Cell detection method and kit
The nucleic acid aptamer system amplifies luminescent signals to detect target cells like CTCs efficiently and cost-effectively, addressing the limitations of existing CTC detection methods by reducing time and system complexity.
Patent Information
- Application Number
- JP2021090562
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2020-05-29
- Filing Date
- 2021-05-28
- Publication Date
- 2025-12-25
- Estimated Expiration
- 2041-05-28
AI Technical Summary
Current methods for detecting circulating tumor cells (CTCs) are expensive, time-consuming, and limited by the need for fluorescent staining and complex systems, making them unsuitable for rapid diagnostics during surgeries.
A cell detection method using a nucleic acid aptamer system that amplifies luminescent signals through a nucleic acid circuit, allowing for the detection of target cells without direct staining, by adding tagged nucleic acid aptamers that bind to cell surface substances, releasing trigger nucleic acids, and rotating a nucleic acid circuit to amplify signals.
Enables rapid and cost-effective detection of target cells, such as CTCs, by amplifying luminescent signals, reducing diagnostic time and system complexity, and allowing for versatile detection of multiple targets.
Smart Images

Figure 0007792085000001 
Figure 0007792085000002 
Figure 0007792085000003
Abstract
Description
[Technical Field]
[0001] The present invention relates to a cell detection method for detecting target cells in a biological sample, and a kit for use in the method, and in particular to a cell detection method for detecting target cells in a biological sample that is inexpensive, shortens diagnostic time, and uses a simpler system, and a kit for use in the method. [Background technology]
[0002] Biopsies using tumor markers are a typical method used in clinical practice to diagnose cancer. However, because tumors are not a collection of monoclonal cells but are composed of cells with different profiles, differences in the location from which cells are collected can lead to different results, and this has led to skepticism about the reliability of biopsies as a diagnostic indicator.
[0003] In advanced cancers, tumor cells detach from the primary tumor tissue, travel through the bloodstream or lymphatic system, and migrate to other organs within the body, resulting in cancer metastasis. Tumor cells circulating in the bloodstream are called circulating tumor cells (CTCs). Recently, it has become clear that the number of CTCs per unit blood volume is closely related to cancer prognosis and treatment success, and CTCs have attracted attention as a diagnostic marker for cancer pathology, replacing tumor markers. The number of CTCs present in blood has been shown to be highly correlated with cancer pathology, making them a valuable tool for determining cancer prognosis and treatment success. However, because 1 mL of blood contains only a few to several dozen CTCs compared to 1 billion blood cells, detecting CTCs is extremely difficult.
[0004] Currently, the only prognostic diagnostic system based on CTC counting approved by the U.S. Food and Drug Administration (FDA) is the Cell Search System from Veridex, Inc. Many solid tumors are known to highly express EpCAM (Epithelial Cell Adhesion Molecule) on the cell membrane (approximately 400,000 or more per cell). In this system, magnetic particles are modified with anti-EpCAM antibodies, which capture CTCs onto the magnetic particles. The captured CTCs are stained with anti-cytokeratin antibodies and DAPI, and the number of CTCs is counted using a cell counter (Patent Document 1). While this system can reproducibly detect up to a single CTC in 7.5 mL of peripheral blood, it requires a relatively long diagnostic time, requiring approximately 40 minutes for peripheral blood concentration and 2–3 hours for subsequent measurement. In recent years, there has been a growing need in the medical field to count CTCs during laparotomy after surgery to confirm the success of lesion resection. However, the Cell Search System requires a total of nearly four hours to complete a diagnosis, making it unable to meet this need. Reducing the diagnostic time is an urgent issue. Furthermore, the use of antibodies and the need for an expensive system make the diagnostic cost very high, hindering the widespread use of the system. There is a need to develop a new diagnostic method to replace the Cell Search System.
[0005] In addition to the magnetic particle-based Cell Search System, other techniques for selectively capturing and trapping CTCs have been proposed, including filter separation and capture using differences in cell size between CTCs and other peripheral blood components (CTCs: approximately 30 μm, leukocytes: approximately 8–20 μm, erythrocytes: approximately 8 μm, thickness: approximately 2 μm, platelets: approximately 2–4 μm in diameter); microfluidic separation and capture using differences in dielectrophoretic properties; and capture using biotin-modified nucleic acid aptamers immobilized on avidin-modified plates (for plate readers). However, in all these methods, the isolated and captured CTCs are stained with fluorescently labeled anti-epithelial cell adhesion molecule (anti-EpCAM) or anti-cytokeratin antibodies and then directly observed using a confocal laser microscope, cell counter, or flow cytometer. Therefore, in principle, the signal intensity is limited to the number of targeted CTCs, making it extremely difficult to detect CTCs, which are said to exist in only a few dozen cells per mL of blood. Furthermore, the above-mentioned devices and fluorescently labeled antibodies are very expensive, which increases the cost of diagnosis. [Prior art documents] [Patent documents]
[0006] [Patent Document 1] Patent No. 5701749 [Patent Document 2] Japanese Patent Application Publication No. 2017-079634 Summary of the Invention [Problem to be solved by the invention]
[0007] To address the above problem, the inventors have reported a method for detecting target cells in a biological sample by using a nucleic acid aptamer complex containing a trigger nucleic acid that partially base pairs to form a double strand, releasing the trigger nucleic acid from the nucleic acid aptamer complex and rotating the nucleic acid circuit, thereby enhancing the fluorescent signal (Patent Document 2). However, this method has the following problems.
[0008] As mentioned above, the trigger nucleic acid forms a double strand with a part of the nucleic acid aptamer (inactivating the nucleic acid aptamer). The above method works by competitively binding this inactivated nucleic acid aptamer with a cell surface substance of the target cell, releasing the trigger nucleic acid when the nucleic acid aptamer regains its active structure, thereby rotating the nucleic acid circuit. However, this method has the problem that it requires searching for the optimal binding site and number of bases of the trigger nucleic acid for each target protein so that an inactive nucleic acid aptamer structure can be stably formed while an active aptamer structure is induced as a result of competitive binding.
[0009] The present invention has been made to solve the above-mentioned problems, and aims to provide a cell detection method that is inexpensive, shortens diagnostic time, and detects target cells in a biological sample using a simpler system, as well as a kit for use in said method. [Means for solving the problem]
[0010] As a result of extensive research to solve the above problems, the inventors came up with the idea that, rather than staining cells and observing them directly, it would be possible to easily detect extremely small amounts of target cells by constructing a mechanism that amplifies luminescent molecules in a reaction solution in response to the presence of target cells, and thus discovered the present invention. That is, the present invention includes the following aspects.
[0011] [Aspect 1] A cell detection method for detecting target cells in a biological sample, comprising: adding a tagged nucleic acid aptamer composed of a single-stranded nucleic acid to a solution containing the target cells, and allowing it to specifically bind to a cell surface substance of the target cells; Adding a trigger nucleic acid complex consisting of a trigger nucleic acid containing a partial base sequence of the tag portion in the tagged nucleic acid aptamer and a mask nucleic acid containing a base sequence complementary to the base sequence of the tag portion, and releasing the trigger nucleic acid; In the solution containing the released trigger nucleic acid, nucleic acid A and nucleic acid B, each modified with a signal-emitting molecule and a signal-suppressing molecule, and a template nucleic acid complex in which both modification sites are located in close proximity to suppress the signal in the tandem double strand formed by the template nucleic acid, and a fuel nucleic acid are added, and the nucleic acid circuit is rotated to amplify the signal; Comprising the step of detecting the amplified signal; The template nucleic acid complex is a sequence in which N segments are linked (the first
[0012] , * , , , , * , , sequence to the Nth * base sequence of the sequence), a template nucleic acid that forms a double strand with the template nucleic acid, and the first * sequence to the Pth <000000
[0013] [Aspect 3] In the cell detection method according to Aspect 1 or 2, a cell detection method, characterized in that the binding constant between the trigger nucleic acid and the template nucleic acid is higher than the binding constant between the nucleic acid B and the template nucleic acid.
[0014] [Aspect 4] In the cell detection method according to any one of Aspects 1 to 3, a cell detection method, characterized in that the binding constant between the fuel nucleic acid and the template nucleic acid is higher than the binding constant between the nucleic acid A and the template nucleic acid and the binding constant between the trigger nucleic acid and the template nucleic acid.
[0015] [Aspect 5] A kit for use in the cell detection method according to any one of Aspects 1 to 4, comprising: a tagged nucleic acid aptamer that specifically binds to a cell surface substance of the target cell and consists of a single-stranded nucleic acid, a template nucleic acid complex formed by nucleic acid A and nucleic acid B, each of which is modified with a signal-emitting molecule and a signal-suppressing molecule, and the template nucleic acid, wherein both modification sites are located in close proximity so as to suppress the signal, and the template nucleic acid has a sequence (the first * sequence to the Nth * sequence) in which N types of segments are linked, and the nucleic acid A has a base sequence of the first * sequence to the Pth * sequence complementary to the first sequence to the Pth sequence, and the nucleic acid B has a base sequence of the (P + 1)th * sequence to the Qth * sequence complementary to the (P + 1)th sequence to the Qth sequence (where P, Q, and N are integers satisfying \(1 < P < P + 1 < Q < N\)). a partial base sequence of the tag portion in the tagged nucleic acid aptamer, and the Rth * sequence to the Sth *A trigger nucleic acid complex comprising a trigger nucleic acid containing the base sequences of the Rth to Sth sequences complementary to the array (where R and S are integers satisfying 1 < P + 1 < R ≤ Q < S ≤ N), and a mask nucleic acid containing a base sequence complementary to the base sequence of the tag portion. The first of the template nucleic acids * sequence to the Tth * A kit comprising a fuel nucleic acid containing the base sequences of the first to Tth sequences complementary to the first to Tth sequences of the template nucleic acid (where T is an integer satisfying R ≤ T).
Brief Description of Drawings
[0016] [Figure 1] It is a schematic diagram showing one aspect of the cell detection method according to the present invention, where (a) shows the release of the trigger nucleic acid in response to cancer cells, and (b) shows the rotation and signal amplification of the nucleic acid circuit accompanying the released trigger nucleic acid. [Figure 2] 1 shows fluorescent observation photographs of target cells and normal cells in Example 1. [Figure 11] FIG. 1 is a schematic diagram showing a cell detection experiment using a nucleic acid circuit in Example 2. [Figure 12] 10 is a graph showing the change in luminescence intensity accompanying the rotation of the nucleic acid circuit in Example 2. [Figure 13] 10 is a graph showing the change in luminescence intensity depending on the amount of fuel nucleic acid added in Example 3. [Figure 14] FIG. 10 is a schematic diagram showing the general configuration of a microfilter used in Example 4. [Figure 15] FIG. 10 is an exploded perspective view of the microfilter device used in Example 4. [Figure 16] FIG. 1 is a schematic diagram of a cell trapping device used in Example 4 to trap cancer cells. [Figure 17] 10 is a fluorescent observation photograph of cancer cells captured in a microfilter device using the cell capture device in Example 4. [Figure 18] 10 is a graph showing the change in luminescence intensity accompanying the rotation of the nucleic acid circuit in Example 4. [Figure 19] 10 is a photograph showing the state of light emission within a cell accompanying rotation of a nucleic acid circuit in Example 4. [Figure 20] 10 is a graph showing the change in luminescence intensity depending on the amount of trigger nucleic acid added in Example 5. DETAILED DESCRIPTION OF THE INVENTION
[0017] First Embodiment [Cell detection method] The cell detection method of the present invention comprises the following steps. (Step 1) A step of adding a tagged nucleic acid aptamer composed of a single-stranded nucleic acid to a solution containing target cells, and allowing it to specifically bind to a cell surface substance of the target cells. Adding a trigger nucleic acid complex composed of a trigger nucleic acid containing a partial base sequence of a tag portion in a tagged nucleic acid aptamer and a mask nucleic acid containing a base sequence complementary to the base sequence of the tag portion, and releasing the trigger nucleic acid (Step 3) In a solution containing the released trigger nucleic acid, nucleic acid A and nucleic acid B, each modified with a signal-emitting molecule and a signal-suppressing molecule, respectively, and a template nucleic acid complex in which both modification sites are located in close proximity so as to suppress the signal in the tandem double-strand formed by the template nucleic acid, and a fuel nucleic acid are added, and the nucleic acid circuit is rotated to amplify the signal (Step 4) Detecting the amplified signal
[0018] Here, the template nucleic acid complex is a sequence in which N segments are linked (the first * sequence to the Nth * base sequence of the sequence), a template nucleic acid, forms a double-strand with the template nucleic acid, and the first * sequence to the Pth * nucleic acid A containing the base sequences of the first to Pth sequences complementary to the sequence, and the (P + 1) * sequence to the Qth * nucleic acid B containing the base sequences of the (P + 1)th to Qth sequences complementary to the sequence (where P, Q, and N are integers satisfying 1 < P < P + 1 < Q < N).
