Compositions and methods for modulating TCF4 gene expression and treating Pitt-Hopkins syndrome
A recombinant nucleic acid construct with a mini-promoter linked to TCF4 polypeptide, delivered via viral vectors, addresses TCF4 haploinsufficiency in neurological disorders by enhancing TCF4 and SOX gene expression, improving neuronal development and function in Pitt-Hopkins syndrome.
Patent Information
- Application Number
- JP2023519419
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2020-09-30
- Filing Date
- 2021-09-30
- Publication Date
- 2025-12-16
- Estimated Expiration
- 2041-09-30
AI Technical Summary
Neurological and neurodevelopmental disorders such as Pitt-Hopkins syndrome, schizophrenia, and autism spectrum disorders are characterized by significant cognitive impairment and genetic overlap, with limited understanding of TCF4 gene regulation and downstream gene expression, leading to complex symptoms including intellectual disability and epilepsy.
A recombinant nucleic acid construct with a mini-promoter operably linked to a TCF4 polypeptide coding sequence, delivered via viral vectors like AAV9, is used to increase expression of TCF4 and its target genes SOX3 and SOX4 in neurons, addressing TCF4 haploinsufficiency.
The approach enhances neuronal development and function, rescuing abnormal phenotypes in Pitt-Hopkins syndrome by increasing TCF4 and SOX gene expression, improving neural progenitor proliferation and neuronal differentiation, and restoring electrophysiological properties.
Smart Images

Figure 0007786750000004 
Figure 0007786750000005 
Figure 0007786750000006
Abstract
Description
[Technical Field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority under 35 U.S.C. § 119 to U.S. Provisional Application No. 63 / 085,878, filed September 30, 2020, the disclosure of which is incorporated herein by reference.
[0002] Technical Field The present disclosure relates to methods and compositions for treating neurological or neurodevelopmental diseases and disorders.
[0003] INCORPORATION BY REFERENCE TO SEQUENCE LISTING This application is accompanied by a Sequence Listing entitled "Sequence-Listing_ST25," created on September 30, 2021, containing 40,086 bytes of data, and machine-formatted for an IBM-PC MS-Windows operating system, which is hereby incorporated by reference in its entirety for all purposes. [Background technology]
[0004] Neurological and neurodevelopmental diseases and disorders, including schizophrenia, autism, and autism spectrum disorders, are chronic and debilitating. Pitt-Hopkins syndrome (PTHS) and 18q syndrome are rare neurodevelopmental disorders characterized by symptoms including intellectual disability, impaired language acquisition, motor learning disorders, hyperventilation, epilepsy, autistic behavior, and gastrointestinal abnormalities. A specific single nucleotide polymorphism (SNP) at the genomic locus containing TCF4 was one of the first to reach genome-wide significance in a clinical genome-wide association study (GWAS) for schizophrenia. Each of these neuropsychiatric disorders is characterized by significant cognitive impairment, suggesting not only genetic overlap but also potential pathophysiological overlap between these disorders.
[0005] TCF4 is a basic helix-loop-helix (bHLH) transcription factor (TF) that forms homodimers or heterodimers with itself or other bHLH TFs. TCF4 dimerization allows recognition of an E-box binding site (motif: CANNTG), and direct binding to DNA can result in transcriptional repression or activation, depending on the protein complex bound to TCF4. The TCF4 gene is highly expressed throughout the CNS during human development, but regulation of its expression and splicing is complex, as multiple alternative transcripts containing different 5' exons and internal splicing have been identified. The genes regulated downstream of TCF4 are not fully understood, due to the limited specificity of the E-box sequence and the context-dependent regulation of TCF4 through heterodimerization, developmental expression, and cell-type specificity. Summary of the Invention [Problem to be solved by the invention]
[0006] Means to solve the problem The present disclosure provides methods and compositions useful for the delivery of molecules into cells.
[0007] The present disclosure provides a recombinant nucleic acid construct comprising a mini-promoter operably linked to a coding sequence for a TCF4 polypeptide. In one embodiment, the nucleic acid further comprises one or more transcription factor binding motifs. In a further embodiment, the one or more transcription factor binding motifs are microE5 motifs. In another further embodiment, the recombinant nucleic acid comprises 1 to 15 microE5 motifs. In yet another further embodiment, the recombinant nucleic acid comprises at least 5 microE5 motifs, at least 10 microE5 motifs, or at least 12 microE5 motifs. In another or a further embodiment, the recombinant nucleic acid has the following general structure: microE5 n-mini-promoter-TCF4 coding sequence, where n is an integer ranging from 5 to 15. In yet another or further embodiments, the microE5 motif comprises the nucleotide sequence of SEQ ID NO: 10. In yet another or further embodiments of any of the preceding embodiments, the TCF4 polypeptide is TCF4-B. In further embodiments, the TCF4 polypeptide comprises an amino acid sequence having at least 85%, 90%, 95%, 98% or more sequence identity to SEQ ID NO: 2. In yet another or further embodiments of any of the preceding embodiments, the TCF4 coding sequence comprises a nucleotide sequence having at least 80%, 85%, 90%, 95% or more identity to SEQ ID NO: 1. In yet another embodiment, the TCF4 coding sequence hybridizes under stringent conditions to a sequence consisting of SEQ ID NO: 1. In yet another embodiment, the mini-promoter of any of the preceding embodiments comprises a core promoter. In further embodiments, the mini-promoter comprises a nucleotide sequence having at least 70%, 80%, 90% or more sequence identity to SEQ ID NO: 3. In another embodiment, the mini-promoter comprises the nucleotide sequence of SEQ ID NO: 3, optionally with 1 to 5 nucleotide alterations independently selected from deletions, insertions, and substitutions. In yet another or further of any of the foregoing embodiments, the nucleic acid construct comprises a nucleotide sequence that is at least 80% identical to any of SEQ ID NOs: 4, 5, 6, 7, or 8.
[0008] The present disclosure also provides a vector comprising any of the above-described recombinant nucleic acids. In a further embodiment, the vector is a viral vector. In another further embodiment, the viral vector is a retroviral vector. In yet another further embodiment, the vector is an adeno-associated viral (AAV) vector, a lentiviral vector, or a gamma-retroviral vector. In another further embodiment, the vector is an AAV9 vector.
[0009] The present disclosure also provides a recombinant cell comprising a recombinant nucleic acid of the present disclosure or a vector of the present disclosure.
[0010] The present disclosure also provides pharmaceutical compositions comprising the vectors of the present disclosure.
[0011] The present disclosure also provides a method of treating a neurological or neurodevelopmental disease or disorder in a subject, comprising transforming a neuron of the subject with a recombinant nucleic acid of the present disclosure, administering a vector of the present disclosure, or administering a pharmaceutical composition of the present disclosure to the subject. In yet another embodiment, the neurological or neurodevelopmental disease or disorder is Pitt-Hopkins syndrome, schizophrenia, autism, autism spectrum disorder, or 18q syndrome. In yet another embodiment, the neurological or neurodevelopmental disease or disorder is Pitt-Hopkins syndrome and is associated with TCF4 haploinsufficiency. In yet another or further embodiment, the subject has one or more single nucleotide polymorphisms in the TCF4 gene. In yet another or further embodiment, the subject has a chromosomal deletion comprising at least a portion of the TCF4 gene. In a further embodiment, the subject has a complete deletion of the TCF4 gene. In yet another embodiment, the subject has a chromosomal translocation comprising at least a portion of the TCF4 gene. In another embodiment, the subject has a translocation, frameshift, or nonsense mutation in the TCF4 gene. In another or further embodiment, the subject is an infant or child. In a further embodiment, the subject is about 16 years old or younger. In yet another embodiment, the subject is about 12 years old or younger. In yet another embodiment, the subject is about 8 years old or younger, about 5 years old or younger, or about 2 years old or younger. In another embodiment, the subject is an adult subject.
[0012] The present disclosure also provides a method of treating a neurological or neurodevelopmental disease or disorder associated with TCF4 haploinsufficiency in a subject, the method comprising increasing expression of one or more of SOX3 and SOX4 in neurons of the subject. In another embodiment, expression of SOX3 and / or SOX4 is increased by introducing into the neuron a recombinant nucleic acid expressing a TCF4-B polypeptide. In a further embodiment, the recombinant nucleic acid comprises a mini-promoter operably linked to a coding sequence for a TCF4-B polypeptide. In another further embodiment, the recombinant nucleic acid further comprises one or more transcription factor binding motifs. In a further embodiment, the one or more transcription factor binding motifs are microE5 motifs. In another further embodiment, the recombinant nucleic acid comprises 1 to 15 microE5 motifs. In yet another or further embodiment, the recombinant nucleic acid comprises at least 5, at least 10, or at least 12 microE5 motifs. In another embodiment, the nucleic acid comprises a microE5 motif. n-minipromoter-TCF4 coding sequence, where n is an integer ranging from 5 to 15. In yet another or further embodiment, the microE5 motif comprises the nucleotide sequence of SEQ ID NO: 10. In yet another or further embodiment, the recombinant nucleic acid expressing the TCF4-B polypeptide is delivered to the subject by a viral vector. In a further embodiment, the viral vector is a retroviral vector. In another further embodiment, the vector is an adeno-associated viral (AAV) vector, a lentiviral vector, or a gamma-retroviral vector. In a further embodiment, the vector is an AAV9 vector. In another or further embodiment of any of the foregoing embodiments, the neurological or neurodevelopmental disease or disorder is Pitt-Hopkins syndrome, schizophrenia, autism, autism spectrum disorder, or 18q syndrome. In a further embodiment, the neurological or neurodevelopmental disease or disorder is Pitt-Hopkins syndrome. In yet another or further embodiment of any of the foregoing embodiments, the subject has one or more single nucleotide polymorphisms in the TCF4 gene. In yet another or further embodiment of any of the foregoing embodiments, the subject has a chromosomal deletion involving at least a portion of the TCF4 gene. In yet another or further embodiment of any of the foregoing embodiments, the subject has a complete deletion of the TCF4 gene. In yet another or further embodiment of any of the foregoing embodiments, the subject has a chromosomal translocation involving at least a portion of the TCF4 gene. In yet another or further embodiment of any of the foregoing embodiments, the subject has a translocation, frameshift, or nonsense mutation in the TCF4 gene. In yet another or further embodiment of any of the foregoing embodiments, the subject is an infant or child. In a further embodiment, the subject is about 16 years of age or younger, about 12 years of age or younger, about 8 years of age or younger, about 5 years of age or younger, or about 2 years of age or younger. In another embodiment, the subject is an adult subject.
[0013] The details of one or more embodiments are set forth in the accompanying drawings and the description below. Other features, objects, and advantages will become apparent from the description and drawings, and from the claims. [Brief explanation of the drawings]
[0014] [Figure 1A-B] Figure 1 shows the expression levels of TCF4 in neural progenitor cells. (A) Each bar represents the abundance of TCF4 expression (transcripts per million) in RNA-sequencing libraries generated from PTHS individuals (red bars) and healthy controls (black bars), the parents of affected offspring. Transcript isoforms on the horizontal axis are named according to the Ensembl database entry for the human TCF4 gene. (B) Correspondence between each transcript variant and its respective protein isoform, named according to Sepp et al., 2011 (Functional Diversity of Human Basic Helix-Loop-Helix Transcription Factor TCF4 Isoforms Generated by Alternative 59 Exon Usage and Splicing. PLoS ONE 6(7): e22138. doi:10.1371 / journal.pone.0022138). [Figure 2A-C] Construction and validation of DNA cassettes for TCF4 overexpression. (A) Schematic representation of expression constructs in which the TCF4-B cDNA sequence is under the control of a minimal promoter (minP) preceded by various numbers of μE5 boxes. (B) Western blot analysis of TCF4 protein in HEK293 cells expressing the constructs shown in A, as well as empty vector and "no DNA" controls. Representative blot of n=3 replicates. β-Actin was used as a loading control. (C) DNA sequence of the regulatory elements preceding the TCF4-B coding sequence in an example of a DNA construct generated in this study, containing 12 μE5 boxes and the minimal promoter minP. [Figure 3A-B]Figure 2 shows increased expression of TCF4 and one of its target genes after transduction of patient-derived neural progenitor cells with a DNA construct. (A) Relative expression levels of the TCF4 gene in a control cell line (orange bars) and a PTHS-derived cell line (blue bars) after transduction with lentiviral particles (viral vectors) containing 12 or 6 μE5 boxes, according to the details outlined in Figure 2C. Two patient lines and a control were used in the experiment. n = 3 biological replicates per treatment, and triplicate technical replicates per biological replicate. (B) As in A, but for the GADD45G gene, one of the known targets of TCF4 in human progenitor cells. The bar representing the control line transduced with viral particles is grayed out to highlight the comparison with the orange bar (normal levels of GADD45G expression) and the blue bar (expression in affected cells before and after genetic manipulation). [Figure 4A-E] FIG. 1 provides exemplary TCF4 cassettes (SEQ ID NOs: 4-8) of the present disclosure. [Figure 5A-E]PTHS organoids exhibit abnormal development and altered neural progenitor and cortical neuron content. (A) Brightfield microscopy images of mantle cortex organoids (CtOs) derived from control (parental) and PTHS individuals over 4 weeks of in vitro culture. (B) Left: Distribution of CtO size at 4 weeks of in vitro culture for four parent-offspring pairs (see Table 1 for a description of the subjects involved in this study). Right: Mean CtO size at 4 weeks. N = 4 subjects per group (indicated by different symbols according to the legend in Table 1), 12–30 organoids per subject. (C) Microscopy images of control and PTHS submantle organoids (sPOs) over 4 weeks of in vitro culture. Due to the large size of the organoids, images at week 4 were taken directly from 3.5 cm diameter plates. (D) Quantification of SOX2+ cell content at two stages of development. N = 4 subjects (symbols), 3 batches per subject, 6 organoids per batch, 4 random 100 x 100 μm regions of interest (ROIs) per organoid. For quantification of SOX2+ cells in the sPO, see Figure 12F. (E) Quantification of the content of CTIP2-expressing cortical neurons at two stages of CtO development. N = 4 subjects (symbols), 3 batches per subject, 6 organoids per batch, 4 random ROIs per organoid. For quantification of SATB2+ cells in the CtO, see Figure 12G. [Figure 6A-J]This figure shows that PTHS organoids increased the percentage of neural progenitors and decreased the percentage of excitatory cortical neurons and inhibitory interneurons. (A) Uniform manifold approximation and projection (UMAP) two-dimensional reduction of single-cell RNA-Seq transcriptome profiling of CtO and sPO derived from parental control and PTHS organoids. Color codes represent six annotated subpopulations: Pr-Glut, neural progenitors of the glutamatergic lineage; IP-Glut, intermediate progenitors of the glutamatergic lineage; N-Glut, glutamatergic neurons; Pr-GABA, neural progenitors of the inhibitory lineage; IP-GABA, intermediate progenitors of the inhibitory lineage; and N-GABA, GABAergic interneurons (see also Figure 13A). Other cell types are not shown. (B) Trajectory analysis showing the presence of distinct cell lineages in the CtO and sPO. Color maps represent progression along pseudotime in each lineage (glutamatergic or GABAergic). (C) Comparison of the content of different cell types between the parental CtO and the PTHS CtO. Color coding is the same as in A. Black dots represent cells from other populations not depicted in A. (D) Quantification of the percentage of cell types in each subpopulation of the CtO (color coding is the same as in A). (E) Left: SOX2 expression levels in the Pr-Glut subpopulation of the CtO; each dot represents a single cell. Right: Percentage of cells expressing SOX2 (above a threshold equal to 40% of the mean). (F) Comparison of cell populations between the parental sPO and the PTHS sPO. (G) Quantification of the percentage of cell types in each subpopulation of the sPO. (H) Left: SOX2 expression levels in the Pr-GABA subpopulation of the sPO. Right: Percentage of SOX2+ cells. (I, J) Left: Expression of CTIP2 and SATB2 (I) or GAD2 (J) in the N-Glut subpopulation of the CtO (I) or the N-GABA subpopulation of the sPO (J). Right: Significant reduction in the percentage of neuronal subtypes (expression above a threshold corresponding to 40% of the mean) in the PTHS CtO and sPO. [Figure 7A-H]PTHS neurons exhibit abnormal electrophysiological properties and gene expression programs. (A) Left: CtO seeded on a multielectrode array (MEA) plate. Right: Average firing rate in CtO. N = 4 subjects per group (symbols), triplicate independent replicates per subject. (B) iPSC-derived neurons immunostained for MAP2 (white) under two-dimensional culture conditions. (C) Comparison of axon length and cell body area between parent- and PTHS-derived neurons. Median values are indicated by colored lines. N = 30–80 neurons per line (dots) from subjects in parent-child pairs #1 and #4. (D) Patch-clamp electrophysiology of iPSC-derived neurons showing reduced spike frequency (top) and intrinsic excitability (bottom) in PTHS neurons. N = 10 (parent) or 9 (PTHS) neurons. (E) Comparison of sodium and potassium current measurements between PTHS (blue line) and parental controls (orange line). N = 10 (parent) or 9 (PTHS) neurons. (F) Left: Expression of FOS in N-Glut neurons of the CtO; violin diagrams represent the distribution of gene expression in each population; N = 1,401 (parent) and 380 (PTHS) cells. Right: Percentage of FOS+ cells. (G) Relative expression (RT-qPCR) of selected neuronal genes in iPSC-derived neurons. N = 4 subjects per group (symbols), triplicate independent replicates per subject, duplicate technical replicates per sample. In the control group, the mean value of gene expression was normalized to 1. STMN2, stathmin 2; TAC1, tachykinin precursor 1; CNTN2, contactin 1; INA, internexin neuronal intermediate filament protein alpha; ADCYAP1, adenylate cyclase-activating polypeptide 1; SYT13, synaptotagmin 13; and SLC17A6, vesicular glutamate transporter 2 (VGLUT2). (H) Expression of the same genes as in G in single-cell transcriptome data from N-GABA neurons of the sPO. Sample size is the same as in F. Bars represent mean + SEM.ns indicates no statistically significant difference, *p<0.05, **p<0.01, ***p<0.001; Kruskal-Wallis H test (F and H), Welch t test (A), ANOVA with Geisser-Greenhouse correction for repeated measures followed by LSD post-hoc test (C), or ANOVA followed by HSD post-hoc test (D and E). Scale bar is 100 μm. In F and H, statistical comparisons are between the mean gene expression values for each gene. [Figure 8A-J]PTHS neural progenitor cells proliferate at a slower rate. (A) Left: Immunostaining of CtOs at 2 weeks for SOX2 and MAP2. Arrowheads indicate example rosettes. Middle: Graph showing the number of rosettes in parental and PTHS organoids at 2 weeks. Right: Density of SOX2+ cells in organoids. N = 4 subjects per group (symbols), triplicate technical replicates. (B) Left: NPC growth curve; line represents average cell number; N = 3 independent replicates / time point (circles), triplicate technical replicates. Right: Relative viable cell number of neural progenitor cells after 4 days in culture (starting cell number = 100,000). N = 4 subjects per group (symbols), triplicate biological replicates, triplicate technical replicates. (C) Quantification of Annexin V-positive (apoptotic) cells in NPCs. N = 4 subjects per group (symbols), triplicate independent replicates per subject. (D) Viable cell counts in NPC proliferation assay. N = 4 subjects per group (symbols), triplicate independent replicates per subject. (E) Left: Flow cytometry assessment of EdU-positive (dividing) NPCs. Right: Percentage of EdU+ cells; N = 3 subjects per group (symbols), triplicate independent replicates per subject, sextuplicate technical replicates. (F) Morphological abnormalities in PTHS NPCs showing flattened, enlarged cells (arrowheads). (G) Left: Staining for senescence-associated β-galactosidase (SA-β-gal) activity in NPCs (green fluorescence). Quantification is shown on the right. N = 4 subjects per group (symbols), triplicate independent replicates per subject. (H) Relative expression of CDKN2A (cyclin-dependent kinase inhibitor 2A; left) and LMNB1 (lamin B1; right) in NPCs. N=4 subjects per group (symbols), triplicate independent replicates per subject, duplicate technical replicates. (I) Relative expression of CDKN2A in postmortem PTHS cortical samples. (J) Quantification of p16INK4a+ cells (left) and apoptotic cells (cleaved caspase 3, CC3+; right) in CtO. N=4 subjects per group (symbols), two batches, six organoids per batch, four 100x100µm ROIs per organoid. All bars represent mean + SEM. ns = not statistically significant.*p<0.05, **p<0.01, ***p<0.001; ANOVA (left panel in C) or Welch t-test for remaining comparisons. In panel H, mean gene expression in controls was normalized to 1. DAPI nuclear staining is in blue. Scale bar is 100 μm. [Figure 9A-K]Figure 1 shows that manipulation of the Wnt signaling pathway rescues PTHS neural progenitor cells from abnormal proliferation. (A) Ratio of expression abundance (transcripts per million, TPM) of Wnt signaling pathway genes between parental and PTHS NPCs. N = 4 parent-child pairs (symbols). (B) Relative expression of selected Wnt signaling genes in NPCs. N = 4 subjects per group (symbols), triplicate independent replicates per subject, duplicate technical replicates. (C) Reduced Wnt signaling activity in PTHS NPCs (TOP-Flash assay). N = 4 subjects per group (symbols), triplicate independent replicates per subject. Mean activity (arbitrary units) was normalized to 1 in the "parent" group. (D) Relative expression of selected Wnt genes in postmortem PTHS cortical samples. (E) Treatment of control NPCs with the Wnt pathway antagonists DKK-1 and ICG-001 (yellow bars) phenocopied the proliferation defect in PTHS progenitor cells. N=3 replicates per group (dots); cells derived from parent / child pair #4 in Table 1. (F) ICG-001 treatment phenocopies the reduction in neural progenitor content (SOX2) in PTHS organoids. N=3 independent experiments (dots); 12 organoids evaluated per experiment per group; four random 100 x 100 µm ROIs per organoid. (G) Viable cell counts showing treatment of NPCs with the Wnt pathway agonist CHIR99021. N=3 subjects per group (symbols); triplicate independent replicates per subject; triplicate technical replicates. (H) EdU proliferation assay in NPCs treated with CHIR99021. Left graph represents data from parent / patient pair #4, right graph represents data from pair #1. N=3 technical replicates. (I) Quantification of p16INK4a+ (senescent) cells in NPCs treated with CHIR99021. Data are for pair #4 (see also Figure 16E for pair #1). (J) CHIR99021 restores expression of several progenitor genes in treated PTHS NPCs. N=4 subjects per group (symbols), 3 independent replicates per subject, 2 technical replicates. (K) Quantification of SOX2+ cells after treatment of PTHS CtO with CHIR99021.N=3 experiments (dots); 6 organoids per experiment in each group; 4 random 100x100µm ROIs per organoid. Bars represent mean + SEM. ns indicates no statistically significant difference; **p<0.01, ***p<0.001; Welch t-test (in B, C, D) or ANOVA (in the remaining panels). In B, D, and J, the mean value of control gene expression is set to 1. In K, statistical comparisons are between the mean values of the PTHS+CHIR and PTHS+DMSO (control) groups. Scale bar is 100µm. [Figure 10A-L]Figure 1 shows the mechanistic involvement of SOX genes in the cellular pathophysiology of PTHS. (A) Ratio of the expression abundance (TPM) of several SOX genes in NPCs. N = 4 parent-child pairs (symbols). Brackets above the bars indicate the class of SOX genes. (B) Top: Expression abundance (TPM) of SOX3 in NPCs. Bottom: Relative expression of SOX3 determined via qPCR. N = 4 subjects per group (symbols), triplicate independent replicates per subject, duplicate technical replicates. (C) SOX3 is downregulated after shRNA-mediated TCF4 knockdown in NPCs (cells from parent #4 in Table 1). N = 3 independent replicates per group (dots), duplicate technical replicates. (D) Relative expression of SOX3 in postmortem PTHS cortical samples. (E) Immunostaining of SOX3 in postmortem PTHS samples (two ROIs per genotype are shown). (F) Treatment of PTHS NPCs with CHIR99021 results in recovery from aberrant SOX3 expression. N = 4 subjects per group (symbols), triplicate independent replicates per subject, duplicate technical replicates. (G) shRNA-mediated SOX3 knockdown reduces progenitor cell proliferation. N = 3 independent replicates per group (dots), triplicate technical replicates. (H) SOX4 expression is reduced in PTHS NPCs. Top: Expression abundance (in TPM). Bottom: Relative expression. N = 4 subjects per group (symbols), triplicate replicates per subject, duplicate technical replicates. (I) SOX4 expression is reduced in intermediate progenitor cells (IP-Glut) and neurons (N-Glut) of PTHS CtOs. N = 717 (parent) and 382 (PTHS) IP-Glut cells or 1401 (parent) and 380 (PTHS) N-Glut neurons. (J) Ratio of neurons (MAP2+) to NPCs (SOX2+) as a proxy for neuronal differentiation frequency. N = 4 subjects per group (symbols). (K) Ratio of MAP2+ to SOX2+ after SOX4 knockdown. N = 3-4 ROIs per genotype; cells are from parent / child pairs #1 and #4. (L) Ratio of MAP2 gene expression levels to SOX2 gene expression levels after SOX4 knockdown. N = 4 biological replicates; cells are from parent / child pair #4. Bars represent mean + SEM.