Compositions for use in the treatment of group B streptococcus (GBS) infections

Abstract

The present invention relates to the field of bacterial infections, in particular group B streptococcus (GBS) infections during and after pregnancy. The present invention relates to the use of a composition comprising a strain of Lactobacillus acidophilus, a strain of Lactobacillus rhamnosus, and lactoferrin in the prophylactic and / or therapeutic treatment of group B streptococcus (GBS) infections.

Description

[Technical Field]

[0001] The present invention relates to the field of bacterial infections, in particular group B streptococcus (GBS) infections during and after pregnancy.

[0002] The present invention relates to the use of a composition comprising a strain of Lactobacillus acidophilus, a strain of Lactobacillus rhamnosus and lactoferrin in the prophylactic and / or therapeutic treatment of group B streptococcus (GBS) infections. [Background technology]

[0003] Streptococcus agalactiae, or group B streptococcus (GBS), is a significant cause of morbidity and mortality for both mothers and newborns worldwide. The gastrointestinal tract is the natural host for GBS, and the bacteria can migrate and colonize the vagina. Studies conducted in the United States have shown that 10–35% of pregnant women are asymptomatic carriers of GBS. Colonization can be a rare, chronic, or intermittent event. The most important risk factor for neonatal infection is the presence of pathogenic bacteria in the maternal genitourinary tract during labor and fetal passage through the birth canal. Alternatively, pathogenic bacteria can reach amniotic fluid from the ascending flow after membrane rupture, although this latter event is not necessary for bacterial colonization.

[0004] Regarding the etiology of late neonatal infection, transmission is presumed to be horizontal, with causative factors including close maternal contact, breastfeeding, and nosocomial infection.

[0005] The primary problem associated with the presence of GBS in both the maternal genitourinary and gastrointestinal tracts is asymptomatic colonization. Indeed, asymptomatic bacteriuria is frequently observed during pregnancy. In asymptomatic cases, clinical manifestations in pregnant women include chorioamnionitis, cystitis, pyelonephritis, and febrile bacteremia, as well as fever and endometritis during the postpartum period. Furthermore, this pathogen correlates with prolonged labor, premature rupture of membranes (PROM), and preterm labor (PPT). Less commonly, this pathogen has been associated with surgical wound infections after cesarean section, pelvic abscess, septic pelvic vein thrombosis, and osteomyelitis.

[0006] At birth, GBS is found in the external ear canal, pharynx, umbilicus, and anorectal tract of 50–65% of newborns of colonized mothers.

[0007] Approximately 98% of newborns who show signs of colonization do not develop infection, although this infection occurs in 1-2% of cases.

[0008] GBS can cause two distinct clinical manifestations: early and late neonatal infection. The former (early infection) occurs within the first 7 days of life and its main symptom is respiratory distress. Pneumonia and sepsis are the most common clinical manifestations, but meningitis occurs in 5-10% of newborns. Early infection is 10 times more common in preterm infants.

[0009] Late infection occurs between 7 days and 3 months of age. These patients usually develop prematurely and often develop meningitis, sepsis, and osteoarticular infections. More than 20% of newborns who survive meningitis caused by GBS develop permanent neurological damage, including sensorineural hearing loss, mental retardation, and cortical blindness. Mortality rates in the United States have declined significantly over the past 30 years: from 50% in 1970 to 6% in 1990; more recent data from the CDC indicate even lower rates.

[0010] Diagnosis in pregnant women is carried out as follows: - Culture assays to detect pathogenic bacteria from either vaginal or anorectal swabs; - Urine culture test.

[0011] Diagnosis in newborns is performed as follows: - Culture assays to detect pathogenic bacteria from either nasopharyngeal or ear swabs; - blood culture; - Cerebrospinal fluid test.