[0019] The trigger nucleic acid contains the base sequences of the Rth * sequence to the Sth * sequence complementary to the sequence (where R and S are integers satisfying 1 < P + 1 < R ≤ Q < S ≤ N).
[0020] The fuel nucleic acid contains the base sequences of the first * sequence to the Tth * sequence complementary to the sequence (where T is an integer satisfying R ≤ T).
[0021] Hereinafter, each step will be described using FIG. 1.
[0022] (Step 1) In step 1, a tagged nucleic acid aptamer consisting of a single-stranded nucleic acid is added to a solution containing target cells in a biological sample, and the nucleic acid aptamer is allowed to specifically bind to a cell surface substance on the target cells.
[0023] The target cells may be suspended in a solution or entrapped on a carrier, as described below.
[0024] The solvent for suspending the target cells is not particularly limited, but examples thereof include phosphate buffered saline (PBS), and specifically, D-PBS(-) (Dulbecco's PBS(-)) can be used.
[0025] The type of biological sample is not particularly limited as long as it has the potential to contain the target cells of interest. For example, biological samples include body fluids and cell isolation solutions. Examples of body fluids include blood (whole blood or plasma), lymph, tissue fluid (interstitial fluid, intercellular fluid, interstitial fluid), body cavity fluid (synovial fluid, cerebrospinal fluid, serous cavity fluid, aqueous humor, etc.), digestive fluid (saliva, gastric juice, bile, pancreatic juice, intestinal juice, etc.), sweat, tears, etc., and blood (whole blood or plasma) is preferred. A cell isolation solution refers to a liquid obtained by isolating and dispersing biological tissue using a known method. The biological tissue is not particularly limited, and any biological tissue, such as stomach, intestine, skin, lung, breast, prostate, testis, ovary, uterus, or bone marrow, can be used as appropriate. Reagents for isolating and dispersing biological tissue include, for example, reagents containing enzymes such as trypsin, papain, elastase, hyaluronidase, collagenase, or mixtures thereof, and can be used appropriately depending on the type of biological tissue and cell. For example, the Cell Isolation Optimizing System (manufactured by Funakoshi Co., Ltd.) contains a set of multiple enzymes, such as trypsin and collagenase.
[0026] The biological sample is not particularly limited, but may be derived from mammals such as humans, monkeys, dogs, cats, mice, rats, and guinea pigs.
[0027] Target cells include, but are not limited to, tumor cells, other common cultured cells, pluripotent cells, etc., preferably tumor cells. The types of tumors include, but are not limited to, malignant brain tumors, gastric cancer, lung cancer, breast cancer, pharyngeal cancer, esophageal cancer, colon cancer, liver cancer, uterine cancer, testicular cancer, ovarian cancer, bladder cancer, prostate cancer, basal cell carcinoma, malignant lymphoma, leukemia, glioma, etc. Tumor cells include primary tumor cells, metastatic tumor cells, and circulating tumor cells, preferably circulating tumor cells (CTCs).
[0028] The cell detection method of the present invention amplifies the signal to detect target cells of interest, making it possible to detect target cells even at low concentrations in a biological sample.
[0029] (Process 2) In step 2, a trigger nucleic acid complex consisting of a trigger nucleic acid containing a partial base sequence of the tag portion of the tagged nucleic acid aptamer and a mask nucleic acid containing a base sequence complementary to the base sequence of the tag portion is added to a solution in which the tagged nucleic acid aptamer has specifically bound to a cell surface substance of the target cell, and the trigger nucleic acid is released.
[0030] The mask nucleic acid of the trigger nucleic acid complex forms a more stable complex with the tag structure of the tagged nucleic acid aptamer bound to the cell surface material of the target cell in the biological sample than with the trigger nucleic acid. Therefore, when the trigger nucleic acid complex comes close to the tag portion of the nucleic acid aptamer bound to the cell surface material of the target cell in the biological sample, a complementary bond is formed between the mask nucleic acid of the trigger nucleic acid complex and the tag sequence, resulting in the release of the trigger nucleic acid from the trigger nucleic acid complex.
[0031] In the cell detection method of the present invention, the aptamer site and the trigger release site are independent of each other. The release of the trigger nucleic acid occurs on the tag attached to the nucleic acid aptamer, and this sequence can be freely changed. In other words, this system can be said to replace target protein information with tag sequence information, converting it into an arbitrary so-called "biobarcode," and amplifying that information via the respective trigger nucleic acid. This system is highly versatile and is not limited to cases where the target protein is EpCAM. Barcoding and signal amplification are based on the complementary base pairing ability of nucleic acids, and as long as the sequences do not interfere with each other, it is possible to simultaneously and independently amplify signals from multiple target cells.
[0032] (Step 3) In step 3, nucleic acid A and nucleic acid B, each modified with a signal-emitting molecule and a signal-suppressing molecule, as well as a template nucleic acid complex in which both modification sites are positioned in close proximity to each other in a tandem duplex formed by the template nucleic acid so as to suppress the signal, and a fuel nucleic acid are added to a solution containing the released trigger nucleic acid, and the nucleic acid circuit is rotated to amplify the signal.
[0033] First, two nucleic acid probes are prepared: one modified with a signal-emitting molecule and the other modified with a signal-suppressing molecule. These probes are then allowed to form a double-stranded complex (template nucleic acid complex) with their complementary strands, with their modified sites in close proximity. The released trigger nucleic acid then initiates a strand exchange reaction via the toehold site in the template nucleic acid complex. As a result, the probe modified with the signal-suppressing molecule is released from the template nucleic acid complex, eliminating the proximity between the two, and restoring the signal from the signal-emitting molecule. If a fuel nucleic acid (fuel nucleic acid) is added to this, a strand exchange reaction triggered by the toehold site occurs again, and not only the signal molecule-modified probe but also the trigger nucleic acid is released into the solution again, and the trigger nucleic acid becomes free and floats in the solution. The trigger nucleic acid suspended in the solution reacts with a new template nucleic acid complex, releasing the signal suppressor molecule-modified probe from the template nucleic acid complex. This releases the probe from the signal-emitting molecule, restoring the signal from the signal-emitting molecule and completing a full cycle of the nucleic acid circuit.
[0034] In other words, the trigger nucleic acid is reusable, and if the template nucleic acid complex and fuel nucleic acid are added in excess, even if the number of target cells is small and only a small amount of trigger nucleic acid is released, the trigger nucleic acid will react with new template nucleic acid complexes multiple times to release signal molecules, thereby increasing the number of free signal molecules and resulting in a strong signal response. This series of reactions can occur isothermally.
[0035] (Step 4) In step 4, the amplified signal is detected as described above. The amplified signal can be detected visually or with a spectrophotometer. Alternatively, electrochemical detection is possible by combining an electrochemically active molecule with its silencer. Furthermore, by chemically modifying a probe double-stranded complex modified with colloidal particles or nanoparticles onto a sensor chip and creating a mechanism for release in response to a trigger, this method can be applied to various analytical methods, such as SPR (spectrophotometric reflection) and QCM (quantum chromatograph).
[0036] Furthermore, when detecting a signal, it may be determined that a target cell has been detected in the biological sample if the signal intensity exceeds a predetermined threshold, thereby reducing variations in detection accuracy for each biological sample and target cell.
[0037] [Various nucleic acid materials] Next, the template nucleic acid complex, trigger nucleic acid complex, fuel nucleic acid, and tagged nucleic acid aptamer used in the cell detection method of the present invention will be described. In the present invention, the type of "nucleic acid" is not particularly limited, and may be any of DNA, RNA, or a DNA-RNA complex, with DNA being preferred.
[0038] The template nucleic acid complex includes a template nucleic acid having a sequence in which N segments are linked (the base sequence of the first * sequence to the Nth * sequence), a nucleic acid A that forms a double strand with the template nucleic acid and includes the base sequences of the first * sequence to the Pth * sequence complementary to the first sequence to the Pth sequence, and a nucleic acid B that includes the base sequences of the (P + 1)th * sequence to the Qth * sequence complementary to the (P + 1)th sequence to the Qth sequence (where P, Q, and N are integers satisfying 1 < P < P + 1 < Q < N). [[ID=Of the template nucleic acid, nucleic acid A, and nucleic acid B that constitute the template nucleic acid complex, two nucleic acids are modified with a signal-emitting molecule and a signal-suppressing molecule, respectively, and both modification sites are located in close proximity so as to suppress the signal.
[0042] In the example shown in Figure 1, a signal-emitting molecule is modified at the 3' end of nucleic acid A, and a signal-suppressing molecule is modified at the 5' end of nucleic acid B, which is adjacent to A, to suppress luminescence from the signal-emitting molecule. That is, the trigger nucleic acid forms a complex with the template nucleic acid, and nucleic acid B, modified with the signal-suppressing molecule, is released, thereby restoring the signal from the signal-emitting molecule modified by nucleic acid A.
[0043] The signal-emitting molecule and the signal-suppressing molecule may be modified such that the 5'-end of nucleic acid B is modified with the signal-emitting molecule and the 3'-end of nucleic acid A is modified with the signal-suppressing molecule, as shown in Figure 2(a); or such that the 5'-end of nucleic acid A is modified with the signal-emitting molecule and the 3'-end of the template nucleic acid is modified with the signal-suppressing molecule, as shown in Figure 2(b); or such that the 3'-end of the template nucleic acid is modified with the signal-emitting molecule and the 5'-end of nucleic acid A is modified with the signal-suppressing molecule, as shown in Figure 2(c). In the example shown in Figure 2(a), the trigger nucleic acid forms a complex with the template nucleic acid, and nucleic acid B, which has been modified with a signal-emitting molecule, is released, thereby restoring the signal from the signal-emitting molecule. In the example shown in Figure 2(b), the fuel nucleic acid forms a complex with the template nucleic acid, and nucleic acid A, which has been modified with a signal-emitting molecule, is released, thereby restoring the signal from the signal-emitting molecule modified by the template nucleic acid. In the example shown in Figure 2(c), the fuel nucleic acid forms a complex with the template nucleic acid, and nucleic acid A, which has been modified with a signal-inhibiting molecule, is released, thereby restoring the signal from the signal-emitting molecule modified by the template nucleic acid. In either case, as described above, nucleic acid B is released by the strand exchange reaction caused by the trigger nucleic acid, and the trigger nucleic acid and nucleic acid A are released by the strand exchange reaction caused by the fuel nucleic acid, causing the nucleic acid circuit to rotate and a signal from the signal molecule-modified probe to be observed.
