteria and yeast to mice and men. Nat Rev Mol Cell Biol 2008;9:206-218). Histone acetyltransferases and HDACs are all known to be involved in cell proliferation, differentiation, and cell cycle regulation (Witt O, Deubzer HE, Milde T, Oehme I. HDAC family: What are the cancer-relevant targets? Cancer Lett 2009;277:8-21).It has also been reported that pathological activity and deregulation of HDACs can cause various diseases such as cancer, immune disorders, and muscular dystrophy (Yang XJ, Seto E. HDACs and HDACs: from structure, function, and regulation to novel strategies for therapy and prevention. Oncogene 2007;26:5310-5318). HDAC6 is a class IIb family member of HDACs and mediates the function of microtubules (MTs).

[0004] It acts as a cytoplasmic deacetylase that deacetylates alpha-tubulin (Hubbert C, Guardiola A, Shao R, Kawaguchi Y, Ito A, Nixon A, et al HDAC6 is a microtubule-associated Mis18α. Nature 2002;417:455-458).

[0004] Meanwhile, miRNAs are a type of endogenous small RNA (RNA) found in cells, measuring 20-25 nucleotides in length. They are derived from DNA that does not synthesize proteins and are produced from hairpin-shaped transcripts. miRNAs bind to complementary sequences in the 3'-UTR of target mRNAs, inducing translational repression or destabilization of the mRNA, ultimately acting as a repressor that suppresses protein synthesis of the target mRNA. It is known that one miRNA targets several mRNAs, and that an mRNA can also be regulated by several miRNAs.

[0005] Meanwhile, macrophages engulf diseased cells (cancer cells) through phagocytosis, which occurs when the Fc fragment of an antibody binds to Fc receptors on the macrophage membrane. However, tumors can evade attack by immune cells, including macrophages, by subverting normal immune regulatory mechanisms. One such mechanism is CD47, a protein expressed on normal cells. CD47 interacts with a macrophage receptor called SIRPα (signal-regulatory protein α), which induces macrophages to transmit a "don't eat me" (phagocytosis block) signal, causing them to leave the normal cells. Similarly, expression of CD47 by cancer cells renders them resistant to macrophages, even when bound to antibodies. Thus, although large numbers of macrophages approach tumors, they cannot attack cancer cells unless the "phagocytosis block" signal is abrogated. One therapeutic strategy for this is to block the "phagocytosis block" signal using a monoclonal antibody against CD47.

[0006] Therefore, the present invention has confirmed that RT-LET7, an inhibitor of Let-7i-5p expression, can be modified to have improved efficacy compared to existing RT-LET7, and thus can be used as a pharmaceutical composition for preventing or treating liver cancer. Furthermore, the modified RT-LET7 suppresses Let-7i-5p in liver cancer cells, increasing TSP1, and the increased TSP1 binds to CD47, preventing its interaction with SIRPα in macrophages. Therefore, it has been confirmed that the modified RT-LET7 can be used as an immuno-anticancer agent for the treatment of CD47-positive liver cancer by significantly increasing the phagocytic activity of macrophages through the mechanism of preventing the binding of CD47 in liver cancer cells to SIRPα in macrophages, thereby enhancing the immune activity of macrophages against cancer cells and exerting an anti-cancer effect, thereby significantly increasing the phagocytic activity of macrophages. Thus, the present invention has been completed. Summary of the Invention [Problem to be solved by the invention]

[0007] An object of the present invention is to provide nucleic acid molecules that target Let-7i-5p. Another object of the present invention is to provide a nucleic acid molecule characterized in that a hepatocyte targeting moiety is bound to the nucleic acid molecule. Another object of the present invention is to provide a pharmaceutical composition for preventing or treating liver cancer, which contains the nucleic acid molecule as an active ingredient.

[0008] Another object of the present invention is to provide an immunological anticancer agent for treating CD47-positive liver cancer, which comprises the nucleic acid molecule as an active ingredient. Another object of the present invention is to provide a method for preventing or treating liver cancer, which comprises administering the pharmaceutical composition to an individual.

[0009] Another object of the present invention is to provide a nucleic acid molecule targeting Let-7i-5p, characterized in that the nucleotide sequence of the nucleic acid molecule represented by SEQ ID NO: 1 has been modified by 2'-O-Methoxyethylation and a hepatocyte targeting moiety has been attached, the backbone of which has been partially modified with phosphorothioate. [Means for solving the problem]

[0010] To solve the above problem, the present invention provides a nucleic acid molecule targeting Let-7i-5p, characterized in that the nucleic acid molecule is represented by the base sequence of SEQ ID NO: 1, and is a nucleic acid whose nucleotide sequence has been modified by 2'-O-Methoxyethylation, and in that a portion or the entire backbone has been modified with phosphorothioate.

[0011] The present invention also provides a nucleic acid molecule targeting Let-7i-5p, characterized in that the nucleic acid molecule is represented by the base sequence of SEQ ID NO: 1, and is a nucleic acid whose nucleotide sequence has been modified by 2'-O-Methoxyethylation, and in that a portion or the entire backbone has been modified with phosphorothioate, and in that a hepatocyte-targeting moiety is bound to the nucleic acid molecule.

