Non-viral DNA vectors for expressing FVIII therapeutic agents and their uses
Capsid-free ceDNA vectors address the limitations of AAV-based gene therapy for hemophilia A by enabling rapid and sustained expression of Factor VIII, providing effective treatment through minimal invasion.
Patent Information
- Application Number
- JP2021554696
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2019-06-03
- Filing Date
- 2020-03-13
- Publication Date
- 2026-01-07
- Estimated Expiration
- 2040-03-13
AI Technical Summary
Current AAV-based gene therapy for hemophilia A is limited by immune response, limited viral packaging capacity, and slow gene expression, making it unsuitable for continuous delivery of factor VIII and inaccessible to patients with pre-existing antibodies.
Development of capsid-free, covalently closed-end DNA (ceDNA) vectors that express Factor VIII protein, which can be delivered in a minimally invasive manner, providing sustained and titratable therapeutic levels without immune activation.
The ceDNA vectors enable rapid onset of therapeutic benefit, sustained expression of Factor VIII, and effective treatment of hemophilia A, overcoming limitations of AAV-based therapies.
Smart Images

Figure 0007795357000184 
Figure 0007795357000185 
Figure 0007795357000186
Abstract
Description
[Technical Field]
[0001] Related Applications This application claims priority to U.S. Provisional Application No. 62 / 817,904, filed March 13, 2019, and U.S. Provisional Application No. 62 / 856,432, filed June 3, 2019, the contents of each of which are incorporated herein by reference in their entirety.
[0002] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in ASCII format, as well as the sequences in Tables 1-9 herein, each of which is incorporated by reference in its entirety. The ASCII copy, created on March 11, 2020, is named 131698-06020_SL.txt and is 116,781 bytes in size.
[0003] The present invention relates to the field of gene therapy, including the production of non-viral vectors for expressing transgenes or isolated polynucleotides in subjects or cells.The present disclosure also relates to nucleic acid constructs, promoters, vectors, and host cells containing polynucleotides, as well as methods for delivering exogenous DNA sequences to target cells, tissues, organs, or organisms.For example, the present disclosure provides a method for expressing FVIII from cells using non-viral ceDNA vectors, for example, a method for expressing FVIII therapeutic proteins for the treatment of subjects with hemophilia A.The method and composition can be used, for example, to treat diseases by expressing FVIII in cells or tissues of subjects in need of treatment. [Background technology]
[0004] Gene therapy aims to improve the clinical outcome for patients suffering from either genetic mutations or acquired diseases caused by abnormalities in gene expression profiles.Gene therapy includes the treatment or prevention of medical conditions caused by defective genes or abnormal regulation or expression, for example, underexpression or overexpression, which can lead to disorders, diseases, malignancies, etc.For example, diseases or disorders caused by defective genes can be treated, prevented, or improved by delivering repair genetic material to patients, or by modifying or silencing the defective gene using repair genetic material to patients, which results in the therapeutic expression of genetic material in patients.
[0005] The basis of gene therapy is the provision of an active gene product (sometimes referred to as a transgene) in a transcription cassette, which may result in, for example, a positive gain-of-function effect, a negative loss-of-function effect, or another outcome. Such outcomes may result from the expression of therapeutic proteins such as antibodies, functional enzymes, or fusion proteins. Gene therapy can also be used to treat diseases or malignancies caused by other factors. Human monogenic disorders can be treated by delivering and expressing normal genes in target cells. Delivery and expression of repair genes in patient target cells can be carried out through a number of methods, including the use of engineered viruses and viral gene delivery vectors. Among the many available virus-derived vectors (e.g., recombinant retroviruses, lentiviruses, recombinant adenoviruses, etc.), recombinant adeno-associated viruses (rAAVs) have gained popularity as versatile vectors in gene therapy.
[0006] Adeno-associated viruses (AAV) belong to the Parvoviridae family and, more specifically, to the Dependoparvovirus genus. AAV-derived vectors (i.e., recombinant AAV (rAVV) or AAV vectors) are attractive for delivering genetic material because (i) they can infect (transduce) a wide variety of non-dividing and dividing cell types, including muscle cells and neurons; (ii) they lack viral structural genes, thereby reducing host cell responses to viral infection, such as interferon-mediated responses; (iii) wild-type viruses are considered non-pathogenic in humans; (iv) in contrast to wild-type AAV, which can integrate into the host cell genome, replication-deficient AAV vectors lack the rep gene and generally persist episomally, thus limiting the risk of insertional mutagenesis or genotoxicity; and (v) compared to other vector systems, AAV vectors are generally considered relatively poor immunogens and therefore do not induce significant immune responses (see ii), thereby allowing for sustained vector DNA and potentially long-term expression of therapeutic transgenes.
[0007] However, the use of AAV particles as gene delivery vectors presents several significant drawbacks. One significant drawback associated with rAAV is its limited viral packaging capacity of approximately 4.5 kb of heterologous DNA (Dong et al., 1996; Athanasopoulos et al., 2004; Lai et al., 2010). As a result, the use of AAV vectors is limited to protein-coding capacities of less than 150,000 Da. A second drawback is that, as a result of the prevalence of wild-type AAV infection in the population, rAAV gene therapy candidates must be screened for the presence of neutralizing antibodies that eliminate the vector from patients. A third drawback relates to capsid immunogenicity, which prevents re-administration to patients who were not excluded from initial treatment. In response to vectors that effectively act as a "booster" shot, the patient's immune system may be stimulated to produce high-titer anti-AAV antibodies that prevent future treatment. Several recent reports have demonstrated a relationship with immunogenicity in high-dose situations. Another notable drawback is the relatively slow onset of AAV-mediated gene expression, given that single-stranded AAV DNA must be converted to double-stranded DNA prior to heterologous gene expression.
[0008] Additionally, conventional AAV virions with capsids can be produced by introducing a plasmid containing the AAV genome, rep gene, and cap gene (Grimm et al., 1998). However, such encapsidated AAV viral vectors have been shown to inefficiently transduce certain cell and tissue types, and the capsids also induce immune responses.
[0009] Thus, the use of adeno-associated virus (AAV) vectors for gene therapy is limited due to a single administration to the patient (due to the patient's immune response), the limited range of transgene genetic material suitable for delivery in AAV vectors due to minimal viral packaging capacity (approximately 4.5 kb), and slow AAV-mediated gene expression.
[0010] Hemophilia A has a significant unmet need for disease-modifying therapies. Current therapies are burdensome and require intravenous (IV) administration. First, these factor VIII injectables do not provide continuous delivery of factor at trough levels, which allows for bleeding episodes. Second, there is no approved gene therapy for hemophilia A, and AAV-based therapies cannot be used by 25%–40% of patients due to preexisting antibodies. AAV can only be administered once, resulting factor VIII levels may not be high enough to be effective or may be abnormal, and dose levels cannot be titrated. Third, many hemophilia A patients cannot access these therapies due to the development of neutralizing antibodies against these exogenous artificial clotting factors.
[0011] Thus, there is a need in the art for technologies that allow for the expression of therapeutic FVIII proteins in cells, tissues, or subjects for the treatment of hemophilia A. Summary of the Invention [Means for solving the problem]
[0012] Short description The technology described herein relates to methods and compositions for treating hemophilia A through expression of factor VIII (FVIII) protein from a capsid-free (e.g., non-viral) DNA vector with covalently closed ends (referred to herein as a "closed-end DNA vector" or "ceDNA vector"). The ceDNA vector contains an FVIII nucleic acid sequence or a codon-optimized version thereof. These ceDNA vectors can be used to produce FVIII protein for treatment, monitoring, and diagnosis. The application of ceDNA vectors expressing FVIII to subjects for the treatment of hemophilia A is useful for (i) providing disease-modifying levels of FVIII enzyme, (ii) being minimally invasive in delivery, (iii) being reproducible and administered to exert efficacy, (iv) having a rapid onset of therapeutic effect, (v) resulting in sustained expression of the corrected FVIII enzyme in the liver, (vi) restoring urea cycle function, and / or (vii) being titratable to achieve appropriate pharmacological levels of the defective enzyme.
[0013] In some embodiments, the ceDNA vector expressing FVIII is optionally present in a liposomal nanoparticle formulation (LNP) for the treatment of hemophilia A. The ceDNA vectors described herein can provide one or more benefits, including, but not limited to, providing disease-modifying levels of Factor VIII and being minimally invasive in delivery, reproducible and dosed to be effective, providing rapid onset of therapeutic benefit within days of therapeutic intervention, sustained expression of corrected Factor VIII in the circulation, titratable to achieve appropriate pharmacological levels of the defective clotting factor, and / or providing treatment for other hemophilia diseases, including, but not limited to, Factor VIII deficiency.
[0014] Thus, the invention described herein relates to a capsid-free (e.g., non-viral) DNA vector (referred to herein as a "closed-end DNA vector" or "ceDNA vector") with covalently closed ends comprising a heterologous gene encoding FVIII to enable expression of a therapeutic FVIII protein in a cell. According to one aspect, the present disclosure provides a capsid-free closed-end DNA (ceDNA) vector comprising at least one heterologous nucleotide sequence between adjacent inverted terminal repeats (ITRs), wherein the at least one heterologous nucleotide sequence encodes at least one FVIII protein, and the at least one heterologous nucleotide sequence encoding the at least one FVIII protein is selected from any of the sequences in Table 1. According to some embodiments, the ceDNA vector comprises a nucleic acid sequence selected from any of those in Table 9. According to some embodiments, the ceDNA vector comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:207, SEQ ID NO:210, SEQ ID NO:212, SEQ ID NO:199, SEQ ID NO:208, SEQ ID NO:211, and SEQ ID NO:214. According to some embodiments, the ceDNA vector comprises a nucleic acid sequence at least 85% identical to SEQ ID NO:210. According to some embodiments, the ceDNA vector comprises a nucleic acid sequence at least 90% identical to SEQ ID NO:210. According to some embodiments, the ceDNA vector comprises a nucleic acid sequence at least 95% identical to SEQ ID NO:210. According to some embodiments, the ceDNA vector comprises a nucleic acid sequence at least 96% identical to SEQ ID NO:210. According to some embodiments, the ceDNA vector comprises a nucleic acid sequence at least 97% identical to SEQ ID NO:210. According to some embodiments, the ceDNA vector comprises a nucleic acid sequence at least 98% identical to SEQ ID NO:210. According to some embodiments, the ceDNA vector comprises a nucleic acid sequence at least 99% identical to SEQ ID NO:210. According to some embodiments, the ceDNA vector comprises a nucleic acid sequence at least 85% identical to SEQ ID NO:214. According to some embodiments, the ceDNA vector comprises a nucleic acid sequence at least 90% identical to SEQ ID NO:214.According to some embodiments, the ceDNA vector comprises a nucleic acid sequence that is at least 95% identical to SEQ ID NO: 214. According to some embodiments, the ceDNA vector comprises a nucleic acid sequence that is at least 96% identical to SEQ ID NO: 214. According to some embodiments, the ceDNA vector comprises a nucleic acid sequence that is at least 97% identical to SEQ ID NO: 214. According to some embodiments, the ceDNA vector comprises a nucleic acid sequence that is at least 98% identical to SEQ ID NO: 214. According to some embodiments, the ceDNA vector comprises a nucleic acid sequence that is at least 99% identical to SEQ ID NO: 214.
[0015] In one embodiment, provided herein is a capsid-free closed-end DNA (ceDNA) vector comprising at least one heterologous nucleotide sequence between flanking inverted terminal repeats (ITRs), wherein the at least one heterologous nucleotide sequence encodes at least one FVIII protein, and the at least one heterologous nucleotide sequence encoding the at least one FVIII protein is selected from sequences having at least 85% identity to any of the sequences in Table 1. In one embodiment, the at least one heterologous nucleotide sequence encoding the at least one FVIII protein is selected from sequences having at least 90% identity to any of the sequences in Table 1. In one embodiment, the at least one heterologous nucleotide sequence encoding the at least one FVIII protein is selected from sequences having at least 91% identity to any of the sequences in Table 1. In one embodiment, the at least one heterologous nucleotide sequence encoding the at least one FVIII protein is selected from sequences having at least 92% identity to any of the sequences in Table 1. In one embodiment, the at least one heterologous nucleotide sequence encoding at least one FVIII protein is selected from a sequence having at least 93% identity to any of the sequences in Table 1. In one embodiment, the at least one heterologous nucleotide sequence encoding at least one FVIII protein is selected from a sequence having at least 94% identity to any of the sequences in Table 1. In one embodiment, the at least one heterologous nucleotide sequence encoding at least one FVIII protein is selected from a sequence having at least 95% identity to any of the sequences in Table 1. In one embodiment, the at least one heterologous nucleotide sequence encoding at least one FVIII protein is selected from a sequence having at least 96% identity to any of the sequences in Table 1. In one embodiment, the at least one heterologous nucleotide sequence encoding at least one FVIII protein is selected from a sequence having at least 97% identity to any of the sequences in Table 1.In one embodiment, the at least one heterologous nucleotide sequence encoding the at least one FVIII protein is selected from a sequence having at least 98% identity to any of the sequences in Table 1. In one embodiment, the at least one heterologous nucleotide sequence encoding the at least one FVIII protein is selected from a sequence having at least 99% identity to any of the sequences in Table 1. In one embodiment, the at least one heterologous nucleotide sequence encoding the at least one FVIII protein is selected from a sequence comprising any of the sequences in Table 1. In one embodiment, the at least one heterologous nucleotide sequence encoding the at least one FVIII protein is selected from a sequence consisting of any of the sequences in Table 1.
[0016] In one embodiment, the sequence in Table 1 is selected from the group consisting of SEQ ID NO:380, SEQ ID NO:381, SEQ ID NO:382, SEQ ID NO:383, SEQ ID NO:384, SEQ ID NO:385, SEQ ID NO:386, SEQ ID NO:387, SEQ ID NO:388, SEQ ID NO:389, SEQ ID NO:390, SEQ ID NO:391, SEQ ID NO:392, SEQ ID NO:393, SEQ ID NO:394, SEQ ID NO:395, SEQ ID NO:396, and SEQ ID NO:397. In one embodiment, the sequence is SEQ ID NO:380. In one embodiment, the sequence is SEQ ID NO:381. In one embodiment, the sequence is SEQ ID NO:382. In one embodiment, the sequence is SEQ ID NO:383. In one embodiment, the sequence is SEQ ID NO:384. In one embodiment, the sequence is SEQ ID NO:385. In one embodiment, the sequence is SEQ ID NO:386. In one embodiment, the sequence is SEQ ID NO:387. In one embodiment, the sequence is SEQ ID NO:388. In one embodiment, the sequence is SEQ ID NO:389. In one embodiment, the sequence is SEQ ID NO:390. In one embodiment, the sequence is SEQ ID NO: 391. In one embodiment, the sequence is SEQ ID NO: 392. In one embodiment, the sequence is SEQ ID NO: 393. In one embodiment, the sequence is SEQ ID NO: 394. In one embodiment, the sequence is SEQ ID NO: 395. In one embodiment, the sequence is SEQ ID NO: 396. In one embodiment, the sequence is SEQ ID NO: 397.
[0017] In one embodiment, the ceDNA vector comprises a nucleic acid sequence selected from a sequence having at least 85% identity to any of the sequences in Table 9. In one embodiment, the ceDNA vector comprises a nucleic acid sequence selected from a sequence having at least 90% identity to any of the sequences in Table 9. In one embodiment, the ceDNA vector comprises a nucleic acid sequence selected from a sequence having at least 91% identity to any of the sequences in Table 9. In one embodiment, the ceDNA vector comprises a nucleic acid sequence selected from a sequence having at least 92% identity to any of the sequences in Table 9. In one embodiment, the ceDNA vector comprises a nucleic acid sequence selected from a sequence having at least 93% identity to any of the sequences in Table 9. In one embodiment, the ceDNA vector comprises a nucleic acid sequence selected from a sequence having at least 94% identity to any of the sequences in Table 9. In one embodiment, the ceDNA vector comprises a nucleic acid sequence selected from a sequence having at least 95% identity to any of the sequences in Table 9. In one embodiment, the ceDNA vector comprises a nucleic acid sequence selected from a sequence having at least 96% identity to any of the sequences in Table 9. In one embodiment, the ceDNA vector comprises a nucleic acid sequence selected from a sequence having at least 97% identity to any of the sequences in Table 9. In one embodiment, the ceDNA vector comprises a nucleic acid sequence selected from a sequence having at least 98% identity to any of the sequences in Table 9. In one embodiment, the ceDNA vector comprises a nucleic acid sequence selected from a sequence having at least 99% identity to any of the sequences in Table 9. In one embodiment, the ceDNA vector comprises a nucleic acid sequence comprising a sequence in Table 9. In one embodiment, the ceDNA vector comprises a nucleic acid sequence consisting of a sequence in Table 9.
[0018] In one embodiment, the sequence in Table 9 is selected from the group consisting of SEQ ID NO:197, SEQ ID NO:198, SEQ ID NO:199, SEQ ID NO:200, SEQ ID NO:201, SEQ ID NO:202, SEQ ID NO:203, SEQ ID NO:204, SEQ ID NO:205, SEQ ID NO:206, SEQ ID NO:207, SEQ ID NO:208, SEQ ID NO:209, SEQ ID NO:210, SEQ ID NO:211, SEQ ID NO:212, SEQ ID NO:213, SEQ ID NO:214, SEQ ID NO:215, SEQ ID NO:216, and SEQ ID NO:217. In one embodiment, the sequence in Table 9 is SEQ ID NO:197. In one embodiment, the sequence in Table 9 is SEQ ID NO:198. In one embodiment, the sequence in Table 9 is SEQ ID NO:199. In one embodiment, the sequence in Table 9 is 200. In one embodiment, the sequence in Table 9 is 201. In one embodiment, the sequence in Table 9 is 202. In one embodiment, the sequence in Table 9 is 203. In one embodiment, the sequence in Table 9 is 204. In one embodiment, the sequence in Table 9 is 205. In one embodiment, the sequence in Table 9 is 206. In one embodiment, the sequence in Table 9 is 207. In one embodiment, the sequence in Table 9 is 208. In one embodiment, the sequence in Table 9 is 209. In one embodiment, the sequence in Table 9 is 210. In one embodiment, the sequence in Table 9 is 211. In one embodiment, the sequence in Table 9 is 212. In one embodiment, the sequence in Table 9 is 213. In one embodiment, the sequence in Table 9 is 214. In one embodiment, the sequence in Table 9 is 215. In one embodiment, the sequence in Table 9 is 216. In one embodiment, the sequence in Table 9 is 217.
[0019] In one embodiment, the ceDNA vector comprises a nucleic acid sequence having at least 85% identity to SEQ ID NO: 210. In one embodiment, the ceDNA vector comprises a nucleic acid sequence having at least 90% identity to SEQ ID NO: 210. In one embodiment, the ceDNA vector comprises a nucleic acid sequence having at least 91% identity to SEQ ID NO: 210. In one embodiment, the ceDNA vector comprises a nucleic acid sequence having at least 92% identity to SEQ ID NO: 210. In one embodiment, the ceDNA vector comprises a nucleic acid sequence having at least 93% identity to SEQ ID NO: 210. In one embodiment, the ceDNA vector comprises a nucleic acid sequence having at least 94% identity to SEQ ID NO: 210. In one embodiment, the ceDNA vector comprises a nucleic acid sequence having at least 95% identity to SEQ ID NO: 210. In one embodiment, the ceDNA vector comprises a nucleic acid sequence having at least 96% identity to SEQ ID NO: 210. In one embodiment, the ceDNA vector comprises a nucleic acid sequence having at least 97% identity to SEQ ID NO: 210. In one embodiment, the ceDNA vector comprises a nucleic acid sequence having at least 98% identity to SEQ ID NO: 210. In one embodiment, the ceDNA vector comprises a nucleic acid sequence having at least 99% identity to SEQ ID NO: 210. In one embodiment, the ceDNA vector comprises a nucleic acid sequence comprising SEQ ID NO: 210. In one embodiment, the ceDNA vector comprises a nucleic acid sequence consisting of SEQ ID NO: 210.
[0020] In one embodiment, the ceDNA vector comprises a nucleic acid sequence having at least 85% identity to SEQ ID NO: 214. In one embodiment, the ceDNA vector comprises a nucleic acid sequence having at least 90% identity to SEQ ID NO: 214. In one embodiment, the ceDNA vector comprises a nucleic acid sequence having at least 91% identity to SEQ ID NO: 214. In one embodiment, the ceDNA vector comprises a nucleic acid sequence having at least 92% identity to SEQ ID NO: 214. In one embodiment, the ceDNA vector comprises a nucleic acid sequence having at least 93% identity to SEQ ID NO: 214. In one embodiment, the ceDNA vector comprises a nucleic acid sequence having at least 94% identity to SEQ ID NO: 214. In one embodiment, the ceDNA vector comprises a nucleic acid sequence having at least 95% identity to SEQ ID NO: 214. In one embodiment, the ceDNA vector comprises a nucleic acid sequence having at least 96% identity to SEQ ID NO: 214. In one embodiment, the ceDNA vector comprises a nucleic acid sequence having at least 97% identity to SEQ ID NO: 214. In one embodiment, the ceDNA vector comprises a nucleic acid sequence having at least 98% identity to SEQ ID NO: 214. In one embodiment, the ceDNA vector comprises a nucleic acid sequence having at least 99% identity to SEQ ID NO: 214. In one embodiment, the ceDNA vector comprises a nucleic acid sequence comprising SEQ ID NO: 214. In one embodiment, the ceDNA vector comprises a nucleic acid sequence consisting of SEQ ID NO: 214.
[0021] The ceDNA vectors for expression of FVIII protein production described herein are non-encapsid-containing linear double-stranded DNA molecules formed from continuous strands of complementary DNA with covalently closed ends (linear, continuous, and non-encapsidated structures), and include a 5' inverted terminal repeat (ITR) sequence and a 3' ITR sequence, where the 5' ITR and 3' ITR can have the same symmetrical three-dimensional configuration relative to each other (i.e., symmetric or substantially symmetric), or alternatively, the 5' ITR and 3' ITR can have different three-dimensional configurations relative to each other (i.e., asymmetric ITR). Furthermore, the ITRs can be derived from the same or different serotypes. In some embodiments, the ceDNA vectors can include ITR sequences that have a symmetrical three-dimensional spatial configuration (i.e., they are the same or are mirror images of each other) such that their structures are the same shape in geometric space or have the same A, C-C', and B-B' loops in three-dimensional space. In some embodiments, one ITR may be derived from one AAV serotype and the other ITR may be derived from a different AAV serotype.
[0022] Thus, some embodiments of the technology described herein relate to ceDNA vectors for improved protein expression and / or production of FVIII proteins comprising ITR sequences flanking a heterologous nucleic acid sequence, including any of the FVIII nucleic acid sequences disclosed in Table 5, wherein the ITR sequences are selected from either: (i) at least one WT ITR and at least one modified AAV inverted terminal repeat (ITR) (e.g., an asymmetric modified ITR), (ii) two modified ITRs (e.g., an asymmetric modified ITR) in which the mod-ITR pair has a different three-dimensional spatial organization relative to each other, or (iii) a symmetric or substantially symmetric WT-WT ITR pair in which each WT-ITR has the same three-dimensional spatial organization, or (iv) a symmetric or substantially symmetric modified ITR pair in which each mod-ITR has the same three-dimensional spatial organization. The ceDNA vectors disclosed herein can be produced in eukaryotic cells and thus lack prokaryotic DNA modifications and bacterial endotoxin contamination in insect cells.
[0023] The methods and compositions described herein relate, in part, to the discovery of non-viral, capsid-free DNA vectors (ceDNA vectors) with covalently closed ends that can be used to express at least one FVIII protein, or two or more FVIII proteins, from cells, including, but not limited to, cells of the liver.
[0024] Thus, in one aspect, provided herein is a DNA vector (e.g., a ceDNA vector) comprising at least one heterologous nucleic acid sequence encoding at least one transgene encoding a FVIII protein operably linked to a promoter located between two different AAV inverted terminal repeats (ITRs), one of the ITRs comprising a functional AAV terminal cleavage site and a Rep binding site, one of the ITRs comprising a deletion, insertion, or substitution relative to the other ITR, the transgene encoding the FVIII protein, the DNA having the presence of a characteristic band of linear, continuous DNA when digested with a restriction enzyme having a single recognition site on the DNA vector, compared to a linear, discontinuous DNA control when analyzed on a non-denaturing gel. Other aspects include the delivery of FVIII protein by expressing it in vivo from the ceDNA vector described herein, and further, the treatment of hemophilia A using a ceDNA vector encoding FVIII. Cells comprising the ceDNA vector encoding FVIII described herein are also contemplated herein. According to some embodiments, the ceDNA vector is selected from the group consisting of ceDNAFVIII vector 16, ceDNAFVIII vector 19, ceDNAFVIII vector 21, ceDNAFVIII vector 8, ceDNAFVIII vector 17, ceDNAFVIII vector 20, and ceDNAFVIII vector 23. According to some embodiments, the ceDNA vector is ceDNAFVIII vector 19 or ceDNAFVIII vector 23.
[0025] Aspects of the present invention relate to methods for producing ceDNA vectors useful for producing FVIII proteins in cells described herein. In other embodiments, the present invention relates to ceDNA vectors produced by the methods provided herein. In one embodiment, a capsid-free (e.g., non-viral) DNA vector (ceDNA vector) for producing FVIII proteins is obtained from a plasmid (referred to herein as a "ceDNA-plasmid") containing a polynucleotide expression construct template that includes, in this order, an initial 5' inverted terminal repeat (e.g., AAV ITR), a heterologous nucleic acid sequence, and a 3' ITR (e.g., AAV ITR), where the 5' ITR and 3' ITR can be asymmetric or symmetric relative to each other (e.g., WT-ITR or modified symmetric ITR), as defined herein. According to some embodiments, the ceDNA vector is selected from the group consisting of ceDNAFVIII vector 16, ceDNAFVIII vector 19, ceDNAFVIII vector 21, ceDNAFVIII vector 8, ceDNAFVIII vector 17, ceDNAFVIII vector 20, and ceDNAFVIII vector 23. According to some embodiments, the ceDNA vector is ceDNAFVIII vector 19 or ceDNAFVIII vector 23.
[0026] The ceDNA vector for expressing the FVIII protein disclosed herein can be obtained by several means that will be known to those skilled in the art upon reading this disclosure. For example, the polynucleotide expression construct template used to generate the ceDNA vector of the present invention can be a ceDNA-plasmid, a ceDNA-bacmid, and / or a ceDNA-baculovirus. In one embodiment, the ceDNA-plasmid contains a restriction cloning site (e.g., SEQ ID NO: 123 and / or 124) operably positioned between the ITRs, allowing for the insertion of, for example, a transgene, such as an expression cassette comprising a promoter operably linked to a nucleic acid encoding FVIII. In some embodiments, the ceDNA vector for expressing the FVIII protein is produced from a polynucleotide template (e.g., a ceDNA-plasmid, a ceDNA-bacmid, a ceDNA-baculovirus) containing symmetric or asymmetric ITRs (modified or wild-type ITRs).
[0027] In permissive host cells, for example, in the presence of Rep, a polynucleotide template having at least two ITRs replicates to produce a ceDNA vector expressing a FVIII protein. ceDNA vector production involves two steps: first, Rep protein-mediated excision ("rescue") of the template from a template backbone (e.g., ceDNA-plasmid, ceDNA-bacmid, ceDNA-baculovirus genome, etc.), and second, Rep-mediated replication of the excised ceDNA vector. Rep proteins and Rep binding sites of various AAV serotypes are well known to those skilled in the art. Those skilled in the art will understand that Rep proteins are selected from serotypes that bind to and replicate nucleic acid sequences based on at least one functional ITR. For example, if a replication-competent ITR is derived from AAV serotype 2, the corresponding Rep will be derived from an AAV serotype that cooperates with that serotype; for example, AAV2 ITRs cooperate with AAV2 or AAV4 Rep, but not with AAV5 Rep. Upon replication, the covalently closed-end ceDNA vector continues to accumulate in permissive cells, and the ceDNA vector preferably accumulates under standard replication conditions and in the presence of Rep proteins sufficiently stably over long periods of time, for example in amounts of at least 1 pg / cell, preferably at least 2 pg / cell, preferably at least 3 pg / cell, more preferably at least 4 pg / cell, and even more preferably at least 5 pg / cell.
[0028] Thus, one aspect of the present invention relates to a process for producing such a ceDNA vector for expression of FVIII protein, comprising: a) incubating a population of host cells (e.g., insect cells) harboring a polynucleotide expression construct template (e.g., ceDNA-plasmid, ceDNA-bacmid, and / or ceDNA-baculovirus) under conditions effective and for a time sufficient to induce production of the ceDNA vector in the host cells in the presence of Rep proteins, wherein the host cells lack viral capsid-encoding sequences; and b) harvesting and isolating the ceDNA vector from the host cells. The presence of Rep proteins induces replication of the vector polynucleotide with modified ITRs to produce the ceDNA vector for expression of the FVIII protein in the host cells. However, viral particles (e.g., AAV virions) are not expressed. Therefore, there is no virion-imposed size limit. According to some embodiments, the ceDNA vector is selected from the group consisting of ceDNAFVIII vector 16, ceDNAFVIII vector 19, ceDNAFVIII vector 21, ceDNAFVIII vector 8, ceDNAFVIII vector 17, ceDNAFVIII vector 20, and ceDNAFVIII vector 23. According to some embodiments, the ceDNA vector is ceDNAFVIII vector 19 or ceDNAFVIII vector 23.
[0029] The presence of a ceDNA vector useful for expressing a FVIII protein isolated from a host cell can be confirmed by digesting the DNA isolated from the host cell with a restriction enzyme that has a single recognition site on the ceDNA vector and analyzing the digested DNA material on denaturing and non-denaturing gels to confirm the presence of a characteristic linear, continuous DNA band compared to linear, discontinuous DNA.
[0030] Also provided herein are methods for expressing therapeutic FVIII proteins using ceDNA vectors in cells or subjects. Such FVIII proteins can be used to treat hemophilia A. Accordingly, provided herein are methods for treating hemophilia A, comprising administering a ceDNA vector encoding a therapeutic FVIII protein to a subject in need thereof. According to some embodiments, the ceDNA vector encoding the therapeutic FVIII protein is selected from the group consisting of ceDNAFVIII vector 16, ceDNAFVIII vector 19, ceDNAFVIII vector 21, ceDNAFVIII vector 8, ceDNAFVIII vector 17, ceDNAFVIII vector 20, and ceDNAFVIII vector 23. According to some embodiments, the ceDNA vector is ceDNAFVIII vector 19 or ceDNAFVIII vector 23. According to some embodiments, the level of FVIII in the subject's serum is increased in subjects administered the ceDNA vector compared to a control. According to some embodiments, the increase in FVIII level is greater than about 40% compared to a control. According to some embodiments, the increase in FVIII levels is greater than about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75% compared to a control.