*p<0.05; **p<0.01; ***p<0.001; Kruskal-Wallis H test (I), or ANOVA (F and G), Welch t-test for remaining panels. Scale bars are 100 μm. DAPI nuclear staining is in blue. [Figures 11A-H]Figure 1 shows reversal of abnormal phenotypes in PTHS organoids subjected to genetic correction of TCF4 expression. (A) Schematic of CRISPR-based transepigenetic correction of TCF4 expression using constructs for guide RNA (gRNA), transcriptional activation module MPH, and dead Cas9. (B) Top: Viral application regimen. Bottom: Brightfield image of PTHS brain organoids subjected to correction of TCF4 expression (PTHS+TCF4 gRNA) compared to controls transduced with scrambled gRNA (scr gRNA). (C) Fluorescence microscopy image of transduced organoids after immunostaining for TCF4. C': Clustered TCF4+ cells (arrowheads) in the abnormal proliferation. (D) Transduced organoids stained for MAP2 and SOX2 at two developmental time points. Arrowheads: Abnormal proliferation in scr gRNA PTHS. Inset: Higher magnification: Clustered, abnormally shaped MAP2+ cells in the organoid proliferation. (E) Overexpression constructs showing the placement of the TCF4-B coding sequence under the control of a synthetic promoter composed of the minimal promoter minP and various numbers of TCF4-binding sites (μE5 boxes). (F) Top: Viral application regimen. Bottom: Microscopic images showing the general morphology of 6-week-old organoids transduced with the TCF4 OE vector or empty vector (control) (top line), immunostaining for SOX2 and MAP2 (middle line), and immunostaining for CTIP2 (bottom line). Arrowheads, neural rosettes. (G) Left: Raster plot showing the electrical activity of transduced 2- to 3-month-old organoids subjected to multielectrode array (MEA) analysis. Each column represents an electrode. Vertical red rectangles represent bursts of electrical activity (network bursts) occurring at the network level. Right: Quantification of the average firing frequency over time in transduced organoids (top right) (see also Figure 18L for the raster plot) and the number of network bursts (bottom). (H) Top: Virus application regimen. Bottom: Immunostaining for TCF4 (top line), SOX2 and MAP2 (middle), and CTIP2 (bottom). Arrowheads, neural rosettes. Bars represent mean + SEM.ns, not statistically significant, *p<0.05; **p<0.01; ***p<0.001; by Welch t-test for each time point in G. Scale bar is 100 μm. DAPI nuclear staining is in blue. [Figures 12A-M]This figure shows that PTHS iPSCs exhibit normal proliferation rates and can differentiate into neurons. (A) TCF4 exon structure in different patients (numbers above each rectangle). White rectangles represent exons lost due to partial or complete gene deletion. Bold rectangles represent the coding sequence in each case. AD1-AD3, transcriptional activation domain; bHLH, basic helix-loop-helix DNA-binding domain. Exons 1 and 2 are shown, but they are not part of the primary transcript of the TCF4 gene, referred to as TCF4-B. Details of the mutations carried by each patient are shown on the right (see also Table 1 for details). (B) An example of digital karyotyping by SNP mapping via chip hybridization for a sample from patient PTHS#2 (Table 1), showing a large deletion on chromosome 18 (asterisk). Numbers on the left represent chromosomes. The y-axis in each chromosome graph represents the log R ratio of each hybridized chip probe (dot). (C) Comparison of iPSC colony growth rates (days to reach 2 mm, the size required for passaging) among parental (control), PTHS, and control iPSC lines derived from a subject (WT83) not involved in this study. N = 5 (symbols). Each measurement is the median value from five independent plates. (D) Representative brightfield microscopy images showing iPSC-derived neurons in culture. Note the formation of progenitor cells and neuronal cell body bundles in both the parental and PTHS groups. (E) Fluorescence microscopy images of the cultures in D stained for MAP2 (red) and SOX2 (green), demonstrating the ability of iPSCs to differentiate into NPCs (SOX2+) and neurons (MAP2+) in both groups. (F) Left: Brightfield images of CtOs from PTHS and parental controls derived from two different batches (clones) of iPSCs. Center: Size distribution of organoids. Right: Immunostaining for SOX2 and MAP2. Arrowheads point to small rosettes in the patient line. (G) Percentage of SOX2+ cells in 4- and 10-week-old CtOs of parental and PTHS genotypes. N = 4 subjects (symbols).(H) Fluorescence microscopy images of parental and PTHS sPO at 6 weeks in vitro after immunostaining for the NPC marker SOX2 (green) and the neuronal marker MAP2 (red). (I) Quantification of the density of SOX2+ cells in the parental and PTHS sPO at 6 weeks in vitro. N = 4 subjects (symbols), 2 batches per subject, 6 organoids per batch, 4 random 100 × 100 μm regions of interest (ROIs) per organoid. (J) Quantification of the density of SATB2-expressing cortical neurons in the parental and PTHS CtO at two developmental stages in vitro. N = 4 subjects (symbols), 3 batches per subject, 6 organoids per batch, 4 random ROIs per organoid. (K) Relative expression of neuronal markers in postmortem PTHS cortical samples. (L) Quantification of the percentage of CTIP2+ cells in postmortem samples. (M) Quantification of vGLUT1 and GAD65 / 67 expression, as determined by the number of pixels above threshold intensity per unit area in the CtO and sPO of PTHS and controls. N = 6 sections per condition (circles), 4 ROIs per section. Bars represent mean + SEM. ns indicates no statistically significant difference, **p<0.01, ***p<0.001; two-sample Welch t-test (D, G, I, and K), one-way ANOVA followed by Tukey-Kramer HSD post-hoc test (G) for each parent group, or Wilcoxon-Mann-Whitney U test (M). Scale bar is 100 μm. [Figure 13A-I]Figure 6. Annotation of subpopulations in single-cell RNA-Seq experiments and related controls. (A) Dot plots showing the expression of selected marker genes in the six subpopulations of cells depicted in Figure 6A. Pr-Glut, neural progenitors of the glutamatergic lineage; IP-Glut, intermediate progenitors of the glutamatergic lineage; N-Glut, glutamatergic neurons; Pr-GABA, neural progenitors of the inhibitory lineage; IP-GABA, intermediate progenitors of the inhibitory lineage; N-GABA, GABAergic interneurons. "Other" represents a heterogeneous group of cells not included in the six categories. Dot size represents the percentage of cells in each subpopulation with detectable expression for the corresponding gene. (B) Violin diagram of the marker genes shown in A, showing the range of expression in the six subpopulations of cells analyzed (and "Other"). Color coding is the same as in Figure 2A. For GRIN2, GAD1, and GAD2, expression in each cell is represented as a dot because the median values were low. (C) Single-cell RNA-Seq quality control data. Violin diagrams represent the number of reads, number of detected genes (features), and percentage of mitochondrial genes (mtRNAs) in the subpopulations listed in A. The color code is the same as in Figure 6A, with "Other" indicated in black. (D) UMAP showing expression of TCF4, neural lineage markers SOX2 and MAP2, mesodermal markers MIXL1 and TBXT (Brachyury), and endodermal markers CFTR and SOX17. Purple intensity indicates relative expression levels. (E) Characteristics of unassigned cells in the "Other" subpopulation. Top left: Percentage of cells in the "Other" and high mitochondrial RNA content subpopulations in the CtO and sPO of parental and PTHS organoids. Top right: Expression levels of neural lineage markers SOX2 and MAP2 in the CtO and sPO of parental (orange) and PTHS (blue) organoids. Bottom, Expression levels of mesodermal and endodermal markers in CtOs and sPOs of parental (left side of each group) and PTHS (right side of each group) genotypes in D. (F) Left, UMAP showing expression of astrocyte markers S100B and ALDH1L1 in CtOs of parental and PTHS.Right: Comparison of expression levels of the same genes in parental and PTHS CtOs. (G) Controls demonstrating the reproducibility of CtO generation across independent batches (replicates #1 and #2; left) and the robustness of single-cell RNA-Seq analysis in detecting similar percentages of each cell type across independent batches of parent-derived organoids (right). Color coding is the same as in Figure 6A. (H, I) Left: Comparison of parental and PTHS CtOs for expression of genes encoding markers of cortical neuron subtypes, TBR1 (H) and CUX (I), in the N-Glut subpopulation. Right: Significant reduction in the percentage of neuronal subtypes (cells expressing each marker gene above a threshold corresponding to 40% of the corresponding mean value) in PTHS CtOs. ns indicates no statistically significant difference, Wilcoxon-Mann-Whitney U test. (F) [Figures 14A-H]Supporting data for the investigation of neurons in 2D culture. (A) Changes in mean firing frequency over time in CtOs subjected to multielectrode array (MEA) assays show a comparison between parental (orange) and PTHS (blue) organoids. Each patient is represented by a different symbol, as shown in Table 1. The red line and error bars indicate the mean value across all subjects over time. N = 4 subjects (symbols), triplicate independent replicates per subject. (B) Representative fluorescence microscopy images showing the expression of TCF4 protein (green) in neurons differentiated in 2D culture from parental-derived iPSCs (MAP2 labeling is shown in red). (C) Relative TCF4 expression levels (RT-qPCR) between iPSC-derived PTHS and parental neuronal cultures. N = 4 subjects (symbols), triplicate independent replicates per subject, duplicate technical replicates per sample. Each PTHS sample is compared to its respective parent (expression normalized to 1). (D) Comparison of membrane capacitance between PTHS neurons (blue circles) and parental control neurons (circles) in 2D culture by patch-clamp electrophysiological analysis. (E) Examination of sodium (top) and potassium (bottom) current densities comparing PTHS neurons (blue line) and control neurons (orange line). N = 10 (parent) or 9 (PTHS) neurons. (F) Heatmap showing the expression levels of 20,000 highly expressed genes in RNA-Seq libraries from neurons from one parent and each PTHS offspring (PTHS#4 in Table 1). The number of differentially expressed (DE) genes in the parent-offspring comparison is indicated above the plot. (G) Dot plot results of Gene Ontology-Biological Process (top) and Pathway (bottom) analyses of down-regulated DE genes in D. For each analysis, the top 10 categories in terms of adjusted p-values are shown. The size of the dots represents the number of DE genes that fall into each classification category, the color of the dots represents the adjusted p-value, and the x-axis represents the percentage of genes in each category that are DE-expressed genes in the RNA-Seq library. Note the presence of genes involved in glutamatergic and GABAergic transmission. (H) MA plot of genes expressed in control and PTHS neurons. Gray dots represent genes that are not statistically differently expressed between control and PTHS neurons.Blue and red dots indicate statistically significant DE genes. Red dots represent genes encoding sodium or potassium channels with a log2 fold change greater than 4 (dashed line). Bars represent mean + SEM. *p<0.05, **p<0.01, ***p<0.001 by Welch t-test (A and D) or ANOVA followed by HSD post-hoc test (E). Scale bar is 100 μm. [Figures 15A-N]Expression analysis in neural progenitor cells. (A) Validation of the expression of several NPC markers in iPSC-derived neural progenitor cells from parental and PTHS subjects, as determined by TPM expression abundance in RNA-Seq libraries. N = 4 subjects per group (symbols), with triplicate independent replicates per subject. (B) Relative TCF4 expression levels (RT-qPCR) in iPSC and iPSC-derived NPC and neuronal cultures, as well as expression in a non-neuronal cell line (HEK293T). N = 14 independent replicates per group, with duplicate technical replicates per sample. The mean expression values in the neural progenitor group were normalized to 1. (C) Representative fluorescence microscopy images of NPCs in 2D culture after immunostaining for TCF4 (red) and the NPC marker nestin (green). The inset is a higher magnification image. (D) Representative fluorescence microscopy images showing abundant expression of TCF4 (red) in NPCs in rosettes in control (parental) CtOs. (E) Relative expression of TCF4 (RT-qPCR) in NPCs derived from parents and each PTHS child. N = 5 subjects per group (symbols: subjects PTHS #1 to #5 in Table 1), triplicate independent replicates per subject, duplicate technical replicates per sample. Note that for one PTHS subject (circle), expression was not significantly reduced. This was unexpected, as this patient (PTHS #4) harbored a point mutation that is not expected to affect transcript abundance. All others harbor mutations that are expected to reduce transcript abundance (nonsense mutations, frameshift mutations, whole-gene deletions, and translocations). The mean expression value for each PTHS subject is shown relative to each parent (all parental means are normalized to 1). (F) Relative expression of GADD45G in NPCs derived from parents and each PTHS child. N = 15 subjects per group (symbols), triplicate independent replicates per subject, duplicate technical replicates per sample. (G) High-magnification fluorescent image (arrowhead) showing decreased expression of TCF4 in PTHS (patient PTHS#2) and what appears to be mislocalization of TCF4 protein outside the cell nucleus. (H) Ratio of expression of transcriptional markers of replicative senescence between PTHS and control samples. Cells are derived from parent-child pair #4 (Table 1).For each gene, the average value at each passage was determined from triplicate independent biological samples. Each line connects the expression of a specific gene in early and late passage conditions. Marker genes are divided according to class (down- or up-regulated in senescent cells). Note the more pronounced misregulation in late passage conditions. Similar results were obtained for parent-offspring pair #1. (I) Quantification of the percentage of cells expressing the senescent marker p16INK4a cells that also express the neural lineage marker nestin, the progenitor marker SOX2, the mesoderm marker brachyury, and the endoderm marker SOX17. For SOX2, some cells show strong staining, while others stain weakly. (J) Left, high-magnification image of CtO stained for SOX2, MAP2, and p16INK4a, followed by quantification of cells co-expressing p16INK4a with SOX2 or MAP2 (right). (K) Left: shRNA-mediated TCF4 knockdown reduces NPC proliferation. N = 3 independent replicates (dots) per group, triplicate technical replicates per sample. Initial seeding density is 1 x 10 cells. Right: Quantification of the percentage of EdU-positive NPCs in the same group; N = 3 independent replicates (dots) per group. (L) shRNA-mediated TCF4 knockdown reduces the expression of TCF4 and the TCF4 downstream target gene GADD45G while increasing the expression of the senescence marker CDKN2A. N = 3 independent replicates (dots) per group, duplicate technical replicates per sample. (M) An example heatmap showing the expression levels of the 20,000 most highly expressed genes in RNA-Seq libraries of NPCs derived from two parents and their respective PTHS offspring. The number of differentially expressed (DE) genes at the intersection of all four parent-offspring comparisons is indicated above the plot. (N) Dot plot results of Gene Ontology-Biological Process (top) and Pathway analysis (bottom) for down-regulated DE genes listed in M resulting from the intersection of all four parent-offspring pairs. For each analysis, the top 10 categories in terms of adjusted p-values are shown.The size of the dots represents the number of DE genes falling into each classification category, the color of the dots represents the adjusted p-value, and the x-axis represents the percentage of genes in each category that were DE-expressed genes in the RNA-Seq library. Note the presence of down-regulated genes in the Wnt signaling pathway. Bars represent the mean + SEM. *p<0.05, **p<0.01, ***p<0.001; by two-sample Welch t-test assuming unequal variances (E, F, and K) or ANOVA followed by Tukey-Kramer HSD post-hoc test (K). In L, the mean gene expression values were normalized to 1 in each parental + control shRNA group. Scale bar is 100 μm. [Figures 16A-N]Figure 1. Additional controls for manipulating Wnt signaling in organoids. (A) Expression abundance of selected genes in the Wnt signaling pathway comparing parental (orange) and PTHS (blue) NPCs. N = 4 subjects per group (symbols), triplicate independent replicates per subject. (B) Treatment of parent-derived NPCs with DKK-1 increases expression of the senescence marker CDKN2A. N = 4 biological replicates (symbols). (C) Treatment of control CtOs with the Wnt pathway antagonist ICG-001 (yellow bars) phenocopies the small organoid size of PTHS organoids. N = 3 independent replicates (dots), 12–30 organoids per experiment in each group. (D) Confirmation of increased Wnt signaling activity following treatment of NPCs with the agonist CHIR99021, as measured by the TOP-Flash functional reporter assay. N = 4 subjects per group (symbols), triplicate independent replicates per subject. Mean activity (arbitrary units) was normalized to 1 in the "parent + DMSO" group. (E) Fluorescence microscopy images of NPCs from parents and PTHS subjects treated with CHIR99021 (or DMSO as a control) after staining for mesodermal marker brachyury and senescence marker p16INK4a (top row), endodermal markers SOX17 or TCF4 (middle row), and neural lineage markers nestin and SOX2 (bottom row). Arrowheads in the high-magnification inset indicate colocalization. (F) Treatment of PTHS NPCs with the Wnt pathway agonist CHIR99021 (light blue bar) restores organoid size. N = 3 independent replicates (dots), 15-20 organoids measured per experiment in each group. (G and H). Treatment of sPO (G) and CtO (H) with the Wnt agonist CHIR99021 increases the population of NPCs as revealed by single-cell RNA-Seq. Left: Comparison of UMAP representations showing cellular diversity, showing the six subpopulations of cells from Figure 6A.Pr-Glut, neural progenitor cells of the glutamatergic lineage; IP-Glut, intermediate progenitor cells of the glutamatergic lineage; N-Glut, glutamatergic neuron; Pr-GABA, neural progenitor cells of the inhibitory lineage; IP-GABA, intermediate progenitor cells of the inhibitory lineage; N-GABA, GABAergic interneuron. Other cell types are not shown. Right: Quantification of the percentage of neural progenitor cells and neurons. (I) Relative expression of GAD1 and GAD2 in CtO organoids treated with CHIR99021. N=3 biological replicates per condition for parent / pup pair #4. (J) Top: UMAP showing TCF4 expression in CHIR99021-treated PTHS sPOs (right) compared to untreated PTHS sPOs (left). Purple intensity indicates relative expression levels. Bottom: Violin diagram showing TCF4 expression levels in single cells (dots) of untreated and CHIR-treated PTHS sPO. (K) Treatment of PTHS NPCs with CHIR99021 increases the expression of TCF4 and the TCF4 downstream target gene GADD45G. N = 4 subjects per group (symbols), triplicate independent replicates per subject. Mean expression levels were normalized to 1 in the "parents + DMSO" group for each gene. (L) Immunostaining for β-catenin in 4-week-old CtOs shows localization to the rosette center in control organoids but disorganized staining in PTHS CtOs (arrowheads). (M) Expression levels of CTNNB1 (β-catenin) in NPCs (top left) or in excitatory lineage progenitors in the CtO (top right). (N) Expression of genes encoding cadherin 23 (CDH23) and protocadherin 15 (PCDH15), which are DE genes between parental and PTHS NPCs (left). The graph on the right shows expression levels in NPCs treated with the Wnt agonist CHIR99021. Bars represent mean + SEM. ns indicates no statistically significant difference; *p<0.05, **p<0.01, ***p<0.001; Welch t-test for M and N (left graphs); ANOVA followed by HSD post-hoc test for others. In B, I, K, and N (right graphs), the mean gene expression values were normalized to 1 in each control group. In D, Wnt signaling activity in the parental + DMSO group was set to 1.In K, the mean expression value of the parent + DMSO group was set to 1 for each gene. In K, statistical comparisons were made between the mean values of the PTHS + CHIR and PTHS + DMSO (control) groups. [Figure 17A-L]This figure shows that intermediate progenitor cells are less abundant in PTHS organoids. (A) Violin diagram showing the expression of SOX1, SOX3, SOX4, and SOX11 in cell subpopulations of the CtO and sPO. For SOX2 expression, see Figure 13B. Pr-Glut: neural progenitor cells of the glutamatergic lineage; IP-Glut: intermediate progenitor cells of the glutamatergic lineage; N-Glut: glutamatergic neurons; Pr-GABA: neural progenitor cells of the inhibitory lineage; IP-GABA: intermediate progenitor cells of the inhibitory lineage; N-GABA: GABAergic interneurons. (B and C) Expression of SOX1 (B) and SOX3 (C) in progenitor cells (Pr-Glut) and intermediate progenitor cells (IP-Glut) in the CtO, and in progenitor cells (Pr-GABA) and intermediate progenitor cells (IP-GABA) in the sPO. Each dot represents a single cell, and the violin diagram shows the distribution of gene expression in each population: N = 959 and 1230 Pr-Glut cells in the parental and PTHS CtO groups, respectively; N = 717 and 382 IP-Glut cells in the parental and PTHS CtO groups, respectively; N = 346 and 1376 Pr-GABA cells in the parental and PTHS sPO groups, respectively; and N = 2737 and 105 IP-GABA cells in the parental and PTHS sPO groups, respectively. (D) Relative expression of SOX3 (RT-qPCR) after shRNA-mediated SOX3 knockdown in parental and control NPCs in 2D culture. N = 3 independent replicates (dots), with duplicate technical replicates per sample. There was a trend toward lower expression, which did not reach significance (P ≈ 0.50), but was in the expected direction. The mean expression in the parental + control shRNA group was normalized to 1. The NPCs used were derived from the parental #4 lineage (Table 1). (E) Relative expression (RT-qPCR) of CDKN2A, ASCL1, and HES1 after shRNA-mediated SOX3 knockdown in parental control NPCs in 2D culture. N=3 independent replicates (dots), duplicate technical replicates per sample. The NPCs used were derived from the parental #4 lineage (Table 1). (F) Viable cell counts in parental and PTHS NPCs subjected to SOX3 overexpression. N=3 biological replicates using cells from parent / child pair #4.(G) Relative expression of SOX3 after SOX3 overexpression. N = 3 biological replicates using cells from parent / offspring pair #4. (H) SOX4 expression is normal in intermediate progenitor cells (IP-GABA) and neurons (N-GABA) in PTHS sPOs. Each dot represents a single cell, and the violin diagram shows the distribution of gene expression in each population: N = 2737 and 105 IP-GABA cells in the parental and PTHS groups, respectively; N = 2661 and 988 N-GABA neurons in the parental and PTHS groups, respectively. As seen for the CtO (Figure 10G), there is a clear reduction in the number of both intermediate progenitor cells and neurons in PTHS organoids, although expression per cell was unchanged. The color code for the violin diagram is the same as in B. (I) SOX11 expression is normal in intermediate progenitor cells (IP-Glut and IP-GABA) and neurons (N-Glut and N-GABA) of the PTHS CtO and sPO. Each dot represents a single cell, and the violin diagram shows the distribution of gene expression in each population: N = 717 and 382 IP-Glut cells in the parental and PTHS CtO groups, respectively; N = 1401 and 380 N-Glut neurons in the parental and PTHS CtO groups, respectively; N = 2737 and 105 IP-GABA cells in the parental and PTHS sPO groups, respectively; N = 2661 and 988 N-GABA neurons in the parental and PTHS sPO groups, respectively; and N = 717 and 382 IP-Glut cells in the parental and PTHS CtO groups, respectively. The color code for the violin diagram is the same as in B. (J) Quantification of the percentage of MAP2+ cells in 2D cultures of differentiated neurons derived from parental control and PTHS subjects. N = 4 subjects per group (symbols), duplicate independent differentiation experiments, triplicate independent replicates per subject, four randomly selected fields per independent replicate. (K) UMAP display of single-cell RNA-Seq results for CtO and sPO of PTHS and parental control, highlighting intermediate progenitor cells in each plot in red. The percentage of IPs is displayed in the bottom left of each quadrant.(L) Left: Violin diagram showing the expression of POU3F2 (encoding BRN2 and expressed in intermediate progenitors) in IPs and neurons of the CtO and sPO. Each dot represents a single cell. Right: A significant decrease in the percentage of intermediate progenitors in the PTHS CtO and sPO, as determined by quantification of cell populations in single-cell RNA-Seq data. The color code for the violin diagram is the same as in B. Bars represent the mean + SEM. ns indicates no statistically significant difference; *p<0.05, **p<0.01, ***p<0.001; Welch t-test assuming unequal variances (E and J), Kruskal-Wallis H test for comparing gene expression in PTHS and each parent (left panels of B, C, H, I, and L). In D, comparisons between parent and each PTHS group achieved statistical significance with a critical p-value of 0.5. † indicates that the PTHS mean was statistically significantly different from the parent mean, but the fold change was less than 10%. [Figure 18A-O]Figure 1 provides details on genetic correction of TCF4 expression. (A) Normalized transcriptional activity from alternative promoters at the TCF4 locus (red bars) in parental and PTHS samples (column 1). Column 2 is a schematic diagram of the TCF4 locus, showing the locations of its exons. The positions of the designed gRNAs (blue arrows) are shown upstream of exons 3b, 8a, and 10a for the three selected TCF4 alternative promoters. The remaining columns show transcripts formed from transcription initiated in exons 3b, 8a, and 10a, which give rise to the TCF4 protein isoforms TCF4-B, TCF4-D, and TCF4-A, respectively. (B) Test of the transactivation efficiency of five TCF4 gRNAs on TCF4 expression in SH-S5Y5 cells. Scrambled gRNA, control scrambled gRNA; no gRNA, empty expression construct. N = 4 independent replicates, triplicate technical replicates. (C) Left: Relative expression of CNTNAP2 in 2D neuronal cultures. N = 3 (control) or 4 (PTHS) subjects (symbols), triplicate independent replicates per subject, duplicate technical replicates. Bottom: Transepigenetic TCF4 expression correction increases CNTNAP2 in SH-S5Y5 cells. N = 4 independent replicates, triplicate technical replicates. Right: Relative expression (RT-qPCR) of the TCF4 target gene KCNQ1 is significantly increased in PTHS neurons. N = 4 subjects per group (symbols), triplicate independent replicates per subject, duplicate technical replicates per sample. Bottom: TCF4 expression correction reduces KCNQ1 expression in transfected SH-S5Y5 cells. (D) Top: Increased TCF4 expression levels after TCF4 correction. Bottom: Ratio of expression abundance of normal (C at position 959 of the coding sequence) and mutant (T at that position) TCF4 alleles. N=3 independent replicates (dots) per group, 10 pooled organoids per sample. (E) Expression levels of GADD45G (TCF4 downstream target gene), CDKN2A, SOX3, and MAP2 after TCF4 correction. N=3 independent replicates (dots) per group, 10 pooled organoids per sample. (F) Correction of DCX expression levels after TCF4 correction.N = 3 independent replicates (dots) per group, 10 pooled organoids per sample. (G) Relative expression of DCX in postmortem PTHS cortical tissue. (H) DCX expression is reduced in intermediate progenitor cells (IP-Glut and IP-GABA) and neurons (N-Glut and N-GABA) of the PTHS CtO and sPO. N = 717 (parent) and 382 (PTHS) IP-Glut cells, 1401 (parent) and 380 (PTHS) N-Glut neurons, 2737 (parent) and 105 (PTHS) IP-GABA cells, or 2661 (parent) and 988 (PTHS) N-GABA neurons. (I) As judged by RNA-Seq data, DCX expression abundance (transcripts per million, or TPM) in PTHS neurons is significantly lower compared to neurons derived from parental controls. N=3 independent replicates per group (dots). (J) Validation of correction of TCF4 expression by an overexpression cassette (top) containing a synthetic promoter containing micro-E5 (μE5) regulatory binding sites preceding the cDNA encoding the TCF4-B isoform, allowing overexpression in TCF4-expressing cells and preventing ectopic expression. Multiple versions of this construct (with 6 or 12 μE5 boxes) were transfected into PTHS NPCs in 2D culture, followed by RT-qPCR evaluation of increased expression of TCF4 and the TCF4 target gene GADD45G. N=3 independent replicates per group. Cells transfected with overexpression cassettes containing 6 or 12 μE5 boxes are compared to controls with a minimal promoter (minP; expected not to increase TCF4 levels) for mean relative expression levels. Expression of each gene in the parental group is normalized to 1. (K) Top row: Relative expression of TCF4 and CDKN2A in CtOs subjected to TCF4 OE with lentiviral vectors applied at the beginning of the organoid derivation protocol. Bottom row: Density of SOX2- and CTIP2-positive cells in CtOs subjected to TCF4 OE. N=3 biological replicates per subject for organoids derived from parent / offspring pairs #1 and #4.(L) Representative raster plots showing differences in firing activity between parental CtOs (left) and PTHS CtOs (top right) in the MEA assay, but partial recovery of activity in PTHS organoids treated with the TCF4 OE (bottom right) lentiviral vector. (M) Low-magnification images of 8-week-old CtOs transduced with an OE AAV vector containing 12 μE5 boxes (TCF4 OE). (N) Top row: Relative expression of TCF4 and CDKN2A in CtOs subjected to TCF4 OE by application of the AAV vector after the end of the neural induction phase. Bottom row: Density of SOX2- and CTIP2-positive cells in CtOs subjected to TCF4 OE. N = 3 biological replicates per subject for organoids derived from parent / child pairs #1 and #4. (O) Current mechanistic model to explain abnormal cellular phenotypes in PTHS neural structures. Due to TCF4 haploinsufficiency in PTHS, Wnt signaling activity is reduced, which subsequently leads to reduced SOX3 expression in NPCs and impaired proliferation. Furthermore, SOX4 is also downregulated in PTHS cells, suggesting that it impairs neuronal differentiation and content in PTHS neural tissue. Scrambled gRNA, scrambled (control) guide RNA. Bar graphs show mean + SEM. *p<0.05, **p<0.01, ***p<0.001; by Welch t-test (D) or ANOVA followed by Tukey-Kramer HSD post-hoc test (C). DETAILED DESCRIPTION OF THE INVENTION
[0015] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a promoter" includes a plurality of such promoters, reference to "the construct" includes reference to one or more constructs, and so forth.