[0012] The present invention provides a pharmaceutical composition for preventing or treating liver cancer, which comprises modified RT-LET7 as an active ingredient. The present invention also provides a pharmaceutical composition for preventing or treating liver cancer, comprising, as an active ingredient, a modified RT-LET7 conjugated with a hepatocyte-targeting moiety. The present invention also provides an immuno-anticancer pharmaceutical composition for treating CD47-positive liver cancer, which comprises modified RT-LET7 as an active ingredient.

[0013] The present invention also provides an immunological anticancer agent for treating CD47-positive liver cancer, which comprises, as an active ingredient, a modified RT-LET7 conjugated with a hepatocyte-targeting moiety. The present invention also provides a method for preventing or treating liver cancer, comprising administering the pharmaceutical composition to an individual. [Effects of the Invention]

[0014] The modified RT-LET7 or the modified RT-LET7 conjugated with a hepatocyte-targeting moiety according to the present invention has the effects of increasing the suppression of Let-7i-5p expression, increasing the growth inhibition of hepatoma cells, increasing TSP1 expression, and increasing the phagocytic activity of macrophages, compared to the existing RT-LET7, which is an antisense microRNA (AS-miRNA) that inhibits Let-7i-5p. Furthermore, by conjugating the modified RT-LET7 with a hepatocyte-targeting moiety, the ability to be delivered to hepatoma cells is increased, thereby significantly improving the therapeutic effect of hepatoma. Therefore, the modified RT-LET7 may be useful as a pharmaceutical composition for preventing and treating hepatoma or an immunoanticancer agent for preventing or treating CD47-positive hepatoma. [Brief explanation of the drawings]

[0015] [Figure 1A] In one embodiment of the present invention, various modified structures (Figure 1A) and inhibitory efficiencies (Figure 1B) of RT-LET7, an inhibitor of Let-7i-5p expression (basic form: RT-LET7, modified forms: RT-LET7-2, RT-LET7-4, RT-LET7-6, and RT-LET7-8) are shown. [Figure 1B] (As mentioned above.) [Figure 2A] In one embodiment of the present invention, the modified RT-LET7 of the present invention, RT-LET7-8, significantly and persistently suppressed Let-7i-5p in HCC cell lines (Figure 2A; SNU-387, Figure 2B; SNU-368, Figure 2C; SNU-423). [Figure 2B] (As mentioned above.) [Figure 2C] (As mentioned above.) [Figure 3A]In one embodiment of the present invention, the growth inhibition of HCC cell lines and the increase in macrophage activity were confirmed by the modified RT-LET7 of the present invention, RT-LET7-8 (Figure 3A; tumorigenicity characteristics of Let-7i-5p by MTT and cell viability analysis; Figure 3B; changes in TSP1 expression by Western blot analysis after treatment with the original RT-LET7 and modified RT-LET7-8; Figure 3C; macrophage phagocytic activity of HCC cells treated with the original RT-LET7 and modified RT-LET7-8). [Figure 3B] (As mentioned above.) [Figure 3C] (As mentioned above.) [Figure 4A] FIG. 1 shows the inhibitory effect of GalNAc-conjugated RT-LET7-8 on Let-7i-5p expression in HCC cells and its sustained inhibitory effect on Let-7i-5p. [Figure 4B] (As mentioned above.) [Figure 5A] FIG. 1 shows the inhibitory effect of Gal-LNP-conjugated RT-LET7-8 on Let-7i-5p expression in HCC cells and its sustained inhibitory effect on Let-7i-5p in one example of the present invention. [Figure 5B] (As mentioned above.) [Figure 6A] In one embodiment of the present invention, GalNAc-conjugated RT-LET7-8 inhibited the growth of HCC cell lines and increased macrophage activity (Figure 6A; tumorigenicity characteristics of Let-7i-5p as determined by MTT and cell viability analysis; Figure 6B; changes in TSP1 expression as determined by Western blot analysis after treatment with GalNAc-conjugated RT-LET7-8; Figure 6C; macrophage phagocytic activity of HCC cells treated with GalNAc-conjugated RT-LET7-8). [Figure 6B] (As mentioned above.) [Figure 6C] (As mentioned above.) [Figure 7A]In one embodiment of the present invention, the growth inhibition of HCC cell lines and the increase in macrophage activity were confirmed by Gal-LNP-conjugated RT-LET7-8 (Figure 7A; tumorigenicity characteristics of Let-7i-5p as determined by MTT and cell viability analysis; Figure 7B; changes in TSP1 expression as determined by Western blot analysis after treatment with Gal-LNP-conjugated RT-LET7-8; Figure 7C; macrophage phagocytic activity of HCC cells treated with Gal-LNP-conjugated RT-LET7-8). [Figure 7B] (As mentioned above.) [Figure 7C] (As mentioned above.) [Figure 8A] FIG. 8A shows a simplified schematic diagram of hepatocyte-targeting delivery systems (GalNAc and Gal-LNP) conjugation in one embodiment of the present invention (FIG. 8A: Gal-LNP conjugation, FIG. 8B: Old-GalNAc conjugation, FIG. 8C: D-GalNAc conjugation). [Figure 8B] (As mentioned above.) [Figure 8C] (As mentioned above.) [Figure 9A] This figure shows the inhibitory efficiency of Let-7i-5p expression and the sustained inhibitory effect of Let-7i-5p in HCC cells of RT-LET7-8 bound to a different structure of GalNAc (D-GalNAc) in one example of the present invention. [Figure 9B] (As mentioned above.) [Figure 9C] (As mentioned above.) [Figure 10A] FIG. 1 is a diagram confirming the growth inhibition of HCC cell lines by RT-LET7-8 conjugated with a different GalNAc structure (D-GalNAc) in one example of the present invention. [Figure 10B] (As mentioned above.) [Figure 11A] FIG. 1 shows changes in TSP1 expression in HCC cell lines and increased macrophage activity confirmed by RT-LET7-8 conjugated with a different GalNAc structure (D-GalNAc) in one example of the present invention. [Figure 11B] (As mentioned above.) DETAILED DESCRIPTION OF THE INVENTION

