Use of circular RNA in the preparation of a medicament for treating systemic lupus erythematosus

CircRNAs with imperfect duplex structures are used to address the lack of early SLE diagnosis and treatment by serving as diagnostic markers and therapeutic agents, reducing PKR phosphorylation and cytokine expression in SLE patients.

JP7784306B2Active Publication Date: 2025-12-11センター フォー エクセレンス イン モレキュラー セル サイエンスチャイニーズ アカデミー オブ サイエンシーズ
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
JP2021550102
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2019-02-25
Filing Date
2019-12-10
Publication Date
2025-12-11
Estimated Expiration
2039-12-10

AI Technical Summary

Technical Problem

Current diagnostic markers for systemic lupus erythematosus (SLE) primarily detect biochemical and immunological changes after organ damage, making early diagnosis impossible, and specific therapeutic measures are lacking due to unclear causes and pathogenesis.

Method used

The use of circular RNA (circRNA) with an imperfect duplex structure of 16 to 33 bp in length and/or its promoter for the preparation of medicaments to treat SLE, including methods to enhance circRNA levels and regulate their pathways, and their application in diagnostic kits.

Benefits of technology

CircRNAs with imperfect duplex structures serve as diagnostic markers for SLE, enabling accurate and rapid diagnosis, and their expression products can treat SLE by reducing PKR phosphorylation and downregulating cytokine expression, providing a new therapeutic approach.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007784306000008
    Figure 0007784306000008
  • Figure 0007784306000009
    Figure 0007784306000009
  • Figure 0007784306000010
    Figure 0007784306000010
Patent Text Reader

Abstract

The present invention provides use of a circular RNA having an imperfect duplex structure of 16 bp to 33 bp in length and / or a promoter of the circular RNA having an imperfect duplex structure of 16 bp to 33 bp in length in the preparation of a medicament for treating systemic lupus erythematosus.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present disclosure is in the field of biomedicine and particularly relates to the use of circular RNA (circRNA) in the preparation of a medicament for treating systemic lupus erythematosus. [Background technology]

[0002] Systemic lupus erythematosus (SLE) is a typical multiorgan, multitissue autoimmune disease with complex and diverse clinical and immunological symptoms, such as immunological tolerance, dysregulated lymphocyte function and impaired lymphocyte apoptosis, complement deficiency and impaired immune complex clearance, and dysregulated cytokine secretion, almost encompassing disorders of the entire immune system. Clinically, SLE primarily manifests as disorders of multiple organs, such as the kidneys, nervous and psychiatric systems, and hematological systems. Early diagnosis in SLE patients before vital organs are affected is of great significance for preventing and treating SLE and improving patients' quality of life and productivity. However, existing markers for biological diagnosis are primarily biochemical and immunological changes that occur after organ damage and cannot be used for early diagnosis of organ damage in SLE patients.

[0003] Currently, the causes and pathogenesis of SLE are not yet fully understood and are thought to be due to various factors, such as familial inheritance, sex hormone disturbances, and environmental factors. Therefore, specific therapeutic measures are still lacking, making it essentially impossible to enhance the prevention and treatment of SLE. Summary of the Invention [Problem to be solved by the invention]

[0004] To solve the problems in the prior art, the purpose of the present disclosure is to examine the expression of circRNAs in SLE and their regulatory effects on the biological functions of SLE, and to provide the use of the expression products of circRNAs in the diagnosis and treatment of SLE. [Means for solving the problem]

[0005] To achieve the above objectives and other related objectives, the present disclosure adopts the following technical solutions.

[0006] In a first aspect of the present disclosure, there is provided use of a circRNA having an imperfect duplex structure of 16 bp to 33 bp in length and / or a promoter of a circRNA having an imperfect duplex structure of 16 bp to 33 bp in length in the preparation of a medicament for treating SLE.

[0007] In a second aspect of the present disclosure, there is provided a method for treating SLE by administering to a subject an effective amount of a circRNA having an imperfect duplex structure of 16 bp to 33 bp in length and / or a promoter of a circRNA having an imperfect duplex structure of 16 bp to 33 bp in length.

[0008] In a third aspect of the present disclosure, there is provided a pharmaceutical for treating SLE, comprising an effective dose of a circRNA having an imperfect duplex structure of 16 bp to 33 bp in length and / or a promoter of a circRNA having an imperfect duplex structure of 16 bp to 33 bp in length.

[0009] In a fourth aspect of the present disclosure, there is provided a pharmaceutical combination for treating SLE, comprising an effective dose of a circRNA having an imperfect duplex structure of 16 bp to 33 bp in length and / or a promoter of a circRNA having an imperfect duplex structure of 16 bp to 33 bp in length, and at least one additional pharmaceutical for treating SLE.

[0010] In a fifth aspect of the present disclosure, there is provided a method for treating SLE by administering to a subject an effective amount of a circRNA having an imperfect duplex structure of 16 bp to 33 bp in length and / or a promoter of a circRNA having an imperfect duplex structure of 16 bp to 33 bp in length, administering to the subject an effective amount of an additional pharmaceutical agent for treating SLE, and / or applying to the subject other means for treating SLE.

[0011] In a sixth aspect of the present disclosure, (1) Regulating the circRNA pathway and enhancing the level of circular RNA; and (2) Directly increasing circRNA levels in cells The present invention provides use of a circRNA having an imperfect duplex structure of 16 bp to 33 bp in length and / or a promoter of a circRNA having an imperfect duplex structure of 16 bp to 33 bp in length in the preparation of a pharmaceutical having one or more effects selected from the group consisting of:

[0012] In a seventh aspect of the present disclosure, there is provided use of a circRNA having an imperfect duplex structure of 16 bp to 33 bp in length and / or a promoter of a circRNA having an imperfect duplex structure of 16 bp to 33 bp in length in the preparation or screening of a pharmaceutical for treating SLE.

[0013] An eighth aspect of the present disclosure provides use of a circRNA having an imperfect duplex structure of 16 bp to 33 bp in length in the preparation or screening of a substance for detecting systemic lupus erythematosus.

[0014] A ninth aspect of the present disclosure provides use of a substance for specifically recognizing circRNA having an imperfect duplex structure of 16 bp to 33 bp in length in the preparation of a kit for detecting SLE.

[0015] In a tenth aspect of the present disclosure, there is provided a kit for detecting SLE, comprising at least one substance for specifically recognizing a circRNA having an imperfect duplex structure of 16 bp to 33 bp in length.

[0016] Compared with the prior art, the present disclosure has the following beneficial effects:

[0017] According to the present disclosure, a pair of specific primers was designed to detect the expression of circRNAs with imperfect duplex structures of 16 bp to 33 bp in length. The expression of circRNAs with imperfect duplex structures of 16 bp to 33 bp in length was then detected in patients with SLE, and the results showed a significant decrease in expression level. Therefore, circRNAs can be used as diagnostic markers for SLE. Additionally, the present disclosure tested the cellular function of circRNA genes with imperfect duplex structures of 16 bp to 33 bp in length in vitro. In this case, the gene sequence of the circRNA was inserted into the pZW1 vector to construct an expression vector for high expression of circRNAs with imperfect duplex structures of 16 bp to 33 bp in length. Compared with controls transfected with an empty vector, peripheral blood mononuclear cells (PBMCs) from SLE patients with high expression of circRNA genes with imperfect duplex structures of 16 to 33 bp showed significantly downregulated phosphorylase kinase (PKR) phosphorylation levels and downregulated expression of the cytokine IFN-beta and SLE diagnostic genes in PBMCs and immune T cells from SLE patients. It was demonstrated that circRNA genes with imperfect duplex structures of 16 to 33 bp and their expression products can be used in the preparation of drugs for treating SLE. Collectively, circRNA genes with imperfect duplex structures of 16 to 33 bp may serve as diagnostic markers for SLE, enabling more accurate and rapid diagnosis. The expression products of circRNA genes may serve as molecules for the preparation of drugs for the treatment of SLE, providing a new approach to treating SLE. [Brief explanation of the drawings]

[0018] [Figure 1] 1 illustrates a location map of circPOLR2A on the chromosome. [Figure 2] 1 illustrates the expression of circPOLR2A in SLE patients, detected using specific detection primers. [Figure 3]Illustrates the receiver operating characteristic (ROC) curve obtained with the circRNA circPOLR2A. [Figure 4] The secondary structure diagrams of circPOLR2A, 26 identical circRNAs with a special duplex structure, and circSMARCA5, a circRNA without a special duplex structure, are shown. [Figure 5] This shows examples of the phosphorylation levels of PKR and downstream genes of PKR after high expression of circPOLR2A and circSMARCA5, a circRNA without a special double-stranded structure. [Figure 6] This figure illustrates the downregulation of the phosphorylation level of PKR and the expression of cytokine IFN-beta and SLE diagnostic genes MX-1, LY-6E, and IFIT3 in PBMCs and immune T cells of SLE patients after high expression of circPOLR2A. [Figure 7] 1 illustrates the expression of cytokines IFN-beta, TNF-alpha, and IL-6 after transfection of circPOLR2A into human HeLa cells. [Figure 8] 1 illustrates the changes in the level of in vitro PKR phosphorylation activity after incubation of circPOLR2A using an in vitro PKR phosphorylation activity experimental system. DETAILED DESCRIPTION OF THE INVENTION

[0019] Before further describing specific embodiments of the present disclosure, it should be understood that the scope of protection of the present disclosure is not limited to the following specific embodiments. Also, it should be understood that the terms used in the examples of the present disclosure are intended to describe specific embodiments and are not intended to limit the scope of protection of the present disclosure. Experimental methods in the following examples that are not specified by specific conditions are generally carried out according to conventional conditions or conditions recommended by manufacturers.