[0016] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice of the disclosed methods and compositions, exemplary methods, devices, and materials are described herein.
[0017] Also, the use of "or" means "and / or" unless stated otherwise. Similarly, "comprise," "comprises," "comprising," "include," "includes," and "including" are interchangeable and are not intended to be limiting.
[0018] Furthermore, where the descriptions of various embodiments use the term "comprising," it should be understood that those skilled in the art will understand that in some specific instances, the embodiments may alternatively be described using the words "consisting essentially of" or "consisting of."
[0019] The publications discussed above and throughout the text are provided solely for their disclosure prior to the filing date of the present application. Nothing herein should be construed as an admission that any publication is prior art. Furthermore, with respect to any terms provided in one or more publications that are similar or identical to terms expressly defined in this disclosure, the definition of the term expressly provided in this disclosure shall control in all respects.
[0020] Transcription factor 4 (TCF4; OMIM 602272) encodes a helix-loop-helix transcription factor involved in several aspects of neural development, including neurogenesis, cell survival, cell cycle regulation, neuronal differentiation, neural lineage commitment, and neuronal excitability. The TCF4 locus transcribes multiple alternative transcripts, some of which are highly expressed during brain development.
[0021] Numerous studies have demonstrated that TCF4 gene variants are genetically associated with a wide range of neuropsychiatric disorders, namely schizophrenia, bipolar disorder, post-traumatic stress disorder, and major depressive disorder. Importantly, de novo heterozygous mutations in TCF4 cause an autism spectrum disorder known as Pitt-Hopkins syndrome (MIM#610954), and similar syndromes have been shown to be caused by mutations in NRXN1β and CNTNAP2, downstream target genes of TCF4. Despite this knowledge, little is known about the molecular and cellular mechanisms by which TCF4 mutations lead to alterations in neuronal development and function.
[0022] PTHS is characterized by severely debilitating clinical symptoms, including profound cognitive impairment, developmental delay, generalized hypotonia, respiratory abnormalities, seizures, speech loss, typical autistic behavior, chronic constipation, and distinctive facial dysmorphology. Most patients with PTHS exhibit individual TCF4 mutations, which can be large gene-wide chromosomal deletions, partial gene deletions, translocations, frameshift mutations, nonsense mutations, splice site mutations, or missense mutations, most of which are considered loss-of-function mutations that impair the transcriptional activity of TCF4.
[0023] Several transgenic mouse strains carrying TCF4 mutations have been generated as animal models of PTHS. Some of these strains exhibit PTHS-like phenotypes, including defects in social interaction, associative memory, sensorimotor gating, and altered gastrointestinal transit. Examination of brain tissue from these animals revealed abnormal cortical development, altered neuronal migration during hippocampal and pontine nuclei development, and impaired oligodendrocyte differentiation. However, these mice do not exhibit all clinically relevant symptoms, including many of the most debilitating symptoms, such as severe motor delay and hypotonia. Furthermore, only a few of these mouse strains harbor heterozygous mutations similar to those found in PTHS patients.
[0024] To study TCF mutations, we used neural progenitor cells (NPCs) and neurons differentiated in vitro from patient-derived induced pluripotent stem cells (iPSCs), allowing us to analyze the effects of disease on individual cell types in the appropriate genomic context. Additionally, we generated patterned cortical organoids, including pallial and parapallial organoids containing excitatory and inhibitory neuronal lineages. These three-dimensional (3D) neural structures consistently display a wide range of distinct cell populations and have been successfully used to model cellular pathology during early neurogenesis in several disorders.
[0025] This disclosure demonstrates that PTHS cortical organoids are abnormal in size and structure, containing a higher percentage of NPCs and fewer neurons than control organoids. PTHS-derived NPCs exhibit reduced proliferation and impaired neuronal differentiation. Importantly, molecular exploration of these nervous systems has revealed the pathological mechanism by which mutations in TCF4 reduce canonical Wnt / β-catenin signaling, subsequently reducing the expression of SOX transcription factors, resulting in cellular abnormalities. This disclosure also shows that pharmacological manipulation of Wnt signaling and genetically correcting the expression of TCF4 itself can restore neural properties at the cellular level. Taken together, the data disclosed herein reveal novel cellular and molecular PTHS phenotypes in relevant human cell types, demonstrate that they are reversible, and provide a pathway for therapeutic intervention in patients with PTHS or other genetic disorders associated with TCF4.
[0026] We used two types of patient-derived brain organoids (palliative and parapalliative) in combination with a neural 2D culture system to investigate the pathophysiology and abnormal molecular mechanisms associated with clinically significant mutations in TCF4. These cells were derived from pediatric patients with PTHS, a debilitating autism spectrum disorder caused solely by TCF4 mutations. This disclosure demonstrates that PTHS NPCs proliferate at a slower rate and exhibit impaired neuronal differentiation. Furthermore, we show that PTHS organoids exhibit abnormal electrical properties and contain fewer cortical neurons (Figures 5-7).
[0027] This disclosure presents a model (Figure 18O) in which the pathological molecular mechanism involves a cascade of molecular events leading from TCF4 loss-of-function mutations to reduced Wnt signaling activity in hypoproliferative PTHS NPCs (Figure 8). This data demonstrates that Wnt signaling is mechanistically downstream of TCF4 in a distinct cascade that is dysregulated in patient cells, providing insight into therapeutic intervention and a better understanding of disease pathology. Pharmacological activation of Wnt signaling in PTHS samples can completely correct the aberrant NPC growth phenotype, organoid morphology, and expression of senescence markers and downstream molecular players (Figure 9), providing a potential therapeutic approach.
[0028] This disclosure also provides mechanistic evidence that Wnt signaling regulates the expression of two SOX transcription factors, SOX3 and SOX4 (Figure 10). We found that reduced expression of SOX3 in PTHS NPCs, organoids, and postmortem cortical samples, and that downregulation of SOX3 led to reduced NPC proliferation (Figure 10). Interestingly, mutations in SOX3 are associated with X-linked mental retardation, another neurodevelopmental disorder, suggesting that there are overlapping molecular mechanisms between this condition and PTHS.
[0029] PTHS NPCs also exhibit impaired neuronal differentiation, consistent with the proneural role of the helix-loop-helix transcription factors NEUROG1, NEUROG2, and ASCL1, which are known to interact with TCF4. Interestingly, SOX4 expression was found to be reduced in PTHS NPCs as well as in intermediate progenitor cells and neurons in PTHS organoids (Figure 10). The SOX4 transcription factor is known to be involved in neuronal differentiation, which is consistent with the findings that PTHS organoids contain fewer neurons and that patient-derived NPCs differentiate more slowly than control cells. This phenotype was also observed when SOX4 expression was knocked down in differentiating neuronal cultures (Figure 10). We hypothesize that TCF4 haploinsufficiency leads to the downregulation of SOX4, resulting in reduced neuronal differentiation (Figure 18O).
[0030] Defects in cell proliferation and differentiation contribute to the reduced cortical neuron content observed in both PTHS organoids and postmortem brain tissue from PTHS individuals. It is noteworthy that the reduced neuron content in organoids and postmortem samples coincides with the reduced or absent corpus callosum detected via MRI in some PTHS offspring. It is noteworthy that PTHS neural tissue exhibits such levels of disorganization and reduced cortical neuron content, and it will be interesting to determine which clinical symptoms result from these abnormalities and whether this effect manifests during neurogenesis or in the fully formed nervous system.
[0031] Tcf4 knockout mice carrying a homozygous loss-of-function mutation exhibit substantial alterations in cortical neuronal populations, including SATB2- and BRN2-expressing cells, and these alterations are not mediated by Tcf4 + / -The phenotype in mice is significantly milder and clearly less pronounced than the level of tissue disruption and gene expression changes in postmortem PTHS cortical samples (Figures 5 and 12). This suggests that mouse models are not ideal for studying TCF4 heterozygous mutations, such as those seen in PTHS patients. In contrast, the data provided herein demonstrate severe impairment of cortical neuron differentiation in PTHS organoids, consistent with observations in postmortem brain tissue, implying that the brain organoid model offers new therapeutic opportunities for studying neurodevelopmental abnormalities associated with PTHS. + / - The difference in phenotypic severity between mouse brains and those from PTHS human organoids or postmortem samples may reflect important evolutionary differences between human and rodent neurogenesis, and thus justify the use of patient-derived systems to better understand pathophysiology in the context of this and other neurodevelopmental pathologies.
[0032] This disclosure also presents a series of genetic manipulation experiments to enhance TCF4 expression and thereby correct its expression in PTHS neural tissue in vitro (Figure 11). These approaches, including overexpression of redundant TCF4 gene copies and CRISPR-mediated transepigenetic enhancement of expression from the endogenous TCF4 locus, resulted in reversal of the abnormal cellular phenotype, an important finding that may guide therapeutic efforts to treat PTHS. Furthermore, because CRISPR-mediated correction of TCF4 expression enhances transcription from both the mutated and normal endogenous alleles, this experiment conclusively demonstrates that the PTHS phenotype observed here is caused by haploinsufficiency, rather than a dominant-negative effect. The disclosed methods and compositions also benefit the understanding of other genetic disorders, including autosomal recessive intellectual disability conditions classified as Pitt-Hopkins-like syndromes, which are caused by mutations in the TCF4 downstream target genes NRXN1β and CNTNAP2, as well as schizophrenia and other disorders that may have TCF4 as a genetic component.
[0033] The practice of the techniques described herein will employ, unless otherwise indicated, conventional techniques of tissue culture, immunology, molecular biology, microbiology, cell biology, and recombinant DNA, which are within the skill of the art. For example, see Green and Sambrook (eds.) (2012) Molecular Cloning: A Laboratory Manual, 4th edition; Ausubel et al. (eds.) (2015) Current Protocols in Molecular Biology series; Methods in Enzymology series (Academic Press, Inc., NY); MacPherson et al. (2015) PCR 1: A Practical Approach (IRL Press at Oxford University Press); MacPherson et al. (1995) PCR 2: A Practical Approach; McPherson et al. (2006) PCR: The Basics (Garland Science); Harlow and Lane (eds.) (1999) Antibodies, A Laboratory Manual; Greenfield (eds.) (2014) Antibodies, A Laboratory Manual; Freshney (2010) Culture of Animal Cells: A Manual of Basic Techniques, 6th edition; Gait (ed.) (1984) Oligonucleotides Synthesis; U.S. Patent No. 4,683,195; Hames and Higgins (eds.) (1984) Nucleic Acid Hybridization; Anderson (1999) Nucleic Acid Hybridization; Herdewijn (eds.) (2005) Oligonucleotide Synthesis: Methods and Applications; Hames and Higgins (eds.) (1984) Transcription and Translation; Buzdin and Lukyanov (eds.) (2007) Nucleic Acids Hybridization: Modern Applications;Immobilized Cells and Enzymes (IRL Press (1986)); Grandi (ed.), (2007) In vitro Transcription and Translation Protocols, 2nd ed.; Guisan (ed.), (2006) Immobilization of Enzymes and Cells; Perbal (1988) A Practical Guide to Molecular Cloning, 2nd ed.; Miller and Calos (ed.), (1987) Gene Transfer Vectors for Mammalian Cells (Cold Spring Harbor Laboratory); Makrides (ed.), (2003) Gene Transfer and Expression in Mammalian Cells; Mayer and Walker (ed.), (1987) Immunochemical Methods in Cell and Molecular Biology (Academic Press, London); Lundblad and Macdonald (ed.), (2010) Handbook of Biochemistry and Molecular Biology, 4th ed.; Herzenberg et al. (ed.), (1996) Weir's Handbook of Experimental Immunology, 5th Edition, and / or their more recent editions.
[0034] The terminology used in the description herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the disclosure.
[0035] All numerical designations, including ranges, such as pH, temperature, time, concentration, and molecular weight, are approximations that vary (+) or (-) by increments of 1.0 or 0.1, as appropriate, or alternatively by a variation of + / - 15%, or alternatively by a variation of 10%, or alternatively by 5%, or alternatively by 2%. It should be understood, although not always explicitly stated, that all numerical designations are preceded by the term "about." It should also be understood, although not always explicitly stated, that the reagents described herein are merely exemplary and that equivalents of such are known in the art.
[0036] Unless the context indicates otherwise, it is expressly intended that the various features of the disclosure described herein may be used in any combination. Moreover, the present disclosure also contemplates that, in some embodiments, any feature or combination of features described herein may be excluded or omitted. By way of example, if the specification refers to a composite comprising components A, B, and C, it is expressly intended that any or any combination of A, B, or C, singly or in any combination, may be omitted or waived.
[0037] Unless expressly stated otherwise, all specific embodiments, features and terms are intended to include both the recited embodiment, feature or term and their biological equivalents.
[0038] The terms "protein" or "polypeptide," used interchangeably herein, comprise one or more chains of chemical building blocks called amino acids that are linked together by chemical bonds called peptide bonds.
[0039] As used herein, the term "about" can mean within an acceptable error range for a particular value as determined by one of ordinary skill in the art, which may depend in part on how the value is measured or determined, e.g., the limitations of the measurement system. For example, "about" can mean plus or minus 10%, according to practice in the art. Alternatively, "about" can mean a range of plus or minus 20%, plus or minus 10%, plus or minus 5%, or plus or minus 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, within 5-fold, or within 2-fold of a value. When specific values are described in applications and claims, unless otherwise specified, the term "about" can be assumed to mean within an acceptable error range for the particular value. Also, when ranges and / or subranges of values are provided, the ranges and / or subranges can include the endpoints of the ranges and / or subranges. In some cases, variations can include amounts or concentrations of 20%, 10%, 5%, 1%, 0.5%, or even 0.1% of the specified amount.
[0040] For the recitation of numerical ranges herein, each intervening number is expressly contemplated with the same degree of precision. For example, for the range of 6 to 9, the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range of 6.0 to 7.0, the numbers 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are expressly contemplated.
[0041] As used herein, the term "adeno-associated virus" or "AAV" refers to a member of the genus Dependoparvovirus, a class of viruses associated with this name, belonging to the family Parvoviridae. Multiple serotypes of this virus are known to be suitable for gene delivery, and all known serotypes are capable of infecting cells from a variety of tissue types. At least 11 consecutively numbered serotypes have been disclosed in the prior art. Non-limiting exemplary serotypes useful for the purposes disclosed herein include any of the 11 serotypes, e.g., AAV2 and AAV9. As used herein, the term "lentivirus" refers to a member of the genus Lentivirus, a class of viruses associated with this name, belonging to the family Retroviridae. Some lentiviruses are known to cause disease, while others are known to be suitable for gene delivery. See, for example, Tomas et al. (2013) Biochemistry, Genetics and Molecular Biology: "Gene Therapy - Tools and Potential Applications", ISBN 978-953-51-1014-9, DOI: 10.5772 / 52534.
[0042] The term "CAS9" can refer to the CRISPR-associated endonuclease referred to by this name. Non-limiting exemplary CAS9s include Staphylococcus aureus CAS9, nuclease-dead CAS9, and their respective orthologs and biological equivalents. Orthologs include, but are not limited to, CAS9 from Streptococcus pyogenes CAS9 ("spCas9"), Streptococcus thermophiles, Legionella pneumophilia, Neisseria lactamica, Neisseria meningitides, and Francisella novicida; and Cpf1 (which performs a cleavage function similar to CAS9) from various bacterial species, including Acidaminococcus spp. and Francisella novicida U112. For example, UniProtKB G3ECR1(CAS9_STRTR) can be used, as well as dead CAS9 or dCas9 lacking endonuclease activity (e.g., with mutations in both the RuvC and HNH domains). The term "CAS9" can further refer to equivalents of a reference CAS9 having at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto, including, but not limited to, other large CAS9 proteins. In some embodiments, the CAS9 is derived from Campylobacter jejuni or another CAS9 ortholog that is 1000 amino acids or less in length.
[0043] As used herein, the term "cassette" or "expression cassette" refers to a modular polynucleotide construct that may contain one or more domains such that the cassette can be efficiently moved between different vector systems and, when expressed, provides a substantially similar encoded construct or expression profile.
[0044] A "TCF4 cassette" is a cassette containing a TCF4 coding sequence. In one embodiment, a TCF4 cassette includes at least one mini-promoter or core promoter cassette operably linked to a polynucleotide encoding a TCF4 polypeptide (e.g., a TCF4-B polypeptide). In some embodiments, a TCF4 cassette may include one or more μE5 boxes. Thus, a "TCF4 cassette" may include a single mini-promoter operably linked to the coding sequence of a TCF4 polypeptide (e.g., a TCF4-B polypeptide) and may include one or more μE5 boxes operably associated with the mini-promoter. Examples of cassettes are provided in Figures 4A-E (SEQ ID NOS: 4, 5, 6, 7, and 8, respectively). It will be recognized that the sequences provided in Figure 4 may vary by 1% to 15% (e.g., 85% to 99% identical to the sequences of Figures 4A-D or E), so long as the variant still drives transcription of a functional TCF4 polypeptide.
[0045] As used herein, the term "CRISPR" can refer to a method of sequence-specific gene manipulation that relies on the clustered regularly interspaced short palindromic repeats pathway.CRISPR can be used to perform gene editing and / or gene regulation, and simply to target proteins to specific genomic locations."Gene editing" can refer to a type of genetic engineering in which the nucleotide sequence of a target polynucleotide is changed through the introduction of deletion, insertion, single-strand or double-strand breaks, or base substitutions in the polynucleotide sequence.In some embodiments, CRISPR-mediated gene editing utilizes the pathway of non-homologous end joining (NHEJ) or homologous recombination to perform editing.Gene regulation can refer to increasing or decreasing the production of a specific gene product, for example, protein or RNA.
[0046] As used herein, the term "deficient" can refer to a lower than normal (physiologically acceptable) level of a particular agent. In the context of a protein, deficient can refer to a lower than normal level of the full-length protein.
[0047] As used herein, the term "domain" can refer to a specific region of a polypeptide or polynucleotide that is associated with a specific function. For example, a "domain that binds to an RNA-binding protein" can refer to a domain of a polynucleotide that binds to one or more polypeptides that regulate expression.
[0048] The term "encoding," when applied to a polynucleotide, can refer to a polynucleotide that is said to "encode" a polypeptide if it, in its natural state or when manipulated by methods well known to those of skill in the art, can be transcribed and / or translated to produce mRNA for the polypeptide and / or fragment thereof. The antisense strand is the complement of such a nucleic acid, and the coding sequence can be deduced therefrom.
[0049] The terms "equivalent" or "biological equivalent" are used interchangeably when referring to a particular molecule, biological material, or cellular material and are intended to have minimal homology while still maintaining the desired structure or function.
[0050] As used herein, the term "gRNA" or "guide RNA" can refer to a guide RNA sequence used to target a specific polynucleotide sequence for gene editing using CRISPR technology. Techniques for designing gRNAs and donor therapeutic polynucleotides for target specificity are well known in the art. For example, see Doench, J. et al., Nature biotechnology 2014;32(12):1262-7; Mohr, S. et al. (2016) FEBS Journal 283:3232-38; and Graham, D. et al., Genome Biol. 2015;16:260. The gRNA may comprise, alternatively consist essentially of, or further consist of a fusion polynucleotide comprising a CRISPR RNA (crRNA) and a trans-activating CRIPSPR RNA (tracrRNA); or a polynucleotide comprising a CRISPR RNA (crRNA) and a trans-activating CRIPSPR RNA (tracrRNA). In some embodiments, the gRNA is synthetic (Kelley, M. et al., J of Biotechnology 233 (2016) pp. 74-83).
[0051] "Homology" or "identity" or "similarity" can refer to the sequence similarity between two peptides or two nucleic acid molecules. Homology can be determined by comparing positions in each sequence, which can be aligned for comparison. If a position in the compared sequences is occupied by the same base or amino acid, the molecules are homologous at that position. The degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. An "unrelated" or "non-homologous" sequence shares less than 40% identity, or alternatively, less than 25% identity, with one of the sequences of the present disclosure.
[0052] As a practical matter, a specific sequence can be at least 50%, 60%, 70%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to any sequence described herein (which can correspond to a specific nucleic acid sequence described herein), and such a specific sequence can be conventionally determined using a known computer program such as the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, Wis. 53711).When using Bestfit or any other sequence alignment program to determine whether a specific sequence is, for example, 95% identical to a reference sequence, parameters can be set so that the percentage of identity is calculated over the entire length of the reference sequence, and a maximum of 5% gap in homology can be allowed across the entire reference sequence.