[0016] The present invention will be described in detail below with reference to the accompanying drawings. However, the following examples are presented as examples of the present invention, and if it is determined that a detailed description of a technology or configuration well known to those skilled in the art may unnecessarily obscure the gist of the present invention, such detailed description may be omitted and the present invention is not limited thereby. The present invention is susceptible to various modifications and applications within the scope of the claims below and the scope of equivalents analyzed therefrom.

[0017] Furthermore, the terminology used in this specification is used to appropriately describe preferred embodiments of the present invention, and may vary depending on the intention of the user or operator, or the practice of the art to which the present invention pertains. Therefore, definitions of these terms should be based on the overall content of this specification. Throughout the specification, when a part "comprises" a certain element, this does not mean that it excludes other elements, but that it may further include other elements, unless otherwise specified.

[0018] In one aspect, the present invention relates to a nucleic acid molecule represented by SEQ ID NO: 1, which targets Let-7i-5p.

[0019] In one embodiment, the "nucleic acid molecule" of the present invention may be modified by 2'-O-Methoxyethylation of the nucleotide sequence.

[0020] In one embodiment, the "nucleic acid molecule" of the present invention may have a partial or entire backbone modified with phosphorothioate, preferably, the backbone of the nucleotides 1 to 4 from the 5' end and 1 to 4 from the 3' end of SEQ ID NO: 1 may be modified with phosphorothioate, but is not limited thereto.

[0021] In one embodiment, the "nucleic acid molecule" of the present invention may be linked to a hepatocyte targeting moiety.

[0022] Furthermore, the hepatocyte-targeting moiety may be any known hepatic tissue-targeting drug delivery system, without limitation, including, for example, N-Acetylgalactosamine (GalNAc), Gal-LNP (Galactosyl lipidoid nanoparticle), Lipid-siRNA, Antibody-siRNA, Peptide-ASO, Stable nucleic acid lipid particle, Exosome, Spherical nucleic acid, and DNA cage (Nat Rev Drug Discov. 2020 Oct; 19(10): 673-694).

[0023] Furthermore, the Gal-LNP (Galactosyl lipidoid nanoparticle) may be composed of cholesterol, DSPC, C16-PET2000-ceramide, and α-galactosyl ceramide.

[0024] Furthermore, the N-Acetylgalactosamine (GalNAc) may be one represented by Chemical Formula 1 or 2, and preferably one represented by Chemical Formula 2, but is not limited thereto.

[0025] [ka]

[0026] [ka]

[0027] In one aspect, the present invention relates to a pharmaceutical composition for preventing or treating liver cancer, which comprises the nucleic acid molecule as an active ingredient.

[0028] In one embodiment, the "composition" of the present invention may suppress the expression of Let-7i-5p.

[0029] In one embodiment, the "composition" of the present invention may inhibit the growth of liver cancer cells.

[0030] In one embodiment, the "composition" of the present invention may increase the expression of TSP1 (thrombospondin-1).

[0031] In one embodiment, the "composition" of the present invention may increase the phagocytic activity of macrophages.

[0032] In one aspect, the present invention relates to an immunoanticancer agent for treating CD47-positive liver cancer, which comprises the nucleic acid molecule as an active ingredient.

[0033] In one embodiment, the "TSP1" of the present invention may occupy the CD47 receptor and disrupt CD47-SIRPα interaction.

[0034] In one embodiment, the "nucleic acid molecule" of the present invention may regulate the let-7i-p-TSP1 signaling axis and may reactivate macrophage phagocytosis of HCC cells by converting the CD47-SIRPα interaction between macrophages and HCC cells into CD47-TSP1 interaction.

[0035] In one embodiment, the "liver cancer" of the present invention may be a liver cancer with high Let-7i-5p expression, or may be a hepatocellular carcinoma, and may be in stage I, II, III, IVA, or IVB. The tumor may be hepatocellular carcinoma of stage III or IV, which is more difficult to treat than early-stage hepatocellular carcinoma.

[0036] In one embodiment, the "liver cancer" of the present invention may be TSP1 low-expression liver cancer or hepatocellular carcinoma, and may be stage I, II, III, IVA or IVB. The tumor may be hepatocellular carcinoma in stage III or IV, which is more preferably hepatocellular carcinoma in stage III or IV, which is more difficult to treat than early-stage tumors.