[0020] When numerical ranges are given in the examples, it should be understood that any value between the two endpoints of each numerical range and the two endpoints can be selected unless otherwise specified in the present disclosure. Unless otherwise defined, all technical and scientific terms used in the present disclosure have the same meaning as commonly understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the examples, any methods, equipment, and materials equivalent or similar to those described in the examples of the present disclosure can be used by those skilled in the art according to conventional knowledge and the description of the present disclosure.

[0021] Unless otherwise specified, all experimental, detection, and preparative methods disclosed in this disclosure employ conventional techniques in molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related fields.

[0022] CircRNAs are recently discovered non-coding RNA molecules. Unlike traditional linear RNAs, circRNAs have been found to have covalently linked loop structures without a 5' cap or 3' poly(A) tail. Recent studies have shown that circRNAs are primarily formed by backsplicing, which is widespread in various biological cells, and are characterized by extremely high structural stability, resistance to exonuclease degradation, tissue specificity, and temporal and spatial specificity of their expression. These properties make circRNAs potentially useful for the development and application of methods for disease diagnosis and treatment.

[0023] An example of the present disclosure provides the use of a circRNA having an imperfect duplex structure of 16 bp to 33 bp in length and / or a promoter of a circRNA having an imperfect duplex structure of 16 bp to 33 bp in length in the preparation of a medicament for treating SLE. An imperfect duplex structure is defined as a stem-loop duplex structure formed by RNA in which both perfectly complementary base pairing and a bulge or internal loop formed by unpaired bases are present. The length of the imperfect duplex structure is calculated based on the number of complementary base pairs. If a bulge or internal loop is present and the number of unpaired bases forming the bulge or internal loop is four or less, it is further considered to be a single imperfect duplex structure rather than multiple imperfect duplex structures.

[0024] As used herein, circRNAs with a special double-stranded structure and circRNAs with an incomplete double-stranded structure of 16 bp to 33 bp in length refer to the same substance.

[0025] The circRNAs having an imperfect duplex structure and a length of 16 bp to 33 bp used in the examples of the present disclosure are any one or more selected from the group consisting of circARID1B, circCAMSAP1, circCCNB1, circCNN2, circDHX34, circEPHB4, circEZH2, circFCHO2, circFGFR1, circFKBP8, circKIAA0368, circMBOAT2, circPIP5K1C, circPOLR2A, circPPP1CB, circPROSC, circPTK2, circPVT1, circRELL1, circSDHAF2, circSLC22A23, circSNHG4, circTBCD, circTMEM181, circUIMC1, and circVAPB.

[0026] In the examples of the present disclosure, the promoter of a circRNA having an imperfect duplex structure of 16 bp to 33 bp in length is any one or more selected from the group consisting of a circARID1B promoter, a circCAMSAP1 promoter, a circCCNB1 promoter, a circCNN2 promoter, a circDHX34 promoter, a circEPHB4 promoter, a circEZH2 promoter, a circFCHO2 promoter, a circFGFR1 promoter, a circFKBP8 promoter, a circKIAA0368 promoter, a circMBOAT2 promoter, a circPIP5K1C promoter, a circPOLR2A promoter, a circPPP1CB promoter, a circPROSC promoter, a circPTK2 promoter, a circPVT1 promoter, a circRELL1 promoter, a circSDHAF2 promoter, a circSLC22A23 promoter, a circSNHG4 promoter, a circTBCD promoter, a circTMEM181 promoter, a circUIMC1 promoter, and a circVAPB promoter.

[0027] Detailed information on circRNAs is provided below.

[0028] circARID1B (Database ID: HSA_CIRCpedia_54093). Its genomic location is chr6:157,357,968-157,406,039. The corresponding linear gene is ARID1B (chr6:157,256,600-157,473,538). The circularized sequence has 286 bases. It contains the second and third exons of the ARID1B gene.

[0029] circCAMSAP1 (Database ID: HSA_CIRCpedia_63397). Its genomic location is chr9:13,8773,478-138,774,924. The corresponding linear gene is CAMSAP1 (chr9:138,700,333-138,799,005). The circularized sequence has 425 bases. It contains the second and third exons of the CAMSAP1 gene.

[0030] circCCNB1 (Database ID: HSA_CIRCpedia_52305). Its genomic location is chr5:68,470,703-68,471,364. The corresponding linear gene is CCNB1 (chr5:68,462,837-68,474,070). The circularized sequence has 378 bases. It contains the 6th and 7th exons of the CCNB1 gene.

[0031] circCNN2 (Database ID: HSA_CIRCpedia_24560). Its genomic location is chr19:1,032,390-1,032,695. The corresponding linear gene is CNN2 (chr19:1,026,274-1,039,067). The circularized sequence has 205 bases. It contains the third and fourth exons of the CNN2 gene.

[0032] circDHX34 (Database ID: HSA_CIRCpedia_26297). Its genomic location is chr19:47,865,732-47,865,950. The corresponding linear gene is DHX34 (chr19:47,852,538-47,885,961). The circularized sequence has 218 bases. It contains the sixth exon of the DHX34 gene.

[0033] circEPHB4 (Database ID: HSA_CIRCpedia_56001). Its genomic location is chr7:100,410,368-100,410,830. The corresponding linear gene is EPHB4 (chr7:100,400,187-100,423,148). The circularized sequence has 362 bases. It contains the 10th and 11th exons of the EPHB4 gene.

[0034] circEZH2 (Database ID: HSA_CIRCpedia_57174). Its genomic location is chr7:148,543,561-148,544,397. The corresponding linear gene is EZH2 (chr7:148,504,464-148,581,441). The circularized sequence has 253 bases. It contains the second and third exons of the EZH2 gene.

[0035] circFCHO2 (Database ID: HSA_CIRCpedia_52515). Its genomic location is chr5:72,370,568-72,373,320. The corresponding linear gene is FCHO2 (chr5:72,251,808-72,386,348). The circularized sequence has 268 bases. It contains the 19th and 20th exons of the FCHO2 gene.

[0036] circFGFR1 (Database ID: HSA_CIRCpedia_60993). Its genomic location is chr8:38,314,873-38,315,052. The corresponding linear gene is FGFR1 (chr8:38,268,656-38,325,363). The circularized sequence has 179 bases. It contains the second exon of the FGFR1 gene.

[0037] circFKBP8 (Database ID: HSA_CIRCpedia_25189). Its genomic location is chr19:18,650,180-18,650,530. The corresponding linear gene is FKBP8 (chr19:18,642,561-18,654,387). The circularized sequence has 259 bases. It contains the third and fourth exons of the FKBP8 gene.

[0038] circKIAA0368 (Database ID: HSA_CIRCpedia_62244). Its genomic location is chr9:114,148,656-114,154,104. The corresponding linear gene is KIAA0368 (chr9:114,122,972-114,246,637). The circularized sequence has 435 bases. It contains exons 28, 29, 30, and 31 of the KIAA0368 gene.

[0039] circMBOAT2 (Database ID: HSA_CIRCpedia_42589). Its genomic location is chr2:9,083,315-9,098,771. The corresponding linear gene is MBOAT2 (chr2:8,992,820-9,143,942). The circularized sequence has 224 bases. It contains the second and third exons of the MBOAT2 gene.

[0040] circPIP5K1C (Database ID: HSA_CIRCpedia_25726). Its genomic location is chr19:3,660,963-3,661,999. The corresponding linear gene is PIP5K1C (chr19:3,630,179-3,700,477). The circularized sequence has 249 bases and contains the fourth and fifth exons of the PIP5K1C gene.

[0041] circPOLR2A (Database ID: HSA_CIRCpedia_22419). Its genomic location is chr17:7,402,357-7,402,810. The corresponding linear gene is POLR2A (chr17:7,387,685-7,417,933). The circularized sequence has 336 bases and contains the 9th and 10th exons of the POLR2A gene.

[0042] circPPP1CB (Database ID: HSA_CIRCpedia_40659). Its genomic location is chr2:29,006,772-29,011,675. The corresponding linear gene is PPP1CB (chr2:28,974,612-29,025,806). The circularized sequence has 224 bases. It contains the fifth and sixth exons of the PPP1CB gene.

[0043] circPROSC (Database ID: HSA_CIRCpedia_60919). Its genomic location is chr8:37,623,043-37,623,873. The corresponding linear gene is PROSC (chr8:37,620,101-37,637,286). The circularized sequence has 220 bases. It contains the second, third, and fourth exons of the PROSC gene.

[0044] circPTK2 (Database ID: HSA_CIRCpedia_60281). Its genomic location is chr8:141,889,569-141,900,868. The corresponding linear gene is PTK2 (chr8:141,667,999-142,011,332). The circularized sequence has 394 bases. It contains the third and fourth exons of the PTK2 gene.

[0045] circPVT1 (Database ID: HSA_CIRCpedia_60029). Its genomic location is chr8:128,902,834-128,903,244. The corresponding linear gene is PVT1 (chr8:128,806,779-129,113,499). The circularized sequence has 410 bases. It contains the second exon of the PVT1 gene.

[0046] circRELL1 (Database ID: HSA_CIRCpedia_48457). Its genomic location is chr4:37,633,006-37,640,126. The corresponding linear gene is RELL1 (chr4:37,592,422-37,687,998). The circularized sequence has 434 bases. It contains the fourth, fifth, and sixth exons of the RELL1 gene.

[0047] circSDHAF2 (Database ID: HSA_CIRCpedia_4841). Its genomic location is chr11:61,205,096-61,205,585. The corresponding linear gene is SDHAF2 (chr11:61,205,096-61,205,585). The circularized sequence has 334 bases. It contains the second and third exons of the SDHAF2 gene.

