Mutant p-hydroxyphenylpyruvate dioxygenases, nucleic acids encoding same and uses thereof

Abstract

The present invention relates to a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a biologically active fragment thereof, and an isolated polynucleotide comprising a nucleic acid sequence encoding the protein or fragment thereof, wherein the mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a biologically active fragment thereof retains or enhances the ability to catalyze the conversion of p-hydroxyphenylpyruvate (HPP) to homogentisic acid and is significantly less sensitive to HPPD-inhibiting herbicides than wild-type HPPD. The present invention also relates to nucleic acid constructs, expression vectors, and host cells comprising the polynucleotide, as well as methods for producing plants that have the ability to catalyze the conversion of p-hydroxyphenylpyruvate (HPP) to homogentisic acid and are significantly less sensitive to HPPD-inhibiting herbicides.

Description

[Technical Field]

[0001] The present invention belongs to the field of agricultural genetic engineering, and in particular relates to a novel mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) that confers resistance or tolerance to HPPD-inhibiting herbicides to plants, a nucleic acid encoding the same, and uses thereof. [Background technology]

[0002] p-Hydroxyphenylpyruvate dioxygenase (HPPD) is an enzyme that catalyzes the conversion of hydroxyphenylpyruvate (HPP) to homogentisic acid. This reaction occurs in the presence of enzyme-bound iron and oxygen. Herbicides that function by inhibiting HPPD are well known and include various types, such as isoxazoles, diketone nitriles, triketones, and pyrazoline salts. Inhibiting HPPD blocks the biosynthesis of plastoquinone (PQ) from tyrosine. PQ is an essential cofactor for the biosynthesis of carotenoid pigments required for photoprotection of photosynthetic centers. Herbicides that inhibit HPPD are bleaching agents capable of phloem transduction, causing new meristems and leaves to appear white when exposed to light. In the absence of carotenoids, chlorophyll is photodestructible, itself photosensitized by singlet oxygen to become a photochemical cleavage agent.

[0003] Technical pathways and methods for providing plants that are resistant to HPPD-inhibiting herbicides are also known, including overexpressing HPPD enzymes so that a sufficient amount of HPPD enzyme is produced that is suitable for a given herbicide, so that even in the presence of inhibitors, plants have sufficient functional enzymes available, or mutating target HPPD into a functional HPPD that is less sensitive to herbicides.HPPD-inhibiting herbicides are a large class that encompasses many different types.While a given HPPD enzyme can provide a useful level of resistance to some HPPD-inhibiting herbicides, it may be completely insufficient to provide commercial levels of resistance to different, more desirable HPPD-inhibiting herbicides (see, for example, U.S. Patent Application Publication No. 2004 / 0058427; and PCT Patent Application Publication Nos. WO98 / 20144 and WO02 / 46387; also see U.S. Patent Application Publication No. 2005 / 024800, which relates to identifying and labeling soybean varieties that are relatively resistant to HPPD). Furthermore, different HPPD-inhibiting herbicides may differ in the range of weeds they control, the target crops to which they are applied, the production costs, and the environmental benefits of each.Therefore, there is still a need in the art for new mutant HPPDs to confer resistance / tolerance to HPPD-inhibiting herbicides on different crops and crop varieties.

[0004] Transgenic technology has been widely used to create herbicide-resistant crops and crop varieties. However, high registration costs have limited the use of transgenic crops, and advances in gene editing technologies such as CRISPR / Cas9 may change this situation.CRISPR / Cas9 is a new site-specific gene editing technology that has emerged since 2012 (Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, JA, and Charpentier, E. 2012. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337: 816-821.; Cong, L., Ran, FA, Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, PD, Wu, X., Jiang, W., Marraffini, LA, and Zhang, F. 2013. Multiplex genome engineering using CRISPR / Cas systems. Science. 339: 819-823; Li, JF, Norville, JE, Aach, J., McCormack, M., Zhang, D., Bush, J., Church, GM, and Sheen, J. 2013. Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9. Nat. Biotechnol. 31: 688.; Mali, P., Yang, L., Esvelt, KM, Aach, J., Guell, M., Dicarlo, JE, Norville, JE, and Church, GM 2013. RNA-guided human genome engineering via Cas9. Science. 339: 823.) Recognition of edited targets by the CRISPR / Cas9 system relies on base pairing between nucleic acid molecules. This system can edit any 20-bp target sequence flanked by a PAM (NGG).Furthermore, the CRISPR / Cas9 system is simple to operate, requiring only 20–30 bp of target nucleotide sequence to be replaced in the original vector for each target, making it suitable for high-throughput manipulation. This system allows for simultaneous editing of multiple sites within the same gene, as well as multiple different genes. Currently, this technology shows great promise for biomedicine, functional genomics, trait improvement, and the creation of novel traits in plants and animals, playing a revolutionary role in facilitating plant and animal breeding. (Hui Zhang, Jinshan Zhang, Zhaobo Lang, Jose Ramon Botellad, and Jian-Kang Zhu. 2017. Genome Editing—Principles and Applications for Functional Genomics Research and Crop Improvement, Critical Reviews in Plant Sciences, 36:4, 291–309, DOI:10.1080 / 07352689.2017.1402989)

[0005] As a third-generation gene editing tool, CRISPR / Cas9 achieves site-directed editing through three major methods. First, site-specific gene knockout to obtain mutant forms. Specifically, Cas9 recognizes and cleaves the target site under the direction of a guide RNA (gRNA), generating double-stranded DNA breaks. DNA breaks are usually repaired by nonhomologous end joining (NHEJ), and frameshift mutations can easily occur during the repair process, resulting in gene disruption. Site-specific gene knockout is highly efficient. Second, it is targeted homologous replacement to replace the target sequence or achieve site-specific insertion. When a double-stranded DNA break occurs, homologous replacement or site-specific insertion can occur if a homologous repair template is present nearby. The efficiency of homologous replacement is low and decreases significantly as the length of the replaced sequence increases. Third, the third approach is base editing (Komor AC, Kim YB, Packer MS, Zuris JA, Liu DR. Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage. Nature. 2016 May 19; 533(7603):420-4. doi: 10.1038 / nature17946;Gaudelli NM, Komor AC, Rees HA, Packer MS, Badran AH, Bryson DI, Liu DR. Programmable base editing of A·T to G·C in genomic DNA without DNA cleavage. Nature. 2017 Nov 23; 551(7681): 464-471. doi: 10.1038 / nature 24644. Epub 2017 Oct 25. Erratum in: Nature. 2018 May 2) Base editing is a gene editing method that uses the CRISPR / Cas9 system to target deaminase to specific sites in the genome and modify specific bases. This method has been successfully applied in rice.[ PubMed ] Yan F., Kuang Y., Ren B., Wang J., Zhang D., Lin H., Yang B., Zhou X., and Zhou H. (2018). High-efficient A·T to G·C base editing by Cas9n-guided tRNA adenosine deaminase in rice. Mol. Plant. doi: 10.1016 / j.molp. 2018.02.008.

[0006] Additionally, CRISPR / Cpf1 can also be used for gene editing (Zetsche, B., Gootenberg, JS, Abudayyeh, OO, Slaymaker, IM, Makarova, KS, Essletzbichler, P., Volz, SE, Joung, J., Oost, J., Regev, A., Koonin, EV, and Zhang, F. 2015. Cpf1 is a single RNA-guided endonuclease of a Class 2 CRISPR Cas system. Cell. 163: 759-771;Endo, A., Masafumi, M., Kaya, H., and Toki, S. 2016a. Efficient targeted mutagenesis of rice and tobacco genomes usingCpf1 from Francisella novicida. Sci. Rep. 6: 38169.). CRISPR / Cpf1 contains two key components: the Cpf1 enzyme and the crRNA, which determines the specificity of the system. Although the CRISPR / Cpf1 system is similar to the CRISPR / Cas9 system, there are certain key differences between them (Hui Zhang, Jinshan Zhang, Zhaobo Lang, Jose Ramon Botella & Jian-Kang Zhu (2017) Genome Editing - Principles and Applications for Functional Genomics Research and Crop Improvement, Critical Reviews in Plant Sciences, 36:4, 291-309, DOI:10.1080 / 07352689.2017.1402989). First, the CRISPR / Cpf1 system does not require the trans-acting crRNA (tracrRNA) required by the CRISPR / Cas9 system. Second, the CRISPR / Cpf1 system is relatively short, measuring 42–44 nucleotides, including a 19-nucleotide repeat and a 23–25-nucleotide spacer.Third, unlike Cas9, which cleaves the DNA double strand at the same position (3–4 bp upstream of the PAM) to generate a blunt end, Cpf1 cleaves the target sequence 23 bp downstream of the PAM sequence and the non-target single strand 18 bp downstream of the PAM sequence, generating a sticky end with a 5-bp overhang. The resulting sticky end can increase the efficiency of HDR-mediated insertion of donor DNA into the Cpf1 cleavage site. Fourth, the CRISPR / Cpf1 system is ideal for editing multiple targets because it requires only one promoter to drive multiple arrays of small crRNAs when editing multiple targets or genes. Fifth, the CRISPR / Cas9 system requires a G-rich (5'-NGG-3') PAM sequence at the 3' end of the target sequence, whereas CRISPR / Cpf1 requires a T-rich (5'-TTTN-3') PAM sequence at the 5' end of the target sequence, making it suitable for editing multiple A / T DNA or genes. Currently, three engineered CRISPR / Cpf1 systems have been developed, including FnCpf1 from Francisella novicida, AsCpf1 from Acidaminococcus sp., and LbCpf1 from Lachnospiraceae bacterium.All three of these Cpf1 systems have been used for plant genome editing in several species, including rice, Arabidopsis, tobacco, and soybean (Endo, A., Masafumi, M., Kaya, H., and Toki, S. 2016a. Efficient targeted mutagenesis of rice and tobacco genomes using Cpf1 from Francisella novicida. Sci. Rep. 6: 38169; Kim, H., Kim, ST, Ryu, J., Kang, BC, Kim, JS, and Kim, SG 2017. CRISPR / Cpf1-mediated DNA-free plant genome editing. Nat. Commun. 8: 14406; Tang, X., Lowder, LG, Zhang, T., Malzahn, AA, Zheng, X., Voytas, DF, Zhong, Z., Chen, Y., Ren, Q., and Li, Q. 2017. A CRISPR-Cpf1 system for efficient genome editing and transcriptional repression in plants. Nat. Plants. 3: 17018.;Wang, M., Mao, Y., Lu, Y., Tao, X., and Zhu, JK 2017a. Multiplex gene editing in rice using the CRISPR-Cpf1 system. Mol. Plant. 10: 1011-1013).

[0007] Currently, one of the research focuses in the field of gene editing is how to improve herbicide resistance in important crops by homologous replacement, site-specific modification, or single-base editing through gene editing. Although several successful cases have been reported, most of them are related to resistance to acetolactate synthase (ALS)-inhibiting herbicides (Yongwei Sun, Xin Zhang, Chuanyin Wu, Ubing He, Youzhi Ma, Han Hou, Xiuping Guo, Wenming Du, Yunde Zhao and Lanqin Xia. 2016. Engineering Herbicide-Resistant Rice Plants through CRISPR / Cas9-Mediated Homologous Recombination of Acetolactate Synthase. Molecular Plant 9,628-631 doi.org / 10.1016 / j.molp.2016.01.001; Yiyu Chen, Zhiping Wang, Hanwen Ni, Yong Xu, Qijun Chen, Linjian Jiang. 2017. CRISPR / Cas9-mediated base-editing system efficiently generates gain-of-function mutations in Arabidopsis. Sci China Life Sci 60. doi: 10.1007 / s11427-017-9021-5) and glyphosate herbicide (WO2017028768A1). Therefore, scientists need to continue research and develop new approaches to improve crop tolerance to various types of herbicides. Summary of the Invention

[0008] In light of the above, the present invention provides a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) that confers resistance or tolerance to HPPD-inhibiting herbicides to plants, where the mutant HPPD retains or enhances the ability to catalyze the conversion of p-hydroxyphenylpyruvate (HPP) to homogentisic acid and is significantly less sensitive to HPPD-inhibiting herbicides than wild-type HPPD. The present invention also relates to biologically active fragments of the mutant p-hydroxyphenylpyruvate dioxygenase, polynucleotides encoding the protein or fragments thereof, and uses thereof.

[0009] Therefore, in one embodiment, according to the present invention, 93S, 103S, 141R, 141K, 141T, 165V, 191, 220, 226, 276, 277, 336, 337, 338, 342, 346, 370, 377, 386, 390, 392, 403, 410, 418, 419, 420, 430, and 431 of the amino acid sequence of the wild-type rice p-hydroxyphenylpyruvate dioxygenase protein represented by SEQ ID NO:2 are selected from the group consisting of 93S, 103S, 141R, 141K, 141T, 165V, 191, 220, 226, 276, 277, 336, 337, 338, 342, 346, 370, 377, 386, 390, 392, 403, 410, 418, 419, 420, 430, and 431. Mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) proteins are provided having one or more mutations selected from the group consisting of 191I, 220K, 226H, 276W, 277N, 336D, 337A, 338D, 338S, 338Y, 342D, 346C, 346D, 346H, 346S, 346Y, 370N, 377C, 386T, 390I, 392L, 403G, 410I, 418P, 419F, 419L, 419V, 420S, 420T, 430G and 431L. Preferably, the amino acid sequence of the mutant p-hydroxyphenylpyruvate dioxygenase protein further has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID NO:2.More preferably, the mutant p-hydroxyphenylpyruvate dioxygenase protein has one or more amino acid residues corresponding to positions 93, 103, 141, 165, 191, 220, 226, 276, 277, 336, 337, 338, 342, 346, 370, 377, 386, 390, 392, 403, 410, 418, 419, 420, 430, and 431 in the amino acid sequence of the wild-type rice p-hydroxyphenylpyruvate dioxygenase protein represented by SEQ ID NO:2, such as 93S, 103S, 141, 165, 191, 220, 226, 276, 277, 336, 337, 338, 342, 346, 370, 377, 386, 390, 392, 403, 410, 418, 419, 420, 430, and 431. It has the amino acid sequence set forth in SEQ ID NO: 2, except that it has one or more amino acid mutations selected from the group consisting of 1R, 141K, 141T, 165V, 191I, 220K, 226H, 276W, 277N, 336D, 337A, 338D, 338S, 338Y, 342D, 346C, 346D, 346H, 346S, 346Y, 370N, 377C, 386T, 390I, 392L, 403G, 410I, 418P, 419F, 419L, 419V, 420S, 420T, 430G and 431L.

[0010] In another aspect, the present invention provides biologically active fragments of mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) proteins, which lack a portion of one or more (e.g., 1-50, 1-25, 1-10, or 1-50, e.g., 1, 2, 3, 4, or 5) amino acid residues at the N-terminus and / or C-terminus of the protein, but still retain the desired biological activity of the full-length protein, i.e., the fragment retains or enhances the ability to catalyze the conversion of p-hydroxyphenylpyruvate (HPP) to homogentisic acid, and is significantly less sensitive to HPPD-inhibiting herbicides than wild-type HPPD or the corresponding biologically active fragments thereof.

[0011] The present invention further relates to a fusion protein comprising a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein of the present invention or a biologically active fragment thereof and an additional component, e.g., a peptide or polypeptide component, fused thereto. Preferably, the component confers a desired property on the fusion protein, such as facilitating its isolation and purification, increasing its stability, extending its half-life, providing additional biological activity, or targeting the fused HPPD protein to a target region, such as a plastid, e.g., a chloroplast. The choice of corresponding components is known to those skilled in the art.

[0012] In another aspect, the present invention provides an isolated polynucleotide comprising a nucleic acid sequence encoding the mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a biologically active fragment thereof, or the fusion protein.

[0013] The present invention further provides a nucleic acid construct comprising the above-described polynucleotide and a regulatory element operably linked thereto.

[0014] In a further aspect, the present invention provides an expression vector comprising the above-described polynucleotide and an expression control element operably linked thereto.

[0015] In yet another aspect, the present invention provides a host cell comprising the above-described polynucleotide, nucleic acid construct or expression vector.

[0016] The present invention further provides methods of manufacturing to produce plants with improved resistance or tolerance to HPPD-inhibiting herbicides.

[0017] The present invention further relates to plants produced by the above method.

[0018] The present invention also provides a method for improving the resistance or tolerance of a plant to an HPPD-inhibiting herbicide, comprising expressing the mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a biologically active fragment thereof, or the fusion protein of the present invention in the plant.

[0019] The present invention further provides a method for improving the resistance or tolerance of a plant to an HPPD-inhibiting herbicide, comprising crossing a plant expressing the mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a biologically active fragment thereof, or the fusion protein of the present invention with another plant.

[0020] The present invention further provides a method for improving resistance or tolerance in a plant to an HPPD-inhibiting herbicide, comprising gene editing of an endogenous HPPD protein gene in a plant cell, plant tissue, plant part, or plant.

[0021] The present invention further relates to the use of the mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a biologically active fragment thereof, or the fusion protein of the present invention, for improving the resistance or tolerance of a plant to an HPPD-inhibiting herbicide.

[0022] The present invention further relates to a method for controlling weeds in a locus containing a plant or seed of the present invention without significantly affecting the plant, comprising applying a herbicidally effective amount of one or more HPPD-inhibiting herbicides to the locus containing the plant or seed of the present invention. [Brief explanation of the drawings]

[0023] [Figure 1] Figure 1 shows the color reaction of the medium of recombinant E. coli transformed with wild-type or mutant rice HPPD genes cultured in a 96-well plate. The recombinant E. coli expressed wild-type rice HPPD (WT) or one of the single-site mutant rice HPPDs. The recombinant E. coli produced metabolites of the herbicides tembotrione (left) or fenpyrazone (right, structural formula: [ka] ) and exhibit varying degrees of color change. In wells containing the same concentration of herbicide, the darker the color, the greater the resistance / tolerance to that herbicide.

[0024] [Figure 2] Figure 2 shows the color reaction of the medium containing recombinant E. coli transformed with wild-type or mutant rice HPPD genes cultured in a 96-well plate. The recombinant E. coli expressed either wild-type rice HPPD (WT) or one of the single-site mutant rice HPPD genes. The recombinant E. coli were cultured in medium containing various concentrations of the herbicide sipirafluon (left) or topramezone (right). The color reaction varied. In wells containing the same concentration of herbicide, the darker the color, the higher the resistance / tolerance to that herbicide.

[0025] [Figure 3] Figure 3 shows the color reaction of the medium containing recombinant E. coli transformed with wild-type or mutant rice HPPD genes cultured in a 96-well plate. The recombinant E. coli expressed wild-type rice HPPD (WT) or one of the single-site mutant rice HPPD genes. The recombinant E. coli were cultured in medium containing various concentrations of the herbicide mesotrione and showed varying degrees of color reaction. For wells containing the same concentration of herbicide, the darker the color, the higher the resistance / tolerance to that herbicide.

[0026] [Figure 4] Figure 4 shows the color reaction of the medium containing recombinant E. coli transformed with wild-type or mutant rice HPPD genes cultured in 96-well plates. The recombinant E. coli expressed wild-type rice HPPD (WT) or single-site mutant HPPD containing the H141R, G342D, or D370N mutations, or a combination thereof. The recombinant E. coli were cultured in medium containing various concentrations of the herbicide tembotrione (top) or a metabolite of fenpyrazone (bottom). The darker the color, the higher the resistance / tolerance to that herbicide.

[0027] [Figure 5] Figure 5 shows the color reaction of the medium of recombinant E. coli transformed with wild-type or mutant rice HPPD genes cultured in 96-well plates. The recombinant E. coli expressed wild-type rice HPPD (WT) or single-site mutant HPPD containing the mutations H141R, G342D, D370N, or their combinations (141 + 342 represents H141R / G342D, 141 + 370 represents H141R / D370N, 342 + 370 represents G342D / D370D; and 141 + 342 + 370 represents H141R / G342D / D370N). The recombinant E. coli were cultured in media containing various concentrations of the herbicide sipirafluon (top) or a metabolite of topramezone (bottom). The color reaction exhibited varying degrees of color change. For wells containing the same concentration of herbicide, the darker the color, the greater the resistance / tolerance to that herbicide.