[0037] The term "silencing" as used herein means causing a decrease in the expression (into mRNA) or translation (into protein) of a target gene, preferably such that the expression of the target gene is undetectable or present at insignificant levels.

[0038] The term "prevention" as used in the present invention means any action of suppressing or delaying the occurrence, development and recurrence of liver cancer by administering the composition according to the present invention.

[0039] The term "treatment" as used herein refers to any action that improves or favorably alters the symptoms of liver cancer and its complications by administering the composition of the present invention. Those skilled in the art should be able to know the exact criteria for diseases for which the composition of the present invention is effective and judge the degree of improvement, enhancement, and treatment by referring to materials presented by the Korean Medical Association, etc.

[0040] In one embodiment, the pharmaceutical composition may be in one or more dosage forms selected from the group consisting of oral dosage forms, topical preparations, suppositories, sterile injection solutions, and sprays.

[0041] The compositions of the present invention may also contain carriers, diluents, excipients, or combinations of two or more thereof commonly used in biological preparations. Pharmaceutically acceptable carriers are not particularly limited as long as they are compatible with in vivo delivery of the composition. For example, compounds listed in the Merck Index, 13th ed., Merck & Co. Inc., saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, or a mixture of one or more of these components may be used. Other commonly used additives, such as antioxidants, buffers, and bacteriostats, may also be added as needed. Furthermore, diluents, dispersants, surfactants, binders, and lubricants may be added to formulate the compositions into commonly used dosage forms, such as aqueous solutions, suspensions, emulsions, pills, capsules, granules, or tablets. Furthermore, the compositions may be formulated in a suitable manner by a method known in the art or as described in Remington's Pharmaceutical Sciences (Mack The formulation may be prepared according to the disease or the component by utilizing the method disclosed in "Therapeutic Agents for the Treatment of Acute ...

[0042] The composition of the present invention may further contain one or more active ingredients exhibiting the same or similar functions. The composition of the present invention contains the above protein in an amount of 0.0001 to 10% by weight, preferably 0.001 to 1% by weight, based on the total weight of the composition.

[0043] The pharmaceutical composition of the present invention may further contain a pharmaceutically acceptable additive, such as starch, gelatinized starch, microcrystalline cellulose, lactose, povidone, colloidal silicon dioxide, calcium hydrogen phosphate, lactose, mannitol, candy, gum arabic, pregelatinized starch, corn starch, powdered cellulose, hydroxypropyl cellulose, Opadry, sodium starch glycolate, carnauba wax, synthetic aluminum silicate, stearic acid, magnesium stearate, aluminum stearate, calcium stearate, sucrose, dextrose, sorbitol, talc, etc. The pharmaceutically acceptable additive according to the present invention is preferably included in an amount of 0.1 to 90 parts by weight of the composition, but is not limited thereto.

[0044] The composition of the present invention may be administered parenterally (e.g., intravenously, subcutaneously, intraperitoneally, or topically) or orally, depending on the intended method, with oral administration being most preferred. The dosage range varies depending on the individual's body weight, age, sex, health condition, diet, administration time, administration method, excretion rate, and disease severity. Liquid preparations for oral administration of the composition of the present invention include suspensions, oral liquids, emulsions, syrups, etc., which may contain various excipients such as wetting agents, sweeteners, flavoring agents, preservatives, etc. in addition to water and liquid paraffin, which are commonly used diluents. Preparations for parenteral administration include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories, etc.

[0045] In one aspect, the present invention relates to a method for treating liver cancer, comprising the step of administering the pharmaceutical composition or immunological anti-cancer agent to an individual.

[0046] The term "individual" as used herein refers to a subject in need of a method for preventing, controlling, or treating a disease, and may include, without limitation, humans, dogs, monkeys, cats, rodents such as mice, genetically engineered mice, etc. More specifically, it refers to mammals such as humans or non-human primates, mice, rats, dogs, cats, horses, and cows.

[0047] The pharmaceutical compositions of the present invention may be administered in a therapeutically effective amount or a pharmaceutically effective amount.

[0048] The term "therapeutically effective amount" in the present invention refers to the amount of a pharmaceutically acceptable salt of a composition that is effective for preventing or treating a target disease. The therapeutically effective amount of the composition of the present invention may vary depending on various factors, such as the administration method, the target site, and the condition of the patient. Therefore, the dosage for use in humans must be determined appropriately, taking into consideration both safety and efficacy. It is also possible to estimate the amount to be used in humans from the effective amount determined through animal experiments. Such matters to be considered when determining an effective amount can be found, for example, in Hardman and Limbird, eds., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 10th ed. (2001), Pergamon Press; and EW Martin ed., Remington's Pharmaceutical Sciences, 18th ed. (1990), Mack Publishing Co.

[0049] The pharmaceutical compositions of the present invention are administered in a pharmaceutically effective amount. The term "pharmaceutically effective amount" as used herein means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to any medical treatment, without causing adverse effects. The effective dose level may be determined by factors including the individual's health status, the type and severity of the infection, the activity of the drug, sensitivity to the drug, the method, time, route and excretion rate of administration, duration of treatment, coadministered or concurrently used drugs, and other factors well known in the medical field. The compositions of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, sequentially or simultaneously with conventional therapeutic agents, and in single or multiple administrations. Taking all of the above factors into consideration, it is important to administer an amount that will achieve maximum efficacy at the minimum dose without causing adverse effects, which can be easily determined by those skilled in the art. [Example]

[0050] The present invention will be described in more detail with reference to the following examples. These examples are intended to explain the present invention in more detail, but the scope of the present invention is not limited to these examples.

