How to test poodles for muscular dystrophy

Abstract

To provide a method for testing muscular dystrophy in poodles.SOLUTION: Provided is a method for testing muscular dystrophy in poodles comprising (1) detecting the presence or absence of nucleotide mutations in exon 45 of the dystrophin gene in a test sample collected from a subject.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to a method for testing poodles for muscular dystrophy. [Background technology]

[0002] Muscular dystrophies are hereditary muscle diseases characterized by degeneration and necrosis of muscle fibers. Muscular dystrophies cause a gradual decline in muscle strength, leading to motor dysfunction and respiratory failure. More than 50 causative genes have been identified in humans.

[0003] Muscular dystrophy cases have been reported in several breeds of dogs, including Golden Retrievers, Labrador Retrievers, Jack Russell Terriers, and Cavalier King Charles Spaniels (see, for example, Non-Patent Document 1). [Prior art documents] [Non-patent literature]

[0004] [Non-Patent Document 1] Brinkmeyer-Langford, et al., Expression profiling of disease progression in canine model of Duchenne muscular dystrophy, PLOS ONE https: / / doi.org / 10.1371 / journal.pone.0194485 March 19, 2018 Summary of the Invention [Problem to be solved by the invention]

[0005] In the course of their research, the inventors discovered the first case of muscular dystrophy in a toy poodle. There have been no reported cases of muscular dystrophy in toy poodles, and it is thought that the condition may have been overlooked. Therefore, it is highly likely that there are already many carriers of the disease in Japan.

[0006] Therefore, an object of the present invention is to provide a method for easily testing for muscular dystrophy in poodles. [Means for solving the problem]

[0007] In view of the above problems, the present inventors have conducted extensive research and found that muscular dystrophy in poodles can be easily diagnosed by detecting the presence or absence of a base mutation in exon 45 of the dystrophin gene in a test sample collected from a subject. Based on this finding, the present inventors have conducted further research and have completed the present invention. Specifically, the present invention encompasses the following aspects.

[0008] Item 1. A method for testing for muscular dystrophy in poodles, comprising: (1) detecting the presence or absence of a base mutation in exon 45 of the dystrophin gene in a test sample collected from a subject; A method comprising:

[0009] Item 2. The method according to Item 1, wherein the base mutation is a base insertion.

[0010] Item 3. The method according to Item 1 or 2, wherein the base mutation is a single-base insertion.

[0011] Item 4. The method according to any one of Items 1 to 3, wherein the base mutation is a single-base insertion within the region from the 207th base (thymine) to the 211th base (thymine) from the 5' end of the base sequence shown in SEQ ID NO: 1 or at the end of said region.

[0012] Item 5. The method according to any one of Items 1 to 4, wherein detecting the presence or absence of a base mutation comprises hybridizing at least one selected from the group consisting of a primer and a probe to the genomic DNA of the subject or a nucleic acid molecule derived therefrom, and performing sequence analysis of the genomic DNA of the subject.

[0013] Item 6. (2a) When the subject is male and the base mutation is detected, determining that the subject is at high risk of developing muscular dystrophy in the future or currently has muscular dystrophy; or (2b) When the subject is female and the base mutation is detected, determining that the subject is a muscular dystrophy carrier, has a high risk of developing muscular dystrophy in the future, or currently has muscular dystrophy. 6. The method according to any one of items 1 to 5, comprising:

[0014] Item 7. The method according to any one of Items 1 to 6, wherein the test sample is a body fluid or a mucous membrane.

[0015] Item 8. The method according to any one of Items 1 to 7, wherein the subject is a toy poodle.