[0028] [Figure 6] Figure 6 shows the color reaction of the medium containing recombinant E. coli transformed with wild-type or mutant rice HPPD genes cultured in a 96-well plate. The recombinant E. coli expressed wild-type rice HPPD (WT) or single-site mutant HPPD containing the H141R, G342D, or D370N mutations, or a combination thereof, in the medium. The recombinant E. coli were cultured in medium containing various concentrations of the herbicide mesotrione and exhibited varying degrees of color change. Within wells containing the same concentration of herbicide, the darker the color, the higher the resistance / tolerance to that herbicide.

[0029] [Figure 7] FIG. 7 shows all amino acid mutations found in the wild-type rice HPPD protein.

[0030] [Figure 8]Figure 8 shows the color reaction of the medium of recombinant E. coli transformed with the mutant rice HPPD gene cultured in a 96-well plate. The recombinant E. coli expressed mutant HPPD containing various combinations of mutations at adjacent positions 336-338-342-346 and the combination 141R+342D+370N (336D, 338D, 338S, 338Y, 342D, 346C, 346H, and 346S represent P336D, N338D, N338S, N338Y, G342D, R346C, R346H, and R346S, respectively; 141R+342D+370N represents H141R / G342D / D370N). The recombinant E. coli expressed a metabolite of the herbicide bipyrazone (code number 101, structural formula [ka] ) and exhibit varying degrees of color change. In wells containing the same concentration of herbicide, the darker the color, the greater the resistance / tolerance to that herbicide.

[0031] [Figure 9] Figure 9 shows the color reaction of the medium of recombinant E. coli transformed with the mutant rice HPPD gene cultured in a 96-well plate. The recombinant E. coli expressed mutant HPPD containing various combinations of mutations at three or four positions (141R, 336D, 338D, 338S, 338Y, 342D, 346C, 346S, 346H, 370N, 418P, and 419F represent H141R, P336D, N338D, N338S, N338Y, G342D, R346C, R346S, R346H, D370N, K418P, and G419F, respectively). The recombinant E. coli were cultured in media containing various concentrations of metabolites of the herbicide bipyrazone, and exhibited various degrees of color change. For wells containing the same concentration of herbicide, the darker the color, the greater the resistance / tolerance to that herbicide.

[0032] [Figure 10]Figure 10 shows the inhibition curves of OsHPPD wild-type and various mutants by bipyrazone metabolites. The horizontal axis represents the concentration of compound 101, and the vertical axis represents the residual activity of the enzyme at various concentrations of compound 101. The reaction rate at an inhibitor concentration of 0 is 100%, and the numbers in the figure represent the various mutation sites. The figure shows that the wild-type WT was extremely sensitive to compound 101, with activity completely inhibited at a concentration of approximately 60 μM of compound 101, and each mutant showed strongly enhanced resistance. Based on these results, IC50 values ​​representing the inhibition of activity of each mutant by compound 101 can be calculated, which similarly confirms that each mutant exhibits significantly improved resistance compared to wild-type OsHPPD (141R, 338D, 342D, 346C, 346H, 370N, 386T, 418P, 419F, and 420S represent H141R, N338D, G342D, R346C, R346H, D370N, P386T, K418P, G419F, and N420S, respectively).

[0033] [Figure 11] Figure 11 shows the sensitivity of transgenic rice (Zhonghua 11) to the HPPD-inhibiting herbicide tembotrione. Rice plants expressing the mutant OsHPPD3M (H141R / G342D / D370N) can maintain their green color in a medium containing 3 μM tembotrione. However, seedlings expressing mCherry (a negative control, CK) also bleach significantly in a medium containing 1.0 μM tembotrione (phytotoxicity).

[0034] [Figure 12]Figure 12 shows the tolerance of transgenic rice (Zhonghua 11) to the HPPD-inhibiting herbicide bipyrazone. T0 plants expressing the rice mutant OsHPPD3M are tolerant to 8–16 grams of the active ingredient bipyrazone per microgram (μm), whereas non-transgenic control plants (CK) die immediately after severe bleaching (A, B). T1 plants expressing the rice mutant OsHPPD3M are tolerant to 32–64 grams of the active ingredient bipyrazone per microgram (μm), whereas non-transgenic control plants die immediately after severe bleaching (C, D).

[0035] [Figure 13] Figure 13 shows a base editing vector for the rice HPPD gene.

[0036] [Figure 14] Figure 14 shows sequence analysis of base-edited rice seedlings and their target H141R (CAC>CGC). A: Base-edited seedlings: In medium containing 0.4 μM tembotrione, unsuccessfully edited seedlings turn white (phytotoxic), while successfully edited seedlings remain green. B: Base-edited target sequence: The amino acid at position 141 in wild-type rice HPPD is histidine (His) and the corresponding codon is CAC (top panel). After editing, the corresponding amino acid is arginine (Arg) and the corresponding codon is CGC (the example is a hybrid, showing a double peak).

[0037] [Figure 15] Figure 15 shows the structure of the rice hppd gene (Oshppd>NC029257.1), showing two exons, one intron, three mutation sites (141, 342, 370), and designed target cleavage sites (gRNA1-2, gRNA2-1).

[0038] [Figure 16]Figure 16 shows the structure of the template DNA. The length of the core substitution region of the three mutated amino acids 141-342-370 is 1056 bp. The length of the left and right homology arms is 350 bp each, with 6 bp left at the left and right ends after cleavage from the vector. The total length of the template is 1768 bp. The NcoI cleavage site has been removed to facilitate rapid genotyping of the PCR product after PCR amplification. The PAM (NGG) at the original cleavage site of the template is also removed to avoid re-cleavage after replacement.

[0039] [Figure 17] Figure 17 shows three homologously substituted mutation sites (H141R-G342D-D370N) in the rice HPPD gene. A: Seedlings in which the rice HPPD gene was edited: In a medium containing 0.4 μM tembotrione, the unedited seedlings (wild type WT) turned white (phytotoxic), while the successfully edited seedlings (two seedlings: AW2 and AW3) remained green. B: After homologous substitution, the codons corresponding to amino acids 342 and 370 were changed, i.e., GGC became GAC, and GAC became AAC (hybrid; resulting in partial G342D and D370N). H141R (CAC>CGC) was also successfully edited (sequence not shown). Detailed Description of the Invention

[0040] Some terms used herein are defined as follows:

[0041] In the present invention, the term "HPPD-inhibiting herbicide" refers to a substance that has herbicidal activity by itself or that is used in combination with other herbicides and / or additives that can modify its effect, and that may act by inhibiting HPPD. Substances capable of inhibiting HPPD and thereby exerting herbicidal activity are known in the art and include many types: 1) triketones, such as sulcotrione (CAS No.: 99105-77-8), mesotrione (CAS No.: 104206-82-8), bicyclopyrone (CAS No.: 352010-68-5), tembotrione (CAS No.: 335104-84-2), tefuryltrione (CAS No.: 473278-76-1), benzobicyclone (CAS No.: 156963-66-5); 2) diketonitriles, such as 2-cyano-3-cyclopropyl-1-(2-methylsulfonyl-4-trifluoromethylphenyl)propane-1,3-dione (CAS No.: 143701-75-1), 2-cyano-3-cyclopropyl-1-(2-methylsulfonyl-3,4-dichloro ... propane-1,3-dione (CAS number: 212829-55-5), 2-cyano-1-[4-(methylsulfonyl)-2-trifluoromethylphenyl]-3-(1-methylcyclopropyl)propane-1,3-dione (CAS number: 143659-52-3); 3) isoxazoles, such as isoxaflutole (CAS number: 141112-29-0); isoxachlorthole (CAS number: 1 41112-06-3), clomazone (CAS number: 81777-89-1); 4) pyrazoles, for example, topramezone (CAS number: 210631-68-8); pyrasulfotole (CAS number: 365400-11-9), pyrazoxyfen (CAS number: 71561-11-0); pyrazolate (CAS number: 58011-68-0), benzofenap (CAS number: 82692-44-2), bipyrazone (CAS number: 1622908-18-2), tolpyralate (CAS number: 1101132-67-5), Fenpyrazone (CAS number: 1992017-55-6), Sipirafluon(CAS No.: 1855929-45-1), Sanzuofankaoton (CAS No.: 1911613-97-2); 5) Benzophenone; 6) Others: Lancotrione (CAS No.: 1486617-21-3), Fenquinotrione (CAS No.: 1342891-70-6). Preferably, the herbicide is tembotrione, Fenpyrazone , Sipirafluon , topramezone, mesotrione, Bipyrazon Or any combination thereof.

[0042] A plant with "enhanced tolerance to HPPD-inhibiting herbicides" or "enhanced resistance to HPPD-inhibiting herbicides" refers to a plant that has higher resistance or tolerance to the HPPD-inhibiting herbicide compared to a plant with a wild-type HPPD gene. An HPPD enzyme with "enhanced tolerance to HPPD-inhibiting herbicides" or "enhanced resistance to HPPD-inhibiting herbicides" refers to an HPPD enzyme that exhibits enzymatic activity that is at least 10%, preferably at least 15%, and more preferably at least 20% higher than that of the wild-type HPPD enzyme at herbicide concentrations known to inhibit the activity of the corresponding wild-type HPPD enzyme protein. In the present invention, the terms "HPPD-inhibiting herbicide tolerance" and "HPPD-inhibiting herbicide resistance" are used interchangeably and both refer to tolerance to HPPD-inhibiting herbicides and resistance to HPPD-inhibiting herbicides.

[0043] The term "wild-type" refers to an existing nucleic acid molecule or protein found in nature.

[0044] The terms "protein," "polypeptide," and "peptide" can be used interchangeably herein and refer to polymers of amino acid residues, including polymers of chemical analogs in which one or more amino acid residues are naturally occurring amino acid residues. Proteins and polypeptides of the present invention can be recombinantly produced or chemically synthesized. The term "mutated protein" or "mutant protein" refers to a protein that has one or more amino acid residue substitutions, insertions, deletions, and / or additions compared to the amino acid sequence of the corresponding wild-type protein.

[0045] The terms "polynucleotide" and "nucleic acid" are used interchangeably and include either double-stranded or single-stranded DNA, RNA, or hybrids thereof.

[0046] In the present invention, the term "host organism" should be understood to mean any unicellular or multicellular organism into which a nucleic acid encoding a mutant HPPD protein can be introduced, including, for example, bacteria such as Eescherichia coli, fungi such as yeast (e.g., Saccharomyces cerevisiae), molds (e.g., Aspergillus), plant cells, plants, etc.

[0047] In the present invention, "plant" should be understood to mean any differentiated multicellular organism capable of photosynthesis, in particular a monocotyledonous or dicotyledonous plant, such as, for example: (1) food crops: rice species (Oryza spp.) such as Oryza sativa, Oryza latifolia, Oryza sativa, Oryza glaberrima; wheat species (Triticum spp.) such as Triticum aestivum, T. turgidum ssp. durum; barley species (Hordeum spp.) such as Hordeum vulgare, Hordeum arizonicum; Secale cereale; oat species (Avena spp.) such as Avena sativa, Avena fatua, Avena byzantine, Avena fatua var. sativa, Avena hybrida; barnyard millet species (Echinochloa spp.) such as Pennisetum glaucum; spp.), Sorghum, Sorghum bicolor, Sorghum vulgare, Triticale, Zea mays or Maize, Millet, Rice, Foxtail millet, Proso millet, Sorghum bicolor, Panicum, Buckwheat (Fagopyrum spp.), Panicum miliaceum, Setaria italica, Zizania palustris, Eragrostis tef, Panicum miliaceum, Eleusine coracana; (2) Legumes: Glycine spp., such as Glycine max, Soja hispida, and Soja max, Vicia spp., Vigna spp., Pisum spp., field bean, and Lupinus spp. spp.), Vicia, Tamarindus indica, Lens culinaris, Lathyrus spp., Lablab, broad bean, mung bean, adzuki bean (red bean, chickpea, (3) oil crops: Arachis hypogaea, Arachis spp., Sesamum spp., Helianthus spp. such as Helianthus annuus, Eiaeis guineensis, Elaeis spp. such as Elaeis oleifera, soybean, Brassica napus, Brassica oleracea, Sesamum orientale, Brassica juncea, oilseed rape, Camellia oleifera, oil palm, olive, castor oil plant, Brassica napus L., canola; (4) fiber crops: Agave (5) Fruit plants: Ziziphus spp., Cucumis spp., Passiflora edulis, Vitis spp., Vaccinium spp., Pyrus communis, Prunus spp., Psidium spp., Punica spp., Punica spp., Prunus communis, Prunus spp., Psidium spp., Punica spp. granatum, Malus spp., Citrullus lanatus, Citrus spp., Ficus carica, Fortunella spp., Fragaria spp., Crataegus spp., Diospyros spp., Eugenia unifora., Eriobotrya japonica, Dimocarpus longan, Carica papaya, Cocos spp., Averrhoa carambola, Actinidia spp., Prunus amygdalus, Musa spp. (Taiwan banana (musa acuminate)), Persea spp. (avocado (Persea Americana)), Psidium guajava, Mammea Americana, Mangifera indica, Canarium album (olive (Olea europaea)), Caricapapaya, Cocos nucifera, Malpighia emarginata, Manilkara zapota, Ananas comosus, Annona spp., Citrus reticulate (Citrus (5) Rhizome crops: Manihot spp., Ipomoea batatas, Colocasia esculenta, tuber mustard, Allium cepa (onion), Eleocharis tuberose (water chestnut), Cyperus rotundus, Rhizoma dioscoreae; (6) Vegetable crops: Spinacia spp., Phaseolus spp., Lactuca sativa, Momordica spp., Petroselinum crispum, Capsicum spp., Solanum spp. (Solanum tuberosum, Solanum integrifolium, Solanum lycopersicum, etc.), Tomato spp.persicon spp. (Lycopersicon esculentum, Lycopersicon lycopersicum, Lycopersicon pyriforme, etc.), Macrotyloma spp., kale, Luffa acutangula, lentils, okra, onion, potato, artichoke, asparagus, broccoli, Brussels sprouts, cabbage, carrot, cauliflower, celery, collard greens, pumpkin, Benincasa hispida, Asparagus officinalis, Apium graveolens, Amaranthus spp., Allium spp., Abelmoschus spp., Cichorium endivia, Cucurbita spp., Coriandrum sativum, B. carinata, Rapbanus sativus, Brassica spp. (Brassica napus, Brassica rapa ssp., canola, rapeseed, turnip rape, mustard, cabbage, black mustard, canola (Brassica napus), Brussels sprouts, Solanaceae (eggplant), Capsicum annuum (bell pepper), cucumber, loofah, Chinese cabbage, rapeseed, cabbage, bottle gourd, chive, lotus, lotus root, lettuce; (8) flower crops: Tropaeolum minus, Tropaeolum majus, Canna indica, Opuntia spp., Tagetes spp., Cymbidium (orchid), Crinum asiaticum L., Clivia Hippeastrum rutilum, Rosa rugosa, Rosa Chinensis, Jasminum sambac, Tulipa gesneriana L., Cerasus sp., Pharbitis nil (L.) Choisy, Calendula officinalis L., Nelumbo sp.)、Bellis perennis L., Dianthus caryophyllus, Petunia hybrida, Tulipa gesneriana L., Lilium brownie, Prunus mume, Narcissus tazetta L., Jasminum nudiflorum Lindl., Primula malacoides, Daphne odora, Camellia japonica, Michelia alba, Magnolia liliiflora, Viburnum macrocephalum, Clivia miniata, Malus spectabilis, Paeonia suffruticosa, Paeonia lactiflora, Syzygium aromaticum, Rhododendron simsii, Rhododendron hybridum, Michelia figo (Lour.) Spreng., Cercis chinensis, Kerria japonica, Weigela florida, Fructus forsythiae, Jasminum mesnyi, Parochetus communis, Cyclamen persicum Mill., Phalaenophsis hybrid, Dendrobium nobile, Hyacinthus orientalis, Iris tectorum Maxim, Zantedeschia aethiopica, Calendula officinalis, Hippeastrum rutilum, Begonia semperflorenshybr, Fuchsia hybrida, Begonia maculate Raddi, Geranium; (9) Medicinal crops: Carthamus tinctorius, Mentha spp.)、Rheum rhabarbarum, Crocus sativus, Lycium chinense, Polygonatum odoratum, Polygonatum Kingianum, Anemarrhena asphodeloides Bunge, Radix ophiopogonis, Fritillaria cirrhosa, Curcuma aromatica, Amomum villosum Lour., Polygonum multiflorum, Rheum officinale, Glycyrrhiza uralensis Fisch, Astragalus membranaceus, Panax ginseng, Panax notoginseng, Acanthopanax gracilistylus, Angelica sinensis, Ligusticum wallichii, Bupleurum sinenses DC., Datura stramonium Linn., Datura metel L., Mentha haplocalyx, Leonurus sibiricus L., Agastache rugosus, Scutellaria baicalensis, Prunella vulgaris L., Pyrethrum carneum, Ginkgo biloba L., Cinchona ledgeriana, Hevea brasiliensis (wild), Medicago sativa Linn, Piper Nigrum L.; (10) Raw material crops: Hevea brasiliensis, Ricinus communis, Vernicia fordii, Morus alba L., Hops Humulus lupulus, Betula, Alnus cremastogyne Burk., Rhus verniciflua stokes; (11) Forage crops: Agropyron spp., Trifolium spp., Miscanthus sinensis, Pennisetum sp.), Phalaris arundinacea, Panicum virgatum, prairiegrasses, Indiangrass, Big bluestem grass, Phleum pratense, Cyperaceae (Kobresia pygmaea, Carex pediformis, Carex humilis), Medicago sativa Linn, Phleum pratense L., Medicago sativa, Melilotus suavcolen, Astragalus sinicus, Crotalaria juncea, Sesbania cannabina, Azolla imbircata, Eichhornia crassipes, Amorpha fruticosa, Lupinus micranthus, Trifolium, Astragalus adsurgens pall, Pistia stratiotes linn, Alternanthera philoxeroides, Lolium; (12) Sugar crops: Saccharum spp., beet; (13) Beverage crops: Camellia sinensis, Camellia Sinensis, tea, coffee (Coffea spp.), Theobroma cacao, Humulus lupulus Linn.; (14) Turf plants: Ammophila arenaria, Poa spp. (Poa pratensis), Agrostis spp. (Agrostis matsumurae, Agrostis palustris), Lolium spp. (Lolium), Festuca spp. (Festuca ovina L.), Zoysia spp. spp.) (Zoysia japonica), Cynodon spp.) (Cynodon dactylon / Chippocampus grass), Stenotaphrum secundatum (Stenotaphrum secundatum), Paspalum spp., Eremochloa ophiuroides (Rough-legged grass), Xonopus spp. (Carpetweed), Bouteloua dactyloides (Landgrass), Bouteloua var. spp. (Blue grama (Bouteloua gracilis)), Digitaria sanguinalis, Cyperus rotundus, Kyllingabrevifolia, etc. (15) Tree crops: Pinus spp., Salix spp., Maple spp., Hibiscus spp., Eucalyptus spp., Ginkgo biloba, Bambusa spp., Populus spp., Prosopis spp., Quercus spp.; (16) Tree crops: Pinus spp., Salix spp., Maple spp., Hibiscus spp., Eucalyptus spp., Ginkgo biloba, Bambusa spp., Populus spp., Prosopis spp., Quercus spp. spp.), Phoenix spp., Fagus spp., Ceiba pentandra, Cinnamomum spp., Corchorus spp., Phragmites australis, Physalis spp., Desmodium spp. spp.), poplar, Hedera helix, Populus tomentosa Carr, Viburnum odoratissinum, Ginkgo biloba L., oak, Ailanthus altissima, Schima superba, Ilex pur-purea, Platanus acerifolia, ligustrum lucidum, Buxus megistophylla Levl., Dahurian larch, Acacia mearnsii, Pinus massoniana, Pinus khasys, Pinus yunnanensis, Pinus finlaysoniana, Pinus tabuliformis, Pinus koraiensis, Juglans nigra, Citrus limon, Platanus acerifolia, Syzygium jambos, Davidia involucrate, Bombax malabarica L., Ceiba pentandra (L.), Bauhinia blakeana, Albizia saman, Albizzia julibrissin, Erythrina corallodendron, Erythrina indica, Magnolia gradiflora, Cycas revolute, Lagerstroemia indica, Coniferales, Trees (macrophanerophytes), Shrubs (Frutex); (16) Nut crops: Bertholletia excelsea, Chestnut species (Castanea spp.), Hazel species (Corylus spp.), Pecan species (Carya spp.), Walnut species (Juglans spp.), Pistacia vera, Anacardium occidentale, Macadamia species (Macadamia integrifolia), Carya illinoensis Koch, Macadamia, pistachios, almonds, and other nut-producing plants; (17) Other: Arabidopsis thaliana, Brachiaria eruciformis, Cenchrus echinatus, Setaria faberi, Eleusine indica, Cadaba farinose, algae, Carex elata, ornamental plants, Carissa macrocarpa, Cynara spp., Daucus carota, Dioscorea spp., Erianthus spp., Festuca arundinacea, Hemerocallis fulva, Lotus spp., Luzula sylvatica, Medicago sativa, Melilotus spp., Morus nigra, Nicotiana spp. spp.), Olea spp., Ornithopus spp., Pastinaca sativa, Sambucus spp., Sinapis spp., Myrtles spp., Tripsacum dactylo. ides, Triticosecale rimpaui, Viola odorata, etc.