[0051] <Example 1> Fabrication of a modified RT-LET7 from the existing RT-LET7 The Let-7i-5p inhibitor RT-LET7 (SEQ ID NO: 1: AACAGCACAAAACUACUACCUCA) was subjected to a four-step process, one cycle at a time, in which the RNA oligo 1mer was subjected to the following processes from the 3' end to the 5' end: Deblocking -> Coupling -> Oxidation -> Capping. Using modified bases, the RT-LET7 was then subjected to the following processes: Deblocking -> Coupling -> Oxidation -> Capping. According to the study published in October 19(10):673-694, 2'-ribose modifications (2'-O-methyl, 2'-MOE) increase resistance to nucleases compared to unmodified RNA and contribute to increased stability in the cytoplasm. They also increase half-life in living tissues, thereby enhancing drug efficacy. Furthermore, they bind strongly to complementary RNA, helping target genes to be more effectively degraded by RNases. Furthermore, when phosphorothioate is substituted between RNA bases, they do not affect RNase activity and efficiently bind to target RNA. Furthermore, ribose and phosphorothioate modifications were developed because they bind to proteins such as albumin in cells and in the body, protecting them from nucleases, thereby preventing them from being excreted in the urine and increasing the duration of drug activity in the body and enhancing drug efficacy.Modified RNA bases 2′-OMe rA Phosphoramidite (Glen Research, Sterling, VA, cat.10-3100), 2′-OMe rC Phosphoramidite (Glen Research, cat.10-3115), 2′-OMe rG Phosphoramidite (Glen Research, cat.10-3120), 2′-OMe rU Phosphoramidite (Glen Research, cat.10-3130), 2′-MOE rA Phosphoramidite(Glen Research, cat.10-3200), 2′-MOE rC Phosphoramidite(Glen Research, cat.10-3211), 2′-MOE rG Phosphoramidite(Glen Research, cat.10-3220), 2′-MOE rU Phosphoramidite(Glen The RNA oligo with no modifications was named RT-LET7. The RNA oligo with all bases modified to 2'-O-methyl and modified to phosphorothioate was named RT-LET7-2. The RNA oligo with four modified bases at the 5' and 3' ends was named RT-LET7-6. The RNA oligo with all bases modified to 2'-MOE and modified to phosphorothioate was named RT-LET7-4. The RNA oligo with four modified bases at the 5' and 3' ends was named RT-LET7-8 (Figure 1A).

[0052] <Example 2> Confirmation of suppression of Let-7i-5p expression by treatment with modified RT-LET7 Total RNA was isolated from HCC cell lines (SNU-387, SNU-368, and SNU-423) transfected with the modified RT-LET7 constructs shown in Figure 1A using TRIzol Reagent (Invitrogen, Carlsbad, CA), and cDNA specific for the two miRNAs was synthesized using the Misccipt II RT Kit (Qiagen, Manchester, UK). qRT-PCR was performed using the SensiFAST™ SYBR NoROX Kit (Bioline, London, UK). qRT-PCR analysis of Let-7i-5p in HCC cell lines (SNU-387, SNU-368, and SNU-423) confirmed that substitution of all bases with 2′-MOE (RT-LET7-4 and RT-LET7-8) was more effective in suppressing Let-7i-5p expression than substitution with 2′-O-methyl (RT-LET7-2 and RT-LET7-6) ( Figure 1B ).

[0053] Furthermore, when RT-LET7 was modified with 2'-MOE, it was transfected into HCC cell lines (SNU-387, SNU-368, and SNU-423) and cultured for up to 7 days. RNA was extracted and the degree of Let-7i-5p expression suppression was compared. When RT-LET7 was modified with 2'-MOE and then replaced with phosphorothioate, the suppression of Let-7i-5p expression was significantly more efficient than that of unmodified RT-LET7 (Figure 2).

[0054] Example 3: Confirmation of tumorigenic properties of Let-7i-5p by MTT and cell viability assays To confirm the in vitro tumorigenesis suppression potential of RT-LET7 in hepatocellular carcinoma, an MTT assay was performed using RT-LET7. Specifically, for the MTT assay, SNU-387 cells were transfected with RT-LET7, RT-LET7-4, or RT-LET7-8 in 12-well plates and incubated with 0.5 mg / ml MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] solution (Sigma) for 1 hour. The absorbance was then measured using a SYNERGY H1 Multilabel plate reader (Bio-Tek, Winooski, VT). The results confirmed that the experimental group treated with RT-LET7-8, a modified form of RT-LET7, showed the greatest inhibition of tumor cell growth (Figure 3A).

[0055] Example 4: Confirmation of regulation of macrophage phagocytosis by modified RT-LET7 To confirm whether Let-7i-5p regulates the expression of TSP1, which is involved in regulating macrophage phagocytosis, we examined the expression changes by Western blot analysis after treatment with RT-LET7 and modified RT-LET7-8.The results confirmed that TSP1 expression was increased when treated with RT-LET7 or RT-LET7-8 (Figure 3B).