[0044] Any molecule can be used as the signal-emitting molecule, as long as it emits a luminescent signal that can be detected with the naked eye or a spectrophotometer, or the like, can be included in cyclodextrin and emits an electrochemical signal, or can be included in cyclodextrin and is capable of electrochemiluminescence. Examples of luminescent molecules include 5-carboxyfluorescein (5-FAM), 6-carboxyfluorescein (6-FAM), 5-carboxytetramethylrhodamine (5-TAMRA), 6-carboxytetramethylrhodamine (6-TAMRA), 5-(dimethylamino)naphthalene-1-sulfonic acid (DANSYL), 5-carboxy-2',4,4',5',7,7'-hexachlorofluorescein (5-HEX), 6-carboxy-2',4,4',5',7,7'-hexachlorofluorescein (6-HEX), 5-carboxy-2',4,7,7'-tetrafluoroethylene (5-FAM), 5-carboxytetramethylrhodamine (5-TAMRA), 5-(dimethylamino)naphthalene-1-sulfonic acid (DANSYL), 5-carboxy-2',4,4',5',7,7'-tetrafluoroethylene (5-HEX), 6-carboxy-2',4,4',5',7,7'-tetrafluoroethylene (5-HEX), 5-carboxy-2',4 ... Chlorofluorescein (5-TET), 6-carboxy-2',4,7,7'-tetrachlorofluorescein (6-TET), 5-carboxy-X-rhodamine (5-ROX), 6-carboxy-X-rhodamine (6-ROX), indocarbocyanine (Cy3), indocarbocyanine (Cy3.5), indocarbocyanine (Cy5), indocarbocyanine (Cy5.5), 4,4-difluoro-4-bora-3a,4a-diaza-s-indacene (BODIPY), 6-carboxy-4',5'-dichloro-2',7'-dimethoxyfluorescein (JOE), Texas Examples of fluorescent dyes include Red, Texas Red-X, Oregon Green 514 (Molecular Probes), Bodipy R6G-X (Molecular Probes), Rhodamine Red-X (Molecular Probes), Bodipy TR-X (Molecular Probes), LightCycler 640 (Roche), and Boidipy 630 / 650-X (Molecular Probes), and any known fluorescent dye can be used. Examples of molecules that emit electrochemical signals include ferrocene, methylene blue, and donomycin, and any known electrochemically active molecule can be used. The electrochemiluminescent molecule may be, for example, a ruthenium trisphenanthroline complex, and any known electrochemiluminescent molecule may be used.
[0045] Any molecule that can suppress a signal from a signal-emitting molecule by being present in the vicinity of the signal-emitting molecule can be used as the signal-inhibiting molecule. Examples of quenching molecules include 4-(4-dimethylaminophenylazo)benzoic acid (DABCYL), N-methyl-N-[4-[2-methoxy-5-methyl-4-(2-nitro-4-methylphenylazo)phenylazo]phenyl]-4-aminobutyric acid (BHQ1), N-methyl-N-[4-[2,5-dimethoxy-4-(4-nitrophenylazo)phenylazo]phenyl]-4-aminobutyric acid (BHQ2), 4-(2-chloro-4-nitrophenylazo)aniline (Eclipse quencher), and BHQ3, and any known quenching dye can be used. In the presence of these quenching dyes, the fluorescence emission of the fluorescent dye is suppressed by energy transfer to the quenching dye, and the fluorescence of the fluorescent dye becomes undetectable. Specifically, DABCYL quenches the fluorescence emission of fluorescent dyes such as FAM, TET, JOE (6-carboxy-4',5'-dichloro-2',7'-dimethoxyfluorescein), HEX, Cy3 (Amersham Biosciences), TAMRA, Cy3.5 (Amersham Biosciences), ROX, and Texas Red. BHQ1 quenches the fluorescence emission of fluorescent dyes such as FAM, Oregon Green 514, TET, Bodipy R6G-X, JOE, HEX, Cy3, Rhodamine Red-X, and TAMRA. BHQ2, BHQ3, and Eclipse quencher quench the fluorescence emission of fluorescent dyes such as HEX, Cy3, Rhodamine Red-X, TAMRA, Cy3.5, ROX, Texas Red-X, Bodipy TR-X, LightCycler 640, and Boidipy. They quench the fluorescence emission of fluorescent dyes such as 630 / 650-X and Cy5 (Amersham Biosciences). Additionally, clathrate compounds such as cyclodextrins can be used as quenching molecules for electrochemical and electrochemiluminescent signals.
[0046] (Trigger Nucleic Acid Complex) The trigger nucleic acid complex is composed of a trigger nucleic acid consisting of a partial base sequence of the tag portion of the tagged nucleic acid aptamer, and a mask nucleic acid containing a base sequence complementary to the base sequence of the tag portion.
[0047] The template nucleic acid is a sequence in which four types of segments are linked (the first * Array ~ 4th * sequence), the trigger nucleic acid is * Array + 4th * It has a base sequence of a third sequence and a fourth sequence that are complementary to the sequence. On the other hand, the mask nucleic acid is a third sequence complementary to the third sequence of the trigger nucleic acid plus a fourth sequence. * Array + 4th *The tagged nucleic acid aptamer has a base sequence (a base sequence complementary to the base sequence of the tag portion in the tagged nucleic acid aptamer) and has a base sequence longer than that of the trigger nucleic acid. * Array + 4th * The base sequence portion other than the sequence) can be freely designed in the same manner as the base sequence of the tag portion in the tagged nucleic acid aptamer described below. In this case, the binding constant between the template nucleic acid and a trigger nucleic acid having the base sequence of the third sequence plus the fourth sequence is designed to be higher than the binding constant between nucleic acid B and the template nucleic acid. For example, it is preferable to design the trigger nucleic acid and the template nucleic acid so that the number of hydrogen bonds formed between the trigger nucleic acid and the template nucleic acid is greater than the number of hydrogen bonds formed between nucleic acid B and the template nucleic acid.
[0048] In the present invention, a high binding constant means high thermal stability. Thermal stability can be evaluated using the temperature (melting temperature Tm) at which a double-stranded complex becomes a single-stranded nucleic acid under the same measurement conditions. The melting temperature Tm is calculated from the inflection point in the temperature-absorbance plot obtained by measuring absorbance at a wavelength of 260 nm while changing the temperature conditions.
[0049] (fuel nucleic acid) The template nucleic acid is a sequence in which four types of segments are linked (the first * Array ~ 4th * sequence), the fuel nucleic acid is * Array ~ 3rd * It has the base sequences of the first to third sequences that are complementary to the sequence. In this case, the binding constant between the template nucleic acid and a fuel nucleic acid having a base sequence of the first sequence, the second sequence, and the third sequence is designed to be higher than the binding constant between nucleic acid A and the template nucleic acid and the binding constant between the trigger nucleic acid and the template nucleic acid. For example, the number of hydrogen bonds formed between the fuel nucleic acid and the template nucleic acid is preferably designed to be higher than the number of hydrogen bonds formed between nucleic acid A and the template nucleic acid and the number of hydrogen bonds formed between the trigger nucleic acid and the template nucleic acid.
[0050] (tagged nucleic acid aptamer) An "aptamer" is a nucleic acid or peptide that specifically binds to a particular molecule. It is usually selected from a huge library of random sequences, but it also exists in nature and is known as a riboswitch. It has been widely studied, from basic research to applications such as drug discovery. Aptamers complexed with ribozymes also exist, and are known to self-cleave in the presence of a target molecule. They can be broadly divided into two types: nucleic acid (DNA, RNA) aptamers and peptide aptamers.
[0051] Nucleic acid aptamers are derived through evolutionary engineering, a process known as in vitro selection or SELEX. They specifically bind to a variety of targets, including small organic molecules, proteins, nucleic acids, cells, tissues, and microorganisms. Nucleic acid aptamers are being explored as biomolecular materials capable of molecular recognition, potentially replacing antibodies, for biotechnology and pharmaceutical applications. Nucleic acid aptamers can be synthesized chemically and quickly using automated nucleic acid synthesizers, and they have the advantage over antibodies of being virtually non-immunogenic. While there is no essential difference between RNA and DNA as nucleic acid aptamers, DNA is chemically more stable. Both DNA and RNA aptamers exhibit high affinity and specificity for a variety of molecules. Nucleic acid aptamers can be chemically synthesized, which can significantly reduce costs.
[0052] The nucleic acid aptamer can be appropriately selected depending on the type of target cell, and is capable of specifically binding to a cell surface substance of the target cell. The nucleic acid aptamer is not particularly limited, but is a nucleic acid aptamer for a membrane protein such as a cell adhesion molecule.
[0053] For example, when the target cells are circulating tumor cells (CTCs), nucleic acid aptamers for epithelial cell adhesion molecule (EpCAM), a cell surface substance of CTCs, can be used. See, for example, Analytical Chemistry, 2013, 85, pp. 4141-4149. This document describes five types of nucleic acid aptamers: SYL1, SYL2, SYL3, SYL4, and SYL3C. Among these, the SYL3C sequence, a partial sequence of SYL3, is highly specific for EpCAM and is therefore desirable.
[0054] EpCAM aptamer (SYL3C): 5'-CACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGGGTTGGCCTG-3' (SEQ ID NO: 8)
[0055] Other nucleic acid aptamers with the following sequences can also be used to detect CTCs: (Unless otherwise specified, base sequences are written from 5' to 3'.)
[0056] EpCAM aptamer (EP166): AACAGAGGGACAAACGGGGGAAGATTTGACGTCGACGACA (SEQ ID NO: 9) (Mol. Cells, 37, 742-746 (2014)) EpCAM aptamer (EpDT3): GCGACUGGUUACCCGGUCG (SEQ ID NO: 10) (Cancer Sci., 102, 991-998 (2011)) MUC1 aptamer (MUC1 S1.3): GCAGTTGATCCTTTGGATACCCTGG (SEQ ID NO: 11) (Tumor Biol., 27, 289-301 (2006)) EGFR aptamer: GGGCGUCCGACCUUAGUCUCUGUGCCGCUAUAAUGCACGGAUUUAAUCGCCGUAGAAAAGCAUGUCAAAGCCGGAACCGUGUAGCACAGCAGAGAAUUAAAUGCCCGCCAUGACCAG (SEQ ID NO: 12) (Cancer Res.,70,9371-9380(2010)) EGFR aptamer (TuTu22): TACCAGTGCGATGCTCAGTGCCGTTTCTTCTCTTTCGCTTTTTTTGCTTTTGAGCATGCTGACGCATTCGGTTGAC (SEQ ID NO: 13) (Biochem.Biophys.Res.Commun.,453,681-685(2014)) EGFRvIII aptamer (U2): ATCCAGAGTGACGCAGCATTTTGACGCTTTATCCTTTTCTTATGGCGGGATAGTTTCGTGGACACGGTGGCTTAGT (SEQ ID NO: 14) (PLOS ONE, 9, e90752 (2014)) HER2 aptamer (2-2): GCACGGTGTGGGG (SEQ ID NO: 15) (Proc. Natl. Acad. Sci. USA, 110, 8170-8175 (2013)) HER2 aptamer (S6): TGGATGGGGAGATCCGTTGAGTAAGCGGGCGTGTCTCTCTGCCGCCTTGCTATGGGG (SEQ ID NO: 16) (Bull. Korean Chem. Soc., 30, 1827-1831 (2009)) HER2 aptamer (Mini): AGCCGCGAGGGGAGGGAUAGGGUAGGGCGCGGCU (SEQ ID NO: 17) (Nucleic Acid Ther., 21, 173-178 (2011)) HER2 aptamer (HSB5): AACCGCCCAAATCCCTAAGAGTCTGCACTTGTCATTTTGTATATGTATTTGGTTTTTGGCTCTCACAGACACACTACACACGCACA (SEQ ID NO: 18) (J. Transl. Med., 10, 148-158 (2012)) ABCG2 aptamer (ABCG2 / A12): ACGCTCGGATGCCACTACAGGCCCACCCTCATGGACGTGCTGGTGAC (SEQ ID NO: 19) (J. Cancer Sci. Ther., 4, 214-222 (2012)) CD71 aptamer (c2.min): GGGGGAUCAAUCCAAGGGACCCGGAAACGCUCCCUUACACCCC (SEQ ID NO: 20) (Mol. Ther. Nucleic Acids, 1, e21 (2012)) CD44 aptamer (Apt1): GGGAUGGAUCCAAGCUUACUGGCAUCUGGAUUUGCGCGUGCCAGAAUAAAGAGUAUAACGUGUGAAUGGGAAGCUUCGAUAGGAAUUCGG (SEQ ID NO: 21) (Nucleic Acid Ther., 23, 401-407 (2013)) CD133 aptamer (CD133-A15): CCCUCCUACAUAGGG (SEQ ID NO: 22) (Cancer Lett., 330, 84-95 (2013)) Immunoglobulin μ heavy chain aptamer (TD05): ACCGGGAGGATAGTTCGGTGGCTGTTCAGGGTCTCCTCCCGGTG (SEQ ID NO: 23) (Mol. Cell. Proteomics, 2230-2230 (2007)) Nucleolin aptamer (AS1411): GGTGGTGGTGGTTGTGGTGGTGGTGG (SEQ ID NO: 24) (Mol. Cancer Ther., 5, 1790-1799 (2006)) Pigpen aptamer (III.1): ATACCAGCTTATTCAATTAGGCGGTGCATTGTGGTGGTAGTATACATGAGGTTTGGTTGAGACTAGTCGCAAGATATAGATAGTAAGTGCAATCT (SEQ ID NO: 25) (J. Biol. Chem., 276, 16464-16468 (2001)) Tenascin C aptamer (GBI-10): GGCTGTTGTGAGCCTCCTCCCAGAGGGAAGACTTTAGGTTCGGTTCACGTCCCGCTTATTCTTACTCCC (SEQ ID NO: 26) (Proc. Natl. Acad. Sci. USA, 100, 15416-15421 (2003)) PTK7 aptamer (sgc8): ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA (SEQ ID NO: 27) (J. Proteome Res., 7, 2133-2139 (2008)) Toledo cell aptamer (Sgd5): ATACCAGCTTATTCAATTATCGTGGGTCACAGCAGCGGTTGTGAGGAAGAAAGGCGGATAACAGATAATAAGATAGTAAGTGCAATCT (SEQ ID NO: 28) (Clin. Chem., 53, 1153-1158 (2007)) MEAR cell aptamer (TLS11a): ACAGCATCCCCATGTGAACAATCGCATTGTGATTGTTACGGTTTCCGCCTCATGGACGTGCTG (SEQ ID NO: 29) (Anal. Chem., 80, 721-728 (2008))
[0057] For the detection of tumor cells other than CTCs, such as acute myeloid leukemia, the nucleic acid aptamers described below can be used.