[0031] In some embodiments, one aspect of the technology described herein relates to a non-viral capsid-free DNA vector (ceDNA vector) with covalently closed ends, the ceDNA vector comprising at least one heterologous nucleotide sequence operably positioned between two inverted terminal repeats, where the ITR sequences can be asymmetric, or symmetric, or substantially symmetric, as these terms are defined herein, and at least one of the ITRs comprises a functional terminal resolution site and a Rep binding site, and optionally the heterologous nucleic acid sequence encodes a transgene (e.g., a FVIII protein), and the vector is not present in a viral capsid.
[0032] These and other aspects of the invention are described in further detail below. [Brief explanation of the drawings]
[0033] Embodiments of the present disclosure, briefly summarized above and discussed in more detail below, can be understood by reference to exemplary embodiments of the present disclosure, which are depicted in the accompanying drawings. However, the accompanying drawings illustrate only typical embodiments of the present disclosure and therefore should not be considered limiting in scope, as the present disclosure may admit of other equally effective embodiments.
[0034] [Figure 1A] 1 shows an exemplary structure of a ceDNA vector for expressing the FVIII protein disclosed herein, comprising asymmetric ITRs. In this embodiment, the exemplary ceDNA vector comprises an expression cassette containing a CAG promoter, a WPRE, and BGHpA. An open reading frame (ORF) encoding a FVIII transgene can be inserted into the cloning site (R3 / R4) between the CAG promoter and the WPRE. The expression cassette is flanked by two inverted terminal repeats (ITRs) - a wild-type AAV2 ITR upstream (5' end) of the expression cassette and a modified ITR downstream (3' end), and therefore the two ITRs flanking the expression cassette are asymmetric with respect to each other. [Figure 1B] 1 shows an exemplary structure of a ceDNA vector for expressing FVIII disclosed herein, which includes a CAG promoter, a WPRE, and an asymmetric ITR with an expression cassette containing BGHpA. An open reading frame (ORF) encoding a FVIII transgene can be inserted into the cloning site between the CAG promoter and the WPRE. The expression cassette is flanked by two inverted terminal repeats (ITRs)—a modified ITR upstream (5' end) of the expression cassette and a wild-type ITR downstream (3' end). [Figure 1C]1 shows an exemplary structure of a ceDNA vector for expressing FVIII disclosed herein, which includes an asymmetric ITR with an expression cassette containing an enhancer / promoter, a FVIII transgene, a post-transcriptional element (WPRE), and a polyA signal. The open reading frame (ORF) allows for insertion of the FVIII transgene into the cloning site between the CAG promoter and the WPRE. The expression cassette is flanked by two inverted terminal repeats (ITRs) that are asymmetric with respect to each other: a modified ITR upstream (5' end) and a modified ITR downstream (3' end) of the expression cassette, where both the 5' and 3' ITRs are modified ITRs but have different modifications (i.e., do not have the same modifications). [Figure 1D] 1 shows an exemplary structure of a ceDNA vector for expressing FVIII disclosed herein, comprising a CAG promoter, a WPRE, and an expression cassette containing BGHpA, and a symmetrically or substantially symmetrically modified ITR as defined herein. An open reading frame (ORF) encoding a FVIII transgene is inserted into the cloning site between the CAG promoter and the WPRE. The expression cassette is flanked by two modified inverted terminal repeats (ITRs), in which the 5'-modified ITR and the 3'-modified ITR are symmetric or substantially symmetric. [Figure 1E] 1 shows an exemplary structure of a ceDNA vector for expressing FVIII disclosed herein, comprising a symmetric or substantially symmetric modified ITR as defined herein, with an expression cassette containing an enhancer / promoter, a transgene, a post-transcriptional element (WPRE), and a polyA signal. The open reading frame (ORF) allows for insertion of a transgene (e.g., FVIII) into the cloning site between the CAG promoter and the WPRE. The expression cassette is flanked by two modified inverted terminal repeats (ITRs), with the 5'-modified ITR and the 3'-modified ITR being symmetric or substantially symmetric. [Figure 1F]1 shows an exemplary structure of a ceDNA vector for expressing FVIII disclosed herein, comprising a CAG promoter, a WPRE, and an expression cassette containing BGHpA, and comprising a symmetrical or substantially symmetrical WT-ITR as defined herein. An open reading frame (ORF) encoding a transgene (e.g., FVIII) is inserted into the cloning site between the CAG promoter and the WPRE. The expression cassette is flanked by two wild-type inverted terminal repeats (WT-ITR), with symmetrical or substantially symmetrical 5'WT-ITR and 3'WT-ITR. [Figure 1G] 1 shows an exemplary structure of a ceDNA vector for expressing FVIII disclosed herein, comprising a symmetric or substantially symmetric modified ITR as defined herein, with an expression cassette containing an enhancer / promoter, a transgene (e.g., FVIII), a post-transcriptional element (WPRE), and a polyA signal. The open reading frame (ORF) allows for insertion of the transgene (e.g., FVIII) into the cloning site between the CAG promoter and the WPRE. The expression cassette is flanked by two wild-type inverted terminal repeats (WT-ITR), with the 5'WT-ITR and 3'WT-ITR being symmetric or substantially symmetric. [Figure 2A] The T-shaped stem-loop structure of the wild-type left ITR of AAV2 (SEQ ID NO: 52) is provided, along with identification of the A-A', B-B', and C-C' arms, and two Rep binding sites (RBE and RBE'), and the terminal resolution site (TRS) is also shown. The RBE contains a series of four double tetramers that are thought to interact with either Rep78 or Rep68. In addition, the RBE' is also thought to interact with the Rep complex assembled on the wild-type or mutant ITR in the construct. The D and D' regions contain transcription factor binding sites and other conserved structures. [Figure 2B]The proposed Rep catalytic nicking and ligation activity in the wild-type left ITR (SEQ ID NO: 53) is shown, including the T-shaped stem-loop structure of the wild-type left ITR of AAV2, along with identification of the A-A' arm, the B-B' arm, the C-C' arm, two Rep binding sites (RBE and RBE'), and also the terminal resolution site (TRS), as well as the D and D' regions containing several transcription factor binding sites and other conserved structures. [Figure 3A] 1 provides the primary structure (polynucleotide sequence) (left) and secondary structure (right) of the A-A' arm and the RBE-containing portions of the C-C' and B-B' arms of the wild-type left AAV2 ITR (SEQ ID NO: 54). [Figure 3B] An exemplary mutant ITR (also referred to as a modified ITR) sequence for the left ITR is shown. The primary structure (left) and predicted secondary structure (right) of the RBE portion of the A-A', C, and B-B' arms of an exemplary mutant left ITR (ITR-1, left) (SEQ ID NO: 113) are shown. [Figure 3C] The primary structure (left) and secondary structure (right) of the A-A' loop and the RBE-containing portions of the B-B' and C-C' arms of the wild-type right AAV2 ITR (SEQ ID NO: 55) are shown. [Figure 3D] An exemplary right-modified ITR is shown. The primary structure (left) and predicted secondary structure (right) of the A-A' arm and the RBE-containing portion of the B-B' and C arms of an exemplary mutant left ITR (ITR-1, right) (SEQ ID NO: 114) are shown. Any combination of left and right ITRs (e.g., AAV2 ITRs or other viral serotype or synthetic ITRs) can be used as taught herein. Each of the polynucleotide sequences in Figures 3A-3D refers to the sequence used in the plasmid or bacmid / baculovirus genome used to produce the ceDNA described herein. The corresponding ceDNA secondary structure, deduced from the ceDNA vector configuration in the plasmid or bacmid / baculovirus genome and predicted Gibbs free energy values, is also included in each of Figures 3A-3D. [Figure 4A]FIG. 4C is a schematic diagram showing the upstream process for generating baculovirus-infected insect cells (BIICs), which are useful for producing ceDNA vectors for expression of FVIII disclosed herein, in the process described in the schematic diagram of FIG. 4B. [Figure 4B] FIG. 1 is a schematic diagram of an exemplary method for the production of ceDNA. [Figure 4C] Biochemical methods and processes for confirming the production of ceDNA vectors are presented. [Figure 4D]Figure 4B is a schematic diagram illustrating a process for identifying the presence of ceDNA in DNA harvested from cell pellets obtained during the ceDNA production process. Figure 4D shows, on the left, the schematic expected bands of an exemplary ceDNA that is either uncut or digested with a restriction endonuclease and then subjected to electrophoresis on either a native or denaturing gel. The leftmost schematic is a native gel, showing multiple bands suggesting that in its duplex and uncut form, ceDNA exists in at least a monomeric and dimeric state, appearing as a faster-migrating, smaller monomer and a slower-migrating dimer that is twice the size of the monomer. The second schematic from the left shows that when ceDNA is cleaved with a restriction endonuclease, the original band disappears and a faster-migrating (e.g., smaller) band appears, corresponding to the expected fragment size remaining after cleavage. Under denaturing conditions, the original duplex DNA is single-stranded and migrates as a species twice as large as that observed on a native gel due to the covalent attachment of the complementary strand. Thus, in the second schematic from the right, digested ceDNA exhibits a banding distribution similar to that observed on a native gel, but the bands migrate as fragments twice the size of their native counterparts. The rightmost schematic shows that uncut ceDNA under denaturing conditions migrates as a single-stranded open circle, and thus the observed bands are twice the size of those observed under native conditions where the circle is not open. In this figure, "kb" is used to indicate the relative size of nucleotide molecules based on the length of the nucleotide chain (e.g., for single-stranded molecules observed under denaturing conditions) or the number of base pairs (e.g., for double-stranded molecules observed under native conditions), depending on the context. Figure 4E shows DNA with a discontinuous structure. ceDNA can be cleaved by a restriction endonuclease with a single recognition site on the ceDNA vector, generating two DNA fragments with different sizes (1 kb and 2 kb) under both neutral and denaturing conditions. Figure 4E also shows ceDNA with a linear and continuous structure.The ceDNA vector can be cleaved by a restriction endonuclease to generate two DNA fragments that migrate as 1 kb and 2 kb in neutral conditions, but under denaturing conditions the strands remain connected, producing single strands that migrate as 2 kb and 4 kb. [Figure 4E]Figure 4B is a schematic diagram illustrating a process for identifying the presence of ceDNA in DNA harvested from cell pellets obtained during the ceDNA production process. Figure 4D shows, on the left, the schematic expected bands of an exemplary ceDNA that is either uncut or digested with a restriction endonuclease and then subjected to electrophoresis on either a native or denaturing gel. The leftmost schematic is a native gel, showing multiple bands suggesting that in its duplex and uncut form, ceDNA exists in at least a monomeric and dimeric state, appearing as a faster-migrating, smaller monomer and a slower-migrating dimer that is twice the size of the monomer. The second schematic from the left shows that when ceDNA is cleaved with a restriction endonuclease, the original band disappears and a faster-migrating (e.g., smaller) band appears, corresponding to the expected fragment size remaining after cleavage. Under denaturing conditions, the original duplex DNA is single-stranded and migrates as a species twice as large as that observed on a native gel due to the covalent attachment of the complementary strand. Thus, in the second schematic from the right, digested ceDNA exhibits a banding distribution similar to that observed on a native gel, but the bands migrate as fragments twice the size of their native counterparts. The rightmost schematic shows that uncut ceDNA under denaturing conditions migrates as a single-stranded open circle, and thus the observed bands are twice the size of those observed under native conditions where the circle is not open. In this figure, "kb" is used to indicate the relative size of nucleotide molecules based on the length of the nucleotide chain (e.g., for single-stranded molecules observed under denaturing conditions) or the number of base pairs (e.g., for double-stranded molecules observed under native conditions), depending on the context. Figure 4E shows DNA with a discontinuous structure. ceDNA can be cleaved by a restriction endonuclease with a single recognition site on the ceDNA vector, generating two DNA fragments with different sizes (1 kb and 2 kb) under both neutral and denaturing conditions. Figure 4E also shows ceDNA with a linear and continuous structure.The ceDNA vector can be cleaved by a restriction endonuclease to generate two DNA fragments that migrate as 1 kb and 2 kb in neutral conditions, but under denaturing conditions the strands remain connected, producing single strands that migrate as 2 kb and 4 kb. [Figure 5] Figure 1 shows an illustrative diagram of an example denaturing gel flow of ceDNA vectors with (+) or without (-) digestion with endonucleases (EcoRI for ceDNA constructs 1 and 2, BamH1 for ceDNA constructs 3 and 4, SpeI for ceDNA constructs 5 and 6, and XhoI for ceDNA vectors 7 and 8). Constructs 1-8 are described in Example 1 of International Application No. 18 / 49996, which is incorporated herein by reference in its entirety. The sizes of the bands highlighted with asterisks were determined and are indicated below the figure. [Figure 6]
[0023] Figure 1 shows the results of the experiment described in Example 7, specifically depicting IVIS images obtained from a mouse treated with the LNP-PolyC control (leftmost mouse) and four mice treated with LNP-ceDNA-luciferase (all but the leftmost mouse). The four ceDNA-treated mice show significant fluorescence in the area containing the mouse's liver. [Figure 7] 1 depicts the results of the experiment described in Example 8. The dark spots indicate the presence of protein resulting from the expressed ceDNA transgene, demonstrating the association of the administered LNP-ceDNA with hepatocytes. [Figure 8A]
[0049] Figure 8A shows the results of the ophthalmic study described in Example 9. Figure 8A shows representative IVIS images from the eye of a rat injected with JetPEI®-ceDNA-luciferase (top left) and the uninjected eye of the same rat (top right), or from the eye of a rat injected with plasmid-luciferase DNA (bottom left) and the uninjected eye of the same rat (bottom right). Figure 8B shows a graph of the average radiance observed in the treated eye or the corresponding untreated eye in each of the treatment groups. Rats treated with ceDNA demonstrated significant fluorescence (and thus expression of the luciferase transgene) over a 99-day period, in stark contrast to rats treated with plasmid-luciferase, where minimal relative fluorescence (and thus expression of the luciferase transgene) was observed. [Figure 8B]
[0049] Figure 8A shows the results of the ophthalmic study described in Example 9. Figure 8A shows representative IVIS images from the eye of a rat injected with JetPEI®-ceDNA-luciferase (top left) and the uninjected eye of the same rat (top right), or from the eye of a rat injected with plasmid-luciferase DNA (bottom left) and the uninjected eye of the same rat (bottom right). Figure 8B shows a graph of the average radiance observed in the treated eye or the corresponding untreated eye in each of the treatment groups. Rats treated with ceDNA demonstrated significant fluorescence (and thus expression of the luciferase transgene) over a 99-day period, in stark contrast to rats treated with plasmid-luciferase, where minimal relative fluorescence (and thus expression of the luciferase transgene) was observed. [Figure 9A]
[0039] Figure 9 shows the results of a ceDNA persistence and re-administration study in Rag2 mice described in Example 10. Figure 9A shows a graph of the total flux over time observed in wild-type C57BL / 6 mice or Rag2 mice treated with LNP-ceDNA-Luc. Figure 9B provides a graph showing the effect of re-dosing on luciferase transgene expression levels in Rag2 mice, resulting in a stable increase in expression observed after re-dosing (arrow indicates time of re-dosing). [Figure 9B]
[0039] Figure 9 shows the results of a ceDNA persistence and re-administration study in Rag2 mice described in Example 10. Figure 9A shows a graph of the total flux over time observed in wild-type C57BL / 6 mice or Rag2 mice treated with LNP-ceDNA-Luc. Figure 9B provides a graph showing the effect of re-dosing on luciferase transgene expression levels in Rag2 mice, resulting in a stable increase in expression observed after re-dosing (arrow indicates time of re-dosing). [Figure 10]
[0033] Data from the ceDNA luciferase expression study in treated mice described in Example 11 are provided, showing the total flux in each group of mice over the duration of the study. High levels of unmethylated CpG correlated with a decrease in total flux observed in mice over time, while the use of a liver-specific promoter correlated with durable, stable expression of the transgene from the ceDNA vector for at least 77 days. [Figure 11A] Figure 11A shows hydrodynamic delivery of FVIII-expressing ceDNA vectors. Figure 11A shows FVIII expression levels in serum samples on days 3 and 7 from mice after hydrodynamic injection of three different ceDNA vectors expressing FVIII (LPS1-F8-v1, LPS1-F8-v2, LPS1-F8-v3) or a control ceDNA vector (ceDNA expressing only luciferase) (shown as vehicle). Two of the three ceDNA vectors expressing FVIII showed FVIII expression. Figure 11B shows a dose-response graph of FVIII expression levels in serum samples over 30 days from mice after hydrodynamic injection of either low or high amounts of three different ceDNA vectors expressing FVIII (LPS1-F8-v1, LPS1-F8-v2, LPS1-F8-v3) or a high amount of vehicle control ceDNA vector (expressing only luciferase). [Figure 11B]Figure 11A shows hydrodynamic delivery of FVIII-expressing ceDNA vectors. Figure 11A shows FVIII expression levels in serum samples on days 3 and 7 from mice after hydrodynamic injection of three different ceDNA vectors expressing FVIII (LPS1-F8-v1, LPS1-F8-v2, LPS1-F8-v3) or a control ceDNA vector (ceDNA expressing only luciferase) (shown as vehicle). Two of the three ceDNA vectors expressing FVIII showed FVIII expression. Figure 11B shows a dose-response graph of FVIII expression levels in serum samples over 30 days from mice after hydrodynamic injection of either low or high amounts of three different ceDNA vectors expressing FVIII (LPS1-F8-v1, LPS1-F8-v2, LPS1-F8-v3) or a high amount of vehicle control ceDNA vector (expressing only luciferase). [Figure 12] 1 is a graph showing plasma FVIII concentrations (IU / ml) at 3 days after hydrodynamic delivery of various ceDNA vectors expressing FVIII (ceDNAFVIII vector 4, ceDNAFVIII vector 6, ceDNAFVIII vector 12, ceDNAFVIII vector 14, ceDNAFVIII vector 16, ceDNAFVIII vector 18, ceDNAFVIII vector 19, ceDNAFVIII vector 21, ceDNAFVIII vector 22). ceDNAFVIII vector 16, ceDNAFVIII vector 19, and ceDNAFVIII vector 21 showed the highest plasma Factor VIII concentrations after 3 days. Vehicle alone was used as a control. [Figure 13]1 is a graph showing plasma FVIII concentrations (IU / ml) at 3 days after hydrodynamic delivery of various ceDNA vectors expressing FVIII (ceDNAFVIII-vector 1, ceDNAFVIII-vector 2, ceDNAFVIII-vector 3, ceDNAFVIII-vector 5, ceDNAFVIII-vector 7, ceDNAFVIII-vector 8, ceDNAFVIII-vector 12, ceDNAFVIII-vector 13, ceDNAFVIII-vector 15). ceDNAFVIII-vector 8 showed the highest plasma Factor VIII concentration after 3 days. Vehicle alone was used as a control. [Figure 14] 1 is a graph showing plasma FVIII concentrations (IU / ml) at 3 days after hydrodynamic delivery of various ceDNA vectors expressing FVIII (ceDNAFVIII-vector 9, ceDNAFVIII-vector 10, ceDNAFVIII-vector 11, ceDNAFVIII-vector 12, ceDNAFVIII-vector 17, ceDNAFVIII-vector 20, ceDNAFVIII-vector 24, ceDNAFVIII-vector 25, ceDNAFVIII-vector 26). ceDNAFVIII-vector 17 and ceDNAFVIII-vector 20 showed the highest plasma Factor VIII concentrations after 3 days. Vehicle alone was used as a control. [Figure 15] 15 is a graph showing plasma FVIII concentrations (IU / ml) one day after hydrodynamic delivery of increasing doses of ceDNAFVIII vector 23 (0.005 μg to 50 μg). As shown in FIG. 15, plasma FVIII increased in a dose-dependent manner with increasing doses of ceDNAFVIII vector 23. Vehicle alone was used as a control. [Figure 16] 1 is a graph showing plasma FVIII concentrations (IU / mL) 7 days after hydrodynamic delivery of the LNP:ceDNAFVIII Vector 23 test article. DETAILED DESCRIPTION OF THE INVENTION
[0035] Provided herein are methods for treating hemophilia A using a ceDNA vector containing one or more nucleic acids encoding a therapeutic FVIII protein or a fragment thereof. Also provided herein are ceDNA vectors for expressing the FVIII proteins described herein, containing one or more heterologous nucleic acids encoding the FVIII protein. In some embodiments, expression of the FVIII protein may include secretion of the therapeutic protein from the cells in which it is expressed. Alternatively, in some embodiments, the expressed FVIII protein can act or function (e.g., exert its effect) within the cells in which it is expressed. In some embodiments, the ceDNA vector expresses the FVIII protein in the liver, muscle (e.g., skeletal muscle) of a subject, or other body part, which can act as a depot for production and secretion of the therapeutic FVIII protein into many systemic compartments.
[0036] I. Definition Unless otherwise defined herein, scientific and technical terms used in connection with this application shall have the meanings commonly understood by those skilled in the art to which this disclosure belongs. It is understood that the present invention is not limited to the particular methodology, protocols, and reagents, etc., described herein, and as such may vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is defined solely by the claims. Definitions of common terms in immunology and molecular biology can be found in The Merck Manual of Diagnosis and Therapy, 19th Edition, published by Merck Sharp & Dohme Corp., 2011 (ISBN 978-0-911910-19-3), Robert S. Porter et al. (eds.), Fields Virology, 6 thEdition,published by Lippincott Williams&Wilkins,Philadelphia,PA,USA(2013),Knipe,D.M.and Howley,P.M.(ed.),The Encyclopedia of Molecular Cell Biology and Molecular Medicine,published by Blackwell Science Ltd.,1999-2012(ISBN9783527600908)、およびRobert A.Meyers(ed.),Molecular Biology and Biotechnology:a Comprehensive Desk Reference,published by VCH Publishers,Inc.,1995(ISBN1-56081-569-8)、Immunology by Werner Luttmann,published by Elsevier,2006、Janeway‘s Immunobiology,Kenneth Murphy,Allan Mowat,Casey Weaver(eds.),Taylor&Francis Limited,2014(ISBN0815345305,9780815345305)、Lewin’s Genes XI,published by Jones&Bartlett Publishers,2014(ISBN-1449659055)、Michael Richard Green and Joseph Sambrook,Molecular Cloning:A Laboratory Manual,4 thed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA (2012) (ISBN1936113414), Davis et al., Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (2012) (ISBN044460149X), Laboratory Methods in Enzymology: DNA, Jon Lorsch(ed.) Elsevier,2013(ISBN0124199542), Current Protocols in Molecular Biology(CPMB),Frederick M.Ausubel(ed.),John Wiley and Sons,2014(ISBN047150338X,9780471503385),Current Protocols in Protein Science(CPPS),John E.Coligan(ed.), John Wiley and Sons, Inc., 2005, and Current Protocols in Immunology (CPI) (John E. Coligan, A.D.A. M. Kruisbeek, David H. Margulies, Ethan M. Shevach, Warren Strobe, (eds.) John Wiley and Sons, Inc., 2003 (ISBN 0471142735, 9780471142737), the contents of all of which are incorporated herein by reference in their entirety.
[0037] As used herein, the terms "administration," "administering," and variations thereof refer to the introduction of a composition or agent (e.g., a therapeutic nucleic acid or immunosuppressant described herein) into a subject, including simultaneous and sequential introduction of one or more compositions or agents. "Administration" can refer to, for example, therapeutic, pharmacokinetic, diagnostic, research, placebo, and experimental methods. "Administration" also encompasses in vitro and ex vivo treatments. Introduction of a composition or agent into a subject can be by any suitable route, including oral, pulmonary, intranasal, parenteral (intravenous, intramuscular, intraperitoneal, or subcutaneous), rectal, intralymphatic, intratumoral, or topical. Introduction of a composition or agent into a subject can be by electroporation. Administration includes self-administration and administration by another. Administration can be performed by any suitable route. A suitable administration route allows the composition or agent to perform its intended function. For example, if the suitable route is intravenous, the composition is administered by introducing the composition or agent into the subject's vein.
[0038] As used herein, the phrases "nucleic acid therapy," "therapeutic nucleic acid," and "TNA" are used interchangeably and refer to any modality of treatment that uses nucleic acids as the active ingredient of a therapeutic agent to treat a disease or disorder. As used herein, these terms refer to RNA-based therapeutics and DNA-based therapeutics. Non-limiting examples of RNA-based therapeutics include mRNA, antisense RNA and oligonucleotides, ribozymes, aptamers, interfering RNA (RNAi), Dicer substrate dsRNA, short hairpin RNA (shRNA), asymmetric interfering RNA (aiRNA), and microRNA (miRNA). Non-limiting examples of DNA-based therapeutics include minicircle DNA, minigene, viral DNA (e.g., lentivirus or AAV genome) or nonviral synthetic DNA vector, closed-end linear double-stranded DNA (ceDNA / CELiD), plasmid, bacmid, doggybone (dbDNA™) DNA vector, minimally immunologically defined gene expression (MIDGE) vector, nonviral ministring DNA vector (linear covalently closed DNA vector), or dumbbell-shaped DNA minimal vector ("dumbbell DNA").
[0039] As used herein, an "effective amount" or "therapeutically effective amount" of a therapeutic agent, such as a FVIII therapeutic protein or fragment thereof, is an amount sufficient to produce a desired effect, e.g., treatment or prevention of hemophilia A. Suitable assays for measuring the expression of a target gene or target sequence include, for example, examining protein or RNA levels using techniques known to those skilled in the art, such as dot blot, Northern blot, in situ hybridization, ELISA, immunoprecipitation, enzyme function, and phenotypic assays also known to those skilled in the art. However, dosage levels are based on a variety of factors, including the type of injury, age, weight, sex, patient condition, severity of the condition, route of administration, and the specific active agent used. Thus, dosage regimens can vary widely but can be routinely determined by a physician using standard methods. Additionally, the terms "therapeutic amount," "therapeutically effective amount," and "pharmaceutically effective amount" include prophylactic or preventative amounts of the described compositions of the present invention. In prophylactic or preventative uses of the described invention, the pharmaceutical composition or medicament is administered to a patient susceptible to or otherwise at risk of a disease, disorder, or condition, including the biochemical, histological, and / or behavioral symptoms of the disease, disorder, or condition, its complications, and intermediate pathological phenotypes manifesting during the development of the disease, disorder, or condition, in an amount sufficient to eliminate or reduce the risk, reduce the severity, or delay the onset of the disease, disorder, or condition. It is generally preferred to use the maximum dose, i.e., the highest safe dose, according to some medical judgment. According to some embodiments, the disease, disorder, or condition is hemophilia A. The terms "dose" and "administration" are used interchangeably herein.
[0040] As used herein, the term "therapeutic effect" refers to a result of treatment, which result is deemed desirable and beneficial. Therapeutic effect can include, directly or indirectly, the prevention, reduction, or elimination of disease symptoms. Therapeutic effect can also include, directly or indirectly, the prevention, reduction, or elimination of the progression of disease symptoms.
[0041] For any therapeutic agent described herein, the therapeutically effective amount can be initially determined from preliminary in vitro studies and / or animal models. The therapeutically effective dose can also be determined from human data. The applied dose can be adjusted based on the relative bioavailability and efficacy of the administered compound. Adjusting the dose to achieve maximum efficacy based on the above and other well-known methods is within the ability of a person skilled in the art. See Goodman and Gilman's The Pharmacological Basis of Therapeutics, 10, incorporated herein by reference. th General principles for determining therapeutic efficacy are summarized below and can be found in Chapter 1 of the "Medical Treatment Guidelines," IEEE Transactions on Clinical Trials and Clinical Practice, McGraw-Hill, New York (2001).
[0042] Pharmacokinetic principles provide the basis for modifying dosing regimens to achieve the desired degree of therapeutic effect while minimizing unacceptable side effects. In situations where the plasma concentration of a drug can be measured and is related to the therapeutic window, additional guidance regarding dosage modifications is available.
[0043] As used herein, the terms "heterologous nucleotide sequence" and "transgene" are used interchangeably and refer to a nucleic acid of interest (other than a nucleic acid encoding a capsid polypeptide) that can be incorporated into, delivered and expressed by, the ceDNA vectors disclosed herein.
[0044] As used herein, the terms "expression cassette" and "transcription cassette" are used interchangeably and refer to a linear stretch of nucleic acid that includes a transgene operably linked to one or more promoters or other regulatory sequences sufficient to direct transcription of the transgene, but does not include capsid coding sequences, other vector sequences, or inverted terminal repeat regions. An expression cassette may additionally include one or more cis-acting sequences (e.g., promoters, enhancers, or repressors), one or more introns, and one or more post-transcriptional regulatory elements.
[0045] The terms "polynucleotide" and "nucleic acid," used interchangeably herein, refer to polymeric forms of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. Thus, the terms include single-, double-, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. An "oligonucleotide" generally refers to a polynucleotide of about 5 to about 100 nucleotides, either single- or double-stranded DNA. However, for purposes of this disclosure, there is no upper limit to the length of an oligonucleotide. Oligonucleotides, also known as "oligomers" or "oligos," can be isolated from genes or chemically synthesized by methods known in the art. The terms "polynucleotide" and "nucleic acid" should be understood to include single-stranded (e.g., sense or antisense) and double-stranded polynucleotides, as applicable to the described embodiments. DNA can be in the form of, for example, antisense molecules, plasmid DNA, DNA-DNA duplexes, precondensed DNA, PCR products, vectors (P1, PAC, BAC, YAC, artificial chromosomes), expression cassettes, chimeric sequences, chromosomal DNA, or derivatives and combinations of these groups. DNA can be in the form of minicircles, plasmids, bacmids, minigenes, ministring DNA (linear covalently closed DNA vectors), closed-end linear double-stranded DNA (CELiD or ceDNA), doggybone (dbDNA™) DNA, dumbbell-shaped DNA, minimally immunologically defined gene expression (MIDGE) vectors, viral or non-viral vectors. RNA can be in the form of small interfering RNA (siRNA), Dicer substrate dsRNA, short hairpin RNA (shRNA), asymmetric interfering RNA (aiRNA), microRNA (miRNA), mRNA, rRNA, tRNA, viral RNA (vRNA), and combinations thereof.Nucleic acids include nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, and have similar binding properties to the reference nucleic acid. Examples of such analogs and / or modified residues include phosphorothioates, phosphorodiamidate morpholino oligomers (morpholinos), phosphoramidates, methyl phosphonates, chiral methyl phosphonates, 2'-O-methyl ribonucleotides, locked nucleic acids (LNA™), and peptide nucleic acids (PNAs). Unless otherwise specified, this term encompasses nucleic acids containing known analogs of natural nucleotides that have similar binding properties to the reference nucleic acid. Unless otherwise specified, a specific nucleic acid sequence also implicitly encompasses its conservatively modified variants (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences, as well as the explicitly indicated sequence.
[0046] A "nucleotide" contains the sugar deoxyribose (DNA) or ribose (RNA), a base, and a phosphate group. Nucleotides are linked together through the phosphate group.