[0012] Currently, the most effective method for reducing the incidence of early neonatal infections is maternal screening aimed at identifying (asymptomatic) pathogenic bacteria and intrapartum antimicrobial therapy. This latter appears to be the best way to prevent maternal complications, infections, and neonatal events. It can be performed based on culture screening between 35 and 37 weeks of gestation, or taking into account risk factors both before and during delivery, as follows: - Vaginal-rectal colonization during 35-37 weeks of pregnancy; - Premature birth; - If swab results are unavailable, consider medical history, especially preterm birth (<37 weeks), pPROM, PROM occurring >18 hours prior, fever during labor (>38°C or 100°F), previous GBS-positive neonate, and maternal GBS-positive urine culture.

[0013] Oral antimicrobial therapy during pregnancy and before delivery is indicated only if GBS is prevalent in urine samples; treatment is not indicated for vaginitis caused by GBS.

[0014] Intrapartum prophylaxis should be administered with penicillin or ampicillin every 4 hours until delivery. Antimicrobial therapy for at-risk neonates should be administered only after clinical signs and diagnosis of infection.

[0015] A vaccine against GBS infection is not yet available.

[0016] Given the current lack of treatments for GBS that would allow avoiding complications and infections for the mother and newborn, the need and importance of developing alternatives to the use of antimicrobial therapy during pregnancy and labor is increasing. Summary of the Invention

[0017] The problem underlying the present invention is to find available treatments for the prevention and treatment of group B streptococcal infections.

[0018] This problem is solved by the present discovery by using a composition comprising a strain of Lactobacillus acidophilus, a strain of Lactobacillus rhamnosus, and lactoferrin in the preventive and / or therapeutic treatment of group B streptococcus (GBS) infections.

[0019] As further described in the detailed description of the invention, the compositions of the present invention have the advantage of allowing for the treatment of Streptococcus agalactiae infections without the use of antibiotics. [Brief explanation of the drawings]

[0020] The features and advantages of the present invention will become apparent from the detailed description reported below, the examples given for illustrative and non-limiting purposes, and the accompanying Figures 1 and 2: [Figure 1] Figures 1A, 1B, and 1C show graphs reporting the growth inhibition of GBS (10 CFU) after various treatments with L. acidophilus, L. rhamnosus, a mixture of both Lactobacillus strains, and a mixture with lactoferrin (0.1-10 mg / ml). Both Lactobacillus strains were used at 10 CFU as described in Example 7. Figures 1A, 1B, and 1C show the growth inhibition of GBS after 6, 12, and 24 hours, respectively. [Figure 2] FIG. 2 shows a graph reporting the growth of GBS in the presence of lactoferrin (Lf). Detailed Description of the Invention

[0021] The present invention relates to a composition comprising a Lactobacillus acidophilus strain, a Lactobacillus rhamnosus strain, and lactoferrin for use in the preventive and / or therapeutic treatment of group B streptococcus (GBS) infection. The composition comprising a Lactobacillus acidophilus strain, a Lactobacillus rhamnosus strain, and lactoferrin is suitable for use in the preparation of a medicament for the preventive and / or therapeutic treatment of group B streptococcus (GBS) infection.

[0022] Lactic acid bacteria such as Lactobacillus acidophilus and Lactobacillus rhamnosus are microorganisms that, when administered in adequate amounts, exert several beneficial effects on human health and are therefore considered probiotics.

[0023] Lactobacillus is a predominant microbial category in a healthy vaginal ecosystem. Lactobacillus species contribute to vaginal homeostasis by producing antibacterial substances that can inhibit the growth of pathogenic microorganisms and balance the various bacterial populations. Furthermore, Lactobacillus species also contribute to a healthy vaginal environment by producing lactic acid, which maintains a physiologically low vaginal pH. Alterations in the microbial composition of the vaginal ecosystem are associated with several adverse health outcomes, such as bacterial vaginosis (BV) and aerobic vaginosis (AV).