[0048] In the present invention, the term "plant tissue" or "plant part" includes plant cells, protoplasts, plant tissue cultures, plant callus, plant blocks, and plant embryos, pollen, ovules, seeds, leaves, stems, flowers, branches, seedlings, fruits, cores, spikes, roots, root tips, anthers, and the like.

[0049] In the present invention, "plant cell" should be understood to mean any cell derived from or found in a plant that is capable of forming undifferentiated tissue such as callus, differentiated tissue such as an embryo, plant part, plant or seed.

[0050] In the terminology used herein regarding amino acid substitutions, the first letter represents the naturally occurring amino acid at a particular position in a particular sequence, the number following it represents the position corresponding to SEQ ID NO: 2, and the second letter represents another amino acid that replaces the naturally occurring amino acid. For example, A103S represents a substitution of serine for alanine at position 103 in the amino acid sequence of SEQ ID NO: 2. For amino acid substitutions without a first letter, this means that the naturally occurring amino acid at a position corresponding to SEQ ID NO: 2 in the amino acid sequence of the wild-type protein is replaced with the amino acid represented by the second letter following the number. In the case of double or multiple mutations, each mutation is separated by a " / ". For example, H141R / G342D / D370N means that, relative to the amino acid sequence of SEQ ID NO: 2, histidine at position 141 is replaced with arginine, glycine at position 342 is replaced with aspartic acid, and aspartic acid at position 370 is replaced with asparagine, and all three mutations are present in the particular mutant HPPD protein.

[0051] In one embodiment, the present invention discloses a mutant HPPD protein or a biologically active fragment thereof, which has improved resistance or tolerance to HPPD-inhibiting herbicides compared to a wild-type p-hydroxyphenylpyruvate dioxygenase protein, while retaining the activity of catalyzing the conversion of p-hydroxyphenylpyruvate (HPP) to homogentisic acid. Specifically, the mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein of the present invention comprises one or more of the amino acids corresponding to positions 93, 103, 141, 165, 191, 220, 226, 276, 277, 336, 337, 338, 342, 346, 370, 377, 386, 390, 392, 403, 410, 418, 419, 420, 430, and 431 of the amino acid sequence of the wild-type rice p-hydroxyphenylpyruvate dioxygenase protein set forth in SEQ ID NO:2. At the above positions, the gene has one or more mutations selected from the group consisting of 93S, 103S, 141R, 141K, 141T, 165V, 191I, 220K, 226H, 276W, 277N, 336D, 337A, 338D, 338S, 338Y, 342D, 346C, 346D, 346H, 346S, 346Y, 370N, 377C, 386T, 390I, 392L, 403G, 410I, 418P, 419F, 419L, 419V, 420S, 420T, 430G and 431L. Preferably, the amino acid sequence of the mutant p-hydroxyphenylpyruvate dioxygenase protein has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID NO:2.More preferably, the mutant p-hydroxyphenylpyruvate dioxygenase protein has one or more amino acid residues corresponding to positions 93, 103, 141, 165, 191, 220, 226, 276, 277, 336, 337, 338, 342, 346, 370, 377, 386, 390, 392, 403, 410, 418, 419, 420, 430, and 431 of the amino acid sequence of the wild-type rice p-hydroxyphenylpyruvate dioxygenase protein set forth in SEQ ID NO:2, such as 93S, 103S, 141R ... , 141K, 141T, 165V, 191I, 220K, 226H, 276W, 277N, 336D, 337A, 338D, 338S, 338Y, 342D, 346C, 346D, 346H, 346S, 346Y, 370N, 377C, 386T, 390I, 392L, 403G, 410I, 418P, 419F, 419L, 419V, 420S, 420T, 430G and 431L.

[0052] In one embodiment, the amino acid sequence of the mutant p-hydroxyphenylpyruvate dioxygenase protein of the present invention has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence of the wild-type rice p-hydroxyphenylpyruvate dioxygenase protein represented by SEQ ID NO:2, and has at least 93, 103, 141, 165, 191, 220, 226, 276, 277, 336, 337, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, ​​383, 384, 385, 386, 387, 388, 389, 390, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, at one or more positions corresponding to positions 37, 338, 342, 346, 370, 377, 386, 390, 392, 403, 410, 418, 419, 420, 430, and 431, including 93S, 103S, 141R, 141K, 141T, 165V, 191I, 220K, 226H, 276W, 277N, 336D, 337A, 338 The compound has one or more amino acid mutations selected from the group consisting of D, 338S, 338Y, 342D, 346C, 346D, 346H, 346S, 346Y, 370N, 377C, 386T, 390I, 392L, 403G, 410I, 418P, 419F, 419L, 419V, 420S, 420T, 430G, and 431L.Preferably, the mutant p-hydroxyphenylpyruvate dioxygenase protein has one or more amino acids selected from the group consisting of R93S, A103S, H141R, H141K, H141R ... It has the amino acid sequence represented by SEQ ID NO: 2, except that it has one or more mutations selected from the group consisting of T, A165V, V191I, R220K, G226H, L276W, P277N, P336D, P337A, N338D, N338S, N338Y, G342D, R346C, R346D, R346H, R346S, R346Y, D370N, I377C, P386T, L390I, M392L, E403, K418P, G419F, G419L, G419V, N420S, N420T, E430G and Y431L.

[0053] Specific amino acid positions (numbering) within a protein of the present invention are determined by aligning the amino acid sequence of the protein of interest with SEQ ID NO: 2 using a standard sequence alignment tool. For example, the Smith-Waterman algorithm or the Clustal W2 algorithm is used to align the two sequences, and these sequences are considered aligned if they have the highest alignment score. The alignment score can be calculated by the method described in Wilbur, WJ and Lipman, DJ (1983), "Rapid similarity searches of nucleic acid and protein data banks," Proc. Natl. Acad. Sci. USA, 80: 726-730. The default parameters used in the Clustal W2 (1.82) algorithm are preferably: protein gap opening penalty = 10.0; protein gap extension penalty = 0.2; protein matrix = Gonnet; protein / DNA end gap = -1; and protein / DNA GAPDIST = 4.

[0054] Preferably, the position of a specific amino acid in a protein of the invention is determined by aligning the amino acid sequence of the protein with SEQ ID NO: 2 using the AlignX program (part of the Vector NTI suite) matching default parameters for multiple alignment (gap opening penalty: 10og, gap extension penalty: 0.05).

[0055] Amino acid sequence identity can be determined by conventional methods, for example, by querying a computer algorithm using the default parameters of Smith and Waterman (1981, Adv. Appl. Math. 2: 482, Pearson & Lipman, 1988, Proc. Natl. Acad. Sci. USA 85: 2444), Thompson et al. (1994, Nucleic Acids Res 22: 467380, etc.), by computer processing (GAP, BESTFIT, FASTA, and TFASTA, Genetics Computer Group in the Wisconsin Genetics software package), or by using the BLAST algorithm (Altschul et al., 1990, Mol. Biol. 215: 403-10) available from the National Center for Biotechnology Information www.ncbi.nlm.nih.gov / ).

[0056] In a further embodiment, the mutant p-hydroxyphenylpyruvate dioxygenase protein of the invention has the amino acid sequence set forth in SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:32, SEQ ID NO:34, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO:46, SEQ ID NO:48, SEQ ID NO:50, SEQ ID NO:52, SEQ ID NO:54, SEQ ID NO:56, SEQ ID NO:58, SEQ ID NO:60, SEQ ID NO:62, SEQ ID NO:64, SEQ ID NO:66, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:72, SEQ ID NO:74, SEQ ID NO:76, SEQ ID NO:78, SEQ ID NO:80, SEQ ID NO:82 or SEQ ID NO:84.

[0057] In a further embodiment, the mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein of the present invention has the following amino acid mutations in its amino acid sequence: H141R / G342D, H141R / D370N, G342D / D370N, H141R / N338D, H141R / G342D, N338D / G342D, K418P / G419F, G419F / N420S, G342D / R346C, G342D / R346H, H141R / N420S, G338D / K418P, P277N / N338D, L276W / P2 77N, H141R / G342D / D370N, H141R / N338D / N420S, H141R / N338S / N420S, P33 6D / N338D / G342D, P336D / N338S / G342D, P336D / N338Y / G342D, N338D / G342D / R346C, N338D / G342D / R346H, N338D / G342D / R346S, N338S / G342D / R346C, N 338S / G342D / R346H, N338S / G342D / R346S, N338Y / G342D / R346C, N338Y / G34 2D / R346H, N338Y / G342D / R346S, P336D / G342D / R346C, P336D / G342D / R346 H, P336D / G342D / R346S, P336D / N338D / R346C, P336D / N338D / R346H, P336D / N338D / R346S, P336D / N338S / R346C, P336D / N338S / R346H, P336D / N338S / R3 46S, P336D / N338Y / R346C, P336D / N338Y / R346H, P336D / N338Y / R346S, H141 R / N338D / G342D, H141R / G342D / K418P, H141R / G342D / G419F, H141R / G342D / P386T, K418P / G419F / N420T, K418T / G419F / N420T, H141R / G342D / R346C, H1 41R / G342D / R346H, H141R / G342D / N420S, H141R / G342D / P277N, H141R / G342 D / P336D, H141R / G342D / L276W, H141R / G342D / R346S, H141R / G342D / L390I,H141R / G342D / I377C, H141R / G342D / M392L, H141R / P337A / G342D, H141R / N338S / G342D, H141R / N338Y / G342D, P277N / N338D / G342D, P277N / G342D / R346C, P277N / N338D / N420S, N338D / G342D / K418P, H141R / N338D / G342D / K418P, H141R / N338D / G342D / G419F, H141R / N338D / G342D / P386T, H141R / N338D / G342D / R346C, H141R / N338D / G342D / R346H, H141R / G342D / K418P / G419F, H141R / G342D / L276W / P277N, P336D / N338D / G342D / R346C, P336D / N338D / G342D / R346H, P336D / N338D / G342D / R346S, P336D / N338S / G342D / R346C, P336D / N338S / G342D / R346H, P336D / N338S / G342D / R346S, P336D / N 338Y / G342D / R346C, P336D / N338Y / G342D / R346H, P336D / N338Y / G342D / R 346S, P277N / P336D / N338D / G342D, P277N / N338D / G342D / R346C, P277N / N 338D / K418P / G419F, H141R / N338D / G342D / K418P / G419F, H141R / N338D / G 342D / G419F / N420S, H141R / G336D / G342D / K418P / G419F / N420S, H141R / N 338D / G342D / K418P / G419F / N420S, H141R / N338D / G342D / K418P / G419F / N420T, H141R / N338D / G342D / R346C / K418P / G419F / N420S, H141R / N338D / G342D / R346H / K418P / G419F / N420S, H141R / P277N / N338D / G342D / K418P / G419F / N420S or H141R / P277N / P336D / N338D / G342D / K418P / G419F / N420S.,

[0058] In yet another embodiment, the mutant p-hydroxyphenylpyruvate dioxygenase protein of the invention is selected from the group consisting of SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:30, SEQ ID NO:86, SEQ ID NO:88, SEQ ID NO:90, SEQ ID NO:92, SEQ ID NO:94, SEQ ID NO:96, SEQ ID NO:98, SEQ ID NO:100, SEQ ID NO:102, SEQ ID NO:104, SEQ ID NO:106, SEQ ID NO:108, SEQ ID NO:110, SEQ ID NO:112, SEQ ID NO:114, SEQ ID NO:116, SEQ ID NO:118, SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:128, SEQ ID NO:130, SEQ ID NO:132, SEQ ID NO:134, SEQ ID NO:136, SEQ ID NO:138, SEQ ID NO:140, SEQ ID NO:142, SEQ ID NO:144, SEQ ID NO:146, SEQ ID NO:148, SEQ ID NO:150, SEQ ID NO:152, SEQ ID NO:154, SEQ ID NO:156, SEQ ID NO:158, SEQ ID NO:160, SEQ ID NO:162, SEQ ID NO:164, 166, SEQ ID NO: 168, SEQ ID NO: 170, SEQ ID NO: 172, SEQ ID NO: 174, SEQ ID NO: 176, SEQ ID NO: 178, SEQ ID NO: 180, SEQ ID NO: 182, SEQ ID NO: 184, SEQ ID NO: 186, SEQ ID NO: 188, SEQ ID NO: 190, SEQ ID NO: 192, SEQ ID NO: 194, SEQ ID NO: 196, SEQ ID NO: 198, SEQ ID NO: 200, SEQ ID NO: 202, SEQ ID NO: 204, SEQ ID NO: 206, SEQ ID NO: 208, SEQ ID NO: 210, SEQ ID NO: 212, SEQ ID NO: 214, SEQ ID NO: 216, SEQ ID NO: 218, SEQ ID NO: 220, SEQ ID NO: 222, SEQ ID NO: 224, SEQ ID NO: 226, SEQ ID NO: 228, SEQ ID NO: 230, SEQ ID NO: 232, SEQ ID NO: 234, SEQ ID NO: 236, SEQ ID NO: 238, SEQ ID NO: 240, SEQ ID NO: 242, SEQ ID NO: 244, SEQ ID NO: 246, SEQ ID NO: 248, SEQ ID NO: 250, SEQ ID NO: 252, SEQ ID NO: 254, SEQ ID NO: 256, SEQ ID NO: 258 or SEQ ID NO: 260.

[0059] In the present invention, the wild-type p-hydroxyphenylpyruvate dioxygenase protein may be derived from any plant, particularly the aforementioned monocotyledonous or dicotyledonous plants. The sequences of several wild-type p-hydroxyphenylpyruvate dioxygenase proteins from other sources and their coding sequences are disclosed in the prior art documents incorporated herein by reference.

[0060] Preferably, the wild-type p-hydroxyphenylpyruvate dioxygenase protein of the present invention is derived from Oryza species, particularly Oryza sativa. More preferably, the wild-type p-hydroxyphenylpyruvate dioxygenase protein has an amino acid sequence set forth in SEQ ID NO:2 or at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID NO:2.

[0061] It will also be clear to those skilled in the art that the structure of a protein can be altered without adversely affecting its activity and functionality, for example, one or more conservative amino acid substitutions can be introduced into the amino acid sequence of a protein without adversely affecting the activity and / or three-dimensional structure of the protein molecule.Those skilled in the art will be familiar with examples and embodiments of conservative amino acid substitutions.Specifically, an amino acid residue at a specific site can be substituted with another amino acid residue belonging to the same group as the substituted amino acid, that is, a non-polar amino acid residue can be substituted with another non-polar amino acid residue, a polar uncharged amino acid residue can be substituted with another polar uncharged amino acid residue, a basic amino acid residue can be substituted with another basic amino acid residue, and an acidic amino acid residue can be substituted with an acidic amino acid residue.As long as the substitution does not impair the biological activity of the protein, conservative substitutions in which an amino acid is substituted with another amino acid belonging to the same group are within the scope of the present invention.

[0062] Therefore, the mutant HPPD proteins of the present invention may further contain one or more other mutations, such as conservative substitutions, in addition to the above mutations in the amino acid sequence. Furthermore, the present invention also encompasses mutant HPPD proteins that further contain one or more other non-conservative substitutions, so long as the non-conservative substitutions do not significantly affect the desired functions and biological activities of the proteins of the present invention.

[0063] As is known in the art, one or more amino acid residues may be deleted from the N-terminus and / or C-terminus of a protein while still retaining its function and activity. Therefore, in another aspect, the present invention also relates to a fragment of a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein in which one or more amino acid residues have been deleted from the N-terminus and / or C-terminus while retaining the desired function and activity. Within the scope of the present invention, a fragment is referred to as a biologically active fragment. In the present invention, the term "biologically active fragment" refers to a portion of a mutant HPPD protein of the present invention that retains the biological activity of the mutant HPPD protein of the present invention and has improved resistance or tolerance to HPPD inhibitors compared to an HPPD fragment without the mutation. For example, a biologically active fragment of a mutant HPPD protein may be a biologically active fragment that lacks one or more (e.g., 1-50, 1-25, 1-10, or 1-5, e.g., 1, 2, 3, 4, or 5) amino acid residues at the N-terminus and / or C-terminus of the protein but retains the desired biological activity of the full-length protein.

[0064] The present invention also provides a fusion protein comprising a mutant HPPD protein of the present invention or a biologically active fragment thereof and an additional component fused thereto. In one preferred embodiment, the additional component is a plastid-targeting peptide, such as a chloroplast-targeting peptide that enables the mutant HPPD protein to target chloroplasts. In another embodiment, the additional component is a tag peptide, such as 6xHis. In yet another embodiment, the additional component is a peptide that contributes to increasing the solubility of the mutant HPPD protein, such as a NusA peptide.

[0065] In yet another aspect, the present invention provides an isolated polynucleotide comprising a nucleic acid sequence encoding the mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a biologically active fragment thereof, or a complementary sequence thereof. The term "isolated" polynucleotide means that the polynucleotide is substantially free of components that normally accompany it in its naturally occurring environment. In one embodiment, the amino acid sequence of the mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID NO:2, and is 93, 103, 141, 165, 191, 220, 226, 276, 277, 336, 337, 338, 342, 346, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, ​​383, 384, 385, 386, 387, 388, 389, 390, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 4 and further comprising one or more amino acid mutations at one or more positions corresponding to positions 77, 386, 390, 392, 403, 410, 418, 419, 420, 430, and 431 selected from the group consisting of 93S, 103S, 141R, 141K, 141T, 165V, 191I, 220K, 226H, 276W, 277N, 336D, 337A, 338D, 338S, 338Y, 342D, 346C, 346D, 346H, 346S, 346Y, 370N, 377C, 386T, 390I, 392L, 403G, 410I, 418P, 419F, 419L, 419V, 420S, 420T, 430G, and 431L. More preferably, the mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or biologically active fragment thereof is derived from a rice HPPD protein and has one or more amino acid substitutions selected from those described above.