[0047] "Base" includes purines and pyrimidines, which further include the naturally occurring compounds adenine, thymine, guanine, cytosine, uracil, inosine, and naturally occurring analogues, and synthetic derivatives of purines and pyrimidines, including, but not limited to, modifications that place new reactive groups such as, but not limited to, amines, alcohols, thiols, carboxylates, and alkyl halides.
[0048] As used herein, the term "interfering RNA" or "RNAi" or "interfering RNA sequence" includes single-stranded RNA (e.g., mature miRNA, ssRNAi oligonucleotide, ssDNAi oligonucleotide), double-stranded RNA (i.e., double-stranded RNA such as siRNA, Dicer substrate dsRNA, shRNA, aiRNA, or pre-miRNA), DNA-RNA hybrid (e.g., see PCT Publication No. 2004 / 078941), or DNA-DNA hybrid (e.g., see PCT Publication No. 2004 / 104199), which can reduce or inhibit the expression of a target gene or sequence when the interfering RNA is present in the same cell as the target gene or sequence (e.g., by mediating degradation or inhibiting the translation of mRNA complementary to the interfering RNA sequence). Thus, interfering RNA refers to a single-stranded RNA complementary to a target mRNA sequence, or a double-stranded RNA formed by two complementary strands or a single self-complementary strand. Interfering RNA can have substantial or complete identity to the target gene or sequence, or can contain mismatched regions (i.e., mismatch motifs). The sequence of interfering RNA can correspond to the full-length target gene or a subsequence thereof. Preferably, interfering RNA molecules are chemically synthesized. The disclosures of each of the above patent documents are incorporated herein by reference in their entirety for all purposes.
[0049] Interfering RNA includes "small interfering RNA" or "siRNA," e.g., an interfering RNA of about 15-60, 15-50, or 15-40 (duplex) nucleotides in length, more typically about 15-30, 15-25, or 19-25 (duplex) nucleotides in length, and preferably about 20-24, 21-22, or 21-23 (duplex) nucleotides in length (e.g., each complementary sequence of a double-stranded siRNA is The siRNA duplexes can be about 15-60, 15-50, 15-40, 15-30, 15-25, or 19-25 nucleotides in length, preferably about 20-24, 21-22, or 21-23 nucleotides in length, and the siRNA duplexes can be about 15-60, 15-50, 15-40, 15-30, 15-25, or 19-25 base pairs in length, preferably about 18-22, 19-20, or 19-21 base pairs in length.) The siRNA duplexes can include a 3' overhang of about 1 to about 4 nucleotides or about 2 to about 3 nucleotides and a 5' phosphate terminus. Examples of siRNA include, but are not limited to, the double-stranded polynucleotide molecule that is assembled from two separate strand molecules (one strand is sense strand, and the other is complementary antisense strand); the double-stranded polynucleotide molecule that is assembled from single-stranded molecules (sense and antisense regions are connected by nucleic acid-based or non-nucleic acid-based linker); the double-stranded polynucleotide molecule that has a hairpin secondary structure with self-complementary sense region and antisense region; and the circular single-stranded polynucleotide molecule that has a stem with two or more loop structures and self-complementary sense and antisense regions (circular polynucleotide can be processed in vivo or in vitro to produce active double-stranded siRNA molecules).As used herein, the term " siRNA " includes RNA-RNA duplex and DNA-RNA hybrid (see, for example, PCT Publication No. 2004 / 078941).
[0050] As used herein, the term "nucleic acid construct" refers to a single- or double-stranded nucleic acid molecule that is isolated from a naturally occurring gene, or that is modified to contain a segment of nucleic acid in a manner that would not otherwise occur in nature, or that is synthetic. The term nucleic acid construct is synonymous with the term "expression cassette" when the nucleic acid construct contains the control sequences necessary for expression of the coding sequence of the present disclosure. An "expression cassette" comprises a DNA coding sequence operably linked to a promoter.
[0051] "Hybridizable" or "complementary" or "substantially complementary" means that a nucleic acid (e.g., RNA) contains a sequence of nucleotides that allows it to non-covalently bind, i.e., "anneal" or "hybridize" to another nucleic acid in a sequence-specific, antiparallel manner (i.e., the nucleic acid specifically binds to a complementary nucleic acid) under appropriate in vitro and / or in vivo conditions of temperature and solution ionic strength, forming Watson-Crick base pairs and / or G / U base pairs. As is known in the art, standard Watson-Crick base pairings include adenine (A) pairing with thymidine (T), adenine (A) pairing with uracil (U), and guanine (G) pairing with cytosine (C). Additionally, it is also known in the art that guanine (G) bases pair with uracil (U) for hybridization between two RNA molecules (e.g., dsRNA). For example, G / U base pairing is partially responsible for the degeneracy (i.e., redundancy) of the genetic code in the context of tRNA anticodon base pairing with codons in mRNA. In the context of this disclosure, guanine (G) of the protein-binding segment (dsRNA duplex) of a subject DNA-targeting RNA molecule is considered to be complementary to uracil (U), and vice versa. Therefore, if a G / U base pair can be made at a given nucleotide position of the protein-binding segment (dsRNA duplex) of a subject DNA-targeting RNA molecule, that position is not considered to be non-complementary, but instead is considered to be complementary.
[0052] The terms "peptide," "polypeptide," and "protein" are used interchangeably herein to refer to polymeric forms of amino acids of any length, which may include coded and non-coded amino acids, amino acids that are chemically or biochemically modified or derivatized, and polypeptides with modified peptide backbones.
[0053] A DNA sequence that "encodes" a particular FVIII protein is a DNA nucleic acid sequence that is transcribed into a particular RNA and / or protein. The DNA polynucleotide may encode an RNA (mRNA) that is translated into a protein, or the DNA polynucleotide may encode an RNA that is not translated into a protein (e.g., tRNA, rRNA, or DNA-targeting RNA, also called "non-coding" RNA or "ncRNA").
[0054] As used herein, the term "fusion protein" refers to a polypeptide comprising protein domains from at least two different proteins. For example, the fusion protein may comprise (i) FVIII or a fragment thereof, and (ii) at least one non-GOI protein. Fusion proteins encompassed herein include, but are not limited to, an antibody, or an Fc or antigen-binding fragment of an antibody fused to the extracellular domain of a FVIII protein, such as a receptor, ligand, enzyme, or peptide. The FVIII protein or fragment thereof that is part of the fusion protein may be a monospecific antibody or a bispecific or multispecific antibody.
[0055] As used herein, the term "genomic safe harbor gene" or "safe harbor gene" refers to a gene or locus into which a nucleic acid sequence can be inserted such that the sequence can integrate and function in a predictable manner (e.g., express a protein of interest) without significantly adversely affecting endogenous gene activity or promoting cancer. In some embodiments, a safe harbor gene is also a locus or gene at which the inserted nucleic acid sequence can be expressed more efficiently and at higher levels than at a non-safe harbor site.
[0056] As used herein, the term "gene delivery" refers to the process by which foreign DNA is introduced into host cells for gene therapy applications.
[0057] As used herein, the term "terminal repeat" or "TR" includes any viral terminal repeat or synthetic sequence that contains at least one minimally necessary replication origin and a region containing a palindromic hairpin structure. The Rep binding sequence ("RBS") (also referred to as an RBE (Rep binding element)) and terminal resolution site ("TRS") together constitute the "minimally necessary replication origin," and thus, a TR contains at least one RBS and at least one TRS. TRs that are reverse complements of each other within a given stretch of a polynucleotide sequence are typically referred to as "inverted terminal repeats" or "ITRs," respectively. In the context of viruses, ITRs mediate replication, viral packaging, integration, and proviral rescue. As unexpectedly discovered herein in the present invention, TRs that are not reverse complements over their entire length can still perform the traditional functions of ITRs; therefore, the term ITR is used herein to refer to TRs in a ceDNA genome or ceDNA vector that can mediate replication of the ceDNA vector. It will be understood by those skilled in the art that there can be three or more ITRs or asymmetric ITR pairs in the construction of a composite ceDNA vector.ITR can be AAV ITR or non-AAV ITR, or can be derived from AAV ITR or non-AAV ITR.For example, ITR can be derived from Parvoviridae, including parvovirus and dependovirus (for example, canine parvovirus, bovine parvovirus, mouse parvovirus, porcine parvovirus, human parvovirus B-19), or the SV40 hairpin that serves as the origin of SV40 replication can be used as ITR, which can be further modified by truncation, substitution, deletion, insertion, and / or addition.Parvoviridae viruses are composed of two subfamilies: Parvovirinae, which infect vertebrates, and Densovirinae, which infect invertebrates. Dependoparvoviruses include the adeno-associated virus (AAV) family of viruses that are capable of replication in vertebrate hosts, including but not limited to humans, primates, bovine, canine, equine, and ovine species.For convenience herein, an ITR located 5' to (upstream of) an expression cassette in a ceDNA vector is referred to as the "5' ITR" or "left ITR," and an ITR located 3' to (downstream of) an expression cassette in a ceDNA vector is referred to as the "3' ITR" or "right ITR."
[0058] "Wild-type ITR" or "WT-ITR" refers to the sequence of a naturally occurring ITR sequence in, for example, an AAV or other depend virus, that retains Rep binding activity and Rep nicking ability. The nucleotide sequence of a WT-ITR from any AAV serotype may differ slightly from the naturally occurring canonical sequence due to degeneracy in the genetic code or drift; therefore, WT-ITR sequences encompassed for use herein include WT-ITR sequences that result from naturally occurring variations (e.g., replication errors) that occur during the production process.
[0059] As used herein, the term "substantially symmetric WT-ITR" or "substantially symmetric WT-ITR pair" refers to a pair of WT-ITRs within a single ceDNA genome or ceDNA vector, both of which are wild-type ITRs with reverse-complementary sequences throughout their entire length. For example, an ITR can be considered to have a wild-type sequence even if it has one or more nucleotides that deviate from the naturally occurring canonical sequence, as long as the changes do not affect the sequence's characteristics and overall three-dimensional structure. In some embodiments, the deviating nucleotides represent conservative sequence changes. As a non-limiting example, a sequence has at least 95%, 96%, 97%, 98%, or 99% sequence identity (e.g., as measured using BLAST with default settings) to the canonical sequence and has a symmetric three-dimensional spatial organization relative to the other WT-ITR, such that their three-dimensional structures have the same shape in geometric space. A substantially symmetric WT-ITR has the same A, C-C', and B-B' loops in three-dimensional space. Substantially symmetric WT ITRs can be functionally confirmed as WT by determining that they have an operable Rep binding site (RBE or RBE') and terminal resolution site (TRS) that pairs with the appropriate Rep protein. Optionally, other functions can be tested, including transgene expression under permissive conditions.
[0060] As used herein, the phrases "modified ITR" or "mod-ITR" or "mutant ITR" are used interchangeably herein and refer to an ITR that has a mutation in at least one or more nucleotides compared to a WT-ITR from the same serotype. The mutation may result in a change in one or more of the A, C, C', B, and B' regions of the ITR, resulting in a change in the three-dimensional spatial configuration (i.e., its three-dimensional structure in geometric space) compared to the three-dimensional spatial configuration of a WT-ITR from the same serotype.
[0061] As used herein, the term "asymmetric ITR," also referred to as an "asymmetric ITR pair," refers to a pair of ITRs within a single ceDNA genome or ceDNA vector that are not reverse complements across their entire length. As a non-limiting example, an asymmetric ITR pair does not have a symmetrical three-dimensional spatial configuration relative to its cognate ITR, such that their three-dimensional structures are different shapes in geometric space. In other words, an asymmetric ITR pair differs in overall geometric structure, i.e., the configuration of their A, C-C', and B-B' loops in three-dimensional space (e.g., compared to the cognate ITR), differs. The sequence difference between the two ITRs may be due to one or more nucleotide additions, deletions, truncations, or point mutations. In one embodiment, one ITR of the asymmetric ITR pair may be a wild-type AAV ITR sequence, and the other ITR may be a modified ITR (e.g., a non-wild-type or synthetic ITR sequence) as defined herein. In another embodiment, neither ITR of the asymmetric ITR pair is a wild-type AAV sequence, but rather the two ITRs are modified ITRs with different shapes in geometric space (i.e., different overall geometric structures). In some embodiments, one mod-ITR of the asymmetric ITR pair can have a short C-C' arm, and the other ITR can have a different modification (e.g., a single arm, or a short B-B' arm, etc.) such that they have a different three-dimensional spatial organization compared to their cognate asymmetric mod-ITR.
[0062] As used herein, the term "symmetric ITRs" refers to a pair of ITRs within a single ceDNA genome or ceDNA vector that are wild-type or mutant (e.g., modified relative to wild-type) dependovirus ITR sequences and are reverse-complementary throughout their entire length. In one non-limiting example, both ITRs are wild-type ITR sequences from AAV2. In another example, neither ITR is a wild-type ITR AAV2 sequence (i.e., they are modified ITRs, also referred to as mutant ITRs), and may differ in sequence from the wild-type ITR due to nucleotide additions, deletions, substitutions, truncations, or point mutations. For convenience, the ITR located 5' (upstream) of the expression cassette in the ceDNA vector is referred to as the "5' ITR" or "left ITR," and the ITR located 3' (downstream) of the expression cassette in the ceDNA vector is referred to as the "3' ITR" or "right ITR."
[0063] As used herein, the term "substantially symmetric modified ITR" or "substantially symmetric mod-ITR pair" refers to a pair of modified ITRs within a single ceDNA genome or ceDNA vector, both of which have reverse-complementary sequences throughout their entire length. For example, modified ITRs can be considered substantially symmetric even if there are some nucleotide sequence deviations from the reverse-complementary sequence, as long as the changes do not affect the properties and overall shape. As a non-limiting example, the sequences have at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity (measured using BLAST with default settings) to the canonical sequence and have a symmetric three-dimensional spatial organization relative to their cognate modified ITR, such that their three-dimensional structures have the same shape in geometric space. In other words, a substantially symmetric modified ITR pair has the same A, C-C', and B-B' loops organized in three-dimensional space. In some embodiments, the ITRs from a mod-ITR pair may have different reverse-complementary nucleotide sequences but still have the same symmetrical three-dimensional spatial organization. That is, both ITRs have mutations that result in the same overall three-dimensional shape. For example, one ITR (e.g., the 5' ITR) of a mod-ITR pair may be derived from one serotype, and the other ITR (e.g., the 3' ITR) may be derived from a different serotype, but both may have the same corresponding mutation (e.g., if the 5' ITR has a deletion in the C region, the cognate modified 3' ITR of the different serotype will have a deletion in the corresponding position in the C' region), thereby resulting in the modified ITR pair having the same symmetrical three-dimensional spatial organization. In such embodiments, each ITR of a modified ITR pair can be derived from a different serotype (e.g., AAV1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, and 12), such as a combination of AAV2 and AAV6, and modifications in one ITR are reflected in the corresponding position of the cognate ITR of the different serotype. In one embodiment, a substantially symmetric modified ITR pair refers to a pair of modified ITRs (mod-ITRs), so long as the nucleotide sequence differences between the ITRs do not affect their properties or overall shape and they have substantially the same shape in three-dimensional space.As a non-limiting example, a mod-ITR has at least 95%, 96%, 97%, 98%, or 99% sequence identity to a canonical mod-ITR, as determined by standard means well known in the art, such as BLAST (Basic Local Alignment Search Tool) or BLASTN with default settings, and has a symmetrical three-dimensional spatial organization such that their three-dimensional structures have the same shape in geometric space. A substantially symmetric mod-ITR pair will have the same A, C-C', and B-B' loops in three-dimensional space. For example, if the modified ITR of a substantially symmetric mod-ITR pair has a deletion of the C-C' arm, the cognate mod-ITR will have a corresponding deletion of the C-C' loop and a similar three-dimensional structure of the remaining A and B-B' loops that are the same shape in geometric space as its cognate mod-ITR.
[0064] The term "flanking" refers to the relative position of one nucleic acid sequence with respect to another. Generally, in the sequence ABC, B is adjacent to A and C. Similarly for the arrangement AxBxC. Thus, a flanking sequence precedes or follows the flanked sequence, but need not be contiguous with or immediately adjacent to the flanked sequence. In one embodiment, the term flanking refers to the terminal repeats at each end of a linear, double-stranded ceDNA vector.
[0065] As used herein, the terms "treat," "treating," and / or "treatment" include arresting, substantially inhibiting, slowing, or reversing the progression of a condition, substantially ameliorating clinical symptoms of a condition, or substantially preventing the appearance of clinical symptoms, or obtaining beneficial or desired clinical results. According to some embodiments, the condition is hemophilia A. Treating further refers to achieving one or more of: (a) reducing the severity of the disorder; (b) limiting the onset of symptoms characteristic of the disorder being treated; (c) limiting the worsening of symptoms characteristic of the disorder being treated; (d) limiting the recurrence of the disorder in patients who previously had the disorder; and (e) limiting the recurrence of symptoms in patients who were previously asymptomatic for the disorder. Beneficial or desired clinical results, such as pharmacological and / or physiological effects, include, but are not limited to, preventing a disease, disorder, or condition from occurring in a subject who may be predisposed to the disease, disorder, or condition, but who has not yet experienced or exhibited symptoms of the disease (prophylactic treatment), alleviating the symptoms of the disease, disorder, or condition, reducing the severity of the disease, disorder, or condition, stabilizing (i.e., not worsening) the disease, disorder, or condition, preventing the spread of the disease, disorder, or condition, delaying or slowing the progression of the disease, disorder, or condition, ameliorating or alleviating the disease, disorder, or condition, and combinations thereof, as well as prolonging survival as compared to expected survival if not receiving treatment.
[0066] As used herein, the terms "increase," "enhance," and "elevate" (and similar terms) generally refer to the act of increasing, directly or indirectly, a concentration, level, function, activity, or behavior relative to natural, expected, or average, or relative to a control condition.
[0067] As used herein, the terms "minimize," "reduce," "decrease," and / or "inhibit" (and similar terms) generally refer to the act of decreasing, either directly or indirectly, a concentration, level, function, activity, or behavior relative to natural, expected, or average, or relative to a control condition.
[0068] As used herein, the term "ceDNA genome" refers to an expression cassette that further incorporates at least one inverted terminal repeat region. The ceDNA genome may further comprise one or more spacer regions. In some embodiments, the ceDNA genome is incorporated into a plasmid or viral genome as an intermolecular double-stranded polynucleotide of DNA.
[0069] As used herein, the term "ceDNA spacer region" refers to an intervening sequence that separates functional elements in a ceDNA vector or ceDNA genome. In some embodiments, the ceDNA spacer region maintains two functional elements at a desired distance for optimal functionality. In some embodiments, the ceDNA spacer region provides or increases the genetic stability of the ceDNA genome, for example, within a plasmid or baculovirus. In some embodiments, the ceDNA spacer region facilitates easy genetic manipulation of the ceDNA genome by providing a convenient location for cloning sites, etc. For example, in certain aspects, an oligonucleotide "polylinker" containing several restriction endonuclease sites, or a non-open reading frame sequence designed to lack known protein (e.g., transcription factor) binding sites, can be positioned in the ceDNA genome to separate cis-acting elements, e.g., inserting a 6-mer, 12-mer, 18-mer, 24-mer, 48-mer, 86-mer, 176-mer, etc., between the terminal resolution site and the upstream transcriptional regulatory element. Similarly, a spacer can be incorporated between the polyadenylation signal sequence and the 3' terminal resolution site.
[0070] As used herein, the terms "Rep binding site," "Rep binding element," "RBE," and "RBS" are used interchangeably and refer to the binding site of a Rep protein (e.g., AAV Rep 78 or AAV Rep 68), which, upon binding by the Rep protein, allows the Rep protein to perform its site-specific endonuclease activity on the sequence incorporating the RBS. An RBS sequence and its reverse complement together form a single RBS. RBS sequences are known in the art and include, for example, the RBS sequence specified in AAV2, 5'-GCGCGCTCGCTCGCTC-3' (SEQ ID NO: 60). Any known RBS sequence may be used in embodiments of the present invention, including other known AAV RBS sequences and other naturally occurring or synthetic RBS sequences. Without being bound by theory, it is believed that the nuclease domain of the Rep protein binds to the double-stranded nucleotide sequence GCTC, and thus two known AAV Rep proteins directly bind to the double-stranded oligonucleotide 5'-(GCGC)(GCTC)(GCTC)(GCTC)-3' (SEQ ID NO: 60) and stably assemble. In addition, soluble aggregated conformers (i.e., an indefinite number of interrelated Rep proteins) dissociate and bind to oligonucleotides containing the Rep binding site. Each Rep protein interacts with both the nitrogenous bases and the phosphodiester backbone on each strand. The interactions with the nitrogenous bases provide sequence specificity, while the interactions with the phosphodiester backbone are non- or low-sequence specific, stabilizing the protein-DNA complex.
[0071] As used herein, the terms "terminal resolution site" and "TRS" are used interchangeably herein and refer to the region where Rep forms a tyrosine-phosphodiester bond with 5'-thymidine, generating a 3'-OH that serves as a substrate for DNA elongation via cellular DNA polymerases, such as DNA pol delta or DNA pol epsilon. Alternatively, the Rep-thymidine complex can participate in a coordinate ligation reaction. In some embodiments, the TRS minimally contains non-base-paired thymidines. In some embodiments, the nicking efficiency of the TRS can be controlled, at least in part, by its distance from the RBS within the same molecule. When the acceptor substrate is a complementary ITR, the resulting product is an intermolecular duplex. TRS sequences are known in the art and include, for example, the hexanucleotide sequence 5'-GGTTGA-3' (SEQ ID NO: 61) identified in AAV2. Any known TRS sequence can be used in embodiments of the invention, including other known AAV TRS sequences, other naturally known or synthetic TRS sequences such as AGTT (SEQ ID NO: 62), GGTTGG (SEQ ID NO: 63), AGTTGG (SEQ ID NO: 64), AGTTGA (SEQ ID NO: 65), and other motifs such as RRTTRR (SEQ ID NO: 66).
[0072] As used herein, the term "ceDNA-plasmid" refers to a plasmid that contains a ceDNA genome as an intermolecular duplex.
[0073] As used herein, the term "ceDNA-bacmid" refers to an infectious baculovirus genome that contains a ceDNA genome as an intermolecular duplex that can be propagated as a plasmid in E. coli, thereby acting as a shuttle vector for baculovirus.
[0074] As used herein, the term "ceDNA-baculovirus" refers to a baculovirus that contains a ceDNA genome as an intermolecular duplex within the baculovirus genome.
[0075] As used herein, the terms "ceDNA-baculovirus-infected insect cells" and "ceDNA-BIIC" are used interchangeably and refer to invertebrate host cells (including but not limited to insect cells (e.g., Sf9 cells)) infected with a ceDNA-baculovirus.
[0076] As used herein, the term "ceDNA" refers to capsid-free, closed-ended, linear, double-stranded (ds) duplex DNA for synthetic or other non-viral gene transfer. A detailed description of ceDNA is provided in International Application PCT / US2017 / 020828, filed March 3, 2017, the entire contents of which are expressly incorporated herein by reference. Certain methods for producing ceDNA containing various inverted terminal repeat (ITR) sequences and configurations using cell-based methods are described in Example 1 of International Application Nos. 18 / 49996, filed September 7, 2018, and 2018 / 064242, filed December 6, 2018, each of which is incorporated herein by reference in its entirety. Certain methods for the production of synthetic ceDNA vectors containing various ITR sequences and configurations are described, for example, in International Application No. 2019 / 14122, filed January 18, 2019, the entire contents of which are incorporated herein by reference.
[0077] As used herein, the term "closed-end DNA vector" refers to a capsid-free DNA vector that has at least one covalently closed end and at least a portion of the vector has an intramolecular double-stranded structure.
[0078] As used herein, the terms "ceDNA vector" and "ceDNA" are used interchangeably and refer to a closed-end DNA vector containing at least one terminal palindrome. In some embodiments, the ceDNA contains two covalently closed ends.
[0079] As used herein, the term "neDNA" or "nicked ceDNA" refers to closed-end DNA that has a nick or gap of 1 to 100 base pairs in the stem or spacer region 5' upstream of the open reading frame (e.g., the promoter and transgene to be expressed).
[0080] As used herein, the terms "gap" and "nick" are used interchangeably and refer to an interrupted portion of the synthetic DNA vector of the invention, creating a stretch of single-stranded DNA in the otherwise double-stranded cDNA. The gap can be from 1 base pair to 100 base pairs in length for one strand of the double-stranded DNA. Exemplary gaps designed and created by the methods described herein, and synthetic vectors generated thereby, can be, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 bp in length. Exemplary gaps in the present disclosure can be 1 bp to 10 bp in length, 1 to 20 bp in length, or 1 to 30 bp in length.
[0081] As defined herein, a "reporter" refers to a protein that can be used to provide a detectable readout. Reporters generally produce a measurable signal, such as fluorescence, color, or luminescence. A reporter protein coding sequence encodes a protein whose presence in a cell or organism is easily observed. For example, fluorescent proteins cause cells to fluoresce when excited with a particular wavelength of light, luciferase causes cells to catalyze a light-producing reaction, and enzymes such as β-galactosidase convert a substrate into a colored product. Exemplary reporter polypeptides useful for experimental or diagnostic purposes include, but are not limited to, β-lactamase, β-galactosidase (LacZ), alkaline phosphatase (AP), thymidine kinase (TK), green fluorescent protein (GFP) and other fluorescent proteins, chloramphenicol acetyltransferase (CAT), luciferase, and others well known in the art.
[0082] As used herein, the terms "sense" and "antisense" refer to the orientation of a structural element on a polynucleotide. The sense and antisense versions of an element are the reverse complements of each other.
[0083] As used herein, the terms "synthetic AAV vector" and "synthetic production of AAV vector" refer to AAV vectors and methods for their synthetic production in an entirely cell-free environment.
[0084] As used herein, "reporter" refers to a protein that can be used to provide a detectable readout. Reporters generally produce a measurable signal, such as fluorescence, color, or luminescence. A reporter protein coding sequence encodes a protein whose presence in a cell or organism is easily observed. For example, fluorescent proteins cause cells to fluoresce when excited with a particular wavelength of light, luciferase causes cells to catalyze a light-producing reaction, and enzymes such as β-galactosidase convert a substrate into a colored product. Exemplary reporter polypeptides useful for experimental or diagnostic purposes include, but are not limited to, β-lactamase, β-galactosidase (LacZ), alkaline phosphatase (AP), thymidine kinase (TK), green fluorescent protein (GFP) and other fluorescent proteins, chloramphenicol acetyltransferase (CAT), luciferase, and others well known in the art.
[0085] As used herein, the term "effector protein" refers to a polypeptide that provides a detectable readout, for example, as a reporter polypeptide, or more appropriately, as a cell-killing polypeptide, such as a toxin or a drug that renders cells susceptible to killing by a selected agent or its deletion. Effector proteins include any protein or peptide that directly targets or damages host cell DNA and / or RNA. For example, effector proteins include, but are not limited to, restriction endonucleases (whether genomic or extrachromosomal) that target host cell DNA sequences, proteases that target polypeptides required for cell survival, DNA gyrase inhibitors, and ribonuclease-type toxins. In some embodiments, the expression of an effector protein controlled by a synthetic biological circuit described herein can participate as a factor in another synthetic biological circuit, thereby expanding the range and complexity of the biological circuit system's responsiveness.
[0086] Transcriptional regulator refers to transcriptional activators and repressors that activate or repress the transcription of genes of interest, such as FVIII. A promoter is a region of nucleic acid that initiates the transcription of a specific gene. A transcriptional activator typically binds near the transcriptional promoter and recruits RNA polymerase to directly initiate transcription. A repressor binds to the transcriptional promoter and sterically hinders the transcription initiation by RNA polymerase. Other transcriptional regulators can serve as either activators or repressors depending on where they bind and cellular and environmental conditions. Non-limiting examples of transcriptional regulator classes include, but are not limited to, homeodomain proteins, zinc finger proteins, winged helix (forkhead) proteins, and leucine zipper proteins.
[0087] As used herein, a "repressor protein" or an "inducer protein" is a protein that binds to a regulatory sequence element and represses or activates, respectively, the transcription of a sequence operably linked to the regulatory sequence element. Preferred repressor and inducer proteins described herein are sensitive to the presence or absence of at least one input agent or environmental input. Preferred proteins described herein are modular in form, for example, containing separable DNA binding and input agent binding or response elements or domains.
[0088] As used herein, "carrier" includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, etc. The use of such media and agents for pharmaceutical active substances is well known in the art. Supplementary active ingredients can also be incorporated into the composition. The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that do not produce toxic, allergic, or similar adverse reactions when administered to a host.
[0089] As used herein, an "input agent responsive domain" is a domain of a transcription factor that binds to or otherwise responds to a condition or input agent in a manner that renders the linked DNA-binding fusion domain responsive to the presence of that condition or input. In one embodiment, the presence of the condition or input results in a conformational change in the input agent responsive domain or the protein to which it is fused, which modifies the transcriptional regulatory activity of the transcription factor.
[0090] The term "in vivo" refers to an assay or process that occurs in or within an organism, such as a multicellular animal. In some of the embodiments described herein, a method or use may be said to occur "in vivo" when a unicellular organism, such as a bacterium, is used. The term "ex vivo" refers to methods and uses that are carried out using living cells with intact membranes outside the body of a multicellular animal or plant, such as explants, cultured cells (including primary cells and cell lines), transformed cell lines, and extracted tissues or cells (including blood cells), among others. The term "in vitro" refers to assays and methods that do not require the presence of cells with intact membranes, such as cell extracts, and can refer to introducing a programmable synthetic biological circuit into a non-cellular system, e.g., a medium that does not contain cells or cell systems, such as a cell extract.
[0091] As used herein, the term "promoter" refers to any nucleic acid sequence that regulates the expression of another nucleic acid sequence by driving the transcription of that nucleic acid sequence, which may be a heterologous target gene encoding a protein or RNA. A promoter can be constitutive, inducible, repressible, tissue-specific, or any combination thereof. A promoter is a control region of a nucleic acid sequence that controls the initiation and rate of transcription of the remainder of the nucleic acid sequence. A promoter can also contain genetic elements to which regulatory proteins and molecules, such as RNA polymerase and other transcription factors, can bind. In some embodiments of the aspects described herein, a promoter can drive the expression of transcription factors that regulate its own expression. Within the promoter sequence, one will find a transcription initiation site, as well as protein binding domains involved in the binding of RNA polymerase. Eukaryotic promoters often, but not necessarily, contain "TATA" and "CAT" boxes. A variety of promoters, including inducible promoters, can be used to drive the expression of transgenes in the ceDNA vectors disclosed herein. The promoter sequence is bounded at its 3' end by a transcription initiation site and extends upstream (5' orientation) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background.
[0092] As used herein, the term "enhancer" refers to a cis-acting regulatory sequence (e.g., 50 to 1,500 base pairs) that binds to one or more proteins (e.g., activator proteins or transcription factors) to increase transcriptional activation of a nucleic acid sequence. Enhancers can be located upstream of the start site of the gene they regulate or up to 1,000,000 base pairs downstream of the start site of the gene. Enhancers can be located within intronic or exon regions of unrelated genes.