[0053] For example, in certain embodiments, the identity between a reference sequence (query sequence, i.e., a sequence of the present disclosure) and a subject sequence, also referred to as a global sequence alignment, can be determined using the FASTDB computer program based on the algorithm of Brutlag et al. (Comp. App. Biosci. 6:237-245 (1990)). In some cases, parameters for certain embodiments in which identity is interpreted narrowly are used for FASTDB amino acid alignment, which may include the following: scoring scheme = PAM (percent allowed mutations) 0, k-tuple = 2, mismatch penalty = 1, joining penalty = 20, randomization group length = 0, cutoff score = 1, window size = sequence length, gap penalty = 5, gap size penalty = 0.05, window size = 500 or the length of the subject sequence, whichever is shorter. According to this embodiment, if the subject sequence is shorter than the query sequence due to N- or C-terminal deletions rather than internal deletions, a manual correction can be made to the results to account for the fact that the FASTDB program does not consider N- and C-terminal truncations of the subject sequence when calculating the global percent identity. For subject sequences that are truncated at the N- and C-termini relative to the query sequence, the percent identity can be corrected by calculating the number of query sequence residues at the N- and C-termini of the subject sequence that are not matched / aligned with the corresponding subject residues as a percentage of the total bases in the query sequence. Whether a residue is matched / aligned can be determined by the results of the FASTDB sequence alignment. This percentage can then be subtracted from the percent identity calculated by the FASTDB program using the specified parameters to arrive at a final percent identity score. This final percent identity score can be used for the purposes of this embodiment. In some cases, for the purpose of manually adjusting the percent identity score, only residues at the N- and C-termini of the subject sequence that are not matched / aligned with the query sequence are considered.That is, only query residue positions outside the farthest N- and C-terminal residues of the subject sequence are considered for this manual correction. For example, a 90-residue subject sequence can be aligned with a 100-residue query sequence to determine percent identity. Because the deletion occurs at the N-terminus of the subject sequence, the FASTDB alignment does not show a match / alignment of the first 10 residues at the N-terminus. Because these unpaired 10 residues represent 10% of the sequence (number of unmatched N- and C-terminal residues / total number of query residues), 10% is subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 residues are perfectly matched, the final percent identity may be 90%. In another example, a 90-residue subject sequence is compared with a 100-residue query sequence. This time, because the deletion is internal, there are no residues at the N- or C-termini of the subject sequence that are not matched / aligned with the query. In this case, the percent identity calculated by FASTDB is not manually corrected. Again, only residue positions outside the N- and C-termini of the subject sequence, as shown in the FASTDB alignment, that are not matched / aligned with the query sequence are manually corrected. Alignment of two polynucleotides can also be performed using a similar approach.
[0054] "Hybridization" can refer to a reaction in which one or more polynucleotides react to form a complex stabilized through hydrogen bonds between the bases of nucleotide residues. Hydrogen bonds can occur through Watson-Crick base pairing, Hoogsteen binding, or any other sequence-specific manner. The complex can include two strands forming a duplex structure, three or more strands forming a multi-stranded complex, a single self-hybridizing strand, or any combination thereof. A hybridization reaction can constitute a step in a larger process, such as the initiation of a PCR reaction or the enzymatic cleavage of a polynucleotide by a ribozyme.
[0055] Examples of stringent hybridization conditions include an incubation temperature of about 25°C to about 37°C, a hybridization buffer concentration of about 6xSSC to about 10xSSC, a formamide concentration of about 0% to about 25%, and a wash solution of about 4xSSC to about 8xSSC. Examples of moderate hybridization conditions include an incubation temperature of about 40°C to about 50°C, a buffer concentration of about 9xSSC to about 2xSSC, a formamide concentration of about 30% to about 50%, and a wash solution of about 5xSSC to about 2xSSC. Examples of high stringency conditions include an incubation temperature of about 55°C to about 68°C, a buffer concentration of about 1xSSC to about 0.1xSSC, a formamide concentration of about 55% to about 75%, and a wash solution of about 1xSSC, 0.1xSSC, or deionized water. Generally, hybridization incubation times range from 5 minutes to 24 hours, with one, two, or more wash steps, with wash incubation times of about 1, 2, or 15 minutes. SSC is a 0.15M NaCl and 15 mM citrate buffer. It will be understood that equivalents of SSC using other buffer systems can be used.
[0056] The term "isolated" as used herein can refer to a molecule or biologic or cellular material that is substantially free of other materials. In one aspect, the term "isolated" can refer to a nucleic acid, e.g., DNA or RNA, or a protein or polypeptide (e.g., an antibody or derivative thereof), cell or organelle, or tissue or organ, separated from other DNA or RNA, protein or polypeptide, cell or organelle, or tissue or organ, respectively, present in its natural source. The term "isolated" can also refer to a nucleic acid or peptide that is substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized. Furthermore, "isolated nucleic acid" is meant to include nucleic acid fragments that are not naturally occurring as fragments and would not be found in the natural state. The term "isolated" is also used herein to refer to a polypeptide isolated from other cellular proteins, and is meant to encompass both purified and recombinant polypeptides. The term "isolated" is also used herein to refer to a cell or tissue isolated from other cells or tissues, and is meant to encompass both cultured and engineered cells or tissues.
[0057] The terms "protein," "peptide," and "polypeptide" are used interchangeably and, in their broadest sense, refer to a compound of two or more subunit amino acids, amino acid analogs, or peptidomimetics. The subunits may be linked by peptide bonds. In another embodiment, the subunits may be linked by other bonds, such as esters, ethers, etc. A protein or peptide can contain at least two amino acids, and there is no limit to the maximum number of amino acids that can make up the sequence of a protein or peptide. As used herein, the term "amino acid" can refer to either natural and / or unnatural or synthetic amino acids, including glycine and both D and L optical isomers, amino acid analogs, and peptidomimetics. As used herein, the term "fusion protein" can refer to a protein containing domains derived from two or more naturally occurring or recombinantly produced proteins, generally with each domain performing a different function. In this regard, the term "linker" can refer to a protein fragment used to link these domains together (optionally to maintain the conformation of the fusion protein domains and / or to prevent undesired interactions between the fusion protein domains that could impair their respective functions).
[0058] The terms "polynucleotide" and "oligonucleotide" are used interchangeably and refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or their analogs. Polynucleotides can have any three-dimensional structure and can perform any function, known or unknown. The following are non-limiting examples of polynucleotides: genes or gene fragments (e.g., probes, primers, ESTs, or SAGE tags), exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, RNAi, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. Polynucleotides can contain modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure can be imparted before or after assembly of the polynucleotide. The sequence of nucleotides can be interrupted by non-nucleotide components. Polynucleotides can be further modified after polymerization, such as by conjugation with a labeling component. The term can also refer to both double-stranded and single-stranded molecules. Unless otherwise specified or required, any embodiment of the present disclosure that is a polynucleotide encompasses both the double-stranded form and each of the two complementary single-stranded forms that are known or predicted to constitute the double-stranded form.
[0059] It is understood that the polynucleotides described herein include "genes," and that the nucleic acid molecules described herein include "vectors" or "plasmids." For example, a polynucleotide encoding TCF4 may be encoded by the TCF4 gene or a homolog thereof. Thus, the term "gene," also referred to as a "structural gene," refers to a polynucleotide that encodes a specific sequence of amino acids, comprising all or part of one or more proteins or enzymes, and may include regulatory (non-transcribed) DNA sequences, e.g., promoter sequences, that determine the conditions under which the gene is expressed. The transcribed region of a gene may include, in addition to the coding sequence, untranslated regions, including introns, 5'-untranslated regions (UTRs), and 3'-UTRs. The terms "nucleic acid" or "recombinant nucleic acid" refer to polynucleotides such as deoxyribonucleic acid (DNA), and, where appropriate, ribonucleic acid (RNA). Any sequence containing thymine (T) provided herein can be converted to an RNA sequence by replacing "T" with "U" (uracil). Thus, both DNA and RNA sequences are contemplated herein.
[0060] Those skilled in the art will recognize that, due to the degeneracy of the genetic code, a variety of DNA or RNA compounds differing in nucleotide sequence can be used to encode a given amino acid sequence of the present disclosure. The native DNA or RNA sequences encoding TCF4 are merely exemplary embodiments of the present disclosure, and the present disclosure includes DNA compounds of any sequence that encode the amino acid sequence of the polypeptides and proteins utilized in the methods of the present disclosure. Similarly, polypeptides can typically tolerate one or more amino acid substitutions, deletions, and insertions in their amino acid sequence without loss or significant loss of desired activity. The present disclosure includes such polypeptides with alternative amino acid sequences, and the amino acid sequences encoded by the DNA sequences shown herein are merely illustrative embodiments of the present disclosure.
[0061] The nucleic acid of the present disclosure can be amplified by using cDNA, mRNA or alternatively genomic DNA as template and suitable oligonucleotide primers according to standard PCR amplification method.The nucleic acid thus amplified can be cloned into suitable vector and characterized by DNA sequencing.In addition, the oligonucleotide corresponding to nucleotide sequence can be prepared by standard synthesis method, for example, using automatic DNA synthesizer.
[0062] It will also be understood that isolated nucleic acid molecules encoding polypeptides homologous to the TCF4 polypeptides described herein can be generated by introducing one or more nucleotide substitutions, additions, or deletions into the nucleotide sequence encoding a particular polypeptide, resulting in one or more amino acid substitutions, additions, or deletions in the encoded protein. Mutations can be introduced into polynucleotides by standard techniques, such as site-directed mutagenesis and PCR-mediated mutagenesis. Conservative amino acid substitutions are preferred at some positions, in contrast to positions where non-conservative amino acid substitutions are desirable. A "conservative amino acid substitution" is one in which an amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains are defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
[0063] The term "polynucleotide sequence" refers to the alphabetical representation of a polynucleotide molecule that can be entered into a database in a computer having a central processing unit and used in bioinformatics applications, such as functional genomics and homology searching.
[0064] As used herein, the term "recombinant expression system" refers to one or more genetic constructs for the expression of particular genetic material formed by recombinant means, and in this regard the term "construct" is interchangeable with the term "vector" as defined herein.
[0065] As used herein, the term "restoring" with respect to protein expression can refer to the ability to establish expression of a full-length protein whose previous expression was truncated due to a mutation. In the context of "restoring activity," this term includes restoring protein expression to its normal, non-mutated level when a mutation has resulted in aberrant expression (e.g., too low or too high).
[0066] "Transformation" refers to the process by which a vector is introduced into a host cell. Transformation (or transduction, or transfection) can be accomplished by any one of several means, including viral delivery, electroporation, microinjection, biolistic (or biolistic-mediated delivery), etc.
[0067] As used herein, the terms "treating," "treatment," and the like are used herein to mean obtaining a desired pharmacological and / or physiological effect. The effect can be prophylactic, in that it completely or partially prevents a disease, disorder, or condition, or a sign or symptom thereof, and / or therapeutic, in that it partially or completely cures the disorder and / or adverse effects resulting from the disorder.
[0068] As used herein, the term "vector" can refer to a nucleic acid construct designed for transfer between different hosts, including, but not limited to, plasmids, viruses, cosmids, phages, BACs, YACs, etc. A "viral vector" is defined as a recombinantly produced virus or viral particle containing a polynucleotide that is delivered to a host cell either in vivo, ex vivo, or in vitro. In some embodiments, a plasmid vector can be prepared from a commercially available vector. In other embodiments, a viral vector can be generated from a baculovirus, retrovirus, adenovirus, AAV, etc., according to techniques known in the art. In one embodiment, the viral vector is a lentiviral vector. Examples of viral vectors include retroviral vectors, adenoviral vectors, adeno-associated viral vectors, alphaviral vectors, etc. Infectious tobacco mosaic virus (TMV)-based vectors can be used to produce proteins and have been reported to express Griffithsin in tobacco leaves (O'Keefe et al. (2009) Proc. Nat. Acad. Sci. USA 106(15):6099-6104). Alphavirus vectors, such as Semliki Forest virus-based vectors and Sindbis virus-based vectors, have also been developed for use in gene therapy and immunotherapy. See Schlesinger and Dubensky (1999) Curr. Opin. Biotechnol. 5:434-439 and Ying et al. (1999) Nat. Med. 5(7):823-827. In embodiments where gene transfer is mediated by a retroviral vector, vector construct can refer to a polynucleotide comprising the retroviral genome or a portion thereof and a gene of interest.Further details regarding the latest methods of vectors for use in gene transfer can be found, for example, in Kotterman et al. (2015) Viral Vectors for Gene Therapy: Translational and Clinical Outlook Annual Review of Biomedical Engineering 17. Vectors containing both a promoter and a cloning site into which a polynucleotide can be operably linked are well known in the art. Such vectors can transcribe RNA in vitro or in vivo and are commercially available from suppliers such as Agilent Technologies (Santa Clara, Calif.) and Promega Biotech (Madison, Wis.).
[0069] PTHS can be caused by heterozygous mutations in the TCF4 gene, which encodes a basic helix-loop-helix (bHLH) transcription factor. Patients with PTHS exhibit severe intellectual and cognitive impairment, marked developmental delay, complete absence of speech, and characteristic facial dysmorphism. Most patients exhibit hypotonia, motor retardation, and / or ataxic gait. Constipation is a common symptom, likely due to enteric nervous system abnormalities. Respiratory abnormalities and seizures are variable clinical findings, sometimes with delayed onset. Autistic behaviors include lack of verbal communication, intellectual disability, and repetitive, self-centered behaviors.
[0070] The TCF4 gene is located on chromosome 18 (18q21.2) and spans 18 coding exons. Its longest and most extensively studied alternatively spliced transcript encodes the TCF4-B protein isoform, a bHLH transcription factor highly expressed throughout the brain during development. The TCF4 protein binds to E-box regulatory sequences (consensus CANNTG) and appears to be involved in multiple developmental processes in the immune system, epithelial-mesenchymal transition, and nervous system. Most patients with PTHS exhibit private mutations in the TCF4 gene, which can be large chromosomal deletions spanning the entire gene, partial gene deletions, translocations, or point mutations.
[0071] This disclosure provides DNA constructs and methods for altering the expression of the human gene TCF4 (OMIM 602272; synonyms E2-2, ITF2, PTHS, SEF2, and bHLHb19), which can therefore be used to develop methods for increasing expression of the TCF4 gene in diseased cells and tissues or in individuals with decreased TCF4 expression, such as, but not limited to, human subjects with the genetic condition known as Pitt-Hopkins syndrome (PTHS; MIM #610954). Interestingly, according to a WGAS study, TCF4 is also the greatest risk factor for schizophrenia.
[0072] The present disclosure provides multiple expression cassettes that can be used with suitable DNA constructs and vectors to deliver and / or increase TCF4 or TCF4 expression. For example, in one embodiment, extra copies of the TCF4 coding sequence (e.g., the TCF4 gene) are inserted into a target cell or tissue. The DNA construct contains the coding sequence for a TCF4-B transcript or variant, typically preceded by a DNA regulatory element that allows for control of the expression rate once the construct is inserted into a target cell. TCF4-B is used as an example based on its high expression level in neural progenitor cells and neurons (Figure 1). In one embodiment, the expression cassette TCF4-B cDNA sequence can be placed under the control of a synthetic minimal promoter (minP) preceded by a variable number (0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 3, 14, or 15) of regulatory sequences recognized by the TCF4 protein itself, known as μE5 boxes (Figure 2). This approach provides for expression of the TCF4 gene only in cell types in which it is normally found.
[0073] The results demonstrate that TCF4 expression levels can be manipulated by varying the number of μE5 boxes, resulting in controllable overexpression of the TCF4 gene in target cells (Figure 2). Furthermore, these DNA constructs have been used in lentiviral particles to infect (transduce) affected target cells derived from PTHS patients. In particular, this construct has been introduced into neural progenitor cells (NPCs). Experiments have verified that they enhance TCF4 expression in these cells (Figure 3A), increasing expression levels by 2- to 5-fold, depending on the number of μE5 boxes in the specific construct tested. Furthermore, this genetic manipulation corrected the expression of TCF4 target genes, such as GADD45G (Figure 3B), restoring their levels to normal levels seen in control cell lines (Figure 3B).
[0074] As provided herein, the cassette of the present disclosure comprises a TCF4 (TCF4-B) cDNA: Code the following.
[0075] The cassette can include a minimal promoter and one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or more) protein binding domains, e.g., one or more μE5 box domains, operably linked to the minimal promoter. The μE5 box has the sequence cacctg, and in some embodiments, the μE5 is spaced from the next adjacent μE5 by about 3 to about 10 nucleotides, e.g., about 4 to about 8 nucleotides (e.g., about 6 nucleotides), such that the μE5 can include the sequence of SEQ ID NO: 10. An exemplary μE5 is represented by SEQ ID NO: 10. An exemplary minimal promoter includes agagggtatataatggaagctcgacttccag (SEQ ID NO: 3). Other minimal or core promoters are described herein. In some embodiments, the minimal promoter of SEQ ID NO: 3 is separated from the μE5 domain by a spacer (e.g., caagaa).
[0076] The cassette can be placed into a suitable vector by recombinant molecular biology techniques to facilitate delivery to cells. As described below, suitable vectors can be DNA constructs or viral vectors (e.g., adenoviral vectors, retroviral vectors, e.g., lentiviral vectors, and gammaviral vectors).
[0077] Most promoters are quite large, typically exceeding 600 bp, and full-length promoters can be several kilobases in size. Smaller promoters can be engineered to enable reliable expression of transgenes in mammalian cells from vectors such as retroviral vectors, including replicating and non-replicating viral vectors. As noted above, a suitable mini-promoter can include SEQ ID NO: 3. Other suitable mini-promoters can be derived from the "core" promoter described by Kadanaga et al. (Juven-Gershon et al., Nature Methods, 11:917-922, 2006). These core promoters are based on the adenovirus major late (AdML) and cytomegalovirus (CMV) major immediate early genes, and the synthetic "super core promoter"-1 (SCP1). Other cellular core promoters include, but are not limited to, the human homeooxygenase proximal promoter (121 bp; Tyrrell et al., Carcinogenesis, 14:761-765, 1993), the CTP:phosphocholine cytidylyltransferase (CCT) promoter (240 bp; Zhou et al., Am. J. Respir. Cell Mol. Biol., 30:61-68, 2004); human ASK (activator of S-phase kinases, also known as HsDbf4 gene, 63 bp; Yamada et al., J. Biol. Chem., 277:27668-27681, 2002); and the HSVTK intragenic core (Al-Shawi et al., Mol. Cell. Biol., 11:4207, 1991; Salamon et al., Mol. Cell. Biol., 15:5322, 1995). Furthermore, these "core" promoters can be used as a starting point for further modifications to improve promoter activity. For example, such modifications include the addition of other domains and sequences (e.g., enhancers, Kozak sequences, etc.) to the "core" promoter to improve function. In one embodiment, such further modifications can include the addition of enhancer or transcription binding protein sequences.
[0078] These core promoters are approximately 30-80 bp in length, providing ample additional capacity for transgene sequences when used in viral vectors. The use of such promoters can result in efficient expression of genes such as the TCF4 gene or coding sequence (e.g., SEQ ID NO: 1).
[0079] Furthermore, rational design methods can be used to optimize the expression and stability of vectors and cassettes using various promoter components.Such optimized core promoters can provide more efficient expression and stability of viral polynucleotides.For example, "designer" promoters can include core promoters that are further modified to include one or more additional elements suitable for stability and expression.
[0080] As used herein, "core promoter" refers to a minimal promoter consisting of approximately 30-100 bp and lacking enhancer elements. Such core promoters include, but are not limited to, the SCP1, AdML, and CMV core promoters, as well as the promoter of SEQ ID NO: 3. An exemplary promoter may include SEQ ID NO: 3.
[0081] Core promoters include certain viral promoters. As used herein, a viral promoter is a promoter that has a core sequence but usually also has several additional auxiliary elements. For example, the SV40 early promoter contains three elements: a TATA box, an initiation site, and a GC repeat sequence (Barrera-Saldana et al., EMBO J, 4:3839-3849, 1985; Yaniv, Virology, 384:369-374, 2009). The TATA box is located approximately 20 base pairs upstream from the transcription start site. The GC repeat sequence is a 21-base pair repeat sequence containing six GC boxes, which determines the direction of transcription. This core promoter sequence is approximately 100 base pairs long. By adding an additional 72-base pair repeat sequence, it becomes a "mini promoter," which is useful as a transcription enhancer, increasing promoter function by approximately 10-fold. When SP1 protein interacts with the 21-bp repeat sequence, it binds to either the first or last of the three GC boxes. Binding to the first three initiates early expression, while binding to the last three initiates late expression. The function of the 72-bp repeat sequence is to increase the amount of stable RNA and enhance synthesis rate. This is achieved by binding (dimerizing) with AP1 (activator protein 1), resulting in a 3' polyadenylated and 5' capped primary transcript. Other viral promoters, such as Rous sarcoma virus (RSV), HBV X gene promoter, and herpes thymidine kinase core promoter, can also be used as a basis for selecting desired functions.
[0082] Core promoters typically span the -40 to +40 region relative to the +1 transcription start site (Juven-Gershon and Kadonaga, Dev. Biol. 339:225-229, 2010), and this start site defines the location where the RNA polymerase II machinery begins transcription. Typically, RNA polymerase II interacts with several transcription factors that bind to DNA motifs in the promoter. These factors are commonly known as "general" or "basal" transcription factors, and include, but are not limited to, TFIIA (transcription factor for RNA polymerase IIA), TFIIB, TFIID, TFIIE, TFIIF, and TFIIH. These factors act in a "general" manner on all core promoters; therefore, they are often referred to as "basal" transcription factors.
[0083] Juven-Gershon et al., 2006 (supra) describe the elements of core promoters. For example, the pRC / CMV core promoter consists of a TATA box and is 81 bp in length, and the CMV core promoter consists of a TATA box and an initiator site, while the SCP synthetic core promoters (SCP1 and SCP2) consist of a TATA box, an Inr (initiator), an MTE site (motif 10 element), and a DPE site (downstream promoter element) and are approximately 81 bp in length. The SCP synthetic promoters have improved expression compared to the simple pRC / CMV core promoter.
[0084] As used herein, a "mini-promoter" or "mini promoter" refers to a regulatory domain that promotes transcription of an operably linked gene or coding nucleic acid sequence. As the name implies, a mini-promoter contains the minimum number of elements necessary for efficient transcription and / or translation of an operably linked coding sequence. A mini-promoter can include a "core promoter" in combination with additional regulatory elements or a "modified core promoter." Typically, a mini-promoter or modified core promoter is about 30-600 bp in length, while a core promoter is typically less than about 100 bp (e.g., about 30-80 bp). In other embodiments in which a core promoter is present, the cassette can optionally include enhancer elements or other elements, either upstream or downstream of the core promoter sequence, that facilitate expression of the operably linked coding sequence at levels exceeding those of the core promoter alone.
[0085] Thus, the present disclosure provides mini-promoters (e.g., modified core promoters) derived from cellular elements determined for "core promoter" elements, which enable ubiquitous expression at significant levels in target cells, are useful for stable integration into vectors in general, especially viral vectors, and enable efficient expression of transgenes. Also provided are mini-promoters that contain a minimal enhancer sequence and / or Kozak sequence in addition to the core promoter, which allows for better gene expression compared to when such sequences are still less than 200, 400, or 600 bp of the core promoter. Such mini-promoters include modified core promoters, as well as naturally occurring tissue-specific promoters, such as the elastin promoter (specific for pancreatic acinar cells, (204 bp; Hammer et al., Mol. Cell. Biol., 7:2956-2967, 1987) and promoters from the cell cycle-dependent ASK genes from mouse and human (63-380 bp; Yamada et al., J. Biol. Chem., 277:27668-27681, 2002). Ubiquitously expressed mini-promoters include viral promoters, such as the SV40 early and late promoters (approximately 340 bp), the RSV LTR promoter (approximately 270 bp), and the HBV X gene promoter (approximately 180 bp), which lack the canonical "TATTAA box" and have a 13 bp core sequence of 5'-CCCCGTTGCCCGG-3' (see, e.g., R Anish et al., PLoS One, 4:5103, 2009).
[0086] As described herein, such minipromoters, alone or with additional elements for expression, can be used in a variety of cassettes and vectors, including replication-competent and non-competent viral vectors, to express the TCF4 coding sequence (e.g., SEQ ID NO: 1). For example, the present disclosure provides cassettes that can be incorporated into expression vectors or viral vectors. Various vectors are known that allow for cloning of cassettes into such expression vectors or viral vectors. For example, some viral vectors can tolerate cloning of cassettes into the long terminal repeat (LTR). Other vectors can tolerate cloning of cassettes downstream of the envelope gene but upstream of the 3' LTR. Still other non-replicating vectors have essential genes (e.g., gag and pol) removed, resulting in larger cassette capacity.