[0024] Lactoferrin (Lf), a harmless, natural component of most exocrine biological fluids, including tears, milk, saliva, and vaginal secretions, merits attention as a potential therapeutic agent. Lf is an ~80 kDa iron-binding multifunctional glycoprotein that constitutes one of the major immunomodulatory components of the innate immune system. Other biological activities of Lf described in the scientific literature include antimicrobial activity against a wide range of pathogenic bacteria, fungi, protozoa, and viruses, as well as anti-inflammatory and iron carrier properties. Like other milk glycoconjugates, Lf functions as a soluble receptor mimetic that inhibits pathogen binding to mucosal cell surfaces. Despite the broad antibacterial spectrum and immunomodulatory activity of Lf described above, relatively little is known about its activity in controlling vaginal bacterial growth.

[0025] Without being bound by any theory, the mechanism of action involved in the prevention of GBS infection in women is the direct effect of the antibacterial activity of the composition of the present invention in the gastrointestinal tract.In fact, the intestine is the host of many pathogenic microorganisms that cause human diseases, such as lower urogenital tract infections.The composition of the present inventors can significantly reduce the proliferation, migration and colonization of GBS in the lower urogenital tract.

[0026] In previous experimental studies, the present inventors found that a combination of lactic acid bacteria, namely L. acidophilus and L. rhamnosus, exerts antibacterial effects by inhibiting the proliferation and growth of several specific pathogens and opportunistic bacteria. In particular, the present inventors demonstrated that the probiotic combination induces significant effects on Staphylococcus aureus and Escherichia coli, which are considered the most common causes of lower urinary tract infections. In contrast, nothing is known about the effect of this combination on GBS.

[0027] Based on the above evidence, we tested the ability of selected lactobacilli, mainly Lactobacillus acidophilus and Lactobacillus rhamnosus, alone or in combination, to support the growth and proliferation of GBS in the presence or absence of Lf, preferably bovine lactoferrin.

[0028] Surprisingly, the present inventors have found that when a strain of Lactobacillus acidophilus, a strain of Lactobacillus rhamnosus and lactoferrin are combined together in a composition, the composition has a synergistic effect against GBS.

[0029] As shown in Figures 1 and 2 and described in Example 7, neither Lactobacillus acidophilus nor Lactobacillus rhamnosus, alone or in combination, inhibit the growth of GBS after 6 hours of incubation. Although slight inhibition was seen in L. acidophilus after 12 hours, lactoferrin alone exerted no significant inhibitory effect at any time point of incubation.

[0030] The results in Figures 1 and 2 were obtained with L. acidophilus strain LMG S-29159 and L. rhamnosus strain SD5675.

[0031] However, those skilled in the art know that similar results can be obtained by using different strains of L. acidophilus and L. rhamnosus, since different bacterial strains may very often have very subtle genetic variations and at the same time have the same activity. Deposit It will also be known to those skilled in the art that the fluoropolymers may have different numbers and / or different commercial names.

[0032] The inventors have surprisingly found that Lactobacillus acidophilus strains derived from the Lactobacillus acidophilus La-14 strain (e.g. L. acidophilus L MGS-29159 and L. acidophilus GLA-14) make it possible to obtain compositions having the effects described in the present invention.

[0033] In particular, Lactobacillus acidophilus strains with surprising activity can be identified by comparing 16s rRNA gene sequences.

[0034] A 500 base pair region from the 16s region of L. acidophilus L MGS-29159, L. acidophilus La-14 and L. acidophilus GLA-14 is set forth in SEQ ID NO:1.