[0048] circSLC22A23 (Database ID: HSA_CIRCpedia_54791). Its genomic location is chr6:3,410,421-3,416,089. The corresponding linear gene is SLC22A23 (chr6:3,269,196-3,457,256). The circularized sequence has 259 bases. It contains the second and third exons of the SLC22A23 gene.

[0049] circSNHG4 (Database ID: HSA_CIRCpedia_50464). Its genomic location is chr5:138,614,015-138,614,818. The corresponding linear gene is SNHG4 (chr5:138,609,441-138,618,873). The circularized sequence has 161 bases. It contains the third and fourth exons of the SNHG4 gene.

[0050] circTBCD (Database ID: HSA_CIRCpedia_22969). Its genomic location is chr17:80,858,526-80,869,665. The corresponding linear gene is TBCD (chr17:80,709,940-80,881,609). The circularized sequence has 389 bases. It contains exons 17, 18, 19, 20, 21, and 22 of the TBCD gene.

[0051] circTMEM181 (Database ID: HSA_CIRCpedia_54188). Its genomic location is chr6:159,004,985-159,010,814. The corresponding linear gene is TMEM181 (chr6:158,957,468-159,049,522). The circularized sequence has 324 bases. It contains the third, fourth, and fifth exons of the TMEM181 gene.

[0052] circUIMC1 (Database ID: HSA_CIRCpedia_51249). Its genomic location is chr5:176,370,335-176,385,155. The corresponding linear gene is UIMC1 (chr5:176,332,006-176,433,409). The circularized sequence has 397 bases. It contains exons 7, 8, 9, and 10 of the UIMC1 gene.

[0053] circVAPB (Database ID: HSA_CIRCpedia_34824). Its genomic location is chr20:57,014,000-57,016,139. ​​The corresponding linear gene is VAPB (chr20:56,964,175-57,026,156). The circularized sequence has 258 bases. It contains the fourth and fifth exons of the VAPB gene.

[0054] In embodiments, the medicament for treating SLE comprises: (1) It reduces the phosphorylation level of PKR in mononuclear cells derived from SLE patients, and (2) it downregulates the expression of cytokine IFN-beta and diagnostic genes for systemic lupus erythematosus, MX-1, LY-6E, and IFIT3, in mononuclear cells and immune T cells from SLE patients. It has at least one effect selected from the group consisting of:

[0055] A promoter of circRNA having an imperfect duplex structure with a length of 16 bp to 33 bp is a substance for enhancing the level of circRNA having an imperfect duplex structure with a length of 16 bp to 33 bp. In detail, (1) a circARID1B promoter refers to a substance for enhancing the level of circARID1B, (2) a circCAMSAP1 promoter refers to a substance for enhancing the level of circCAMSAP1, (3) a circCCNB1 promoter refers to a substance for enhancing the level of circCCNB1, (4) a circCNN2 promoter refers to a substance for enhancing the level of circCNN2, (5) a circDHX34 promoter refers to a substance for enhancing the level of circDHX34, (6) a circEPHB4 promoter refers to a substance for enhancing the level of circEPHB4, (7) a circEZH2 promoter refers to a substance for enhancing the level of circEZH2, (8) a circFCHO2 promoter refers to a substance for enhancing the level of circFCHO2, (9) a circFGFR1 promoter refers to a substance for enhancing the level of circFGFR1, and (10) a circFKBP8 promoter refers to a substance for enhancing the level of circFKBP8. (11) a circKIAA0368 promoter refers to a substance for enhancing the level of circKIAA0368; (12) a circMBOAT2 promoter refers to a substance for enhancing the level of circMBOAT2; (13) a circPIP5K1C promoter refers to a substance for enhancing the level of circPIP5K1C; (14) a circPOLR2A promoter refers to a substance for enhancing the level of circPOLR2A; and (15) a circPPP1CB promoter refers to a substance for enhancing the level of ci (16) a circPROSC promoter refers to a substance for enhancing the level of circPROSC; (17) a circPTK2 promoter refers to a substance for enhancing the level of circPTK2; (18) a circPVT1 promoter refers to a substance for enhancing the level of circPVT1; (19) a circRELL1 promoter refers to a substance for enhancing the level of circRELL1; and (20) a circSDHAF2 promoter refers to a substance for enhancing the level of circRELL1.(21) a circSLC22A23 promoter refers to a substance for enhancing the level of circSLC22A23; (22) a circSNHG4 promoter refers to a substance for enhancing the level of circSNHG4; (23) a circTBCD promoter refers to a substance for enhancing the level of circTBCD; (24) a circTMEM181 promoter refers to a substance for enhancing the level of circTMEM181; (25) a circUIMC1 promoter refers to a substance for enhancing the level of circUIMC1; and (26) a circVAPB promoter refers to a substance for enhancing the level of circVAPB.

[0056] Specifically, the levels of circRNAs with imperfect duplex structures of 16 bp to 33 bp in length can be enhanced by using various chemical, physical, and biological methods. (1) A method for enhancing the level of circRNAs having an imperfect duplex structure with a length of 16 bp to 33 bp by regulating the pathway of circRNAs having an imperfect duplex structure with a length of 16 bp to 33 bp; and (2) A method to directly increase the levels of circRNAs with imperfect duplex structures of 16-33 bp in length in cells Including, but not limited to:

[0057] The level of circRNAs with imperfect duplex structures of 16 bp to 33 bp in length can be directly increased by high expression of circRNAs with imperfect duplex structures of 16 bp to 33 bp in length.

[0058] In detail, (1) the level of circARID1B can be enhanced by high expression of circARID1B, (2) the level of circCAMSAP1 can be enhanced by high expression of circCAMSAP1, (3) the level of circCCNB1 can be enhanced by high expression of circCCNB1, (4) the level of circCNN2 can be enhanced by high expression of circCNN2, (5) the level of circDHX34 can be enhanced by high expression of circDHX34, and (6) the level of circEPHB4 can be enhanced by high expression of circEPHB4, (7) circEZH2 levels can be enhanced by high expression of circEZH2, (8) circFCHO2 levels can be enhanced by high expression of circFCHO2, (9) circFGFR1 levels can be enhanced by high expression of circFGFR1, (10) circFKBP8 levels can be enhanced by high expression of circFKBP8, and (11) circKIAA0368 levels can be enhanced by high expression of circKIAA0368. (12) the level of circMBOAT2 can be enhanced by high expression of circMBOAT2, (13) the level of circPIP5K1C can be enhanced by high expression of circPIP5K1C, (14) the level of circPOLR2A can be enhanced by high expression of circPOLR2A, (15) the level of circPPP1CB can be enhanced by high expression of circPPP1CB, (16) the level of circPROSC can be enhanced by high expression of circPROSC, (1 7) The level of circPTK2 can be enhanced by high expression of circPTK2, (18) the level of circPVT1 can be enhanced by high expression of circPVT1, (19) the level of circRELL1 can be enhanced by high expression of circRELL1, (20) the level of circSDHAF2 can be enhanced by high expression of circSDHAF2, (21) the level of circSLC22A23 can be enhanced by high expression of circSLC22A23, (22) the level of circSNHG4 can be enhanced by high expression of circSDHAF2, (23) the level of circSNHG4 can be enhanced by high expression of circSDHAF2, (24) the level of circSNHG4 can be enhanced by high expression of circSDHAF2, (25) the level of circSNHG4 can be enhanced by high expression of circSLC22A23, (26) the level of circSNHG4 can be enhanced by high expression of circSLC22A23, (27) the level of circSNHG4 can be enhanced by high expression of circSLC22A23, (28) the level of circSNHG4 can be enhanced by high expression of circSLC22A23, (29) the level of circSNHG4 can be enhanced by high expression of circSLC22A23, (30) the level of circSNHG4 can be enhanced by high expression of circSLC22A23, (31) the level of circSNHG4 can be enhanced by high expression of circSLC22A23, (32) the level of circSNHG4 can be enhanced by high expression of circSLC22A23, (33) the level of circSNHG4 can be enhanced by high expression of circSLC22A23, (34) the level of circSNHG4 can be enhanced by high expression of circSLC22A23, (35) the level of circ(23) The level of circTBCD can be enhanced by high expression of circTBCD, (24) the level of circTMEM181 can be enhanced by high expression of circTMEM181, (25) the level of circUIMC1 can be enhanced by high expression of circUIMC1, and (26) the level of circVAPB can be enhanced by high expression of circVAPB.

[0059] In the method for controlling the pathway of circRNA having an imperfect duplex structure with a length of 16 bp to 33 bp, the level of circRNA having an imperfect duplex structure with a length of 16 bp to 33 bp can be enhanced by using an agonist of circRNA having an imperfect duplex structure with a length of 16 bp to 33 bp.

[0060] The method for enhancing the level of circRNAs having imperfect duplex structures of 16 bp to 33 bp in length refers to increasing the level of circRNAs having imperfect duplex structures of 16 bp to 33 bp in length. Preferably, the level of circRNAs having imperfect duplex structures of 16 bp to 33 bp in length is enhanced by at least 10%, preferably at least 30%, even more preferably at least 50%, more preferably 70%, and most preferably at least 90% compared to the level before enhancement.