[0087] Another suitable delivery vehicle for the CNS includes nanoparticles, typically with sizes less than 200 nm, or less than about 150 nm, or less than about 100 nm. These can include lipid-based nanoparticles, polymeric nanoparticles, dendrimers, and inorganic nanoparticles, some of which can be adapted to cross the blood-brain barrier (BBB). In some embodiments, the delivery system actively targets delivery by using transporter or receptor ligands to enhance nanoparticle uptake across the BBB. A preferred route for this approach is receptor- (or transporter-) mediated transcytosis, in which cargo (e.g., nanoparticles) are transported between the apical and basolateral surfaces of brain ECs. For example, low-density lipoproteins undergo transcytosis through ECs via a receptor-mediated process, bypassing the lysosomal compartment and releasing at the basolateral surface of the brain. Furthermore, because the BBB contains transporters for amino acids, using the naturally occurring arginine transporter for delivery is one approach for brain delivery. Another vehicle for brain delivery is exosomes, small extracellular vesicles secreted by cells. The main advantage of exosomes over other synthetic nanoparticles is their non-immunogenicity, which leads to long and stable circulation.
[0088] The present disclosure provides methods and compositions for treating and / or alleviating symptoms of neurological or neurodevelopmental diseases and disorders associated with abnormal expression of TCF4 in neuronal cells of the central nervous system (CNS) or peripheral nervous system (PNS), by administering an effective amount of a construct containing the disclosed TCF4 cassette so that the cassette is expressed by the neuronal cells. Neurological or neurodevelopmental diseases or disorders can also be associated with defects or abnormalities in TCF4 transcription factor gene expression and / or protein function in neuronal cells, e.g., through mutation or haploinsufficiency. Such neurological or neurodevelopmental diseases and disorders include, for example, Pitt-Hopkins syndrome (PTHS), schizophrenia, autism, and autism spectrum disorders. TCF4 cassettes can be engineered such that constructs containing the cassette are ectopically expressed in neuronal cells. As used herein, ectopic expression refers to the expression and / or activity of a protein in cells and / or tissues in which it is not normally expressed. In this case, ectopic, abnormal, or atypical expression or activity of TCF4.
[0089] The present disclosure provides a method for treating and / or alleviating a symptom of a neurological or neurodevelopmental disease or disorder, comprising delivering and expressing a TCF4 cassette to treat and / or alleviate a symptom of the neurological or neurodevelopmental disease or disorder. In one embodiment, the vector comprising the TCF4 cassette is an AAV9 vector having the sequence of SEQ ID NO:9 or a sequence at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% identical to SEQ ID NO:9. In one embodiment, the neurological or neurodevelopmental disease or disorder is associated with defective or abnormal TCF4 transcription factor gene expression and / or protein function in neuronal cells. In one embodiment, a subject in need thereof has, is suspected of having, or is at risk of having such a neurological or neurodevelopmental disease or disorder (e.g., has been identified as having a mutation in TCF4). In one embodiment, the neurological or neurodevelopmental disease or disorder is Pitt-Hopkins syndrome, schizophrenia, autism, autism spectrum disorder, or 18q syndrome.
[0090] The present disclosure also provides a method for treating and / or alleviating symptoms of a neurological or neurodevelopmental disease or disorder associated with abnormal or defective neuronal TCF4 expression and / or function in a subject in need thereof by administering to the subject a therapeutically effective amount of a TCF4 construct of the present disclosure (e.g., a vector comprising a TCF4 cassette).
[0091] The present disclosure also provides pharmaceutical compositions for administering the vectors and / or cassettes of the present disclosure, which can be conveniently provided in dosage unit form and can be prepared by any method well known in the art of pharmacy. Pharmaceutical compositions can be prepared, for example, by uniformly and intimately combining the vector and / or cassette-containing compositions provided herein with liquid carriers, finely divided solid carriers, or both. In the pharmaceutical composition, the compounds provided herein are contained in an amount sufficient to produce the desired therapeutic effect.
[0092] Systemic formulations include those designed for administration by injection (e.g., subcutaneous, intravenous, infusion, intramuscular, intracerebral, intraspinal, intrathecal, or intraperitoneal injection), as well as those designed for transdermal, transmucosal, oral, or pulmonary administration.
[0093] Useful injection preparations include the sterile suspension, solution or emulsion of the compound provided herein in aqueous or oily vehicle.Compositions can also contain formulation agents such as suspending agent, stabilizing agent and / or dispersing agent.Injection preparations can be provided in unit dosage form, for example, in ampoules or in multi-dose containers, and can contain added preservatives.
[0094] Alternatively, the injectable formulations may be provided in powder form for reconstitution with a suitable vehicle, including, but not limited to, sterile pyrogen-free water, buffer, and dextrose solution, before use. To this end, the compositions provided herein may be dried by any known method, such as lyophilization, and reconstituted before use.
[0095] "Administration" can be performed in one dose, continuously or intermittently throughout the course of treatment. Methods for determining the most effective administration means and dosage are known to those skilled in the art and can vary depending on the composition used for therapy, the purpose of therapy, the target cells being treated, and the subject being treated. Single or multiple administrations can be performed, with the dosage level and pattern selected by the treating physician. Suitable dosage formulations and methods for administering drugs are known in the art. The route of administration can also be determined, and methods for determining the most effective administration route are known to those skilled in the art and can vary depending on the composition used for therapy, the purpose of therapy, the health condition or stage of the disease of the subject being treated, and the target cells or tissues.
[0096] Administration can refer to methods that can be used to deliver a compound or composition (such as a DNA construct or viral vector) to the desired site of biological action. These methods can include parenteral administration (including intravenous, subcutaneous, intrathecal, intraperitoneal, intramuscular, intravascular, or infusion), intracerebral, and intraspinal administration. In some cases, the subject can administer the composition unsupervised. In some cases, the subject can administer the composition under the supervision of a medical professional (e.g., a doctor, nurse, physician's assistant, caregiver, hospice worker, etc.). In some cases, the medical professional can administer the composition. In some cases, the cosmetic surgery professional can administer the composition.
[0097] Administration or application of the compositions disclosed herein may be for at least about 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 31 days, 32 days, 33 days, 34 days, 35 days, 36 days, 37 days, 38 days, 39 days, 40 days, 41 days, 42 days, 43 days, 44 days, 45 days, 46 days, 47 days, 48 days, 49 days, 50 days, 51 days, 52 days, 53 days, 54 days, 55 days, 56 days, 57 days, 58 days, 59 days, 60 days, 61 days, 62 days, 63 days, 64 days, 65 days, 66 days, 67 days, 68 days, 69 days, 70 days, 71 days, 72 days, 73 days, 74 days, 75 days, 76 days, 77 days, 78 days, 79 days, 80 days, 81 days, 82 days, 83 days, 84 days, 85 days, 86 days, 87 days, 88 days, 89 days, 90 days, 91 days, 92 days, 93 days, 94 days, 95 days, 96 days, 97 days, 98 days, 99 days, 100 days, 101 days Treatment periods of 2, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 consecutive or non-consecutive days can be administered. In some cases, the treatment period is from about 1 to about 30 days, from about 2 to about 30 days, from about 3 to about 30 days, from about 4 to about 30 days, from about 5 to about 30 days, from about 6 to about 30 days, from about 7 to about 30 days, from about 8 to about 30 days, from about 9 to about 30 days, from about 10 to about 30 days, from about 11 to about 30 days, from about 12 to about 30 days, from about 13 to about 30 days, from about 14 to about 30 days, from about 15 to about 30 days, The incubation period may be 0 days, about 16 to about 30 days, about 17 to about 30 days, about 18 to about 30 days, about 19 to about 30 days, about 20 to about 30 days, about 21 to about 30 days, about 22 to about 30 days, about 23 to about 30 days, about 24 to about 30 days, about 25 to about 30 days, about 26 to about 30 days, about 27 to about 30 days, about 28 to about 30 days, or about 29 to about 30 days.
[0098] The administration or application of the compositions disclosed herein can occur at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 times per day. In some cases, the administration or application of the compositions disclosed herein can occur at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 times per week. In some cases, the administration or application of the compositions disclosed herein is at least once, twice, three times, four times, five times, six times, seven times, eight times, nine times, ten times, eleven times, twelve times, thirteen times, fourteen times, fifteen times, sixteen times, seventeen times, eighteen times, nineteen times, twenty times, twenty-one times, twenty-two times, twenty-three times, twenty-four times, twenty-five times, twenty-six times, twenty-seven times, twenty-eight times, twenty-nine times, thirty-one times, thirty-two times, thirty-three times, thirty-four times, thirty-five times, thirty-six times, thirty-seven times, thirty-eight times, thirty-nine times, forty-one times, forty-one times, forty-one times, forty-two times, forty-three times, forty-five ... 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, or 90 times.
[0099] In some cases, composition can be administered / applied as a single dose or as divided doses.In some cases, the composition described herein can be administered at a first time point and a second time point.In some cases, composition can be administered such that the first administration is administered before the other, so that the difference between the administration times is 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 16 hours, 20 hours, 1 day, 2 days, 4 days, 7 days, 2 weeks, 4 weeks, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year or more.
[0100] A "composition" typically contemplates a combination of an active agent (e.g., a TCF4 cassette of the present disclosure) in a vector, such as a viral vector (e.g., and AAV9 vector), with an inert or active natural or non-natural carrier, such as an auxiliary agent, diluent, binder, stabilizer, buffer, salt, lipophilic solvent, preservative, or adjuvant, including a pharmaceutically acceptable carrier. In one embodiment, the composition comprises a sequence at least 80% to 100% identical to SEQ ID NO: 9. Carriers also include pharmaceutical excipients and additives such as proteins, peptides, amino acids, lipids, and carbohydrates (e.g., sugars, including monosaccharides, disaccharides, trisaccharides, tetrasaccharides, oligosaccharides, and oligosaccharides; derivatized sugars, e.g., alditols, aldonic acids, esterified sugars, and the like; and polysaccharides or sugar polymers), which may be present alone or in combination and may comprise 1 to 99.99% by weight or volume, alone or in combination. Exemplary protein excipients include serum albumins such as human serum albumin (HSA), recombinant human albumin (rHA), gelatin, casein, etc. Representative amino acid building blocks that can also function in a buffering capacity include alanine, arginine, glycine, arginine, betaine, histidine, glutamic acid, aspartic acid, cysteine, lysine, leucine, isoleucine, valine, methionine, phenylalanine, aspartame, etc. Carbohydrate excipients are also contemplated as being within the scope of this technology, examples of which include, but are not limited to, monosaccharides such as fructose, maltose, galactose, glucose, D-mannose, sorbose, etc., disaccharides such as lactose, sucrose, trehalose, cellobiose, etc., polysaccharides such as raffinose, melezitose, maltodextrin, dextran, starch, etc., and alditols such as mannitol, xylitol, maltitol, lactitol, xylitol sorbitol (glucitol), and myo-inositol.
[0101] Compositions and pharmaceutical preparations used in accordance with the present disclosure can be packaged in dosage unit form for ease of administration and uniformity of dosage. The term "unit dose" or "dosage" can refer to physically discrete units suitable for use in a subject, each containing a predetermined amount of the composition calculated to produce the desired response in conjunction with its administration, i.e., an appropriate route and regimen. The amount administered, both according to the number of treatments and the unit dose, depends on the desired outcome and / or protection. The precise amount of the composition also depends on the judgment of the practitioner and is unique to each individual. Factors affecting dosage include the subject's physical and clinical condition, the route of administration, the intended goal of treatment (whether symptomatic relief or cure), and the efficacy, stability, and toxicity of the particular composition. Upon formulation, solutions can be administered in a manner compatible with the dosage formulation and in such amount as will be therapeutically or prophylactically effective. The formulations are easily administered in a variety of dosage forms, for example, as the types of injectable solutions described herein. [Example]
[0102] Human Subjects. Subjects were members of volunteer families recruited through the Pitt Hopkins Research Foundation. PTHS subjects (Table 1) were selected based on the availability of detailed clinical and molecular diagnostic information, including the type of TCF4 mutation they carried. For patients with point mutations, small indels, or translocations, details of each TCF4 mutation were confirmed by resequencing the TCF4 locus. All participating family members completed a detailed and personalized questionnaire to collect information about the patient's PTHS clinical symptoms. This included questions about neurological findings, cognitive symptoms, behavioral and gastrointestinal symptoms, age at diagnosis, general quality of life, temporal progression of motor milestones, level of communication, facial dysplasia, urinary symptoms, visual impairment, sensory reactivity, sleep disorders, respiratory abnormalities (e.g., apnea and hyperventilation), eating habits and bowel symptoms, seizure history, and MRI findings. These data are reported in Table 1. To maximize comparability, only male subjects were selected for this study. Control subjects were matched fathers of patients with no history of psychiatric or genetic disorders. The participation of all subjects was approved by the Human Subjects Ethics Committee of the institution where the study was conducted. Written informed consent was obtained from all participating families after a detailed explanation of the study. It is important to note that TCF4 (transcription factor 4) should not be confused with TCF-4 (T-cell factor 4), which is an older, outdated name for TCFL7, a TCF-LEF protein that is the endpoint of the Wnt signaling pathway and is completely unrelated to the TCF4 mutated in PTHS patients.
[0103] [Table 1] For all patients, the control was a gender-matched parent. Abbreviations: FG: facial dysplasia; SM / MM: severe (SM) or mild (MM) motor retardation at age 3 years; AS: speech deficit; CT: constipation; SZ: seizures; BA: respiratory disorder (hyperpnea or apnea); UA: urinary abnormality (retention or incontinence); VA: visual abnormality (ocular abnormality); RB: repetitive behavior; abMRI: brain malformation detected by MRI (thin corpus callosum).
[0104] Reprogramming of dermal fibroblasts into induced pluripotent stem cells (iPSCs). Dermal fibroblasts were obtained from biopsy samples taken from PTHS and control subjects and then cultured in DMEM / F12 medium containing 10% fetal bovine serum and penicillin / streptomycin. iPSCs were derived from fibroblasts via cell reprogramming as described (Marchetto et al., 2017). Briefly, fibroblast cultures were transduced with Sendai virus containing overexpression cassettes for OCT4, SOX2, KLF4, and MYC (Cytotune iPS 2.0 Sendai Reprogramming Kit; Thermo Fisher Scientific). Seven days after transduction, cells were replated onto a feed layer composed of mouse embryonic fibroblasts (mEFs) in DMEM / F12 containing 20% knockout serum replacement (Thermo Fisher Scientific), 1% non-essential amino acids (NEAA), and 100 μM β-mercaptoethanol. iPSC colonies were identified after two weeks and transferred to 6 cm plates coated with Matrigel® (BD Biosciences). They were then maintained in mTeSR1 medium (StemCell Technologies) and passaged by manual extraction using a pipette tip. A total of 20 iPSC lines were generated for each subject in the study, all of which were analyzed by a combination of immunostaining and SNP mapping to rule out the presence of undesired chromosomal abnormalities and mutations (example in Figure 12B). All iPSC clones were passaged to P10, after which two clones were selected for further NPC and organoid derivation. Most experiments in this study were performed using one P15 iPSC clone per subject. Cultures were tested for mycoplasma every two weeks, and no contamination was confirmed at any stage.
[0105] iPSC validation was performed by immunostaining for SOX2, OCT4, NANOG, and LIN28. Briefly, a total of 20 colonies were grown in wells of LabTek II 8-well chamber slides (Thermo Fisher Scientific) until they reached a size of 2 mm. Subsequently, colonies were fixed with 4% paraformaldehyde solution for 10 min, washed once with 1x phosphate-buffered saline (PBS), permeabilized with 1% Triton X-100 for 5 min, washed again with 1x PBS, and blocked with 10% bovine serum albumin (BSA) / 1% Triton X-100 / 1x PBS. Incubation with primary antibodies was performed for 16 h at 4°C in the same blocking solution. The primary antibodies used were anti-SOX2 (Abcam; ab97959), anti-OCT4 (Abcam; ab19857), anti-NANOG (GeneTex; GTX100863), and anti-LIN28 (Cell Signaling; 3978). After three washes in 1x PBS, colonies were incubated with fluorescently labeled secondary antibodies for 3 hours, and nuclei were counterstained with 1 μg / mL DAPI (Thermo Fisher Scientific) for 30 minutes. Slides were mounted with ProLong Gold antifade mounting medium (Thermo Fisher Scientific).
[0106] To identify undesirable chromosomal structural changes, genome-wide profiling of amplifications, deletions, copy number changes, and rearrangements was performed on genomic DNA extracted from iPSC lines using the iScan system (Illumina) and the Infinium HumanCytoSNP-12 BeadChip (Illumina; 299,140 genetic markers). No clones containing significant deletions or duplications were found. An example of karyotyping performed using this technique is presented in Figure 12B for PTHS patient #2, showing the expected large deletion in the long arm of chromosome 18 for this patient line.
[0107] Generation of mantle and paramantle organoids. For the generation of mantle (cortical) cerebral organoids (CtOs), iPSC colonies were dissociated using Accutase (Thermo Fisher Scientific; diluted with an equal volume of 1x PBS) for 12 min at 37°C. After centrifugation at 150 x g for 3 min, individualized cells were resuspended in mTeSR1 medium (StemCell Technologies) supplemented with 10 mM SB431542 (Stemgent) and 1 mM dorsomorphin (R&D Systems). Approximately 3–4 million cells were seeded into each well of a low-binding 6-well plate and placed on a shaker in a carbon dioxide incubator at 95 rpm. During the first 24 h, 5 mM Rho kinase inhibitor (Y-27632; Calbiochem, Sigma-Aldrich) was added to the medium. Over the course of 3 days, cells clustered to form spherical embryoid bodies. After 3 days, the mTeSR1 cells were replaced with neural induction medium containing Neurobasal medium (Thermo Fisher Scientific) supplemented with GlutaMAX, 1% Gem21 NeuroPlex supplement (Gemini Bio-Products), 1% N2 NeuroPlex (Gemini Bio-Products), 1% NEAA (Thermo Fisher Scientific), 1% penicillin / streptomycin (Thermo Fisher Scientific), 10 mM SB431542, and 1 mM dorsomorphin for 7 days. The medium was then replaced with NPC growth medium containing Neurobasal medium supplemented with GlutaMAX, 1% Gem21, 1% NEAA, and 20 ng / mL FGF-2 (Thermo Fisher Scientific) for 7 days, followed by an additional 7 days in the same medium supplemented with 20 ng / mL EGF (PeproTech).Neuronal differentiation and organoid maturation were achieved by switching to Neurobasal medium containing 1% GlutaMAX, 1% Gem21, 1% NEAA, 10 ng / mL BDNF, 10 ng / mL GDNF, 10 ng / mL NT-3 (all PeproTech), 200 mM L-ascorbic acid, and 1 mM dibutyryl-cAMP (Sigma-Aldrich) for 7 days. After this period, CtOs were maintained in Neurobasal medium containing GlutaMAX, 1% Gem21, and 1% NEAA for the required length of time, with medium changes every 3–4 days. For all subjects, most experiments were performed with at least three independent batches (usually greater than 10 batches), which are considered independent biological replicates throughout the study, and there were at least triplicate technical replicates (organoid wells) per batch. For phenotypic assessments performed on four or more separate batches, two or more independent clones of iPSCs were used to generate organoids (and NPCs) to confirm the effect of genotype, as depicted in Figure 12F.
[0108] Subpallial organoids (sPOs) were generated using a previously published protocol (Birey et al., 2017) with minor modifications. Embryoid bodies were cultured in mTeSR1 for 3 days and then transferred to neural induction medium (Neurobasal medium supplemented with 1% GlutaMAX, 1% Gem21, 1% N2, 1% NEAA, 1% penicillin / streptomycin, 10 mM SB431542, and 1 mM dorsomorphin) containing 5 μM Wnt pathway inhibitor IWP-2 (SelleckChem) for days 4–10. The medium was then replaced with NPC growth medium consisting of Neurobasal medium containing 1% GlutaMAX, 1% Gem21, 1% NEAA, 20 ng / mL FGF-2, and 100 nM of the SHH pathway agonist SAG (SelleckChem) for 7 days, followed by an additional 2 days of culture in the same medium supplemented with 20 ng / mL EGF (PeproTech). The NPC growth phase was completed by an additional 5 days of culture in the same medium without SAG. Following this, neuronal differentiation and organoid maturation were performed using the same medium and duration as used in the CtO induction protocol.
[0109] Immunofluorescence staining. After in vitro culture for the required time, CtO and sPO were fixed in 4% paraformaldehyde for 4–8 hours at 4°C and cryoprotected in 30% sucrose for 12 hours. Subsequently, organoids were embedded in TissueTek (Leica Microsystems) and sectioned using a Leica VT1000S cryostat to generate 20 μm sections. For staining, slides were air-dried for 10 minutes, permeabilized in 1% Triton X-100 / 1x PBS for 2 minutes, blocked in 0.1% Triton X-100 / 3% BSA / 1x PBS for 1 hour at 25°C, and then incubated with primary antibodies in the same solution for 16 hours at 4°C. The primary antibodies used were rat anti-CTIP2 (Abcam; ab18465; 1:500); rabbit anti-SATB2 (Abcam; ab34735; 1:200); chicken anti-MAP2 (Abcam; ab5392; 1:1000); rabbit anti-SOX2 (Cell Signaling Technology; 2748; 1:500); rabbit anti-GAD65 / 67 (Abcam; ab11070; 1:200); rabbit anti-CUX1 (CUTL1 or CASP) (Abcam; ab54583; 1:200); rabbit anti-TCF4 (Abcam; ab217668; 1:1000); rabbit anti-vGLUT1 (Synaptic Systems; 135311; 1:500); rabbit anti-CC3 (cleaved caspase 3) (Cell Signaling Technology; 2748; 1:500). Signaling; 9664S; 1:500; rabbit anti-doublecortin (DCX) (Abcam; ab18723; 1:200); mouse anti-Cas9 (Abcam; ab210571; 1:200); mouse anti-p16 INK4aThe primary antibodies were: CDKN2A (Abcam; ab54210; 1:1000); rabbit anti-SOX3 (Abcam; ab183606; 1:200); mouse anti-nestin (Abcam; ab22035; 1:1000); goat anti-SOX17 (R&D Systems; AF1924; 1:200); rabbit anti-Brachyury (Sigma; B8436; 1:200); or rabbit anti-β-catenin (Cell Signaling; 9582S; 1:100). After incubation in the solution containing the primary antibodies, the slides were washed three times with 1x PBS for 5 min each and then incubated with fluorescently labeled secondary antibodies (Alexa Fluor 488- or 555-conjugated antibodies; 1:500 dilution; Thermo Fisher Scientific) in the same solution as the primary antibodies for 3 h at 25°C. After further washing with 1x PBS, slides were counterstained with DAPI solution (1 μg / mL) for 45 minutes and mounted with ProLong Gold. All images were taken using a Zeiss fluorescence microscope equipped with an Apotome (Axio Observer Apotome, Zeiss). For projection of z-series stack images of DCX-stained organoids, the maximum intensity feature of ZEN software (Zeiss) was used after collecting 10 optical slices per section. p16 INK4a For staining, slides were incubated in 1x Universal HIER Antigen Retrieval Reagent (Abcam; ab208572) at 60°C for 10 minutes for antigen retrieval, followed by standard immunostaining. INK4a To count SOX2+ cells after co-staining (Fig. 15J), unprocessed raw images were used, and strongly stained cells were defined as cells with a mean pixel intensity between the third quartile from the top and the maximum pixel intensity in each image. The remaining SOX2+ cells were considered weakly stained.
[0110] For quantification of cell types in organoid sections, four random 100 × 100 μm regions of interest (ROIs) were sampled across each imaged section. The average number of labeled cells per sample was calculated by first averaging the number of labeled cells in each ROI to generate an average number of labeled cells per section, and then averaging these averages across all sections for each subject. The number of subjects and sections quantified is indicated in the figure legend. Because vGLUT1 is mostly found outside the cell bodies, vGLUT1 and GAD65 / 67 were quantified by counting pixels in raw, unprocessed fluorescent microscopy images using the Color Pixel Counter plugin in ImageJ software and counting particles with a pixel size of 1 and a color intensity greater than 50 (ranging from 0 to 255) (Figure 12M). The average percentage of pixels that followed these rules was calculated across four 100 × 100 μm ROIs per section and six sections per subject.
[0111] For immunofluorescent labeling of NPCs, these cells were seeded at a density of 50,000 cells per well in LabTek II 8-well chamber slides. When cells reached 50% confluence, they were fixed and processed for immunostaining in the same manner as described for iPSC colonies using the following primary antibodies: rabbit anti-TCF4 (Abcam; ab217668; 1:1000); and chicken anti-vimentin (VIM) (Abcam; ab22651; 1:2000). NPCs were also stained for senescence-associated β-galactosidase (SA-β-gal) using the CellEvent™ Senescence Green Detection Kit (Thermo Fisher Scientific; C10850) after antigen retrieval as described above. p16 INK4a The same method described above for counting weakly and strongly stained SOX2+ cells after co-staining was applied to NPCs.