[0066] It will be clear to those skilled in the art that due to the degeneracy of the genetic code, various different nucleic acid sequences can encode the amino acid sequences disclosed herein.Those skilled in the art can generate additional nucleic acid sequences that encode the same protein, and therefore the present invention encompasses nucleic acid sequences that encode the same amino acid sequence due to the degeneracy of the genetic code.For example, to achieve high expression of heterologous genes in host organisms such as plants, genes can be optimized using codons that are preferred by the host for better expression.

[0067] Thus, in some embodiments, the polynucleotide of the invention is: (1): SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, No. 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, SEQ ID NO: 140, SEQ ID NO: 142, SEQ ID NO: 144, SEQ ID NO: No. 146, SEQ ID NO: 148, SEQ ID NO: 150, SEQ ID NO: 152, SEQ ID NO: 154, SEQ ID NO: 156, SEQ ID NO: 158, SEQ ID NO: 160, SEQ ID NO: 162, SEQ ID NO: 164, SEQ ID NO: 166, SEQ ID NO: 168, SEQ ID NO: 170, SEQ ID NO: 172, SEQ ID NO: 174, SEQ ID NO: 176, SEQ ID NO: 178, SEQ ID NO: 180, SEQ ID NO: 182, SEQ ID NO: 184, SEQ ID NO: 186, SEQ ID NO: 188, SEQ ID NO: 190, SEQ ID NO: 192, SEQ ID NO: 194, SEQ ID NO: 196, SEQ ID NO: 198, SEQ ID NO: 200, SEQ ID NO: 202, SEQ ID NO: 204, SEQ ID NO: 206, SEQ ID NO: a nucleic acid sequence encoding the amino acid sequence represented by SEQ ID NO:208, SEQ ID NO:210, SEQ ID NO:212, SEQ ID NO:214, SEQ ID NO:216, SEQ ID NO:218, SEQ ID NO:220, SEQ ID NO:222, SEQ ID NO:224, SEQ ID NO:226, SEQ ID NO:228, SEQ ID NO:230, SEQ ID NO:232, SEQ ID NO:234, SEQ ID NO:236, SEQ ID NO:238, SEQ ID NO:240, SEQ ID NO:242, SEQ ID NO:244, SEQ ID NO:246, SEQ ID NO:248, SEQ ID NO:250, SEQ ID NO:252, SEQ ID NO:254, SEQ ID NO:256, SEQ ID NO:258 or SEQ ID NO:260, or a complementary sequence thereof;(2) SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO:75, SEQ ID NO:77, SEQ ID NO:79, SEQ ID NO:81, SEQ ID NO:83, SEQ ID NO:85, SEQ ID NO:87, SEQ ID NO:89, SEQ ID NO:91, SEQ ID NO:93, SEQ ID NO:95, SEQ ID NO:97, SEQ ID NO:99, SEQ ID NO:101, SEQ ID NO:103, SEQ ID NO:105, SEQ ID NO:107, SEQ ID NO:109, SEQ ID NO:111, SEQ ID NO:113, SEQ ID NO:115, SEQ ID NO:117, SEQ ID NO:119, SEQ ID NO:121, SEQ ID NO:123, SEQ ID NO:125, SEQ ID NO:127, SEQ ID NO:129, SEQ ID NO:131, SEQ ID NO:133, SEQ ID NO:135, SEQ ID NO:137, SEQ ID NO: No. 139, SEQ ID NO:141, SEQ ID NO:143, SEQ ID NO:145, SEQ ID NO:147, SEQ ID NO:149, SEQ ID NO:151, SEQ ID NO:153, SEQ ID NO:155, SEQ ID NO:157, SEQ ID NO:159, SEQ ID NO:161, SEQ ID NO:163, SEQ ID NO:165, SEQ ID NO:167, SEQ ID NO:169, SEQ ID NO:171, SEQ ID NO:173, SEQ ID NO:175, SEQ ID NO:177, SEQ ID NO:179, SEQ ID NO:181, SEQ ID NO:183, SEQ ID NO:185, SEQ ID NO:187, SEQ ID NO:189, SEQ ID NO:191, SEQ ID NO:193, SEQ ID NO:195, SEQ ID NO:197, SEQ ID NO:199, SEQ ID NO: a nucleic acid sequence represented by SEQ ID NO: 201, SEQ ID NO: 203, SEQ ID NO: 205, SEQ ID NO: 207, SEQ ID NO: 209, SEQ ID NO: 211, SEQ ID NO: 213, SEQ ID NO: 215, SEQ ID NO: 217, SEQ ID NO: 219, SEQ ID NO: 221, SEQ ID NO: 223, SEQ ID NO: 225, SEQ ID NO: 227, SEQ ID NO: 229, SEQ ID NO: 231, SEQ ID NO: 233, SEQ ID NO: 235, SEQ ID NO: 237, SEQ ID NO: 239, SEQ ID NO: 241, SEQ ID NO: 243, SEQ ID NO: 245, SEQ ID NO: 247, SEQ ID NO: 249, SEQ ID NO: 251, SEQ ID NO: 253, SEQ ID NO: 255, SEQ ID NO: 257 or SEQ ID NO: 259;or their complementary sequences; (3) a nucleic acid sequence that hybridizes under stringent conditions to the sequence set forth in (1) or (2); and (4) A nucleic acid sequence that encodes the same amino acid sequence as the sequence shown in (1) or (2) due to the degeneracy of the genetic code, or a complementary sequence thereof. The nucleic acid sequence is selected from:

[0068] More preferably, the polynucleotides of the present invention are: SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:33, SEQ ID NO:35, SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:45, SEQ ID NO:47, SEQ ID NO:49, SEQ ID NO:51, SEQ ID NO:53, SEQ ID NO:55, SEQ ID NO:57, SEQ ID NO:59, SEQ ID NO:61, SEQ ID NO:63, SEQ ID NO:65, SEQ ID NO: No. 67, SEQ ID NO:69, SEQ ID NO:71, SEQ ID NO:73, SEQ ID NO:75, SEQ ID NO:77, SEQ ID NO:79, SEQ ID NO:81, SEQ ID NO:83, SEQ ID NO:85, SEQ ID NO:87, SEQ ID NO:89, SEQ ID NO:91, SEQ ID NO:93, SEQ ID NO:95, SEQ ID NO:97, SEQ ID NO:99, SEQ ID NO:101, SEQ ID NO:103, SEQ ID NO:105, SEQ ID NO:107, SEQ ID NO:109, SEQ ID NO:111, SEQ ID NO:113, SEQ ID NO:115, SEQ ID NO:117, SEQ ID NO:119, SEQ ID NO:121, SEQ ID NO:123, SEQ ID NO:125, SEQ ID NO:127, SEQ ID NO:129, SEQ ID NO:131, SEQ ID NO: SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137, SEQ ID NO: 139, SEQ ID NO: 141, SEQ ID NO: 143, SEQ ID NO: 145, SEQ ID NO: 147, SEQ ID NO: 149, SEQ ID NO: 151, SEQ ID NO: 153, SEQ ID NO: 155, SEQ ID NO: 157, SEQ ID NO: 159, SEQ ID NO: 161, SEQ ID NO: 163, SEQ ID NO: 165, SEQ ID NO: 167, SEQ ID NO: 169, SEQ ID NO: 171, SEQ ID NO: 173, SEQ ID NO: 175, SEQ ID NO: 177, SEQ ID NO: 179, SEQ ID NO: 181, SEQ ID NO: 183, SEQ ID NO: 185, SEQ ID NO: 187, SEQ ID NO: 189, SEQ ID NO: 191, SEQ ID NO: 193, Column number 195, SEQ ID NO: 197, SEQ ID NO: 199, SEQ ID NO: 201, SEQ ID NO: 203, SEQ ID NO: 205, SEQ ID NO: 207, SEQ ID NO: 209, SEQ ID NO: 211, SEQ ID NO: 213, SEQ ID NO: 215, SEQ ID NO: 217, SEQ ID NO: 219, SEQ ID NO: 221, SEQ ID NO: 223, SEQ ID NO: 225, SEQ ID NO: 227, SEQ ID NO: 229, SEQ ID NO: 231, SEQ ID NO: 233, SEQ ID NO: 235, SEQ ID NO: 237, SEQ ID NO: 239, SEQ ID NO: 241, SEQ ID NO: 243, SEQ ID NO: 245, SEQ ID NO: 247, SEQ ID NO: 249, SEQ ID NO: 251, SEQ ID NO: 253, SEQ ID NO: 255,A nucleic acid sequence represented by SEQ ID NO: 257 or SEQ ID NO: 259, or a complementary sequence thereof; The nucleic acid sequence is selected from:

[0069] Preferably, stringent conditions refer to conditions of 6 M urea, 0.4% SDS, and 0.5×SSC, or equivalent hybridization conditions, and also refer to conditions of higher stringency, such as 6 M urea, 0.4% SDS, 0.1×SSC, or equivalent hybridization conditions. In various conditions, the temperature may be greater than about 40° C., and for example, when higher stringency conditions are required, the temperature may be, for example, about 50° C. or even about 65° C.

[0070] More preferably, the wild-type and mutant codons corresponding to the amino acid mutation sites are as shown in the following chart: [Table 1] TIFF0007785536000004.tif42150

[0071] The present invention also provides a nucleic acid construct comprising a nucleic acid sequence encoding a mutant p-hydroxyphenylpyruvate dioxygenase protein of the present invention, or a biologically active fragment thereof, or a fusion protein thereof, and one or more regulatory elements operably linked thereto. As used herein, the term "regulatory element" refers to a nucleic acid sequence capable of regulating the transcription and / or translation of a nucleic acid operably linked thereto.

[0072] The regulatory element may be a suitable promoter sequence recognized by the host cell for expression of the nucleic acid sequence encoding the protein of the present invention. The promoter sequence includes a transcriptional regulatory sequence that mediates protein expression. The promoter may be any nucleotide sequence that exhibits transcriptional activity in the selected host cell, including mutant promoters, truncated promoters, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides that are homologous or heterologous to the host cell gene. The promoter expressed in plant cells or plants may be a naturally occurring promoter of p-hydroxyphenylpyruvate dioxygenase or a heterologous promoter active in plants. The promoter may be one that confers constitutive or inducible expression. Examples of promoters include histone promoters, rice actin promoters, and plant virus promoters such as the cauliflower mosaic virus promoter.

[0073] The regulatory element may also be a suitable transcription terminator sequence recognized by the host cell to terminate transcription. The terminator sequence is operably linked to the 3' end of the nucleic acid sequence encoding the protein of the present invention. Any terminator that functions in the selected host cell can be used in the present invention.

[0074] The regulatory element may also be a suitable leader sequence, i.e., a non-translated region of an mRNA that is important for translation in the host cell. The leader sequence is operably linked to the 5' end of the nucleic acid sequence encoding the protein of the present invention. Any leader sequence that is functional in the host cell of choice can be used in the present invention.

[0075] The regulatory element may also be a polyadenylation sequence, i.e., a sequence operably linked to the 3' end of the nucleic acid sequence that is recognized by the host cell during transcription as a signal for the addition of polyadenylic acid residues to the transcribed mRNA. Any polyadenylation sequence that is functional in the host cell of choice may be used in the present invention.

[0076] A regulatory element can also be a signal peptide coding region that encodes an amino acid sequence linked to the amino terminus of a protein and directs the encoded protein into the secretory pathway within the cell. The 5' end of the coding sequence of the nucleic acid sequence may substantially contain a signal peptide coding region that is naturally linked to the coding region encoding the secreted polypeptide in translation reading frame. Alternatively, the 5' end of the coding sequence may contain a signal peptide coding region that is foreign to the coding sequence. If the coding sequence does not naturally contain a signal peptide coding region, a foreign signal peptide coding region is required. Alternatively, the foreign signal peptide coding region may simply replace the natural signal peptide coding region to promote secretion of the polypeptide. In any case, any signal peptide coding region that directs an expressed polypeptide into the secretory pathway of a selected host cell, i.e., secretes the polypeptide into the culture medium, can be used in the present invention.

[0077] Regulatory sequences that allow the expression of the polypeptide to be regulated according to the growth of the host cell can also be suitably added. Regulatory systems include, for example, the lac, tec, and tip operon systems, the ADH2 system, or GAL1, which allow gene expression to be turned on or off in response to chemical or physical stimuli (including the presence of regulatory compounds). Other examples of regulatory sequences are those that allow gene amplification. In eukaryotic systems, these include the dihydrofolate reductase gene, which is amplified in the presence of methotrexate, and the metallothionein gene, which is amplified due to heavy metals. In these cases, the nucleotide sequence encoding the polypeptide would be operably linked to a regulatory sequence.

[0078] In the present invention, the regulatory element may also be a transcriptional activator, i.e., an enhancer, such as the tobacco mosaic virus translational activator described in WO 87 / 07644, or an intron, such as the maize adh1 intron, the maize bronze 1 gene intron, or the rice actin intron 1, which can enhance the expression of the mutant HPPD protein of the present invention, its biologically active fragment, or fusion protein in transgenic plants.

[0079] The present invention also provides an expression vector comprising a nucleic acid sequence encoding the mutant p-hydroxyphenylpyruvate dioxygenase protein of the present invention or a biologically active fragment thereof, or a fusion protein thereof, and an expression regulatory element operably linked thereto. The expression vector also comprises at least one origin of replication for autonomous replication. The choice of vector generally depends on the compatibility of the vector with the host cell into which it will be introduced. The vector may be an autonomously replicating vector, i.e., a vector that exists as an extrachromosomal entity, whose replication is independent of chromosomal replication, such as a plasmid, extrachromosomal element, minichromosome, or artificial chromosome. The vector may contain any element that ensures autonomous replication. Alternatively, the vector may be a vector that, upon introduction into a host cell, integrates into the host cell's genome and replicates together with the chromosome into which it is integrated. Furthermore, a single vector or plasmid, or two or more vectors or plasmids containing the entire DNA or transposon to be introduced into the host cell's genome, may be used. Alternatively, the vector may be a vector for gene editing of the host cell's endogenous HPPD gene.

[0080] Vectors may be plasmids, viruses, cosmids, phages, etc., which are known to those skilled in the art and have been extensively described in the technical field. Preferably, the expression vector of the present invention is a plasmid. The expression vector may contain a promoter, a ribosome binding site for translation initiation, a polyadenylation site, a transcription terminator, an enhancer, etc. Examples of such selectable markers include a gene encoding dihydrofolate reductase, a gene conferring resistance to neomycin, a gene conferring resistance to tetracycline or ampicillin, etc.

[0081] The vectors of the present invention may contain elements that enable integration of the vector into the genome of a host cell or autonomous replication independent of the cell's genome. For integration into the genome of a host cell, the vector may rely on a polynucleotide sequence encoding a polynucleotide or any other element of the vector to be appropriately integrated into the genome by homologous or non-homologous recombination. Alternatively, the vector may contain additional nucleotide sequences to direct integration of the vector by homologous recombination at a precise chromosomal location in the host cell's genome. To increase the likelihood of integration at a precise location, the integration elements should preferably contain a sufficient number of nucleic acids, such as 100-10,000 base pairs, preferably 400-10,000 base pairs, and more preferably 800-10,000 base pairs, that have a high degree of identity with the corresponding target sequence to increase the likelihood of homologous recombination. Integration elements can be any sequence homologous to a target sequence in the genome of the host cell. Furthermore, integration elements can be non-coding or coding nucleotide sequences. In another embodiment, the vector can be integrated into the genome of the host cell by non-homologous recombination. In the case of autonomous replication, the vector may further comprise a replication origin that allows the vector to replicate autonomously in a host cell. The replication origin may be any plasmid replicon that mediates autonomous replication and functions in a cell. The term "replication origin" or "plasmid replicon" is defined herein as a nucleotide sequence that allows a plasmid or vector to replicate in vivo.

[0082] The polynucleotide having multiple copies of the present invention is inserted into a host cell to increase the yield of gene product.Increasing the number of polynucleotide copies can be achieved by integrating at least one additional copy of the sequence into the genome of the host cell, or by combining the polynucleotide with an amplifiable selectable marker gene.In the latter case, cells containing the amplified copy of the selectable marker gene and the additional copy of the polynucleotide can be screened by artificially culturing the cells in the presence of an appropriate selectable agent.

[0083] The nucleic acid sequences of the present invention can be inserted into a vector by a variety of methods, for example, by digestion of the insert and vector with appropriate restriction endonucleases, followed by ligation. A variety of cloning techniques are known in the art and are within the knowledge of one of ordinary skill in the art.

[0084] Suitable vectors for use in the present invention include commercially available plasmids, such as, but not limited to, pBR322 (ATCC 37017), pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden), GEM1 (Promega Biotec, Madison, Wisconsin, USA), pQE70, pQE60, pQE-9 (Qiagen), pD10, psiX174, and pBluescript II. Examples include KS, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene), ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia), pKK232-8, pCM7, pSV2CAT, pOG44, pXT1, pSG (Stratagene), pSVK3, pBPV, pMSG and pSVL (Pharmacia).

[0085] The present invention also provides host cells containing the nucleic acid sequences, nucleic acid constructs, or expression vectors of the present invention. The vectors of the present application are introduced into host cells so that the vector exists as part of a chromosomal component, as an extrachromosomal vector for autonomous replication as described above, or so that the vector can genetically edit an endogenous HPPD gene in the host cell. The host cell can be any host cell known to those skilled in the art, including prokaryotic and eukaryotic cells such as bacteria, fungi, yeast, mammalian, insect, or plant cells, including Escherichia coli (E. coli), Streptomyces, Bacillus subtilis, Salmonella typhimurium, Pseudomonas, Streptomyces, Staphylococcus, Spodoptera Sf9, CHO, COS, etc. Those skilled in the art are able to select an appropriate host cell.

[0086] As used herein, the term "host cell" also encompasses any progeny of a parent cell that is not completely identical to the parent cell due to mutations that occur during replication.

[0087] The nucleic acid sequence, nucleic acid construct or expression vector of the present invention can be introduced into host cells by various techniques, including transformation, transfection, transduction, viral infection, gene gun or Ti-plasmid mediated gene delivery, calcium phosphate transfection, DEAE-dextran mediated transfection, lipofection or electroporation, etc. (See Davis, L., Dibner, M., Battey, I., Basic Methods in Molecular Biology, 1986).

[0088] In certain embodiments, the mutant HPPD proteins of the present invention can be targeted to plastids in plants, such as chloroplasts. This can be achieved by ligating a nucleic acid sequence encoding the mutant HPPD proteins of the present invention in the reading frame of a nucleic acid sequence encoding a plastid-inducing peptide, such as a chloroplast-inducing peptide, or by directly transforming a polynucleotide, nucleic acid construct, or expression vector of the present invention into the chloroplast genome of a plant cell. Those skilled in the art will recognize vectors and methods that can be used to transform the chloroplast genome of a plant cell. For example, the nucleic acid sequence encoding the mutant HPPD proteins of the present invention can be integrated into target plant leaves by ion bombardment with DNA-coated ions, homologous recombination, or non-homologous recombination.

[0089] If necessary, the transformed host cells may be cultured in conventional nutrient media. After transforming suitable host cells and culturing the host cells to an appropriate cell density, the selected promoter may be induced by an appropriate method, such as temperature shift or chemical induction, and the cells may be cultured for an additional period of time with the mutant HPPD protein or biologically active fragment thereof, or fusion protein of the present invention.

[0090] Therefore, the present invention also relates to a method for producing a mutant HPPD protein or a biologically active fragment thereof, or a fusion protein of the present invention, comprising: (a) culturing the host cell under conditions that promote the production of the mutant HPPD protein or a biologically active fragment thereof, or a fusion protein; and (b) recovering the mutant HPPD protein or a biologically active fragment thereof, or a fusion protein.