[0061] In the examples of the present disclosure, we demonstrated that directly increasing the level of circRNAs with imperfect duplex structures of 16 bp to 33 bp in cells through high expression of circRNAs with imperfect duplex structures of 16 bp to 33 bp in length significantly reduced PKR phosphorylation levels in mononuclear cells of SLE patients and downregulated the expression of cytokine IFN-beta and SLE diagnostic genes MX-1, LY-6E, and IFIT3 in PBMCs and immune T cells of SLE patients. Therefore, it can be understood that the above-mentioned method of controlling the pathway of circRNAs with imperfect duplex structures of 16 bp to 33 bp in length can result in a significant reduction in PKR phosphorylation levels in mononuclear cells of SLE patients and downregulated the expression of cytokine IFN-beta and SLE diagnostic genes MX-1, LY-6E, and IFIT3 in PBMCs and immune T cells of SLE patients. Therefore, such a method is believed to be useful for treating SLE.

[0062] A medicine for treating SLE necessarily contains a circRNA having an incomplete duplex structure with a length of 16 bp to 33 bp and / or a promoter of a circRNA having an incomplete duplex structure with a length of 16 bp to 33 bp, and the circRNA having an incomplete duplex structure with a length of 16 bp to 33 bp and / or a promoter of a circRNA having an incomplete duplex structure with a length of 16 bp to 33 bp functions as an active ingredient for the above-mentioned effect.

[0063] In pharmaceuticals for treating SLE, the active ingredient having the above-mentioned effect may simply be a circRNA having an incomplete duplex structure with a length of 16 bp to 33 bp and / or a promoter of a circRNA having an incomplete duplex structure with a length of 16 bp to 33 bp, or may include other molecules having similar effects.

[0064] In other words, the promoter of a circRNA with an imperfect duplex structure having a length of 16 bp to 33 bp and / or a circRNA with an imperfect duplex structure having a length of 16 bp to 33 bp can be the active ingredient alone or one of the active ingredients.

[0065] Medicaments for treating SLE can be single-component drugs or multi-component drugs.

[0066] The medicament for treating SLE may be in various forms, such as solid, liquid, gel, semi-liquid and aerosol, without being particularly limited.

[0067] The target of medicines for treating SLE is primarily mammals, such as rodents and primates.

[0068] The method for treating SLE provided in the present disclosure includes administering to a subject an effective amount of a circRNA having an imperfect duplex structure with a length of 16 bp to 33 bp and / or a promoter of a circRNA having an imperfect duplex structure with a length of 16 bp to 33 bp.

[0069] The subject may be a mammal. The mammal is preferably selected from the group consisting of rodents, artiodactyls, perissodactyls, lagomorphs, primates, etc. The primate is preferably a monkey, ape, or human.

[0070] The subject may be a patient with SLE or an individual in whom prevention or alleviation of SLE is expected, or the subject may be SLE cells isolated from a patient with SLE or an individual in whom prevention or alleviation of SLE is expected.

[0071] A circRNA having an imperfect duplex structure with a length of 16 bp to 33 bp and / or a promoter of a circRNA having an imperfect duplex structure with a length of 16 bp to 33 bp can be administered to a subject before, during, or after treatment for SLE.

[0072] The pharmaceutical for treating SLE provided in the present disclosure comprises an effective dose of a circRNA having an imperfect duplex structure of 16 bp to 33 bp in length and / or a promoter of a circRNA having an imperfect duplex structure of 16 bp to 33 bp in length.

[0073] In an embodiment, a pharmaceutical for treating SLE comprises an effective dose of a circRNA having an imperfect duplex structure of 16 bp to 33 bp in length and / or a promoter of a circRNA having an imperfect duplex structure of 16 bp to 33 bp in length, and a pharmaceutically acceptable carrier.

[0074] A medicine for treating SLE necessarily contains a circRNA having an incomplete duplex structure with a length of 16 bp to 33 bp and / or a promoter of a circRNA having an incomplete duplex structure with a length of 16 bp to 33 bp, and the circRNA having an incomplete duplex structure with a length of 16 bp to 33 bp and / or a promoter of a circRNA having an incomplete duplex structure with a length of 16 bp to 33 bp is the active ingredient for the above-mentioned effect.

[0075] In pharmaceuticals for treating SLE, the active ingredient having the above-mentioned effect may simply be a circRNA having an incomplete duplex structure with a length of 16 bp to 33 bp and / or a promoter of a circRNA having an incomplete duplex structure with a length of 16 bp to 33 bp, or may include other molecules having similar effects.

[0076] In other words, the promoter of a circRNA with an imperfect duplex structure having a length of 16 bp to 33 bp and / or a circRNA with an imperfect duplex structure having a length of 16 bp to 33 bp can be the active ingredient alone or one of the active ingredients.

[0077] Medicaments for treating SLE can be single-component drugs or multi-component drugs.

[0078] The medicament for treating SLE may be in various forms, such as solid, liquid, gel, semi-liquid and aerosol, without being particularly limited.

[0079] The target of medicines for treating SLE is primarily mammals, such as rodents and primates.

[0080] The pharmaceutical combination for treating SLE provided in the present disclosure comprises an effective dose of a circRNA having an imperfect duplex structure of 16 bp to 33 bp in length and / or a promoter of a circRNA having an imperfect duplex structure of 16 bp to 33 bp in length, and at least one additional pharmaceutical for treating SLE.

[0081] The pharmaceutical combination for the combined treatment can be in any one of the following forms:

[0082] I) A circRNA having an imperfect duplex structure with a length of 16 bp to 33 bp, a promoter of the circRNA having an imperfect duplex structure with a length of 16 bp to 33 bp, and an additional drug for treating SLE are each prepared into individual formulations. The dosage forms of the formulations may be the same or different, and the administration routes may also be the same or different.

[0083] When the additional medicament for treating SLE is an antibody, parenteral administration is generally used.When the additional medicament for treating SLE is a chemical preparation, the administration route can be diversified, such as gastrointestinal administration and parenteral administration.Generally, the known administration route for each chemical preparation is recommended.

[0084] II) A compound formulation is prepared containing a circRNA having an imperfect duplex structure of 16 bp to 33 bp in length and / or a promoter of a circRNA having an imperfect duplex structure of 16 bp to 33 bp in length, and an additional drug for treating SLE. A compound formulation formulated with a circRNA having an imperfect duplex structure of 16 bp to 33 bp in length and / or a promoter of a circRNA having an imperfect duplex structure of 16 bp to 33 bp in length, and an additional drug for treating SLE, is applicable when the circRNA having an imperfect duplex structure of 16 bp to 33 bp in length and / or the promoter of a circRNA having an imperfect duplex structure of 16 bp to 33 bp in length, and the additional drug for treating SLE are administered simultaneously via the same administration route.

[0085] The method for treating SLE provided in the present disclosure includes administering to a subject a circRNA having an imperfect duplex structure with a length of 16 bp to 33 bp and / or a promoter of a circRNA having an imperfect duplex structure with a length of 16 bp to 33 bp; and administering to the subject an effective amount of an additional pharmaceutical agent for treating SLE and / or applying other means for treating SLE to the subject.

[0086] An effective amount of a circRNA having an imperfect duplex structure with a length of 16 bp to 33 bp and / or a promoter of a circRNA having an imperfect duplex structure with a length of 16 bp to 33 bp, and an effective amount of at least one additional pharmaceutical agent for treating SLE can be administered simultaneously or sequentially.

[0087] Considering that circRNAs having an imperfect duplex structure with a length of 16 bp to 33 bp are the first therapeutic target for SLE discovered in the present disclosure, promoters of circRNAs having an imperfect duplex structure with a length of 16 bp to 33 bp and / or promoters of circRNAs having an imperfect duplex structure with a length of 16 bp to 33 bp can at least achieve an additive therapeutic effect in combined drug therapy with additional drugs for treating SLE other than promoters of circRNAs having an imperfect duplex structure with a length of 16 bp to 33 bp and / or promoters of circRNAs having an imperfect duplex structure with a length of 16 bp to 33 bp, thereby further enhancing the therapeutic effect of SLE.

[0088] Additional medications for treating SLE include, but are not limited to, antibodies, chemical agents, or targeted medications.

[0089] The circRNA having an imperfect duplex structure of 16 bp to 33 bp in length and / or a promoter of the circRNA having an imperfect duplex structure of 16 bp to 33 bp in length can be administered gastrointestinal or parenterally. The additional pharmaceutical agent for treating SLE can be administered gastrointestinal or parenterally.

[0090] In the example of the present disclosure, (1) It reduces the phosphorylation level of PKR in mononuclear cells of SLE patients, and (2) it downregulates the expression of cytokine IFN-beta and SLE diagnostic genes MX-1, LY-6E, and IFIT3 in PBMCs and immune T cells of SLE patients. The present invention provides the use of one or more of a circRNA having an imperfect duplex structure of 16 bp to 33 bp in length and / or a promoter of a circRNA having an imperfect duplex structure of 16 bp to 33 bp in length in the preparation of a medicine, the use having one or more effects selected from the group consisting of:

[0091] An example of the present disclosure provides the use of circRNAs having imperfect duplex structures of 16 bp to 33 bp in length in the preparation or screening of pharmaceuticals for treating SLE.

[0092] In some embodiments, circRNAs with imperfect duplex structures of 16 to 33 bp in length function as targets. Specifically, one or more of circARID1B, circCAMSAP1, circCCNB1, circCNN2, circDHX34, circEPHB4, circEZH2, circFCHO2, circFGFR1, circFKBP8, circKIAA0368, circMBOAT2, circPIP5K1C, circPOLR2A, circPPP1CB, circPROSC, circPTK2, circPVT1, circRELL1, circSDHAF2, circSLC22A23, circSNHG4, circTBCD, circTMEM181, circUIMC1, and circVAPB function as targets.