[0035] SEQ ID NO:1 TGGAGAGTTTGATCCTGGCTCAGGACGAACGCTGGCGGCGTGCCTAATACATGCAAGTCGAGCGAGCTGAACCAACAGATTCACTTCGGTGATGACGTTGGGAACGCGAGCGGCGGATGGGTGAGTAACACGTGGGG AACCTGCCCCATAGTCTGGATACCACTTGGAAACAGGTGCTAATACCGGATAAGAAAGCAGATCGCATGATCAGCTTATAAAAGGCGGCGTAAGCTGTCGCTATGGGATGGCCCCGCGGTGCATTAGCTAGTTGGTA GGGTAACGGCCTACCAAGGCAATGATGCATAGCCGAGTTGAGAGACTGATCGGCCACATTGGGACTGAGACACGGCCCAAACTCCTACGGAGGGCAGCAGTAGGGAATCTTCCACAATGGACGAAAGTCTGATGGAG CAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTTGGTGAAGAAGGATAGAGGTAGTAACTGGCCTTTATTTGACGGTAATCAACCAGAAAGTCACGGCTAACTACGTGCCAGCAGCCGCGGTA

[0036] Any combination of Lactobacillus rhamnosus and lactoferrin and L. acidophilus having a 16s rRNA gene sequence with a 16s region having 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to the sequence of SEQ ID NO: 1 makes it possible to obtain a composition for use according to claim 1.

[0037] In a preferred aspect, the present invention provides the use of a composition comprising a strain of Lactobacillus acidophilus, said strain of Lactobacillus acidophilus having a 16s region having at least 95% identity with the sequence of SEQ ID NO:1.

[0038] Nevertheless, when combined with Lf, the inhibitory effect of the lactic acid bacteria strain was stronger, appeared earlier and was significantly enhanced, highlighting the synergistic effect.

[0039] In a preferred embodiment, the present invention provides the use of a composition comprising a strain of Lactobacillus acidophilus, a strain of Lactobacillus rhamnosus and lactoferrin, wherein the strain of Lactobacillus acidophilus and the strain of Lactobacillus rhamnosus are 10 7 ~10 12 CFU / dose, preferably 10 9 are independent of each other in terms of total CFU / dose concentration.

[0040] In a further embodiment, the strain of Lactobacillus acidophilus in the composition of the present invention is Deposit L. acidophilus deposited under number SD5212 (ATCC (American Type Culture Collection)) and Deposit Lactobacillus acidophilus deposited under the number LMG S-29159 (BCCM (Belgian Coordinated Collections of Microorganisms) / LMG, University of Ghent, Belgium) (equivalent to L. acidophilus La-14 and L. acidophilus GLA-14) and other lactic acid bacteria belonging to the same genus, including but not limited to L. acidophilus La-5, L. acidophilus Lafti L-10, L. acidophilus W22 and Lactobacillus acidophilus BIFOLAC 5 strains, and the Lactobacillus rhamnosus strain is selected from the group consisting of: Deposit L. rhamnosus deposited under number SD5675 (ATCC, equivalent to L. rhamnosus HN001) and other lactic acid bacteria belonging to the same genus, including but not limited to L. rhamnosus Lr-32, L. rhamnosus GG, L. rhamnosus GR-1 and L. rhamnosus SP-1 strains.

[0041] In a preferred embodiment, the strain of Lactobacillus acidophilus in the composition of the present invention is DepositLactobacillus acidophilus, deposited under the number LMG S-29159, and Lactobacillus rhamnosus strains Deposit The strain is Lactobacillus rhamnosus, deposited under the number SD5675.

[0042] In a more preferred embodiment, in the composition of the present invention, the Lactobacillus acidophilus strain has a 16s region that has at least 90%, 95%, 96%, 97%, 98% or 99% identity to the sequence of SEQ ID NO:1, and more preferably, the 16s region is SEQ ID NO:1.

[0043] In a further embodiment, in the composition of the present invention, the lactoferrin, preferably bovine lactoferrin, has a total concentration in the range of 5 mg / dose to 300 mg / dose, preferably 50 mg / dose.

[0044] According to another aspect, the present invention provides use of a composition comprising a Lactobacillus acidophilus strain, a Lactobacillus rhamnosus strain and lactoferrin, said composition optionally comprising at least one additional component selected from the group consisting of minerals, vitamins, probiotics, prebiotics, proteins, or any mixture thereof.