[0093] A promoter can be said to drive the expression or transcription of the nucleic acid sequence it regulates. The phrases "operably linked," "operably positioned," "operably linked," "under control," and "under transcriptional control" indicate that the promoter is in the correct functional location and / or orientation with respect to a nucleic acid sequence and regulates to control transcription initiation and / or expression of that sequence. As used herein, an "inverted promoter" refers to a promoter in which a nucleic acid sequence is in the reverse orientation, whereby what was the coding strand is now the non-coding strand, and vice versa. Inverted promoter sequences are used in various embodiments to regulate the state of a switch. Additionally, in various embodiments, a promoter can be used in conjunction with an enhancer.
[0094] A promoter can be naturally associated with a gene or sequence, which can be obtained by isolating the 5' non-coding sequence located upstream of the coding segment and / or exon of a given gene or sequence. Such a promoter can be called "endogenous." Similarly, in some embodiments, an enhancer can be naturally associated with a nucleic acid sequence, located either downstream or upstream of the sequence.
[0095] In some embodiments, a coding nucleic acid segment is placed under the control of a "recombinant promoter" or "heterologous promoter," both of which refer to a promoter that is not normally associated with an operably linked encoded nucleic acid sequence in its natural environment. A recombinant or heterologous enhancer refers to an enhancer that is not normally associated with a given nucleic acid sequence in its natural environment. Such promoters or enhancers can include promoters or enhancers of other genes, promoters or enhancers isolated from any other prokaryotic, viral, or eukaryotic cell, and synthetic promoters or enhancers that are not "naturally occurring," i.e., may contain different elements of different transcriptional regulatory regions and / or mutations that alter expression through methods of genetic engineering known in the art. In addition to synthetically producing promoter and enhancer nucleic acid sequences, promoter sequences can be produced using recombinant cloning and / or nucleic acid amplification techniques, including PCR, for the synthetic biological circuits and modules disclosed herein (see, e.g., U.S. Pat. Nos. 4,683,202 and 5,928,906, each of which is incorporated herein by reference). Furthermore, it is contemplated that regulatory sequences that direct transcription and / or expression of sequences within non-nuclear organelles, such as mitochondria, chloroplasts, etc., can be similarly employed.
[0096] As described herein, an "inducible promoter" is characterized by initiating or enhancing transcriptional activity when in the presence of, affected by, or contacted by an inducer or inducer agent. As defined herein, an "inducer" or "inducing agent" can be endogenous or can be a compound or protein, usually exogenous, administered in such a manner that it is active in inducing transcriptional activity from an inducible promoter. In some embodiments, the inducer or inducer, i.e., a chemical, compound, or protein, can itself be the result of transcription or expression of a nucleic acid sequence (i.e., the inducer can be an inducer protein expressed by another component or module) and can itself be under the control of an inducible promoter. In some embodiments, an inducible promoter is induced in the absence of certain agents, such as repressors. Examples of inducible promoters include, but are not limited to, tetracycline, metallothionine, ecdysone, mammalian viruses (e.g., adenovirus late promoter and mouse mammary tumor virus long terminal repeat (MMTV-LTR)), as well as other steroid-responsive promoters, rapamycin-responsive promoters, and the like.
[0097] The terms "DNA regulatory sequence," "control element," and "regulatory element," used interchangeably herein, refer to transcriptional and translational control sequences, such as promoters, enhancers, polyadenylation signals, terminators, proteolysis signals, etc., that provide for and / or regulate the transcription of a non-coding sequence (e.g., a DNA-targeting RNA) or a coding sequence (e.g., a site-directed modifying polypeptide or a Cas9 / Csn1 polypeptide) and / or regulate the translation of the encoded polypeptide.
[0098] "Operably linked" refers to a juxtaposition of the components described in such a way that they are in a relationship that allows them to function in their intended manner. For example, a promoter is operably linked to a coding sequence if the promoter affects its transcription or expression. An "expression cassette" comprises a heterologous DNA sequence operably linked to a promoter or other regulatory sequence sufficient to direct the transcription of a transgene in a ceDNA vector. Suitable promoters include, for example, tissue-specific promoters. The promoter may also be of AAV origin.
[0099] As used herein, the term "subject" refers to a human or animal to which treatment, including prophylactic treatment, with a ceDNA vector according to the present invention is provided. Typically, the animal is a vertebrate, such as, but not limited to, a primate, a rodent, a domestic animal, or a game animal. Primates include, but are not limited to, chimpanzees, cynomolgus monkeys, spider monkeys, and macaques, such as rhesus monkeys. Rodents include mice, rats, woodchucks, ferrets, rabbits, and hamsters. Domestic and game animals include, but are not limited to, cattle, horses, pigs, deer, bison, buffalo, felines, such as domestic cats, canines, such as dogs, foxes, wolves, avian species, such as chickens, emus, ostriches, and fish, such as trout, catfish, and salmon. In certain embodiments of the aspects described herein, the subject is a mammal, such as a primate or human. The subject may be male or female. Additionally, the subject may be an infant or child. In some embodiments, the subject may be a newborn or fetal subject, e.g., the subject is present in utero. Preferably, the subject is a mammal. The mammal may be, but is not limited to, a human, non-human primate, mouse, rat, dog, cat, horse, or cow. Non-human mammals may be advantageously used as subjects representing animal models of diseases and disorders. In addition, the methods and compositions described herein may be used with domestic animals and / or pets. Human subjects may be of any age, sex, race, or ethnic group, e.g., Caucasian (white), Asian, African, Black, African-American, African-European, Latino, Middle Eastern, etc. In some embodiments, the subject may be a patient or other subject in a clinical setting. In some embodiments, the subject has already received treatment. In some embodiments, the subject is an embryo, fetus, newborn, infant, child, adolescent, or adult. In some embodiments, the subject is a human fetus, human newborn, human infant, human child, human adolescent, or human adult. In some embodiments, the subject is an animal embryo, or a non-human embryo or a non-human primate embryo, hi some embodiments, the subject is a human embryo.
[0100] As used herein, the term "host cell" includes any cell type that is amenable to transformation, transfection, transduction, etc. with a nucleic acid construct or ceDNA expression vector of the present disclosure. By way of non-limiting example, host cells include isolated primary cells, pluripotent stem cells, CD34 + The host cells can be either human cells, induced pluripotent stem cells, or any of several immortalized cell lines (e.g., HepG2 cells). Alternatively, the host cells can be in situ or in vivo cells in a tissue, organ, or organism.
[0101] The term "exogenous" refers to a substance present in a cell other than its natural source. As used herein, the term "exogenous" can refer to a nucleic acid (e.g., a nucleic acid encoding a polypeptide) or polypeptide that is not normally found and that has been introduced into a biological system, such as a cell or organism, by a process involving the hand of man, where it is desired to introduce the nucleic acid or polypeptide into such a cell or organism. Alternatively, "exogenous" can refer to a nucleic acid or polypeptide that is found in relatively low amounts and that has been introduced into a biological system, such as a cell or organism, by a process involving the hand of man, where it is desired to increase the amount of the nucleic acid or polypeptide in the cell or organism, e.g., to result in ectopic expression or levels. In contrast, the term "endogenous" refers to a substance that is natural to a biological system or cell.
[0102] The term "sequence identity" refers to the relationship between two nucleotide sequences. For purposes of this disclosure, the degree of sequence identity between two deoxyribonucleotide sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, supra), preferably version 3.0.0 or later. Optional parameters used are a gap opening penalty of 10, a gap extension penalty of 0.5, and the EDNAFULL (EMBOSS version in NCBI NUC4.4) substitution matrix. The output of Needle labeled "Longest Identity" (obtained using the -nobrief option) is used as the percent identity, calculated as follows: (identical deoxyribonucleotides × 100) / length of alignment - total number of gaps in the alignment). The length of the alignment is preferably at least 10 nucleotides, preferably at least 25 nucleotides, more preferably at least 50 nucleotides, and most preferably at least 100 nucleotides.
[0103] As used herein, the term "homology" or "homology" is defined as the percentage of nucleotide residues that are identical to the nucleotide residues of the corresponding sequence on the target chromosome, after aligning the sequences as necessary and introducing gaps to achieve the maximum sequence identity percentage. Alignment for determining the percentage of nucleotide sequence homology can be achieved in a variety of ways within the skill of the art, for example, using publicly available computer software such as BLAST, BLAST-2, ALIGN, ClustalW2, or Megalign (DNASTAR) software. Those skilled in the art can determine the appropriate parameters for aligning sequences, including any algorithms required to achieve maximum alignment across the entire length of the sequences being compared. In some embodiments, for example, a nucleic acid sequence (e.g., a DNA sequence) of an arm of homology is considered "homologous" if the sequence is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more identical to the corresponding native or unedited nucleic acid sequence (e.g., genomic sequence) of the host cell.
[0104] As used herein, the term "heterologous" refers to a nucleotide or polypeptide sequence that is not found in a naturally occurring nucleic acid or protein, respectively. A heterologous nucleic acid sequence can be linked (e.g., by genetic engineering) to a naturally occurring nucleic acid sequence (or a variant thereof) to generate a chimeric nucleotide sequence that encodes a chimeric polypeptide. A heterologous nucleic acid sequence can be linked (e.g., by genetic engineering) to a variant polypeptide to generate a nucleotide sequence that encodes a fusion variant polypeptide.
[0105] A "vector" or "expression vector" is a replicon, such as a plasmid, bacmid, phage, virus, virion, or cosmid, to which another DNA segment, i.e., an "insert," can be attached to effect replication of the attached segment in a cell. A vector can be a nucleic acid construct designed for delivery to a host cell or for transfer between different host cells. As used herein, a vector can be viral or non-viral in origin and / or final form, but for purposes of this disclosure, "vector," as the term is used herein, generally refers to a ceDNA vector. The term "vector" encompasses any genetic element that, when associated with the appropriate control elements, is capable of replication and transfer of genetic sequences into a cell. In some embodiments, the vector can be an expression vector or a recombinant vector.
[0106] As used herein, the term "expression vector" refers to a vector that directs the expression of RNA or polypeptides from sequences linked to transcriptional regulatory sequences on the vector. The expressed sequences are often, but not necessarily, heterologous to the cell. Expression vectors can contain additional elements; for example, an expression vector can have two replication systems, allowing it to be maintained in two organisms, such as human cells for expression and prokaryotic hosts for cloning and amplification. The term "expression" refers to the cellular processes involved in the production of RNA and proteins, and, where appropriate, secreted proteins, including, but not limited to, transcription, transcription processing, translation, and protein folding, modification, and processing. "Expression product" includes RNA transcribed from a gene and polypeptides obtained by translation of mRNA transcribed from a gene. The term "gene" refers to a nucleic acid sequence (DNA) that is transcribed into RNA in vitro or in vivo when operably linked to appropriate regulatory sequences. A gene may or may not include regions preceding and following the coding region, such as 5' untranslated (5'UTR) or "leader" sequence and 3'UTR or "trailer" sequence, as well as intervening sequences (introns) between individual coding segments (exons).
[0107] "Recombinant vector" refers to a vector containing a heterologous nucleic acid sequence, or a "transgene" that can be expressed in vivo. It should be understood that in some embodiments, the vectors described herein can be combined with other suitable compositions and therapies. In some embodiments, the vector is episomal. The use of a suitable episomal vector provides a means for maintaining the nucleotide of interest in a subject in high copy number extrachromosomal DNA, thereby eliminating the potential effects of chromosomal integration.
[0108] As used herein, the phrase "genetic disease" refers to a disease caused, directly or indirectly, in part or in whole by one or more abnormalities in the genome, particularly conditions present from birth. The abnormality may be a mutation, insertion, or deletion. The abnormality may affect the coding sequence of a gene or its regulatory sequence. The genetic disease may be, but is not limited to, DMD, hemophilia, cystic fibrosis, Huntington's disease, familial hypercholesterolemia (LDL receptor deficiency), hepatoblastoma, Wilson's disease, congenital hepatic porphyria, inherited disorders of liver metabolism, Lesch-Nyhan syndrome, sickle cell anemia, thalassemia, xeroderma pigmentosum, Fanconi anemia, retinitis pigmentosa, ataxia-telangiectasia, Bloom's syndrome, retinoblastoma, and Tay-Sachs disease.
[0109] As used herein, "inhibitory polynucleotide" refers to a DNA or RNA molecule that reduces or prevents the expression (transcription or translation) of a second (target) polynucleotide.Inhibitory polynucleotides include antisense polynucleotides, ribozymes, and external guide sequences.The term "inhibitory polynucleotide" also includes DNA and RNA molecules, such as RNAi that encodes actual inhibitory species, such as DNA molecules that encode ribozymes.
[0110] As used herein, "gene silencing" or "gene silenced" with respect to the activity of an RNAi molecule, eg, an siRNA or miRNA, refers to a reduction in the mRNA levels of a target gene in a cell.
[0111] As used herein, the term "RNAi" refers to any type of interfering RNA, including but not limited to siRNA, shRNAi, endogenous microRNA, and artificial microRNA.For example, it includes the sequence previously identified as siRNA, regardless of the mechanism of downstream processing of RNA (that is, siRNA is believed to have a specific in vivo processing method that leads to mRNA cleavage, but such sequence can be incorporated into a vector in the context of the adjacent sequence described herein).The term "RNAi" can include both gene silencing RNAi molecules and RNAi effector molecules that activate gene expression.
[0112] As used herein, the terms "comprising" or "comprises" are used in reference to compositions, methods, and their respective components that are essential to the method or composition, but are open to the inclusion of non-specified elements, whether essential or not.
[0113] As used herein, the term "consisting essentially of" refers to elements required for a given embodiment. The term permits the presence of elements that do not materially affect the basic, novel, or functional characteristics of the embodiment. The use of "comprises" indicates inclusion rather than limitation.
[0114] The term "consisting of" refers to the compositions, methods, and their respective components described herein, excluding any elements not recited in the description of the embodiments.
[0115] As used herein, the term "consisting essentially of" refers to elements required for a given embodiment. The term permits the presence of additional elements that do not materially affect the basic and novel or functional characteristics of the embodiment of this invention.
[0116] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to a "method" includes one or more methods, and / or steps of the type described herein and / or that will become apparent to those of ordinary skill in the art upon reading this disclosure, etc. Similarly, the word "or" is intended to include "and" unless the context clearly dictates otherwise. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below. The abbreviation "eg" is derived from the Latin "exempli gratia," and is used herein to indicate a non-limiting example. Thus, the abbreviation "eg" is synonymous with "for example."
[0117] Groupings of alternative elements or embodiments of the invention disclosed herein are not to be construed as limitations. Members of each group may be referenced and claimed individually or in any combination with other members of the group or other elements found herein. One or more members of a group may be included in, or deleted from, a group for reasons of convenience and / or patentability. When any such inclusion or deletion occurs, the specification is herein deemed to include the modified group, thus satisfying all Markush group descriptions used in the appended claims.
[0118] In some embodiments of any aspect, the disclosure described herein does not pertain to human cloning processes, processes for correcting the genetic identity of human germ lines, the use of human embryos for industrial or commercial purposes, or animals that are likely to cause suffering without providing any substantial medical benefit to humans or animals, and processes for modifying the genetic identity of animals resulting from such processes.
[0119] Other terms are defined herein within the description of various aspects of the invention.
[0120] All patents and other publications cited throughout this application, including literature references, issued patents, published patent applications, and pending patent applications, are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that may be used in connection with the technology described herein. These publications are provided solely for their disclosure prior to the filing date of this application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or representation as to the contents of these documents are based on the information available to the applicant and do not constitute any admission as to the accuracy of the dates or contents of these documents.
[0121] The description of the embodiments of the present disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. While specific embodiments and examples of the present disclosure are described herein for illustrative purposes, those skilled in the art will recognize that various equivalent modifications are possible within the scope of the present disclosure. For example, while method steps or functions may be presented in a given order, alternative embodiments may perform the functions in a different order, or the functions may be performed substantially simultaneously. The teachings of the disclosure provided herein can be applied to other procedures or methods as appropriate. The various embodiments described herein can be combined to provide further embodiments. Aspects of the present disclosure can be modified, as appropriate, to employ the compositions, functions, and concepts of the above-mentioned references and applications to provide further embodiments of the present disclosure. Furthermore, due to considerations of biological functional equivalence, some changes can be made to protein structure without affecting the type or amount of biological or chemical activity. These and other changes can be made to the present disclosure in light of the detailed description. All such modifications are intended to be within the scope of the appended claims.
[0122] Particular elements of any of the foregoing embodiments can be combined with or substituted for elements of other embodiments. Additionally, although advantages associated with certain embodiments of the present disclosure have been described in the context of those embodiments, other embodiments may also exhibit such advantages, and not all embodiments necessarily exhibit such advantages, to be within the scope of the present disclosure.
[0123] The techniques described herein are further illustrated by the following examples, which should not be construed as further limiting in any way. It is understood that the present invention is not limited to the particular methodology, protocols, and reagents, etc., described herein and as such may vary. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the present invention, which is defined solely by the claims.
[0124] II. Expression of FVIII protein from ceDNA vector The technology described herein generally relates to the expression and / or production of FVIII protein in cells from non-viral DNA vectors, such as the ceDNA vectors described herein. ceDNA vectors for expressing FVIII protein are described herein in the section entitled "ceDNA Vectors in General." In particular, ceDNA vectors for expressing FVIII protein include a pair of ITRs (e.g., symmetric or asymmetric as described herein) and a nucleic acid encoding the FVIII protein described herein, operably linked to a promoter or regulatory sequence between the ITR pair. A distinct advantage of ceDNA vectors for expressing FVIII protein over traditional AAV vectors and even lentiviral vectors is that there is no size constraint on the heterologous nucleic acid sequence encoding the desired protein. Thus, even a full-length 6.8 kb FVIII protein can be expressed from a single ceDNA vector. Therefore, the ceDNA vectors described herein can be used to express therapeutic FVIII protein in subjects in need thereof, for example, subjects with hemophilia A.
[0125] As can be understood, the ceDNA vector technology described herein can be adapted to any level of complexity, or can be used in a modular manner, whereby the expression of different components of the FVIII protein can be controlled in an independent manner.For example, the ceDNA vector technology designed herein can be as simple as using a single ceDNA vector to express a single heterologous gene sequence (e.g., FVIII protein), or as complex as using multiple ceDNA vectors, where each vector expresses multiple FVIII proteins or related cofactors or accessory proteins, each independently controlled by a different promoter.The following embodiments are specifically contemplated herein and can be adapted by those skilled in the art as needed.
[0126] In one embodiment, a single ceDNA vector can be used to express a single component of the FVIII protein. Alternatively, a single ceDNA vector can be used to express multiple components (e.g., at least two) of the FVIII protein under the control of a single promoter (such as a strong promoter), optionally using an IRES sequence to ensure proper expression of each of the components, e.g., cofactors or accessory proteins.
[0127] Also contemplated herein, in another embodiment, is a single ceDNA vector containing at least two inserts (e.g., expressing a heavy chain or a light chain), with the expression of each insert being under the control of its own promoter. The promoter may include multiple copies of the same promoter, multiple different promoters, or any combination thereof. As those skilled in the art will appreciate, it is often desirable to express components of the FVIII protein at different expression levels, thus controlling the stoichiometry of the individual expressed components to ensure efficient folding and assembly of the FVIII protein in cells.
[0128] Further variations of ceDNA vector technology can be envisioned by those skilled in the art or can be adapted from conventional vector-based protein production methods.
[0129] A. Nucleic acid Characterization and development of nucleic acid molecules for potential therapeutic applications are provided herein. According to some embodiments, the nucleic acid for therapeutic applications encodes a FVIII protein. In some embodiments, chemical modifications of oligonucleotides are described, as needed, for altered and improved in vivo properties (delivery, stability, life span, folding, target specificity), as well as their biological functions and mechanisms that directly correlate with therapeutic applications.
[0130] Exemplary therapeutic nucleic acids of the present disclosure that may be immunostimulatory and may require the use of the immunosuppressants disclosed herein can include, but are not limited to, minigenes, plasmids, minicircles, small interfering RNAs (siRNAs), microRNAs (miRNAs), antisense oligonucleotides (ASOs), ribozymes, closed-ended double-stranded DNA (e.g., ceDNA, CELiDs, linear covalently closed DNA ("ministrings"), doggybone (dbDNA™) DNA, protelomeric closed-ended DNA, or dumbbell linear DNA), Dicer substrate dsRNA, small hairpin RNAs (shRNAs), asymmetric interfering RNAs (aiRNAs), microRNAs (miRNAs), mRNAs, tRNAs, rRNAs, and DNA viral vectors, viral RNA vectors, and any combination thereof.
[0131] siRNA or miRNA, which can downregulate the intracellular level of specific proteins through a process called RNA interference (RNAi), are also contemplated by the present invention as nucleic acid therapeutic agents.After siRNA or miRNA is introduced into the cytoplasm of host cells, these double-stranded RNA constructs can bind to a protein called RISC.The sense strand of siRNA or miRNA is removed by the RISC complex.When the RISC complex binds to complementary mRNA, it cleaves the mRNA and releases the cleaved strand.RNAi is by inducing the specific destruction of mRNA, which leads to the downregulation of corresponding proteins.
[0132] Antisense oligonucleotides (ASOs) and ribozymes, which inhibit mRNA translation into proteins, can be used as nucleic acid therapeutics. In the case of antisense constructs, these single-stranded deoxyribonucleotides have sequences complementary to the target protein mRNA sequence and can bind to the mRNA through Watson and Crick base pairing. This binding prevents translation of the target mRNA and / or induces RNase H degradation of the mRNA transcript. As a result, antisense oligonucleotides have enhanced specificity of action (i.e., downregulation of specific disease-related proteins).
[0133] In any of the methods provided herein, the therapeutic nucleic acid can be a therapeutic RNA.The therapeutic RNA can be an inhibitor of mRNA translation, an RNA interference (RNAi) agent, a catalytically active RNA molecule (ribozyme), a transfer RNA (tRNA), or an mRNA transcript (ASO), an RNA that binds to protein or other molecular ligands (aptamer).In any of the methods provided herein, the RNAi agent can be a double-stranded RNA, a single-stranded RNA, a microRNA, a short interfering RNA, a small hairpin RNA, or a triple-helix-forming oligonucleotide.
[0134] According to some embodiments, the therapeutic nucleic acid is a closed-end double-stranded DNA, such as ceDNA. According to some embodiments, the expression and / or production of therapeutic proteins in cells is derived from a non-viral DNA vector, such as a ceDNA vector. A clear advantage of ceDNA vectors for the expression of therapeutic proteins over traditional AAV vectors and even lentiviral vectors is that there is no size constraint on the heterologous nucleic acid sequence encoding the desired protein. Therefore, even large therapeutic proteins can be expressed from a single ceDNA vector. Therefore, ceDNA vectors can be used to express therapeutic proteins in subjects in need thereof.
[0135] Generally, the ceDNA vector for expressing a therapeutic protein disclosed herein comprises, in the 5' to 3' direction, a first adeno-associated virus (AAV) inverted terminal repeat (ITR), a nucleotide sequence of interest (e.g., an expression cassette described herein), and a second AAV ITR. The ITR sequences are selected from: (i) at least one WT ITR and at least one modified AAV inverted terminal repeat (mod-ITR) (e.g., an asymmetric modified ITR), (ii) two modified ITRs (e.g., an asymmetric modified ITR) in which the mod-ITR pair has a different three-dimensional spatial configuration relative to each other, or (iii) a symmetric or substantially symmetric WT-WT ITR pair in which each WT-ITR has the same three-dimensional spatial configuration, or (iv) a symmetric or substantially symmetric modified ITR pair in which each mod-ITR has the same three-dimensional spatial configuration.
[0136] In some embodiments, the transgene encoding the FVIII protein can also encode a secretory sequence, which targets the FVIII protein to the Golgi apparatus and endoplasmic reticulum, and allows the FVIII protein to be folded into the correct conformation by chaperone molecules as it passes through the ER and exits the cell. Exemplary secretory sequences include, but are not limited to, VH-02 (SEQ ID NO: 88) and VK-A26 (SEQ ID NO: 89) and the Igκ signal sequence (SEQ ID NO: 126), as well as the Gluc secretory signal (SEQ ID NO: 188) that enables tagged proteins to be secreted from the cytosol, and the TMD-ST secretory sequence (SEQ ID NO: 189) that targets tagged proteins to the Golgi apparatus.
[0137] Regulatory switches can also be used to fine-tune expression of FVIII protein, such that the FVIII protein is expressed as needed (including, but not limited to, expression of FVIII protein at a desired expression level or amount), or alternatively, in the presence or absence of a particular signal, including a cell signaling event. For example, as described herein, expression of FVIII protein from a ceDNA vector can be turned on or off when a particular condition occurs, as described herein in the section entitled "Regulatory Switches."
[0138] For example, and for illustrative purposes only, the FVIII protein can be used to stop an undesirable reaction, such as the production of too high a level of FVIII protein. The FVIII gene may contain a signal peptide marker to direct the FVIII protein to the desired cells. However, in any situation, it may be desirable to regulate the expression of the FVIII protein. ceDNA vectors readily accommodate the use of regulatory switches.
[0139] A distinct advantage of ceDNA vectors over traditional AAV vectors and even lentiviral vectors is that there are no size constraints on the heterologous nucleic acid sequence encoding the FVIII protein. Therefore, full-length FVIII, as well as optionally any cofactors or evaluation proteins, can be expressed from a single ceDNA vector. Furthermore, depending on the required stoichiometry, multiple segments of the same FVIII protein can be expressed, using the same or different promoters, and regulatory switches can be used to fine-tune the expression of each region. For example, as shown in the Examples, ceDNA vectors containing dual-promoter systems can be used, whereby different promoters are used for each domain of the FVIII protein. The use of ceDNA plasmids to produce FVIII proteins can involve unique combinations of promoters for the expression of FVIII protein domains, resulting in the appropriate ratio of each domain for the formation of functional FVIII protein. Thus, in some embodiments, ceDNA vectors can be used to express different regions of the FVIII protein separately (e.g., under the control of different promoters).
[0140] In another embodiment, the FVIII protein expressed from the ceDNA vector further comprises additional functions such as fluorescence, enzymatic activity, a secretion signal, or an immune cell activator.
[0141] In some embodiments, the ceDNA encoding the FVIII protein can further include, for example, a linker domain. As used herein, "linker domain" refers to an oligo- or polypeptide region approximately 2 to 100 amino acids in length that connects together any of the domains / regions of the FVIII protein described herein. In some embodiments, the linker can contain or consist of flexible residues such as glycine and serine to allow adjacent protein domains to move freely relative to each other. Longer linkers can be used if it is desirable to prevent two adjacent domains from sterically interfering with each other. The linker can be cleavable or non-cleavable. Examples of cleavable linkers include a 2A linker (e.g., T2A), a 2A-like linker, or functional equivalents thereof, and combinations thereof. The linker can be a linker region that is T2A derived from Thosea asigna virus.
[0142] For example, it is well within the ability of one of ordinary skill in the art to take a known and / or publicly available protein sequence, such as FVIII, and reverse engineer a cDNA sequence to encode such a protein. The cDNA can then be codon-optimized to be consistent with the intended host cell and inserted into a ceDNA vector as described herein.
[0143] B. ceDNA Vector Expressing FVIII Protein A ceDNA vector for expressing a FVIII protein having one or more sequences encoding a desired FVIII can include regulatory sequences such as a promoter, secretion signal, polyA region, and enhancer. At a minimum, the ceDNA vector includes one or more heterologous sequences encoding a FVIII protein.
[0144] To achieve highly efficient and accurate assembly of the FVIII protein, in some embodiments, it is specifically contemplated that the FVIII protein comprises an endoplasmic reticulum (ER) leader sequence that directs it to the ER where protein folding occurs, e.g., a sequence that targets the expressed protein to the ER for folding.
[0145] In some embodiments, a cellular or extracellular localization signal (e.g., a secretory signal, a nuclear localization signal, a mitochondrial localization signal, etc.) is included in the ceDNA vector to direct the secretion or desired intracellular localization of the FVIII protein, thereby enabling the FVIII protein to bind to an intracellular target (e.g., an intrabody) or an extracellular target.
[0146] In some embodiments, the ceDNA vectors for expression of FVIII proteins described herein allow for the assembly and expression of any desired FVIII protein in a modular manner. As used herein, the term "module" refers to an element in a ceDNA expression plasmid that can be easily removed from the construct. For example, modular elements in ceDNA production plasmids contain unique pairs of restriction sites flanking each element within the construct, allowing for exclusive manipulation of individual elements (see, e.g., Figures 1A-1G). Thus, the ceDNA vector platform can enable the expression and assembly of any desired FVIII protein configuration. In various embodiments, provided herein are ceDNA plasmid vectors that can reduce and / or minimize the amount of manipulation required to assemble a desired ceDNA vector encoding a FVIII protein.
[0147] C. Exemplary FVIII Proteins Expressed by ceDNA Vectors In particular, the ceDNA vectors for expression of FVIII proteins disclosed herein can encode, for example, but not limited to, FVIII proteins, and variants and / or active fragments thereof, for use in treating, preventing, and / or ameliorating one or more symptoms of hemophilia A. In one embodiment, hemophilia A is human hemophilia A.
[0148] (i) FVIII therapeutic proteins and fragments thereof Essentially, any version of a FVIII therapeutic protein or a fragment thereof (e.g., functional fragment) can be encoded by a ceDNA vector and expressed in and from a ceDNA vector as described herein. Those skilled in the art will understand that a FVIII therapeutic protein includes all splice variants and orthologs of the FVIII protein. A FVIII therapeutic protein includes the intact molecule as well as fragments thereof (e.g., functional).
[0149]
[0150] Factor VIII Factor VIII is a non-enzymatic cofactor of activated coagulation factor IX (FIXa), which, upon proteolytic activation, interacts with FIXa to form a tight, non-covalent complex that binds and activates factor X (FX).
[0151] The factor VIII gene or protein may also be referred to as F8, coagulation factor VIII, procoagulant component, antihemophilic factor, F8C, AHF, DXS1253E, FVIII, HEMA, or F8B. Factor VIII gene expression is tissue-specific and is primarily observed in hepatocytes. The highest levels of mRNA and factor VIII protein have been detected in hepatic sinusoidal lining cells, with significant amounts of factor VIII also present in hepatocytes and Kupffer cells (resident macrophages of the hepatic sinusoids). Moderate levels of factor VIII protein are detectable in serum and plasma. Low to moderate levels of factor VIII protein are expressed in fetal brain, retina, kidney, and testis.