[0091] In the production methods of the present invention, cells are cultured in a nutrient medium suitable for producing the polypeptide by methods known in the art. For example, cells are cultured in a suitable medium in laboratory or industrial fermentors under conditions that allow for expression and / or isolation of the polypeptide, using culturing methods such as shaft flask culture and small- or large-scale fermentation (including continuous, batch, fed-batch, or solid-state fermentation). Culturing is carried out in a suitable nutrient medium containing a carbon source, a nitrogen source, and inorganic salts, by procedures known in the art. Suitable media can be purchased from commercial suppliers or formulated according to disclosed compositions (e.g., those disclosed in catalogs of the American Type Culture Collection). If the polypeptide is secreted into the nutrient medium, it can be recovered directly from the culture medium. If the polypeptide is not secreted into the medium, it can be recovered from a cell lysate.

[0092] The polypeptides can be detected by art-specific methods, which may include use of specific antibodies, formation of an enzyme product, or loss of an enzyme substrate.

[0093] The produced polypeptide can be recovered by methods known in the art. For example, cells can be harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract can be retained for further purification. Transformed host cells expressing the mutant HPPD protein of the present invention or a biologically active fragment thereof, or a fusion protein, can be lysed by any suitable means, including freeze-thaw cycles, sonication, mechanical disruption, or the use of cell lysing agents. These methods are known to those skilled in the art. The mutant HPPD protein of the present invention or a biologically active fragment thereof can be recovered and purified from the culture of transformed host cells by methods such as ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxyapatite chromatography, and phytohemagglutinin chromatography.

[0094] The present invention also relates to a method for preparing a host organism, specifically a plant cell, plant tissue, plant part, or plant, that is resistant or tolerant to HPPD-inhibiting herbicides, comprising transforming the host organism with a nucleic acid sequence encoding the mutant HPPD protein of the present invention or a biologically active fragment thereof, or a nucleic acid construct or expression vector containing the nucleic acid sequence. Methods for transforming host cells, such as plant cells, are known in the art, and include, for example, protoplast transformation, fusion, injection, electroporation, PEG-mediated transformation, ion bombardment, viral transformation, Agrobacterium-mediated transformation, electroporation perforation, or bombardment. A range of such transformation methods are described in the known technical literature, for example, the technique for soybean transformation described in EP1186666 and the technique suitable for transforming monocotyledonous plants, particularly rice, described in WO92 / 09696. Agrobacterium tumefaciens or Agrobacterium rhizogenes can also be used to effectively culture plant explants to transfer DNA to plant cells. Whole plants can then be regenerated from infected plant material (such as leaf fragments, stem segments, roots, protoplasts, or suspension-cultured cells) in an appropriate medium containing antibiotics or pesticides for selection. Transformed cells can be grown in plants by conventional methods to form gametes and transfer the transformed trait to progeny plants. Such plants can be cultured by conventional methods and crossed with plants carrying the same transformed genetic material or other genetic factors. The resulting hybrids will possess the corresponding phenotypic characteristics.

[0095] The present invention also provides a method for preparing a host organism, specifically a plant cell, plant tissue, plant part, or plant, that is resistant or tolerant to HPPD-inhibiting herbicides, comprising integrating a nucleic acid encoding a mutant p-hydroxyphenylpyruvate dioxygenase protein or a biologically active fragment thereof into the genome of the host organism and expressing the nucleic acid. Suitable vectors and selectable markers are known to those skilled in the art. For example, a method for integrating into the tobacco genome is described in WO06 / 108830, the disclosure of which is incorporated herein by reference. The gene of interest is preferably expressed in plant cells by either a constitutive or inducible promoter. Upon expression, the mRNA is translated into a protein, thereby incorporating the desired amino acid into the protein. The gene encoding the protein expressed in plant cells can be under the control of a constitutive promoter, a tissue-specific promoter, or an inducible promoter. For example, promoters of bacterial origin, such as the octopine synthase promoter, nopaline synthase promoter, and mannopine synthase promoter, cauliflower mosaic virus (35S and 19S), and 35T (a redesigned 35S promoter, see U.S. Pat. No. 6,166,302, especially Example 7E), can be used. Plant promoter regulators can also be used, including, but not limited to, the ribulose-1,6-bisphosphate (RUBP) carboxylase small subunit (ssu), β-conglycinin promoter, β-phaseolin promoter, ADH promoter, heat shock promoters, and tissue-specific promoters. Constitutive promoter regulators can also be used, which can induce continuous gene expression in all cell types at all times (e.g., actin, ubiquitin, CaMV 35S, etc.). Tissue-specific promoter regulators are involved in gene expression in specific cell or tissue types, such as leaves or seeds (e.g., zein, oleosin, napin, ACP, globulin, etc.), and can also be used in the present invention. Promoter-regulatory elements may also become active (or inactive) at specific stages of plant development.Examples include, but are not limited to, pollen-specific, embryo-specific, corn-silk-specific, cotton-fiber-specific, root-specific, seed endosperm-specific, or vegetative phase-specific promoter-regulators. Under certain circumstances, it may be desirable to use inducible promoter-regulators that are responsible for gene expression in response to specific signals, such as physical stimuli (heat shock genes), light (RUBP carboxylase), hormones (Em), metabolites, chemicals (tetracycline responsive), and stress. Other desired transcription and translation factors that function in plants can be used.

[0096] The present invention also provides a method for improving the resistance or tolerance of a plant cell, plant tissue, plant part, or plant to an HPPD-inhibiting herbicide, the method comprising transforming the plant or plant part with a nucleic acid molecule comprising a nucleic acid sequence encoding a mutant HPPD protein or a biologically active fragment thereof, or a fusion protein of the present invention, and expressing the nucleic acid molecule. The nucleic acid molecule can be expressed as an extrachromosomal entity, or by integrating it into the genome of the plant cell, particularly by integrating it into the endogenous gene location of the plant cell by homologous recombination. All of these embodiments are within the scope of the present invention.

[0097] The present invention also provides a method for improving the resistance or tolerance of a plant or part thereof to an HPPD-inhibiting herbicide, the method comprising crossing a plant expressing a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a biologically active fragment thereof, or a fusion protein of the present invention with another plant, and screening for a plant with improved resistance and tolerance to the HPPD-inhibiting herbicide.

[0098] The present invention also provides a method for improving the resistance or tolerance of a plant cell, plant tissue, plant part, or plant to an HPPD-inhibiting herbicide, the method comprising gene editing of an endogenous HPPD protein gene in the plant cell, plant tissue, plant part, or plant to achieve expression of a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or biologically active fragment thereof, or a fusion protein of the invention.

[0099] The present invention also provides a method for preparing a plant having resistance or tolerance to a herbicide by conventional breeding techniques, which comprises self-breeding or crossing a plant having integrated into its genome a nucleic acid sequence encoding a mutant p-hydroxyphenylpyruvate dioxygenase protein or bioactive substance of the present invention, and screening for progeny containing heterozygous or homozygous nucleic acid sequences.

[0100] The present invention further relates to plant cells, plant tissues, plant parts and plants obtainable by the above methods, as well as their progeny.

[0101] Preferably, plant cells, plant tissues, or plant parts transformed with the polynucleotides of the present invention can be regenerated into whole plants. The present invention encompasses cell cultures, including tissue cell cultures, liquid cultures, and solid plate cultures. Seeds produced by and / or used to regenerate plants of the present invention are also encompassed within the scope of the present invention. Other plant tissues and parts are also encompassed within the present invention. The present invention also encompasses methods for producing plants or cells containing the nucleic acid molecules of the present invention. A preferred method for producing such plants includes planting the seeds of the present invention. Plants transformed in this manner can be conferred resistance to various herbicides with different modes of action.

[0102] For example, for transformation of plant cells using Agrobacterium, explants can be incubated with the transformed Agrobacterium for a time sufficient to allow transformation. After transformation, the Agrobacterium is killed by selection with an appropriate antibiotic, and the plant cells are cultured on an appropriate selective medium. Once callus is formed, appropriate plant hormones can be used to promote shoot formation, according to methods known in the art of plant tissue culture and plant regeneration. However, the intermediate callus stage is not necessary. After shoot formation, the plant cells can be transferred to a medium that promotes root formation, thereby completing plant regeneration. The plant can then be grown to produce seeds, which can be used to establish future generations. Regardless of the transformation technique, the gene encoding the bacterial protein is preferably incorporated into a gene transfer vector adapted to express the gene in plant cells by including a plant promoter element and a 3' untranslated transcription termination region, such as Nos, in the vector.

[0103] The present invention also provides a method for controlling weeds in a locus of growing plants, the method comprising applying a herbicidally effective amount of one or more HPPD-inhibiting herbicides to a locus containing a plant or seed of the present invention.

[0104] In the present invention, the term "growing locus" includes the location where the plant of the present invention is grown, such as soil, and also includes, for example, plant seeds, plant seedlings, and grown plants. The term "herbicidally effective amount" means an amount of herbicide sufficient to affect the growth or development of target weeds, for example, to prevent or inhibit the growth or development of target weeds, or to kill weeds. Advantageously, a herbicidally effective amount does not significantly affect the growth and / or development of the plant seed, plant seedling, or plant of the present invention. One skilled in the art can determine such a herbicidally effective amount through routine experimentation.

[0105] The present invention also provides a method for producing a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein that retains or enhances its ability to catalyze the conversion of p-hydroxyphenylpyruvate (HPP) to homogentisic acid and is significantly less sensitive to HPPD-inhibiting herbicides than wild-type HPPD, the method comprising the steps of mutating a nucleic acid encoding wild-type HPPD, coherently fusing and linking the mutated nucleic acid in an expression vector to a nucleic acid reading frame sequence encoding a solubility-enhancing component to form a sequence encoding a fusion protein, transforming the resulting recombinant expression vector into a host cell, expressing the fusion protein under appropriate conditions containing an HPPD-inhibiting herbicide and an HPPD enzyme substrate, and screening for a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein that retains or enhances its ability to catalyze the conversion of p-hydroxyphenylpyruvate (HPP) to homogentisic acid and is significantly less sensitive to HPPD-inhibiting herbicides. Preferably, the solubility-enhancing component is selected from NusA, which preferably forms a fusion protein with the mutant HPPD protein of the present invention. More preferably, the expression vector is selected from the pET-44a vector.The host cell is selected from a bacterial cell, a fungal cell or a plant cell.

[0106] Unless otherwise stated or implied, the terms "a," "an," and "the" as used herein mean "at least one." All patents, patent applications, and publications mentioned or cited herein are incorporated herein by reference in their entirety and are to the same extent as the individual cited documents.

[0107] Detailed embodiments of the present invention The present invention will be further described in conjunction with the following examples. All methods and operations described in the examples are provided as examples and should not be construed as limiting. For DNA manipulation methods, please refer to Current Protocols in Molecular Biology, Volumes 1 and 2, Ausubel FM, Greene Publishing Associates and Wiley Interscience, 1989, Molecular Cloning, T. Maniatis et al., 1982, or Sambrook J. and Russell D., 2001, Molecular Cloning: a laboratory manual, version 3. [Example]

[0108] Example 1 Cloning of the rice HPPD (OsHPPD) gene The rice (Oryza sativa, Japonica Group) 4-hydroxyphenylpyruvate dioxygenase (HPPD) gene was located at the site of the second chromosome, Os02g0168100. The coding region DNA (OsHPPD) (General Biosystems, Chuzhou, Anhui Province, China) was directly synthesized according to the corresponding cDNA sequence (NCBI accession number XP_015626163.1) and used as a PCR template. Primers NusOsF:acgattgatgacgac gThe primers acaag ATGCCTCCCACTCCCACCCC and NusOsR:tccacgagctcccggactc TTA CTAGGATCCTTGAACTGTAG were designed and synthesized according to the sequence of the vector pET-44a (Novagen) and XP_015626163.1. PCR amplification was performed using these primers, the synthesized template, and Q5 DNA polymerase (NEB, New England Biolabs, Boston, USA) under the following conditions: 98°C for 2 minutes, followed by 35 cycles of 98°C for 20 seconds, 65°C for 30 seconds, and 72°C for 60 seconds, followed by 72°C for 2 minutes. The amplified fragment was shown to be 1.3 kb by agarose gel electrophoresis, and its DNA concentration was determined by UV absorption after recovery.

[0109] The pET-44a (Novagen) plasmid was digested with BoxI (Thermo Fisher Scientific, Shanghai, China) at 37°C for 1 hour and then heated to 65°C to inactivate BoxI. Equal volumes of the OsHPPD DNA fragment and the BoxI-linearized pET-44a vector were mixed and then added to an equal volume of 2x Gibson Assembly Master Mix (Hanbio Biotechnology Co., Ltd., Shanghai, China), mixed, and incubated at 50°C for 1 hour. 5 μl of the ligation product was used to transform competent E. coli DH5a. The bacterial solution was applied to the surface of an LB solid medium plate containing 100 ppm ampicillin and cultured overnight at 37°C. The next day, correct clones were confirmed by individual bacterial colony PCR. Three correct clones were cultured overnight at 37°C, and sufficient plasmid DNA was extracted and sent to Qingke Biotechnology Co., Ltd. (Beijing, China) for Sanger sequencing. The sequencing results confirmed that the correct full-length rice HPPD coding region DNA was obtained.

[0110] Example 2: Saturated random mutation of each amino acid in rice HPPD (OsHPPD) protein The full-length rice OsHPPD enzyme has 446 amino acids, the amino acid sequence of which is shown in SEQ ID NO:2. Amino acids 1–50 are thought to constitute a signal peptide involved in chloroplast induction (Siehl et al. Plant Physiol. 2014 Nov.; 166(3): 1162–1176). Therefore, we generated saturation random mutations at each amino acid from amino acid 51 to amino acid 466. This was achieved by performing bridge PCR using a primer containing the coding sequence of the amino acid to be mutated to NNK and another appropriate conventional primer. In NNK, N represents A / T / G / C and K represents G / T. The NNK codon can encode any one of the 20 amino acids or a terminator. Thus, this was a saturation mutagenesis. See Kille S, Acevedo-Rocha CG, Parra LP, Zhang ZG, Opperman DJ, Reetz MT, Acevedo JP (2013) Reducing codon redundancy and screening effort of combinatorial protein libraries created by saturation mutagenesis. ACS Synth Biol 2(2):83-92; Directed Evolution Library Creation: methods and protocols 2nd ed. Edited by Elizabeth MJ Gillam, Janine N. Copp and David F. Ackerley New York, NY United States: Springer, 2014. doi:10.1007 / 978-1-4939-1053-3. A large number of variants were generated. The mutants were cloned into a linearized pET-44a vector and transformed into E. coli. The E. coli were cultured in 2xYT medium containing an HPPD-inhibiting herbicide (such as 1-2 μM tembotrione) and the substrate tyrosine (1 g / L) in a 96-well plate at 28°C and 150 rpm in a shaker for 24 hours to express the mutants. The mutants were then rapidly screened for browning.Using this method, 10 single amino acid mutations, A103S, H141R, H141K, H141T, A165V, V191I, R220K, G342D, D370N, and K410I, were screened for their effects on the activity of tembotrione and tembotrione compared to the wild type. Fenpyrazone The color reactions of these resistant mutants in the presence of metabolites are shown in Figure 1. Among them, the color changes of H141R and G342D were the most prominent, and were clearly darker than those of the wild type.

[0111] The method of this patent increases the solubility of bacterially expressed HPPD by fusing NusA with the rice HPPD protein, allowing the protein to be expressed and the enzymatic reaction to be carried out simultaneously at 28°C, significantly reducing screening time and steps.

[0112] Similarly, three other HPPD-inhibiting herbicides, Sipirafluon The color reactions of these mutants in the presence of α-topramezone, α-topramezone, and α-topramezone were measured; see Figures 2 and 3. The resistance / tolerance of each mutant to the five herbicides was estimated based on its color change, and the results are shown in Table 1. The more plus signs "+," the darker the color compared to the wild type, and the higher the resistance / tolerance.

[0113] [Table 2]

[0114] The whole process is illustrated by taking the production and screening of the H141R mutant as an example.

[0115] 1. PCR amplification was performed using NusOsF and OsHPPD-H141R-R:CACCGCGAGGCCGTGGTCC as primers, a synthesized full-length OsHPPD template, and Q5 DNA polymerase (NEB, New England Biolabs, Boston, USA) to obtain the forward DNA fragment. Amplification was performed under the following conditions: 98°C / 2 min; 98°C / 20 s, 65°C / 30 s, 72°C / 60 s (35 cycles); and 72°C / 2 s. After detection by agarose gel electrophoresis, bands of the correct size were collected and their concentrations were measured by UV absorption. Similarly, PCR amplification was performed using NusOsR and OsHPPD-H141R-F:CACGGCCTCGCGGTGNNKGCCGTGGCGCTGCGCG as primers, a synthesized full-length OsHPPD template, and Q5 DNA polymerase (NEB, New England Biolabs, Boston, USA) to obtain the reverse DNA fragment. 2. The forward and reverse fragments overlap by 19 bases in the center (OsHPPD-H141R-F and OsHPPD-H141R-R). Therefore, the two fragments were mixed in equimolar amounts, and an equal volume of 2x Glodstar MasterMix (ComWin Biotechnology Co., Ltd., Beijing) was added. 10 pmol of NusOsF and NusOsR primers were added to perform bridge PCR. Amplification was performed under the following conditions: 96°C for 2 minutes; 96°C for 20 seconds, 65°C for 30 seconds, and 72°C for 60 seconds (30 cycles); and 72°C for 5 minutes. After agarose gel electrophoresis, the band of the correct size (1.3 kb) was collected and its concentration was measured by UV absorption. 3. The OsHPPDMut DNA fragment was mixed with an equal volume of the linearized pET-44a vector described above, and an equal volume of 2x Gibson Assembly Master Mix (Hanbio Biotechnology Co., Ltd.) was added and incubated at 50°C for 1 hour. 5 μl of the ligation product was used to transform competent E. coli DH5a. The bacterial solution was applied to the surface of an LB solid medium plate containing 100 ppm ampicillin and cultured at 37°C overnight. All clones (colonies) on the plate were disrupted, the plasmids were extracted, and the DNA was quantified by UV absorption. 100 ng of the plasmid was transformed into competent BL21(DE3) cells, the plates were coated, and the plates were cultured at 37°C overnight. To screen for mutants, the plates containing the transformed E. coli were temporarily stored at 4°C. 4. Screening of mutants resistant to HPPD-inhibiting herbicides by color reaction HPPD-inhibiting herbicides inhibited HPPD enzyme activity. When tyrosine was converted to 4-hydroxyphenylpyruvate (HPP) under the action of tyrosine transaminase, inactivated HPPD was unable to oxidize 4-hydroxyphenylpyruvate to homogentisic acid (HGA). HGA was dark brown. Therefore, if an HPPD mutant was resistant or tolerant to a herbicide, after expression in E. coli, the mutant was also able to oxidize 4-hydroxyphenylpyruvate to homogentisic acid, resulting in a dark brown color. Therefore, E. coli was cultured in 2xYT medium containing HPPD-inhibiting herbicides and the substrate tyrosine in a 96-well plate and rapidly screened based on the color change.

[0116] (1) Preparation of 2xYT medium (supplemented with 1 g / L L-Tyr, 0.1 mM IPTG, 0.01 mM MnCl2, and 100 mg / L ampicillin). (2) 0.1 mL of the above medium was added to each well of a 96-well plate, and the OsHPPD wild-type or mutant (OsHPPD Mut) expression clones from the E. coli plate obtained by the transformation described above were placed in the liquid medium in the 96-well plate. Depending on the selected agent, HPPD inhibitors were added at final concentrations of 1 μM to 20 μM. For example, the final concentrations of tembotrione and mesotrione were 1.7 μM and 10 μM, respectively. After adding all the components, a strong gas-permeable sealing film (Suolaibao Biological Agent Company, Beijing, China) was applied as a cover. (3) The 96-well plate was incubated on a shaker at 28°C and 150 rpm for 24 hours. The cultures were visualized or detected for light absorption at 400 nm, and clones producing significant amounts of black pigment were selected using an inoculating loop and further cultured. Plasmid DNA was extracted and sequenced for further studies, including expression, purification, and enzyme activity assays of OsHPPD protein.