[0045] Preferably, the minerals are selected from the group consisting of calcium, phosphorus, copper, magnesium, potassium, iron, selenium, sodium, zinc, manganese, chloride and iodine, the vitamins are selected from the group consisting of vitamin A, vitamin B1 (thiamine), vitamin B2 (riboflavin), vitamin B3 (niacin), vitamin B6, vitamin B8 (biotin), vitamin B12, vitamin C, vitamin D, vitamin E and folic acid, and the probiotics are selected from the group consisting of Lactobacillus bulgaricus, Lactobacillus casei, Lactobacillus bifidus, Lactobacillus reuteri, Lactobacillus crispatus, Lactobacillus gasseri, Lactobacillus The bifidobacteria or lactic acid bacteria is selected from the group consisting of Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus jensenii, Lactobacillus delbrueckii, Lactobacillus fermentum, Lactobacillus iners, and Lactobacillus helveticus, and the protein is selected from whey and casein.

[0046] In a more preferred embodiment, the present invention provides a method for producing a 10 7 ~10 12 Lactobacillus acidophilus in the CFU / dose range, 10 7 ~10 12 The present invention relates to use of a composition comprising Lactobacillus rhamnosus in a range of CFU / dose, lactoferrin in a range of 5 mg / dose to 300 mg / dose, and a pharmaceutically acceptable excipient.

[0047] Such pharmaceutically acceptable excipients may be, but are not limited to, hydroxypropylmethylcellulose, starch, magnesium stearate and silicon dioxide. Other excipients are known to those skilled in the art who can prepare compositions according to the examples.

[0048] In another embodiment, a composition comprising a strain of Lactobacillus acidophilus and a strain of Lactobacillus rhamnosus is 7 ~10 12 CFU / dose, preferably 10 9 It can be used in daily doses ranging from 20:1 to 2:1 CFU / dose, where the ratio between L. acidophilus and L. rhamnosus is in the range of 20:1 to 2:1, preferably 4:1, with the ratio of L. acidophilus always being higher than L. rhamnosus.

[0049] Lactoferrin, preferably bovine lactoferrin, can be used in a daily dose ranging from 5 mg / dose to 300 mg / dose, preferably 50 mg / dose.

[0050] These doses were used in our ongoing multicenter clinical trial in which 410 pregnant women were randomized into two groups according to treatment (verum or placebo). They received one capsule of the formulation daily from 32 to 37 weeks of pregnancy. One capsule contains 5 x 10 9 CFU of a lactic acid bacteria mixture (L. acidophilus and L. rhamnosus) and 50 mg of lactoferrin. In a preferred embodiment, the composition for use according to the invention is for oral administration, and said composition is contained in a solid or liquid form selected from the group consisting of a tablet, a capsule, a powder, a granule, a soluble stick, and a liquid suspension.

[0051] The compositions described herein are useful for preventing and / or treating Group B Streptococcus (GBS) infections that occur during or after pregnancy.

[0052] Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples. [Example]

[0053] Reference is now made to the following examples which, together with the above description, illustrate certain embodiments of the invention.

[0054] Example 1 Preparation of the composition according to the invention (capsules) The composition of the present invention was prepared by weighing the ingredients L. acidophilus, L. rhamnosus, lactoferrin, fatty acid magnesium salt, and silicon dioxide in a controlled humidity environment ranging from 20 to 30%. The ingredients were then sieved, introduced into a blender, and mixed under nitrogen to minimize oxygen exclusion. Under controlled environmental conditions (temperature and humidity), the powder mixture was loaded into the hopper of a capsule machine to produce HPMC capsules. After filling, the capsules were transported to a blistering machine in alu / alu blisters or suitable jars for primary packaging.