[0016] Item 9. A diagnostic agent for muscular dystrophy in poodle breeds, comprising at least one primer and probe selected from the group consisting of primers and probes for detecting the presence or absence of a base mutation in exon 45 of the dystrophin gene. [Effects of the Invention]

[0017] According to the present invention, a method for easily testing for muscular dystrophy in poodles can be provided. [Brief explanation of the drawings]

[0018] [Figure 1] This is a photograph of the subject (a toy poodle). The subject has a hunched back posture and joint contractures in the shoulder and knee joints. [Figure 2] This shows a hematoxylin-eosin stained image of a muscle tissue section from a subject. Variation in muscle fiber size, degeneration, and necrosis are observed. [Figure 3] The figure shows an immunostained image of a muscle tissue section from a subject using a dystrophin antibody. The vertical axis shows the dystrophin antibodies used (DYSA: antibody against the C-terminal region, DYSB: antibody against the N-terminal region). [Figure 4]The whole genome sequence analysis of the subject and the results are summarized below. It was found that there was a single base insertion in exon 45, resulting in a frameshift and the appearance of a stop codon in exon 46. DETAILED DESCRIPTION OF THE INVENTION

[0019] In this specification, the expressions "contain" and "comprise" include the concepts of "contain," "comprise," "consist essentially of," and "consist only of."

[0020] 1. Testing method In one aspect, the present invention relates to a method for testing for muscular dystrophy in poodles, which comprises: (1) detecting the presence or absence of a base mutation in exon 45 of the dystrophin gene in a test sample collected from a subject (hereinafter, this method may be referred to as the "testing method of the present invention"). This method is described below.

[0021] 1-1. Process (1) The type of muscular dystrophy to be tested is not particularly limited. All types, classes, grades, and stages according to various classification criteria for muscular dystrophy can be tested. Examples of muscular dystrophinopathy include dystrophinopathy (Duchenne / Becker muscular dystrophy), limb-girdle muscular dystrophy, facioscapulohumeral muscular dystrophy, Emery-Dreifuss muscular dystrophy, oculopharyngeal muscular dystrophy, Fukuyama congenital muscular dystrophy, and myotonic dystrophy.

[0022] The subject is a poodle dog. A poodle is a dog of the poodle breed, or a descendant of such a dog (including hybrids). Examples of poodles include toy poodles, miniature poodles, medium poodles, standard poodles, and teacup poodles, with toy poodles being particularly preferred. Whether a dog is a descendant of a poodle can be determined according to a known method, for example, according to the method described in a previous report (Parker et al., 2017, Cell Reports 19, 697-708).

[0023] The condition of the subject is not particularly limited, and examples of the subject include a subject whose presence or absence of muscular dystrophy is unknown, a subject whose presence or absence has already been determined by another method to be due to muscular dystrophy, a subject whose presence or absence has already been determined by another method to be due to the absence of muscular dystrophy, and a subject undergoing treatment for muscular dystrophy.

[0024] The canine dystrophin gene is known and is registered, for example, with Ensembl (https: / / asia.ensembl.org / index.html?mobileredirect=no) under the code number ENSCAFG00000023562. The nucleotide sequences of each intron and each exon of the gene can be obtained, for example, from the above registration information.

[0025] "Exon 45," for which the presence or absence of a base mutation is detected in step (1), is the 45th exon in the canine dystrophin gene in the genomic DNA (i.e., chromosomal DNA), when counting exons from the promoter side of the gene. The base sequence of exon 45 and its surroundings is shown in SEQ ID NO: 1.

[0026] In step (1), the presence or absence of a base mutation in exon 45 is detected. Examples of base mutations include base insertions, base deletions, and base substitutions. In the present invention, base insertions, particularly single-base insertions, are particularly preferred. Previous reports of canine dystrophin gene mutations have mostly focused on base deletions, but no reports of base insertions have been reported to date.

[0027] The base mutation is particularly preferably a single base insertion within the region from the 207th base (thymine) to the 211th base (thymine) from the 5' end of the base sequence shown in SEQ ID NO: 1 or at the end of this region.

[0028] The insertion of one base within the region from the 207th base (thymine) to the 211th base (thymine) or at the end of this region refers to the insertion of one base on the 5' side of the 207th base (thymine) (between the 206th base (guanine) and the 207th base (thymine)), between the 207th base (thymine) and the 208th base (thymine), between the 208th base (thymine) and the 209th base (thymine), between the 209th base (thymine) and the 210th base (thymine), between the 210th base (thymine) and the 211th base (thymine), or on the 3' side of the 211th base (thymine) (between the 211th base (thymine) and the 212th base (cytosine)).

[0029] More specifically, step (1) can be carried out by analyzing the genomic DNA of the subject present in the test sample.