[0117] The single mutations A103S, A165V, V191I, R220K, D370N, K410I and the triple mutation H141R / G342D / D370N were obtained using the same method with the primers shown in Table 2, respectively.

[0118] [Table 3]

[0119] In addition, several double-site mutants containing combinations of single-site mutations, such as H141R / G342D, H141R / D370N, and G342D / D370N, were also prepared using a similar method to bridge PCR.

[0120] Example 3 Combination of multiple mutations in rice HPPD (OsHPPD) protein In the present invention, mutant HPPD proteins containing H141R, G342D, D370N and combinations thereof were tested at different times on different 96-well plates in combination with five different HPPD-inhibiting herbicides, such as tembotrione, Fenpyrazone Metabolites of Sipirafluon The color reaction with topramezone and mesotrione was also tested. The test results are shown in Figures 4, 5, and 6. Table 3 shows the resistance / tolerance of these mutants to the corresponding herbicides, estimated based on their color. Table 3 indicates that the two-site and three-site mutants also have high herbicide resistance, and that combinations of amino acid mutations may exist in the rice HPPD (OsHPPD) protein, which also confer high resistance and / or tolerance to HPPD-inhibiting herbicides.

[0121] [Table 4]

[0122] Example 4 Further saturation mutations based on the three-site mutation H141R-G342D-D370N 1. In the color reaction of the triple mutant OsHPPDH141R-G342D-D370N expressed in E. coli, BipyrazonWhen compound 101 (code 101) was used for inhibition, a concentration of 120 μM was required to prevent significant color reaction. Therefore, 120 μM of compound 101 was selected for the initial screening. Using the technical pathway described above, a pair of primers was designed for each amino acid from amino acid positions 51 to 446 (excluding positions 141R, 342D, and 370N), one of which was represented by NNK at the amino acid site to be subjected to saturation mutagenesis. A series of mutants were generated by PCR amplification, then expressed in E. coli BL21(DE3), and repeatedly screened with 120 μM of compound 101. After all single-site mutations were screened, 18 new mutation sites were obtained. The new sites were: R93S, G226H, L276W, P277N, P336D, P337A, N338D, N338S, N338Y, R346C, R346D, R346H, R346S, R346Y, I377C, P386T, L390I, M392L, E403G, K418P, G419F, G419L, G419V, N420S, N420T, E430G, and Y431L. The amino acid changes and nucleotides of these new mutation sites, as well as the primers used to generate these new mutation sites, are shown in Table 4, and the sequences of the primers are shown in Table 5. That is, as shown in Figure 7, a total of 26 mutation sites were obtained by screening, and one original amino acid at some sites could be changed to several different amino acids, for example, H141R, K, T; N338D, S, Y; R346C, D, H, S, Y; G419F, L, V and N420S, T.

[0123] [Table 5]

[0124] [Table 6] TIFF0007785536000010.tif34162

[0125] Example 5 Combinations of mutation sites The mutation sites were combined based on the following three principles: the sites were close to each other to facilitate homologous substitution in gene editing, resulting in high editing efficiency; the base changes were the same as A → G / T → C or C → T / G → A to facilitate base editing; and the resistant sites were made as small as possible to facilitate editing and avoid possible adverse effects. Based on the above principles, combinations of corresponding primers and prokaryotic expression vectors were designed and then screened by color reaction to find combinations with significant resistance suitable for editing to perform gene editing.

[0126] (1) Based on the principle of proximity, a total of 33 combinations were designed, of which 24 combinations had three mutation sites and 9 combinations had four mutation sites. These combinations and the primer sequences used are listed in Table 6. [Table 7] TIFF0007785536000012.tif122166

[0127] As shown in Figure 8, various combinations of these adjacent mutation sites were cloned, expressed, and compared by color reaction. The three combinations with the mutation sites N338D / G342D / R346C, N338D / G342D / R346H, and N338S / G342D / R346C, respectively, showed the highest resistance, ranging from 1000 to 1500 μM. bipyrazone It was found that the α-glucanase showed a significant color reaction even in the presence of metabolite 101, followed by two combinations with four adjacent mutation sites: P336D / N338D / G342D / R346C and P336D / N338D / G342D / R346H.

[0128] (2) Six combinations, namely, H141R / N338D / N420S, H141R / N338S / N420S, H141R / N338D, and H141R / N420S, which correspond to the same A→G / T→C sequence, and G342D / R346C and G342D / R346H, which correspond to the same C→T / G→A sequence, were designed based on the principle of facilitating base editing. The primers for generating these combinations and their sequences are shown in Table 7.

[0129] [Table 8]

[0130] After detection, it was found that the color reactions of the above six combinations were also strong, and the color reactions could be distinguished in E. coli cultures containing Herbicide 101 at concentrations of 600 to 1000 μM.

[0131] (3) Other combinations are shown in Table 8. [Table 9] TIFF0007785536000015.tif235170TIFF0007785536000016.tif235170TIFF0007785536000017.tif107170

[0132] After detection, the color reaction of the above two mutation site combinations was observed weakly with the naked eye, and it was found that all of them were within 100 μM of Compound 101; for combinations of three, four, or more sites, the color reaction of H141R / G342D / N338D / R346C, H141R / G342D / N338D / R346H, H141R / G342D / N338D / K418P, H141R / G342D / N338D / G419F, and H141R / G342D / N338D / G419F / N420S was strong, even at concentrations of Compound 101 of 1000 to 2000 μM (shown in Figure 9).

[0133] Single-site mutations showed resistance at 10-20 μM; two-site mutation combinations showed resistance at approximately 20-120 μM, which was stronger than that of single-site mutations, and the color faded at 100 μM; triple-site mutation combinations, i.e., H141R / N338D / G342D, H141R / G342D / K418P, H141R / G342D / G419F, 338D / 342D / 346C / H, H141R / G342D / N420S, and H141R / N338D / N420S, showed good resistance and showed a pale color up to 1000 μM; 4 Combinations of more than one mutation site, i.e., H141R / N338D / G342D / K418P, H141R / G342D / K418P / G419F, H141R / N338D / G342D / R346C, H141R / N338D / G342D / R346H, H141R / N338D / G342D / K418P / G419F, H141R / N338D / G342D / G419F / N420S, H141R / N338D / G342D / K418P / G419F / N420S, etc., showed higher resistance and showed significant color development even at a concentration of 2500 μM of Compound 101.

[0134] Example 6 Expression, isolation and purification of OsHPPD protein The rice OsHPPD protein and homogentisate 1,2-dioxygenase (HGD) were obtained by heterologous expression in Escherichia coli, i.e., the genes were inserted into the pET-15b expression vector, expressed in the BL21(DE3) expression strain, and purified by Ni-NTA resin.

[0135] (1) The HPPD open reading frame (ORF) from the positive clone was cloned into the pET-15b vector to form the 6His-HPPD expression vector, which was then transformed into BL21(DE3) cells. The expression strain was inoculated into 10 mL of 2xYT medium and grown overnight at 37°C in a shaker at 200 rpm. The 10 mL culture was then inoculated into 1 L of 2xYT medium and grown until the OD600 reached 0.6-0.8. The culture was then cooled to 16°C and induced with 0.2 mM IPTG (isopropylthiogalactoside) overnight. The strain was harvested by centrifugation at 2800 x g. (2) The collected strains were resuspended in Buffer A (50 mM Tris pH 8.0, 500 mM NaCl, 20 mM imidazole), and phenylmethanesulfonyl fluoride (PMSF) was added to a final concentration of 1 mM. 250 μL of a protease inhibitor cocktail (i.e., a mixture of multiple protease inhibitors) was added and mixed. The cells were disrupted by sonication in an ice bath (40% of the total power, 3-second / 6-second intervals, 2 × 30 min (Ningbo Scientz Biotechnology Co., Ltd., Ningbo, China)). The solution was then centrifuged at 12,000 rpm for 30 min at 4°C. The supernatant was filtered through a 0.22 μm filter membrane. (3) Purification by Ni-NTA column: The supernatant was contacted with Ni-NTA resin, then washed with buffer A containing 50 mM imidazole to remove impurities, and finally eluted with elution buffer containing 400 mM imidazole. (4) The approximate purity of the target protein was analyzed by SDS-PAGE. The eluates containing the target protein were combined and concentrated using an ultrafiltration device (10 kDa molecular weight cutoff, Amicon Ultra). The solution was desalted by replacing it with a solution containing 20 mM Tris-HCl at pH 7.5 at least three times. The total protein concentration was measured by the BCA method. The expressed and purified rice HPPD wild type and its various mutants are listed in Table 9.

[0136] [Table 10]

[0137] (5) Dialysis or desalting column passage: The buffer was replaced with a stock solution of 50 mM Tris pH 8.0 and 500 mM NaCl. The concentration was measured by the BCA method. After packaging and flash-freezing in liquid nitrogen, the eluate was stored in a refrigerator at -80°C.

[0138] Example 7 Determination of the effects of compounds on various enzymatic parameters of OsHPPD protein 1. The activity of the HPPD enzyme was determined by detecting the conversion of 4-hydroxyphenylpyruvic acid (4-HPP) to homogentisic acid (HGA), which is catalyzed by the HPPD enzyme, and the conversion of HGA to maleylacetoacetate (MAA), which is catalyzed by homogentisate dioxygenase. Maleylacetoacetate has an absorption maximum at 318 nm and an absorption constant of 14.7 OD M. -1 .cm -1 It was. 2. Six microliters of 4-hydroxyphenylpyruvic acid (4-HPP) at a concentration 50 times the final substrate concentration was added to the ELSA plate, followed by 294 μL of hydroxyethylpiperazineethanesulfonic acid (HEPES) at a final concentration of 25 mM, pH 7, along with 2 mM vitamin C, 10 mM FeSO, 50 nM homogentisate dioxygenase, and 5–240 nM HPPD enzyme. The final concentration of the reaction substrate, 4-HPP, typically ranged from 1–100 μM. The absorbance changes of the reaction wells at 3.318 nm were continuously monitored with a UV ELISA detector (ReadMax 1900 light absorption full-wavelength microplate reader) (Shanghai). 4. OsHPPD K m , K. cat and K. cat / K m Decision V max is the maximum catalytic reaction rate achievable by enzyme catalysis. The Michaelis constant, K m is the maximum rate at which an enzyme catalyzes a reaction (V max ) is the concentration of substrate required to achieve half of the K m The K value is constant and independent of enzyme concentration, but varies with changes in substrate type, reaction temperature, pH, and ionic strength. cat is the catalytic constant of an enzyme, which refers to the number of substrate molecules that can be catalyzed per second by an enzyme molecule or enzyme active center. cat / K mrepresents the catalytic efficiency of the enzyme. The enzyme parameters of wild-type rice HPPD (WT) and various mutants were determined, as shown in Table 10. The data in the table showed that most of the HPPD mutants had improved catalytic efficiency.

[0139] [Table 11]

[0140] 5. Herbicides 101 and 102 against OsHPPD protein Sipirafluon Inhibitory activity (IC 50 ) measurement As shown in Figure 10 and Table 11, Bipyrazon Metabolites of and Sipirafluon The inhibitory activity of compound 101 and compound 102 on the rice wild type (WT) and various mutant OsHPPD proteins was measured. Sipirafluon IC of herbicide compounds 50 The IC values ​​for the Compound 101 herbicide compound against the H141R / N338D / G342D / K418P / G419F / N420S mutant were significantly enhanced compared to those against the wild type. 50 Values ​​are IC values ​​for wild type 50 The value increased 13.7-fold compared to the mutant Sipirafluon IC 50 The IC value increased 1.8-fold. 50 The increase in the values ​​indicates that these mutants have improved tolerance to HPPD herbicides. Sipirafluon Due to the unique characteristics of each IC 50 The magnitude of the increase in values ​​was not entirely consistent between the two HPPD herbicides.

[0141] [Table 12]

[0142] 6. Determining the Enzyme Compatibility of OsHPPD Protein to Inhibitors Enzyme fitness is a measure of the enzyme's adaptability to inhibitors; the higher the value, the stronger the enzyme's resistance to inhibitors. The concentration of substrate in a reaction is K m value, and the reaction conditions for different OsHPPD variants were the same, so the K cat is the V achieved by catalysis at the same concentration of enzyme (500 nM). max can be replaced by Enzyme compatibility = K cat *K m -1 *K i , Ki=IC 50 / (1+S / K m ) (inhibition constant) Herbicide compound 101 and its derivatives against rice HPPDWT and various mutants Sipirafluon The tolerance of these mutants to herbicides was further evaluated by detecting the inhibition constants of the enzymes and their corresponding enzyme fitness. The results shown in Table 12 indicate that the enzyme fitness of the mutants all have different levels of enhancement compared to the wild type, confirming their enhanced tolerance.

[0143] [Table 13]

[0144] In summary, a series of enzyme tests confirmed that the rice OsHPPD mutants have improved herbicide tolerance compared to the wild type (WT). Among them, the four-site mutant H141R / N338D / G342D / K418P, which showed the strongest resistance in the color reaction, also showed high resistance in in vitro enzyme activity experiments. Furthermore, the results showed that the mutant with the K418P mutation showed significantly improved resistance but reduced affinity for the substrate (Km). The mutants H141R / G342D / P277N and H141R / N338D / G342D / K418P had equivalent resistance and showed reduced affinity for the substrate (Km). m) did not decrease affinity to the nucleotide sequence. Furthermore, the triple mutants H141R / N338D / G342D and the quadruple mutants H141R / N338D / G342D / P386T also showed relatively high resistance, and their Km values ​​did not decrease. The shortest triple mutant, N338D / G342D / R346H, also showed good resistance and was easy to edit.

[0145] The following fragments were prioritized for further testing: N338D / G342D / R346H (the shortest and suitable for homologous substitution HDR), H141R / N338D / G342D (even shorter and also suitable for homologous substitution), and H141R / N338D / N420S (suitable for base editing and exhibiting stronger resistance). After gene transfer and gene editing, the changes in plant resistance were detected.

[0146] Example 8 Overexpression of the triple mutant OsHPPD3M in transgenic rice 1. Construction of Overexpression Vector 1) Primers: Primers were designed according to the selected restriction sites and the nucleotide sequence of the gene itself to amplify the triple-mutated HPPD (H141R / G342D / D370N) (OsHPPD3M). The designed primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.: HPPD-F, HPPD-G, HPPD-H ... GATAGCCGGTACGGGTTCGA GCCACC ATGCCTCCCACT CCCACCC, HPPD-R, CATCTTTGTAATCGGGGTAC CTAGGATCCTTGAACTGTAGGGGC. 2) PCR amplification: The target gene was amplified using synthesized primers and Q5 DNA polymerase (NEB, New England Biolabs, Boston, USA). The amplified product was assayed by agarose gel electrophoresis, and the product was recovered according to the TIANquick Midi Purification Kit operating instructions. After recovery was complete, the concentration of the extracted DNA was measured using a Nanodrop™. 3) Construction of rice overexpression vector: The rice overexpression vector pCAMBIA1301-OsHPPD3M was constructed using the recovered HPPD fragment and plasmid pCAMBIA1301 digested with KpnI and HindIII using the HB-in fusion™ Seamless Cloning Kit from HanBio Biotechnology Co., Ltd. (Shanghai), and then transformed into competent E. coli DH5α to obtain positive clones; after sequencing and restriction endonuclease digestion, the positive clones were transformed into Agrobacterium.

[0147] 2. Generation of transformed Agrobacterium-infected rice calli and transgenic events 1) 1 μg of the rice overexpression vector pCAMBIA1301-OsHPPD3M and the empty vector pCAMBIA1301 expressing only mCherry (a fluorescent protein marker gene) were added to competent Agrobacterium EH105, incubated on ice for 5 minutes, rapidly frozen in liquid nitrogen for 5 minutes, incubated at 37°C for 5 minutes, and then incubated on ice for 5 minutes. 500 μl of YEB medium (antibiotic-free) was added and incubated at 28°C and 200 rpm for 2–3 hours. Cells were harvested by centrifugation at 3500 rpm, and then plated on YEB (kalamycin + rifampicin) plates and incubated at 28°C for 2 days. Single clones were selected, cultured in liquid medium, and stored at -80°C. 2) Cultivation of Agrobacterium: Select the transformed monoclonal Agrobacterium and grow it in YEB liquid medium (karamycin + rifampicin) until OD 600 The culture was incubated at 28°C until the pH reached 0.5, and colonies were harvested at 3500 rpm. The colonies were diluted with an equal volume of AAM liquid medium (1 ml AAM + 1 μl 1000×AS) and used to infect calli. 3) Callus induction for rice cultivar Zhonghua 11: Before preparing the Agrobacterium, rice callus was first prepared. Rice seeds were peeled and washed with sterile water until the water was clear (without limiting the washing time). They were then sterilized with 70% alcohol for 30 seconds and then with 5% sodium hypochlorite. They were then incubated on a horizontal shaker for 20 minutes, sterilized with sodium hypochlorite, washed five times with sterile water, and placed on sterile absorbent paper to air-dry the water on the seed surface. They were then inoculated onto induction medium and cultured at 28°C. 4) Agrobacterium infection of rice calli: 3 mm diameter Huaidao No. 5 calli were selected and pre-cultured for 10 days. The calli were collected in 50 ml centrifuge tubes. An adjusted concentration of Agrobacterium bacterial solution was added to the calli-containing tubes, and the tubes were placed on a shaker at 28°C and 200 rpm for 20 minutes to infect them. After infection was complete, the bacterial solution was removed, and the calli were placed on sterile filter paper, air-dried for approximately 20 minutes, and then co-cultured on a co-culture plate covered with sterile filter paper moistened with AAM (1 ml AAM + 30 μl 1000×AS) liquid medium. Three days after infection, the Agrobacterium was washed away (i.e., five times with sterile water, followed by 20 minutes with 500 mg / L cephalosporin antibiotic), and the calli were cultured in 50 mg / L hygromycin screening medium. 5) Screening, differentiation, and rooting of resistant calli: The co-cultured calli were transferred to screening medium for the first screening (2 weeks); after the first screening, newly grown calli were transferred to screening medium (containing 50 mg / L hygromycin) for the second screening (2 weeks). After screening, blond calli showing good growth were selected and differentiated. 1 μM to 5 μM tembotrione was added to the differentiation medium for screening for herbicide resistance. After 3 to 4 weeks, seedlings approximately 1 cm in size were obtained. The differentiated seedlings were transferred to rooting medium for rooting; the rooted seedlings were subjected to acclimation treatment and then transferred to pots containing soil for greenhouse cultivation. 55 OsHPPD3M seedlings or events were obtained.

[0148] 3. Preliminary detection of herbicide resistance in transgenic seedlings (T0 generation): 1-5 μM tembotrione was added to the differentiation medium. As a result, seedlings with an empty vector control were not resistant to tembotrione, while transformed seedlings overexpressing the three-site mutant HPPD (H141R / G342D / D370N) were shown to be resistant to 3 μM tembotrione, as shown in Figure 11.

[0149] 4. Redetection of herbicide resistance in transgenic seedlings (T0 generation): Transgenic seedlings from the T0 generation were transplanted into large plastic buckets in a greenhouse to obtain seeds for the T1 generation. Two events were randomly selected from the overexpressed mutant events at the zygotic stage, and herbicide resistance was detected in the two events and in the non-transgenic rice cultivar Zhonghua 11 at the same growth stage as a control. The herbicides used were: bipyrazone It was. bipyrazone The field rate was typically 4g ai / mu. bipyrazone The ratios were 8 and 16 g per mu.