[0152] Factor VIII mRNA is expressed throughout many tissues of the body, including bone marrow, whole blood, white blood cells, lymph nodes, thymus, brain, cerebral cortex, cerebellum, retina, spinal cord, tibial nerve, heart, arteries, smooth muscle, skeletal muscle, small intestine, colon, adipocytes, kidney, liver, lung, spleen, stomach, esophagus, bladder, pancreas, thyroid, salivary gland, adrenal gland, pituitary gland, breast, skin, ovary, uterus, placenta, prostate, and thymus. The FVIII gene, located on the long arm of the X chromosome, occupies a region approximately 186 kbp long and consists of 26 exons (69-3, 106 kbp) and introns (207-32.4 kbp). The total coding sequence of this gene is 9 kbp.
[0153] The mature factor VIII polypeptide contains the A1-A2-B-A3-C1-C2 structural domains. Three acidic subdomains, designated a1-a3-A1(a1)-A2(a2)-B-(a3)A3-C1-C2, are located at the interface of the A domain and play important roles in the interaction between FVIII and other proteins, including thrombin in particular. Mutations in these subdomains reduce the level of factor VIII activation by thrombin.
[0154] The Factor VIII protein (coagulation Factor VIII isoform) is a preproprotein [Homo sapiens]; accession number: NP_000123.1 (2351 aa), with the following sequence:
[0155]
[0156] A distinct advantage of ceDNA vectors over conventional AAV and even lentiviral vectors is that there is no size constraint on the heterologous nucleic acid sequence encoding the desired protein, and therefore multiple full-length FVIII therapeutic proteins can be expressed from a single ceDNA vector.
[0157] Expression of a FVIII therapeutic protein or fragment thereof from a ceDNA vector can be achieved both spatially and temporally using one or more inducible or repressible promoters, as known in the art or as described herein, including the regulatory switches described herein.
[0158] In one embodiment, the therapeutic FVIII protein is a "therapeutic protein variant," which refers to a therapeutic FVIII protein with an altered amino acid sequence, composition, or structure compared to the corresponding native therapeutic FVIII protein. In one embodiment, the FVIII is a functional version (e.g., wild-type). For example, it may be useful to express mutant versions of the FVIII protein, such as point mutations or deletion mutations that lead to hemophilia A, to evaluate animal models of disease and / or drugs for hemophilia A. To generate disease models, mutant or modified FVIII proteins can be delivered to cells or animal model systems. Such cells or animal models can be used for research and / or drug screening. The therapeutic FVIII protein expressed from a ceDNA vector may further comprise sequences / moieties that confer additional functions, such as fluorescence, enzymatic activity, or secretion signals. In one embodiment, the therapeutic FVIII protein variant comprises a non-native tag sequence (e.g., an immunotag) for identification, allowing it to be distinguished from endogenous therapeutic FVIII proteins in recipient host cells.
[0159] For example, it is well within the ability of one of ordinary skill in the art to take a known and / or publicly available protein sequence of a FVIII therapeutic protein and reverse engineer a cDNA sequence to encode such a protein. The cDNA can then be codon-optimized to be consistent with the intended host cell and inserted into a ceDNA vector as described herein.
[0160] In one embodiment, the FVIII therapeutic protein coding sequence may be derived from an existing host cell or cell line, for example, by reverse transcribing mRNA obtained from the host and amplifying the sequence using PCR.
[0161] (ii) ceDNA vector expressing FVIII therapeutic protein A ceDNA vector carrying one or more sequences encoding a desired FVIII therapeutic protein can include regulatory sequences such as a promoter, secretion signal, polyA region, and enhancer. At a minimum, the ceDNA vector contains one or more heterologous sequences encoding a FVIII therapeutic protein or a functional fragment thereof. Exemplary cassette insertions for generating a ceDNA vector encoding a FVIII therapeutic protein are shown in Figures 1A-1G. In one embodiment, the ceDNA vector contains a FVIII sequence listed in Table 1 herein. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] Table 1-6 Table 1-7 Table 1-8 Table 1-9 Table 1-10 Table 1-11 Table 1-12 Table 1-13 Table 1-14 Table 1-15 Table 1-16 Table 1-17 Table 1-18 Table 1-19 Table 1-20 Table 1-21 Table 1-22 Table 1-23 Table 1-24 Table 1-25 Table 1-26 Table 1-27 Table 1-28 Table 1-29 Table 1-30 Table 1-31 Table 1-32 Table 1-33 Table 1-34 Table 1-35 Table 1-36 Table 1-37 Table 1-38 Table 1-39 Table 1-40 Table 1-41 Table 1-42 Table 1-43 Table 1-44 Table 1-45 Table 1-46 Table 1-47 Table 1-48 Table 1-49 Table 1-50 Table 1-51 Table 1-52 Table 1-53 Table 1-54 Table 1-55 Table 1-56 Table 1-57 Table 1-58 Table 1-59 Table 1-60 Table 1-61 [Table 1-62]
[0162] (iii) FVIII therapeutic proteins and uses thereof for the treatment of hemophilia A The ceDNA vectors described herein can be used to deliver therapeutic FVIII proteins for the treatment of hemophilia A, which is associated with inappropriate expression of and / or mutations within the FVIII protein.
[0163] The ceDNA vectors described herein can be used to express any desired FVIII therapeutic protein. Exemplary therapeutic FVIII proteins include, but are not limited to, any FVIII protein expressed by the sequences shown in Table 1 herein.
[0164] In one embodiment, the expressed FVIII therapeutic protein is functional for the treatment of hemophilia A. In some embodiments, the FVIII therapeutic protein does not provoke an immune system response.
[0165] In another embodiment, a ceDNA vector encoding a FVIII therapeutic protein or a fragment thereof (e.g., a functional fragment) can be used to generate a chimeric protein. Thus, it is specifically contemplated herein that a ceDNA vector expressing a chimeric protein can be administered to any one or more tissues selected from, for example, the liver, kidney, gallbladder, prostate, and adrenal gland. In some embodiments, when a ceDNA vector expressing FVIII is administered to an infant or administered to a subject in utero, the ceDNA vector expressing FVIII can be administered to any one or more tissues selected from the liver, adrenal gland, heart, intestine, lung, and stomach, or to liver stem cell precursors thereof, for in vivo or ex vivo treatment of hemophilia A.
[0166] hemophilia: Hemophilia A is a genetic defect in clotting factor VIII that causes increased bleeding and typically affects males. It is most often inherited as an X-linked recessive trait, but can also result from spontaneous mutations. Symptoms of hemophilia A include internal or external bleeding episodes. Individuals with more severe hemophilia suffer from more severe and more frequent bleeding episodes, while others with milder hemophilia typically experience milder symptoms, except after surgery or severe trauma. Patients with moderate hemophilia have a range of symptoms that manifest along a spectrum between severe and mild hemophilia.
[0167] Current treatments for preventing bleeding in people with hemophilia A include factor VIII drug therapy. Most patients with severe hemophilia require regular supplementation with recombinant or plasma-concentrated factor VIII. Recombinant factor VIII is one of the most complex proteins for industrial production due to the low efficiency of its gene transcription, the extensive intracellular loss of its proprotein during post-translational processing, and the instability of the secreted protein. Patients with mild hemophilia can manage their condition with desmopressin, a drug that releases stored factor VIII from blood vessel walls.
[0168] There are many complications associated with the treatment of hemophilia A. In children, easily accessible intravenous ports may be inserted to minimize frequent, traumatic intravenous cannulation. However, these ports carry a high infection rate and the risk of clot formation at the catheter tip, rendering them useless. Viral infections can be common in hemophilia patients due to frequent transfusions, which puts patients at risk for blood-borne infections such as HIV, hepatitis B, and hepatitis C. Prion infections can also be transmitted through transfusions. Another treatment complication for hemophilia A is the development of inhibitor antibodies against factor VIII due to frequent infusions. These occur when the body recognizes infused factor VIII as foreign because it does not produce its own copies. In these individuals, activated factor VII, the precursor to factor VIII in the coagulation cascade, can be infused to treat bleeding and replenish antibodies against factor VIII in individuals with hemophilia.
[0169] Coagulation cascade Coagulation, also known as thrombus formation, is the process by which blood changes from a liquid to a gel, forming a clot. It potentially leads to hemostasis, the cessation of blood loss from an injured blood vessel and subsequent repair. The mechanism of coagulation includes platelet activation, adhesion, and aggregation, as well as fibrin deposition and maturation. Disorders of coagulation are disease states that can result in bleeding (hemorrhage or bruising) or obstructive clotting (thrombosis).
[0170] Coagulation begins almost instantly after vascular injury damages the endothelium, which lines the inside of a blood vessel. Exposure of blood to the subendothelial space initiates two processes: platelet alterations and exposure of subendothelial tissue factor to plasma factor VII, which ultimately leads to fibrin formation. Platelets immediately form a clot at the site of injury, a process called primary hemostasis. Secondary hemostasis occurs simultaneously: additional coagulation or thrombogenic factors beyond factor VII (including factor VIII) react in a complex cascade to form fibrin strands and strengthen the platelet clot.
[0171] The coagulation cascade of secondary hemostasis has two initial pathways leading to fibrin formation. These are the contact activation pathway (also known as the intrinsic pathway) and the tissue factor pathway (also known as the extrinsic pathway), both of which trigger the same basic reactions that generate fibrin. The primary pathway for initiating blood clotting is the tissue factor (extrinsic) pathway. The pathway is a series of reactions in which a serine protease zymogen (an inactive enzyme precursor) and its glycoprotein cofactor are activated to become an active component, which catalyzes the next reaction in the cascade, ultimately resulting in cross-linked fibrin. Clotting factors are commonly designated by Roman numerals, with a lowercase letter added to indicate the active form.
[0172] Clotting factors are generally serine proteases (enzymes) that act by cleaving downstream proteins. The exceptions are tissue factors FV, FVIII, and FXIII. Tissue factors FV and FVIII are glycoproteins, and factor XIII is a transglutaminase. Clotting factors circulate as inactive zymogens. Therefore, the coagulation cascade is classically divided into three pathways. The tissue factor and contact activation pathways both activate factor X, thrombin, and fibrin in the "final common pathway."
[0173] The primary role of the tissue factor (extrinsic) pathway is to generate the "thrombin burst," a process in which thrombin, the most important component of the coagulation cascade in terms of its feedback activation role, is released very rapidly. FVIIa circulates in greater amounts than any other activated coagulation factor. This process involves the following steps:
[0174] Step 1: After vascular injury, FVII leaves the circulation and comes into contact with tissue factor (TF) expressed on tissue factor-containing cells (interstitial fibroblasts and leukocytes), forming an activation complex (TF-FVIIa).
[0175] Step 2: TF-FVIIa activates FIX and FX.
[0176] Step 3: FVII itself is activated by thrombin, FXIa, FXII, and FXa.
[0177] Step 4: Activation of FX by TF-FVIIa (to form FXa) is almost immediately inhibited by tissue factor pathway inhibitor (TFPI).
[0178] Step 5: FXa and its cofactor FVa form the prothrombinase complex that activates prothrombin to thrombin.
[0179] Step 6: Thrombin then activates other components of the coagulation cascade, including FV and FVIII (which forms a complex with FIX), activating FVIII and releasing it from its binding to von Willebrand factor (vWF).
[0180] Step 7: FVIIIa is a cofactor for FIXa, and together they form the "tenase" complex that activates FX, thereby continuing the cycle.
[0181] The contact activation (intrinsic) pathway begins with the formation of a primary complex on collagen by high molecular weight kininogen (HMWK), prekallikrein, and FXII (Hageman factor). Prekallikrein is converted to kallikrein, and FXII becomes FXIIa. FXIIa converts FXI to FXIa. Factor XIa activates FIX, which, together with its cofactor FVIIIa, forms a tenase complex and activates FX to FXa. The minor role of the contact activation pathway in initiating thrombus formation can be explained by the fact that patients with severe deficiencies of FXII, HMWK, and prekallikrein do not have bleeding disorders. Instead, the contact activation system is more involved in inflammation and innate immunity.
[0182] The final common pathway shared by the intrinsic and extrinsic coagulation pathways involves the conversion of prothrombin to thrombin and fibrinogen to fibrin. Thrombin has a wide range of functions beyond converting fibrinogen to fibrin, a component of hemostatic clots. Furthermore, it is the most important platelet activator, activating factors VIII and V and their inhibitor, protein C (in the presence of thrombomodulin), and factor XIII, which forms covalent bonds that crosslink the fibrin polymers formed from the activated monomers.
[0183] Following activation by the contact factor or tissue factor pathway, the coagulation cascade is maintained in a prothrombotic state by continued activation of FVIII and FIX to form the tenase complex until down-regulation by the anticoagulant pathway. The method includes administering to a subject an effective amount of a composition comprising a ceDNA vector encoding a FVIII therapeutic protein or a fragment thereof (e.g., a functional fragment), as described herein. As will be understood by those skilled in the art, the term "effective amount" refers to the amount of the administered ceDNA composition that results in expression of the protein in a "therapeutically effective amount" for the treatment of a disease or disorder.
[0184] The dosage range of a composition comprising a ceDNA vector encoding a therapeutic FVIII protein or a fragment thereof (e.g., a functional fragment) depends on potency (e.g., promoter efficiency) and includes an amount sufficient to produce the desired effect, e.g., expression of the desired therapeutic FVIII protein, for the treatment of phenylketonuria (hemophilia A). The dosage should not be so high as to cause unacceptable adverse side effects. Generally, dosage will vary depending on the specific characteristics of the ceDNA vector, expression efficiency, and the age, condition, and sex of the patient. Dosages can be determined by one skilled in the art and, unlike conventional AAV vectors, can also be adjusted by an individual physician in the event of complications because ceDNA vectors do not contain immunostimulatory capsid proteins that prevent repeated dosing.
[0185] The administration of the ceDNA composition described herein can be repeated for a limited period of time.In some embodiments, the dose is given periodically or by pulse administration.In a preferred embodiment, the dose listed above is administered over several months.The duration of treatment depends on the clinical progress of the subject and their responsiveness to treatment.Booster treatment over time is contemplated.In addition, the expression level can be titrated as the subject grows.
[0186] The FVIII therapeutic protein can be expressed in a subject for at least 1 week, at least 2 weeks, at least 1 month, at least 2 months, at least 6 months, at least 12 months / 1 year, at least 2 years, at least 5 years, at least 10 years, at least 15 years, at least 20 years, at least 30 years, at least 40 years, at least 50 years, or longer. Long-term expression can be achieved by repeated administration of the ceDNA vectors described herein at predetermined or desired intervals.
[0187] As used herein, the term "therapeutically effective amount" refers to the amount of expressed FVIII therapeutic protein or functional fragment thereof that is sufficient to result in a statistically significant measurable change in the expression of a disease biomarker or a reduction in a given disease symptom (see "Measurement of Efficacy" below). Such an effective amount can be assessed in clinical trials as well as animal studies for a given ceDNA composition.
[0188] The exact amount of ceDNA vector required to be administered depends on the judgment of the practitioner and is specific to each individual. Suitable administration regimes vary, but are typically an initial administration followed by repeated doses at one or more intervals by subsequent injections or other administrations. Alternatively, particularly for the treatment of acute diseases / disorders, continuous intravenous infusion sufficient to maintain blood concentrations within the range specified for in vivo treatment is contemplated.
[0189] The agents useful in the methods and compositions described herein can be administered topically, intravenously (by bolus or continuous infusion), intracellularly, intra-tissue, orally, by inhalation, intraperitoneally, intramuscularly, subcutaneously, intracavity, and optionally by peristaltic means or other means known to those skilled in the art. The agents can be administered systemically, if desired. They can also be administered intrauterinely.
[0190] The effectiveness of a given treatment for hemophilia A can be determined by a skilled clinician. However, if any one or all of the signs or symptoms of the disease or disorder are modified in a beneficial manner, or other clinically acceptable symptoms or markers of the disease are improved or ameliorated by at least 10% after treatment with, for example, a ceDNA vector encoding FVIII or a functional fragment thereof, the treatment is considered "effective treatment," as that term is used herein. Efficacy can also be measured by disease stabilization or failure of an individual to deteriorate, as assessed by the need for medical intervention (i.e., disease progression is stopped or at least slowed). Methods for measuring these indicators are known to those skilled in the art and / or are described herein. Treatment includes any treatment of disease in an individual or animal (some non-limiting examples include humans or mammals), including: (1) inhibiting the disease, e.g., halting or slowing the progression of the disease or disorder, or (2) relieving the disease, e.g., causing a reduction in symptoms, and (3) preventing or reducing the likelihood of developing the disease, such as liver or kidney failure, or preventing secondary diseases / disorders associated with the disease (e.g., hand deformities due to rheumatoid arthritis, or cancer metastasis). An effective amount for treating a disease means an amount that, when administered to a mammal in need thereof, is sufficient to provide effective treatment for the disease, as that term is defined herein.
[0191] The effectiveness of a drug can be determined by assessing physical indicators specific to hemophilia A. Standard methods for assaying hemophilia A indicators are known in the art.
[0192] In some embodiments, the ceDNA vectors for expression of the FVIII protein disclosed herein can also encode cofactors or other polypeptides, sense or antisense oligonucleotides, or RNA (coding or non-coding, e.g., siRNA, shRNA, microRNA, antisense counterparts (e.g., antagoMiR) that can be used in combination with the FVIII protein expressed from the ceDNA). Additionally, the expression cassettes comprising sequences encoding the FVIII protein can also include exogenous sequences encoding reporter proteins used for experimental or diagnostic purposes, such as β-lactamase, β-galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), luciferase, and others known in the art.
[0193] In one embodiment, the ceDNA vector comprises a nucleic acid sequence for expressing a therapeutic FVIII protein that is functional for the treatment of hemophilia A. In a preferred embodiment, the therapeutic FVIII protein does not provoke an immune system response unless one is desired.
[0194] III. Generic ceDNA Vectors for Use in the Production of FVIII Therapeutic Proteins Embodiments of the present invention are based on methods and compositions comprising closed-end linear double-stranded (ceDNA) vectors capable of expressing a FVIII transgene. In some embodiments, the transgene is a sequence encoding a FVIII protein. The ceDNA vectors for expressing FVIII proteins described herein are not limited by size, thereby enabling, for example, the expression of all components necessary for transgene expression from a single vector. The ceDNA vectors for expressing FVIII proteins are preferably double-stranded, e.g., self-complementary, over at least a portion of the molecule, such as an expression cassette (e.g., the ceDNA is not a double-stranded circular molecule). The ceDNA vectors have covalently closed ends and are therefore resistant to exonuclease digestion (e.g., exonuclease I or exonuclease III), for example, at 37°C for 1 hour or more.
[0195] Generally, the ceDNA vector for expressing the FVIII protein disclosed herein comprises, from 5' to 3', a first adeno-associated virus (AAV) inverted terminal repeat (ITR), a nucleotide sequence of interest (e.g., an expression cassette described herein), and a second AAV ITR. The ITR sequences are selected from: (i) at least one WT ITR and at least one modified AAV inverted terminal repeat (mod-ITR) (e.g., an asymmetric modified ITR), (ii) two modified ITRs (e.g., an asymmetric modified ITR) in which the mod-ITR pair has a different three-dimensional spatial configuration relative to each other, or (iii) a symmetric or substantially symmetric WT-WT ITR pair in which each WT-ITR has the same three-dimensional spatial configuration, or (iv) a symmetric or substantially symmetric modified ITR pair in which each mod-ITR has the same three-dimensional spatial configuration.
[0196] The present disclosure includes methods and compositions for the production of FVIII protein, including ceDNA vectors, and may further include delivery systems, such as, but not limited to, liposomal nanoparticle delivery systems.Non-limiting exemplary liposomal nanoparticle systems that can be used are disclosed herein.In some embodiments, the present disclosure provides lipid nanoparticles comprising ceDNA and ionized lipids.For example, lipid nanoparticle formulations prepared and loaded with ceDNA obtained by the process are disclosed in International Application No. 2018 / 050042, filed September 7, 2018, and are incorporated herein.
[0197] The ceDNA vector for expressing FVIII proteins disclosed herein does not have the packaging constraints imposed by the limited space within the viral capsid. In contrast to the enclosed AAV genome, the ceDNA vector represents a versatile eukaryotic alternative to prokaryotically produced plasmid DNA vectors. This allows the insertion of control elements, such as the regulatory switches disclosed herein, large transgenes, multiple transgenes, etc.
[0198] 1A-1E show schematic diagrams of non-limiting exemplary ceDNA vectors for expressing FVIII proteins, or the sequences of corresponding ceDNA plasmids. The ceDNA vectors for expressing FVIII proteins do not contain capsids and can be obtained from plasmids encoding the first ITR, an expression cassette containing a transgene, and a second ITR in this order. The expression cassette can include one or more regulatory sequences that enable and / or control the expression of the transgene. For example, the expression cassette can include one or more of an enhancer / promoter, an ORF reporter (transgene), a post-transcriptional regulatory element (e.g., WPRE), and a polyadenylation and termination signal (e.g., BGH polyA), in this order.
[0199] The expression cassette may also contain an internal ribosome entry site (IRES) and / or a 2A element. Cis-regulatory elements include, but are not limited to, promoters, riboswitches, insulators, mir regulatory elements, post-transcriptional regulatory elements, tissue- and cell-type-specific promoters, and enhancers. In some embodiments, the ITRs may act as a promoter for a transgene, such as a FVIII protein. In some embodiments, the ceDNA vector may contain additional components for regulating the expression of the transgene, such as a regulatory switch for controlling and regulating the expression of the FVIII protein, as described in the section entitled "Regulatory Switches" herein, and, if desired, a kill switch that enables controlled cell death of cells containing the ceDNA vector.
[0200] An expression cassette can comprise more than 4000 nucleotides, 5000 nucleotides, 10,000 nucleotides, 20,000 nucleotides, 30,000 nucleotides, 40,000 nucleotides, or 50,000 nucleotides, or any range between about 4000 and 10,000 nucleotides, or 10,000 and 50,000 nucleotides, or greater than 50,000 nucleotides. In some embodiments, an expression cassette can comprise a transgene in the range of 500 to 50,000 nucleotides in length. In some embodiments, an expression cassette can comprise a transgene in the range of 500 to 75,000 nucleotides in length. In some embodiments, an expression cassette can comprise a transgene that is in the range of 500 to 10,000 nucleotides in length. In some embodiments, an expression cassette can comprise a transgene that is in the range of 1000 to 10,000 nucleotides in length. In some embodiments, an expression cassette can comprise a transgene that is in the range of 500 to 5,000 nucleotides in length. ceDNA vectors do not have the size limitations of encapsidated AAV vectors, and therefore can deliver large expression cassettes resulting in efficient transgene expression. In some embodiments, ceDNA vectors lack prokaryotic cell-specific methylation.
[0201] The ceDNA expression cassette may contain, for example, an expressible exogenous sequence (e.g., an open reading frame) or transgene encoding a protein that is absent, inactive, or insufficiently active in the recipient subject, or a gene encoding a protein with a desired biological or therapeutic effect. The transgene may encode a gene product that can function to correct the expression of a defective gene or transcript. In principle, the expression cassette may contain any gene that encodes a protein, polypeptide, or RNA that is reduced or absent due to a mutation, or that provides a therapeutic effect if overexpression is considered within the scope of the present disclosure.
[0202] The expression cassette can include any transgene (e.g., encoding a FVIII protein), for example, a FVIII protein useful for treating hemophilia A in a subject, i.e., a therapeutic FVIII protein. The ceDNA vector can be used alone or in combination with exogenous genes and nucleotide sequences, including polypeptide-encoding or non-coding nucleic acids (e.g., RNAi, miR, etc.), and viral sequences in the subject's genome, such as HIV viral sequences, to deliver and express any FVIII protein of interest to a subject. Preferably, the ceDNA vectors disclosed herein are used for therapeutic purposes (e.g., medical, diagnostic, or veterinary use) or immunogenic polypeptides. In certain embodiments, the ceDNA vector is useful for expressing any gene of interest in a subject, including one or more polypeptides, peptides, ribozymes, peptide nucleic acids, siRNAs, RNAis, antisense oligonucleotides, antisense polynucleotides, or RNAs (coding or non-coding, e.g., siRNAs, shRNAs, microRNAs, and their antisense counterparts (e.g., antagoMiRs)), antibodies, fusion proteins, or any combination thereof.
[0203] Expression cassettes may also encode polypeptides, sense or antisense oligonucleotides, or RNA (coding or non-coding, e.g., siRNA, shRNA, microRNA, and their antisense counterparts (e.g., antagoMiR)). Expression cassettes may also include exogenous sequences encoding reporter proteins used for experimental or diagnostic purposes, such as β-lactamase, β-galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), luciferase, and others known in the art.
[0204] The sequence provided in the expression cassette, the expression construct of the ceDNA vector for expressing the FVIII protein described herein, can be codon-optimized for the target host cell. As used herein, the term "optimized codons" or "codon optimization" refers to the process of modifying a nucleic acid sequence by replacing at least one, two or more, or a substantial number of codons of a native sequence (e.g., a prokaryotic sequence) with codons more frequently or most frequently used in the genes of a vertebrate of interest, for enhanced expression in the cells of the vertebrate of interest, such as a mouse or human. Various species exhibit specific biases toward certain codons for certain amino acids. Typically, codon optimization does not change the amino acid sequence of the original translated protein. Optimized codons can be determined, for example, using Aptagen's Gene Forge® codon optimization and custom gene synthesis platform (Aptagen, Inc., 2190 Fox Mill Rd. Suite 300, Herndon, Va. 20171) or another public database. In some embodiments, the nucleic acid encoding the FVIII protein is optimized for human expression and / or is human FVIII or a functional fragment thereof, as known in the art.
[0205] As disclosed herein, the transgene expressed by the ceDNA vector for expressing FVIII protein encodes the FVIII protein. There are many structural features of the ceDNA vector for expressing FVIII protein that distinguish it from a plasmid-based expression vector. The ceDNA vector may have one or more of the following characteristics: lack of original (i.e., uninserted) bacterial DNA, lack of a prokaryotic replication origin, be self-contained (i.e., do not require any sequences other than the two ITRs containing the Rep binding and terminal resolution sites (RBS and TRS), or any exogenous sequences between the ITRs), have ITR sequences that form hairpins, and lack bacterial-type DNA methylation, or indeed any other methylation that would be considered abnormal by a mammalian host. Generally, it is preferred that the vector does not contain any prokaryotic DNA, although it is contemplated that some prokaryotic DNA may be inserted as an exogenous sequence, for example, into a promoter or enhancer region. Another important feature that distinguishes ceDNA vectors from plasmid expression vectors is that ceDNA vectors are single-stranded linear DNA with closed ends, whereas plasmids are always double-stranded DNA.
[0206] The ceDNA vector for expression of FVIII protein produced by the methods provided herein preferably has a linear, continuous, rather than discontinuous, structure as determined by restriction enzyme digestion assay ( FIG. 4D ). A linear, continuous structure is believed to be more stable against attack by cellular endonucleases and less likely to undergo recombination, leading to mutagenesis. Therefore, a ceDNA vector with a linear, continuous structure is a preferred embodiment. Continuous, linear, single-stranded, intramolecularly duplexed ceDNA vectors may have covalently linked termini without sequences encoding AAV capsid proteins. These ceDNA vectors are structurally distinct from plasmids (including the ceDNA plasmids described herein), which are circular, double-stranded nucleic acid molecules of bacterial origin. While the complementary strands of a plasmid can be separated following denaturation to produce two nucleic acid molecules, a ceDNA vector, although having complementary strands, is a single DNA molecule and therefore remains a single molecule even when denatured. In some embodiments, the ceDNA vectors described herein, unlike plasmids, can be produced without prokaryotic cell-type DNA base methylation. Thus, ceDNA vectors and ceDNA-plasmids differ both in terms of their structure (in particular, linear versus circular) and the methods used to produce and purify these different entities (see below), as well as in terms of their DNA methylation, which is of prokaryotic cell type in the case of ceDNA-plasmids and eukaryotic cell type in the case of ceDNA vectors.
[0207] There are several advantages to using ceDNA vectors for expression of the FVIII proteins described herein over plasmid-based expression vectors, including, but not limited to: 1) Plasmids contain bacterial DNA sequences and are subject to prokaryotic cell-specific methylation, such as 6-methyladenosine and 5-methylcytosine methylation, whereas capsid-free AAV vector sequences are of eukaryotic origin and are not subject to prokaryotic cell-specific methylation. As a result, capsid-free AAV vectors are less likely to induce inflammation and immune responses compared to plasmids. 2) Plasmids require the presence of resistance genes during the production process, whereas ceDNA vectors do not. 3) Circular plasmids are not delivered to the nucleus upon introduction into cells and require overloading to bypass degradation by cellular nucleases, whereas ceDNA vectors contain viral cis-elements, i.e., ITRs, that confer resistance to nucleases and can be designed to be targeted and delivered to the nucleus. We hypothesize that the minimal defining elements essential for ITR function are a Rep binding site (RBS, 5'-GCGCGCTCGCTCGCTC-3' (SEQ ID NO: 60) for AAV2) and a terminal resolution site (TRS, 5'-AGTTGG-3' (SEQ ID NO: 64) for AAV2), plus a variable palindromic sequence that allows hairpin formation. 4) ceDNA vectors do not have the excessive representation of CpG dinucleotides often found in prokaryotic-derived plasmids that reportedly bind members of the Toll-like family of receptors and elicit T cell-mediated immune responses. In contrast, transduction with the capsid-free AAV vectors disclosed herein can use a variety of delivery reagents and efficiently target cells and tissue types that are difficult to transduce with conventional AAV virions.
[0208] IV. Inverted terminal repeat (ITR) As disclosed herein, a ceDNA vector for expressing a FVIII protein contains a transgene or heterologous nucleic acid sequence positioned between two inverted terminal repeat (ITR) sequences, which may be an asymmetric ITR pair or a symmetric or substantially symmetric ITR pair, as these terms are defined herein. The ceDNA vector disclosed herein may include ITR sequences selected from: (i) at least one WT ITR and at least one modified AAV inverted terminal repeat (mod-ITR) (e.g., an asymmetric modified ITR), (ii) two modified ITRs (e.g., an asymmetric modified ITR) in which the mod-ITR pair has a different three-dimensional spatial configuration relative to each other, or (iii) a symmetric or substantially symmetric WT-WT ITR pair in which each WT-ITR has the same three-dimensional spatial configuration, or (iv) a symmetric or substantially symmetric modified ITR pair in which each mod-ITR has the same three-dimensional spatial configuration, and the disclosed method may further include a delivery system, such as, but not limited to, a liposomal nanoparticle delivery system.
[0209] In some embodiments, the ITR sequences may be derived from viruses of the Parvovirinae family, which includes two subfamilies: the Parvovirinae, which infect vertebrates, and the Densovirinae, which infect insects. The Parvovirinae subfamily (also called parvoviruses) includes the Dependoviruses, whose members, under most conditions, require co-infection with a helper virus, such as an adenovirus or a herpesvirus, for productive infection. The Dependovirus family includes adeno-associated viruses (AAVs), which typically infect humans (e.g., serotypes 2, 3A, 3B, 5, and 6) or primates (e.g., serotypes 1 and 4), as well as related viruses that infect other warm-blooded animals (e.g., bovine, canine, equine, and ovine adeno-associated viruses). Parvoviruses and other members of the Parvoviridae family are generally described in Kenneth I. Berns, "Parvoviridae: The Viruses and Their Replication," Chapter 69 in FIELDS VIROLOGY (3d Ed. 1996).