[0030] The test sample is not particularly limited as long as it can contain genomic DNA. From the viewpoint of simplicity, it is desirable that the test sample be a sample that can be collected by a minimally invasive method. Examples of such test samples include body fluids (e.g., whole blood, serum, plasma, lymph, saliva, urine, tissue fluid (including bronchoalveolar lavage fluid), sweat, tears, sputum, nasal secretions, etc.), mucous membranes (e.g., oral mucosa, nasal mucosa, etc.), etc.

[0031] Body fluids and mucous membranes can be collected from a subject by methods known to those skilled in the art. For example, whole blood can be collected by drawing blood using a syringe or the like. Serum is a portion of whole blood from which blood cells and specific blood coagulation factors have been removed, and can be obtained, for example, as the supernatant after clotting of whole blood. Plasma is a portion of whole blood from which blood cells have been removed, and can be obtained, for example, as the supernatant when whole blood is centrifuged under conditions that do not cause clotting. Body fluids and mucous membranes can also be collected by contacting (preferably rubbing) a swab or the like with mucosal tissue.

[0032] The detection of the presence or absence of a base mutation is not particularly limited and can be carried out according to or in accordance with known methods, or by utilizing the principles of known methods. Detection of the presence or absence of a base mutation can include, for example, hybridizing at least one primer and probe to the genomic DNA of the subject or a nucleic acid molecule derived therefrom (e.g., a restriction enzyme fragment of genomic DNA, a PCR amplification product of genomic DNA, etc.), and performing at least one method selected from the group consisting of sequencing the genomic DNA of the subject. The detection of the presence or absence of a base mutation can be performed by sequencing the area surrounding the target base mutation, or by using PCR-based methods, DNA probe-based methods, or mass spectrometry-based methods. Examples of PCR-based methods include SNP typing, TaqMan PCR, single-base extension, pyrosequencing, and exonuclease cycling assays. Examples of methods using DNA probes include the Invader method (Comprehensive Genetic Polymorphism Analysis (SNP), Japanese Journal of Pharmacology, 125, 148-152, 2005).

[0033] Examples of primers include primers that amplify a region containing the target base mutation site and its surrounding sequence, primers that hybridize to a region containing the target base mutation site, etc. Examples of probes include primers that hybridize to a region containing the target base mutation site.

[0034] The primers and probes are preferably oligonucleotides having a chain length of at least 15 nucleotides. When such oligonucleotides are used as primers, their length is, for example, 15 bp to 100 bp, preferably 17 bp to 30 bp. The primers are not particularly limited as long as they can amplify at least a portion of the DNA containing the target base mutation site. The length of the DNA that can be amplified by the primers is, for example, 15 to 1000 bp, preferably 20 to 500 bp, and more preferably 20 to 200 bp.

[0035] When used as a probe, its length is, for example, 5 bp to 200 bp, preferably 7 bp to 100 bp, and more preferably 7 bp to 50 bp. The probe is not particularly limited as long as it can hybridize with DNA containing the target base mutation site.

[0036] In addition to a base sequence identical to or complementary to the base sequence of the region containing the target base mutation site, any base sequence can be added to the primer. For example, in a method for analyzing polymorphisms using a type IIs restriction enzyme, a primer containing a recognition sequence for the type IIs restriction enzyme is used. Furthermore, the primer may be modified. For example, a primer labeled with a fluorescent substance or a binding affinity substance such as biotin or digoxin may be used.

[0037] The probe capable of hybridizing to the region containing the target nucleotide mutation site may be any probe capable of hybridizing to a polynucleotide having the nucleotide sequence of the region containing the target nucleotide mutation site, and preferably hybridizes specifically to DNA having the nucleotide sequence of the region containing the target nucleotide mutation site. Here, "specifically hybridize" means that under normal hybridization conditions, preferably under stringent hybridization conditions (e.g., the conditions described in Sambrook et al., Molecular Cloning, Cold Spring Harbour Laboratory Press, New York, USA, 2nd ed. 1989), there is no significant cross-hybridization with DNA other than the DNA having the nucleotide sequence of the region containing the target nucleotide mutation site. More specifically, a probe containing the target nucleotide mutation site in its nucleotide sequence is preferred. Alternatively, depending on the method for analyzing the base at the target nucleotide mutation site, the end of the probe may be designed to correspond to the base adjacent to the target nucleotide mutation site. Therefore, it is also possible to use a probe whose base sequence does not include the target base mutation site but which contains a base sequence complementary to a region adjacent to the target base mutation site.