[0093] Specifically, the use refers to screening of candidate substances targeting circRNAs having an imperfect duplex structure of 16 bp to 33 bp in length to seek out promoters of circRNAs having an imperfect duplex structure of 16 bp to 33 bp in length as alternative medicines for treating SLE.

[0094] A promoter of a circRNA having an imperfect duplex structure with a length of 16 bp to 33 bp can be a high-expression substance for a circRNA having an imperfect duplex structure with a length of 16 bp to 33 bp.In detail, (1) the circARID1B promoter is a substance that promotes high circARID1B expression, (2) the circCAMSAP1 promoter is a substance that promotes high circCAMSAP1 expression, (3) the circCCNB1 promoter is a substance that promotes high circCCNB1 expression, (4) the circCNN2 promoter is a substance that promotes high circCNN2 expression, (5) the circDHX34 promoter is a substance that promotes high circDHX34 expression, (6) the circEPHB4 promoter is a substance that promotes high circEPHB4 expression, and (7) the circEZH2 promoter is a substance that promotes high circEZH2 expression. (8) the circFCHO2 promoter is a substance that highly expresses circFCHO2; (9) the circFGFR1 promoter is a substance that highly expresses circFGFR1; (10) the circFKBP8 promoter is a substance that highly expresses circFKBP8; (11) the circKIAA0368 promoter is a substance that highly expresses circKIAA0368; (12) the circMBOAT2 promoter is a substance that highly expresses circMBOAT2; and (13) the circPIP5K1C promoter is a substance that highly expresses circPIP5K1C. (14) A circPOLR2A promoter is a substance that highly expresses circPOLR2A, (15) a circPPP1CB promoter is a substance that highly expresses circPPP1CB, (16) a circPROSC promoter is a substance that highly expresses circPROSC, (17) a circPTK2 promoter is a substance that highly expresses circPTK2, (18) a circPVT1 promoter is a substance that highly expresses circPVT1, (19) a circRELL1 promoter is a substance that highly expresses circRELL1, and (20) a circSDHAF2 promoter is a substance that highly expresses ci (21) a circSLC22A23 promoter is a substance that highly expresses circSLC22A23, (22) a circSNHG4 promoter is a substance that highly expresses circSNHG4, (23) a circTBCD promoter is a substance that highly expresses circTBCD, (24) a circTMEM181 promoter is a substance that highly expresses circTMEM181, (25) a circUIMC1 promoter is a substance that highly expresses circUIMC1, and (26) a circVAPB promoter is a substance that highly expresses circVAPB.

[0095] The present disclosure provides the use of circRNAs having an imperfect duplex structure of 16 bp to 33 bp in length in the preparation or screening of substances for detecting SLE.

[0096] In an embodiment, circRNAs having an imperfect duplex structure with a length of 16 bp to 33 bp function as biomarkers.

[0097] In an embodiment, the substance for detecting SLE is used in the determination or diagnosis of SLE.

[0098] It should be noted that the substance for detecting SLE includes, but is not limited to, a liquid form.

[0099] In an embodiment, the substance for detecting SLE is selected from substances for specifically recognizing circRNAs having an imperfect duplex structure of 16 bp to 33 bp in length. In detail, the substance for detecting SLE includes (1) a substance for specifically recognizing circARID1B, (2) a substance for specifically recognizing circCAMSAP1, (3) a substance for specifically recognizing circCCNB1, (4) a substance for specifically recognizing circCNN2, (5) a substance for specifically recognizing circDHX34, (6) a substance for specifically recognizing circEPHB4, (7) a substance for specifically recognizing circEZH2, (8) a substance for specifically recognizing circFCHO2, (9) a substance for specifically recognizing circFGFR1, (10) a substance for specifically recognizing circFKBP8, (11) a substance for specifically recognizing circKIAA0368, (12) a substance for specifically recognizing circMBOAT2, (13) a substance for specifically recognizing circPIP5K1C, and (14). (14) a substance specifically recognizing circPOLR2A, (15) a substance specifically recognizing circPPP1CB, (16) a substance specifically recognizing circPROSC, (17) a substance specifically recognizing circPTK2, (18) a substance specifically recognizing circPVT1, (19) a substance specifically recognizing circRELL1, (20) a substance specifically recognizing circSDHAF2, (21) a substance specifically recognizing circSLC22A23, (22) a substance specifically recognizing circSNHG4, (23) a substance specifically recognizing circTBCD, (24) a substance specifically recognizing circTMEM181, (25) a substance specifically recognizing circUIMC1, and (26) a substance specifically recognizing circVAPB.

[0100] In an embodiment, the substance for specifically recognizing circRNA having an incomplete duplex structure of 16 bp to 33 bp in length is a primer pair for specifically detecting circRNA having an incomplete duplex structure of 16 bp to 33 bp in length. In detail, (1) the substance for specifically recognizing circARID1B is a primer pair for specifically detecting circARID1B, (2) the substance for specifically recognizing circCAMSAP1 is a primer pair for specifically detecting circCAMSAP1, (3) the substance for specifically recognizing circCCNB1 is a primer pair for specifically detecting circCCNB1, (4) the substance for specifically recognizing circCNN2 is a primer pair for specifically detecting circCNN2, (5) the substance for specifically recognizing circDHX34 is a primer pair for specifically detecting circDHX34, (6) the substance for specifically recognizing circEPHB4 is a primer pair for specifically detecting circEPHB4, (7) the substance for specifically recognizing circEZH2 is a primer pair for specifically detecting circEZH2, and (8) the substance for specifically recognizing circCCNB1 is a primer pair for specifically detecting circCCNB1. (9) a substance for specifically recognizing cFCHO2 is a primer pair for specifically detecting circFCHO2, (10) a substance for specifically recognizing circFGFR1 is a primer pair for specifically detecting circFGFR1, (11) a substance for specifically recognizing circKIAA0368 is a primer pair for specifically detecting circKIAA0368, (12) a substance for specifically recognizing circMBOAT2 is a primer pair for specifically detecting circMBOAT2, (13) a substance for specifically recognizing circPIP5K1C is a primer pair for specifically detecting circPIP5K1C, and (14) a substance for specifically recognizing circPOLR2A is a primer pair for specifically detecting circPOLR2A.(15) The substance for specifically recognizing circPPP1CB is a primer pair for specifically detecting circPPP1CB, (16) the substance for specifically recognizing circPROSC is a primer pair for specifically detecting circPROSC, (17) the substance for specifically recognizing circPTK2 is a primer pair for specifically detecting circPTK2, (18) the substance for specifically recognizing circPVT1 is a primer pair for specifically detecting circPVT1, (19) the substance for specifically recognizing circRELL1 is a primer pair for specifically detecting circRELL1, (20) the substance for specifically recognizing circSDHAF2 is a primer pair for specifically detecting circSDHAF2, and (21 (21) A substance for specifically recognizing circSLC22A23 is a primer pair for specifically detecting circSLC22A23, (22) a substance for specifically recognizing circSNHG4 is a primer pair for specifically detecting circSNHG4, (23) a substance for specifically recognizing circTBCD is a primer pair for specifically detecting circTBCD, (24) a substance for specifically recognizing circTMEM181 is a primer pair for specifically detecting circTMEM181, (25) a substance for specifically recognizing circUIMC1 is a primer pair for specifically detecting circUIMC1, and (26) a substance for specifically recognizing circVAPB is a primer pair for specifically detecting circVAPB.

[0101] This study was the first to find that the expression of circRNAs with imperfect duplex structures measuring 16 bp to 33 bp in length in PBMCs of SLE patients was significantly reduced compared to that in normal subjects.

[0102] The present disclosure provides use of a substance for specifically recognizing circRNA having an imperfect duplex structure of 16 bp to 33 bp in length in the preparation of a kit for detecting SLE.

[0103] In detail, the substances for specifically recognizing circRNAs having an imperfect duplex structure with a length of 16 bp to 33 bp include (1) a substance for specifically recognizing circARID1B, (2) a substance for specifically recognizing circCAMSAP1, (3) a substance for specifically recognizing circCCNB1, (4) a substance for specifically recognizing circCNN2, (5) a substance for specifically recognizing circDHX34, (6) a substance for specifically recognizing circEPHB4, (7) a substance for specifically recognizing circEZH2, (8) a substance for specifically recognizing circFCHO2, (9) a substance for specifically recognizing circFGFR1, (10) a substance for specifically recognizing circFKBP8, (11) a substance for specifically recognizing circKIAA0368, (12) a substance for specifically recognizing circMBOAT2, and (13) a substance for specifically recognizing circPIP5K1. (14) a substance for specifically recognizing circPOLR2A, (15) a substance for specifically recognizing circPPP1CB, (16) a substance for specifically recognizing circPROSC, (17) a substance for specifically recognizing circPTK2, (18) a substance for specifically recognizing circPVT1, (19) a substance for specifically recognizing circRELL1, (20) a substance for specifically recognizing circSDHAF2, (21) a substance for specifically recognizing circSLC22A23, (22) a substance for specifically recognizing circSNHG4, (23) a substance for specifically recognizing circTBCD, (24) a substance for specifically recognizing circTMEM181, (25) a substance for specifically recognizing circUIMC1, and (26) a substance for specifically recognizing circVAPB.

[0104] CircRNAs with imperfect duplex structures of 16 bp to 33 bp in length function as biomarkers.

[0105] In an embodiment, the kit for detecting SLE is used in the determination or diagnosis of SLE.

[0106] It should be noted that substances for specifically recognizing circRNAs having an incomplete double-stranded structure of 16 bp to 33 bp in length include, but are not limited to, liquid forms.