[0058] Siglec-5 aptamer (K19): AAGGGGTTGGGTGGGTTTATACAAATTAATTAATATTGTATGGTATATTT (SEQ ID NO: 30) (J. Hematol. Oncol., 7, 5 (2014)) HL60 cell aptamer (KH1C12): ATCCAGAGTGACGCAGCATGCCCTAGTTACTACTACTCTTTTTAGCAAACGCCCTCGCTTTGGACACGGTGGCTTAGT (SEQ ID NO: 31) (Leukemia, 23, 235-244 (2009)) Vimentin aptamer (NAS-24): CTCCTCTGACTGTAACCACGCCTGGGACAGCCACACAGAAGTGTAGACCTCGCGGAATCGGCATAGGTAGTCCAGAAGCC (SEQ ID NO: 32) (Nucleic Acid Ther., 24, 160-170 (2014))
[0059] For detecting target cells other than tumor cells, such as bacteria, the nucleic acid aptamers described below can be used.
[0060] In1A aptamer (A8): ATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT (SEQ ID NO: 33) (J. Appl. Microbiol., 109, 808-817 (2010))
[0061] The tagged nucleic acid aptamer according to the present invention has a tag portion linked to a conventional nucleic acid aptamer via a spacer portion. The base sequences of the spacer portion and tag portion can be freely designed, but include the base sequence of the trigger nucleic acid in the trigger nucleic acid complex, and also include a base sequence complementary to the base sequence of the mask nucleic acid. The length of the base sequence of the tag portion of the tagged nucleic acid aptamer is designed to be longer than the base sequence of the trigger nucleic acid, and the trigger nucleic acid is released from the trigger nucleic acid complex by stable binding between the tag portion and the mask nucleic acid.
[0062] [kit] The kit for use in the cell detection method of the present invention for detecting target cells in a biological sample includes a tagged nucleic acid aptamer that specifically binds to a cell surface substance of the target cell and is composed of a single-stranded nucleic acid, nucleic acid A and nucleic acid B modified with a signal-emitting molecule and a signal-suppressing molecule, respectively, and a template nucleic acid, which form a tandem double strand, in which both modification sites are located in close proximity to each other so as to suppress signals, and the template nucleic acid has a sequence in which N types of segments are linked (first * Array ~ Nth * the nucleic acid A contains the base sequence of the first* Array ~ the Pth * It contains the base sequences of the first to Pth arrays complementary to the array, and the nucleic acid B is the (P + 1)th * Array ~ the Qth * A template nucleic acid complex containing the base sequences of the (P + 1)th to Qth arrays complementary to the array (where P, Q, and N are integers satisfying 1 < P < P + 1 < Q < N), and a part of the base sequence of the tag portion in the tagged nucleic acid aptamer, and the Rth * Array ~ the Sth * A trigger nucleic acid containing the base sequences of the Rth to Sth arrays complementary to the array (where R and S are integers satisfying 1 < P + 1 < R ≤ Q < S ≤ N), and a trigger nucleic acid complex composed of a mask nucleic acid containing a base sequence complementary to the base sequence of the tag portion, and the first * Array ~ the Tth * A fuel nucleic acid containing the base sequences of the first to Tth arrays complementary to the array (where T is an integer satisfying R ≤ T).
[0063] The kit of the present invention may be configured to accommodate the above various materials in different containers respectively. For example, it may be configured as container A for accommodating the tagged nucleic acid aptamer, container B for accommodating the trigger nucleic acid complex, container C for accommodating the template nucleic acid complex, and container D for accommodating the fuel nucleic acid.
[0064] Regarding the tagged nucleic acid aptamer, template nucleic acid complex, trigger nucleic acid complex, and fuel nucleic acid contained in the kit, they are as described above.
[0065] The kit of the present invention may further include a carrier for capturing the target cells described later.
[0066] [Carrier] In the cell detection method of the present invention, the target cells in the solution may be captured by the carrier
[0067] The mode for capturing target cells on a carrier is not particularly limited. Nucleic acid aptamers, antibodies, etc. specific to the target cells can be used. Preferably, the target cells are captured on the carrier by a nucleic acid aptamer or antibody that specifically binds to a cell surface substance of the target cells.
[0068] The cell detection method of the present invention may further comprise the step of capturing target cells derived from a biological sample on a carrier.
[0069] The type of carrier for capturing target cells is not particularly limited. Examples of the carrier include: (i) a support layer comprising an element selected from Group 10 elements, Group 11 elements, and combinations thereof of the Periodic Table of Elements; (ii) a self-assembled monolayer provided on the support layer; (iii) a nucleic acid aptamer or antibody that is provided directly on the support layer or via the self-assembled monolayer and specifically binds to a cell surface substance of a target cell; are available.
[0070] In one aspect of the present invention, one end group of the self-assembled monolayer is bound to an element constituting the support layer, and at least a portion of the end group on the side not bound to the support layer is bound to a nucleic acid aptamer or an antibody.
[0071] The support layer may be a metal substrate containing an element selected from Group 10 elements, Group 11 elements, and combinations thereof in the periodic table, or a support substrate such as metal, glass, plastic, or paper, on at least one surface of which the element is formed using a known method such as plating, vapor deposition, or sputtering. Alternatively, the support substrate may be plated with a nickel-based alloy (e.g., nickel-cobalt, nickel-phosphorus, etc.), a chromium-based alloy, or a tin-based alloy, and then a film of an element selected from Group 10 elements, Group 11 elements, and combinations thereof is formed by electroforming to form the support layer. In either film-forming method, the support substrate is not particularly limited, and it is sufficient that at least the surface of the support layer contains an element selected from Group 10 elements, Group 11 elements, and combinations thereof. It is particularly preferred that the support layer contain an element selected from the group consisting of gold, platinum, silver, palladium, copper, and combinations thereof.
[0072] The nucleic acid aptamer for capturing target cells on a carrier is not particularly limited, and may be the same as or different from the nucleic acid aptamer that constitutes the tagged nucleic acid aptamer.
[0073] The antibody used to capture cells onto the carrier is not particularly limited. When the target cells are CTCs, an antibody against epithelial cell adhesion molecule (EpCAM) is preferred. For example, a rabbit anti-human EpCAM monoclonal IgG antibody available from Abcam (catalog number ab32392) is an example. Even when the target cells are not CTCs, they can be specifically captured via proteins expressed on the target cell surface. For example, Abcam (catalog number ab97426) can be used to capture leukocytes from acute myeloid leukemia.
[0074] Examples of carriers that can be used in the cell detection method of the present invention are shown in FIGS.
[0075] Fig. 3 shows an embodiment in which an aptamer or antibody 33 is provided on a support layer 31 while being chemically bound to a self-assembled monolayer 32. Fig. 4 shows an embodiment in which an aptamer or antibody 33 is directly chemically bound to the support layer 31. In the embodiment shown in the figure, the aptamer or antibody 33 and / or the self-assembled monolayer 32 are bound to the elements constituting the support layer 31 by thiol bonds.
[0076] The self-assembled monolayer 32 contains a thiol group at one end and a carboxyl group, hydroxyl group, amino group, or N-hydroxysuccinimide group at the other end. It can be formed from a polyethylene glycol film or a hydroxyalkanethiol film whose ends are modified with these functional groups. Suitable examples of hydroxyalkanethiols include, but are not limited to, hydroxy-EG6-undecanethiol, hydroxy-EG3-undecanethiol, 6-mercapto-1-hexanol (HHT), sulfobetaine 3-undecanethiol (SB3UT, zwitterionic type), and hydroxy-EG3-hexadecanethiol (H-EG3HDT).
[0077] In an embodiment in which an aptamer or antibody 33 is bound to the self-assembled monolayer 32, the terminal carboxyl or hydroxyl group of the self-assembled monolayer 32 may be modified with a functional group to activate it, and then the functional group may be substituted with the aptamer or antibody 33. Although not limited thereto, the functional group modifying the terminal group of the self-assembled monolayer 32 is preferably an N-hydroxysuccinimide group or a maleimide group.
[0078] When the end of the self-assembled monolayer 32 is an N-hydroxysuccinimide group, it can be reacted with the amino group of an aminated aptamer or antibody 33 to bind to the self-assembled monolayer 32. When the end of the self-assembled monolayer 32 is an amino group, for example, a chemically synthesized N-hydroxysuccinimide-modified aptamer or an antibody with an N-hydroxysuccinimide-modified carboxyl terminus can be bound to the self-assembled monolayer 32.
[0079] When the end of the self-assembled monolayer 32 is an amino group, the amino group may be further maleimidized to form a maleimide group as the functional group modifying the end of the self-assembled monolayer 32. Specifically, without particular limitation, a bifunctional reagent having an N-hydroxysuccinimide group at one end and a maleimide group at the other end, such as N-(6-maleimidocaproyloxy)succinimide (EMCS) (available, for example, from Dojindo Laboratories, Inc.), is reacted with the self-assembled monolayer 32 having an amino group at its end, resulting in a maleimide group as the functional group modifying the end of the self-assembled monolayer 32. In this case, a chemically synthesized thiolated aptamer or an antibody having a thiol group (an antibody having a cysteine residue) can be bound to the self-assembled monolayer 32.