[0038] For example, typical post-hybridization washing conditions include approximately 1×SSC, 0.1% SDS, and 37°C. It is preferable that the complementary strand maintains its hybridization state with the target positive strand even when washed under these conditions. While not particularly limited, more stringent hybridization conditions include approximately 0.5×SSC, 0.1% SDS, and 42°C, and even more stringent hybridization conditions include approximately 0.1×SSC, 0.1% SDS, and 65°C. Specifically, examples of such complementary strands include a strand consisting of a nucleotide sequence that is completely complementary to the nucleotide sequence of the target positive strand, and a strand consisting of a nucleotide sequence that shares at least 90%, preferably 95%, more preferably 98% or more, and even more preferably 99% or more identity with the target positive strand.

[0039] As with primers, probes may be modified, have additional base sequences, or be modified. For example, probes used in the Invader method may have additional base sequences unrelated to the genome that constitutes the flap. Such probes are also included in the probes of this embodiment as long as they hybridize to a region containing the target base mutation site. The base sequence constituting the probe of this embodiment can be designed according to the analysis method based on the base sequence of the DNA region surrounding the target base mutation site of this embodiment in the genome.

[0040] Those skilled in the art can design primers and probes appropriate for the analytical method based on the base sequence information for the DNA region surrounding the target base mutation site. The base sequences constituting the primers and probes may not only be completely complementary to the base sequence of the genome, but may also be appropriately modified.

[0041] The testing method of the present invention, which includes step (1), can provide information on the presence or absence of base mutations, which are an indicator for detecting muscular dystrophy, and can thereby assist in assessing the risk of developing muscular dystrophy, diagnosing muscular dystrophy, and the like.

[0042] 1-2. Process (2) In one aspect, the testing method of the present invention comprises: (2a) determining that the subject is at high risk of developing muscular dystrophy in the future or currently has muscular dystrophy if the subject is male and the base mutation is detected (hereinafter, this may be referred to as "step (2a)"); or (2b) if the subject is female and the base mutation is detected, determining that the subject is a muscular dystrophy carrier, has a high risk of developing muscular dystrophy in the future, or currently has muscular dystrophy (hereinafter sometimes referred to as "step (2b)"). It is preferred that the compound contains:

[0043] According to the testing method of the present invention, which includes steps (2a) and (2b) (hereinafter collectively referred to as "step (2)"), it is possible to determine the risk of developing muscular dystrophy, whether or not muscular dystrophy has occurred, and whether or not a person is a muscular dystrophy carrier.

[0044] 2. Higher accuracy of diagnosis If the test method of the present invention including step (2a) determines that a subject is at high risk of developing muscular dystrophy in the future or currently has muscular dystrophy, the risk of developing muscular dystrophy in the future or whether the subject currently has muscular dystrophy can be diagnosed with higher accuracy by combining the test method of the present invention with a step of having a veterinarian diagnose muscular dystrophy.

[0045] 3. Actions to be taken after diagnosis When the test method of the present invention including step (2) determines that the subject is at high risk of developing muscular dystrophy in the future, currently has muscular dystrophy, or is a muscular dystrophy carrier, the test method of the present invention may further include the following steps: (3a) Treating the subject so that it cannot be used for breeding. This will help prevent the future occurrence of muscular dystrophy in poodles. Treatments to prevent breeding include sterilization surgery and separating males and females from each other in breeding areas.

[0046] When the test method of the present invention including step (2a) determines that the subject is at high risk of developing muscular dystrophy in the future or currently has muscular dystrophy, the test method of the present invention may further include the following steps: (3) To prevent the onset of or treat muscular dystrophy in subjects who have been determined or diagnosed as having a high risk of developing the disease in the future or who currently have the disease. This makes it possible to prevent the onset of the disease or treat the disease in the subject.

[0047] Examples of preventive (including the concept of delaying onset) and therapeutic methods include rehabilitation therapy, drug therapy, etc. Examples of therapeutic agents used in drug therapy include exon skipping therapeutic agents, etc.