[0056] Based on these results, we performed an in vitro phagocytosis assay to determine whether TSP1 occupies the CD47 receptor in the Let-7i-5p-TSP1 network, disrupting the CD47-SIRPα interaction and enabling macrophages to phagocytose HCC. Specifically, the HCC cell line SNU-387 was prepared as a single-cell suspension and labeled with CFSE (Abcam, Cambridge, UK). Peritoneal macrophages were then obtained from C57BL / 6 mice and co-cultured with SNU-387 for 2 hours, then treated with RT-LET7 or modified RT-LET7-8, respectively, and compared with HCC cells directly treated with TSP1 recombinant protein as a positive control. The phagocytic index was calculated by dividing the number of macrophages capturing tumor cells by the total number of macrophages. As a result, we confirmed that the phagocytic activity of macrophages was significantly increased in both RT-LET7 and modified RT-LET7-8-treated HCC cells, and that the phagocytic activity of macrophages was further increased in modified RT-LET7-8 compared to RT-LET7 (Figure 3C).

[0057] This indicates that RT-LET7-8, a modified form of RT-LET7, can regulate the let-7i-p-TSP1 signaling axis and convert the CD47-SIRPα interaction between macrophages and HCC into a CD47-TSP1 interaction, thereby reactivating macrophage phagocytosis of HCC cells.

[0058] Example 5: Verification of the efficiency of RT-LET7-8 conjugated with a hepatocyte-targeting moiety 5-1. Confirmation of suppression of Let-7i-5p expression by RT-LET7-8 using a delivery system To confirm the inhibitory effect of modified RT-LET7-8 on Let-7i-5p expression using a delivery system, nucleic acid molecules in which RT-LET7-8 was conjugated to N-Acetylgalactosamine (GalNAc) or Gal-LNP (Galactosyl lipidoid nanoparticle), known as drug delivery systems, were delivered to cells (Hep3B) positive for ASGPR (asialoglycoprotein receptor) expression and cells (SNU-449) negative for ASGPR expression.

[0059] Specifically, Gal-LNP-RT-LET7-8 was prepared by mixing C12-SPM (synthesized by conjugating alkyl epoxide (Sigma-Aldrich) and polyamine (Sigma-Aldrich), distearoylphosphatidylcholine (DSPC) (Sigma-Aldrich), cholesterol (Sigma-Aldrich), C16-PEG2000-ceramide (Avanti Polar Lipids), and α-galactosyl ceramide (Avanti Polar Lipids) in a ratio of 50:10:38.5:0.75:0.75, respectively. RT-LET7-8 solution (10 mg / mL) was then mixed with 10 mM citrate buffer (pH 3). Gal-LNP and RT-LET7-8 were mixed at a ratio of 7:1 and incubated at 37°C for 30 minutes to allow RT-LET7-8 to be loaded onto Gal-LNP. The mixture was then dialyzed against PBS (Sigma-Aldrich, cat. P5368) for 75 minutes to remove ethanol and RT-LET7-8 lacking Gal-LNP (see Figure 8A). GalNAc-RT-LET7-8 was then synthesized by conjugating Trebler phosphoramidite (GLEN Research) to the 5' end of modified RT-LET7-8, followed by N-acetylgalactosamine (GLEN Research) (see Figure 8B). The expression level of Let-7i-5p in each cell line was then determined using the same method as in Example 2.

[0060] The results showed that GalNAc-conjugated RT-LET7-8 significantly increased the inhibitory effect on Let-7i-5p expression compared to conventional RT-LET7-8 in ASGPR-positive Hep3B cells, but not in ASGPR-negative SNU-449 cells (Figure 4A). In contrast, Gal-LNP-conjugated RT-LET7-8 significantly increased the inhibitory effect on Let-7i-5p expression, regardless of the presence or absence of ASGPR (Figure 5A). These results are likely due to the fact that GalNAc, a delivery system that binds to the ASGPR receptor on the surface of hepatocytes, exerts its effect only on ASGPR-positive cells, whereas Gal-LNP, with a structure similar to the cell membrane, exerts its effect regardless of ASGPR.

[0061] Furthermore, Gal-LNP-conjugated RT-LET7-8 (Gal-LNP-RT-LET7-8) showed significantly reduced Let-7i-5p expression compared to lipofectamine-conjugated RT-LET7-8 (Lipo-RT-LET7-8). This indicates that lipofectamine, which is composed of a simple phospholipid, significantly reduces the efficiency of delivery to the liver and stability in vivo compared to Gal-LNP, which is composed of cholesterol, DSPC, C16-PET2000-ceramide, and α-galactosyl ceramide.

[0062] Next, we investigated the maintenance of efficacy of RT-LET7-8 conjugated with a hepatocyte-targeting moiety (GalNAc or Gal-LNP) for 7 days in Hep3B cells. The results showed that the inhibitory effect on Let-7i-5p expression was maintained for up to 7 days, demonstrating a more stable suppression of Let-7i-5p expression than Lipo-RT-LET7-8 (Figures 4B and 5B).