[0107] In an embodiment, the substance for specifically recognizing circRNA having an incomplete duplex structure of 16 bp to 33 bp in length is a primer pair for specifically detecting circRNA having an incomplete duplex structure of 16 bp to 33 bp in length. In detail, (1) the substance for specifically recognizing circARID1B is a primer pair for specifically detecting circARID1B, (2) the substance for specifically recognizing circCAMSAP1 is a primer pair for specifically detecting circCAMSAP1, (3) the substance for specifically recognizing circCCNB1 is a primer pair for specifically detecting circCCNB1, (4) the substance for specifically recognizing circCNN2 is a primer pair for specifically detecting circCNN2, (5) the substance for specifically recognizing circDHX34 is a primer pair for specifically detecting circDHX34, (6) the substance for specifically recognizing circEPHB4 is a primer pair for specifically detecting circEPHB4, (7) the substance for specifically recognizing circEZH2 is a primer pair for specifically detecting circEZH2, and (8) the substance for specifically recognizing circCCNB1 is a primer pair for specifically detecting circCCNB1. (9) a substance for specifically recognizing cFCHO2 is a primer pair for specifically detecting circFCHO2, (10) a substance for specifically recognizing circFGFR1 is a primer pair for specifically detecting circFGFR1, (11) a substance for specifically recognizing circKIAA0368 is a primer pair for specifically detecting circKIAA0368, (12) a substance for specifically recognizing circMBOAT2 is a primer pair for specifically detecting circMBOAT2, (13) a substance for specifically recognizing circPIP5K1C is a primer pair for specifically detecting circPIP5K1C, and (14) a substance for specifically recognizing circPOLR2A is a primer pair for specifically detecting circPOLR2A.(15) The substance for specifically recognizing circPPP1CB is a primer pair for specifically detecting circPPP1CB, (16) the substance for specifically recognizing circPROSC is a primer pair for specifically detecting circPROSC, (17) the substance for specifically recognizing circPTK2 is a primer pair for specifically detecting circPTK2, (18) the substance for specifically recognizing circPVT1 is a primer pair for specifically detecting circPVT1, (19) the substance for specifically recognizing circRELL1 is a primer pair for specifically detecting circRELL1, (20) the substance for specifically recognizing circSDHAF2 is a primer pair for specifically detecting circSDHAF2, and (21 (21) A substance for specifically recognizing circSLC22A23 is a primer pair for specifically detecting circSLC22A23, (22) a substance for specifically recognizing circSNHG4 is a primer pair for specifically detecting circSNHG4, (23) a substance for specifically recognizing circTBCD is a primer pair for specifically detecting circTBCD, (24) a substance for specifically recognizing circTMEM181 is a primer pair for specifically detecting circTMEM181, (25) a substance for specifically recognizing circUIMC1 is a primer pair for specifically detecting circUIMC1, and (26) a substance for specifically recognizing circVAPB is a primer pair for specifically detecting circVAPB.

[0108] The present disclosure provides a kit for detecting SLE, which includes a substance for specifically recognizing circRNA having an imperfect duplex structure of 16 bp to 33 bp in length.

[0109] In an embodiment, circRNAs having an imperfect duplex structure with a length of 16 bp to 33 bp function as biomarkers.

[0110] In an embodiment, the kit for detecting SLE is used in the determination or diagnosis of SLE.

[0111] It should be noted that substances for specifically recognizing circRNAs having an incomplete double-stranded structure of 16 bp to 33 bp in length include, but are not limited to, liquid forms.

[0112] In an embodiment, the substance for specifically recognizing circRNA having an incomplete duplex structure of 16 bp to 33 bp in length is a primer pair for specifically detecting circRNA having an incomplete duplex structure of 16 bp to 33 bp in length. In detail, (1) the substance for specifically recognizing circARID1B is a primer pair for specifically detecting circARID1B, (2) the substance for specifically recognizing circCAMSAP1 is a primer pair for specifically detecting circCAMSAP1, (3) the substance for specifically recognizing circCCNB1 is a primer pair for specifically detecting circCCNB1, (4) the substance for specifically recognizing circCNN2 is a primer pair for specifically detecting circCNN2, (5) the substance for specifically recognizing circDHX34 is a primer pair for specifically detecting circDHX34, (6) the substance for specifically recognizing circEPHB4 is a primer pair for specifically detecting circEPHB4, (7) the substance for specifically recognizing circEZH2 is a primer pair for specifically detecting circEZH2, and (8) the substance for specifically recognizing circCCNB1 is a primer pair for specifically detecting circCCNB1. (9) a substance for specifically recognizing cFCHO2 is a primer pair for specifically detecting circFCHO2, (10) a substance for specifically recognizing circFGFR1 is a primer pair for specifically detecting circFGFR1, (11) a substance for specifically recognizing circKIAA0368 is a primer pair for specifically detecting circKIAA0368, (12) a substance for specifically recognizing circMBOAT2 is a primer pair for specifically detecting circMBOAT2, (13) a substance for specifically recognizing circPIP5K1C is a primer pair for specifically detecting circPIP5K1C, and (14) a substance for specifically recognizing circPOLR2A is a primer pair for specifically detecting circPOLR2A.(15) The substance for specifically recognizing circPPP1CB is a primer pair for specifically detecting circPPP1CB, (16) the substance for specifically recognizing circPROSC is a primer pair for specifically detecting circPROSC, (17) the substance for specifically recognizing circPTK2 is a primer pair for specifically detecting circPTK2, (18) the substance for specifically recognizing circPVT1 is a primer pair for specifically detecting circPVT1, (19) the substance for specifically recognizing circRELL1 is a primer pair for specifically detecting circRELL1, (20) the substance for specifically recognizing circSDHAF2 is a primer pair for specifically detecting circSDHAF2, and (21 (21) A substance for specifically recognizing circSLC22A23 is a primer pair for specifically detecting circSLC22A23, (22) a substance for specifically recognizing circSNHG4 is a primer pair for specifically detecting circSNHG4, (23) a substance for specifically recognizing circTBCD is a primer pair for specifically detecting circTBCD, (24) a substance for specifically recognizing circTMEM181 is a primer pair for specifically detecting circTMEM181, (25) a substance for specifically recognizing circUIMC1 is a primer pair for specifically detecting circUIMC1, and (26) a substance for specifically recognizing circVAPB is a primer pair for specifically detecting circVAPB.

[0113] Our research results show that high expression of the above-mentioned circRNAs with imperfect duplex structures (16-33 bp) in model cells, i.e., human HeLa cells, can inhibit the phosphorylation activity of the protein kinase PKR and associated protein kinases in its downstream pathway. However, high expression of circSMARCA5, a circRNA without a specific duplex structure, cannot inhibit the phosphorylation activity of PKR and associated protein kinases in its downstream pathway. This indicates that the above-mentioned genes and their expression products of circRNAs with imperfect duplex structures (16-33 bp) may open a new avenue for regulating the phosphorylation activity of PKR, a protein involved in innate immunity, and associated protein kinases in its downstream pathway in autoimmune diseases.

[0114] According to the applicant's research results, the expression of the above-mentioned genes of circRNAs with imperfect duplex structures of 16 bp to 33 bp in length is significantly down-regulated in PBMCs of SLE patients. High expression of circRNAs with imperfect duplex structures of 16 bp to 33 bp in length in primary cells or immune T cells can inhibit the phosphorylation activity of protein kinase PKR and the expression of cytokine IFN-beta and diagnostic genes for SLE. This demonstrates that genes of circRNAs with imperfect duplex structures of 16 bp to 33 bp in length and their expression products may open new avenues for the diagnosis and treatment of SLE.

[0115] The properties and functions of circRNAs with special structures are explained below by taking circPOLR2A as an example. [Example]

[0116] Example 1: Chromosomal location map of circPOLR2A The location of circPOLR2A on the chromosome is shown in Figure 1. This sequence was obtained from the circexplorer database (http: / / yanglab.github.io / CIRCexplorer / ). The gene sequence of circPOLR2A is shown in SEQ ID NO: 1. The material used to detect circRNA molecular markers for SLE was a pair of specific primers, including the upstream primer: aatcggcctgtcatgggtat (SEQ ID NO: 2) and the downstream primer: aaagtctgcattgtacggagt (SEQ ID NO: 3). The primer pair was designed by examining and analyzing the circularization site of such circRNAs. The primers were synthesized by Shanghai Biosune Co., Ltd.

[0117] Example 2 Detection of circPOLR2A expression in SLE patients by using specific detection primers Step 1: PBMCs were obtained from normal individuals and SLE patients. Peripheral blood samples were collected from 32 normal individuals and 32 SLE patients at Shanghai Renji Hospital. Isolated PBMCs were obtained by density gradient centrifugation followed by detection.

[0118] Step 2: RNA extraction The culture medium was first removed. The cells were washed twice with PBS, and the liquid was removed by aspiration. The cells were placed on ice, and Trizol solution was added (1 ml per 10 cm culture dish, 0.5 ml per 6 cm culture dish, and 0.2 ml per well of a 6-well plate). As the liquid became viscous, the cells were detached and completely disrupted until the liquid became clear. The cell lysate was pipetted into a DEPC-treated EP tube, and 0.2 volumes of chloroform were added. The EP tube was shaken for 15 seconds, inverted several times, and allowed to stand at room temperature for 2–3 minutes. After centrifugation at 12,000 g for 15 minutes at 4°C, the liquid separated into a bottom layer (red phenol-chloroform phase), a middle layer (pink association phase), and an upper layer (colorless liquid phase containing all RNA). The supernatant was carefully transferred to a new EP tube, ensuring that the middle layer was not aspirated, and an equal volume of isopropanol was added. The EP tube was inverted several times and allowed to stand at room temperature for 10 minutes. After centrifugation at 12,000 g for 15 minutes at 4°C, the supernatant was removed, leaving a small amount of milky-white precipitate, i.e., RNA, at the bottom of the EP tube. The precipitate was washed twice with 1 ml of 75% DEPC-ethanol. The supernatant was removed by aspiration and then air-dried for 10 minutes. 20–30 μl of DEPC-treated water was added to the precipitate and mixed thoroughly to dissolve the RNA. The concentrations were measured as follows: A260 / 280 in the range of 1.8–2.0, A260 / 230 approximately 2.0, and A260 in the range of 0.1–1. The samples were stored at -80°C.