[0080] Functional groups that are not substituted by the aptamer or antibody 33 may remain. Functional groups to which the aptamer does not bind, such as N-hydroxysuccinimide groups, decompose in water, leaving hydroxyl or carboxyl groups at the ends of the self-assembled monolayer 32. When the end groups of the self-assembled monolayer 32 are modified with maleimide groups, the maleimide groups to which the aptamer does not bind remain as end groups of the self-assembled monolayer 32. The remaining maleimide groups must be capped with a capping agent having an SH group at one end and a methoxy group (-OCH), a carbamoyl group (-CONH), a methylcarbamoyl group (-CONHCH), and a hydroxy group (-OH) at the other end.
[0081] If the terminal groups of the self-assembled monolayer 32 to which the aptamer or antibody 33 is not bound are N-hydroxysuccinimide groups, it is more preferable that all or part of them are capped with a capping agent having an NH2 group at one end and a group selected from a methoxy group (-OCH3), a carbamoyl group (-CONH2), a methylcarbamoyl group (-CONHCH3), and a hydroxy group (-OH) at the other end.
[0082] If the terminal groups of the self-assembled monolayer 32 to which the aptamer or antibody 33 is not bound are amino groups, it is more preferable that all or a portion of them are capped with a capping agent having an N-hydroxysuccinimide group at one end and a group selected from a methoxy group (-OCH3), a carbamoyl group (-CONH2), a methylcarbamoyl group (-CONHCH3), and a hydroxy group (-OH) at the other end.
[0083] As described above, by capping the terminal groups to which the aptamer or antibody 33 is not bound, non-specific binding to cells other than the target cells can be suppressed, and only the target cells can be captured more reliably.
[0084] [One aspect of the present invention] One embodiment of the cell detection method of the present invention will be described below, but the present invention is not particularly limited thereto.
[0085] (i) To suppress nonspecific cell adsorption, a polyethylene glycol derivative SAM film is first formed on the substrate, and then the EpCAM aptamer is modified on it. (ii) A sample solution containing tumor cells is dropped onto the modified substrate, and the targeted tumor cells are selectively captured. (iii) After washing, a solution of tagged EpCAM aptamer prepared in PBS is dropped onto the substrate. After further washing with PBS, a solution of a partially double-stranded complex of trigger nucleic acid and mask nucleic acid prepared in PBS is dropped onto the substrate. Upon binding of the tag portion of the tagged EpCAM aptamer on the cells captured on the substrate to the mask nucleic acid, the trigger nucleic acid is released. (iv) The released trigger nucleic acid triggers the signal amplification reaction. Because analytical techniques such as fluorescent and electrochemical labeling, SPR, and QCM can be used, kinetic analysis can be performed by real-time monitoring.
[0086] The detailed considerations for each step are as follows:
[0087] (i) Preparation of aptamer-modified carriers on a substrate An aptamer-modified carrier can be used, in which gold is plated on a copper substrate as a support layer, a hydroxyalkanethiol film is formed as a self-assembled monolayer, and a terminally aminated aptamer is bound as a nucleic acid aptamer.
[0088] After introducing functional groups to the ends of the self-assembled monolayer, if necessary, the functional groups may be capped by adding a terminally aminated aptamer and a capping agent (including a methoxy group (-OCH3), a carbamoyl group (-CONH2), a methylcarbamoyl group (-CONHCH3), or a hydroxy group (-OH)).
[0089] (ii) Evaluation of tumor cell capture efficiency on the substrate A sample solution containing tumor cells is dropped onto a modified substrate (carrier), and the targeted tumor cells are selectively captured. The nuclei of the cells used are stained with DAPI and the cell membrane with DiD, and the cells are confirmed under a fluorescence microscope. As shown in Figure 5, an attempt to detect tumor cells was made, and the selective capture of tumor cells was successful. Capture of the target cells, MDA-MB-453 (human breast cancer cells) and KATOIII (human gastric cancer-derived cells), was confirmed, but not of the normal cells, HEK-293T (human fetal kidney-derived cells). As a comparative example, tumor cell detection was attempted when MDA-MB-453 (human breast cancer cells) were dropped onto a carrier that was not aptamer-modified, but no cell capture was confirmed. From the above, specific capture of the target cancer cells was confirmed.
[0090] (iii) Evaluation of the release efficiency of trigger nucleic acids in response to tumor cells OligoAnalyzer predicts that the EpCAM aptamer forms a structure with three hairpin loops, as shown in Figure 6. The tagged EpCAM aptamer is linked to the tag via a spacer from the end. The release of the trigger nucleic acid on cells was confirmed by the binding of the tagged EpCAM aptamer tag to the mask nucleic acid. Specifically, the tagged EpCAM aptamer was first bound to cells whose nuclei were stained with Hoechst 33342. After washing, a double-stranded complex (trigger nucleic acid complex) consisting of the FAM-modified mask nucleic acid and the trigger nucleic acid was added. The release efficiency of the trigger nucleic acid was evaluated by observing the FAM-stained cells. The binding rate of the mask nucleic acid to the target cells is calculated by (number of cells stained with FAM / number of cells stained with Hoechst33342)×100.
[0091] (iv) Evaluation of signal amplification efficiency by trigger nucleic acid The released single strand serves as a trigger to rotate the nucleic acid circuit and amplify the signal. In the condition testing stage, the trigger nucleic acid is not actually released by tumor cells, but is instead used in an amount (amol to fmol (pM to nM) order) that is expected to be released from several to several tens of cells (volume is approximately 100 μL).
[0092] Two nucleic acid probes modified with a fluorescent dye and a quencher dye were prepared. A tandem double-stranded complex (template nucleic acid complex) was formed with the complementary strands of the probes, with the modification sites adjacent to each other (fluorescence off). The tagged EpCAM aptamer was released in response to tumor cells, and the trigger nucleic acid triggered a strand exchange reaction via the toehold site at the end of the template nucleic acid complex. As a result, the quencher dye-modified probe was released from the template nucleic acid complex, and the fluorescent probe emitted light. Adding a nucleic acid (fuel nucleic acid) to fuel the circuit again triggers an entropy-driven strand exchange reaction triggered by the toehold site, releasing both the fluorescent probe and the trigger nucleic acid back into the solution, making the trigger nucleic acid reusable. Adding an excess of the template nucleic acid complex and fuel nucleic acid enabled a strong signal response from even a small amount of trigger nucleic acid (i.e., a small amount of EpCAM or a small amount of CTC).
[0093] (v) Experiments on tumor cell capture and detection in blood matrices Based on the optimal conditions obtained from experiments in serum medium, tumor cell capture experiments are performed in a blood (whole blood) matrix. Tumor cells are mixed with blood to achieve a tumor cell concentration equivalent to that of an actual patient's blood (several tumor cells per 10 mL), and this is used for the capture experiment. If necessary, the blood cell component is separated from the plasma component by centrifugation, and the blood cell component is used. Tumor cells are actually captured using the optimized conditions. After washing, the tagged EpCAM aptamer is incubated in the solvent for a certain period of time, and then a trigger nucleic acid complex, probe double-stranded complex (template nucleic acid complex), and fuel nucleic acid are added in a minimal volume to perform signal amplification, releasing the trigger nucleic acid and amplifying the signal.
[0094] One aspect of the present invention involves a method for generating a nucleic acid circuit that responds to tumor cells and amplifies a signal. Below, an outline of one aspect of the method for amplifying a detection signal from tumor cells captured on a carrier is described.
[0095] The cell suspension is contacted with an EpCAM aptamer-modified carrier, the cells are captured, and then washed. Next, a tagged EpCAM aptamer solution is separately prepared and contacted with the carrier for a certain period of time. After washing the cells, the cells are contacted with a trigger nucleic acid complex consisting of a trigger nucleic acid and a mask nucleic acid for a certain period of time, and the supernatant is collected. Upon reaction with the tag of the tagged EpCAM aptamer bound to EpCAM on the target cell membrane captured on the carrier, the trigger nucleic acid complex dissociates, the mask nucleic acid binds to the tag, and the trigger nucleic acid is released as a single strand into the recovery solution. Next, a template nucleic acid complex is prepared in which two nucleic acid probes modified with a fluorescent dye and a quencher dye form a tandem double-stranded complex with their complementary strands so that their modification sites are close to each other (fluorescence off), and this probe solution is mixed with the above-mentioned recovered solution.
[0096] The released trigger nucleic acid initiates a strand exchange reaction at the toehold site at the end of the template nucleic acid complex. As a result, the quencher dye-modified probe is released from the template nucleic acid complex, and the fluorescent probe emits light. Furthermore, by adding a fuel nucleic acid solution to rotate the circuit, the fuel nucleic acid initiates an entropy-driven strand exchange reaction, liberating not only the fluorescent probe but also the trigger nucleic acid (regeneration of the trigger nucleic acid). In other words, the trigger nucleic acid is ready to initiate the next circuit with a new template nucleic acid complex. Therefore, if excess template nucleic acid complex and fuel nucleic acid are added, this cycle can be repeated multiple times, enabling a strong signal response from a small amount of trigger nucleic acid (i.e., a small amount of target cells). This reaction allows for isothermal, enzyme-free signal amplification without the need for thermal cycling, as in PCR.
[0097] Furthermore, target cancer cells can be captured from the blood (whole blood) matrix by using carriers such as filter-like structures with holes (approximately 20 μm) larger in diameter than normal cells such as red blood cells (approximately 7 μm) and white blood cells (approximately 15 μm), structures with multiple micropillars on a flat surface, and spiral-shaped three-dimensional structures. Other examples include the target cell capture devices described in JP 2017-083265 and JP 2017-083266, and the target cell capture filter described in PCT / JP2020 / 019715. If necessary, the blood cell components are separated from the plasma components by centrifugation, and the blood cell components are used. After capture, the carrier is washed with PBS and contacted with a tagged EpCAM aptamer for a certain period of time. Then, a trigger nucleic acid complex consisting of a trigger nucleic acid and a mask nucleic acid and a fuel nucleic acid are mixed and incubated for a certain period of time. The luminescence of this mixed solution allows for easy detection of minute amounts of cancer cells in the blood.
[0098] The cell detection method of the present invention makes it possible to obtain a large number of signals from minute amounts of CTCs. Furthermore, because the signal generation and amplification reactions occur not on the cell but in a solution containing the trigger nucleic acid released from the trigger nucleic acid complex, direct observation of each cell is not necessary as in conventional methods. For example, when two nucleic acid probes modified with a fluorescent dye and a quencher dye are used, the solution containing CTCs emits light in response to the CTCs, which is expected to be easily detected visually or with a general-purpose spectrometer. Furthermore, since the series of reactions proceeds spontaneously and isothermally in response to the CTCs, the experimenter simply mixes these reagents with the cells. Alternatively, electrochemical detection is also possible using a combination of electrochemically active molecules and their silencers. Furthermore, by chemically modifying a probe double-stranded complex modified with colloidal particles, nanoparticles, etc. onto a sensor chip and allowing it to detach in response to a trigger, this highly versatile method can be applied to various analytical methods such as SPR and QCM.
[0099] As described above, the cell detection method of the present invention allows for rapid detection of target cells such as CTCs at low cost and with simple operations. Therefore, it is expected that this method will contribute not only to patient prognosis assessments in hospitals, but also to diagnosis for patient detection in settings such as regular health checkups at workplaces and schools. Furthermore, because it can capture and detect target cells more quickly than existing systems, it can also be used to test the success of lesion removal during surgical procedures for cancer patients. Early cancer detection offers significant benefits in addressing the issue of rising medical costs due to the advancement of a super-aging society. This comprehensive system is timely in meeting social needs and has great potential for the future.
[0100] <Second embodiment> A cell detection method according to the second embodiment will be described below, with the overlapping descriptions with the first embodiment being omitted.