[0150] Resistance detection results: Five days after spraying (16 g / mu) and seven days after spraying (8 g / mu), non-transgenic rice seedlings began to bleach, while the overexpression transgenic mutants, Event 1, Event 2, Event 3, and Event 4, remained green. 32 days after spraying, the non-transgenic seedlings sprayed with the herbicide were nearly dead, while the overexpression transgenic mutants treated with 8 g / mu or 16 g / mu of herbicide were still green, grew normally, and began to produce panicles (shown in Figures 12A and 12B).

[0151] 5. Redetection of herbicide resistance in transgenic seedlings (T1 generation): a) Three events selected from overexpressing transgenic mutant HPPD, event 20, event 28, and event 37, and the non-transgenic wild-type Huaidao No. 5 (Huaidao No. 5 showed higher HPPD inhibitor activity than Zhonghua 11). bipyrazone The natural resistance to HCl is high, so the resistance multiplier cannot be calculated based on Huaidao No. 5, and the actual resistance will be higher.) b) Used bipyrazone The rates were 0, 4, 8, 16, 32, and 64 g / mu. Due to the low temperatures and poor lighting in the greenhouse during winter, phytotoxicity symptoms appeared slowly. On the 14th day after spraying, non-transgenic Huaidao No. 5 plants treated with 32 and 64 g / mu of herbicide showed symptoms, while the transgenic plants were asymptomatic and remained green (Figures 12C and 12D).

[0152] In conclusion, overexpression of the triple mutant OsHPPD3M (H141R / G342D / D370N) could enhance the tolerance of transgenic rice varieties to HPPD-inhibiting herbicides by at least four-fold. Preliminary observations of the growth, development, flowering, and fruiting of the T0 and T1 generations showed that most plants were normal.

[0153] Example 9 Determination of HPPD copy number overexpressed in transgenic rice Hygromycin resistance gene: The rice hppd (Oshppd) gene has a high GC content, which affected the efficiency of PCR amplification. Furthermore, rice contains endogenous copies of hppd. Therefore, to estimate copy number, we selected the hygromycin resistance gene hyg, a selectable marker gene, as the exogenous gene and the sucrose phosphate synthase (SPS) gene as the endogenous reference gene. The SPS gene is a rice-specific gene with a single copy that can function as an endogenous reference gene in rice (Ding Jiayu, Jia Junwei, Yang Li Tao et al. Validation of a rice-specific gene, sucrose phosphate synthase, used as the endogenous reference gene for qualitative and real-time quantitative PCR detection of transgenes [J]. J. Agric. Food Chem., 2004, 52: 3372-7). The copy number of the overexpressed hppd can be indirectly estimated by determining the copy number of the selectable marker gene hygromycin resistance gene (hyg) in the transgenic rice.

[0154] Genomic DNA: Genomic DNA from rice leaves was extracted and purified using a plant genomic DNA extraction kit from Tian'gen Biotech Co., Ltd. (Beijing). DNA content and purity were detected using a Nanodrop nucleic acid analyzer (Nanodrop). Purity was considered good when the OD260 / OD280 ratio was in the range of 1.8-2.0 and when the OD260 / OD230 ratio was approximately 2.0.

[0155] Primers: Two pairs of primers were designed: Hyg-F: 5'-GTACACAAATCGCCCGCAG-3' and Hyg-R: 5'-TCTATTTCTTTGCCCTCGGAC-3' were used to amplify a 111 bp fragment length of the hygromycin resistance gene; Sps-F: 5'-GTACACAAATCGCCCGCAG-3' and Sps-R: 5'-TCTATTTCTTTGCCCTCGGAC-3' were used to amplify a 170 bp fragment of the sucrose phosphate synthase (SPS) gene.

[0156] Quantitative PCR reaction system: The reaction solution (20 μL) was prepared according to the SYBR Premix ExTaq II system for real-time fluorescent quantitative PCR. The PCR amplification procedure was: pre-denaturation at 95°C for 30 seconds, followed by 40 cycles of 95°C for 5 seconds, 55°C for 30 seconds, and 72°C for 30 seconds.

[0157] Drawing the standard curve: Quantitatively PCR-amplified fragments containing 400 bp sequences of the SPS or HYG genes were selected, ligated by homologous recombination, and then ligated into the pClone007 vector. The constructed standard product plasmids containing the HYG and SPS genes were digested with the restriction endonuclease PshaI to linearize the DNA, and their concentrations were measured using a nucleic acid protein detector. The resulting plasmids were diluted to 100 kJ / mL with ddH2O. 6 Copies / µL, 10 5 Copies / µL, 10 4 Copies / µL, 10 3 Copies / µL and 10 2 The sample was diluted to 1000 copies / µL. Five standard samples and controls at different dilutions were simultaneously amplified, with three technical replicates for each sample. PCR amplification was performed as described above. The conversion formula for concentration and copy number was: copy number (copies / mL) = (6.02 x 10 23 The average molecular weight (MW g / mol): dsDNA = (number of bases) × (660 daltons / bp).

[0158] Calculation of transgene copy number: Each sample tested was counted at the cycle number C at which the threshold was reached. t To obtain the initial amount of template in the sample, t The values ​​were substituted into the standard curve, and the ratio of the initial template amount of the gene of interest to the initial template amount of the endogenous gene was the copy number of the gene of interest. The data obtained from the experiment were exported by the software and analyzed using Excel.

[0159] Real-time fluorescent quantitative PCR: The expression levels of related genes in transgenic rice were analyzed using qRT-PCR to verify the efficiency of gene overexpression. The rice UBQ5 gene was used as an endogenous reference gene. Reaction solutions for real-time fluorescent quantitative PCR were prepared. Reaction solutions (20 μL) were prepared using the SYBR Premix ExTaq II system. The qRT-PCR amplification procedure was as follows: pre-denaturation at 95°C for 30 seconds; denaturation at 95°C for 5 seconds; annealing at 60°C for 30 seconds; and extension at 65°C for 5 minutes, for a total of 40 cycles. Data obtained from the experiment were exported by software and analyzed using Excel. The relative expression levels of genes were calculated using △△CT. Three independent biological replicates were set up for every sample.

[0160] In this study, 54 positive PCR plants and 4 non-transgenic plants were selected as controls, and genomic DNA was extracted using a plant genomic DNA extraction kit. Each sample had three replicates for quantitative PCR reactions to obtain amplification curves, and the fluorescence threshold was set in the same way as for drawing the gene standard curve. The C of the samples to be tested was t The value is obtained and the number of initial templates of the HYG gene in the sample is calculated using the formula: HYG0 = 10 (-0.260CT+10.442) The number of initial templates of the Sps gene in this sample was calculated using the formula: SPS0 = 10 (-0.260CT+10.172)The formula for the calculation was: Because the endogenous reference gene Sps in rice is homozygous diploid, and the probability that the exogenous gene in the transgenic plants is homozygous is very small, the copy number of the gene of interest in the rice genome is equal to the value obtained by dividing the number of initial templates for Hyg by the number of initial templates for Sps and multiplying the result by 2. The number of initial templates for the gene of interest Hyg was compared with the number of initial templates for the endogenous reference gene Sps in rice. The results in Table 13 showed that of the 54 transgenic plants, 36 plants had a copy number of 1, 13 plants had a copy number of 2, 4 plants had a copy number of 3, and 1 plant had a copy number of 4, while the negative control had a copy number of 0.

[0161] [Table 14] TIFF0007785536000023.tif191165

[0162] Example 10: Rice varieties resistant to HPPD-inhibiting herbicides obtained by gene editing The rice HPPD gene was mutated and screened to obtain three mutation sites, 141, 342, and 370, as well as their combinations, and their resistance to HPPD-inhibiting herbicides was tested in vitro. Based on this, the combined mutant OsHPPD3M (H141R / G342D / D370N) was overexpressed in transgenic rice and confirmed to be significantly resistant to HPPD-inhibiting herbicides. The HPPD gene was then gene-edited to obtain non-transgenic rice varieties resistant to HPPD-inhibiting herbicides. First, base editing was performed on the three sites corresponding to amino acid positions 141, 342, and 370, respectively, and homologous substitution was performed on the three sites corresponding to amino acid positions 141, 342, and 370. The gene editing process and results are as follows.

[0163] (1) Base editing is a gene editing method that uses the CRISPR / Cas9 system to target deaminase to specific sites in the genome and modify specific bases. This method has been effectively applied to rice. For example: Yan F., Kuang Y., Ren B., Wang J., Zhang D., Lin H., Yang B., Zhou X., and Zhou H. (2018). High-efficient A·T to G·C base editing by Cas9n-guided tRNA adenosine deaminase in rice. Mol. Plant. doi: 10.1016 / j.molp.2018.02.008.

[0164] In this example, sites in the rice HPPD gene at the Os02g0168100 locus on chromosome 2, i.e., sites corresponding to amino acid positions 141, 342, and 370, were edited. The histidine (codon CAC) amino acid residue at position 141 of rice HPPD was edited to arginine (codon CGC; original A changed to G) by base editing. Similarly, the glycine (codon GGC) amino acid residue at position 342 was edited to aspartic acid (codon GAC; original G changed to A), and the aspartic acid (codon GAC) amino acid residue at position 370 was edited to asparagine (codon AAC; original G changed to A). The mutant Cas9 protein xCas9(3.7)-ABE, which has broader PAM compatibility, was selected as the editing tool (Hu, JH et al. Evolved Cas9 variants with broad PAM compatibility and high DNA specificity. Nature http: / / dx.doi.org / 10.1038 / nature26155 (2018)).

[0165] The sgRNA target site was designed according to the DNA sequence of the rice HPPD gene, corresponding to amino acid position 141: GGTGC a CGCCGTGGCGCTGC-GCG, arepresents the ABE action site for editing A to G. The PAM of this sgRNA was GCG, which meets the requirements of xCas9 (3.7).

[0166] Similarly, the sgRNA target site was designed according to the DNA sequence of the rice HPPD gene, which corresponds to amino acid position 342: GCACG c CGTCGTAGTAGTTGGGC, c represents the CBE site of action for C-to-T editing. The PAM of this sgRNA was GGC, which meets the requirements of xCas9 (3.7).

[0167] The DNA sequence of the region near the rice HPPD gene corresponding to amino acid position 370 was analyzed to design the sgRNA target site: CCTGGT c ATCCCTGTCCACGAGC, c represents the CBE action site for editing C to T. This sgRNA was GGC, which meets the requirements of xCas9 (3.7).

[0168] Therefore, three primer pairs were synthesized: 141GE-F: ggcgGTGCaCGCCGTGGCGCTGC and 141GE-R: aaacGCAGCGCCACGGCGtGCAC; 342GE-F: ggcgCACGcCGTCGTAGTAGTTG and 342GE-R: aaacCAACTACTACGACGgCGTG; 370GE-F: ggcgCCTGGTcATCCCTGTCCACG and 370GE-R: aaacCGTGGACAGGGATgACCAGG. These primer pairs were then diluted to 10 µM with ultrapure water and mixed in equal amounts; the mixture was placed in a boiling water bath and allowed to cool to room temperature for preparation. One microgram of the pQY000140 vector was digested with BsaI enzyme at 37°C for 1 hour; after detection by agarose gel electrophoresis, the target fragment was recovered, its concentration was measured by UV absorption, and it was mixed with the annealed fragment at a 1:10 ratio. The resulting fragment was ligated with T4 DNA ligase (NEB, New England Biolabs, Boston, USA) at 16°C for 2 hours and then transformed into Trans5a competent cells (TransGen Biotech, Beijing). The transformed cells were cultured overnight at 37°C. The monoclonal components were sequenced using Sanger sequencing to confirm the sequence of the single-base editing vector. The constructed vector, pQY000141, is shown in Figure 13. The correctly sequenced E. coli was cloned, and the plasmid was extracted and transformed into EH105 Agrobacterium (Shanghai Weidi Biotechnology Co., Ltd.).

[0169] Huaidao No. 5 calli (at least 3,000 calli) were infected using the Agrobacterium infection method described above for rice calli. After Agrobacterium infection, the infected calli were transferred to 50 mg / L HYG screening medium for screening culture. After three rounds of screening (15 days x 3), blond calli showing good growth were selected and differentiated on differentiation medium. 0.2 μM tembotrione was added during the differentiation process and screened. After 3–4 weeks, approximately 1,500 seedlings measuring approximately 1 cm were obtained. Of the approximately 1,500 differentiated seedlings, most were bleached, with only four remaining normal green. These four seedlings were then transferred to rooting medium containing 0.4 μM tembotrione and cultured for two weeks. Two seedlings were bleached, while the other two remained green (Figure 14A). Genomic DNA was extracted from a small number of leaves using the CTAB method. PCR was performed using primers oshppd54F: TTCCACCACGTCGAGCTC and Oshppd356R: GGTGAACCCGGAGATGTACG. The amplified products were detected by 1% agarose electrophoresis and sequenced by Sanger sequencing.

[0170] Sequencing results showed that amino acid position 141 was successfully edited in both of the two green seedlings (QY000141-1 and QY000141-2) (Figure 14B), while the albino ones were wild-type.

[0171] (2) CRISPR / cas9-mediated homologous replacement of rice HPPD mutants for herbicide resistance After obtaining the overexpressed triple mutant H141R / G342D / D370N in a transgenic event, the combination of the three mutation sites was subjected to homologous substitution to obtain non-transgenic rice plants with herbicide tolerance.

[0172] The rice hppd gene has two exons and one intron. The three target sites, H141, G342, and D370, are located in the first exon.

[0173] gRNA design: At least one gRNA was designed upstream of H141 and downstream of D370, each with a single cut; three sites were simultaneously replaced by homologous replacement. The sequence of exon 1 was entered into http: / / crispor.tefor.net / to evaluate all possible gRNAs. By following the principle that a specific score value greater than 90 (Hsu PD, Scott DA, Weinstein JA, Ran FA, Konermann S, Agarwala V, Li Y, Fine EJ, Wu X, Shalem O, Cradick TJ, Marraffini LA, Bao G, Zhang F. Nat Biotechnol. 2013 Sep;31(9):827-32. doi: 10.1038 / nbt.2647. Epub 2013 Jul 21), off-target effects can be avoided, and the length should be as short as possible. The following two gRNAs are recommended: OshppdgRNA-PAM1-2: 5'-GGAACGCGAGCGCCTGGAAC CGG -3' (GC=70%) (bottom strand); and OshppdgRNA-PAM2-1 (GC=39%): 5'-CACCTCTTTCATGATGAAAA TGG The -3' (top strand) is selected, the underlined is the PAM sequence, and the bolded G means that the template DNA to be replaced is designed, and this G is changed to another base in the replacement template to destroy the PAM and avoid re-cutting after replacement.

[0174] The distribution of the two genes, gRNA1-2 and gRNA2-1, in rice genomic DNA is shown in Figure 15.

[0175] The design of the template donor DNA was based on a study conducted by the Zhaoyunde lab (Sun Y, Zhang X, Wu C, He Y, Ma Y, Hou H, Guo X, Du W, Zhao Y, Xia L. Engineering Herbicide-Resistant Rice Plants through CRISPR / Cas9-Mediated Homologous Recombination of Acetolactate Synthase. Mol Plant. 2016 Apr 4; 9(4): 628-31. doi: 10.1016 / j.molp.2016.01.001. Epub 2016 Jan. 6), as shown in Figure 16 . 350 bp homologous arms were first designed; to increase the possibility of homologous replacement, two versions of the template donor were designed for each editing vector; and the template was directly attached to the editing vector, so that the gRNA, Cas9, and template could be simultaneously transfected into the same cell. Once the cellular genome target DNA is cleaved by Cas9 and gRNA, the template donor DNA can be repaired in time. Another version is free template donor DNA generated by PCR amplification. These additional repair templates were mixed with the editing vector at a molar ratio of 20:1 (free repair template:editing vector) and bombarded with a gene gun. The length of the core replacement region of the three mutated amino acids 141-342-370 was determined by the two selected RNA target cleavage sites (i.e., 1056 bp). The left and right homology arms were each 350 bp long. After cleavage from the vector, 6 bp remained at each of the left and right ends, resulting in a total template length of 1768 bp. The NcoI cleavage site was removed to facilitate rapid genotyping of the PCR products after PCR amplification. The PAM (NGG) at the original cleavage site of the template was also removed to avoid re-cleavage after replacement.

[0176] The editing vectors, gRNA1-2 and gRNA2-1, were each expressed by the rice U3 promoter. The two gRNA expression cassettes were ligated together with a template and sent to GenScript Co., Ltd. (Nanjing) for synthesis. The synthesized DNA fragments were ligated into the backbone vector pCXUN-Cas9 at the KpnI site using seamless cloning technology (Huazhong Agricultural University and Dr. Yu Bing, Mol Plant. 2016 Apr 4;9(4):628-31. doi: 10.1016 / J.molp.2016.01.001. Epub 2016 Jan. 6) to generate the editing vector.

[0177] Gene gun transformation, seedling screening, differentiation, rooting, and soil culture: The editing vector constructed above was verified by sequencing and multi-enzyme digestion. It was then mixed with free template donor DNA generated by PCR amplification at a molar ratio of 20:1 (free repair template:editing vector), and Huaidao No. 5 calli were transformed by gene gun. Approximately 3,000 calli were transformed and transferred to 50 mg / L HYG screening medium for screening to obtain transgenic plants. After three rounds of screening (15 days x 3), blond calli showing good growth were selected and differentiated on differentiation medium. 0.2 μM tembotrione was added during the differentiation process for screening. After 3-4 weeks, approximately 1,000 seedlings, approximately 1 cm in diameter, were obtained. Of the approximately 1,000 differentiated seedlings, the majority were bleached, with only 21 remaining green. The 21 seedlings were transplanted into rooting medium containing 0.4 μM tembotrione and continuously cultivated to promote root growth. After two weeks, 19 seedlings bleached. The remaining two green seedlings (AW2 and AW3) were transplanted into pots and cultivated in a greenhouse. A photograph of the green seedlings taken before transplanting is shown in Figure 17A.

[0178] Identification of the hppd genotype of edited seedlings: To identify the genotype, three pairs of PCR primers were designed to amplify the 342-370 mutation site region, the 342-370 region and a portion of the downstream genomic DNA sequence, and a single site at 141. These primer pairs were: 290-F:AGATACAGACGTACCTGGACCACCA and 1553-R:GCCGGCAAAAAGGAACTGGG (342-370 mutation site region); 90-F:AGATACAGACGTACCTGGACCACCA and donor-out-R:AGTGATTGTACCATCATTTGTC (342-370 region and a portion of the downstream genomic DNA sequence); and 54-F:TTCCACCACGTCGAGCTC and 356-R:GGTGAACCCGGAGATGTACG (single site at 141).

[0179] The identification results indicated that two green seedlings were successfully edited (Figure 17B). The bands generated by digesting the PCR product with NcoI enzyme were as expected. Sequencing results showed that the wild-type histidine His was changed to arginine Arg at position 141 (codon change from CAC to CGC), the wild-type glycine Gly was changed to aspartic acid Asp at position 342 (codon change from GGC to GAC), and the wild-type aspartic acid Asn was changed to asparagine Asn at position 370 (codon change from GAC to AAC).

[0180] At the same time, numerous studies have shown that introducing the genes of the present invention into model plants such as Arabidopsis thaliana and Brachypodium distachyon improves herbicide resistance. Editing the above mutation sites and their combinations using the CRISPR / Cpf1 system can also be applied. As a result, when transgenic or gene editing techniques are applied to the above plants, such as food crops, legume crops, oilseed crops, fiber crops, fruit crops, root crops, vegetable crops, flower crops, medicinal crops, industrial crops, pasture crops, sugar crops, beverage crops, turfgrass plants, tree crops, and nut crops, the corresponding resistance characteristics can be obtained, which will be of great industrial value.

[0181] All publications and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication or patent application was individually or specifically indicated to be incorporated by reference herein.

[0182] Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be apparent that changes and modifications may be practiced which, within the scope of the appended claims, are within the scope of the invention.