[0119] Step 3: cDNA was obtained by reverse transcription. (1) RNA was treated with DNase. The reaction system is shown below. RNA 1-5 μg DEPC-treated water RQ1DNase 10x reaction buffer 1 μl RQ1RNase-free DNase 1U / μgRNA After a reaction at 37°C for 30 minutes, 1 µl of stop buffer was added, and the reaction was continued at 65°C for 10 minutes.

[0120] (2) Each reaction system to which 0.5 μg of random primer was added was reacted at 72° C. for 5 minutes, and then placed on ice for 2 minutes.

[0121] (3) The reverse transcription reaction system is shown below. 5x reverse transcription buffer 5 μl dNTP (10 mM) 1.25 μl RNase inhibitor 0.5 μl MML-V reverse transcriptase 1 μl DEPC-treated water 5.25 μl The reaction system was incubated at 37°C for 60 minutes and then at 72°C for 10 minutes.

[0122] Step 4: Fluorescent quantitative Q-PCR The real-time quantitative PCR reaction was completed using a Biorad real-time PCR device. The reaction system is shown below. 2x SYBR GreenTaq mix 10 μl Primer (F+R) 1 μl Template 1 μl ddH2O 8 μl

[0123] The reaction conditions were as follows: JPEG0007784306000001.jpg30149

[0124] The data is 2 -ΔΔCT The analysis was carried out according to the method (Kenneth J. Livak, Thomas D. Schmittgen. Method, 25, 2001: 402-408).

[0125] As shown in Figure 2, the expression of the circRNA circPOLR2A in PBMCs of SLE patients was significantly reduced compared to that in normal individuals. An independent sample t-test was performed, and the P value of the circRNA circPOLR2A was less than 0.05, demonstrating a significant difference. As shown in Figure 3, a receiver operating characteristic (ROC) curve was plotted for the circRNA circPOLR2A, and the area under the curve (AUC) exceeded 0.89, indicating that this circRNA, as a marker, had very high diagnostic sensitivity and specificity for identifying SLE using PBMC samples.

[0126] Example 3 Schematic diagram of the secondary structures of circPOLR2A, 26 identical circRNAs with a unique double-stranded structure, and circSMARCA5, a circRNA without a unique double-stranded structure. Step 1: Human-derived model research cells, namely the PA-1 ovarian cancer cell line, were obtained.

[0127] Step 2: RNA was labeled and extracted. The culture medium was first removed. Cells were washed twice with PBS, and the SHAPE reaction labeling compound NAI was added to the labeled RNA. After 10 minutes of labeling, the liquid was removed by aspiration. Cells were placed on ice, and Trizol solution was added (1 ml per 10 cm culture dish, 0.5 ml per 6 cm culture dish, and 0.2 ml per well of a 6-well plate). As the liquid became viscous, the cells were detached and completely disrupted until the liquid became clear. The cell lysate was pipetted into a DEPC-treated EP tube, and 0.2 volumes of chloroform were added. The EP tube was shaken for 15 seconds, inverted several times, and allowed to stand at room temperature for 2–3 minutes. After centrifugation at 12,000 g for 15 minutes at 4°C, the liquid separated into a bottom layer (red phenol-chloroform phase), a middle layer (pink association phase), and an upper layer (colorless liquid phase containing all the RNA). The supernatant was carefully transferred to a new EP tube, ensuring that the middle layer was not aspirated, and an equal volume of isopropanol was added. The EP tube was inverted several times and allowed to stand at room temperature for 10 minutes. After centrifugation at 12,000 g for 15 minutes at 4°C, the supernatant was removed, leaving a small amount of milky-white precipitate, i.e., RNA, at the bottom of the EP tube. The precipitate was washed twice with 1 ml of 75% DEPC-ethanol. The supernatant was removed by aspiration and then air-dried for 10 minutes. 20–30 μl of DEPC-treated water was added to the precipitate and mixed thoroughly to dissolve the RNA. The concentrations were measured as follows: A260 / 280 in the range of 1.8–2.0, A260 / 230 approximately 2.0, and A260 in the range of 0.1–1. The samples were stored at -80°C.

[0128] Step 3: cDNA was obtained by reverse transcription. (1) RNA was treated with DNase. The reaction system is shown below. RNA 1-5 μg DEPC-treated water RQ1DNase 10x reaction buffer 1 μl RQ1RNase-free DNase 1U / μgRNA After a reaction at 37°C for 30 minutes, 1 µl of stop buffer was added, and the reaction was continued at 65°C for 10 minutes.

[0129] (2) Each reaction system to which 0.5 μg of specific primer was added was reacted at 72° C. for 5 minutes, and then placed on ice for 2 minutes.

[0130] (3) The reverse transcription reaction system is shown below. 5x reverse transcription buffer 5 μl dNTP (10 mM) 1.25 μl RNase inhibitor 0.5 μl MML-V reverse transcriptase 1 μl DEPC-treated water 5.25 μl

[0131] The reaction system was incubated at 37°C for 60 minutes and then at 42°C for 180 minutes. The reverse transcription products were subjected to high-throughput sequencing (RNA-seq) analysis to identify the secondary structure of the corresponding RNA. Secondary structure maps of 27 circRNAs were plotted. Figure 4 shows examples of 26 circRNAs with a unique duplex structure and one circRNA, circSMARCA5, that does not have a unique duplex structure.

[0132] Example 4: Construction of pZW1-circPOLR2A vector (Zhang et al., Cell, 2014) The loop region of circPOLR2A was obtained by PCR. The complete linear sequence was inserted into the pZW1 vector via the multiple cloning site. Recombinant plasmids were identified by Sanger sequencing using an empty pZW1 vector without inserted sequence as a negative control. The constructed pZW1-circPOLR2A vector had the sequence of SEQ ID NO: 4, which was specifically as follows: JPEG0007784306000002.jpg75149 JPEG0007784306000003.jpg205149 JPEG0007784306000004.jpg207149 JPEG0007784306000005.jpg206149 JPEG0007784306000006.jpg206149 JPEG0007784306000007.jpg28149

[0133] Example 5: Detection of phosphorylation levels of PKR and downstream genes of PKR after high expression of circPOLR2A and circSMARCA5, a circRNA without a specific double-strand structure The pZW1-circPOLR2A and pZW1-circSMARCA5 expression vectors prepared in Example 4 were transfected into human HeLa cells using Lipo2000 transfection to induce high expression of circPOLR2A and circSMARCA5. After 12 to 14 hours, the stimulatory compound poly(I:C), a mimic of double-stranded viral RNA, was added. Cells were harvested at the corresponding time points for Western blot and Q-PCR analysis.

[0134] As shown in Figure 5, after overexpression of circPOLR2A, the phosphorylation levels of PKR and downstream genes of PKR in HeLa cells were significantly reduced when innate immunity was stimulated with the stimulatory compound [poly(I:C)] (a mimic of double-stranded viral RNA). After overexpression of circSMARCA5, the phosphorylation levels of PKR and downstream genes of PKR in HeLa cells were not significantly altered when innate immunity was stimulated with the stimulatory compound [poly(I:C)] (a mimic of double-stranded viral RNA).

[0135] circPOLR2A and 25 identical circRNAs all had this special double-stranded structure. The above experimental results clearly demonstrated that high expression of circPOLR2A and 25 identical circRNAs with special double-stranded structures and their expression products can be used to control the phosphorylation levels of PKR protein, which is involved in the innate immune pathway, and the phosphorylation levels of PKR downstream genes.

[0136] Example 6: Detection of PKR phosphorylation level after high expression of circPOLR2A, and expression of cytokine IFN-beta and SLE diagnostic genes MX-1, LY-6E, and IFIT3 PBMCs from SLE patients were isolated by density gradient centrifugation. pZW1-circPOLR2A, prepared in Example 4, was transfected into primary cells by electroporation to induce high expression of circPOLR2A. After 12 to 14 hours, the cells were harvested and subjected to Western blot and Q-PCR analysis.

[0137] As shown in Figure 6, overexpression of circPOLR2A significantly reduced PKR phosphorylation levels in mononuclear cells from SLE patients compared with overexpression of linear POLR2A alone. Expression of the cytokine IFN-beta and the SLE diagnostic genes MX-1, LY-6E, and IFIT3 were downregulated. This demonstrates that circPOLR2A can function as a target and that overexpression of circPOLR2A and 26 other circRNAs with the same double-stranded structure and their expression products can be used to treat SLE.

[0138] The foregoing is merely a preferred example of the present disclosure and is not intended to limit the present disclosure in any form or essence. It should be noted that some improvements and additions may be made by those skilled in the art without departing from the method of the present disclosure, and such improvements and additions should also be construed as being within the protection scope of the present disclosure. Equivalent variations of the changes, modifications and variations made by those skilled in the art to the technical content disclosed above without departing from the spirit and scope of the present disclosure shall be equivalent examples of the present disclosure, and any changes, modifications and variations of the equivalent variations made to the above examples according to the technical essence of the present disclosure shall be within the protection scope of the present disclosure.