[0101] This embodiment differs from the first embodiment in that the nucleic acid circuit is rotated in multiple stages to amplify the signal.
[0102] First, two types of template nucleic acid complexes are prepared as materials for the multi-step nucleic acid circuit. For example, the first template nucleic acid complex may have a sequence in which six types of segments are linked (1b * Array ~ 1d * Array + 2nd * Array ~ 4th * a first template nucleic acid having a sequence * Array ~ 1d * a first nucleic acid A having sequences 1a to 1d containing base sequences 1b to 1d complementary to the sequence; * Array + 3rd * It is a complex in which a first nucleic acid B having a base sequence of a second sequence complementary to the first sequence and a third sequence forms a double strand. The second template nucleic acid complex has a sequence in which five types of segments are linked (the sixth * Array + 5th * Array + 1a * Sequence ~ 1c * a second template nucleic acid having a sequence * a second nucleic acid A having a base sequence of a sixth sequence complementary to the fifth sequence; * Array + 1a * Array + 1b * It is a complex in which a second nucleic acid B having a base sequence of a fifth sequence complementary to the sequence, sequence 1a, and sequence 1b forms a double strand. In each template nucleic acid complex, the signal-emitting molecule is modified at the 3' end of nucleic acid A, and the signal-suppressing molecule is modified at the 5' end of nucleic acid B.
[0103] In addition, the first template nucleic acid complex 1b * Array ~ 1d * Array + 2nd * Array ~ 3rd * a first fuel nucleic acid having a base sequence of 1b sequence to 1d sequence plus a base sequence of 2nd sequence to 3rd sequence, a sixth base sequence in a second template nucleic acid complex; * Array + 5th * Array + 1a * Array + 1b *A second fuel nucleic acid is prepared, which has a base sequence of the sixth sequence complementary to the sequence, the fifth sequence, the 1a sequence, and the 1b sequence.
[0104] Next, the mechanism of the multi-stage nucleic acid circuit will be explained. Note that the process up to the release of the trigger nucleic acid and the signal molecule-modified probe into the solution is the same as in the first embodiment, so the explanation of that process will be omitted and the explanation will start from the second stage of the nucleic acid circuit.
[0105] As shown in Figure 7, in the second-stage nucleic acid circuit, the signal molecule-modified probe (first nucleic acid A) released into the solution in the first-stage nucleic acid circuit is used as a trigger to rotate this nucleic acid circuit. Specifically, the signal-inducing molecule-modified probe (first nucleic acid A) released from the first template nucleic acid complex triggers a strand exchange reaction at the toehold site in the second template nucleic acid complex, resulting in the release of the signal-suppressing molecule-modified probe (second nucleic acid B) from the second template nucleic acid complex, which eliminates the proximity between the two, restoring the signal from the signal-inducing molecule. If a fuel nucleic acid (second fuel nucleic acid) is added to this, a strand exchange reaction triggered by the toehold site occurs again, and not only the signal molecule modified probe (second nucleic acid A) but also the signal molecule modified probe (first nucleic acid A) derived from the first template nucleic acid complex that acted as the trigger is released into the solution again and floats in the solution. The signal-emitting molecule-modified probe (first nucleic acid A) derived from the first template nucleic acid complex suspended in the solution reacts with a new second template nucleic acid complex, releasing the signal-suppressing molecule-modified probe (second nucleic acid B) from the second template nucleic acid complex. This releases the probe from the signal-emitting molecule (second nucleic acid A) from its proximity, restoring the signal from the signal-emitting molecule and completing the second nucleic acid circuit. Thus, the multi-step nucleic acid circuit can increase the signal intensity in a shorter time than the single-step nucleic acid circuit, thereby further shortening the diagnostic time.
[0106] The multi-step nucleic acid circuit may also be configured to undergo a process as shown in FIG. In the multi-step (autocatalytic) nucleic acid circuit shown in Figure 8, one type of template nucleic acid complex and one type of fuel nucleic acid are prepared. In this process, the signal-emitting molecule-modified probe (nucleic acid A) derived from the template nucleic acid complex in the first step and the signal-emitting molecule-modified probe derived from the template nucleic acid complex in the second step are the same. In the second step, the fuel nucleic acid acts as a trigger, and two nucleic acids A are suspended in solution at once. This results in an exponential increase in signal intensity, enabling the shortest possible diagnostic time.
[0107] For example, the template nucleic acid complex may have a sequence in which seven types of segments are linked (sequence 1b * Array + 2a * Array + 2nd b * Array + 3rd * Array + 1a * Array + 1b * Array + 2a * a template nucleic acid having a sequence of 1b * Array + 2a * Array + 2nd b * a nucleic acid A having a sequence 1a+sequence 1b+sequence 2a+sequence 2b, which contains a base sequence of a sequence 1b+sequence 2a+sequence 2b complementary to the sequence; * Array + 1a * Array + 1b * It is a complex in which a double strand is formed by nucleic acid A and nucleic acid B having the base sequence of sequence 3 complementary to sequence A + sequence 1a + sequence 1b. The signal-emitting molecule is modified at the 3' end of nucleic acid A, and the signal-suppressing molecule is modified at the 5' end of nucleic acid B.
[0108] In addition, the fuel nucleic acid is * Array + 2a * Array + 2nd b * Array + 3rd * Array + 1a * Array + 1b * Sequence 1b complementary to * Array + 2a * Array + 2nd b * Array + 3rd * Array + 1a* Array + 1b * It has the base sequence of the sequence.
[0109] In this multi-step circuit, the base sequence of the trigger nucleic acid is adjusted to be the same as that of nucleic acid A (sequence 1a+sequence 1b+sequence 2a+sequence 2b).
[0110] Next, the mechanism of the multi-stage nucleic acid circuit will be explained. Note that the process up to the release of the trigger nucleic acid and the signal molecule-modified probe into the solution is the same as in the first embodiment, so the explanation of that process will be omitted and the explanation will start from the second stage of the nucleic acid circuit.
[0111] As shown in Figure 8, in the second stage of the nucleic acid circuit, the signal molecule-modified probe (nucleic acid A) released into the solution is used as a trigger to rotate this nucleic acid circuit. Specifically, the signal-initiating molecule-modified probe (nucleic acid A) released as a trigger from the template nucleic acid complex in the first step triggers a strand exchange reaction via a toehold site in the template nucleic acid complex in the second step. As a result, the signal-inhibiting molecule-modified probe (nucleic acid B) in the template nucleic acid complex in the second step is released from the template nucleic acid complex, and the proximity between the two is eliminated, resulting in the recovery of a signal from the new signal-initiating molecule-modified probe. Here, the signal-initiating molecule-modified probe (nucleic acid A) derived from the template nucleic acid complex in the first step and the signal-initiating molecule-modified probe (nucleic acid A) derived from the template nucleic acid complex in the second step are the same. If a fuel nucleic acid (fuel nucleic acid) is added to this, a strand exchange reaction triggered by the toehold site occurs again, and not only the signal molecule-modified probe (nucleic acid B) of the template nucleic acid complex in the second step, but also the signal molecule-modified probe (nucleic acid B) of the template nucleic acid complex in the first step that acted as the trigger is released into the solution again and floats in the solution. Two signal-emitting molecule-modified probes (nucleic acid A) suspended in the solution react with two new template nucleic acid complexes, releasing the signal-suppressing molecule-modified probe from the template nucleic acid complex. This releases the probe from its proximity to the signal-emitting molecule probe, restoring the signal from the signal-emitting molecule and completing a full cycle of the nucleic acid circuit. Thus, compared with the single-step nucleic acid circuit and the multi-step nucleic acid circuit described above, this multi-step nucleic acid circuit can further shorten the diagnostic time due to the exponential increase in signal intensity, and also reduces the manufacturing cost due to the reduced number of required materials. [Example]
[0112] The present invention will be described in detail below based on examples, but the present invention is not limited to these examples. The base sequences of the tagged EpCAM aptamer, trigger nucleic acid, mask nucleic acid, template nucleic acid, 5-FAM modified nucleic acid, BHQ1 modified nucleic acid, and fuel nucleic acid used in this example are shown below.
[0113] Tagged EpCAM aptamer: 5'-CACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGGGTTGGCCTGTTTTTTTTTTGTCGATTCCATTCAATACCCTACGTCTCCA-3' (SEQ ID NO: 1) Trigger nucleic acid: 5'-CATTCAATACCCTACGTCTCCA-3' (SEQ ID NO: 2) Mask nucleic acid: 5'-TGGAGACGTAGGGTATTGAATGGAATCGAC-3' (SEQ ID NO: 3) Template nucleic acid: 5'-TGGAGACGTAGGGTATTGAATGAGGGCCGTAAGTTAGTTGGAGACGTAGG-3' (SEQ ID NO: 4) 5-FAM modified nucleic acid: 5'-CCTACGTCTCCAACTAACTTACGG-(5-FAM)-3' (SEQ ID NO: 5) 5-FAM modified nucleic acid II: 5'-CATTCAATACCCTACGTCTCCAACTAACTTACGG-(5-FAM)-3' (SEQ ID NO: 34) BHQ1 modified nucleic acid: 5'-(BHQ1)-CCCTCATTCAATACCCTACG-3' (SEQ ID NO: 6) Fuel nucleic acid: 5'-CCTACGTCTCCAACTAACTTACGGCCCTCATTCAATACCCTACG-3' (SEQ ID NO: 7)
[0114] In the tagged EpCAM aptamer, 5'-CACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGGGTTGGCCTG(-3') is the base sequence of the EpCAM aptamer, (5'-)TTTTTTTTTT(-3') is the base sequence of the spacer portion, and (5'-)GTCGATTCCATTCAATACCCTACGTCTCCA-3' is the base sequence of the tag portion.
[0115] [Example 1] The binding of the tagged EpCAM aptamer to target cells and the release of the trigger nucleic acid were confirmed by the following procedure: The release of the trigger nucleic acid was confirmed by a mask nucleic acid bound to the tag portion of the tagged EpCAM aptamer.
[0116] First, MDA-MB-453 cells and HEK-293T cells, whose nuclei were stained with Hoechst 33342, were detached using Cell Dissociation Solution (Sigma-Aldrich). 5 mL of serum-free medium was added, and the cells were centrifuged (1000 rpm, 1 minute) to remove the supernatant. 5 mL of serum-free medium was then added, centrifuged (1000 rpm, 1 minute), and the supernatant was removed (twice). Next, 1 mL of a solution containing 5.0 mM MgCl2 and 4.5 mg / mL glucose in D-PBS(-) (hereafter referred to as BB (Binding Buffer)) was added, centrifuged, and the BB was removed (three times). Another 1 mL of BB was added, and the cell count was adjusted to 1.0 x 106 cells / mL.
[0117] Then, 1 μM Cy5 (λ em = 667 nm) modified tagged EpCAM aptamer solution (prepared in BB, 1 μM thymine 20-mer, T 20 100 μL of the cell suspension was added to 100 μL of the culture medium containing T 20 was added as a sacrificial nucleic acid that nonspecifically adsorbs to the tube. The cells were then washed twice with 50 μL of BB. A portion of the cells was collected and observed under a fluorescence microscope.
[0118] 1 μM Cy5-unmodified tagged EpCAM aptamer solution (prepared in BB, 1 μM thymine 20-mer, T 20 The tagged EpCAM aptamer was bound to 5-FAM (λ 2000) prepared in BB in 50 μL of the washed cell suspension. em = 520 nm) modified mask nucleic acid and trigger nucleic acid. 20 After incubation in an ice bath for 30 minutes, the cells were washed with BB and observed under a fluorescence microscope.
[0119] The binding rates of the tagged EpCAM aptamer and masked nucleic acid to target cells were calculated based on the following formula.