[0112] Postmortem Brain Sample Collection and Analysis. Patient #6 (Table 1) died at age 7 during a surgical procedure to correct scoliosis due to complications unrelated to the neurological symptoms of PTHS. A hospital pathologist immediately dissected the brain and harvested cortical tissue encompassing the entire width of the cortex at the border between the premotor and prefrontal cortices. Hippocampal tissue was also harvested but not described in this study. Brain tissue was fixed in formalin for 24 hours, followed by 6 hours in 4% paraformaldehyde, cryoprotected in 20% sucrose, sectioned under a vibratome, and then immunostained as described above. PTHS images were compared with those obtained from parallel-stained sections using normal brain tissue from a commercial source (NOVUS; NBP2-77523) collected from a 12-year-old boy with no signs of disease or neuropathology (Figure 10E). Because the characteristically disordered anatomy of PTHS brain tissue precluded the use of laminar structure as a proxy for localization within the tissue, comparisons were made using corresponding images collected from regions of interest (ROIs) at equivalent depths (measured in mm) from the cortical surface. No significant differences were observed by pathologists in the general appearance of the gyri and the width of the cortical tissue before dissection.
[0113] Single-cell RNA sequencing analysis of organoids. CtO and sPO were dissociated to generate single-cell suspensions through a combination of mechanical dissociation using tweezers and enzymatic digestion using Accutase for 10 minutes. A total of 15 organoids were dissociated for each library, and the resulting cells were pooled and then filtered to isolate single cells for RNA sequencing analysis on the same day. Dissociated cells were pelleted (3 minutes, 100 × g, 4 °C) and resuspended in 10 mL of Neurobasal medium. The concentration of single cells in each library was determined using a Chemometec automated cell counter, and a minimum population viability of 85% was found across all libraries. Single-cell RNA-seq libraries were prepared using the Chromium Single Cell 3'v3 Library Kit (10x Genomics) according to the manufacturer's protocol. Approximately 20,000 cells per sample were loaded onto a Chromium chip. All steps, including GEM (gel beads in emulsion) preparation, reverse transcription, PCR amplification, and Illumina library construction, were performed in a T100 thermal cycler (Bio-Rad). The cDNA extracted from the GEM was cleaned up using MyOne Silane Beads (Thermo Fisher Scientific), PCR amplified for a total of 10 cycles, and then purified using the SPRIselect Reagent Kit (B23317, Beckman Coulter). Next, the cDNA pool was enzymatically fragmented for each library, and double size selection was performed using the SPRIselect Reagent Kit. Finally, Illumina adapters were ligated to prepare the libraries for sequencing, followed by another double size selection using the SPRIselect Reagent Kit. The final library sizes ranged from 300 to 700 bp, with an average size of around 450 bp.Illumina libraries were quantified using the Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific), and size quality control was performed with a High Sensitivity D1000 tapestation (Agilent). Libraries were sequenced on a NovaSeq 6000 S4 sequencer (Illumina) to generate 20,000 reads per single cell or 400 million reads per library, with 26 cycles for read_1, 8 cycles for the index, and 98 cycles for read_2, which contains the gene sequence.
[0114] Feature count matrices for each single-cell RNA-Seq library were generated separately using Cell Ranger (version 4.0.0) software and the "cellranger count" command for the GRCh38 2020-A reference dataset of human transcripts. The independent libraries were then normalized to the same sequencing depth and aggregated into a single feature-barcode matrix using the "cellranger aggr" command. Cell type subpopulations were delineated through a combination of automated annotation and curated manual inspection. First, the processed data was transferred to Cell Loupe software (10x Genomics) for analysis, where single-cell populations were partitioned using k-means clustering with eight groups. Marker gene expression was then visually inspected in each subpopulation assigned by Cell Loupe. Next, the expression of each marker gene was analyzed (Figure 13B) and manually adjusted to the k-means-assigned subpopulations based on the expression patterns of these genes. This combined approach, which first performs unbiased subpopulation determination followed by manual curation, maximizes the identification of biologically relevant cell populations. Although it is clear that these subpopulations could be further subdivided into other groups of cells, we decided to focus on the group containing progenitors, intermediate progenitors, and neurons in excitatory and inhibitory lineages, as indicated by the single-cell data (Figure 6A-J). A few other subpopulations existed, but due to our focus on the six subpopulations described above, they were not represented in most panels. The other populations are collectively named "other" in Figure 13A-B, and further analysis led to the conclusion that the number of cells in this category did not differ between parental and PTHS, indicating that these were not cells of non-neuronal origin and were not present in significant amounts in CTO or sPO (Figure 13E). Mitochondrial genes were used as a proxy to identify apoptotic cells, which were generally rare (less than 5%) in all libraries.
[0115] Next, downstream processing and analysis of the feature-barcode matrix was performed using the Seurat library (version 3.2.2) (Butler et al., 2018). First, the aggregate matrix generated by Cell Ranger was imported into Seurat and normalized by dividing each cell's feature count by that cell's total count. The data were then scaled to 10,000 counts per cell before performing a logarithmic transformation ("NormalizeData" function). Variable features were then identified using the "FindVariableFunctions" function, which fits a polynomial curve to the mean-variance relationship, normalizing feature counts based on the expected variance given their expression, and selecting the 3,000 features with the highest variance. Highly variable features were then scaled to a distribution with a mean expression of 0 and variance of 1 across cells ("ScaleData" function), which was then used to perform linear dimensionality reduction (PCA, "RunPCA" function). The first 15 PCA dimensions were used to embed cells into a nonlinear reduced dimensional space using the UMAP algorithm ("RunUMAP" function).
[0116] Unsupervised trajectory (pseudotime) inference (Figure 6B) was performed independently for excitatory and inhibitory lineages using Monocle 3 (version 0.2.2) (Cao et al., 2019). Specifically, the Leiden method was used to cluster cells within the UMAP embedding ("cluster_cells" function). Subsequently, a non-split main graph representing the differentiation trajectory was fitted to the data ("learn_graph" function). Finally, cells were ordered by routing trajectories through manually annotated progenitor subpopulations ("order_cells" function). Pseudotime is the transcriptional distance (in abstract units) between a cell and the start of the trajectory, measured along the shortest path.
[0117] The percentage of cells in each subpopulation and library was quantified using Cell Loupe software (Figures 6D, 6G, 13F, 13G, 16H, and 17K). To calculate the percentage of cells expressing a specific gene, the Seurat and R packages were used to count the number of cells expressing the gene above a threshold level corresponding to 40% of the mean gene expression value in each group being compared (Figures 6E, 6H-J, 7F, 13H, 13I, and 17L). For statistical comparisons of gene expression levels between specific subpopulations, the Mann-Whitney U test (two groups) or the Kruskal-Wallis test followed by Dunn's post hoc test (comparisons of more than two groups and pairwise comparisons) were used.
[0118] NPC induction and neuronal differentiation. iPSC colonies maintained in mTeSR1 medium were switched to DMEM / F12 medium containing N2 and GEM21 supplements (StemCell Technologies). After 2 days, colonies were lifted from the plate using Accutase and cultured in suspension on a platform shaker in the same medium supplemented with 10 mM SB431542 and 1 mM dorsomorphin until embryoid bodies formed. After 2 weeks of culture in this manner, embryoid bodies were plated directly onto Matrigel-coated culture dishes and maintained in DMEM / F12 medium containing N2 and SM1 supplements (StemCell Technologies), 20 ng / mL FGF-2, and 1% penicillin / streptomycin. Rosettes appeared after 3–5 days, and after 7 days, rosettes were manually picked and replated onto Matrigel-coated culture dishes. NPCs sprouted around the rosettes, were dissociated with Accutase for 5 minutes, and then replated onto plates coated with 10 μg / mL polyornithine (Sigma-Aldrich) and 5 μg / mL laminin (Thermo Fisher Scientific) to generate the first passage (P1). NPCs were maintained in DMEM / F12 medium containing N2 and SM1 supplements, 20 ng / mL FGF-2, and 1% penicillin / streptomycin until passage 20. Cultures were not induced in medium containing Wnt or Shh agonists / antagonists (e.g., cyclopamine), because treatment of progenitor cells with these substances at artificially high concentrations may affect cell proliferation rates, thereby adding a confounding factor to the assessment of NPC proliferation.
[0119] For neuronal differentiation, NPCs were plated onto polyornithine- and laminin-coated plates and cultured in NPC medium until they reached 90% confluency, at which point the medium was changed to DMEM / F12 containing N2 and SM1 supplements and 1% penicillin / streptomycin, with medium changes every 3–4 days. One week later, when neurites began to grow, the medium was changed to BrainPhys neuron medium (StemCell Technologies), and cells were maintained under these conditions for up to 4 months, with medium changes every 3–4 days. Electrophysiological measurements in Figure 7D–E were performed on neuronal cultures after 3 or 4 months in BrainPhys medium, at which point the majority of cells in the cultures were MAP2+ (95.4 ± 2.4% in parental cultures vs. 93.2 ± 1.4% in PTHS cultures; P = 2.4; unpaired Welch t-test).
[0120] Quantification of neuronal differentiation frequency (Figures 10J, 10K, and 17J) was achieved by counting MAP2+ and SOX2+ cells in differentiating neuronal cultures plated on LabTek II chamber slides after 2 months of differentiation in BrainPhys medium, followed by immunofluorescence staining as previously described.
[0121] RNA sequencing of NPC and neuronal cultures. Using the RNeasy Mini Plus kit (Qiagen), RNA was isolated from NPCs of four subjects and each of four parental controls at passage 15 for most analyses, from NPCs of two subjects and each of two controls at passage 5 for the analysis in Figure 15H, and from differentiated neuronal cultures (one patient and each parental control) after 2 months in BrainPhys medium that were subjected to FACS sorting to purify the CD184+ / CD44- / CD24+ population (Figures 7G, 14C, 14F, 14G, and 18L). For each subject, RNA was extracted from triplicate, independently prepared biological replicates. A total of 1 μg of RNA from each sample was used for Illumina library preparation using the stranded TruSeq kit (Illumina). RNA was sequenced on an Illumina NovaSeq 6000 S4 instrument using 150 bp paired-end reads, generating approximately 40 million sequencing fragments per library.
[0122] To estimate transcript-level expression from bulk RNA-Seq data, we used Salmon (version 0.14.1) software (Patro et al., 2017) with selective mapping ("--validateMappings") and correction for sequence-specific bias ("--seqBias"), GC content bias ("--seqBias"), and fragment position bias ("--posBias"). Reference transcripts for read mapping were obtained from the GENCODE 32 Basic Annotation (Frankish et al., 2019). For all samples, outliers were defined by high inter-replicate Euclidean distance (after transformation to achieve homoscedasticity, as described elsewhere herein), which led to the exclusion of only one library replicate from PTHS patient #3 from follow-up expression analysis. All 41 remaining libraries passed the quality control phase and were retained.
[0123] Pairwise differential expression (DE) tests between cells from PTHS patients and their respective parental controls were performed using DESeq2 (version 1.22.1) (Love et al., 2014). Transcript abundances were aggregated to gene-level counts using tximport (version 1.10.1) (Soneson et al., 2015). Next, normalization between samples was performed using the size factor approach (Anders and Huber, 2010), and a local variance model was fitted to the normalized counts. Finally, a negative binomial generalized linear model was fitted to the data, and effect sizes (log2FoldChange) were reduced using the apeglm algorithm (Zhu et al., 2019). Rigorous statistical testing was performed using a threshold-based Wald test (lfcThreshold=0.5). DE transcripts were determined based on their s value (<0.005). Transformation of the count data into an approximately uniform matrix for clustering and visualization purposes (Figures 14F and 15M) was achieved by the "varianceStabilizingTransformation" function with the "blind" parameter set to "TRUE."
[0124] To obtain a list of DE genes for all subjects, we first derived a list of DE genes between each PTHS subject and each of their parents (Table 3). We then cross-examined the four lists and selected DE genes common to all four parent-child pairs. The final list was then used for gene set enrichment assessment, followed by Gene Ontology (GO) and pathway analysis using the web-based WebGestalt tool (Wang et al., 2017) with default parameters. WebGestalt sorts the genes to obtain overrepresentation Z-scores and enrichment p-values for each GO term. For pathway analysis, we used the KEGG option with default parameters. For all analyses, we performed a BH multiple testing correction with at least five genes per category, and selected a significance level of 0.05 for the false discovery rate.
[0125] Real-time quantitative PCR. Total RNA was extracted using the RNeasy Mini Plus Kit (Qiagen), followed by on-column DNase I treatment according to the manufacturer's recommendations. 2.5 μg of total RNA was reverse transcribed into cDNA using the Superscript III First-Strand Reverse Transcription System (Thermo Fisher Scientific). Real-time quantitative PCR (RT-qPCR) was performed on a CFX Connect Real Time PCR Detection System (Bio-Rad) using a pre-validated FAM-MGB TaqMan probe (Thermo Fisher Scientific) and UNG-free TaqMan Universal Master Mix II (Thermo Fisher Scientific) with the following cycling parameters: 94°C for 3 minutes, followed by 40 cycles of 94°C for 30 seconds and 68°C for 1 minute. Amplification and denaturation curves for all probes were analyzed to confirm amplification of only one amplicon. All RT-qPCR analyses were performed using RNA extracted from at least triplicate independent biological samples per subject / condition and normalized to the following endogenous control genes: TBP, ACTB, and GAPDH. Relative expression was calculated using the conventional ΔΔCt method.
[0126] The following TaqMan probes were used: STMN2 (Hs00199796_m1), TAC1 (Hs00243225_m1), INA (Hs00190771_m1), SLC17A6 (Hs00220439_m1), CDKN2A (Hs00923894_m1), LMNB1 (Hs01059210_m1), WNT2B (Hs00921615_m1). 1), WNT3(Hs00902257_m1), WNT5A(Hs00180103_m1), SFRP2(Hs00293258_m1), ASCL1(Hs00269932 _m1), NEUROD1(Hs00159598_m1), HES1(Hs00172878_m1), SOX2(Hs04234836_s1), SOX3(Hs0027162 7_s1), SOX4(Hs00268388_s1), TCF4(Hs00972432_m1), CNTNAP2(Hs01034283_m1), GADD45G(Hs00 198672_m1), MAP2(Hs01103234_g1), VIM(Hs00185584_m1), NES(Hs04187831_g1), ID3(Hs0017140 9_m1), KCNQ1(Hs00165003_m1), BCL11B(CTIP2)(Hs00256257_m1), SATB2(Hs00392652_m1), CUX1(Hs00738851_m1), TBR1(Hs00232429_m1), CDH23(Hs00254446_m1), and PCDH15(Hs00263709_m1).
[0127] Neuron morphometric measurements. Neurons were morphologically analyzed using Neurolucida Neuron Tracing Software (MBF Bioscience) (Figure 7C). Individual MAP2+ neurons were identified from confocal images that clearly showed either the number of processes branching from the cell body, the complete root-to-tip length of the process, or the complete cell body. Only neurons whose shortest dendrite was at least three times the diameter of the cell body were counted. Random images from at least two clones of each cell line were evaluated. Using the "Contour" function, the incremental length of each curve along the longest path of the complete process was traced and summed to obtain its total length. The outline of the cell body was also traced using the "Contour" function, and the resulting surface area was automatically calculated by the software.
[0128] Multielectrode array analysis. Electrical activity readings were obtained from organoids using a 12-well multielectrode array plate manufactured by Axion Biosystems. Six organoids were plated per well on day 20 of the organoid induction protocol described herein using Neurobasal medium containing GlutaMAX, 1% Gem21, 1% NEAA, 10 ng / mL BDNF, 10 ng / mL GDNF, 10 ng / mL NT-3, 200 mM L-ascorbic acid, and 1 mM dibutyryl-cAMP. They were maintained in this medium for 7 days and then switched to Neurobasal medium containing 1% GlutaMAX, 1% Gem21, 1% NEAA, and 0.5% penicillin / streptomycin for an additional 7 days. After this time frame, the seeded organoids were maintained in BrainPhys medium until measurement. At least two independent experiments were performed for each subject, with triplicate independent replicates per subject within each experiment. Seven days after switching to BrainPhys medium, organoids were evaluated for electrophysiological parameters. Data reported in Figure 7A were from organoids cultured in BrainPhys medium for 30 days. Data reported in Figure 11G were from organoids cultured in BrainPhys medium for up to 90 days.
[0129] Recordings were performed using the Maestro system and AxIS software (Axion Biosystems) with bandwidth filters ranging from 10 Hz to 2.5 kHz. Spike detection was calculated using an adaptive threshold of 5.5 times the standard deviation of the estimated noise for each electrode. The plate in the Maestro instrument was left untouched for 3 minutes before recording, which continued for an additional 3 minutes. Data were analyzed using the Axion Biosystems Neural Metrics Tool, under conditions where an electrode was considered active if it generated at least five spikes per minute (minimum 5 spikes / min). The mean firing rate for a subject was calculated across the active electrodes of all wells for that subject. A network burst was defined as a burst of more than 10 spikes occurring in more than 25% of the active electrodes in a well, with a maximum interspike interval of 100 ms.
[0130] Patch-clamp electrophysiological analysis. Whole-cell patch-clamp recordings were performed on two-dimensional (monolayer) cultured neurons differentiated from NPCs on 35-mm culture dishes coated with polyornithine and laminin for 4 months after FGF-2 withdrawal. Similar neuronal densities were achieved in all plates. The extracellular solution was 130 mM NaCl, 3 mM KCl, 1 mM CaCl2, 1 mM MgCl2, 10 mM HEPES, and 10 mM glucose, adjusted to pH 7.4 with 1 M NaOH (approximately 4 mM NaOH). + The internal solution of the glass electrode was 138 mM potassium gluconate, 4 mM KCl, 10 mM Na2-phosphocreatine, 0.2 mM CaCl2, 10 mM HEPES (Na + Salt), 1 mM EGTA, 4 mM Mg-ATP, 0.3 mM Na-GTP, adjusted to pH 7.4 with 1 M KOH (approximately 3 mM K +(Addition of HCl). The osmolarity of all solutions was adjusted to 290 mOsm. Filamentous borosilicate glass capillaries (1.2 mm outer diameter, 0.69 mm inner diameter, World Precision Instruments) were pulled with a Flaming / Brown micropipette puller (Model P-87, Sutter Instrument). Electrode resistance for whole-cell recordings was 4–6 MΩ. For electrophysiological recordings at room temperature, an axonal CV-4 headstage and an Axopatch 200A amplifier (Molecular Devices) were used. For evoked AP recordings, a current-clamp configuration was employed, in which a weak current was injected to maintain the membrane potential at -70 mV. Voltage-clamp configuration was then used to measure voltage-dependent neuronal Na+ levels. + and K. + Currents were recorded. Recordings were low-pass filtered at 1 kHz and digitized at 10 kHz using a DigiData 1322A (Molecular Devices). There was no liquid junction potential. Electrophysiological data were analyzed offline using pCLAMP 10 software (Molecular Devices). Statistical comparisons were performed using a two-tailed Welch t-test with 10 (parent) or 9 (PTHS) neurons per group, using a significance threshold of p = 0.05.
[0131] Proliferation and apoptosis assays. To quantify cell proliferation via cell counting, 100,000 cells were seeded per well in individual wells of polyornithine / laminin-coated 12-well plates. At least two experiments were performed per subject, with triplicate technical replicates per subject and experiment. After the indicated days, cells were lifted by Accutase treatment for 5 min, resuspended in an equal volume of DMEM / F12, and counted using a Chemometec Via-1 cassette, which also calculated the total viable cell count.
[0132] For the EdU cell cycle assay, the Click-iT EdU Flow Cytometry Assay Kit (Thermo Fisher Scientific) was used according to the manufacturer's protocol. Briefly, NPCs at 70% confluence from 10 cm culture dishes were dissociated with Accutase and resuspended in StemDiff Neural Progenitor Medium (StemCell Technologies) to obtain 0.2 × 10 6 NPCs were seeded onto Matrigel-coated 6-well plates at a density of 1000 cells / well. Cells were incubated at 37°C and 5% CO2 for 12 hours, after which EdU was added to the medium at a final concentration of 10 μM. Cells were incubated for an additional 2.5 hours for EdU incorporation and then harvested by Accutase-mediated dissociation, resuspension in 3 mL of 1% BSA in 1x PBS, and pelleting at 500 x g for 5 minutes. The pellet was resuspended and incubated in the kit's fixation solution for 15 minutes in the dark at 25°C, followed by the addition of 3 mL of 1% BSA in 1x PBS to stop fixation. Next, NPCs were pelleted at 500 x g for 5 minutes, the supernatant was removed, and the pelleted cells were incubated in 1x Click-iT saponin-based permeabilization and wash reagent for 15 minutes. During incubation, the Click-iT reaction cocktail was prepared according to the manufacturer's protocol and added to the sample. The sample was then homogenized and incubated for 30 minutes, protected from light. Cells were rehomogenized every 5 minutes, subsequently washed in 3 mL of 1x Click-iT Permeabilization and Wash Reagent, pelleted, resuspended in the same solution, and then nuclear stained in 1x PBS / 0.1% Triton X-100 / 100 μg / mL RNase A containing 20 μg / mL propidium iodide. Immediately after nuclear staining, cells were transferred to ice and kept at 4°C protected from light until analysis on an LSR Fortessa X-20 cell counter (BD Biosciences).
[0133] Apoptosis assays on NPCs were performed using the Dead Cell Apoptosis Kit with Annexin V FITC and PI (V13242, Thermo Fisher Scientific) according to the manufacturer's protocol and analyzed by flow cytometry with the same instrument as above.
[0134] TOP-Flash Luciferase Reporter Wnt Functional Assay. To assess the level of Wnt signaling, 70% confluent cultures of NPCs in 24-well plates (containing StemCell Technologies' Neural Progenitor Medium) were transfected with the M50 Super8xTOPFlash plasmid (Addgene#12456; [http: / / www.addgene.net / addgene:12456; RRID:Addgene_12456; referred to as the TOP-Flash luciferase reporter plasmid), which is used to assess β-catenin-mediated transcriptional activation. This plasmid contains seven binding sites (AGATCAAAGG; SEQ ID NO: 1) for TCF / LEF (Veeman et al., 2003), not to be confused with TCF4, in front of a minimal TA virus promoter driving expression of the firefly luciferase gene. Control NPCs were transfected with the M51 Super8xFOPflash plasmid (Addgene plasmid #12457; [http: / ] / n2t.net / addgene:12457; RRID:Addgene_12457) carrying a mutant TCF / LEF binding site.
[0135] Transfections were performed using the Amaxa Nucleofaction Mouse Neural Stem Cell Nucleofector Kit for NPC (Lonza) according to the manufacturer's recommendations. After 24 hours, medium was replenished, and luciferase assays were performed on 50,000-cell samples using the Pierce Firefly Luciferase Flash Assay Kit (Thermo Fisher Scientific) on a Synergy microplate reader (BioTek Instruments). All assays were performed on three independent replicates per NPC line (per subject) and three technical replicates. Activity levels were expressed as arbitrary units normalized to the mean activity in each control.
[0136] Manipulation of Wnt signaling. To manipulate the Wnt / β-catenin signaling pathway in NPCs, 200,000 cells were seeded onto 6-well plates and then treated with the specific agonist CHIR99021 (1 μM) for 4 days. Controls were treated with DMSO (CHIR diluent) at the same concentration and for the same duration. In separate experiments, cells were treated with the Wnt signaling antagonists DKK-1 (25 μM) or ICG-001 (1 μM) for 3–5 days. In all cases, treated cells were assayed to measure Wnt pathway activity via transfection with the TOP-Flash plasmid described herein. Triplicate biological replicates per strain were used for all experiments, and similar results were obtained in at least three independent experiments.
[0137] On the first day of the progenitor cell proliferation phase (when FGF-2 was first added to the growing organoids), CtO or sPO were treated with 1 μM CHIR99021 (or DMSO as a control) in the same medium as untreated organoids. Similarly, on the first day of the progenitor cell proliferation phase, treatment with the Wnt antagonist ICG-001 (1 μM) was performed. In all cases, treatment was performed on at least six independent replicates of each organoid line.
[0138] Knockdown of TCF4, SOX3, and SOX4. For knockdown of TCF4 and SOX3 in NPCs, 100,000 cells were transfected using the Amaxa Nucleofaction Mouse Neural Stem Cell Nucleofector Kit (Lonza) with shRNA Mission plasmids (Sigma Millipore) according to the manufacturer's recommendations. Pre-validated Mission shRNA vectors (Sigma Millipore) for SHCLND-NM-005834 (SOX3) and SHCLND-NM_003199 (TCF4) were used, engineered in the pLKO.1 plasmid backbone (TRC2 series). SHC201 empty TRC2 vector was used as a control. Four days after transfection, cells were counted, and RNA was extracted using the RNeasy Mini Plus kit (Qiagen) before gene expression analysis of selected genes via RT-qPCR. Each experiment was performed using triplicate replicates per subject / condition for cell counting or triplicate independent replicates for RNA extraction and gene expression assessment. Because no selection was applied after transfection, the observed effects of SOX3 or TCF4 knockdown on the expression of other genes should be interpreted as the average of the variation across all cells in the transfected population. This may explain, for example, why TCF4 knockdown in NPCs resulted in a decrease in SOX3 expression (Figure 10C) with a smaller effect size than that observed in the comparison between control and PTHS NPC samples (Figure 10B).