[0055] composition Lactoferrin 54.3 mg L. acidophilus + rhamnosus: 5 x 10 9 CFU Hydroxypropyl methylcellulose 80 mg Starch 53.6 mg Fatty acid magnesium salts 5 mg Silicon dioxide 3.7 mg

[0056] Example 2. Preparation of the composition according to the invention (coated tablets 1 g) Lactoferrin 60 mg L. acidophilus 20 x 10 9 L. rhamnosus 5×10 9 Calcium phosphate 300 mg Microcrystalline cellulose 150 mg Fatty acid magnesium salts 10 mg Silicon dioxide 5 mg Coating agent 50 mg Mixtures of hydroxypropyl methylcellulose (200 mg) with methylcellulose (125 mg) of various viscosities

[0057] Example 3. Preparation of the composition according to the invention (2 g sachet) Lactoferrin 100 mg L. acidophilus 10x10 9 L. rhamnosus 2 x 10 9 Maltodextrin 1780 mg Silicon dioxide 20 mg

[0058] Example 4. Preparation of a composition according to the invention (ready-to-use oral stick pack 1.5 g) Lactoferrin 50 mg L. acidophilus 15 x 10 9 L. rhamnosus 5×10 9 1000 mg fructooligosaccharides Sorbitol 335 mg Silicon dioxide 15 mg

[0059] Example 5. Preparation of the composition according to the invention (10 ml of suspension in oil) Lactoferrin 30 mg L. acidophilus 6 x 10 9 L. rhamnosus 3 x 10 9 up to 10ml sunflower oil Fatty acid mono-diglycerides 5 mg Vitamin E 15 mg

[0060] Example 6 Preparation of the composition according to the invention (liquid suspension) Vial 10 ml Plug: Lactoferrin 25 mg; Lactobacillus mixture 15 x 10 9 (L. acidophilus; L. rhamnosus) 75 mg, silicon dioxide 5 mg Vial: Water, fructose, potassium sorbate, sodium benzoate, flavoring, citric acid.

[0061] Example 7 In vitro analysis of the activity of compositions of the present invention: liquid co-culture assay. The ability of L. acidophilus and L. rhamnosus, alone and in combination with lactoferrin, to inhibit the growth of GBS was assessed by liquid co-culture assay.

[0062] Lactic acid bacteria strains ( L. acidophilus LMG S-29159 and L. rhamnosus SD5675) were stored in milk yeast extract (MYE) at −80°C. Prior to the experiment, each strain was transferred from a frozen stock culture into MRS (De Man Rugosa Sharpe) broth incubated at 37°C under non-agitation conditions. Streptococcus agalactiae was cultured in brain heart infusion (BHI) medium. The co-culture test was carried out using different concentrations of probiotic strains (10 7 and 10 8 cfu / mL) alone or at different concentrations (10 6 and 10 7 This was performed by incubating the probiotic in DMSGTS (Defined Medium Simulating Genital Tract Secretions), which is capable of supporting growth of both the probiotic and the pathogen, in combination with 0.1 cfu / mL of the target pathogen. Probiotic strains were tested alone and in combination with lactoferrin at the following final concentrations: 0.1, 1, 5, and 10 mg / mL. Controls were performed by inoculating DMSGTS with bacteria alone.

[0063] To check whether the pathogens were inhibited or killed, 0.05 mL of the co-culture suspension was diluted and plated on specific agar media. After incubation at 37 °C for 6 to 24 hours, bacterial growth was assessed. Growth was not judged as bactericidal activity (100% inhibition). Statistical analysis was performed by Student's t-test for unpaired data. Data are expressed as mean and standard deviation, and a P value of less than 0.05 was considered significant.

[0064] result The results of experiments conducted with L. acidophilus LMG S-29159 and L. rhamnosus SD5675 are shown in Figures 1 and 2 . Lactobacillus bacteria, when tested alone, showed different effects on GBS growth. In particular, L. acidophilus caused slight growth inhibition after 12 hours of incubation with the pathogenic bacteria. On the other hand, L. rhamnosus did not reduce bacterial growth after 6 or 12 hours and showed slight inhibition after 24 hours. Lactoferrin had no significant effect on GBS growth (Figure 2). Surprisingly, when Lf was added to the lactobacillus mixture, the composite showed a more pronounced inhibition, which was already significant after 6 hours of incubation. This effect was independent of the initial number of probiotics (10 7 and 10 8 cfu / ml gave similar results).