[0120] Binding rate of tagged EpCAM aptamer = (Number of cells stained with Cy5 / Number of cells stained with Hoechst33342) x 100 Mask nucleic acid binding rate = (number of cells stained with FAM / number of cells stained with Hoechst33342) x 100
[0121] The results are shown in Figures 9 and 10. Figure 10(a) is an image of HEK-293T cells observed under Hoechst33342 fluorescence, Figure 10(b) is an image of HEK-293T cells observed under Cy5 fluorescence, Figure 10(c) is an image of HEK-293T cells observed under FAM fluorescence, Figure 10(d) is an image obtained by merging the fluorescence observation photographs in Figures 10(a) to 10(c), Figure 10(e) is an image of MDA-MB-453 cells observed under Hoechst33342 fluorescence, Figure 10(f) is an image of MDA-MB-453 cells observed under Cy5 fluorescence, Figure 10(g) is an image of MDA-MB-453 cells observed under FAM fluorescence, and Figure 10(h) is an image obtained by merging the fluorescence observation photographs in Figures 10(e) to 10(g).
[0122] As shown in Figure 9, the tagged EpCAM aptamer bound sufficiently to over 70% of MDA-MB-453 cells, whereas it bound only about 20% of HEK-293T cells. Furthermore, when the trigger nucleic acid complex was added, approximately 65% of the mask nucleic acid was found to bind to MDA-MB-453 cells, whereas only approximately 15% of the mask nucleic acid was found to bind to HEK-293T cells. In addition, when we also tested the case where only the trigger nucleic acid complex was added without adding the tagged EpCAM aptamer, only about 10% of the mask nucleic acid bound to both types of cells. As shown in Figure 10, the cells to which the tagged EpCAM aptamer was bound were completely identical to the cells to which the mask nucleic acid was bound, suggesting that the mask nucleic acid specifically bound to the tag portion.
[0123] As described above, it is clear that the tagged EpCAM aptamer specifically binds to MDA-MB-453 cells, and that the mask nucleic acid is stably bound to the tag portion of this tagged EpCAM aptamer, which indicates that the trigger nucleic acid has been released from the trigger nucleic acid complex.
[0124] [Example 2] Next, we attempted to detect cancer cells using nucleic acid circuits. As shown in Figure 1, two types of nucleic acid probes (5-FAM-modified nucleic acid and BHQ1-modified nucleic acid, respectively) modified with a fluorescent dye (5-FAM) and a quencher (BHQ1) were prepared, and the modified sites were placed close to each other (fluorescence off) to form a template nucleic acid complex. The trigger nucleic acid released in response to cancer cells binds to the protruding portion at the end of the template nucleic acid complex (the fourth portion in Figure 1). * The strand exchange reaction is triggered by the BHQ1-modified nucleic acid (the second nucleic acid in Figure 1). As a result, the BHQ1-modified nucleic acid is released from the double-stranded complex, and the 5-FAM-modified nucleic acid emits light. When a nucleic acid (fuel nucleic acid) is added to the double-stranded complex, the newly appeared protruding site (the second nucleic acid in Figure 1) emits light. * The strand exchange reaction triggered by the 5-FAM-modified nucleic acid sequence occurs, releasing not only the 5-FAM-modified nucleic acid but also the trigger nucleic acid into the solution, making the trigger nucleic acid reusable.
[0125] First, MDA-MB-453 cells with nuclei stained with Hoechst 33342 were detached using Cell Dissociation Solution (Sigma-Aldrich). Then, 5 mL of serum-free medium was added, and the cells were centrifuged (1000 rpm, 1 minute) to remove the supernatant. 5 mL of serum-free medium was then added, centrifuged (1000 rpm, 1 minute), and the supernatant was removed (twice). Next, 1 mL of a solution containing 5.0 mM MgCl2 and 4.5 mg / mL glucose in D-PBS(-) (BB) was added, and the cells were centrifuged and the BB was removed (three times). After adding 1 mL of BB again, the cell count was adjusted to 1.0 x 10 6 The concentration was adjusted to cells / mL.
[0126] Next, as shown in Figure 11, a 1 μM tagged EpCAM aptamer solution (prepared in BB, 1 μM thymine 20-mer, T 20 100 μL of the cell suspension was added to 100 μL of the plate containing BB solution and incubated in an ice bath for 30 minutes. The cells were then washed twice with 50 μL of BB.
[0127] A 1 μM trigger nucleic acid complex solution (1 μM T 20 After adding 50 μL of BB (containing 1 μM T 20 The mixture was centrifuged for 30 seconds in a tabletop centrifuge, and 50 μL of the supernatant was collected (the tube used to collect the supernatant was the one containing 1 μM T 20 (The collected solution was then heated at 95°C for 5 minutes and the solution was removed and used.) The collected solution was then heated at 95°C for 5 minutes and allowed to cool to room temperature (25°C).
[0128] Separately, annealing was performed in 10 mM Tris-HCl buffer (containing 1 mM EDTA and 12.25 mM MgCl), and then a template nucleic acid complex (200 nM) solution (containing 1 μM T) consisting of 5-FAM-modified nucleic acid I, BHQ1-modified nucleic acid, and template nucleic acid was maintained at 25 °C. 20 To 100 μL of the 10 mM Tris-HCl buffer (containing 1 mM EDTA and 12.25 mM MgCl 2 ) was added 830 μL of 10 mM Tris-HCl buffer (containing 1 mM EDTA and 12.25 mM MgCl 2 ).
[0129] A 10 μM fuel nucleic acid solution (1 μM T) prepared in 10 mM Tris-HCl buffer (containing 1 mM EDTA and 12.25 mM MgCl) was added thereto. 20 The supernatant (50 μL) collected above was added to the mixture, and fluorescence measurement was carried out at 25° C. using a Spectrofluorometer FP-8500 (JASCO).
[0130] The same procedure was also carried out using HEK-293T cells.
[0131] The results obtained are shown in FIG. As shown in Figure 12, the luminescence intensity of the solution containing MDA-MB-453 cell supernatant increased rapidly after addition. On the other hand, a slight signal was observed in the HEK-293T cells, likely due to the trigger nucleic acid released by the nonspecifically bound tagged EpCAM aptamer, as seen in Figure 10. However, a clear difference of approximately 3.5-fold or more was observed in the luminescence intensity, and this difference was easily visible.
[0132] [Example 3] Next, we verified that the nucleic acid circuit was rotating normally. As described above, the trigger nucleic acid released in response to cancer cells is designed to trigger a strand exchange reaction using the protruding portion at the end of the template nucleic acid complex, resulting in the release of the BHQ1-modified nucleic acid from the template nucleic acid complex and the 5-FAM-modified nucleic acid emitting light. In this case, the possible reasons for the increase in luminescence intensity are (i) a change in luminescence intensity due to the BHQ1-modified nucleic acid released over time depending on the amount of trigger nucleic acid in the solution, and (ii) a change in luminescence intensity caused by the rotation of the nucleic acid circuit due to the reuse of the trigger nucleic acid. To verify this, the amount (concentration) of fuel nucleic acid added was changed and the change in luminescence intensity over time was confirmed.
[0133] First, annealing was performed in 10 mM Tris-HCl buffer (containing 1 mM EDTA and 12.25 mM MgCl), and then a template nucleic acid complex (200 nM) solution (containing 1 μM T) consisting of 5-FAM-modified nucleic acid I, BHQ1-modified nucleic acid, and template nucleic acid was maintained at 25°C. 20 To 100 μL of the 10 mM Tris-HCl buffer (containing 1 mM EDTA and 12.25 mM MgCl 2 ) was added 830 μL of 10 mM Tris-HCl buffer (containing 1 mM EDTA and 12.25 mM MgCl 2 ).
[0134] A 40 nM trigger nucleic acid solution (1 μM T 2050 μL of a 10 μM fuel nucleic acid solution (1 μM T) prepared in 10 mM Tris-HCl buffer (containing 1 mM EDTA and 12.25 mM MgCl) 20 Fluorescence measurement (excitation wavelength 490 nm, fluorescence wavelength 520 nm) was carried out at 25°C using a Spectrofluorometer FP-8500 (JASCO).
[0135] After adding the template nucleic acid complex, trigger nucleic acid, and fuel nucleic acid, the final concentrations in the solution were 20 nM (template nucleic acid complex), 2 nM (trigger nucleic acid solution), and 200 nM (fuel nucleic acid), respectively.
[0136] Similarly, fluorescence measurements were also performed when the final concentration of the fuel nucleic acid was changed from 200 nM to 100 nM, 20 nM, and 10 nM, when no fuel nucleic acid was added (prepared so that the final concentrations of the template nucleic acid complex and trigger nucleic acid were 20 nM and 2 nM, respectively), and when no trigger nucleic acid was added (prepared so that the final concentrations of the template nucleic acid complex and fuel nucleic acid were 20 nM and 200 nM, respectively).
[0137] The results obtained are shown in FIG. If the luminescence intensity changes depending on the amount of trigger nucleic acid in the solution, the intensity should saturate at the same value regardless of the amount of fuel nucleic acid, but as shown in Figure 13, a change in luminescence intensity depending on the amount of fuel nucleic acid was confirmed. This indicates that the fuel nucleic acid causes the trigger nucleic acid to be released back into the solution, making it reusable, and the nucleic acid circuit is rotating. Furthermore, when only the fuel nucleic acid was added without the trigger nucleic acid, no change in luminescence intensity was observed, confirming that no complex was formed with the template nucleic acid, i.e., the 5-FAM-modified nucleic acid was not released.
[0138] [Example 4] Next, using blood from patients with gastroesophageal junction cancer, we verified the normal rotation of the nucleic acid circuit and detected cancer cells using the nucleic acid circuit.
[0139] First, 100 μL of 1 μM 5'-end biotinylated aptamer was added to 1 mL of blood provided by a patient with gastroesophageal junction cancer, and the mixture was incubated at 25°C for 30 minutes to form a cell suspension.
[0140] Furthermore, referring to Japanese Patent No. 6781876, a microfilter mold was fabricated by coating a substrate with photoresist using a spin coater, exposing it to UV light through a photomask, and developing it using a photoresist developer. Nickel electroforming was then performed on this substrate, and the nickel structure was removed from the mold. The nickel structure was gold-plated to cover the entire structure with a thin gold film, thereby fabricating the elastically deformable microfilter 40 shown in FIG. 14. The fabricated microfilter 40 was immersed in an aqueous NeutrAvidin solution to modify the microfilter surface with NeutrAvidin. The fabricated microfilter 40 was attached to a housing 50 having an inlet portion 50a and an outlet portion 50b shown in FIG.
[0141] 16, a reservoir tank 52 storing the cell suspension was connected to a microfilter device 51 by a tube via a pump 53. Furthermore, the microfilter device 51 was connected to a waste liquid tank 54 for storing the waste liquid of the cell suspension that had passed through the microfilter device 51.
[0142] The pump 53 was set to a liquid delivery rate of 3 mL / h, and 1 mL of a blood sample from a patient with gastroesophageal junction cancer was delivered from the reservoir 52 to the microfilter device 51. After the blood was delivered, 1 mL of PBS(-) was delivered at a rate of 3 mL / h to wash the microfilter 40.
[0143] The microfilter 40 was removed from the microfilter device 51, and the cells captured on the microfilter 40 were immobilized and permeabilized. After treatment with blocking buffer, primary antibodies for cytokeratin and CD45 were bound to the microfilter. The cells were then immersed in a mixed solution containing secondary antibodies for cytokeratin and CD45 modified with Alexa Fluor 488 and Alexa Fluor 594, respectively, and DAPI for nuclear staining, for immunostaining. The immunostained cells were observed using a confocal laser inverted microscope (Nikon C2+). Cells that were positive for both DAPI and cytokeratin were considered to be cancer cells, and their numbers were counted. A fluorescent observation photograph of cancer cells captured using the microfilter device 51 is shown in Figure 17. When 1 mL of blood was pumped into each of the three microfilter devices 51, it was confirmed that an average of six cancer cells were captured.