Claims

1. A mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a biologically active fragment thereof, wherein the amino acid sequence of the mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein is the amino acid sequence of a wild-type p-hydroxyphenylpyruvate dioxygenase protein derived from a monocotyledonous plant, and has one or more mutations selected from the group consisting of 338D, 338S, 338Y and 342D at one or more positions corresponding to 338 and 342 in the amino acid sequence of the wild-type rice p-hydroxyphenylpyruvate dioxygenase protein represented by SEQ ID NO: 2, and the mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a biologically active fragment thereof has enhanced resistance or tolerance to HPPD-inhibiting herbicides.

2. The mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a biologically active fragment thereof according to claim 1, wherein the amino acid sequence of the mutant p-hydroxyphenylpyruvate dioxygenase protein has at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence represented by SEQ ID NO:

2.

3. The mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a biologically active fragment thereof according to claim 1, wherein the mutant p-hydroxyphenylpyruvate dioxygenase protein has the amino acid sequence represented by SEQ ID NO: 2, except that the mutant p-hydroxyphenylpyruvate dioxygenase protein has one or more amino acid mutations as defined in claim 1.

4. The mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a biologically active fragment thereof according to any one of claims 1 to 3, wherein the amino acid sequence of the mutant p-hydroxyphenylpyruvate dioxygenase protein has one or more mutations selected from the group consisting of N338D, N338S, N338Y, and G342D at one or more positions corresponding to 338 and 342 in the amino acid sequence of the wild-type rice p-hydroxyphenylpyruvate dioxygenase protein represented by SEQ ID NO:

2.

5. The mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a biologically active fragment thereof according to claim 4, wherein the mutant p-hydroxyphenylpyruvate dioxygenase protein has an amino acid sequence represented by SEQ ID NO: 22, SEQ ID NO: 44, SEQ ID NO: 46, or SEQ ID NO:

48.

6. The amino acid sequence of the mutant p-hydroxyphenylpyruvate dioxygenase protein has the following amino acid mutations: H141R / G342D, G342D / D370N, H141R / N338D, H141R / G342D, N338D / G342D, G342D / R346C, G342D / R346H, G338D / K418P, P277N / N338D, H141R / G342D / D370N, H141R / N338D / N420S, H141R / N338S / N420S, P336D / N338D / G342D, P336 / N338S / G342D, P336 / N338S / G34 2D, P336D / N338Y / G342D, N338D / G342D / R346C, N338D / G342D / R346H, N338 D / G342D / R346S, N338S / G342D / R346C, N338S / G342D / R346H, N338S / G342D / R346S, N338Y / G342D / R346C, N338Y / G342D / R346H, N338Y / G342D / R346S, P3 36D / G342D / R346C, P336D / G342D / R346H, P336D / G342D / R346S, P336D / N338 D / R346C, P336D / N338D / R346H, P336D / N338D / R346S, P336D / N338S / R346C , P336D / N338S / R346H, P336D / N338S / R346S, P336D / N338Y / R346C, P336D / N 338Y / R346H, P336D / N338Y / R346S, H141R / N338D / G342D, H141R / G342D / K41 8P, H141R / G342D / G419F, H141R / G342D / P386T, H141R / G342D / R346C, H141R / G342D / R346H, H141R / G342D / N420S, H141R / G342D / P277N, H141R / G342D / P336D, H141R / G342D / L276W, H141R / G342D / R346S, H141R / G342D / L390I, H1 41R / G342D / I377C, H141R / G342D / M392L, H141R / P337A / G342D, H141R / N338 S / G342D, H141R / N338Y / G342D, P277N / N338D / G342D, P277N / G342D / R346C,P277N / N338D / N420S, N338D / G342D / K418P, H141R / N338D / G342D / K418P, H141R / N338D / G342D / G419F, H141R / N338D / G342D / P386T, H141 R / N338D / G342D / R346C, H141R / N338D / G342D / R346H, H141R / G342D / K418P / G419F, H141R / G342D / L276W / P277N, P336D / N338D / G342D / R3 46C, P336D / N338D / G342D / R346H, P336D / N338D / G342D / R346S, P336D / N338S / G342D / R346C, P336D / N338S / G342D / R346H, P336D / N338S / G342D / R346S, P336D / N338Y / G342D / R346C, P336D / N338Y / G342D / R346H, P336D / N338Y / G342D / R346S, P277N / P336D / N338D / G342D, P277N / N338D / G342D / R346C, P277N / N338D / K418P / G419F, H141R / N338D / G342D / K418P / G419F, H141R / N338D / G342D / G419F / N420S, H141R / G33 6D / G342D / K418P / G419F / N420S, H141R / N338D / G342D / K418P / G419F / N420S, H141R / N338D / G342D / K418P / G419F / N420T, H141R / N338D / G 5. The mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a biologically active fragment thereof according to claim 4, having the following structure: 342D / R346C / K418P / G419F / N420S, H141R / N338D / G342D / R346H / K418P / G419F / N420S, H141R / P277N / N338D / G342D / K418P / G419F / N420S, H141R / P277N / P336D / N338D / G342D / K418P / G419F / N420S.

7. The mutant p-hydroxyphenylpyruvate dioxygenase protein is selected from the group consisting of SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:30, SEQ ID NO:86, SEQ ID NO:88, SEQ ID NO:90, SEQ ID NO:96, SEQ ID NO:98, SEQ ID NO:102, SEQ ID NO:104, SEQ ID NO:108, SEQ ID NO:110, SEQ ID NO:112, SEQ ID NO:114, SEQ ID NO:120, SEQ ID NO:122, SEQ ID NO:124, SEQ ID NO:126, SEQ ID NO:128, SEQ ID NO:130, SEQ ID NO:132, SEQ ID NO:134, SEQ ID NO:136, SEQ ID NO:138, SEQ ID NO:140, SEQ ID NO:142, SEQ ID NO:144, SEQ ID NO:146, SEQ ID NO:148, SEQ ID NO:150, SEQ ID NO:152, SEQ ID NO:154, SEQ ID NO:156, SEQ ID NO:158, SEQ ID NO:160, SEQ ID NO:162, SEQ ID NO:164, SEQ ID NO:166, SEQ ID NO:168, SEQ ID NO:170, SEQ ID NO:172, SEQ ID NO:174, SEQ ID NO:176, SEQ ID NO:178, SEQ ID NO:180, The mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein of claim 6, or a biologically active fragment thereof, having the amino acid sequence represented by SEQ ID NO:182, SEQ ID NO:184, SEQ ID NO:186, SEQ ID NO:188, SEQ ID NO:190, SEQ ID NO:192, SEQ ID NO:194, SEQ ID NO:196, SEQ ID NO:198, SEQ ID NO:200, SEQ ID NO:202, SEQ ID NO:204, SEQ ID NO:206, SEQ ID NO:208, SEQ ID NO:210, SEQ ID NO:212, SEQ ID NO:214, SEQ ID NO:216, SEQ ID NO:218, SEQ ID NO:220, SEQ ID NO:222, SEQ ID NO:224, SEQ ID NO:226, SEQ ID NO:228, SEQ ID NO:230, SEQ ID NO:232, SEQ ID NO:234, SEQ ID NO:236, SEQ ID NO:238, SEQ ID NO:240, SEQ ID NO:242, SEQ ID NO:244, SEQ ID NO:246, SEQ ID NO:248, SEQ ID NO:250, SEQ ID NO:252, SEQ ID NO:254, SEQ ID NO:256, SEQ ID NO:258, or SEQ ID NO:

260.

8. 8. The mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a biologically active fragment thereof according to any one of claims 1 to 7, wherein the HPPD-inhibiting herbicide is selected from the group consisting of tembotrione, fenpyrazone, sipirafluone, topramezone, mesotrione, and bipyrazone.

9. A fusion protein comprising the mutant HPPD protein or a biologically active fragment thereof according to any one of claims 1 to 8 and an additional component fused thereto.

10. The fusion protein of claim 9 , wherein the additional component is selected from the group consisting of a tag peptide and a plastid-directing peptide.

11. The fusion protein of claim 10, wherein the tag peptide is 6xHis.

12. The fusion protein according to claim 10, wherein the plastid-targeting peptide is a chloroplast-targeting peptide. (a) a nucleic acid sequence encoding the mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a biologically active fragment thereof according to any one of claims 1 to 8, or the fusion protein according to any one of claims 9 to 12; or (b) the complement of the nucleic acid sequence of (a); 1. An isolated polynucleotide comprising: The polynucleotide is DNA, RNA or a hybrid thereof, and is single-stranded or double-stranded.

14. (1) SEQ ID NO: 22, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, SEQ ID NO: 140, SEQ ID NO: 142, SEQ ID NO: 144, SEQ ID NO: 146, SEQ ID NO: 148, SEQ ID NO: 150, SEQ ID NO: 152, SEQ ID NO: 154, SEQ ID NO: 156, SEQ ID NO: 158, SEQ ID NO: 160, SEQ ID NO: 162, SEQ ID NO: 164, SEQ ID NO: 166, SEQ ID NO: 168, SEQ ID NO: 170, SEQ ID NO: 172, SEQ ID NO: 174, SEQ ID NO: 176, sequence a nucleic acid sequence encoding the amino acid sequence set forth in SEQ ID NO:178, SEQ ID NO:180, SEQ ID NO:182, SEQ ID NO:184, SEQ ID NO:186, SEQ ID NO:188, SEQ ID NO:190, SEQ ID NO:192, SEQ ID NO:194, SEQ ID NO:196, SEQ ID NO:198, SEQ ID NO:200, SEQ ID NO:202, SEQ ID NO:204, SEQ ID NO:206, SEQ ID NO:208, SEQ ID NO:210, SEQ ID NO:212, SEQ ID NO:214, SEQ ID NO:216, SEQ ID NO:218, SEQ ID NO:220, SEQ ID NO:222, SEQ ID NO:224, SEQ ID NO:226, SEQ ID NO:228, SEQ ID NO:230, SEQ ID NO:232, SEQ ID NO:234, SEQ ID NO:236, SEQ ID NO:238, SEQ ID NO:240, SEQ ID NO:242, SEQ ID NO:244, SEQ ID NO:246, SEQ ID NO:248, SEQ ID NO:250, SEQ ID NO:252, SEQ ID NO:254, SEQ ID NO:256, SEQ ID NO:258 or SEQ ID NO:260, or a complementary sequence thereof; (2) SEQ ID NO: 21, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 119, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, SEQ ID NO: 127, SEQ ID NO: 129, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137, SEQ ID NO: 139, SEQ ID NO: 141, SEQ ID NO: 143, SEQ ID NO: 145, SEQ ID NO: 147, SEQ ID NO: 149, SEQ ID NO: 151, SEQ ID NO: 153, SEQ ID NO: 155, SEQ ID NO: 157, SEQ ID NO: 159, SEQ ID NO: 161, SEQ ID NO: 163, SEQ ID NO: 165, SEQ ID NO: 167, SEQ ID NO: 169, SEQ ID NO: 171, SEQ ID NO: 173, SEQ ID NO: a nucleic acid sequence represented by SEQ ID NO:175, SEQ ID NO:177, SEQ ID NO:179, SEQ ID NO:181, SEQ ID NO:183, SEQ ID NO:185, SEQ ID NO:187, SEQ ID NO:189, SEQ ID NO:191, SEQ ID NO:193, SEQ ID NO:195, SEQ ID NO:197, SEQ ID NO:199, SEQ ID NO:201, SEQ ID NO:203, SEQ ID NO:205, SEQ ID NO:207, SEQ ID NO:209, SEQ ID NO:211, SEQ ID NO:213, SEQ ID NO:215, SEQ ID NO:217, SEQ ID NO:219, SEQ ID NO:221, SEQ ID NO:223, SEQ ID NO:225, SEQ ID NO:227, SEQ ID NO:229, SEQ ID NO:231, SEQ ID NO:233, SEQ ID NO:235, SEQ ID NO:237, SEQ ID NO:239, SEQ ID NO:241, SEQ ID NO:243, SEQ ID NO:245, SEQ ID NO:247, SEQ ID NO:249, SEQ ID NO:251, SEQ ID NO:253, SEQ ID NO:255, SEQ ID NO:257 or SEQ ID NO:259, or a complementary sequence thereof; (3) a nucleic acid sequence that hybridizes under stringent conditions with the sequence set forth in (1) or (2); and (4) A nucleic acid sequence that encodes the same amino acid sequence as the sequence shown in (1) or (2) due to the degeneracy of the genetic code, or its complementary sequence.

14. The polynucleotide of claim 13, having a nucleic acid sequence selected from:

15. 15. The polynucleotide of claim 14, wherein the nucleic acid sequence is optimized for expression in a plant cell.

16. A nucleic acid construct comprising the polynucleotide of any one of claims 13 to 15 and a regulatory element operably linked thereto.

17. An expression vector comprising the polynucleotide according to any one of claims 13 to 15 and an expression control element operably linked thereto.

18. A host cell comprising the polynucleotide of any one of claims 13 to 15, the nucleic acid construct of claim 16, or the expression vector of claim 17.

19. The host cell of claim 18 , wherein the host cell is a plant cell.

20. 20. A method for producing a plant with improved herbicide resistance or tolerance, comprising regenerating the plant cell of claim 19 into a plant.

21. 21. A plant produced by the method of claim 20.

22. The plant described in claim 21, wherein the plant is a dicotyledonous plant or a monocotyledonous plant.

23. The plant of claim 21, wherein the plant is a food crop, a legume crop, an oil crop, a fiber crop, a fruit crop, a root crop, a vegetable crop, a flower crop, a medicinal crop, an industrial crop, a pasture crop, a sugar crop, a beverage crop, a turf plant, a tree crop, or a nut crop.

24. A method for improving the resistance or tolerance of a plant cell, plant tissue, plant part or plant to an HPPD-inhibiting herbicide, the method comprising expressing a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a biologically active fragment thereof according to any one of claims 1 to 8, or a fusion protein according to any one of claims 9 to 12 in the plant cell, plant tissue, plant part or plant; or or, comprising crossing a plant expressing a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a biologically active fragment thereof according to any one of claims 1 to 8, or a fusion protein according to any one of claims 9 to 12, with another plant, and screening for plants or parts thereof with improved resistance or tolerance to HPPD-inhibiting herbicides; Gene editing of an endogenous HPPD protein in a plant cell, plant tissue, plant part, or plant to achieve expression of a mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a biologically active fragment thereof according to any one of claims 1 to 8, or a fusion protein according to any one of claims 9 to 12, The HPPD-inhibiting herbicides are selected from the group consisting of 1) triketones: sulcotrione, mesotrione, bicyclopyrone, tembotrione, tefuryltrione, and benzobicyclone; 2) diketones: 2-cyano-3-cyclopropyl-1-(2-methylsulfonyl-4-trifluoromethylphenyl)propane-1,3-dione, 2-cyano-3-cyclopropyl-1-(2-methylsulfonyl-3,4-dichlorophenyl)propane-1,3-dione, and 2-cyano-1-[4-(methylsulfonyl)-2-trifluoromethylphenyl]propane-1,3-dione. 3) isoxazoles: isoxaflutole, isoxachlorthole, and clomazone; 4) pyrazoles: topramezone, pyrasulfotole, pyrazoxyfen, pyrazolate, benzofenap, bipyrazone, tolpyralate, fenpyrazone, sipirafluone, and sanzuofankaotone; 5) benzophenones; and 6) others: lancotrione, fenquinotrione.

25. 25. The method of claim 24, wherein the HPPD-inhibiting herbicide is selected from the group consisting of tembotrione, fenpyrazone, sipirafluone, topramezone, mesotrione, and bipyrazone.

26. The method described in claim 24 or 25, wherein the plant is a dicotyledonous or monocotyledonous plant.

27. ​​The method described in claim 24 or 25, wherein the plant is a food crop, a legume crop, an oil crop, a fiber crop, a fruit crop, a root crop, a vegetable crop, a flower crop, a medicinal crop, an industrial crop, a pasture crop, a sugar crop, a beverage crop, a turf plant, a tree crop, or a nut crop.

28. 16. Use of the mutant p-hydroxyphenylpyruvate dioxygenase (HPPD) protein or a biologically active fragment thereof according to any one of claims 1 to 8, the fusion protein according to any one of claims 9 to 12, or the polynucleotide according to any one of claims 13 to 15, for improving the resistance or tolerance of a host cell, a plant cell, a plant tissue, a plant part, or a plant to an HPPD-inhibiting herbicide, wherein the HPPD-inhibiting herbicide is selected from the group consisting of 1) triketones: sulcotrione, mesotrione, bicyclopyrone, tembotrione, tefuryltrione, and benzobicyclone; 2) diketones: 2-cyano-3-cyclopropyl-1-(2-methylsulfonyl-4-trifluoromethylphenyl)propane- 1) a benzophenone; 2) a benzophenone-1,3-dione, 2-cyano-3-cyclopropyl-1-(2-methylsulfonyl-3,4-dichlorophenyl)propane-1,3-dione, and 2-cyano-1-[4-(methylsulfonyl)-2-trifluoromethylphenyl]-3-(1-methylcyclopropyl)propane-1,3-dione; 3) isoxazoles: isoxaflutole, isoxachlorthole, and clomazone; 4) pyrazoles: topramezone, pyrasulfotole, pyrazoxyfen, pyrazolate, benzofenap, bipyrazone, tolpyralate, fenpyrazone, sipirafluone, and sanzuofankaotone; 5) benzophenones; and 6) others: lancotrione, fenquinotrione.

29. 29. The use according to claim 28, wherein the HPPD-inhibiting herbicide is selected from the group consisting of tembotrione, fenpyrazone, sipirafluone, topramezone, mesotrione and bipyrazone.

30. 30. The use according to claim 29, wherein the host cell is a bacterial cell or a fungal cell.

31. The use described in claim 28 or 29, wherein the plant is a dicotyledonous or monocotyledonous plant.

32. The use of claim 28 or 29, wherein the plant is a food crop, a legume crop, an oil crop, a fiber crop, a fruit crop, a root crop, a vegetable crop, a flower crop, a medicinal crop, an industrial crop, a pasture crop, a sugar crop, a beverage crop, a turf plant, a tree crop, or a nut crop.

33. 26. A method for controlling weeds in a locus of growing plants, comprising applying to the locus a herbicidally effective amount of one or more HPPD-inhibiting herbicides, wherein the plant comprises the plant of claim 21 or a plant produced by the method of any one of claims 20 and 24, and wherein the HPPD-inhibiting herbicides are selected from the group consisting of the following active ingredients: 1) triketones: sulcotrione, mesotrione, bicyclopyrone, tembotrione, tefuryltrione, and benzobicyclone; 2) diketones: 2-cyano-3-cyclopropyl-1-(2-methylsulfonyl-4-trifluoromethylphenyl)propane-1,3-dione, ... 2) 2-(4-(methylsulfonyl)-3,4-dichlorophenyl)propane-1,3-dione and 2-cyano-1-[4-(methylsulfonyl)-2-trifluoromethylphenyl]-3-(1-methylcyclopropyl)propane-1,3-dione; 3) isoxazoles: isoxaflutole, isoxachlorthole, and clomazone; 4) pyrazoles: topramezone, pyrasulfotole, pyrazoxyfen, pyrazolate, benzofenap, bipyrazone, tolpyralate, fenpyrazone, sipirafluone, and sanzuofankaotone; 5) benzophenones; and 6) others: lancotrione, fenquinotrione.

34. 34. The method of claim 33, wherein the HPPD-inhibiting herbicide comprises at least one active ingredient: tembotrione, fenpyrazone, sipirafluone, topramezone, mesotrione, and bipyrazone.

35. 35. The method of claim 33 or 34, wherein the plant is a dicotyledonous or monocotyledonous plant.

36. 35. The method of claim 33 or 34, wherein the plant is a food crop, legume crop, oil crop, fiber crop, fruit crop, root crop, vegetable crop, flower crop, medicinal crop, industrial crop, pasture crop, sugar crop, beverage crop, turf plant, tree crop, nut crop or the like.

Images