[0210] ITRs are exemplified herein, and the example herein is the AAV2 WT-ITR, but one of skill in the art will recognize that, as described above, ITRs from any known parvovirus, e.g., dependovirus, such as AAV (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV5, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAVrh8, AAVrh10, AAV-DJ, and AAV-DJ8 genomes can be used; see, e.g., NCBI: NC 002077, NC 001401, NC001729, NC001829, NC006152, NC 006260, NC 006261), chimeric ITRs, or ITRs from any synthetic AAV. In some embodiments, AAV can infect warm-blooded animals, such as avian (AAAV), bovine (BAAV), canine, equine, and ovine adeno-associated viruses. In some embodiments, the ITRs are derived from B19 parvovirus (GenBank accession number NC 000883), minute virus of mice (MVM) (GenBank accession number NC 001510), goose parvovirus (GenBank accession number NC 001701), or snake parvovirus 1 (GenBank accession number NC 006148). In some embodiments, the 5'WT-ITR can be derived from one serotype and the 3'WT-ITR can be derived from a different serotype, as discussed herein.
[0211] Those skilled in the art will recognize that ITR sequences have the general structure of a double-stranded Holliday junction, typically a T- or Y-shaped hairpin structure (see, e.g., Figures 2A and 3A), with each WT-ITR formed by two palindromic arms or loops (B-B' and C-C') embedded in a larger palindromic arm (A-A'), and a single-stranded D sequence (the order of these palindromic sequences defines the flip or flop orientation of the ITR). See, for example, the structural analysis and sequence comparison of ITRs from different AAV serotypes (AAV1-AAV6) and described in Grimm et al., J. Virology, 2006;80(1);426-439; Yan et al., J. Virology, 2005;364-379; and Duan et al., Virology 1999;261;8-14. Based on the exemplary AAV2 ITR sequences provided herein, those skilled in the art can easily determine the WT-ITR sequence from any AAV serotype for use in a ceDNA vector or ceDNA-plasmid. For example, see Grimm et al., J. Virology, 2006;80(1);426-439, for a comparison of the ITR sequences from different AAV serotypes (AAV1 to AAV6, as well as avian AAV (AAAV) and bovine AAV (BAAV)). This shows the percent identity of the left ITR of AAV2 to the left ITRs from other serotypes: AAV-1 (84%), AAV-3 (86%), AAV-4 (79%), AAV-5 (58%), AAV-6 (left ITR) (100%), and AAV-6 (right ITR) (82%).
[0212] A. Symmetric ITR pair In some embodiments, a ceDNA vector for expressing a FVIII protein described herein comprises, from 5' to 3', a first adeno-associated virus (AAV) inverted terminal repeat (ITR), a nucleotide sequence of interest (e.g., an expression cassette described herein), and a second AAV ITR, wherein the first ITR (5'ITR) and the second ITR (3'ITR) are symmetrical or substantially symmetrical with respect to each other; i.e., the ceDNA vector may comprise ITR sequences with a symmetrical three-dimensional spatial organization, such that their structures are the same shape in geometric space or have the same A, C-C', and B-B' loops in three-dimensional space. In such embodiments, the symmetrical or substantially symmetrical ITR pair may be a modified ITR (e.g., a mod-ITR) that is not a wild-type ITR. A mod-ITR pair may have one or more modifications from the wild-type ITR and have the same sequence that is the reverse complement (inverted) of each other. In alternative embodiments, the modified ITR pair is substantially symmetrical as defined herein, i.e., the modified ITR pair may have different sequences but may have corresponding or the same symmetrical three-dimensional shapes.
[0213] (i) Wild-type ITR In some embodiments, the symmetric or substantially symmetric ITRs are wild-type (WT-ITR) as described herein. That is, both ITRs have wild-type sequences, but are not necessarily WT-ITRs of the same AAV serotype. That is, in some embodiments, one WT-ITR can be derived from one AAV serotype, and the other WT-ITR can be derived from a different AAV serotype. In such embodiments, the WT-ITR pair is substantially symmetric as defined herein, that is, they can have one or more conservative nucleotide modifications while maintaining a symmetric three-dimensional spatial configuration.
[0214] Thus, as disclosed herein, a ceDNA vector contains a transgene or heterologous nucleic acid sequence located between two adjacent wild-type inverted terminal repeat (WT-ITR) sequences, which are reverse-complementary (inverted) to each other, or alternatively, are substantially symmetrical to each other. That is, the WT-ITR pair has a symmetrical three-dimensional spatial configuration. In some embodiments, the wild-type ITR sequence (e.g., AAV WT-ITR) comprises a functional Rep binding site (RBS, e.g., 5'-GCGCGCTCGCTCGCTC-3' for AAV2, SEQ ID NO: 60) and a functional terminal resolution site (TRS, e.g., 5'-AGTT-3', SEQ ID NO: 62).
[0215] In one aspect, a ceDNA vector for expressing a FVIII protein can be obtained from a vector polynucleotide encoding a heterologous nucleic acid operably positioned between two wild-type inverted terminal repeats (WT-ITRs) (e.g., AAV WT-ITRs). That is, both ITRs have wild-type sequences, but are not necessarily WT-ITRs of the same AAV serotype. That is, in some embodiments, one WT-ITR can be derived from one AAV serotype, and the other WT-ITR can be derived from a different AAV serotype. In such embodiments, the WT-ITR pair is substantially symmetrical as defined herein, i.e., they can have one or more conservative nucleotide modifications while maintaining a symmetrical three-dimensional spatial configuration. In some embodiments, the 5'WT-ITR is derived from one AAV serotype, and the 3'WT-ITR is derived from the same or a different AAV serotype. In some embodiments, the 5'WT-ITR and the 3'WT-ITR are mirror images of each other, i.e., they are symmetrical. In some embodiments, the 5'WT-ITR and the 3'WT-ITR are from the same AAV serotype.
[0216] WT ITRs are well known. In one embodiment, the two ITRs are derived from the same AAV2 serotype. In certain embodiments, WT ITRs from other serotypes can be used. There are several homologous serotypes, such as AAV2, AAV4, AAV6, and AAV8. In one embodiment, closely homologous ITRs (e.g., ITRs with similar loop structures) can be used. In another embodiment, more diverse AAV WT ITRs, such as AAV2 and AAV5, can be used, and in yet another embodiment, a substantially WT ITR can be used, i.e., it has the basic loop structure of the WT but has some conservative nucleotide changes that do not change or affect its properties. When using WT-ITRs derived from the same virus serotype, one or more regulatory sequences can also be used. In certain embodiments, the regulatory sequence is a regulatory switch that allows for the adjustment of the activity of the ceDNA, for example, the expression of the encoded FVIII protein.
[0217] In some embodiments, one aspect of the technology described herein relates to a ceDNA vector for expressing a FVIII protein, the ceDNA vector comprising at least one heterologous nucleotide sequence encoding a FVIII protein operably positioned between two wild-type inverted terminal repeats (WT-ITRs), where the WT-ITRs can be from the same serotype, different serotypes, or can be substantially symmetrical to each other (i.e., have a symmetrical three-dimensional spatial organization such that their structures are the same shape in geometric space, or have the same A, C-C', and B-B' loops in three-dimensional space). In some embodiments, the symmetric WT-ITRs comprise functional terminal resolution sites and Rep binding sites. In some embodiments, the heterologous nucleic acid sequence encodes a transgene, and the vector is not in a viral capsid.
[0218] In some embodiments, the WT-ITRs are the same but are reverse complements of each other. For example, the sequence AACG in the 5' ITR can be CGTT (i.e., the reverse complement) of the corresponding site in the 3' ITR. In one example, the 5' WT-ITR sense strand comprises the sequence ATCGATCG, and the corresponding 3' WT-ITR sense strand comprises the sequence [ka] (i.e., the reverse complement of ATCGATCG). In some embodiments, the WT-ITR ceDNA further comprises a terminal resolution site and a replication protein binding site (RPS) (sometimes referred to as a replication protein binding site), e.g., a Rep binding site.
[0219] Exemplary WT-ITR sequences for use in ceDNA vectors for expression of FVIII proteins containing WT-ITRs are shown in Table 3 herein, which shows pairs of WT-ITRs (5'WT-ITR and 3'WT-ITR).
[0220] As an illustrative example, the present disclosure provides a ceDNA vector for expression of a FVIII protein comprising a promoter, with or without a regulatory switch, operably linked to a transgene (e.g., a heterologous nucleic acid sequence), wherein the ceDNA lacks a capsid protein and is (a) produced from a ceDNA-plasmid (see, e.g., Figures 1F-1G) encoding WT-ITRs, each WT-ITR having the same number of intramolecularly duplexed base pairs in its hairpin secondary configuration (preferably excluding any AAA or TTT terminal loop deletions in this configuration compared to these reference sequences), and (b) identified as ceDNA using the assay for identification of ceDNA by agarose gel electrophoresis under native and denaturing conditions of Example 1.
[0221] In some embodiments, adjacent WT-ITRs are substantially symmetrical to each other. In this embodiment, the 5'WT-ITR can be derived from one serotype of AAV, and the 3'WT-ITR can be derived from a different serotype of AAV, so that the WT-ITRs are not identical reverse complements. For example, the 5'WT-ITR can be derived from AAV2, and the 3'WT-ITR can be derived from a different serotype (e.g., AAV1, 3, 4, 5, 6, 7, 8, 9, 10, 11, and 12). In some embodiments, the WT-ITRs may be selected from two different parvoviruses selected from any of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, snake parvovirus (e.g., royal python parvovirus), bovine parvovirus, caprine parvovirus, avian parvovirus, canine parvovirus, equine parvovirus, shrimp parvovirus, porcine parvovirus, or insect AAV. In some embodiments, such a combination of WT-ITRs is a combination of WT-ITRs from AAV2 and AAV6. In one embodiment, substantially symmetric WT-ITRs, when inverted relative to the other ITR, are at least 90% identical, at least 95% identical, at least 96%...97%...98%...99%...99.5%, and all points in between, and have the same symmetric three-dimensional spatial configuration. In some embodiments, WT-ITR pairs are substantially symmetric because they have symmetric three-dimensional spatial configurations, e.g., the same three-dimensional configuration of the A, C-C', B-B', and D arms. In one embodiment, a substantially symmetric WT-ITR pair is inverted relative to the other and is at least 95% identical, at least 96%...97%...98%...99%...99.5%, and all points in between, wherein one WT-ITR retains a Rep binding site (RBS) and terminal resolution site (TRS) of 5'-GCGCGCTCGCTCGCTC-3' (SEQ ID NO: 60).In some embodiments, a substantially symmetric WT-ITR pair is inverted relative to each other and is at least 95% identical, at least 96%...97%...98%...99%...99.5%, and all points in between, where one WT-ITR retains a Rep binding site (RBS) and terminal resolution site (TRS) of 5'-GCGCGCTCGCTCGCTC-3' (SEQ ID NO: 60), in addition to a variable palindromic sequence that allows for hairpin secondary structure formation. Homology can be determined by standard means known in the art, such as BLAST (Basic Local Alignment Search Tool), BLASTN, with default settings.
[0222] In some embodiments, the structural element of an ITR can be any structural element involved in the functional interaction of an ITR with a large Rep protein (e.g., Rep 78 or Rep 68). In certain embodiments, the structural element provides selectivity for the interaction of an ITR with a large Rep protein, i.e., determines, at least in part, which Rep protein functionally interacts with the ITR. In other embodiments, the structural element physically interacts with a large Rep protein when the Rep protein is bound to the ITR. Each structural element can be, for example, the secondary structure of the ITR, the nucleotide sequence of the ITR, the space between two or more elements, or any combination of the above. In one embodiment, the structural element is selected from the group consisting of A and A' arms, B and B' arms, C and C' arms, D arm, Rep binding site (RBE) and RBE' (i.e., complementary RBE sequences), and terminal resolution site (TRS).
[0223] By way of example only, Table 2 shows exemplary WT-ITR combinations.
[0224] Table 2: Exemplary combinations of WT-ITRs from the same or different serotypes, or different parvoviruses. The order shown does not indicate ITR position; for example, "AAV1, AAV2" specifies that the ceDNA can contain a WT-AAV1 ITR at the 5' position and a WT-AAV2 ITR at the 3' position, or vice versa, a WT-AAV2 ITR at the 5' position and a WT-AAV1 ITR at the 3' position. Abbreviations: AAV serotype 1 (AAV1), AAV serotype 2 (AAV2), AAV serotype 3 (AAV3), AAV serotype 4 (AAV4), AAV serotype 5 (AAV5), AAV serotype 6 (AAV6), AAV serotype 7 (AAV7), AAV serotype 8 (AAV8), AAV serotype 9 (AAV9), AAV serotype 10 (AAV10), AAV serotype 11 (AAV11), or AAV serotype 12 (AAV12), AAVrh8, AAVrh10, AAV-DJ, and AAV-DJ8 genomes (e.g., NCBI: NC 002077, NC 001401, NC001729, NC001829, NC006152, NC 006260, NC 006261), ITRs from warm-blooded animals (avian AAV (AAAV), bovine AAV (BAAV), canine, equine, and ovine AAV), ITRs from B19 parvovirus (GenBank accession number NC 000883), minute virus from mice (MVM) (GenBank accession number NC 001510), goose: goose parvovirus (GenBank accession number NC 001701), snake: snake parvovirus 1 (GenBank accession number NC 006148). [Table 2-1] [Table 2-2] [Table 2-3]
[0225] By way of example only, Table 3 shows the sequences of exemplary WT-ITRs from several different AAV serotypes. [Table 3-1] [Table 3-2]
[0226] In some embodiments, the nucleotide sequence of the WT-ITR sequence may be modified (e.g., by modifying 1, 2, 3, 4, 5 or more nucleotides, or any range therein), whereby the modification is a substitution of a complementary nucleotide, e.g., G for C and vice versa, T for A and vice versa.
[0227] In certain embodiments of the present invention, a ceDNA vector for expression of a FVIII protein does not have a WT-ITR consisting of a nucleotide sequence selected from any of SEQ ID NOs: 1, 2, 5-14. In alternative embodiments of the present invention, when a ceDNA vector has a WT-ITR comprising a nucleotide sequence selected from any of SEQ ID NOs: 1, 2, 5-14, the adjacent ITR is also WT, and the ceDNA comprises a regulatory switch, e.g., as disclosed herein and in International Application No. 18 / 49996 (see, e.g., Table 11 of PCT / US18 / 49996). In some embodiments, a ceDNA vector for expression of a FVIII protein comprises a regulatory switch disclosed herein and a selected WT-ITR having a nucleotide sequence selected from any of the group consisting of SEQ ID NOs: 1, 2, 5-14.
[0228] The ceDNA vectors for expression of FVIII proteins described herein may contain a WT-ITR structure that retains operable RBE, TRS, and RBE' portions. Figures 2A and 2B, which use wild-type ITRs for illustrative purposes, show one possible mechanism for the operation of the TRS site within the wild-type ITR portion of a ceDNA vector. In some embodiments, the ceDNA vectors for expression of FVIII proteins contain one or more functional WT-ITR polynucleotide sequences that include a Rep-binding site (RBS, 5'-GCGCGCTCGCTCGCTC-3' (SEQ ID NO: 60) for AAV2) and a terminal resolution site (TRS, 5'-AGTT (SEQ ID NO: 62)). In some embodiments, at least one WT-ITR is functional. In alternative embodiments, where the ceDNA vectors for expression of FVIII proteins contain two WT-ITRs that are substantially symmetrical to each other, at least one WT-ITR is functional and at least one WT-ITR is non-functional.
[0229] B. Common modified ITRs (mod-ITRs) of ceDNA vectors containing asymmetric or symmetric ITR pairs As discussed herein, ceDNA vectors for expression of FVIII proteins can contain a symmetric ITR pair or an asymmetric ITR pair. In either case, one or both ITRs can be modified ITRs, the difference being that in the first case (i.e., symmetric mod-ITR), the mod-ITRs have the same three-dimensional spatial organization (i.e., have the same A-A', C-C', and B-B' arm organization), while in the second case (i.e., asymmetric mod-ITR), the mod-ITRs have a different three-dimensional spatial organization (i.e., have a different A-A', C-C', and B-B' arm organization).
[0230] In some embodiments, the modified ITR is an ITR that is modified by deletion, insertion, and / or substitution compared to a wild-type ITR sequence (e.g., an AAV ITR). In some embodiments, at least one of the ITRs in the ceDNA vector comprises a functional Rep binding site (RBS, e.g., 5'-GCGCGCTCGCTCGCTC-3', SEQ ID NO: 60, for AAV2) and a functional terminal resolution site (TRS, e.g., 5'-AGTT-3', SEQ ID NO: 62). In one embodiment, at least one of the ITRs is a non-functional ITR. In one embodiment, each of the different or modified ITRs is not a wild-type ITR from a different serotype.
[0231] While specific alterations and mutations of ITRs are described in detail herein, in the context of ITRs, "altered" or "mutated" or "modified" refers to nucleotides that have been inserted, deleted, and / or substituted relative to the wild-type, reference, or original ITR sequence. An altered or mutant ITR may be an engineered ITR. As used herein, "engineered" refers to an aspect that has been manipulated by the hand of man. For example, a polypeptide is considered "engineered" when at least one aspect of the polypeptide, e.g., its sequence, has been manipulated by the hand of man and is different from the aspect in which it occurs in nature.
[0232] In some embodiments, the mod-ITRs can be synthetic. In one embodiment, the synthetic ITRs are based on ITR sequences from two or more AAV serotypes. In another embodiment, the synthetic ITRs do not contain AAV base sequences. In yet another embodiment, the synthetic ITRs preserve the ITR structure described above but have little or no AAV-origin sequences. In some aspects, the synthetic ITRs may preferentially interact with wild-type Rep or Rep of a particular serotype, or in some cases, are not recognized by wild-type Rep but are recognized only by mutant Rep.
[0233] Those skilled in the art can determine corresponding sequences in other serotypes by known means. For example, determine whether there are changes in the A, A', B, B', C, C', or D regions and determine the corresponding region in another serotype. BLAST® (Basic Local Alignment Search Tool) or other homology alignment programs can be used in their default settings to determine corresponding sequences. The present invention further provides populations and multiple ceDNA vectors containing mod-ITRs from combinations of different AAV serotypes. That is, one mod-ITR can be derived from one AAV serotype and the other mod-ITR can be derived from a different serotype. Without being bound by theory, in one embodiment, one ITR may be derived from or based on an AAV2 ITR sequence, and the other ITR of the ceDNA vector may be derived from or based on any one or more ITR sequences of AAV serotype 1 (AAV1), AAV serotype 4 (AAV4), AAV serotype 5 (AAV5), AAV serotype 6 (AAV6), AAV serotype 7 (AAV7), AAV serotype 8 (AAV8), AAV serotype 9 (AAV9), AAV serotype 10 (AAV10), AAV serotype 11 (AAV11), or AAV serotype 12 (AAV12).
[0234] Any parvovirus ITR can be used for modification as an ITR or as a basic ITR. Preferably, the parvovirus is a dependovirus. More preferably, it is AAV. The serotype selected can be based on the tissue tropism of the serotype. AAV2 has broad tissue tropism, AAV1 preferentially targets neurons and skeletal muscle, and AAV5 targets neurons, retinal pigment epithelium, and photoreceptors. AAV6 preferentially targets skeletal muscle and lung. AAV8 preferentially targets liver, skeletal muscle, heart, and pancreatic tissue. AAV9 preferentially targets liver, skeletal, and lung tissue. In one embodiment, the modified ITR is based on the AAV2 ITR.
[0235] More specifically, the ability of a structural element to functionally interact with a specific large Rep protein can be altered by modifying the structural element. For example, the nucleotide sequence of the structural element can be modified compared to the wild-type sequence of the ITR. In one embodiment, structural elements of the ITR (e.g., the A arm, A' arm, B arm, B' arm, C arm, C' arm, D arm, RBE, RBE', and TRS) can be removed and replaced with wild-type structural elements from a different parvovirus. For example, the replacement structure can be from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, snake parvovirus (e.g., royal python parvovirus), bovine parvovirus, caprine parvovirus, avian parvovirus, canine parvovirus, equine parvovirus, shrimp parvovirus, porcine parvovirus, or insect AAV. For example, the ITRs can be AAV2 ITRs, with the A or A' arms or RBE replaced with structural elements from AAV5. In another example, the ITRs can be AAV5 ITRs, with the C or C' arms, RBE, and TRS replaced with structural elements from AAV2. In another example, the AAV ITRs can be AAV5 ITRs, with the B and B' arms replaced with the AAV2 ITR B and B' arms.
[0236] By way of example only, Table 4 shows exemplary modifications (e.g., deletions, insertions, and / or substitutions) of at least one nucleotide in a region of a modified ITR, where X indicates the modification (e.g., deletion, insertion, and / or substitution) of at least one nucleic acid in that section relative to the corresponding wild-type ITR. In some embodiments, any modification (e.g., deletion, insertion, and / or substitution) of at least one nucleotide in any of the C and / or C' and / or B and / or B' regions retains three consecutive T nucleotides (i.e., TTT) in at least one terminal loop. For example, if the modification results in either a single-arm ITR (e.g., a single C-C' arm or a single B-B' arm), or a modified C-B' arm or C'-B arm, or a two-arm ITR with at least one truncated arm (e.g., a truncated C-C' arm and / or a truncated B-B' arm), at least the single arm, or at least one of the arms of the two-arm ITR (one arm may be truncated), retains three consecutive T nucleotides (i.e., TTT) in at least one terminal loop. In some embodiments, the truncated C-C' arm and / or the truncated B-B' arm has three consecutive T nucleotides (i.e., TTT) in the terminal loop.
[0237] Table 4: Exemplary combinations of modifications (e.g., deletions, insertions, and / or substitutions) of at least one nucleotide for different B-B' and C-C' regions or arms of the ITR (X indicates a nucleotide modification, e.g., addition, deletion, or substitution of at least one nucleotide in the region). [Table 4]
[0238] In some embodiments, mod-ITRs for use in ceDNA vectors for expressing FVIII proteins comprise an asymmetric or symmetric ITR pair disclosed herein and may include any one of the modification combinations shown in Table 4, as well as a modification of at least one nucleotide in any one or more of the regions selected from A' and C, C and C', C' and B, B and B', and B' and A. In some embodiments, any modification (e.g., deletion, insertion, and / or substitution) of at least one nucleotide in the C or C' or B or B' region still preserves the terminal loop of the stem-loop. In some embodiments, any modification (e.g., deletion, insertion, and / or substitution) of at least one nucleotide between C and C' and / or B and B' retains three consecutive T nucleotides (i.e., TTT) in at least one terminal loop. In alternative embodiments, any modification (e.g., deletion, insertion, and / or substitution) of at least one nucleotide between C and C' and / or between B and B' preserves three consecutive A nucleotides (i.e., AAA) in at least one terminal loop. In some embodiments, modified ITRs for use herein may include any one of the combinations of modifications shown in Table 4, and a modification (e.g., deletion, insertion, and / or substitution) of at least one nucleotide in any one or more of the regions selected from A', A, and / or D. For example, in some embodiments, modified ITRs for use herein may include any one of the combinations of modifications shown in Table 4, and a modification (e.g., deletion, insertion, and / or substitution) of at least one nucleotide in the A region. In some embodiments, modified ITRs for use herein may include any one of the combinations of modifications shown in Table 4, and a modification (e.g., deletion, insertion, and / or substitution) of at least one nucleotide in the A' region.In some embodiments, modified ITRs for use herein may include any one of the combinations of modifications shown in Table 4, as well as a modification (e.g., deletion, insertion, and / or substitution) of at least one nucleotide in the A and / or A' region. In some embodiments, modified ITRs for use herein may include any one of the combinations of modifications shown in Table 4, as well as a modification (e.g., deletion, insertion, and / or substitution) of at least one nucleotide in the D region.
[0239] In one embodiment, the nucleotide sequence of a structural element can be modified (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more nucleotides, or any range therein) to produce a modified structural element. In one embodiment, specific modifications to the ITRs are exemplified herein (e.g., SEQ ID NOS: 3, 4, 15-47, 101-116, or 165-187) or shown in Figures 7A-7B of PCT / US2018 / 064242, filed December 6, 2018 (e.g., SEQ ID NOS: 97-98, 101-103, 105-108, 111-112, 117-134, 545-54 of PCT / US2018 / 064242). In some embodiments, the ITRs may be modified (e.g., by modifying 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 or more nucleotides, or any range therein). In other embodiments, the ITRs may have at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more sequence identity to one of the modified ITRs of SEQ ID NOs: 3, 4, 15-47, 101-116, or 165-187, or to the RBE-containing sections of the A-A' arm and the C-C' and B-B' arms as set forth in SEQ ID NOs: 3, 4, 15-47, 101-116, or 165-187, or Tables 2-9 of International Application No. 18 / 49996 (i.e., SEQ ID NOs: 110-112, 115-190, 200-468), which are incorporated by reference herein in their entirety.
[0240] In some embodiments, the modified ITR can include, for example, removal or deletion of all of a particular arm, e.g., all or part of the A-A' arm, or all or part of the B-B' arm, or all or part of the C-C' arm, or alternatively, removal of 1, 2, 3, 4, 5, 6, 7, 8, 9, or more base pairs forming the stem of a loop, so long as there is still a final loop capping the stem (e.g., a single arm) (see, e.g., ITR-21 in Figure 7A of PCT / US2018 / 064242, filed December 6, 2018). In some embodiments, the modified ITR can include removal of 1, 2, 3, 4, 5, 6, 7, 8, 9, or more base pairs from the B-B' arm. In some embodiments, the modified ITR can include the removal of 1, 2, 3, 4, 5, 6, 7, 8, 9, or more base pairs from the C-C' arm (see, e.g., ITR-1 in Figure 3B or ITR-45 in Figure 7A of PCT / US2018 / 064242, filed December 6, 2018). In some embodiments, the modified ITR can include the removal of 1, 2, 3, 4, 5, 6, 7, 8, 9, or more base pairs from the C-C' arm and the removal of 1, 2, 3, 4, 5, 6, 7, 8, 9, or more base pairs from the B-B' arm. Any combination of base pair removal is contemplated; for example, 6 base pairs in the C-C' arm and 2 base pairs in the B-B' arm can be removed. As an illustrative example, Figure 3B shows an exemplary modified ITR having at least seven base pairs deleted from each of the C and C' portions, a substitution of a nucleotide in the loop between the C and C' regions, and a deletion of at least one base pair from each of the B and B' regions, such that the modified ITR comprises two arms in which at least one arm (e.g., C-C') is truncated. In some embodiments, the modified ITR also comprises a deletion of at least one base pair from each of the B and B' regions, such that the B-B' arm is also truncated relative to the WT ITR.
[0241] In some embodiments, the modified ITRs may have a 1-50 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) nucleotide deletion relative to the full-length wild-type ITR sequence. In some embodiments, the modified ITRs may have a 1-30 nucleotide deletion relative to the full-length WT ITR sequence. In some embodiments, the modified ITRs have a 2-20 nucleotide deletion relative to the full-length wild-type ITR sequence.
[0242] In some embodiments, the modified ITRs do not contain any nucleotide deletions in the RBE-containing portions of the A or A' regions so as not to interfere with DNA replication (e.g., binding to the RBE by Rep proteins or nicking at the terminal resolution site). In some embodiments, modified ITRs encompassed for use herein have one or more deletions in the B, B', C, and / or C regions described herein.
[0243] In some embodiments, a ceDNA vector for expression of a FVIII protein comprising a symmetric or asymmetric ITR pair comprises a regulatory switch disclosed herein and at least one selected modified ITR having a nucleotide sequence selected from any of the group consisting of SEQ ID NOs: 3, 4, 15-47, 101-116, or 165-187.
[0244] In another embodiment, the structure of the structural element can be modified. For example, the structural element can have a change in stem height and / or the number of nucleotides in the loop. For example, the stem height can be about 2, 3, 4, 5, 6, 7, 8, or 9 nucleotides or more, or any range therein. In one embodiment, the stem height can be about 5 nucleotides to about 9 nucleotides and can functionally interact with Rep. In another embodiment, the stem height can be about 7 nucleotides and can functionally interact with Rep. In another example, the loop can have a length of 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides or more, or any range therein.
[0245] In another embodiment, the number of GAGY-binding sites or GAGY-related binding sites in an RBE or extended RBE can be increased or decreased. In one example, an RBE or extended RBE can contain 1, 2, 3, 4, 5, 6, or more GAGY-binding sites, or any range therein. Each GAGY-binding site can independently be the exact GAGY sequence or a sequence similar to GAGY, so long as the sequence is sufficient to bind to the Rep protein.
[0246] In another embodiment, the spacing between two elements (such as, but not limited to, an RBE and a hairpin) can be altered (e.g., increased or decreased) to alter functional interactions with a large Rep protein. For example, the spacing can be about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides or more, or any range therein.
[0247] The ceDNA vectors for expression of FVIII proteins described herein may contain ITR structures that are modified relative to the wild-type AAV2 ITR structure disclosed herein, while still retaining operable RBE, TRS, and RBE' portions. Figures 2A and 2B show one possible mechanism for engineering TRS sites within the wild-type ITR structure of a ceDNA vector for expression of FVIII proteins. In some embodiments, a ceDNA vector for expression of FVIII proteins contains one or more functional ITR polynucleotide sequences, including a Rep-binding site (RBS, 5'-GCGCGCTCGCTCGCTC-3' (SEQ ID NO: 60) for AAV2) and a terminal resolution site (TRS, 5'-AGTT (SEQ ID NO: 62)). In some embodiments, at least one ITR (wild-type or modified ITR) is functional. In alternative embodiments, where a ceDNA vector for expression of FVIII proteins contains two modified ITRs that are different or asymmetric from each other, at least one modified ITR is functional and at least one modified ITR is non-functional.
[0248] In some embodiments, the modified ITRs (e.g., left or right ITRs) of the ceDNA vectors for expression of FVIII proteins described herein have modifications in the loop arm, cleavage arm, or spacer. Exemplary sequences of ITRs with modifications in the loop arm, cleavage arm, or spacer are listed in Table 2 (i.e., SEQ ID NOS: 135-190, 200-233), Table 3 (e.g., SEQ ID NOS: 234-263), Table 4 (e.g., SEQ ID NOS: 264-293), Table 5 (e.g., SEQ ID NOS: 294-318 herein), Table 6 (e.g., SEQ ID NOS: 319-468), and Tables 7-9 (e.g., SEQ ID NOS: 101-110, 111-112, 115-134) or Table 10A or 10B (e.g., SEQ ID NOS: 9, 100, 469-483, 484-499) of International Application No. 18 / 49996, which are incorporated herein by reference in their entireties.