[0144] Next, we verified the nucleic acid circuit using blood samples from patients with gastroesophageal junction cancer.
[0145] First, 1 μM thymine 20-mer, T 20 1 mL of an aqueous solution containing α-tocopherol was added to the microtube, heated at 95°C for 5 minutes, and then the solution was removed. 20 We produced multiple surface-treated microtubes.
[0146] Using a microtube that had only been surface-treated, 5 μM tagged EpCAM aptamer solution (prepared in BB, 1 μM thymine 20-mer, T 20 Next, after capturing and washing the cancer cells, 40 μL of the 5 μM tagged EpCAM aptamer solution was dropped onto a microfilter (prepared separately from the microfilter used to count the captured cancer cells described above, and 1 mL of the same patient's blood was passed through) before immobilization or permeabilization. The microfilter was then incubated in an incubator at 4°C for 30 minutes. The solution was then removed, and 40 μL of BB was added and removed. This process was repeated once more.
[0147] In addition, a microtube that had only been surface-treated was used to prepare a 1 μM trigger nucleic acid complex solution (prepared in BB, 1 μM thymine 20-mer, T 20 A solution containing 1 μM of the trigger nucleic acid complex was prepared. Next, 40 μL of the 1 μM trigger nucleic acid complex solution was dropped onto the microfilter containing the EpCAM aptamer solution, and then the microfilter was incubated again at 4°C for 30 minutes. Then, 40 μL of the solution (supernatant) was collected (a microtube that had only been surface-treated was used for collecting the supernatant). This was heated at 95°C for 10 minutes and then allowed to stand at room temperature for 30 minutes.
[0148] Furthermore, using a microtube that had only been surface-treated, annealing was performed in 10 mM Tris-HCl buffer (containing 1 mM EDTA and 12.25 mM MgCl2), and then a solution of a template nucleic acid complex (200 nM, 300 nM, and 200 nM, respectively) consisting of 5-FAM-modified nucleic acid I, BHQ1-modified nucleic acid, and template nucleic acid (1 μM T 20 A solution was prepared by adding 840 μL of 10 mM Tris-HCl buffer (containing 1 mM EDTA and 12.25 mM MgCl 2 ) to 100 μL of 10 mM Tris-HCl buffer (containing 1 mM EDTA and 12.25 mM MgCl 2 ).
[0149] Furthermore, a 10 μM fuel nucleic acid solution (1 μM T) prepared in 10 mM Tris-HCl buffer (containing 1 mM EDTA and 12.25 mM MgCl) was used in a microtube that had only been surface-treated. 20 The supernatant (40 μL) recovered after dropping the trigger nucleic acid complex solution was mixed with the prepared template nucleic acid complex solution, and fluorescence measurements (excitation wavelength 490 nm, fluorescence wavelength 520 nm) were performed at 25°C using a Spectrofluorometer FP-8500 (JASCO).
[0150] In addition, fluorescence measurements were also performed on a solution prepared in the same manner, except that 5 μM tagged EpCAM aptamer solution was not dropped onto the microfilter after capturing and washing the cancer cells and before fixation or permeabilization treatment. The results obtained are shown in FIG.
[0151] In addition, after the fuel nucleic acid solution and trigger nucleic acid complex solution were dropped, the supernatant collected was mixed with the prepared template nucleic acid complex solution. One hour later, a photograph of the solution was taken while irradiating it with 254 nm light from a UV handheld lamp (6 W) from a distance of 3 cm. The results are shown in Figure 19.
[0152] As shown in Figures 18 and 19, when the tagged EpCAM aptamer solution was added, the luminescence intensity increased over time, but when the tagged EpCAM aptamer solution was not added, almost no change in luminescence intensity was observed. Furthermore, the difference in luminescence intensity was clearly visible. From the above, it can be seen that the nucleic acid circuit of the present invention is effective in detecting cancer cells even in actual cancer patients.
[0153] [Example 5] Next, it was verified that the multi-stage nucleic acid circuit shown in FIG. 8 rotated normally. In Figure 8, sequence 1a corresponds to (5'-)CATTCAATAC(-3') in 5-FAM modified nucleic acid II, sequence 1b corresponds to (5'-)CCTACG(-3') in 5-FAM modified nucleic acid II, sequence 2a corresponds to (5'-)TCTCCA(-3') in 5-FAM modified nucleic acid II, and sequence 2b corresponds to (5'-)ACTAACTTACGG(-3') in 5-FAM modified nucleic acid II.
[0154] First, 1 μM thymine 20-mer, T 20 1 mL of an aqueous solution containing α-tocopherol was added to the microtube, heated at 95°C for 5 minutes, and then the solution was removed. 20 We produced multiple surface-treated microtubes.
[0155] Next, using a microtube that had only been surface-treated, annealing was performed in 10 mM Tris-HCl buffer (containing 1 mM EDTA and 12.25 mM MgCl2), and then a solution of a template nucleic acid complex (200 nM, 300 nM, and 220 nM, respectively) consisting of 5-FAM-modified nucleic acid II, BHQ1-modified nucleic acid, and template nucleic acid (1 μM T 20 To this, 840 to 890 μL of 10 mM Tris-HCl buffer (containing 1 mM EDTA and 12.25 mM MgCl) was added, depending on the volume of the trigger nucleic acid solution to be added in the next step.
[0156] In addition, a 10 μM fuel nucleic acid solution (1 μM T) prepared in 10 mM Tris-HCl buffer (containing 1 mM EDTA and 12.25 mM MgCl) was used in a microtube that had only been surface-treated. 20 Using 20 μL of a 1 μM trigger nucleic acid solution, 4 μL of a 50 nM trigger nucleic acid solution, or 10 μL of a 2 nM trigger nucleic acid solution prepared in 10 mM Tris-HCl buffer (containing 1 mM EDTA and 12.25 mM MgCl), template nucleic acid complex solution, and a surface-treated microtube, samples with final trigger nucleic acid concentrations of 20 nM, 10 nM, 2 nM, 1 nM, 200 pM, and 20 pM were prepared by adding 10 to 20 μL of a 1 μM trigger nucleic acid solution, 4 to 40 μL of a 50 nM trigger nucleic acid solution, or 10 μL of a 2 nM trigger nucleic acid solution, all prepared in 10 mM Tris-HCl buffer (containing 1 mM EDTA and 12.25 mM MgCl), to a total volume of 1 mL. Additionally, samples were prepared in the same manner except that no trigger nucleic acid solution was added. These samples were subjected to fluorescence measurement (excitation wavelength 490 nm, fluorescence wavelength 520 nm) at 25°C using a Spectrofluorometer FP-8500 (manufactured by JASCO). The results obtained are shown in FIG.
[0157] 20, when the final concentration of the trigger nucleic acid is 20 pM to 2 nM, the luminescence intensity increases in a sigmoidal curve. This is because, when the solution contains a sufficiently larger amount of the template nucleic acid complex than the trigger nucleic acid, the trigger nucleic acid and 5-FAM-modified nucleic acid II released into the solution in the first-stage nucleic acid circuit again induce strand exchange reactions with the template nucleic acid complex, causing the nucleic acid circuit to rotate in multiple stages. From the above, it was confirmed that the multi-step nucleic acid circuit shown in FIG. 8 exponentially increases the luminescence intensity in the shortest diagnostic time. [Explanation of symbols]
[0158] 31 Support layer 32 Self-assembled monolayer 33 Aptamers or antibodies 40 microfilter 50 Housing 50a Inlet 50b Outlet 51 Microfilter Device 52 Reservoir 53 Pump 54 Waste liquid tank
Claims
1. A cell detection method for detecting target cells in a biological sample, comprising: adding a tagged nucleic acid aptamer composed of a single-stranded nucleic acid to a solution containing the target cells, and allowing it to specifically bind to a cell surface substance of the target cells; adding a trigger nucleic acid complex comprising a trigger nucleic acid containing a partial base sequence of the tag portion of the tagged nucleic acid aptamer and a mask nucleic acid containing a base sequence complementary to the base sequence of the tag portion, and releasing the trigger nucleic acid; adding nucleic acid A and nucleic acid B, each modified with a signal-emitting molecule and a signal-suppressing molecule, and a template nucleic acid complex in which both modification sites are positioned adjacent to each other so as to suppress the signal in a tandem double strand formed by the template nucleic acid, and a fuel nucleic acid to a solution containing the released trigger nucleic acid, and rotating the nucleic acid circuit to amplify the signal; detecting the amplified signal; The template nucleic acid complex is a sequence in which N types of segments are linked (first * Sequence ~ Nth * A template nucleic acid having a base sequence of the first sequence is used to form a double strand with the template nucleic acid. * Array ~ P * Nucleic acid A containing base sequences of the first sequence to the Pth sequence complementary to the sequence (P+1) * Array ~ Qth * and a nucleic acid B containing base sequences of sequence (P+1) to sequence Q that are complementary to sequence (P, Q, and N are integers that satisfy the relationship 1<P<P+1<Q<N), The trigger nucleic acid is a nucleic acid having a sequence similar to that of the R * Sequence ~ S * a base sequence of sequence R to sequence S complementary to the sequence (where R and S are integers satisfying 1<P+1<R≦Q<S≦N); The fuel nucleic acid is a first nucleic acid of the template nucleic acid. * Sequence ~ T * a first base sequence to a Tth base sequence complementary to the sequence (where T is an integer satisfying R≦T); the binding constant between the trigger nucleic acid and the template nucleic acid is higher than the binding constant between the nucleic acid B and the template nucleic acid; A cell detection method, wherein the binding constant between the fuel nucleic acid and the template nucleic acid is higher than the binding constants between the nucleic acid A and the trigger nucleic acid and the template nucleic acid.
2. The cell detection method according to claim 1 , A cell detection method characterized in that the step of amplifying the signal further comprises using the trigger nucleic acid and nucleic acid A released into the solution to rotate the nucleic acid circuit in multiple stages to amplify the signal.
3. A kit for use in the cell detection method according to claim 1 or 2, comprising: a tagged nucleic acid aptamer that specifically binds to a cell surface substance of the target cell and is composed of a single-stranded nucleic acid; a template nucleic acid complex in which nucleic acids A and B, each modified with a signal-emitting molecule and a signal-suppressing molecule, and a template nucleic acid form a tandem double-stranded chain in which both modification sites are located in close proximity to each other so as to suppress signals, wherein the template nucleic acid comprises a sequence in which N types of segments are linked (base sequences of 1* sequence to N* sequence), the nucleic acid A comprises base sequences of 1* sequence to P sequence complementary to the 1* sequence to P* sequence, and the nucleic acid B comprises base sequences of (P+1) sequence to Q sequence complementary to the (P+1)* sequence to Q* sequence (where P, Q, and N are integers satisfying 1<P<P+1<Q<N); a trigger nucleic acid complex comprising a trigger nucleic acid that is a partial base sequence of the tag portion in the tagged nucleic acid aptamer and that includes a base sequence of R sequence to S sequence that is complementary to the R* sequence to S* sequence of the template nucleic acid (where R and S are integers that satisfy 1<P+1<R≦Q<S≦N), and a mask nucleic acid that includes a base sequence that is complementary to the base sequence of the tag portion; a fuel nucleic acid comprising base sequences of Sequence 1 to Sequence T that are complementary to Sequence 1* to Sequence T* of the template nucleic acid (wherein T is an integer that satisfies R≦T), the binding constant between the trigger nucleic acid and the template nucleic acid is higher than the binding constant between the nucleic acid B and the template nucleic acid; A kit, wherein the binding constant between the fuel nucleic acid and the template nucleic acid is higher than the binding constants between the nucleic acid A and the trigger nucleic acid and the template nucleic acid.
Citation Information
Patent Citations
Bag manufacturing machine
JP1982001749A
Method of detecting cells of interest in biological sample
JP2017079634A