[0139] For SOX4 knockdown in neurons (Figure 8I-J), we avoided methods requiring transfection of differentiating neuronal cultures because this would likely result in phenotypic changes, cell death, and altered cell density. For this reason, we used an antisense oligonucleotide (ASO) approach, two of which were used in combination in all experiments. ASOs were designed as 16-nucleotide-long antisense locked nucleic acid (LNA) oligos (Qiagen) using the manufacturer's design tool, containing LNA-rich flanking regions but regular DNA nucleotides in an LNA-free central gap (GapmeR). Each ASO was resuspended in 10 mM Tris pH 7.5 / 0.1 mM EDTA and used at a final concentration of 1 μM. Two weeks after FGF-2 withdrawal, differentiating neuronal cultures were treated with ASOs via direct application to the medium for unassisted uptake (gymnosis) on days 15, 20, and 25 after FGF-2 withdrawal. Cultures were fixed or harvested for RNA extraction 3 days after the final treatment with ASO.
[0140] SOX3 overexpression. For SOX3 overexpression in NPCs (Figure 17F–G), 100,000 cells were transfected using the Amaxa Nucleofaction Mouse Neural Stem Cell Nucleofector Kit (Lonza) with 1.5 μg of pENTER-CMV-SOX3 plasmid (Vigene Biosciences; CH850241), in which the SOX3 coding sequence is controlled by the cytomegalovirus (CMV) promoter. Four days after transfection, cells were counted, and RNA was extracted using the RNeasy Mini Plus kit (Qiagen). Gene expression of selected genes was then analyzed via RT-qPCR, as described above. Each experiment was performed with triplicate replicates per subject / condition for cell counting or with triplicate independent replicates for RNA extraction.
[0141] TCF4 Overexpression. Prior to testing CRIPSR-mediated enhancement of TCF4 expression via transepigenetic activation of the endogenous locus, the effects of overexpressing TCF4 were examined by transfecting control and PTHS NPCs with a cassette that placed the TCF4-B transcript variant coding sequence under the control of an artificial promoter (Figures 11E and 18J). For the control condition, the coding sequence was placed under the control of the artificial minP promoter (AGAGGGTATATAATGGAAGCTCGACTTCCAG; SEQ ID NO: 2). Other constructs contained the TCF4-B coding sequence preceded by the minP promoter and various numbers (6 or 12) of μE5 TCF4 regulatory DNA binding sites (CACCTG) separated by a spacer sequence composed of CAAGAA. These constructs were prepared by PCR-based reactions to ligate ultramer oligonucleotides containing artificial promoters (minP_TCF4, E-box-x6-minP_TCF4, or E-box-x12-minP_TCF4; Integrated DNA technologies) to the TCF4-B coding sequence, which had been separately amplified by RT-PCR from human brain cDNA (Promega) using primers TCF4B_cDNA Forward and TCF4B_cDNA Reverse. The resulting PCR fragments were cloned into the EcoRI and XhoI restriction sites of the pLenti-III promoterless vector (Applied Biological Materials). NPCs were transfected with these plasmids using the protocol described herein, followed by total RNA extraction using the RNeasy Mini Plus kit (Qiagen) and RT-qPCR, as before.
[0142] [Table 2] JPEG0007786750000003.jpg61147
[0143] For organoid transduction experiments (Figures 11F-H and 19M-S), lentiviral particles were prepared using the second-generation lentiviral production plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259). Thirty 10-cm plates of HEK293T cells at 80% confluence were transfected with 10 μg of plasmid per plate, second-generation packaging mix (ABM; LV003), and Lentifectin transfection reagent (ABM; G074) using the manufacturer's recommendations. Two days after transfection, supernatants were collected from all plates, and virus was purified by PEG precipitation using PEG-it Virus Precipitation Solution (Systems Biosciences; LV810A-1). Titer determinations were achieved using a qPCR Lentiviral Titration Kit (ABM; LV900). All titers were 10 μg per μL. 9 IU (particles). Equivalent AAV vectors of the AAV9 serotype with a human growth hormone (hGH) terminator in each construct were ordered from Applied Biological Materials (ABM). All titers were >10 per μL. 9 Transduction of organoids (CtOs) was achieved by mixing 3.5 million dissociated iPSCs with lentivirus (Figure 11F) on the first day of organoid induction, or by adding AAV virus directly to the medium after the final day of the neural induction phase at an appropriate viral dose to obtain a multiplicity of infection (MOI) of 5 for each vector type (Figure 11H).
[0144] CRISPR-mediated transepigenetic correction of TCF4 expression. First, RNA sequencing libraries from PTHS and control NPCs were analyzed to determine transcriptional activity from multiple alternative promoters of the human TCF4 gene (Sepp et al., 2011). Promoter activity estimation was performed using the junction read count approach described in (Demircioglu et al., 2019). Briefly, exon junction counts were obtained by mapping RNA-seq reads onto the GRCh38.p13 genome assembly using STAR aligner (version STAR 2.7.6a), using the GENCODE 34 primary annotation as a reference to determine exon coordinates. Next, promoter activity was estimated by counting junction reads mapping to the first set of introns of each TCF4 transcript using the proActiv R package (version 0.99.0), followed by normalizing the counts using a size factor approach and logarithmic transformation of the data. This approach identified promoters upstream of exons 3b, 8a, and 10a as most active in both parental and PTHS samples (Figure 18A), and therefore were selected for CRISPR-mediated transepigenetic manipulation of TCF4 transcriptional activity.
[0145] For these three promoters, gRNAs were designed based on sequences located between -100 and +50 from the corresponding transcription start site (TSS) (Liao et al., 2017) (Figure 18A). For each promoter, three sense gRNAs and two antisense gRNAs were selected based on scores generated by a computational tool designed by (Hsu et al., 2013). A non-targeting scrambled sequence was selected as the control gRNA sequence (see Table 2 for gRNA sequences). The gRNAs were first validated by inserting the corresponding sequences into the conventional CRISPR pSpCas9(BB)-2A-Puro plasmid (Addgene#48139; [http: / / n2t.net / addgene:48139; RRID:Addgene_48139). The efficiency of each gRNA to generate indels was then tested in pilot experiments. For this purpose, pSpCas9(BB)-2A-Puro was digested with BpiI (Thermo Fisher Scientific). Each synthesized gRNA oligonucleotide pair was phosphorylated with T4 polynucleotide kinase (Promega) and annealed by incubation in a thermocycler under the following conditions: 37°C for 30 min, 95°C for 5 min, and 5°C for 5 min. -1 The temperature was then lowered to 25°C. The phosphorylated oligonucleotide duplex of each gRNA was then ligated to the digested plasmid using T4 DNA ligase (Promega) by incubating at 25°C for 1 hour. Competent cells (Stbl3 E. coli strain; Thermo Fisher Scientific) were transformed with each ligation product, and plasmid DNA was extracted from each clone using the PureYield Plasmid Miniprep System (Promega), followed by verification by Sanger sequencing using the hU6-F universal primer.
[0146] Next, HEK293T cells (ATCC) were cultured to 70% confluence in DMEM containing 10% FBS and 1% penicillin / streptomycin and transfected with each gRNA plasmid at a 3:1 PEI / DNA (w / w) ratio using polyethyleneimine (PEI; Sigma-Aldrich) along with 1 μg of DNA per mL of medium. Both PEI and DNA were diluted in Opti-MEM (Gibco) at 1 / 20 of the total medium volume and then incubated for 30 minutes before being applied directly to the top of the cells. The transfection medium was replaced with new medium 16 hours after transfection. To confirm that the selected TCF4 gRNA sequence actually targeted TSSs 3b, 8a, and 10a of the human TCF4 gene, a T7 endonuclease I assay was performed. The transfection medium was diluted at 1 μg mL until all cells in the negative control had died (approximately 72 hours). -1 Transformed cells were selected by replacing the medium with puromycin. Genomic DNA was then extracted using the Illustra Blood Genomic Prep Minispin Kit (GE) according to the manufacturer's instructions. Endpoint PCR was performed using Q5 high-fidelity DNA polymerase (NEB) with one designed primer pair flanking the target site of each gRNA in the genome. Amplicons were purified with the Wizard SV Gel and PCR Clean-Up System (Promega) and quantified using the Qubit DNA BR Assay Kit (Thermo Fisher Scientific). For the T7 endonuclease I assay, 300 ng of amplicon from each sample was incubated with 2 μL of NEBuffer 2 and HO (to a final volume of 19.5 μL) in a thermal cycler using the following cycling parameters: 95°C for 5 min, -2°C for 1 min. -1 The temperature was lowered to 85°C by -0.1°C min -1The temperature was then lowered to 25°C. After denaturation and stepwise reannealing to allow for the formation of DNA heteroduplexes, 5 U of T7 endonuclease I (NEB) was added to the sample and incubated at 37°C for 30 minutes. The products were run on a 1.5% agarose gel, and the CRISPR-mediated efficiency for indel generation was estimated for each gRNA based on the ratio between the mass of the undigested band and the digested fragment. Furthermore, deep sequencing of the amplicons was performed to calculate the percentage of clones with indels.
[0147] All gRNAs were also cloned into the pLentiSAMv2 plasmid (Addgene plasmid #75112; [http: / / www.addgene.net / addgene:75112; RRID:Addgene_75112) containing a gRNA sequence with MS2 loops in both the tetraloop and stem-loop 2 under the control of a U6 promoter, along with a dead Cas9 (dCas9) gene fused to the VP64 gene under the control of an EF1α promoter. Cloning was performed in pLentiSAMv2 via digestion with Esp3I (Thermo Fisher Scientific). Lentiviral particles were then prepared by transfecting HEK293T cells (ATCC) with the appropriate pLentiSAMv2 vector carrying the gRNA to be tested or a scrambled gRNA (control).
[0148] To evaluate the efficiency of the designed TCF4 gRNA sequence in increasing endogenous expression of the TCF4 gene via transepigenetic activation, SH-SY5Y cells were transfected with pLentiSAMv2 and pLentiMPHv2 (Addgene#89308; [http: / / n2t.net / addgene:89308; RRID:Addgene_89308) plasmids, followed by RT-qPCR to verify TCF4 transcript levels. The pLentiMPHv2 vector contains the MS2-P65-HSF1 activator helper (MPH) complex gene under the control of the EF1α promoter (Liao et al., 2017) in combination with the gRNA and dead Cas9 for transepigenetic activation of the TCF4 locus.
[0149] SH-SY5Y cells were cultured in DMEM / F12 containing 10% FBS and 1% penicillin / streptomycin. SH-SY5Y cells were transfected with FuGENE HD Transfection Reagent (Promega) at a 4:1 FuGENE / DNA (v / w) ratio with 2 μg of DNA per mL of medium. Both FuGENE and DNA were diluted in Opti-MEM (Gibco) at 1 / 10 the total medium volume without an incubation period before application to the cells. For selection of transfected cells, the transfection medium was diluted to 10 μg / mL -1The medium was replaced with one supplemented with blasticidin S (Sigma-Aldrich) 16 hours later. After the control cells died (approximately 72 hours), the selective medium was replaced and the cells were allowed to grow. Transfections were performed in triplicate for each gRNA. RNA from selected cells was purified using TRIzol Reagent (Thermo Fisher Scientific) according to the manufacturer's instructions. cDNA was synthesized using the ImProm-II Reverse Transcription System (Promega). For RT-qPCR reactions, primer pairs were designed to detect (I) transcripts encoding TCF4-B, TCF4-D, or TCF4-A (depending on the corresponding promoter targeted by each gRNA), (II) transcripts of the endogenous TBP gene and the exogenous dCas9 (encoded by lentiSAMv2) and MPH (encoded by lentiMPHv2) genes, and (III) transcripts from genes transcriptionally regulated by TCF4. All reactions were performed in duplicate using the PowerUp SYBR Green Master Mix (Applied Biosystems) on a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems). A melting curve step was always included at the end of each run. Samples transfected with the empty lentiSAMv2 plasmid or a plasmid containing a scrambled gRNA were used as references for quantification of the relative levels of TCF4 and TCF4 target gene transcripts via the conventional ΔΔCt method, and transcript levels of TBP, dCas9, and MPH were used for normalization between samples.
[0150] For organoid transduction experiments (Figures 11B-D and 18E-F), lentiviral particles were prepared from the pLentiMPHv2 vector and several pLentiSAMv2 versions (Liao et al., 2017) containing different gRNAs. For virus preparation, the second-generation lentiviral production plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259) were used. Twenty 10 cm plates of HEK293T cells at 80% confluence were transfected with 10 μg of plasmid per plate, second-generation packaging mix (ABM; LV003), and Lentifectin transfection reagent (ABM; G074) using the manufacturer's recommendations. Two days after transfection, supernatants were collected from all plates, and virus was purified by PEG precipitation using PEG-it Virus Precipitation Solution (Systems Biosciences; LV810A-1). Titer determinations were achieved using the qPCR Lentiviral Titration Kit (ABM; LV900). All titers were 10 per mL. 9 It exceeded IU (particles).
[0151] Transduction of organoids (sPOs) was achieved on the first day of organoid induction by mixing 2.5 million dissociated iPSCs with the appropriate amount of virus to achieve a multiplicity of infection (MOI) of 5 for each type of lentivirus. Organoids under the "scrambled gRNA" condition (control) were co-transduced with lentivirus produced from the pLentiMPHv2 and pLentiSAMv2 plasmids containing scrambled gRNA. Organoids in the "TCF4 gRNA" group were co-transduced with lentivirus produced from the pLentiMPHv2 and pLentiSAMv2 plasmids containing gRNA version 3bS3. On days 2 and 3 of organoid induction, the medium was changed and lentivirus was added again. During these three days, embryoid bodies formed in the presence of mTeSR1 medium containing SB431542 and dorsomorphin. From day 4 onward, the medium was changed according to the standard protocol without adding virus. Transduction was confirmed by assessment of Cas9 expression by immunostaining using the protocols described herein and above.
[0152] Statistical Analysis. Data are presented as mean + standard error unless otherwise noted. We did not perform statistical methods such as power analysis to determine sample size due to the limited number of available PTHS samples, which were selected based on the availability of detailed information about the type of TCF4 mutation carried by each patient. However, based on the strong and consistent effect sizes observed throughout the study and the level of variability across all subject cell lines (NPCs and organoids), increasing sample size is not expected to alter the statistical significance of the results.
[0153] Various types of statistical tests were used throughout the study, as indicated in the corresponding figure legends. Typically, for comparisons of means between two groups (PTHS vs. parent) in experiments measuring organoid size, relative expression levels, or expression abundance, a two-sample Welch t-test was used, assuming unequal variances and heterogeneity of variances. For comparisons of these types of means between more than two groups, a one-way analysis of variance (ANOVA) followed by Tukey's Honestly Significantly Different (HSD) post-hoc test was used. For comparisons of the same types of gene expression in single-cell RNA-Seq data between two samples, a nonparametric Mann-Whitney U test was used. For comparisons of the same types between more than two samples, a Kruskal-Wallis test followed by a Dunn post-hoc test was used. For comparisons of gene expression means in single-cell transcriptome data, calculated p-values are presented as asterisks in the figures, while crosses (†) were added for comparisons where the fold change between PTHS and parental was less than an arbitrary value of 10% of the parental group mean in either direction. To compare neurite length and soma area between PTHS and control neurons, ANOVA with Geisser-Greenhouse correction for repeated measures was used, followed by Fisher's Least Significantly Different (LSD) post-hoc test.
[0154] Sample sizes are indicated in the figure legends. P values are reported as asterisks in the figures for significance levels defined as p<0.05 (*), p<0.01 (**), or p<0.001 (***). When experiments included multiple independent replicates per subject cell line or multiple technical replicates per independent replicate, the number of replicates is also indicated in the figure legends, even if each statistical test was calculated based solely on comparisons between means of different subjects. Blinding was used for most analyses comparing patient and control samples. Statistical analyses were performed using Prism software (GraphPad), RStudio, G*Power, and WebPower.
[0155] Brain cortical organoids derived from patients with Pitt-Hopkins syndrome exhibit abnormal size and morphology. To gain insight into the largely unknown cellular pathophysiology caused by TCF4 mutations, iPSC lines were generated by cellular reprogramming of skin fibroblasts from five PTHS patients and their corresponding gender-matched parents (Table 1). These individuals harbor mutations that partially or completely ablate the TCF4 gene, ablate its essential bHLH DNA-binding domain, or affect one of its transcriptional activation domains (Figure 12A). All iPSC clones were examined for the expression of stem cell markers, and karyotype analysis based on SNP mapping revealed no undesired chromosomal abnormalities (Figure 12B). No differences were observed between PTHS and control iPSC lines in terms of proliferation rate (Figure 12C) or the general ability to induce NPCs and neurons in vitro (Figures 12D-E).
[0156] Next, we used iPSC lines to generate cerebral cortical organoids (CtOs) (Figure 5A), and subsequently assessed their abnormal phenotypes at the cellular and molecular levels. CtOs are transcriptionally similar to the early developing human cortex and contain functional glutamatergic and GABAergic neurons, exhibiting cell populations functionally similar to those observed during human neurodevelopment. Control (parental) CtOs exhibited the expected three-dimensional organization into spheroids, which continuously grew and enlarged, producing clearly visible rosette-like cell aggregates (arrowheads in the top row of Figure 5A). In striking contrast, PTHS CtOs were smaller (Figure 5A-B), with significantly fewer recognizable rosettes and smaller in size (Figure 5A). Some PTHS organoids exhibited polarized structures (arrowheads in the bottom row of Figure 5A). These phenotypes were consistent across batches performed using different clones derived from the same patient (Figure 12F).
[0157] Although CtO recapitulate some aspects of cortical development, most of them lack parapallial-derived GABAergic cells (Figure 6D). Therefore, we also derived parapallial organoids (sPOs, Figure 5C), which contain neural progenitor cells and GABAergic inhibitory neurons. Similar to those observed in CtO, PTHS sPOs also exhibited smaller size (Figure 5C) and abnormal internal structure, with few or no rosettes (Figure 1H).
[0158] Taken together, these results demonstrate that PTHS brain organoids exhibit abnormal morphology, suggesting that processes underlying neurogenesis may be altered in PTHS patients. Furthermore, the extent of phenotypic differences between control- and patient-derived brain organoids supports the use of such human cell models to study the pathophysiology and molecular mechanisms of PTHS.
[0159] Abnormal content of progenitor cells and neurons in PTHS organoids. Smaller organoids may be due to a range of altered cellular processes, such as decreased cell division or increased apoptosis, abnormal migration, or aging. To identify which of these processes are defective in PTHS organoids, we analyzed the composition and content of several important cell subtypes. First, immunostaining for the neural progenitor marker SOX2 was performed on tissue sections from patient and control CtOs and sPOs. At 4 weeks in vitro, control CtOs contained numerous rosettes composed of neural progenitor cells surrounding a ventricle-like lumen, similar to the distribution of ventricular and subventricular zone progenitor cells in the developing human brain. As these progenitor-rich structures differentiate into several neuronal subtypes, the size of the rosettes decreased. In contrast to control CtOs, PTHS organoids displayed few rosette-like structures, with neural progenitor cells dispersed throughout the organoid without apparent organized clustering (see supporting control in Figure 12F). Furthermore, most PTHS CtOs are polarized, with SOX2-positive cells concentrated on one side. PTHS CtOs have a significantly lower density compared to control organoids, but the percentage of neural progenitor cells is higher (Figures 5D and 12F). This is consistent with the lower number of rosette structures in which progenitor cells tend to be localized. Similarly, PTHS sPOs show a reduced content of SOX2+ progenitor cells (Figures 12H-I).
[0160] Immunostaining for the neural marker MAP2 revealed that control CtOs had neurons dispersed throughout the spheroid, particularly around and between the rosettes, and that neuronal content increased as parental CtO development progressed. In contrast, PTHS CtOs and sPOs lacked obvious MAP2 labeling, even at later stages of organoid development (Figure 12H). Parental CtOs exhibited a typical pattern of cortical development, recapitulating the temporal progression of neuronal differentiation in the human cortex, with deep layer neurons (i.e., CTIP2+ cells) forming first, followed by differentiation of superficial layer neurons (SATB2+ and CUX1+ cells) (Figure 12J). In contrast, PTHS CtOs exhibited a marked decrease in the content of cortical neuronal subtypes (Figures 5E and 12J). Furthermore, mature PTHS CtOs exhibited decreased staining for vesicular glutamate transporter family member 1 (vGLUT1), a marker of excitatory neurons previously shown to be abundant in CtOs (Figure 12M). Similarly, PTHS sPOs exhibited reduced staining for the GABAergic neuron marker GAD65 / 67 (Fig. S6H). Importantly, similarly reduced expression of MAP2 and cortical neuron markers (Fig. S6K) and reduced numbers of cortical-type neurons (Fig. S6L) were also observed in postmortem PTHS brain samples.
[0161] Taken together, these data demonstrate that patient-derived organoids closely match the neuronal phenotype observed in patients at the cellular level and support that PTHS is characterized by severe defects in cortical neuron content and organization.
[0162] PTHS organoids exhibit a lower percentage of neurons and a higher percentage of progenitor cells. To better quantify the cellular diversity of brain organoids, single-cell RNA sequencing (scRNA-Seq) was performed on cells dissociated from the CtO and sPO. Six annotated cell subpopulations were analyzed: neural progenitors, intermediate progenitors, and mature neurons in both the CtO and sPO (Figures 6A, 13A-C). These cell populations were further analyzed because differentiation trajectory analysis showed that these cell populations comprise two distinct differentiation lineages: neural progenitors progress through an intermediate progenitor stage to generate glutamatergic neurons (excitatory lineage) or GABAergic neurons (inhibitory lineage) (Figure 6B). Therefore, studying these populations is relevant for assessing neurogenesis defects across the spectrum of cortical cell types. The organoids did not contain cells expressing mesodermal and endodermal markers (Figure 12C), and other smaller populations, even though they were of neural origin (Figure 13E), were not examined because they could not be clearly assigned to the six populations selected for analysis ("Other" in Figure 13A).
[0163] Although PTHS organoids have a reduced density of progenitor cells per region (Figure 5D), scRNA-Seq data and immunostaining revealed that the percentage of progenitor cells was higher in PTHS CtOs compared to control organoids (Figures 6C, 6D, 6E, and 12G). Similarly, PTHS sPOs have a higher percentage of paraplegial progenitors than control sPOs (Figures 6F, 6G, and 6H). Furthermore, astrocyte content was small and similar in PTHS and control organoids (Figure 13F), ruling out astroglial content as a possible cause of phenotypic abnormalities in PTHS organoids.
[0164] Consistent with the finding that PTHS organoids have a lower neuronal content (Figures 5D and 5E), scRNA-Seq analysis showed that the percentages of excitatory and inhibitory neurons were reduced in the PTHS CtO and sPO, respectively, compared to control organoids (Figures 6C, 6D, 6F, and 6G). Furthermore, the percentages of neurons expressing BCL11B (encoding CTIP2), SATB2, TBR1, and CUX1 were lower in the PTHS CtO (Figures 6I, 13H, and 13I), and the number of neurons expressing GAD2 (encoding GAD67) was also lower in the PTHS sPO (Figure 6J).
[0165] Taken together, these data indicate that PTHS organoids have proportionally more progenitor cells and fewer neurons, suggesting that the pathophysiology of this disease involves defects in progenitor proliferation and / or differentiation into neurons.
[0166] PTHS neurons exhibit abnormal firing characteristics. The reduced neuronal content in PTHS organoids suggests that neural circuit formation in the patient's neural tissue may be impaired. Furthermore, the reduced vGLUT1 staining in PTHS CtOs may indicate that mutant neurons establish fewer synapses and exhibit impaired electrical activity. To investigate these issues, we used PTHS neurons in 2D culture and organoids. First, we analyzed neuronal activity using a multielectrode array (MEA) assay and found that the average neuronal firing frequency was much lower in PTHS compared with control CtOs (Figures 7A and 14A). PTHS CtOs contain a significant amount of neurons (Figures 5D and 5E), and therefore, such a reduction in electrical activity likely reflects electrophysiological defects at the cellular level. However, neuronal content was impaired in PTHS CtOs (Figures 5E, 6I, 12J, 13H, and 13I). Therefore, formally, the defective PTHS electrical activity may be the result of insufficient connectivity or neuronal density in organoids.
[0167] To assess the effects of TCF4 haploinsufficiency on individual neurons and determine whether the reduced activity in organoids could be due to abnormal electrical neuronal properties, we examined 2D neuronal cultures. First, we performed experiments to confirm that TCF4 was expressed in control neurons (Figure 14B) and that TCF4 expression was reduced in PTHS neurons compared to their respective parental controls (Figure 14C). Through analysis of neuronal branching structure (Figure 7B), we concluded that the cell body regions of PTHS neurons were indistinguishable from those of parental controls, but that PTHS neurons had longer neuronal processes (Figure 7C). Next, we performed patch clamp analysis to evaluate neurons in 2D cultures from the most severely impaired patient strain (Figure 7A). PTHS neurons were found to have significantly reduced intrinsic excitability (Figure 7D), membrane capacitance, and sodium and potassium currents (Figures 7E, 14D, and 14E). Furthermore, lower expression of FOS, a surrogate marker of neuronal activity, was observed in PTHS CtO neurons compared to control CtO neurons (Figure 7F). Taken together, these data indicate that PTHS neurons exhibit profound defects in their electrical properties at the network and cellular levels.