[0063] 5-2. Confirmation of tumorigenesis suppression in liver cancer by RT-LET7-8 using a delivery system To confirm the in vitro tumorigenesis suppression ability of RT-LET7-8 conjugated with a hepatocyte-targeting moiety in hepatocellular carcinoma, MTT assay was performed using the method described in Example 3.

[0064] As a result, GalNAc-RT-LET7-8 and Gal-LNP-RT-LET7-8, which were conjugated with hepatocyte-targeting moieties, were shown to effectively suppress tumorigenesis in hepatocellular carcinoma cells compared to the control group, and showed a higher tumorigenesis inhibitory ability than Lipo-RT-LET7-8 after 72 hours (Figures 6A and 7A).

[0065] 5-3. Confirmation of macrophage phagocytosis regulation by RT-LET7-8 using a delivery system To confirm the change in expression of TSP1, a target protein of let-7i-5p, due to the decreased expression of let-7i-5p, a target microRNA of RT-LET7, we treated modified RT-LET7-8 and RT-LET7-8 conjugated with a hepatocyte-targeting moiety, and then confirmed the change in expression by Western blot analysis.

[0066] As a result, it was confirmed that TSP1 expression was increased in the case of RT-LET7-8 conjugated with a hepatocyte-targeting moiety compared to the modified RT-LET7-8 without a hepatocyte-targeting moiety (Figures 6B and 7B).

[0067] Subsequently, in order to confirm whether macrophages can phagocytose HCC, an in vitro phagocytosis assay was performed using the method of Example 4.

[0068] As a result, it was confirmed that the phagocytic activity of macrophages was further increased in GalNAc-RT-LET7-8 and Gal-LNP-RT-LET7-8 compared to the modified RT-LET7-8 (FIGS. 6C and 7C).

[0069] <Example 6> Verification of the efficiency of D-GalNAc-linked RT-LET7-8 In Example 5, it was confirmed that GalNAc, when combined with modified RT-LET7-8, exhibited higher delivery efficiency to the liver and in vivo stability than Gal-LNP.

[0070] Therefore, to explore the optimal GalNAc that can be conjugated to modified RT-LET7-8 to significantly improve its efficacy, RT-LET7-8 was constructed with a different GalNAc (D-GalNAc) attached to the 5' end, and the efficiency of the modified RT-LET7-8 with GalNAc attached was compared in the following experiment.

[0071] 6-1. Confirmation of suppression of Let-7i-5p expression by D-GalNAc-RT-LET7-8 RT-LET7-8 was prepared by conjugating the GalNAc (Old-GalNAc) used in Example 5 with a new GalNAc, D-GalNAc. The two types, Old-GalNAc-RT-LET7-8 (see Figure 8B) and D-GalNAc-RT-LET7-8 (see Figure 8C), were each transfected into Hep3B cells, and the expression level of Let-7i-5p in each cell was confirmed using the same method as in Example 2.

[0072] As a result, we confirmed that D-GalNAc-conjugated RT-LET7-8 significantly suppressed Let-7i-5p expression in ASGPR-positive Hep3B cells compared with the existing Old-GalNAc-RT-LET7-8 (Figure 9A).

[0073] Subsequently, the maintenance of efficiency of Old-GalNAc-RT-LET7-8 and D-GalNAc-RT-LET7-8 was verified in Hep3B cells for 14 days, and the verification test for the maintenance of efficiency was performed under different temperature conditions (4°C / room temperature).

[0074] As a result, Old-GalNAc-RT-LET7-8 maintained its inhibitory effect on Let-7i-5p expression for up to 7 days, after which Let-7i-5p expression returned to a level similar to that of the control group. However, GalNAc-RT-LET7-8 showed stable inhibition of Let-7i-5p expression for up to 14 days (Fig. 9B, C).

[0075] 6-2. Confirmation of suppression of tumor formation in liver cancer by GalNAc-RT-LET7-8 To confirm the in vitro tumorigenesis suppression ability of RT-LET7-8 conjugated with GalNAc (Old-GalNAc) and the novel GalNAc, D-GalNAc, in hepatocellular carcinoma, Old-GalNAc-RT-LET7-8 and D-GalNAc-RT-LET7-8 were transfected into Hep3B cells, respectively, followed by MTT and BrdU assays.

[0076] The MTT assay was performed by the method described in Example 3, and the BrdU assay was performed using a BrdU cell proliferation assay kit (Millipore) according to the manufacturer's protocol.

[0077] The results of the MTT assay showed that D-GalNAc-RT-LET7-8 more effectively inhibited tumor formation in hepatocellular carcinoma cells than Old-GalNAc-RT-LET7-8 (Fig. 10A).Furthermore, the results of the BrdU assay, similar to the results of the MTT assay, confirmed that D-GalNAc-RT-LET7-8 significantly inhibited proliferation of Hep3B cells compared to Old-GalNAc-RT-LET7-8 (Fig. 10B).

[0078] 6-3. Confirmation of the regulation of macrophage phagocytosis by GalNAc-RT-LET7-8 To confirm whether the decreased expression of let-7i-5p, a target microRNA of RT-LET7, alters the expression of TSP1, a target protein of let-7i-5p, Hep3B cells were treated with Old-GalNAc-RT-LET7-8 and D-GalNAc-RT-LET7-8, respectively, and the changes in expression were confirmed by Western blot analysis.