[0065] conclusion The results shown in Figures 1 and 2 clearly demonstrate the effectiveness of the composition according to the present invention (a formulation of two lactic acid bacteria, L. acidophilus LMG S-29159 and L. rhamnosus SD5675, in combination with lactoferrin) for preventing and reducing the growth of GBS pathogen bacteria. Neither Lactobacillus acidophilus nor Lactobacillus rhamnosus, alone or in combination, inhibited GBS growth after 6 hours of incubation. Lactoferrin alone exerted no significant inhibitory effect on GBS growth at any incubation time, although slight inhibition of L. acidophilus was observed after 12 hours. Surprisingly, the effect of the combination of lactic acid bacteria was potentiated by lactoferrin, highlighting the synergistic effect.

[0066] Considering that GBS is one of the most common and pathogenic bacteria causing severe conditions in both pregnant women and primarily newborns, the compositions of the present invention may represent a potential alternative approach for the prevention and treatment of GBS infection during pregnancy.

[0067] Example 8 Ongoing clinical trials A multicenter, double-blind, randomized, placebo-controlled clinical trial is underway to evaluate the effectiveness of the compositions of the present invention in preventing GBS infection in pregnant women. The study will only commence after written approval from the local independent ethics committees and after contacting the Italian Ministry of Health. The study will be conducted in accordance with the Declaration of Helsinki (Fortaleza, Brazil, October 2013) and Good Clinical Practice.

[0068] A total of 410 pregnant women (32-37 weeks pregnant) will be enrolled and randomized into two treatment groups (verum or placebo). Recruitment will be carried out at the University of Modena (coordinator), the University of Milan, and the University of Reggio Emilia. All adult (>18 years) pregnant women who are at low risk for childbirth and have a GBS-positive rectovaginal swab; pregnant women who are within 33 weeks of pregnancy and planning a vaginal delivery will be recruited. Exclusion criteria included pregnant women with GBS-positive urine; women with infants who previously developed early sepsis; antibiotic use within the month prior to enrollment; and inability to understand the study and provide informed consent. The primary endpoint was the proportion of pregnant women with GBS colonization (carriers) at antenatal screening (35-37 weeks). Secondary endpoints included the proportion of women treated with antibiotics during delivery; the proportion of women with premature rupture of membranes; Apgar score >8 at 5 minutes; the proportion of neonates receiving antibiotics during the first 48 hours of life; the proportion of neonates with early GBS sepsis, and the safety and tolerability of the investigational drug / placebo.

[0069] Treatment consisted of oral administration of one capsule of the investigational drug (a combination of lactic acid bacteria and lactoferrin) or placebo daily from 32 to 37 weeks of pregnancy. 9 Contains CFU of lactic acid bacteria (L. acidophilus, L. rhamnosus) and 50 mg of lactoferrin.

[0070] During the study, rectal and vaginal swabs will be collected from each woman for GBS analysis, in accordance with current standards of clinical trial practice. A follow-up visit will be conducted after delivery to assess GBS colonization in the newborn.

[0071] In addition, in a subgroup of 20 women per site, additional vaginal swabs will be collected between weeks 35 and 37 to demonstrate vaginal colonization with the two Lactobacillus strains included in the study drug and to assess the vaginal microbiota and cytokine profile by molecular approaches (extraction and isolation of bacterial DNA from swabs; 16S rDNA sequencing; RT-PCR analysis).

[0072] Safety will be assessed by recording adverse events. All data are presented as absolute or relative frequencies. Primary and secondary endpoints will be compared between the two study arms using a two-tailed Z-test.

[0073] From the above description and examples, the advantages achieved by the compositions described and obtained according to the present invention are apparent.