[0249] In some embodiments, modified ITRs for use in ceDNA vectors for expression of FVIII proteins comprising asymmetric or symmetric mod-ITR pairs are selected from any of those set forth in Tables 2, 3, 4, 5, 6, 7, 8, 9, and 10A-10B of International Application No. WO 18 / 49996, the entire contents of which are incorporated herein by reference, or a combination thereof.
[0250] Additional exemplary modified ITRs for use in ceDNA vectors for expression of FVIII proteins, including asymmetric or symmetric mod-ITR pairs in each of the above classes, are shown in Tables 5A and 5B. The predicted secondary structures of the right-modified ITRs in Table 5A are shown in Figure 7A of International Application No. 2018 / 064242, filed December 6, 2018, and the predicted secondary structures of the left-modified ITRs in Table 5B are shown in Figure 7B of International Application No. 2018 / 064242, filed December 6, 2018, which are incorporated by reference herein in their entireties.
[0251] Tables 5A and 5B show exemplary right- and left-modified ITRs.
[0252] Table 5A: Exemplary modified right ITRs. These exemplary modified right ITRs can include an RBE GCGCGCTCGCTCGCTC-3' (SEQ ID NO: 60), a spacer ACTGAGGC (SEQ ID NO: 69), a spacer complement GCCTCAGT (SEQ ID NO: 70), and an RBE' (i.e., a complement to the RBE) GAGCGAGCGAGCGCGC (SEQ ID NO: 71). [Table 5A-1] [Table 5A-2]
[0253] Table 5B: Exemplary modified left ITRs. These exemplary modified left ITRs can include the RBE GCGCGCTCGCTCGCTC-3' (SEQ ID NO: 60), the spacer ACTGAGGC (SEQ ID NO: 69), the spacer complement GCCTCAGT (SEQ ID NO: 70), and the RBE complement (RBE') GAGCGAGCGAGCGCGC (SEQ ID NO: 71). [Table 5B-1] [Table 5B-2]
[0254] In one embodiment, a ceDNA vector for expressing a FVIII protein comprises, from 5' to 3', a first adeno-associated virus (AAV) inverted terminal repeat (ITR), a nucleotide sequence of interest (e.g., an expression cassette described herein), and a second AAV ITR, wherein the first ITR (5'ITR) and the second ITR (3'ITR) are asymmetric with each other, i.e., they have different three-dimensional spatial configurations. In an exemplary embodiment, the first ITR can be a wild-type ITR and the second ITR can be a mutant or modified ITR, or vice versa, where the first ITR can be a mutant or modified ITR and the second ITR can be a wild-type ITR. In some embodiments, the first ITR and the second ITR are both mod-ITRs, but have different sequences or modifications, and therefore are not the same modified ITR but have different three-dimensional spatial configurations. In other words, a ceDNA vector using asymmetric ITRs may contain ITRs in which any changes in one ITR relative to the WT-ITR are not reflected in the other ITR, or alternatively, the asymmetric ITRs may have modified asymmetric ITR pairs, which may have different sequences and different three-dimensional shapes relative to each other. Exemplary asymmetric ITRs for use in generating ceDNA-plasmids in ceDNA vectors for expression of FVIII proteins are shown in Tables 5A and 5B.
[0255] In an alternative embodiment, a ceDNA vector for expression of a FVIII protein comprises two symmetric mod-ITRs. That is, both ITRs have the same sequence but are reverse complements (inverted) of each other. In some embodiments, a symmetric mod-ITR pair comprises at least one or any combination of deletions, insertions, or substitutions compared to the wild-type ITR sequence from the same AAV serotype. The additions, deletions, or substitutions of the symmetric ITRs are the same but are reverse complements of each other. For example, an insertion of three nucleotides into the C region of the 5' ITR is reflected by an insertion of three reverse complementary nucleotides into the corresponding section of the C' region of the 3' ITR. For illustrative purposes only, if the addition is AACG in the 5' ITR, the addition is CGTT in the 3' ITR at the corresponding site. For example, if the 5' ITR sense strand is [ka] and between G and A [ka] With the addition of [ka] The corresponding 3' ITR sense strand is [ka] and between T and C [ka] (i.e., the reverse complement of AACG) [ka] results.
[0256] In alternative embodiments, the modified ITR pair is substantially symmetrical as defined herein, i.e., the modified ITR pair may have different sequences but have corresponding or identical symmetrical three-dimensional shapes. For example, one modified ITR may be derived from one serotype, and the other modified ITR may be derived from a different serotype, but they have the same mutation (e.g., nucleotide insertion, deletion, or substitution) in the same region. In other words, for illustrative purposes only, the 5'-modified ITR may be derived from AAV2 and have a deletion in the C region, and the 3'-modified ITR may be derived from AAV5 and have a corresponding deletion in the C' region. Provided that the 5'-modified ITR and the 3'-modified ITR have the same or symmetrical three-dimensional spatial configuration, they are encompassed in their use as modified ITR pairs herein.
[0257] In some embodiments, a substantially symmetric mod-ITR pair has the same A, C-C', and B-B' loops in three-dimensional space. For example, if the modified ITR of a substantially symmetric mod-ITR pair has a deletion of the C-C' arm, the cognate mod-ITR has a corresponding deletion of the C-C' loop and has a similar three-dimensional structure of the remaining A and B-B' loops that are the same shape in geometric space as the cognate mod-ITR. By way of example only, substantially symmetric ITRs can have a symmetric spatial organization such that their structures are the same shape in geometric space. This can occur, for example, when a GC pair is modified to, for example, a CG pair, or vice versa, or when an AT pair is modified to, for example, a TA pair, or vice versa. Thus, [ka] a modified 5'ITR as [ka] A modified 3'ITR as (i.e., [ka] Using the above exemplary example of, for example, [ka] (where the G in the addition is modified to C), these modified ITRs are still symmetrical, and a substantially symmetrical 3' ITR would have the following structure: [ka] In some embodiments, the modified ITR pair has symmetric stereochemistry, such that the modified ITR is substantially symmetric.
[0258] Table 6 shows exemplary symmetrically modified ITR pairs (i.e., left-modified ITRs and symmetrically right-modified ITRs) for use in ceDNA vectors for expression of FVIII proteins. The bold (red) portions of the sequences identify the partial ITR sequences (i.e., the sequences of the A-A', C-C', and B-B' loops), which are also shown in Figures 31A-46B. These exemplary modified ITRs can include the RBE GCGCGCTCGCTCGCTC-3' (SEQ ID NO: 60), the spacer ACTGAGGC (SEQ ID NO: 69), the spacer complement GCCTCAGT (SEQ ID NO: 70), and the RBE' (i.e., the complement to the RBE) GAGCGAGCGAGCGCGC (SEQ ID NO: 71). [Table 6-1] [Table 6-2] [Table 6-3]
[0259] In some embodiments, a ceDNA vector for expression of a FVIII protein comprising an asymmetric ITR pair may comprise an ITR having modifications corresponding to any of the modifications in the ITR sequences or ITR subsequences set forth in any one or more of Tables 5A-5B herein, or shown in Figures 7A-7B of International Application No. 2018 / 064242, filed December 6, 2018, which is incorporated herein in its entirety, or disclosed in Tables 2, 3, 4, 5, 6, 7, 8, 9, or 10A-10B of International Application No. 18 / 49996, filed September 7, 2018, which is incorporated herein by reference in its entirety.
[0260] V. Exemplary ceDNA Vectors As described above, the present disclosure relates to a recombinant ceDNA expression vector and a ceDNA vector encoding a FVIII protein comprising any one of the above-described asymmetric ITR pair, symmetric ITR pair, or substantially symmetric ITR pair. In certain embodiments, the present disclosure relates to a recombinant ceDNA vector for expressing a FVIII protein having adjacent ITR sequences and a transgene, wherein the ITR sequences are asymmetric, symmetric, or substantially symmetric with respect to each other as defined herein, and the ceDNA further comprises a nucleotide sequence of interest (e.g., an expression cassette comprising a transgene nucleic acid) located between the adjacent ITRs, and the nucleic acid molecule lacks a viral capsid protein-encoding sequence.
[0261] The ceDNA expression vector for expressing FVIII protein may be any ceDNA vector that can be conveniently subjected to recombinant DNA procedures, including the nucleotide sequence described herein, provided that at least one ITR is modified. The ceDNA vector for expressing FVIII protein of the present disclosure is compatible with the host cell into which the ceDNA vector is introduced. In certain embodiments, the ceDNA vector may be linear. In certain embodiments, the ceDNA vector may exist as an extrachromosomal entity. In certain embodiments, the ceDNA vector of the present disclosure may contain elements that allow the donor sequence to be integrated into the genome of the host cell. As used herein, "transgene" and "heterologous nucleotide sequence" are synonymous and encode a FVIII protein as described herein.
[0262]
[0013] Referring now to Figures 1A-1G, schematic diagrams of the functional components of two non-limiting plasmids useful for generating ceDNA vectors for expressing FVIII proteins are shown. Figures 1A, 1B, 1D, and 1F show the constructs of ceDNA vectors for expressing FVIII proteins or the sequences of corresponding ceDNA plasmids. The ceDNA vectors are capsid-free and can be obtained from a plasmid encoding a first ITR, an expressible transgene cassette, and a second ITR, in this order, where the first and second ITR sequences are asymmetric, symmetric, or substantially symmetric with respect to each other, as defined herein. The ceDNA vectors for expressing FVIII proteins are capsid-free and can be obtained from a plasmid encoding a first ITR, an expressible transgene (protein or nucleic acid), and a second ITR, in this order, where the first and second ITR sequences are asymmetric, symmetric, or substantially symmetric with respect to each other, as defined herein. In some embodiments, the expressible transgene cassette optionally includes an enhancer / promoter, one or more homology arms, a donor sequence, a post-transcriptional regulatory element (e.g., a WPRE, e.g., SEQ ID NO: 67), and a polyadenylation and termination signal (e.g., a BGH polyA, e.g., SEQ ID NO: 68).
[0263] Figure 5 is a gel confirming the production of ceDNA from multiple plasmid constructs using the methods described in the Examples. The ceDNA is confirmed by the characteristic banding pattern in the gel, as discussed above with respect to Figure 4A and in the Examples.
[0264] A. Regulatory Elements The ceDNA vector for expressing the FVIII protein described herein, which includes an asymmetric ITR pair or a symmetric ITR pair as defined herein, may further include a specific combination of cis-regulatory elements. Cis-regulatory elements include, but are not limited to, promoters, riboswitches, insulators, mir regulatory elements, post-transcriptional regulatory elements, tissue- and cell-type-specific promoters, and enhancers. In some embodiments, the ITRs can act as promoters for transgenes, such as FVIII proteins. In some embodiments, the ceDNA vector for expressing the FVIII protein described herein includes additional components for regulating the expression of the transgene, such as a regulatory switch described herein, which controls the expression of the transgene or a kill switch that can kill cells containing the ceDNA vector encoding the FVIII protein. Regulatory elements, including regulatory switches, that can be used in the present invention are more fully discussed in International Application No. 18 / 49996, the entire contents of which are incorporated herein by reference.
[0265] In certain embodiments, the second nucleotide sequence comprises a regulatory sequence and a nucleotide sequence encoding a nuclease. In certain embodiments, the gene regulatory sequence is operably linked to the nucleotide sequence encoding the nuclease. In certain embodiments, the regulatory sequence is suitable for controlling the expression of the nuclease in a host cell. In certain embodiments, the regulatory sequence comprises a suitable promoter sequence capable of directing the transcription of a gene operably linked to a promoter sequence, such as a nucleotide sequence encoding a nuclease of the present disclosure. In certain embodiments, the second nucleotide sequence comprises an intron sequence linked to the 5' end of the nucleotide sequence encoding the nuclease. In certain embodiments, an enhancer sequence is provided upstream of the promoter to increase the efficiency of the promoter. In certain embodiments, the regulatory sequence comprises an enhancer and a promoter, and the second nucleotide sequence comprises an intron sequence upstream of the nucleotide sequence encoding the nuclease, the intron comprising one or more nuclease cleavage sites, and the promoter is operably linked to the nucleotide sequence encoding the nuclease.
[0266] ceDNA vectors for expression of FVIII proteins produced synthetically or using cell-based production methods such as those described in the Examples herein may further comprise specific combinations of cis-regulatory elements, such as the WHP post-transcriptional regulatory element (WPRE) (e.g., SEQ ID NO: 67) and BGH polyA (SEQ ID NO: 68). Suitable expression cassettes for use in expression constructs are not limited by packaging constraints imposed by the viral capsid.
[0267] (i) Promoter: Those skilled in the art will understand that promoters used in the ceDNA vectors for expression of the FVIII proteins disclosed herein should be appropriately adjusted for the particular sequences they promote. According to some embodiments, the promoter is any of the promoters or promoter sequences set forth in International Application No. 2020 / 021328, filed March 6, 2020, which is incorporated by reference in its entirety.
[0268] According to some embodiments, the promoter is a VandenDriessche (VD) promoter. According to some embodiments, the VD promoter comprises SEQ ID NO: 191, as shown below: CGGGGGAGGCTGCTGGTGAATATTAACCAAGGTCACCCCAGTTATCGGAGGAGCAAACAGGGGCTAAGTCCACACGCGTGGTACCGTCTGTCTGCACATTTCGTAGAGCGAGTGTTCCGATACTCTAATCTCCCTAGGCAAGGTTCATATTTGTGTAGGTTACTTATTCTCCTTTTGTTGACTAAGTCAATAATCAGAATCAGCAGGTTTGGAGTCAGCTTGGCAGGGATCAGCAGCCTGGGTTGGAAGGAGGGGGTATAAAAGCCCCTTCACCAGGAGAAGCCGTCACACAGATCCACAAGCTCCTGAAGAGGTAAGGGTTTAAGGGATGGTTGGTGTGGGGTATTAATGTTTAATTACCTGGAGCACCTGCCTGAAATCACTTTTTTTCAGGTTG (SEQ ID NO: 191)
[0269] According to some embodiments, the promoter comprises a nucleic acid sequence at least about 85% identical to SEQ ID NO: 191. According to some embodiments, the promoter comprises a nucleic acid sequence at least about 90% identical to SEQ ID NO: 191. According to some embodiments, the promoter comprises a nucleic acid sequence at least about 95% identical to SEQ ID NO: 191. According to some embodiments, the promoter comprises a nucleic acid sequence at least about 96% identical to SEQ ID NO: 191. According to some embodiments, the promoter comprises a nucleic acid sequence at least about 97% identical to SEQ ID NO: 191. According to some embodiments, the promoter comprises a nucleic acid sequence at least about 98% identical to SEQ ID NO: 191. According to some embodiments, the promoter comprises a nucleic acid sequence at least about 99% identical to SEQ ID NO: 191. According to some embodiments, the promoter consists of the nucleic acid sequence of SEQ ID NO: 191.
[0270] The expression cassette of the ceDNA vector for expressing FVIII protein may contain a promoter that can affect cell specificity as well as overall expression level. In the case of transgene expression, for example, FVIII protein expression, it may contain a highly active virus-derived immediate early promoter. The expression cassette may contain a tissue-specific eukaryotic promoter to restrict transgene expression to a specific cell type and reduce toxic effects and immune reactions resulting from unregulated ectopic expression. In some embodiments, the expression cassette may contain a promoter or synthetic regulatory element such as the CAG promoter (SEQ ID NO: 72). The CAG promoter contains (i) a cytomegalovirus (CMV) early enhancer element, (ii) the promoter, the first exon and first intron of the chicken β-actin gene, and (iii) the splice acceptor of the rabbit β-globin gene. Alternatively, the expression cassette may contain the alpha-1-antitrypsin (AAT) promoter (SEQ ID NO:73 or SEQ ID NO:74), the liver-specific (LP1) promoter (SEQ ID NO:75 or SEQ ID NO:76), or the human elongation factor-1 alpha (EF1a) promoter (e.g., SEQ ID NO:77 or SEQ ID NO:78). In some embodiments, the expression cassette comprises one or more constitutive promoters, such as the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with an RSV enhancer), or the cytomegalovirus (CMV) immediate early promoter (optionally with a CMV enhancer, e.g., SEQ ID NO:79). Alternatively, an inducible promoter, the transgene's native promoter, a tissue-specific promoter, or various promoters known in the art can be used.
[0271] Suitable promoters, including those described herein, can be derived from viruses and therefore can be referred to as viral promoters, or they can be derived from any organism, including prokaryotes or eukaryotes. Suitable promoters can be used to drive expression by any RNA polymerase (e.g., pol I, pol II, pol III). Exemplary promoters include, but are not limited to, the SV40 early promoter, the mouse mammary tumor virus long terminal repeat (LTR) promoter, the adenovirus major late promoter (Ad MLP), the herpes simplex virus (HSV) promoter, the cytomegalovirus (CMV) promoter, such as the CMV immediate early promoter region (CMVIE), the Rous sarcoma virus (RSV) promoter, the human U6 micronucleus promoter (U6, e.g., SEQ ID NO: 80) (Miyagishi et al., Nature Biotechnology 20, 497-500 (2002)), the enhanced U6 promoter (e.g., Xia et al., Nucleic Acids Res. 2003 Sep. 1; 31 (17)), the human H1 promoter (H1) (e.g., SEQ ID NO: 81 or SEQ ID NO: 155), the CAG promoter, the human alpha 1-antitrypsin (HAAT) promoter (e.g., SEQ ID NO: 82), and the like. In certain embodiments, these promoters are modified at their downstream intron-containing ends to contain one or more nuclease cleavage sites, hi certain embodiments, the DNA containing the nuclease cleavage sites is exogenous to the promoter DNA.
[0272] In one embodiment, the promoter used is the native promoter of the gene encoding the therapeutic protein.The promoter and other regulatory sequences of each gene encoding the therapeutic protein are known and characterized.The promoter region used can further include one or more additional regulatory sequences (e.g., native), such as enhancers (e.g., SEQ ID NO:79 and SEQ ID NO:83), including the SV40 enhancer (SEQ ID NO:126).
[0273] In some embodiments, the promoter may be a promoter from a human gene, such as human ubiquitin C (hUbC), human actin, human myosin, human hemoglobin, human muscle creatine, or human metallothionein. The promoter may also be a natural or synthetic tissue-specific promoter, for example, a liver-specific promoter, for example, human alpha 1-antitrypsin (HAAT). In one embodiment, delivery to the liver may be achieved using endogenous ApoE-specific targeting of a composition comprising a ceDNA vector to hepatocytes via the low-density lipoprotein (LDL) receptor present on the surface of hepatocytes.
[0274] Non-limiting examples of suitable promoters for use in accordance with the present invention include any of the promoters described herein, or, for example, any of the CAG promoter (SEQ ID NO: 72), the HAAT promoter (SEQ ID NO: 82), the human EF1-α promoter (SEQ ID NO: 77), or the EF1a promoter (SEQ ID NO: 78), the IE2 promoter (e.g., SEQ ID NO: 84), and the rat EF1-α promoter (SEQ ID NO: 85), the mEF1 promoter (SEQ ID NO: 59), or the 1E1 promoter fragment (SEQ ID NO: 125).
[0275] (ii) enhancer In some embodiments, the ceDNA expressing FVIII comprises one or more enhancers. In some embodiments, the enhancer sequence is located 5' of the promoter sequence. In some embodiments, the enhancer sequence is located 3' of the promoter sequence. According to some embodiments, the enhancer is any of the enhancers or enhancer sequences set forth in International Application No. 2020 / 021328, filed March 6, 2020, the entire contents of which are incorporated herein by reference.
[0276] (iii) Exemplary 5'UTR and Intron Sequences In some embodiments, the ceDNA vector comprises an intron sequence located 3' of the 5'UTR sequence and / or 5'ITR sequence. In some embodiments, the 5'UTR is located 5' of the sequence encoding the transgene, for example, the FVIII protein. Exemplary 5'UTR sequences are listed in International Application No. 2020 / 021328, for example, in Table 9A, the entire contents of which are incorporated herein by reference.
[0277] (iv) 3'UTR sequence In some embodiments, the ceDNA vector comprises a 3'UTR sequence located 5' of the 3'ITR sequence. In some embodiments, the 3'UTR is located 3' of the sequence encoding the transgene, for example, the FVIII protein. Exemplary 3'UTR sequences are listed in International Application No. 2020 / 021328, for example, in Table 9B, the entire contents of which are incorporated herein by reference.
[0278] (v) polyadenylation sequence A sequence encoding a polyadenylation sequence may be included in a ceDNA vector for expression of a FVIII protein to stabilize the mRNA expressed from the ceDNA vector and to aid in nuclear transport and translation. In one embodiment, the ceDNA vector does not contain a polyadenylation sequence. In other embodiments, the ceDNA vector for expression of a FVIII protein contains at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 45, at least 50, or more adenine dinucleotides. In some embodiments, the polyadenylation sequence contains about 43 nucleotides, about 40-50 nucleotides, about 40-55 nucleotides, about 45-50 nucleotides, about 35-50 nucleotides, or any range therebetween.
[0279] The expression cassette can include any polyadenylation sequence known in the art or variations thereof. In some embodiments, the polyadenylation (polyA) sequence is selected from any of those listed in International Application No. 2020 / 021328, e.g., Table 10, which is incorporated herein by reference in its entirety. Other polyA sequences commonly known in the art can also be used, including, but not limited to, naturally occurring sequences isolated from bovine BGHpA (e.g., SEQ ID NO: 68) or viral SV40pA (e.g., SEQ ID NO: 86), or synthetic sequences (e.g., SEQ ID NO: 87). Some expression cassettes can also include an SV40 late polyA signal upstream enhancer (USE) sequence. In some embodiments, the USE sequence can be used in combination with SV40pA or a heterologous polyA signal. The polyA sequence is located 3' of the transgene encoding the FVIII protein. The expression cassette may also contain post-transcriptional elements to increase transgene expression. In some embodiments, the woodchuck hepatitis virus (WHP) post-transcriptional regulatory element (WPRE) (e.g., SEQ ID NO: 67) is used to increase transgene expression. Other post-transcriptional processing elements, such as the post-transcriptional elements from the thymidine kinase gene of herpes simplex virus or hepatitis B virus (HBV), can be used. A secretory sequence can be linked to the transgene, for example, the VH-02 and VK-A26 sequences, e.g., SEQ ID NO: 88 and SEQ ID NO: 89.
[0280] (vi) Nuclear localization sequence In some embodiments, the ceDNA vector for expressing FVIII protein comprises one or more nuclear localization sequences (NLSs), for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more NLSs. In some embodiments, the one or more NLSs are located at or near the amino terminus, at or near the carboxy terminus, or a combination thereof (e.g., one or more NLSs at the amino terminus and / or one or more NLSs at the carboxy terminus). When two or more NLSs are present, each can be selected independently from the other NLSs, such that a single NLS is present in two or more copies and / or in combination with one or more other NLSs present in one or more copies. Non-limiting examples of NLSs are shown in Table 7. [Table 7]
[0281] B. Additional Components of ceDNA Vectors The ceDNA vector for expression of the FVIII protein of the present disclosure may contain nucleotides encoding other components for gene expression. For example, to select for a specific gene targeting event, a protective shRNA can be embedded in a microRNA and inserted into a recombinant ceDNA vector designed for site-specific integration into a highly active gene locus, such as the albumin locus. Such an embodiment may provide a system for in vivo selection and expansion of gene-modified hepatocytes in any genetic background, as described in Nygaard et al., "A universal system to select gene-modified hepatocytes in vivo," Gene Therapy, June 8, 2016. The ceDNA vector of the present disclosure may contain one or more selectable markers that allow for the selection of transformed, transfected, transduced, etc. cells. A selectable marker is a gene whose product provides biocide or viral resistance, resistance to heavy metals, prototrophy for auxotrophs, NeoR, etc. In certain embodiments, a positive selection marker is incorporated into the donor sequence, such as NeoR. A negative selection marker can be incorporated downstream of the donor sequence, for example, the nucleic acid sequence encoding the negative selection marker, HSV-tk, can be incorporated into the nucleic acid construct downstream of the donor sequence.
[0282] C. Adjustment switch A molecular regulatory switch is one that generates a measurable change in state in response to a signal. Such regulatory switches can be usefully combined with the ceDNA vectors for expression of FVIII proteins described herein to control the output of FVIII protein expression from the ceDNA vector. In some embodiments, the ceDNA vectors for expression of FVIII proteins include a regulatory switch that serves to fine-tune the expression of the FVIII protein. For example, it can serve as a biological containment function for the ceDNA vector. In some embodiments, the switch is an "on / off" switch designed to start or stop (i.e., shut down) the expression of FVIII protein in the ceDNA vector in a controllable and regulatable manner. In some embodiments, the switch can include a "kill switch" that, once activated, can instruct cells containing the ceDNA vector to undergo programmed cell death. Exemplary regulatory switches included for use in ceDNA vectors for expression of FVIII proteins can be used to regulate transgene expression and are discussed more fully in International Application No. 18 / 49996, the entire contents of which are incorporated herein by reference.
[0283] (i) Binary Adjustment Switch In some embodiments, the ceDNA vector for expressing FVIII protein contains a regulatory switch that can help to controllably adjust the expression of FVIII protein. For example, the expression cassette located between the ITRs of the ceDNA vector can additionally contain a regulatory region, such as a promoter, cis-element, repressor, enhancer, etc., operably linked to the nucleic acid sequence encoding the FVIII protein, and this regulatory region is regulated by one or more cofactors or exogenous drugs. By way of example only, the regulatory region can be regulated by a small molecule switch or an inducible or repressible promoter. Non-limiting examples of inducible promoters are hormone-inducible or metal-inducible promoters. Other exemplary inducible promoter / enhancer elements include, but are not limited to, the RU486-inducible promoter, the ecdysone-inducible promoter, the rapamycin-inducible promoter, and the metallothionein promoter.
[0284] (ii) small molecule regulatory switches Various art-known small molecule-based regulatory switches are known in the art and can be combined with the ceDNA vectors for expression of FVIII proteins disclosed herein to form a ceDNA vector controlled by the regulatory switch. In some embodiments, the regulatory switch is an orthogonal ligand / nuclear receptor pair, for example, retinoid receptor variant / LG335 and GRQCIMFI (with an artificial promoter controlling expression of an operably linked transgene, such as that disclosed in Taylor, et al. BMC Biotechnology 10 (2010): 15), an engineered steroid receptor, for example, a modified progesterone receptor with a C-terminal truncation that cannot bind progesterone but binds RU486 (mifepristone) (U.S. Patent No. 5,364,791), the ecdysone receptor from Drosophila and its ecdysteroid ligands (Saez, et al., PNAS, 97 (26) (2000), 14512-14517), or Sando R 3 rd; Nat Methods. 2013, 10(11):1085-8. In some embodiments, the regulatory switch for controlling the transgene expressed by the ceDNA vector is a prodrug activation switch, such as those disclosed in U.S. Patent Nos. 8,771,679 and 6,339,070.
[0285] (iii) "Passcode" adjustment switch In some embodiments, the regulatory switch may be a "passcode switch" or "passcode circuit." A passcode switch allows for fine-tuning of the control of transgene expression from a ceDNA vector when certain conditions occur. That is, a combination of conditions must be present for transgene expression and / or repression to occur. For example, at least conditions A and B must occur for transgene expression to occur. A passcode regulatory switch may be any number of conditions, e.g., at least two, or at least three, or at least four, or at least five, or at least six, or at least seven or more conditions must be present for transgene expression to occur. In some embodiments, at least two conditions (e.g., conditions A and B) must occur, and in some embodiments, at least three conditions (e.g., conditions A, B, and C or A, B, and D) must occur. By way of example only, conditions A, B, and C must be present for gene expression from a ceDNA having a passcode "ABC" regulatory switch to occur. Conditions A, B, and C may be as follows: Condition A is the presence of a pathology or disease, Condition B is a hormonal response, and Condition C is a response to transgene expression. For example, if the transgene edits a defective EPO gene, condition A is the presence of chronic kidney disease (CKD), condition B occurs when the subject has hypoxia in the kidney, and condition C occurs when erythropoietin-producing cells (EPCs) are not recruited in the kidney, or alternatively, when HIF-2 activation is not activated. Once oxygen levels increase or the desired EPO level is reached, the transgene is turned off again and then turned back on until one of the three conditions occurs.
[0286] In some embodiments, the passcode regulatory switches or "passcode circuits" included for use in ceDNA vectors contain hybrid transcription factors (TFs) to expand the range and complexity of environmental signals used to define biological containment conditions. In contrast to dead-man switches, which induce cell death in the presence of predetermined conditions, "passcode circuits" allow cell survival or transgene expression in the presence of specific "passcodes" and can be easily reprogrammed to allow transgene expression and / or cell survival only when a given environmental condition or passcode is present.
[0287] Any and all combinations of the regulatory switches disclosed herein, such as small molecule switches, nucleic acid-based switches, small molecule-nucleic acid hybrid switches, post-transcriptional transgene-regulated switches, post-translational regulated radiation-controlled switches, hypoxia-mediated switches, and other regulatory switches disclosed herein known to those of skill in the art, can be used in the passcode regulatory switches disclosed herein. Regulatory switches encompassed for use are also discussed in the review article Kis et al., JR Soc Interface. 12:20141000 (2015) and summarized in Table 1 of Kis. In some embodiments, regulatory switches for use in the passcode system can be selected from any or combinations of the switches disclosed in Table 11 of International Patent Application No. 18 / 49996, which is incorporated herein by reference in its entirety.
[0288] (iv) a nucleic acid-based regulatory switch for controlling transgene expression In some embodiments, the regulatory switch for controlling the expression of FVIII protein by ceDNA is based on nucleic acid-based control mechanism.Exemplary nucleic acid control mechanism is known in the art and can be used.For example, such mechanism includes riboswitch, for example, those disclosed in US2009 / 0305253, US2008 / 0269258, US2017 / 0204477, WO2018 / 026762A1, U.S. Patent No. 9,222,093 and European Patent Application No. 288071, and those disclosed in the review by Villa JK et al., Microbiol Spectr.2018 May;6(3).Also included are metabolite-responsive transcriptional biosensors, such as those disclosed in WO2018 / 075486 and WO2017 / 147585. Other mechanisms known in the art that can be used include silencing transgenes by siRNA or RNAi molecules (for example, miR, shRNA).For example, ceDNA vectors can contain regulatory switches that code for RNAi molecules that are complementary to the two parts of the transgene that are expressed by ceDNA vectors.When such RNAi is expressed even when transgenes (for example, FVIII protein) are expressed by ceDNA vectors, the complementary RNAi molecules will be silenced; and when RNAi is not expressed when transgenes are expressed by ceDNA vectors, the transgene (for example, FVIII protein) will not be silenced by RNAi.
[0289] In some embodiments, the regulatory switch is a tissue-specific self-inactivating regulatory switch, e.g., as disclosed in US2002 / 0022018, whereby the regulatory switch purposefully switches off the transgene (e.g., FVIII protein) at sites where transgene expression would otherwise be detrimental. In some embodiments, the regulatory switch is a recombinase reversible gene expression system, e.g., as disclosed in US2014 / 0127162 and U.S. Patent No. 8,324,436.