[0139] Example 7 Detection of the expression of cytokines IFN-beta, TNF-alpha, and IL-6 after transfection of human HeLa cells with purified circPOLR2A in vitro CircRNA was successfully prepared by in vitro RNA transcription and in vitro T4 RNA ligase circularization, and then purified in vitro using PAGE purification to obtain highly purified circPOLR2A. The in vitro prepared and purified circPOLR2A was introduced into human HeLa cells using liposome transfection. After 1 or 6 hours of transfection, cells were harvested and Q-PCR was performed to detect the expression of cytokines IFN-beta, TNF-alpha, and IL-6.

[0140] As shown in Figure 7, after transfection of human HeLa cells with in vitro-prepared and purified circPOLR2A using liposome transfection, the expression of cytokines IFN-beta, TNF-alpha, and IL-6 was not increased by in vitro-prepared and purified circPOLR2A compared with transfection with the double-stranded RNA substrate poly(I:C), unpurified RNA, or linear POLR2A. This clearly demonstrated that in vitro-prepared and purified circPOLR2A does not induce an immune response. These experimental results demonstrate that in vitro-prepared and purified circPOLR2A can function as a target without inducing unwanted immune responses in living organisms.

[0141] Example 8: Detection of the level of PKR phosphorylation activity after in vitro purification of circPOLR2A and the regulatory effect of in vitro purified circPOLR2A on PKR protein CircRNA was successfully prepared by in vitro RNA transcription and in vitro T4 RNA ligase circularization, and then purified in vitro using PAGE purification to obtain highly purified circPOLR2A. PKR protein was successfully prepared using an in vitro purification method using a His tag. The in vitro prepared and purified circPOLR2A was incubated in an in vitro PKR phosphorylation activity experiment using an experimental system. After 30 minutes of incubation at 37°C, cells were harvested and isotope-labeled. 32 P autoradiography was performed to detect the level of PKR phosphorylation activity.

[0142] As shown in Figure 8, after in vitro-prepared and purified circPOLR2A was incubated in an in vitro PKR phosphorylation activity assay, circPOLR2A significantly reduced the level of in vitro PKR phosphorylation activity compared to in vitro-prepared and purified linear POLR2A. This demonstrates that circPOLR2A can function as a target and that in vitro-prepared and purified circPOLR2A, 26 identical circRNA genes with a unique double-stranded structure, and their expression products can be used to treat SLE.

[0143] The foregoing is merely a preferred example of the present disclosure and is not intended to limit the present disclosure in any form or essence. It should be noted that some improvements and additions may be made by those skilled in the art without departing from the method of the present disclosure, and such improvements and additions should also be construed as being within the protection scope of the present disclosure. Equivalent variations of the changes, modifications and variations made by those skilled in the art to the technical content disclosed above without departing from the spirit and scope of the present disclosure shall be equivalent examples of the present disclosure, and any changes, modifications and variations of the equivalent variations made to the above examples according to the technical essence of the present disclosure shall be within the protection scope of the present disclosure.

Claims

1. 1. Use of a circular RNA having an imperfect duplex structure of 16 bp to 33 bp in length and / or an expression vector that expresses the circular RNA having an imperfect duplex structure of 16 bp to 33 bp in high levels in the preparation of a medicament for treating systemic lupus erythematosus, comprising: 1) The circular RNA having an imperfect duplex structure with a length of 16 bp to 33 bp is circPOLR2A, and 2) the expression vector capable of highly expressing the circular RNA having an imperfect double-stranded structure with a length of 16 bp to 33 bp is a circPOLR2A expression vector; The use, wherein the expression of said circular RNA having an imperfect duplex structure of 16 bp to 33 bp in length is downregulated in peripheral blood mononuclear cells (PBMCs) of systemic lupus erythematosus patients compared to normal individuals.

2. The use according to claim 1, wherein the medicament for treating systemic lupus erythematosus has at least one of the following effects: (1) reducing the PKR phosphorylation level in mononuclear cells of patients with systemic lupus erythematosus; and (2) downregulating the expression of cytokine IFN-beta and diagnostic genes MX-1, LY-6E, and IFIT3 for systemic lupus erythematosus in mononuclear cells and immune T cells of patients with systemic lupus erythematosus.

3. The use according to claim 1, characterized in that the expression vector that highly expresses the circular RNA having an imperfect duplex structure with a length of 16 bp to 33 bp refers to a substance for increasing the level of the circular RNA having an imperfect duplex structure with a length of 16 bp to 33 bp.

4. The use according to claim 3, wherein the level of the circular RNA having an imperfect duplex structure with a length of 16 bp to 33 bp is increased by overexpressing the circular RNA having an imperfect duplex structure with a length of 16 bp to 33 bp.

5. The use according to claim 1, characterized in that the circular RNA having an imperfect duplex structure of 16 bp to 33 bp in length and / or the expression vector that highly expresses the circular RNA having an imperfect duplex structure of 16 bp to 33 bp in length is the sole active ingredient or one of the active ingredients of the medicament for treating systemic lupus erythematosus.

6. A pharmaceutical for treating systemic lupus erythematosus, comprising an effective dose of a circular RNA having an imperfect duplex structure of 16 bp to 33 bp in length and / or an expression vector that expresses the circular RNA having an imperfect duplex structure of 16 bp to 33 bp in length at a high level, 1) The circular RNA having an imperfect duplex structure with a length of 16 bp to 33 bp is circPOLR2A, and 2) the expression vector capable of highly expressing the circular RNA having an imperfect double-stranded structure with a length of 16 bp to 33 bp is a circPOLR2A expression vector; A medicament, wherein the expression of said circular RNA having an imperfect duplex structure of 16 bp to 33 bp in length is down-regulated in peripheral blood mononuclear cells (PBMCs) of patients with systemic lupus erythematosus compared to normal individuals.

7. A pharmaceutical combination for treating systemic lupus erythematosus, comprising an effective dose of a circular RNA having an imperfect duplex structure of 16 bp to 33 bp in length and / or an expression vector that highly expresses the circular RNA having an imperfect duplex structure of 16 bp to 33 bp in length, and at least one additional pharmaceutical for treating systemic lupus erythematosus, 1) The circular RNA having an imperfect duplex structure with a length of 16 bp to 33 bp is circPOLR2A, and 2) the expression vector capable of highly expressing the circular RNA having an imperfect double-stranded structure with a length of 16 bp to 33 bp is a circPOLR2A expression vector; A pharmaceutical combination, wherein the expression of said circular RNA having an imperfect duplex structure of 16 bp to 33 bp in length is downregulated in peripheral blood mononuclear cells (PBMCs) of patients with systemic lupus erythematosus compared to normal individuals.

8. (1) Use of a circular RNA having an imperfect duplex structure of 16 bp to 33 bp in length and / or an expression vector that highly expresses the circular RNA having an imperfect duplex structure of 16 bp to 33 bp in length in the preparation of a medicament for reducing PKR phosphorylation levels in mononuclear cells of patients with systemic lupus erythematosus, and / or (2) down-regulating the expression of cytokine IFN-beta and diagnostic genes MX-1, LY-6E, and IFIT3 for systemic lupus erythematosus in mononuclear cells (PBMC) and immune T cells of patients with systemic lupus erythematosus, 1) The circular RNA having an imperfect duplex structure with a length of 16 bp to 33 bp is circPOLR2A, and 2) the expression vector capable of highly expressing the circular RNA having an imperfect double-stranded structure with a length of 16 bp to 33 bp is a circPOLR2A expression vector; The use, wherein the expression of said circular RNA having an imperfect duplex structure of 16 bp to 33 bp in length is downregulated in peripheral blood mononuclear cells (PBMCs) of systemic lupus erythematosus patients compared to normal individuals.

9. Use of a circular RNA having an imperfect duplex structure with a length of 16 bp to 33 bp in the preparation or screening of a drug for treating systemic lupus erythematosus, comprising: the circular RNA having an imperfect double-stranded structure with a length of 16 bp to 33 bp is circPOLR2A; The use, wherein the expression of said circular RNA having an imperfect duplex structure of 16 bp to 33 bp in length is downregulated in peripheral blood mononuclear cells (PBMCs) of systemic lupus erythematosus patients compared to normal individuals.

10. 1. Use of a primer pair for specifically detecting circular RNA having an imperfect duplex structure of 16 bp to 33 bp in length in the preparation of a kit for detecting systemic lupus erythematosus in a sample derived from a subject, comprising: the circular RNA having an imperfect double-stranded structure with a length of 16 bp to 33 bp is circPOLR2A; the expression of said circular RNA having an imperfect duplex structure with a length of 16 bp to 33 bp is down-regulated in peripheral blood mononuclear cells (PBMCs) of patients with systemic lupus erythematosus compared to normal individuals; The use, wherein the sample derived from the subject comprises PBMCs from said subject.

11. A kit for detecting systemic lupus erythematosus in a sample derived from a subject, comprising at least a primer pair for specifically detecting circular RNA having an imperfect duplex structure of 16 bp to 33 bp in length, the circular RNA having an imperfect double-stranded structure with a length of 16 bp to 33 bp is circPOLR2A; the expression of said circular RNA having an imperfect duplex structure with a length of 16 bp to 33 bp is down-regulated in peripheral blood mononuclear cells (PBMCs) of patients with systemic lupus erythematosus compared to normal individuals; A kit, wherein the sample from a subject comprises PBMCs from said subject.

Citation Information

Patent Citations

  • Application of three annular RNAs in systemic lupus erythematosus biomarker

    CN108441555A

  • circPTPN22 and application thereof as systemic lupus erythematosus marker

    CN109055529A