[0048] 4. Testing kits In one aspect, the present invention relates to a diagnostic agent for muscular dystrophy in poodle breeds (sometimes referred to herein as the "diagnostic agent of the present invention"), which comprises at least one primer and probe for detecting the presence or absence of a base mutation in exon 45 of the dystrophin gene. This will be described below.

[0049] For the primers and probes, the description in "1-1. Step (1)" above is applicable.

[0050] The primers and probes can also be used by immobilizing them on any solid phase, and therefore the test agent of the present invention can be provided in the form of a substrate on which the primers and probes are immobilized (for example, a microarray chip on which the probes are immobilized).

[0051] The solid phase used for immobilization is not particularly limited as long as it can immobilize polynucleotides, etc., and examples thereof include glass plates, nylon membranes, microbeads, silicon chips, capillaries, and other substrates. The immobilization of the detection agent to the solid phase is not particularly limited. For example, in the case of a microarray, a commercially available spotter (e.g., manufactured by Amersham) can be used. Immobilization methods are well known in the art depending on the type of immobilized probe (e.g., photolithographic technology (Affymetrix) or in situ synthesis of oligonucleotides using inkjet technology (Rosetta Inpharmatics)).

[0052] The diagnostic agent of the present invention may contain other detection agents (e.g., probes for detecting other gene mutations, antibodies, etc.) in addition to the primers and probes. In this case, the diagnostic agent of the present invention may be a diagnostic agent that can detect other diseases or conditions in addition to muscular dystrophy.

[0053] The test agent of the present invention may be in the form of a composition. The composition may contain other components as needed. Examples of other components include bases, carriers, solvents, dispersants, emulsifiers, buffers, stabilizers, excipients, binders, disintegrants, lubricants, thickeners, moisturizers, colorants, fragrances, chelating agents, etc.

[0054] The test agent of the present invention may be in the form of a kit. The kit may contain, in addition to the primers and probes or the composition containing them, other materials that can be used to detect gene mutations. Specific examples of such materials include various reagents (e.g., buffer solutions), containers, and tools (e.g., tools for collecting test samples). [Example]

[0055] The present invention will be described in detail below based on examples, but the present invention is not limited to these examples.

[0056] Test example 1. Muscular dystrophy test <1-1. Phenotype analysis> A toy poodle (intact male, 8 months old) (hereafter referred to as the "subject") was found to have a bowed posture and joint contractures in the shoulder and knee joints (Figure 1). The subject also had abnormal gait and pain while walking, but no abnormalities were found in postural responses, spinal reflexes, or cranial nerve function.

[0057] To observe the cross-sections of muscle fibers, sections of the muscle tissue of the subjects were prepared and stained with hematoxylin and eosin according to standard methods. The sections revealed variations in muscle fiber size, degeneration, and necrosis (Figure 2).

[0058] Based on the phenotypes identified above, we focused on examining dystrophin expression. Muscle tissue sections were immunostained using either an antibody against the N-terminal region of dystrophin (DYSB, Leica Biosystems) or an antibody against the C-terminal region of dystrophin (DYSA, Leica Biosystems) as the primary antibody, according to standard methods. Dystrophin expression was observed in healthy dogs, but not in the cases (Figure 3).

[0059] Based on these results, the subject was diagnosed with muscular dystrophy. Although canine muscular dystrophy has been reported in several breeds, it has never been reported in a toy poodle.

[0060] <1-2. Genetic analysis> Genomic DNA was extracted from the subject's peripheral blood and subjected to whole-genome sequencing (NovaSeq 6000, Illumina) and compared with the sequence of the wild-type dystrophin gene (DMD gene: ENSCAFG00000023562). The results indicated that the subject's dystrophin gene contained a single-nucleotide insertion in exon 45, resulting in a frameshift and the appearance of a stop codon in exon 46 (Figure 4). Specifically, the subject's dystrophin gene contained a single-nucleotide insertion within the region from the 5' end of exon 45 and its surrounding sequence (SEQ ID NO: 1) of the wild-type dystrophin gene (DMD gene: ENSCAFG00000023562) to the 207th base (thymine) and the 211th base (thymine) from the 5' end of the region, i.e., between the 206th base (guanine) and the 207th base (thymine), and the 20th base (thymine). It was found that one base (thymine) was inserted between the 7th base (thymine) and the 208th base (thymine), between the 208th base (thymine) and the 209th base (thymine), between the 209th base (thymine) and the 210th base (thymine), between the 210th base (thymine) and the 211th base (thymine), or on the 3' side of the 211th base (thymine) (between the 211th base (thymine) and the 212th base (cytosine)).