Claims

1. 1. A composition comprising a strain of Lactobacillus acidophilus, a strain of Lactobacillus rhamnosus and lactoferrin for use in the prophylactic and / or therapeutic treatment of group B streptococcus (GBS) infections occurring during or after pregnancy, wherein the Lactobacillus acidophilus strain has a 16s region that has at least 95% identity to the sequence of SEQ ID NO:

1.

2. The Lactobacillus acidophilus strain and the Lactobacillus rhamnosus strain are independently 7 ~10 12 CFU / dose, preferably 10 9 The composition for use according to claim 1, wherein the total concentration is CFU / dose.

3. 3. The composition for use according to claim 1 or 2, wherein the strain of Lactobacillus acidophilus is selected from the group consisting of L. acidophilus La-14 and L. acidophilus GLA-14 deposited under accession number LMG S-29159.

4. 4. The composition for use according to any one of claims 1 to 3, wherein the Lactobacillus rhamnosus strain is selected from the group consisting of L. rhamnosus Lr-32, L. rhamnosus GG, L. rhamnosus GR-1, L. rhamnosus SP-1, and L. rhamnosus deposited under accession number SD5675.

5. 5. The composition for use according to any one of claims 1 to 4, wherein the Lactobacillus acidophilus strain has a 16s region that has 100% identity with the sequence of SEQ ID NO:

1.

6. 6. The composition for use according to any one of claims 1 to 5, wherein the strain of Lactobacillus acidophilus is that deposited under accession number LMG S-29159 and the strain of Lactobacillus rhamnosus is that deposited under accession number SD5675.

7. 7. The composition for use according to any one of claims 1 to 6, wherein the lactoferrin, preferably bovine lactoferrin, is at a total concentration ranging from 5 mg / dose to 300 mg / dose, preferably 50 mg / dose.

8. 8. The composition for use according to any one of claims 1 to 7, further comprising at least one additional ingredient selected from the group consisting of minerals, vitamins, probiotics, prebiotics, proteins or any mixture thereof.

9. The minerals are selected from the group consisting of calcium, phosphorus, copper, magnesium, potassium, iron, selenium, sodium, zinc, chloride, and iodine; the vitamins are selected from the group consisting of vitamin A, vitamin B1 (thiamine), vitamin B2 (riboflavin), vitamin B3 (niacin), vitamin B6, vitamin B8 (biotin), vitamin B12, vitamin C, vitamin D, vitamin E, and folic acid; and the probiotic is selected from the group consisting of Lactobacillus bulgaricus, Lactobacillus casei, Lactobacillus bifidus, Lactobacillus reuteri, Lactobacillus crispatus, Lactobacillus gasseri, Lactobacillus plantarum, or the like.

9. The composition for use according to claim 8, wherein the active ingredient is selected from the group consisting of Lactobacillus plantarum, Lactobacillus jensenii, Lactobacillus delbrueckii, Lactobacillus fermentum, Lactobacillus helveticus, Lactobacillus iners, and the protein is selected from whey and casein.

10. 10 7 ~10 12 Lactobacillus acidophilus in the CFU / dose range, 10 7 ~10 12 10. A composition for use according to any one of claims 1 to 9, comprising Lactobacillus rhamnosus in the range of CFU / dose, lactoferrin in the range of 5 mg / dose to 300 mg / dose, and a pharmaceutically acceptable excipient.

11. Lactobacillus acidophilus and Lactobacillus rhamnosus are independently selected from the group consisting of 10 7 ~10 12 CFU / dose range, preferably 10 9 11. The composition for use according to any one of claims 1 to 10, used in combination with lactoferrin in a daily dose of CFU / dose ranging from 5 mg / dose to 300 mg / dose, preferably 50 mg / dose.

12. The composition for use according to any one of claims 1 to 11, wherein the composition is for oral administration.

13. 13. The composition for use according to any one of claims 1 to 12, wherein the composition is in a solid, liquid or semi-liquid form selected from the group consisting of tablets, capsules, powders, granules, soluble sticks, liquid suspensions.

Images