[0168] Because such neuronal dysfunction may result from aberrant gene expression in PTHS neurons, we used RNA sequencing to explore transcriptional changes in these cells and compare neurons differentiated from iPSC-derived patient and control neural progenitor cells under 2D culture conditions. Differential expression (DE) analysis comparing PTHS and control neurons from 2-month-old FACS-sorted cultures revealed a series of misregulated genes (Figure 14F), some of which are involved in neurogenesis, neuronal organization, differentiation, and the regulation of neuronal excitability (Figure 14G). Among those with higher fold changes (>4), there were several genes important in neuronal function (Figure 7G), which were also downregulated in PTHS organoid-derived neurons (Figure 7H).
[0169] Taken together, these data indicate that neurons derived from PTHS patients are abnormal in terms of morphology, physiology, and transcriptome. Importantly, the list of DE genes includes potassium voltage-gated channel subfamily Q member 1 (KCNQ1), which was previously shown to dysregulate intrinsic excitability in mouse neurons after Tcf4 knockdown (Rannals et al., 2016), as well as several other ion channels (Figure S14H), providing mechanistic insight into the defects in intrinsic excitability of PTHS neurons and new opportunities for pharmacological intervention.
[0170] PTHS neural progenitor cells exhibit a lower proliferation rate and replicative senescence. The finding that PTHS CtOs and sPOs have fewer neural rosettes and a lower density (but a higher percentage) of NPCs raises the question of whether these phenotypes are the result of aberrant neural induction, reduced progenitor cell proliferation, or impaired differentiation. To assess these possibilities, the number of rosettes was counted after the neural induction phase (week 2) and was shown to be similar in parental control and PTHS organoids, as was the density of SOX2+ cells (Figure 8A). These results, taken together with the absence of cells expressing non-neuronal markers in the organoids (Figures 13D and 13E), strongly suggest that neural induction in PTHS organoids is normal and that rosettes are reduced at later stages of organoid maturation due to either poor progenitor cell proliferation or impaired differentiation. To analyze these two possibilities, we generated iPSC-derived NPCs from PTHS individuals and parental controls (see NPC marker expression in Figure 15A). These cells indeed express TCF4 (Figures 15B, 15C, and 15D), and its expression is reduced in PTHS NPCs (Figures 15E and 15G). Importantly, expression of GADD45G, a direct transcriptional target of TCF4, was strongly reduced in PTHS NPCs (Figure 15F), confirming that TCF4 function is severely impaired in all patient lines. PTHS NPCs were observed to proliferate significantly slower in 2D culture than control lines (Figures 8B and 8D). Since this difference could result from either reduced proliferation or increased apoptosis, we assessed the rate of apoptosis using Annexin V-mediated flow cytometry and concluded that there was no significant difference in the percentage of apoptotic cells between PTHS and parental NPCs, generally less than 5% (Figure 8C).
[0171] Next, we performed experiments to assess the proliferative potential of NPCs by incubating cell cultures with 5-ethynyl-2'-deoxyuridine (EdU), a thymine nucleoside analogue that is incorporated into DNA during synthesis. The percentage of cells undergoing division was then determined by flow cytometry. The percentage of proliferating cells in the PTHS line was approximately half that of control NPCs (Figure 8D). We also observed that PTHS NPCs often adopted an atypical, enlarged, flat morphology (arrowhead in Figure 8G), which was not observed in control lines. The combination of abnormal morphology and reduced proliferative activity led us to hypothesize that PTHS neural progenitor cells undergo premature replicative senescence. This is a well-defined cellular process characterized by cell cycle arrest and subsequent cessation of proliferation, and has been shown to be involved in various physiological and pathological defects. Indeed, in addition to larger cell size, PTHS NPCs exhibited three hallmarks of replicative senescence: elevated β-galactosidase activity (SA-β-gal; Figure 8G), decreased expression of the nuclear lamina protein lamin B (LMNB1; Figure 8H), and markedly increased expression of the cyclin-dependent kinase inhibitor genes CDKN2A (Figure 8H) and CDKN1A (whose expression arrests cell division and acts as a marker of replicative senescence). Interestingly, these hallmarks were enhanced with increasing passage number (Figure 15H). Furthermore, senescent NPCs were nestin+ and most were SOX2+. SOX2 expression was lost in some NPCs, and they were negative for brachyury and SOX17 (Figure 16E), indicating that they were senescent NPCs, not undifferentiated cells.
[0172] Interestingly, the expression of senescence markers was also strongly upregulated in PTHS postmortem samples (Figure 8I). PTHS CtOs expressed the CDKN2A gene product p16 INK4AThese organoids contained many neural lineage cells expressing TCF4 (Figures 8J and 15J), but these were not apoptotic cells, which were similarly rare in both PTHS and control organoids (Figure 8J). Importantly, shRNA-mediated TCF4 knockdown in control NPCs resulted in decreased proliferation (Figure 15K) and higher expression of CDKN2A (Figure 15L), further strengthening the association between decreased TCF4 expression and increased senescence and decreased proliferation in patient-derived NPCs.
[0173] Taken together, these data indicate that the pathomechanism of PTHS at the cellular level involves reduced proliferation and enhanced senescence of NPCs.
[0174] Correction of Wnt signaling in PTHS neural progenitor cells and organoids results in recovery from the abnormal phenotype. To gain mechanistic insight into the abnormal proliferative activity of PTHS NPCs, we performed an unbiased search for differentially expressed (DE) genes between PTHS and control cells from four parent-child pairs (Figure 15M), followed by gene set enrichment analysis (Figure 15N). This approach revealed that gene expression changes were predominantly in the Wnt signaling pathway (Figures 9A and 16A). Because the Wnt pathway has been linked to NPC proliferation in many tissues, we hypothesized that abnormal Wnt activity may be causally related to the reduced NPC proliferation rate observed in PTHS cells. To test this hypothesis, we analyzed the expression of Wnt components in PTHS NPCs and confirmed lower expression of WNT2B, WNT3, WNT5A, and SFRP2 in patient lines (Figure 9A-B). Functional assessment of signaling using a luciferase reporter demonstrated a significant reduction in canonical Wnt / β-catenin signaling activity (Figure 9C). Importantly, the expression of several Wnt signaling components is significantly downregulated in postmortem PTHS brain samples (FIG. 9D).
[0175] Treatment of control NPCs with the Wnt signaling antagonists DKK-1 and ICG-001 phenocopied the decreased proliferation rate of PTHS progenitor cells (Figure 9E) and increased CDKN2A expression (Figure 16B). Treatment of control CtOs with ICG-001, a diffusible small molecule that can easily penetrate the three-dimensional organoid structure, significantly reduced organoid size (Figure 16C) and SOX2+ cell content (Figure 9F). As a reverse approach, PTHS NPCs were treated with the Wnt signaling agonist CHIR99021. First, we confirmed that Wnt signaling was increased in the treated cells (Figure 16D). Treatment with CHIR99021 restored the proliferation rate of PTHS NPCs (Figure 9G-H) and increased p16 expression. INK4a The percentage of senescent cells decreased (Figure 16E), and expression of the proliferation-promoting gene HES1 and proneural genes ASCL1 and NEUROD1 increased (Figure 9J). Treatment of PTHS CtOs caused a significant increase in organoid size (Figure 16F) and NPC content (Figure 9K), and prominent neural rosettes reappeared. Analysis of cellular diversity in CHIR99021-treated PTHS CtOs and sPOs confirmed an increase in the progenitor cell population (Figures 16G-H).
[0176] In treated CtOs, the percentage of parapallial neural progenitor cells increased (Figure 16H), and parapallial marker expression was high in both parental and PTHS organoids treated with CHIR 99021 (Figure 16I). Such a partial cell fate change from a cortical-pallial to a parapallial trajectory may have caused the phenotypic reversal observed in PTHS cells after Wnt activation. However, CHIR treatment did not result in an increase in parental organoid size (Figure 16F) or progenitor content (Figure 9K). Furthermore, CHIR treatment did not increase the proliferation of parental NPCs in 2D cultures (Figure 9G-H) or reduce the percentage of senescent cells (Figure 9I). These results rule out the possibility that fate restriction is responsible for the phenotypic correction in PTHS cells after Wnt signaling agonist activation.
[0177] CHIR treatment increased the expression of TCF4 and TCF4 downstream targets in PTHS NPCs in 2D culture (Figure 16K), an effect previously reported in other cell types exposed to high concentrations of CHIR, raising the possibility that the phenotypic correction following Wnt activation is due to increased TCF4. However, neural progenitor cells in the 3D organoid structure did not show increased TCF4 levels after CHIR treatment (Figure 16J), suggesting that the recovery from the proliferation defect in PTHS organoids following Wnt signaling activation is not due to increased TCF4 expression per se.
[0178] The lower number of neural rosettes in PTHS organoids (Figure 9D) suggests defective neuroepithelial structure in progenitor cells. Because β-catenin is a key component of the Wnt signaling pathway and a critical regulator of epithelial cell adhesion and integrity, a plausible hypothesis is that reduced Wnt signaling in PTHS NPCs leads to dysregulated β-catenin expression, resulting in rosette disassembly and impaired neural progenitor organization. Indeed, while β-catenin expression levels remained unchanged in PTHS NPCs and PTHS CtO progenitor cells (Figure 16M), β-catenin expression in PTHS organoids was disordered (Figure 16L), strongly suggesting that downregulation of Wnt signaling may result in defective neuroepithelial integrity during neural development in PTHS.
[0179] Another GO category of DE genes in PTHS NPCs was "cadherin" (Figure (Figure15N),15). Therefore, we performed experiments to determine whether cadherin or protocadherin expression was altered in PTHS cells. Most DE genes in this category are actually components of the Wnt pathway, with the exception of CDH23 and PCDH15. CDH23 expression was negligible (Figure (Figure16N),16),16,17,18, thus dismissing this gene as a mechanistic candidate. Although PCDH15 is significantly downregulated in PTHS NPCs, CHIR99021 treatment of NPCs further reduced its expression (Figure (Figure16N),16) under the same conditions in which the cellular phenotype was corrected (Figures 9G-I), excluding the possibility that PCDH15 could be responsible for the abnormal phenotype in PTHS NPCs.
[0180] Taken together, these experiments confirm the mechanistic involvement of Wnt signaling in the PTHS NPC proliferation defect. More importantly, these results demonstrate that the abnormal phenotype described in PTHS NPCs and organoids can be pharmacologically corrected, an observation that may guide future efforts to treat diseases caused by TCF4 haploinsufficiency.
[0181] Mechanistic involvement of SOX genes in altered proliferation and differentiation of PTHS NPCs. PTHS organoids contained a higher percentage of NPCs, fewer neurons, and altered Wnt signaling compared to parental organoids (Figures 5 and 9). Therefore, we performed experiments to identify mechanistic players downstream of the TCF4 and Wnt pathways that may regulate NPC proliferation and differentiation. Given the described interaction between SRY-related HMG-box (SOX) proteins and Wnt signaling and their known role in cell proliferation / differentiation, we examined the expression of all SOX genes in PTHS NPCs. Results showed that SOX1, SOX2, SOX3, and SOX4 were significantly downregulated in patient-derived cells (Figure 10A). Members of the SOXB subfamily (SOX1, SOX2, and SOX3) have traditionally been considered regulators of cell proliferation. Indeed, these genes were found to be primarily expressed in progenitor and intermediate progenitor cells of the CtO and sPO (Figures 13B, 17A-C). SOX1 was virtually not expressed in organoids (Figure 17A), and for this reason, experimental efforts focused on SOX3. Furthermore, all PTHS strains exhibited reduced expression of this gene, with some patients exhibiting a very strong reduction in expression (Figures 10A-B).
[0182] We first performed experiments to determine whether SOX3 is functionally downstream of TCF4, because shRNA-mediated TCF4 knockdown in control NPCs resulted in decreased SOX3 expression (Figure 10C). Examination of postmortem PTHS cortical samples showed that both SOX3 expression (Figure 10D) and the number of SOX3+ cells (Figure 10E) were significantly impaired. Treatment of PTHS progenitor cells with the Wnt agonist CHIR99021 also increased SOX3 expression, confirming that SOX3 is downstream of the Wnt signaling pathway (Figure 10F). Importantly, shRNA-mediated SOX3 knockdown in control NPCs resulted in decreased cell number (Figures 10G and 17D), increased expression of the cell cycle arrest gene CDKN2A (a senescence marker) (Figure 17E), and decreased expression of the pro-proliferative gene HES1 and proneural gene ASCL1 (Figure 17E), consistent with the phenotype observed in PTHS NPCs. Interestingly, transient SOX3 overexpression via transfection did not rescue PTHS NPCs from their proliferation defect (Figure (Figure17F–G). This may be because SOX3 overexpression was not sustained over the course of several days of the NPC proliferation assay or because other parallel dysregulated pathways were present.
[0183] The frequency of NPC differentiation in PTHS is low, as judged by the neuron-to-progenitor ratio in differentiated 2D cultures (Figures 10J and 17J). Furthermore, intermediate progenitor cells in PTHS are rare compared to control CtO and sPO (Figure 17K), and cells expressing the intermediate progenitor marker POU3F2 (encoding BRN2) are fewer in PTHS organoids (Figure 17L). Taken together, these results indicate abnormal differentiation of progenitor cells into neurons in PTHS neural tissue. Given the known role of members of the SOXC subfamily of SOX transcription factors (SOX4 and SOX11) as differentiation-promoting factors during neurogenesis, a plausible hypothesis is that the abnormal differentiation of PTHS is due to reduced expression of SOXC. In fact, these transcription factor genes are expressed in intermediate progenitor cells and neurons in CtO and sPO (Figures 10I, 17H-I). SOX4 is involved in the generation of intermediate progenitor cells and their differentiation into early-born cortical neurons (CTIP2 and TBR1 positive) and late-born cortical neurons (BRN2, SATB2, and CUX1 positive). SOX4 expression was confirmed to be low in the three PTHS progenitor cell lines (Figure 10H), intermediate progenitors and neurons of the excitatory lineage of the PTHS CtO (Figure 10I), and GABAergic neurons of the PTHS sPO (Figure 17H). To examine the involvement of SOX4 in the cell differentiation pathology, locked nucleic acid antisense oligonucleotide (LNA ASO)-mediated SOX4 knockdown was performed in differentiating neuronal 2D cultures from the two parental lines. Both cell number analysis and transcriptome analysis revealed that the differentiation frequency (MAP2 to SOX2 ratio) was reduced after SOX4 knockdown (Figure 10L), mimicking the abnormal phenotype of PTHS neuronal cultures (Figure 10J).
[0184] One model is that loss of TCF4 function leads to downregulation of Wnt, which in turn reduces SOX3 expression, leading to decreased proliferation and increased cellular senescence. In parallel, reduced SOX4 expression may lead to impaired differentiation in PTHS neural tissue, thereby contributing to the pathological phenotype observed in patient-derived cells.
[0185] Reversal of the abnormal PTHS phenotype via genetic correction of TCF4 expression. We performed experiments to genetically manipulate TCF4 itself. First, we used a CRISPR-based transepigenetic strategy to correct TCF4 expression in PTHS organoids (Liao et al., 2017). This method uses two viral vectors to deliver three expression cassettes into target cells. One encodes an engineered RNA hairpin aptamer linked to a short guide RNA (gRNA). The second encodes a transcription activation complex (MPH) that binds to the aptamer. The third encodes a dead Cas9. Because gRNA binding to the TCF4 promoter via Cas9 aggregates MPH, enhancing transcription from downstream genes, expression of these cassettes in target cells is expected to epigenetically transactivate the endogenous TCF4 locus (Figure 11A).
[0186] We created a series of expression cassettes containing 15 gRNAs targeting three alternative promoters (upstream of exons 3b, 8a, and 10a) of the TCF4 gene. These promoters, which generate transcripts encoding TCF4 protein isoforms B, D, and A, respectively, were highly active in both PTHS and parental control samples (Figure 18A). Several gRNAs were found to efficiently transactivate TCF4 and its target genes in the neuronal cell line SH-SY5Y, with some ideally resulting in a two-fold increase in TCF4 expression (Figure 18B-C). Next, we transduced the expression cassettes containing the most efficient gRNAs into PTHS organoids derived from patient #4 and its respective parental control (Figure 11B). This patient line was chosen because it showed the greatest differences in organoid size and cellular content compared to the respective controls (Figures 5B and 5D), allowing us to more easily identify the benefits of TCF4 correction. TCF4 correction was confirmed by increased TCF4 immunolabeling intensity (Figure 11C) and TCF4 mRNA levels (Figure 18D). TCF4 expression in PTHS line #4 is the same as in the parental control line (Figures 15E and 18D, upper panels), because patient #4 has a point mutation that is not expected to reduce transcription levels (Figure 12A). The CRISPR-mediated correction strategy enriched both the endogenous and mutant alleles (Figure 18D, lower panel), and the overall increased TCF4 levels were accompanied by correction of the TCF4 downstream target GADD45G (Figure 18E), demonstrating functional correction of the TCF4 locus.
[0187] Organoids transduced with the TCF4 gRNA vector showed reduced expression of the senescence gene CDKN2A and corrected expression of the neural marker MAP2 (Figure 18E). Expression of SOX3 also increased in these organoids, although the correction was partial (Figure 18E), likely because not all cells in the organoids express SOX3. The histological phenotypic abnormalities of PTHS were reversed in organoids subjected to TCF4 correction (Figure 11D), resulting in normal spheroids without abnormal proliferation (arrowheads in the middle panel). SOX2 and MAP2 staining of transduced organoids demonstrated that morphological correction was accompanied by reconstitution of the organoid's internal structure, with progenitor cells forming neural rosettes surrounding the lumen (arrowheads in the right panel; Figure 11D). Growth in PTHS organoids typically contained aggregates of MAP2+ cells (Figure 11J inset), an aberrant feature that disappeared in organoids after TCF4 correction upon transduction with TCF4 gRNA.
[0188] We further investigated the presence of immature neurons in PTHS organoids, which may indicate altered cortical neuron formation. Using DCX (doublecortin) as a marker for immature neurons, we confirmed that although DCX+ cells were found in both parental and PTHS organoids, these cells sometimes formed bundles of large, abnormally shaped DCX fibers in outgrowths of PTHS organoids, a feature that was corrected after correction of TCF4 expression. Interestingly, DCX expression was low in PTHS postmortem cortical tissue samples (Figure 18G), intermediate progenitor cells and neurons of PTHS CtO and sPO (Figure 18H), and PTHS neurons in 2D culture (Figure 18I). Notably, DCX expression was corrected in organoids transduced with TCF4 gRNA (Figure 18F), further suggesting that the number of immature neurons returned to normal after CRISPR-mediated correction of TCF4 levels.
[0189] The above CRISPR strategy requires the use of two viral vectors, which must be expressed at optimal levels to facilitate the correction of TCF4 expression. Alternatively, we employed a simpler procedure to correct TCF4 levels by subjecting cells and organoids to overexpression (OE) of extra copies of the TCF4 gene via lentiviral or AAV transduction. In these vectors, the TCF4-B coding sequence was placed under the control of a TCF4-binding motif (μE5 box) (Figures 11E and 18J), an approach expected to prevent ectopic TCF4 expression. First, TCF4 and GADD45G expression were corrected in transduced PTHS NPCs (Figure 18J), indicating that this strategy can be used for TCF4 gene correction. Next, transduction with a lentiviral TCF4 OE construct, observed at the beginning of the organoid induction protocol, resulted in an increase in the intensity of TCF4 labeling in organoids and a correction of TCF4 and CDKN2A levels (Figure 18K). After TCF4 OE, mature PTHS organoids exhibited abundant neural rosettes (Figure 11E), along with a correction of overall morphology and a recovery of the number of SOX2+ progenitor cells and CTIP2+ cortical neurons (Figures 11E and 18K). These effects in PTHS organoids subjected to TCF4 OE were accompanied by significant improvements in two key electrophysiological parameters, namely, mean firing frequency and the number of network electrical bursts (Figure 11G), a clear indication of functional recovery in the corrected organoids.
[0190] When TCF4 OE was performed after the neural induction phase using AAV vectors (Figure S1H), a clear increase in TCF4 labeling intensity was achieved (Figure S1H), and furthermore, the expression of TCF4 and CDKN2A, as well as the number of SOX2+ and CTIP2+ cells, were corrected (Figure S18N), and abundant rosettes reappeared (Figure S1H). This experiment not only demonstrates that the cellular pathology of PTHS can be reversed, but also demonstrates that TCF4 haploinsufficiency does not result in impaired neural induction, consistent with the presence of rosettes in the early stages of PTHS organoid development (Figure S8A), strongly supporting the hypothesis that defective progenitor cell proliferation is involved in the cellular pathophysiology.
[0191] These experiments provide conclusive evidence that the pathology observed in PTHS organoids is the result of reduced TCF4 expression. Importantly, the data provide proof-of-concept that the pathophysiology caused by TCF4 haploinsufficiency, including impaired progenitor cell proliferation and neuronal differentiation, as well as cellular senescence and dysregulated SOX gene expression, can be corrected at the cellular and tissue level, paving the way for much-needed treatments for this condition.
[0192] A number of embodiments have been described. However, it will be understood that various modifications can be made without departing from the spirit and scope of the description. Accordingly, other embodiments are within the scope of the following claims.
Claims
1. A recombinant nucleic acid comprising a mini-promoter and one or more microE5 motifs operably linked to a coding sequence for a TCF4 polypeptide.
2. The recombinant nucleic acid of claim 1, wherein the recombinant nucleic acid comprises 1 to 15 microE5 motifs.
3. The recombinant nucleic acid of claim 2 , wherein the recombinant nucleic acid comprises at least five microE5 motifs.
4. The recombinant nucleic acid of claim 2 , wherein the recombinant nucleic acid comprises at least 10 microE5 motifs.
5. The recombinant nucleic acid of claim 2 , wherein the recombinant nucleic acid comprises 12 microE5 motifs.
6. microE5 n 3. The recombinant nucleic acid of claim 2, having the general structure: -mini-promoter-TCF4 coding sequence, where n is an integer ranging from 5 to 15.
7. The recombinant nucleic acid of any one of claims 2 to 6, wherein the microE5 motif comprises the nucleotide sequence of SEQ ID NO:
10.
8. The recombinant nucleic acid of any one of claims 1 to 7, wherein the TCF4 polypeptide is TCF4-B.
9. The recombinant nucleic acid of claim 8 , wherein the TCF4 polypeptide comprises the amino acid sequence of SEQ ID NO:
2.
10. 10. The recombinant nucleic acid of claim 9, wherein the TCF4 coding sequence comprises a nucleotide sequence that is at least 80% identical to SEQ ID NO:
1.
11. The recombinant nucleic acid of any one of claims 1 to 10, wherein the mini-promoter comprises a core promoter.
12. 12. The recombinant nucleic acid of claim 11, wherein the mini-promoter comprises the nucleotide sequence of SEQ ID NO:
3.
13. The recombinant nucleic acid of any one of claims 1 to 12, wherein the recombinant nucleic acid comprises the nucleotide sequence of any one of SEQ ID NOs: 4, 6, 7 or 8.
14. A vector comprising the recombinant nucleic acid of any one of claims 1 to 13.
15. The vector of claim 14, wherein the vector is an adeno-associated virus (AAV) vector, a lentivirus vector, or a gamma-retrovirus vector.
16. The vector of claim 15, wherein the vector is an AAV9 vector.
17. A recombinant cell comprising a recombinant nucleic acid according to any one of claims 1 to 13 or a vector according to any one of claims 14 to 16.
18. A pharmaceutical composition comprising the vector according to any one of claims 14 to 16.
19. 19. The pharmaceutical composition of claim 18 for treating an associated neurological or neurodevelopmental disease or disorder in a subject.
20. 20. The pharmaceutical composition of claim 19, wherein the neurological or neurodevelopmental disease or disorder is Pitt-Hopkins syndrome, schizophrenia, autism, autism spectrum disorder, or 18q syndrome.
21. 20. The pharmaceutical composition of claim 19, wherein the neurological or neurodevelopmental disease or disorder is Pitt-Hopkins syndrome, which is associated with TCF4 haploinsufficiency.
22. The pharmaceutical composition according to any one of claims 19 to 21, wherein the subject has one or more single nucleotide polymorphisms in the TCF4 gene.
23. The pharmaceutical composition of any one of claims 19 to 21, wherein the subject has a chromosomal deletion comprising at least a portion of the TCF4 gene.
24. 24. The pharmaceutical composition of claim 23, wherein the subject has a complete deletion of the TCF4 gene.
25. The pharmaceutical composition of any one of claims 19 to 21, wherein the subject has a chromosomal translocation involving at least a portion of the TCF4 gene.