[0079] As a result, it was confirmed that TSP1 expression was increased in the case of D-GalNAc-RT-LET7-8 compared to Old-GalNAc-RT-LET7-8 (FIG. 11A).

[0080] Subsequently, in order to confirm whether macrophages can phagocytose HCC, an in vitro phagocytosis assay was performed using the method of Example 4.

[0081] As a result, it was confirmed that D-GalNAc-RT-LET7-8 further increased the phagocytic activity of macrophages compared to Old-GalNAc-RT-LET7-8 (FIG. 11B).

[0082] These results demonstrate that when a hepatocyte-targeted delivery system is incorporated into modified RT-LET7-8, it enhances delivery to the target organ, the liver, and significantly increases the efficacy of inhibiting Let-7i-5p expression in hepatocytes, the efficacy of inhibiting tumor formation in liver cancer, and the efficacy of macrophage phagocytosis. In particular, modified RT-LET7-8 conjugated with D-GalNAc, represented by Chemical Formula 2, among the hepatocyte-targeted delivery systems, significantly improves the aforementioned preventive or therapeutic effects of RT-LET7-8 on liver cancer. The inventions described in the original claims of this application are listed below. [Invention 1] A nucleic acid molecule targeting Let-7i-5p, The nucleic acid molecule is represented by the base sequence of SEQ ID NO: 1, The nucleic acid molecule is characterized in that the nucleotide sequence is a nucleic acid modified by 2'-O-Methoxyethylation, The nucleic acid molecule is characterized in that a part or the entire backbone is modified with phosphorothioate. [Invention 2] The nucleic acid molecule according to Invention 1, wherein the backbone of the nucleotides 1 to 4 from the 5' end of SEQ ID NO: 1 is modified with phosphorothioate. [Invention 3] The nucleic acid molecule according to Invention 1, wherein the backbone of the nucleotides 1 to 4 from the 3' end of SEQ ID NO: 1 is modified with phosphorothioate. [Invention 4] A nucleic acid molecule targeting Let-7i-5p, The nucleic acid molecule is represented by the base sequence of SEQ ID NO: 1, The nucleic acid molecule is characterized in that the nucleotide sequence is a nucleic acid modified by 2'-O-Methoxyethylation, The nucleic acid molecule is characterized in that a part or the entire backbone is modified with phosphorothioate, and the nucleic acid molecule is characterized in that a hepatocyte targeting moiety is bound to the nucleic acid molecule. [Invention 5] 5. The nucleic acid molecule according to claim 4, wherein the hepatocyte targeting moiety is N-Acetylgalactosamine (GalNAc) or Gal-LNP (Galactosyl lipidoid nanoparticle). [Invention 6] The nucleic acid molecule according to invention 5, wherein the N-Acetylgalactosamine (GalNAc) is represented by chemical formula 1 or chemical formula 2:

change

change

Claims

1. A nucleic acid molecule targeting Let-7i-5p, comprising: The nucleic acid molecule is represented by the base sequence of SEQ ID NO: 1, The nucleic acid molecule is a nucleic acid in which all nucleotides of the base sequence of SEQ ID NO: 1 are modified by 2'-O-methoxyethylation, The nucleic acid molecule has a backbone in which the first to fourth nucleotides from the 5' end and the first to fourth nucleotides from the 3' end of the nucleotide sequence of SEQ ID NO: 1 are modified with phosphorothioate. The nucleic acid molecule.

2. A nucleic acid molecule targeting Let-7i-5p, comprising: The nucleic acid molecule is represented by the base sequence of SEQ ID NO: 1, The nucleic acid molecule is a nucleic acid in which all nucleotides of the base sequence of SEQ ID NO: 1 are modified by 2'-O-methoxyethylation, The nucleic acid molecule is a nucleic acid molecule in which the backbones of the 1st to 4th nucleotides from the 5' end and the 1st to 4th nucleotides from the 3' end of the nucleotide sequence of SEQ ID NO: 1 are modified with phosphorothioate; the nucleic acid molecule has a hepatocyte targeting moiety attached thereto; The nucleic acid molecule.

3. The nucleic acid molecule according to claim 2, wherein the hepatocyte targeting moiety is N-acetylgalactosamine (GalNAc) or Gal-LNP (Galactosyl lipidoid nanoparticle).

4. The nucleic acid molecule according to claim 3, wherein the N-acetylgalactosamine (GalNAc) is represented by Chemical Formula 1 or Chemical Formula 2: 【Chemistry 1】 【Chemistry 2】

5. A pharmaceutical composition for preventing or treating liver cancer, comprising the nucleic acid molecule according to any one of claims 1 to 4 as an active ingredient.

6. 6. The pharmaceutical composition for preventing or treating liver cancer according to claim 5, wherein the composition suppresses the expression of Let-7i-5p.

7. The pharmaceutical composition for preventing or treating liver cancer according to claim 5, wherein the composition increases the expression of TSP1 (thrombospondin-1).

8. The pharmaceutical composition for preventing or treating liver cancer according to claim 5, wherein the composition increases the phagocytic activity of macrophages.

9. An immunoanticancer agent for treating CD47-positive liver cancer, comprising the nucleic acid molecule according to any one of claims 1 to 4 as an active ingredient.

Images