[0061] [ka]

[0062] Next, a primer set (forward primer: AATCTGGTGCCTTTCACCCTG (SEQ ID NO: 2), reverse primer: TGGTATCTTACAGGAACTCCAGG (SEQ ID NO: 3)) was designed to amplify an approximately 300-bp region containing the identified single-base insertion site, and PCR was performed using the subject's genomic DNA as a template. The resulting approximately 300-bp fragment was sequenced by direct sequencing (Sanger method). The sequence decoded using the forward primer (SEQ ID NO: 2) as the sequencing primer (SEQ ID NO: 1) and the reverse complementary sequence (SEQ ID NO: 2) of the sequence decoded using the reverse primer (SEQ ID NO: 3) as the sequencing primer were each compared with the sequence of the corresponding region of the wild-type dystrophin gene (DMD gene: ENSCAFG00000023562) (wild-type sequence). The results of comparison between Sequence 1 and the wild-type sequence are shown in Table 1, and the results of comparison between Sequence 2 and the wild-type sequence are shown in Table 2. In Table 1, Sbjct represents sequence 1 (SEQ ID NO: 4), and Query represents the wild-type sequence (SEQ ID NO: 5) of the corresponding region of sequence 1. In Table 2, Sbjct represents sequence 2 (SEQ ID NO: 6), and Query represents the wild-type sequence (SEQ ID NO: 7) of the corresponding region of sequence 2.

[0063] [Table 1]

[0064] [Table 2]

[0065] As can be seen from Tables 1 and 2, the single base insertion identified in the whole genome sequence analysis was also confirmed in this test.

[0066] The subjects were purchased from a breeder in Japan. Considering the possibility that muscular dystrophy has been overlooked because no cases of muscular dystrophy have been reported in toy poodles, as described above, it is highly likely that many poodles already have the above-mentioned base mutation. Furthermore, since poodles are the most popular and widely bred breeds in Japan, further testing of poodles in the future may lead to the discovery of a series of muscular dystrophy cases and muscular dystrophy carriers based on this sequence abnormality. The present invention enables muscular dystrophy testing through a simple genetic test and is useful in situations such as those described above.

Claims

1. A method for testing for muscular dystrophy in toy poodles, comprising: (1) To detect the presence or absence of a base mutation in exon 45 of the dystrophin gene in a test sample collected from a toy poodle subject; A method comprising:

2. The method of claim 1, wherein the base mutation is a base insertion.

3. The method according to claim 1 or 2, wherein the base mutation is a single base insertion.

4. The method according to any one of claims 1 to 3, wherein the base mutation is a single base insertion within the region from the 207th base (thymine) to the 211th base (thymine) from the 5' end of the base sequence shown in SEQ ID NO: 1 or at the end of said region.

5. The method according to any one of claims 1 to 4, wherein detecting the presence or absence of the base mutation comprises hybridizing at least one selected from the group consisting of a primer and a probe to the genomic DNA of the subject or a nucleic acid molecule derived therefrom, and performing sequence analysis of the genomic DNA of the subject.

6. (2a) if the subject is male and the base mutation is detected, determining that the subject is at high risk of developing muscular dystrophy in the future or currently has muscular dystrophy; or (2b) When the subject is female and the base mutation is detected, determining that the subject is a muscular dystrophy carrier, has a high risk of developing muscular dystrophy in the future, or currently has muscular dystrophy. The method according to any one of claims 1 to 5, comprising:

7. The method according to any one of claims 1 to 6, wherein the test sample is a body fluid or a mucous membrane.

8. A diagnostic agent for muscular dystrophy in toy poodles, comprising at least one selected from the group consisting of primers and probes for detecting the presence or absence of a base mutation in exon 45 of the dystrophin gene.

Images