[0290] (v) Post-transcriptional and post-translational regulatory switches. In some embodiments, the regulatory switch for controlling the expression of FVIII protein by ceDNA vector is a post-transcriptional modification system.For example, such regulatory switch can be a tetracycline or theophylline-sensitive aptazyme riboswitch, as disclosed in US2018 / 0119156, GB2011 / 07768, WO2001 / 064956A3, EP2707487, and Beilstein et al., ACS Synth.Biol.,2015,4(5),pp 526-534, Zhong et al., Elife.2016 Nov 2;5.pii:e18858.In some embodiments, it is assumed that a person skilled in the art can code both a transgene and an inhibitory siRNA, which contains a ligand-sensitive (off-switch) aptamer, and the final result is a ligand-sensitive on-switch.
[0291] (vi) Other exemplary adjustment switches Any known regulatory switch can be used in ceDNA vector to control the expression of FVIII protein by ceDNA vector, including those triggered by environmental changes.Additional examples include but are not limited to the BOC method of Suzuki et al., Scientific Reports 8;10051(2018), genetic code expansion and non-physiological amino acid, radiation-controlled or ultrasound-controlled on / off switch (see, for example, Scott S et al., Gene Ther.2000 July;7(13):1121-5, U.S. Patent No. 5,612,318, U.S. Patent No. 5,571,797, U.S. Patent No. 5,770,581, U.S. Patent No. 5,817,636 and WO1999 / 025385A1). In some embodiments, the regulatory switch is controlled by an implantable system, e.g., as disclosed in U.S. Pat. No. 7,840,263, US2007 / 0190028A1, and gene expression is controlled by one or more forms of energy, including electromagnetic energy, that activate a promoter operably linked to a transgene in a ceDNA vector.
[0292] In some embodiments, the regulatory switch envisioned for use in the ceDNA vector is a hypoxia-mediated or stress-activated switch, such as those disclosed in WO1999 / 060142A2, U.S. Patent Nos. 5,834,306, 6,218,179, 6,709,858, US2015 / 0322410, Greco et al., (2004) Targeted Cancer Therapies 9, S368, as well as FROG, TOAD, and NRSE elements, and conditionally inducible silence elements (e.g., hypoxia response element (HRE), inflammatory response element (IRE), and shear stress activation element (SSAE) disclosed in U.S. Patent No. 9,394,526). Such embodiments are useful for turning on the expression of a transgene from a ceDNA vector after ischemia or in ischemic tissue and / or tumor.
[0293] (vii) Kill Switch Other embodiments described herein relate to ceDNA vectors for expressing the FVIII protein described herein, which include a kill switch. The kill switch disclosed herein can cause cells containing the ceDNA vector to be killed or undergo programmed cell death as a means of permanently removing the introduced ceDNA vector from the subject's system. It will be understood by those skilled in the art that the use of a kill switch in a ceDNA vector for expressing a FVIII protein is typically linked to targeting the ceDNA vector to a limited number of cells that the subject can tolerately lose, or to a cell type (e.g., cancer cells) for which apoptosis is desired. In all aspects, the "kill switch" disclosed herein is designed to result in rapid and robust cell killing of cells containing the ceDNA vector in the absence of an input survival signal or other specified condition. In other words, a kill switch encoded by a ceDNA vector for expressing a FVIII protein as described herein can limit cell survival of cells containing the ceDNA vector to an environment defined by a specific input signal. Such a kill switch serves as a biological containment function when it is desirable to remove the ceDNA vector for expression of a FVIII protein in a subject or to ensure that the encoded FVIII protein is not expressed.
[0294] Other kill switches known to those of skill in the art are encompassed for use in the ceDNA vectors for expression of the FVIII proteins disclosed herein, e.g., those disclosed in US2010 / 0175141, US2013 / 0009799, US2011 / 0172826, US2013 / 0109568, as well as the kill switches disclosed in Jusiak et al, Reviews in Cell Biology and molecular Medicine;2014;1-56, Kobayashi et al., PNAS,2004;101;8419-9, Marchisio et al., Int. Journal of Biochem and Cell Biol.,2011;43;310-319, and Reinshagen et al., Science Translational Medicine,2018,11.
[0295] Thus, in some embodiments, a ceDNA vector for expression of a FVIII protein can include a kill-switch nucleic acid construct comprising a nucleic acid encoding an effector toxin or reporter protein, where expression of the effector toxin (e.g., death protein) or reporter protein is controlled by a predetermined condition. For example, the predetermined condition can be the presence of an environmental substance, e.g., an exogenous substance, without which cells will by default express the effector toxin (e.g., death protein) and be killed. In an alternative embodiment, the predetermined condition is the presence of two or more environmental substances, e.g., cells will survive only if two or more necessary exogenous substances are provided, and in the absence of either, the cells containing the ceDNA vector will be killed.
[0296] In some embodiments, the ceDNA vector for expressing FVIII protein is modified to incorporate a kill switch that destroys cells containing the ceDNA vector, effectively terminating the in vivo expression of the transgene expressed by the ceDNA vector (e.g., expression of FVIII protein). Specifically, the ceDNA vector is further engineered to express a switch protein that does not function in mammalian cells under normal physiological conditions. Only upon administration of a drug or environmental condition that specifically targets this switch protein are cells expressing the switch protein destroyed, thereby terminating the expression of the therapeutic protein or peptide. For example, it has been reported that cells expressing HSV-thymidine kinase can be killed by administering drugs such as ganciclovir and cytosine deaminase. See, for example, Dey and Evans, "Suicide Gene Therapy by Herpes Simplex Virus-1 Thymidine Kinase (HSV-TK)," in "Targets in Gene Therapy," edited by You (2011), and Beltinger et al., "Proc. Natl. Acad. Sci. USA 96(15):8699-8704 (1999)." In some embodiments, the ceDNA vector can include an siRNA kill switch called DISE (death by excision of survival genes) (Murmann et al., Oncotarget. 2017;8:84643-84658. Induction of DISE in ovarian cancer cells in vivo).
[0297] VI. Detailed Methods for the Production of ceDNA Vectors A. General production Certain methods for producing ceDNA vectors for expressing FVIII proteins comprising asymmetric or symmetric ITR pairs as defined herein are described in Section IV of International Application No. 18 / 49996, filed September 7, 2018, which is incorporated herein by reference in its entirety. In some embodiments, the ceDNA vectors for expressing FVIII proteins disclosed herein can be produced using insect cells, as described herein. In alternative embodiments, the ceDNA vectors for expressing FVIII proteins disclosed herein can be produced synthetically, and in some embodiments, by cell-free methods, as disclosed in International Application No. 19 / 14122, filed January 18, 2019, which is incorporated herein by reference in its entirety.
[0298] As described herein, in one embodiment, a ceDNA vector for expressing a FVIII protein can be obtained, for example, by a process comprising: a) incubating a population of host cells (e.g., insect cells) harboring a polynucleotide expression construct template (e.g., ceDNA-plasmid, ceDNA-bacmid, and / or ceDNA-baculovirus) under conditions effective to induce production of the ceDNA vector in the host cells in the presence of Rep proteins, and for a time sufficient for the host cells to lack viral capsid-encoding sequences; and b) harvesting and isolating the ceDNA vector from the host cells. The presence of Rep proteins induces replication of the vector polynucleotide with modified ITRs to produce the ceDNA vector in the host cells. However, viral particles (e.g., AAV virions) are not expressed. Therefore, there are no size limitations, such as those naturally imposed by AAV or other virus-based vectors.
[0299] The presence of a ceDNA vector isolated from a host cell can be confirmed by digesting the DNA isolated from the host cell with a restriction enzyme that has a single recognition site on the ceDNA vector and analyzing the digested DNA material on a non-denaturing gel to confirm the presence of a characteristic linear and continuous DNA band compared to linear and discontinuous DNA.
[0300] In yet another aspect, the present invention provides the use of host cell lines that stably integrate a DNA vector polynucleotide expression template (ceDNA template) into their own genome in the production of non-viral DNA vectors, as described, for example, in Lee, L. et al. (2013) Plos One 8(8):e69879. Preferably, Rep is added to the host cells at an MOI of about 3. When the host cell line is a mammalian cell line, such as HEK293 cells, the cell line may have a stably integrated polynucleotide vector template, and a second vector, such as a herpesvirus, may be used to introduce Rep proteins into the cells, allowing for excision and amplification of ceDNA in the presence of Rep and a helper virus.
[0301] In one embodiment, the host cells used to generate ceDNA vectors for expression of FVIII proteins as described herein are insect cells, and baculovirus is used to deliver both the polynucleotide encoding the Rep protein and the ceDNA non-viral DNA vector polynucleotide expression construct template, e.g., as described in Figures 4A-4C and Example 1. In some embodiments, the host cells are engineered to express Rep proteins.
[0302] The ceDNA vector is then harvested and isolated from the host cells. The time for harvesting the ceDNA vector described herein from cells can be selected and optimized to achieve high-yield production of the ceDNA vector. For example, the harvest time can be selected taking into account cell viability, cell morphology, cell growth, etc. In one embodiment, the cells are grown under sufficient conditions and harvested after a sufficient amount of time has passed since baculovirus infection to produce the ceDNA vector, but before the majority of the cells begin to die due to the toxicity of the baculovirus. The DNA vector can be isolated using a plasmid purification kit such as the Qiagen Endo-Free Plasmid Kit. Other methods developed for plasmid isolation can also be adapted to DNA vectors. Generally, any nucleic acid purification method can be employed.
[0303] DNA vector can be purified by any means known to those skilled in the art for DNA purification.In one embodiment, ceDNA vector is purified as DNA molecule.In another embodiment, ceDNA vector is purified as exosome or microparticle.
[0304] The presence of a ceDNA vector for expression of a FVIII protein can be confirmed by digesting vector DNA isolated from cells with a restriction enzyme that has a single recognition site on the DNA vector and analyzing both the digested and undigested DNA material using gel electrophoresis to confirm the presence of characteristic linear and continuous DNA compared to linear and discontinuous DNA. Figures 4C and 4D show one embodiment for identifying the presence of a closed-ended ceDNA vector produced by the processes herein.
[0305] B.ceDNA Plasmid The ceDNA-plasmid is a plasmid used in the subsequent production of a ceDNA vector for the expression of FVIII protein. In some embodiments, the ceDNA-plasmid can be constructed using known techniques to provide at least (1) a modified 5'ITR sequence, (2) an expression cassette containing cis-regulatory elements, such as a promoter, an inducible promoter, a regulatory switch, an enhancer, and the like, and (3) a modified 3'ITR sequence (the 3'ITR sequence is asymmetric relative to the 5'ITR sequence) as operably linked components in the transcriptional direction. In some embodiments, the expression cassette flanked by ITRs contains a cloning site for introducing an exogenous sequence. The expression cassette replaces the rep and cap coding regions of the AAV genome.
[0306] In one aspect, the ceDNA vector for expression of the FVIII protein is derived from a plasmid, referred to herein as a "ceDNA-plasmid," that encodes, in that order, a first adeno-associated virus (AAV) inverted terminal repeat (ITR), an expression cassette comprising a transgene, and a mutant or modified AAV ITR, wherein the ceDNA-plasmid lacks the AAV capsid protein coding sequence. In an alternative embodiment, the ceDNA-plasmid encodes, in that order, a first (or 5') modified or mutant AAV ITR, an expression cassette comprising a transgene, and a second (or 3') modified AAV ITR, wherein the ceDNA-plasmid lacks the AAV capsid protein coding sequence, and the 5' and 3' ITRs are symmetrical with respect to each other. In an alternative embodiment, the ceDNA-plasmid encodes, in that order, a first (or 5') modified or mutated AAV ITR, an expression cassette containing a transgene, and a second (or 3') mutated or modified AAV ITR, wherein the ceDNA-plasmid lacks the AAV capsid protein coding sequence, and the 5' and 3' modified ITRs have the same modifications (i.e., they are reverse complementary or symmetrical to each other).
[0307] In further embodiments, the ceDNA-plasmid system lacks viral capsid protein coding sequences (i.e., it lacks not only the AAV capsid gene but also the capsid gene of other viruses). Additionally, in certain embodiments, the ceDNA-plasmid also lacks the AAV Rep protein coding sequence. Thus, in preferred embodiments, the ceDNA-plasmid lacks functional AAV cap and AAV rep genes (GG-3' in the case of AAV2) as well as a variable palindrome sequence that allows hairpin formation.
[0308] The ceDNA-plasmids of the present invention can be generated using the native nucleotide sequence of the genome of any AAV serotype known in the art. In one embodiment, the ceDNA-plasmid backbone is derived from the AAV1, AAV2, AAV3, AAV4, AAV5, AAV5, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAVrh8, AAVrh10, AAV-DJ, and AAV-DJ8 genomes. See, for example, NCBI: NC 002077, NC 001401, NC001729, NC001829, NC006152, NC 006260, NC 006261; Kotin and Smith, The Springer Index of Viruses, available at the URL maintained by Springer (www web address: oesys.springer.de / viruses / database / mkchapter.asp?virID=42.04) (Note - references to a URL or database refer to the URL or database contents as of the effective filing date of this application). In certain embodiments, the ceDNA-plasmid backbone is derived from the AAV2 genome. In another specific embodiment, the ceDNA-plasmid backbone is a synthetic backbone engineered to include 5' and 3' ITRs from one of these AAV genomes.
[0309] The ceDNA-plasmid may optionally contain a selectable or selectable marker for use in establishing a ceDNA vector-producing cell line. In one embodiment, the selectable marker may be inserted downstream (i.e., 3') of the 3' ITR sequence. In another embodiment, the selectable marker may be inserted upstream (i.e., 5') of the 5' ITR sequence. Suitable selectable markers include, for example, those that confer drug resistance. The selectable marker may be, for example, the blasticidin S resistance gene, kanamycin, geneticin, etc. In a preferred embodiment, the drug selectable marker is the blasticidin S resistance gene.
[0310] An exemplary ceDNA (e.g., rAAV0) vector for expression of a FVIII protein is produced from an rAAV plasmid. A method for producing an rAAV vector can include (a) providing a host cell with an rAAV plasmid as described above, where both the host cell and the plasmid lack a capsid protein-encoding gene, (b) culturing the host cell under conditions that allow the production of a ceDNA genome, and (c) harvesting the cells and isolating the AAV genome produced from the cells.
[0311] C. Exemplary Methods for Producing ceDNA Vectors from ceDNA Plasmids Also provided herein are methods for generating capsid-free ceDNA vectors for expression of FVIII proteins, particularly methods with yields high enough to provide sufficient vector for in vivo experiments.
[0312] In some embodiments, a method for producing a ceDNA vector for expressing a FVIII protein includes the steps of: (1) introducing a nucleic acid construct containing an expression cassette and two symmetric ITR sequences into host cells (e.g., Sf9 cells); (2) optionally, establishing a clonal cell line, for example, by using a selection marker present on the plasmid; (3) introducing a Rep-encoding gene into the insect cells (either by transfection or infection with a baculovirus carrying the gene); and (4) harvesting the cells and purifying the ceDNA vector. The nucleic acid construct containing the expression cassette and two ITR sequences described above for producing a ceDNA vector can be in the form of a ceDNA-plasmid, or a bacmid or baculovirus generated from the ceDNA plasmid as described below. The nucleic acid construct can be introduced into host cells by transfection, viral transduction, stable integration, or other methods known in the art.
[0313] D. Cell line Host cell lines used in producing ceDNA vectors for FVIII protein expression can include insect cell lines derived from Spodoptera frugiperda (Sf9, Sf21, etc.) or Trichoplusia ni cells, or other eukaryotic cell lines, including other invertebrate, vertebrate, or mammalian cells. Other cell lines known to those skilled in the art can also be used, such as HEK293, Huh-7, HeLa, HepG2, HeplA, 911, CHO, COS, MeWo, NIH3T3, A549, HT1 180, monocytes, and mature and immature dendritic cells. Host cell lines can be transfected for stable expression of ceDNA-plasmids for high-yield ceDNA vector production.
[0314] The ceDNA-plasmid can be introduced into Sf9 cells by transient transfection using reagents known in the art (e.g., liposomes, calcium phosphate) or physical means (e.g., electroporation). Alternatively, stable Sf9 cell lines stably incorporating the ceDNA-plasmid into their genome can be established. Such stable cell lines can be established by incorporating a selection marker into the above-mentioned ceDNA-plasmid. If the ceDNA-plasmid used to transfect the cell line contains a selection marker such as an antibiotic, cells transfected with the ceDNA-plasmid and incorporating the ceDNA-plasmid DNA into their genome can be selected by adding the antibiotic to the cell growth medium. Resistant clones of cells can then be isolated and propagated by single-cell dilution or colony transfer techniques.
[0315] Isolation and purification of E. ceDNA vector Examples of processes for obtaining and isolating ceDNA vectors are described in Figures 4A-4E and in the specific examples below. The ceDNA vectors for expression of the FVIII proteins disclosed herein can be obtained from producer cells expressing AAV Rep proteins and further transformed with a ceDNA plasmid, ceDNA bacmid, or ceDNA baculovirus. Plasmids useful for producing ceDNA vectors include plasmids encoding FVIII proteins or plasmids encoding one or more REP proteins.
[0316] In one embodiment, the polynucleotide encodes an AAV Rep protein (Rep 78 or 68) delivered to a producer cell in a plasmid (Rep-plasmid), bacmid (Rep-bacmid), or baculovirus (Rep-baculovirus). The Rep-plasmid, Rep-bacmid, and Rep-baculovirus can be generated by the methods described above.
[0317] A method for producing a ceDNA vector for expression of FVIII protein is described herein. The expression construct used to generate the ceDNA vector for expression of the FVIII protein described herein can be a plasmid (e.g., ceDNA-plasmid), a bacmid (e.g., ceDNA-bacmid), and / or a baculovirus (e.g., ceDNA-baculovirus). By way of example only, the ceDNA vector can be generated from cells co-infected with a ceDNA-baculovirus and a Rep-baculovirus. The Rep protein produced from the Rep-baculovirus replicates the ceDNA-baculovirus to generate the ceDNA vector. Alternatively, the ceDNA vector for expression of FVIII protein can be generated from cells stably transfected with a construct comprising a sequence encoding the AAV Rep protein (Rep78 / 52) delivered in a Rep-plasmid, Rep-bacmid, or Rep-baculovirus. The ceDNA-baculovirus can be transiently transfected into cells and replicated by the Rep proteins to produce the ceDNA vector.
[0318] The bacmid (e.g., ceDNA-bacmid) can be transfected into permissive insect cells, such as Sf9, Sf21, Tni (Trichoplusia ni) cells, or High Five cells, to generate a ceDNA-baculovirus, which is a recombinant baculovirus containing sequences comprising symmetric ITRs and an expression cassette. The ceDNA-baculovirus can be reinfected into insect cells to obtain the next generation of recombinant baculovirus. Optionally, this step can be repeated one or more times to produce larger quantities of recombinant baculovirus.
[0319] The time for harvesting and collecting the ceDNA vector for expression of the FVIII protein described herein from cells can be selected and optimized to achieve high-yield production of the ceDNA vector. For example, the harvest time can be selected taking into account cell viability, cell morphology, cell growth, etc. Typically, cells can be harvested after sufficient time has passed since baculovirus infection to produce the ceDNA vector (e.g., the ceDNA vector), but before a portion of the cells begin to die due to viral toxicity. The ceDNA vector can be isolated from Sf9 cells using a plasmid purification kit, such as the Qiagen ENDO-FREE PLASMID® kit. Other methods developed for plasmid isolation can also be adapted for ceDNA vectors. Generally, any nucleic acid purification method known in the art, as well as commercially available DNA extraction kits, can be employed.
[0320] Alternatively, purification can be achieved by subjecting the cell pellet to an alkaline lysis process, centrifuging the resulting lysate, and performing chromatographic separation. As a non-limiting example, this process can be carried out by loading the supernatant onto an ion exchange column (e.g., SARTOBIND Q®) that retains nucleic acids, then eluting (e.g., with a 1.2 M NaCl solution), and performing further chromatographic purification on a gel filtration column (e.g., 6 Fast Flow GE). The capsid-free AAV vector is then recovered, for example, by precipitation.
[0321] In some embodiments, the ceDNA vector for expressing FVIII protein can also be purified in the form of exosomes or microparticles. It is known in the art that many cell types release not only soluble proteins but also complex protein / nucleic acid cargoes through the shedding of membrane microvesicles (Cocucci et al., 2009, EP10306226.1). Such vesicles include microvesicles (also called microparticles) and exosomes (also called nanovesicles), both of which contain proteins and RNA as cargo. Microvesicles are generated by direct budding of the plasma membrane, and exosomes are released into the extracellular environment upon fusion of multivesicular endosomes with the plasma membrane. Therefore, microvesicles and / or exosomes containing ceDNA vectors can be isolated from cells transduced with ceDNA plasmids or bacmids or baculoviruses produced with ceDNA plasmids.
[0322] Microvesicles can be isolated by filtration or ultracentrifugation of the culture medium at 20,000 x g and exosomes at 100,000 x g. The optimal duration of ultracentrifugation can be determined experimentally and will depend on the specific cell type from which vesicles are isolated. Preferably, the culture medium is first cleared by low-speed centrifugation (e.g., 2000 x g for 5-20 minutes) and then subjected to spin concentration, for example, using an AMICON® spin column (Millipore, Watford, UK). Microvesicles and exosomes can be further purified via FACS or MACS by using specific antibodies that recognize specific surface antigens present on microvesicles and exosomes. Other microvesicle and exosome purification methods include, but are not limited to, immunoprecipitation, affinity chromatography, filtration, and magnetic beads coated with specific antibodies or aptamers. During purification, vesicles are washed, for example, with phosphate-buffered saline. One advantage of using microvesicles or exosomes to deliver ceDNA-containing vesicles is that these vesicles can be targeted to various cell types by containing on them membrane proteins that are recognized by specific receptors on each cell type (see also EP10306226).
[0323] Another aspect of the present invention relates to a method for purifying ceDNA vectors from host cell lines that have stably integrated ceDNA constructs into their genomes. In one embodiment, the ceDNA vectors are purified as DNA molecules. In another embodiment, the ceDNA vectors are purified as exosomes or microparticles.
[0324] Figure 5 of WO 18 / 49996 shows a gel confirming the production of ceDNA from several ceDNA-plasmid constructs using the methods described in the Examples. The ceDNA is confirmed by the characteristic banding pattern in the gel, as discussed with respect to Figure 4D in the Examples.
[0325] VII. Pharmaceutical Compositions In another embodiment, a pharmaceutical composition is provided, comprising a ceDNA vector for expression of a FVIII protein described herein and a pharmaceutically acceptable carrier or diluent.
[0326] The ceDNA vector for expressing FVIII protein disclosed herein can be incorporated into a pharmaceutical composition suitable for administration to a subject for in vivo delivery to the subject's cells, tissues, or organs.Typically, the pharmaceutical composition comprises the ceDNA vector disclosed herein and a pharmaceutically acceptable carrier.For example, the ceDNA vector for expressing FVIII protein described herein can be incorporated into a pharmaceutical composition suitable for the desired route of therapeutic administration (e.g., parenteral administration).Passive tissue transduction via high-pressure intravenous or intra-arterial infusion, as well as intracellular injection, such as intranuclear microinjection or intracytoplasmic injection, are also contemplated.Pharmaceutical compositions for therapeutic purposes can be formulated as solutions, microemulsions, dispersions, liposomes, or other ordered structures suitable for high ceDNA vector concentrations. Sterile injection solution can be prepared by incorporating the required amount of ceDNA vector compound into a suitable buffer, optionally with one or a combination of the above-listed components, and then filtering sterilization containing the ceDNA vector, and can be formulated to deliver the transgene in the nucleic acid to recipient cells, thereby causing the therapeutic expression of the transgene or donor sequence therein.This composition can also contain a pharmaceutically acceptable carrier.
[0327] Pharmaceutically active compositions containing ceDNA vectors for expression of FVIII proteins can be formulated to deliver transgenes to cells, e.g., cells of a subject, for a variety of purposes.
[0328] Pharmaceutical compositions for therapeutic purposes must typically be sterile and stable under the conditions of manufacture and storage.Compositions can be formulated as solution, microemulsion, dispersion, liposome or other ordered structure suitable for high ceDNA vector concentration.Sterile injectable solution can be prepared by incorporating the required amount of ceDNA vector compound in a suitable buffer with one or a combination of the above-listed components as needed, and then filtering sterilization.
[0329] The ceDNA vectors for expression of FVIII proteins disclosed herein can be incorporated into pharmaceutical compositions suitable for local, systemic, intra-amniotic, intrathecal, intracranial, intra-arterial, intravenous, intralymphatic, intraperitoneal, subcutaneous, tracheal, intratissue (e.g., intramuscular, intracardiac), intrahepatic, intrarenal, intracerebral), intrathecal, intravesical, conjunctival (e.g., extraorbital, intraorbital, retroorbital, intraretinal, subretinal, choroidal, subchoroidal, intrainterstitial, intracameral, and intravitreal), intracochlear, and mucosal (e.g., oral, rectal, nasal) administration. Passive tissue transduction via high-pressure intravenous or intra-arterial infusion is also contemplated, as are intracellular injections such as intranuclear microinjection or intracytoplasmic injection.
[0330] In some embodiments, the methods provided herein include delivering one or more ceDNA vectors for expressing the FVIII protein disclosed herein to a host cell. Also provided herein are cells produced by such methods, and organisms (such as animals, plants, or fungi) containing or produced from such cells. Nucleic acid delivery methods can include lipofection, nucleofection, microinjection, biolistics, liposomes, immunoliposomes, polycation or lipid:nucleic acid conjugates, naked DNA, and drug-enhanced uptake with DNA. Lipofection is described, for example, in U.S. Patent Nos. 5,049,386, 4,946,787, and 4,897,355, and lipofection reagents are commercially available (e.g., Transfectam™ and Lipofectin™). Delivery can be to cells (e.g., in vitro or ex vivo administration) or to target tissues (e.g., in vivo administration).
[0331] Various techniques and methods for delivering nucleic acid to cells are known in the art.For example, nucleic acid, such as ceDNA for expressing FVIII protein, can be formulated in lipid nanoparticle (LNP), lipidoid, liposome, lipid nanoparticle, lipoplex or core-shell nanoparticle.Typically, LNP is composed of nucleic acid (for example, ceDNA) molecule, one or more ionized or cationic lipids (or their salts), one or more non-ionic or neutral lipids (for example, phospholipid), aggregation prevention molecule (for example, PEG or PEG-lipid conjugate), and optionally sterol (for example, cholesterol).
[0332] Another method for delivering nucleic acids, such as ceDNA for expressing FVIII protein, into cells is by conjugating the nucleic acid with a ligand that is internalized by the cell.For example, the ligand can bind to a receptor on the cell surface and be internalized through endocytosis.The ligand can be covalently linked to a nucleotide in the nucleic acid.Exemplary conjugates for delivering nucleic acids into cells are described in, for example, WO2015 / 006740, WO2014 / 025805, WO2012 / 037254, WO2009 / 082606, WO2009 / 073809, WO2009 / 018332, WO2006 / 112872, WO2004 / 090108, WO2004 / 091515, and WO2017 / 177326.
[0333] Nucleic acids such as ceDNA for expressing FVIII protein can also be delivered to cells by transfection. Useful transfection methods include, but are not limited to, lipid-mediated transfection, cationic polymer-mediated transfection, or calcium phosphate precipitation. Transfection reagents are well known in the art and include TurboFect™ Transfection Reagent (Thermo Fisher Scientific®), Pro-Ject Reagent (Thermo Fisher Scientific®), TRANSPASS™ P Protein Transfection Reagent (New England Biolabs®), CHARIOT™ Protein Delivery Reagent (Active Motif), PROTEOJUICE™ Protein Transfection Reagent (EMD Millipore®), 293fectin, LIPOFECTAMINE™ 2000, LIPOFECTAMINE™ 3000 (Thermo Fisher Scientific®), LIPOFECTAMINE™ (Thermo Fisher Scientific®), LIPOFECTIN™ (Thermo Fisher Scientific®), DMRIE-C, CELLFECTIN™ (Thermo Fisher Scientific®), OLIGOFECTAMINE™ (Thermo Fisher Scientific®), and IL-16 (Thermo Fisher Scientific®). Scientific®), LIPOFECTACE™, FUGENE™ (Roche®, Basel, Switzerland), FUGENE™ HD (Roche®), TRANSFECTAM™ (Transfectam, Promega®, Madison, Wis.), TFX-10™ (Promega®), TFX-20™ (Promega®), TFX-50™ (Promega), TRANSFECTIN™ (BioRad®, Hercules, Calif.).), SILENTFECT™ (Bio-Rad®), Effectene™ (Qiagen®, Valencia, Calif.), DC-chol (Avanti Polar Lipids), GENEPORTER™ (Gene Therapy Systems®, San Diego, Calif.), DHARMAFECT 1™ (Dharmacon, Lafayette, Colo.), DHARMAFECT 2™ (Dharmacon), DHARMAFECT 3™ (Dharmacon), DHARMAFECT 4™ (Dharmacon), ESCORT™ III (Sigma, St. Louis, Mo.), and ESCORT™ IV (Sigma Chemical Co.). Nucleic acids, such as cDNA, can also be delivered to cells via microfluidics methods known to those skilled in the art.
[0334] The ceDNA vector for expressing FVIII protein described herein can also be directly administered to organisms for in vivo cell transduction.Administration can be by any of the routes that are usually used to finally bring molecules into contact with blood or tissue cells, including but not limited to injection, infusion, topical application, and electroporation.Suitable methods for administering such nucleic acids are available and well known to those skilled in the art, and although more than one route can be used to administer a particular composition, a particular route can often provide a more immediate and effective response than another route.
[0335] The nucleic acid vectors for expression of the FVIII proteins disclosed herein can be delivered to hematopoietic stem cells, for example, by the methods described in US Pat. No. 5,928,638, for example.
[0336] The ceDNA vector for expression of the FVIII protein of the present invention can be attached to liposomes for delivery to cells or target organs in a subject. Liposomes are vesicles with at least one lipid bilayer. Liposomes are typically used as carriers for drug / therapeutic drug delivery in the context of formulation development. They act by fusing with cell membranes and rearranging their lipid structure to deliver drugs or active pharmaceutical ingredients (APIs). Liposome compositions for such delivery are composed of compounds with phospholipids, particularly phosphatidylcholine, although these compositions may also contain other lipids. Exemplary liposomes and liposome formulations, including, but not limited to, polyethylene glycol (PEG)-functionalized compounds, are disclosed in International Application Publication Nos. 2018 / 050042, filed September 7, 2018, and 2018 / 064242, filed December 6, 2018; see, for example, the section entitled "Pharmaceutical Formulations."
[0337] ceDNA vectors can be delivered in vitro or in vivo using various delivery methods known in the art or modifications thereof. For example, in some embodiments, ceDNA vectors for FVIII protein expression are delivered by creating temporary punctures in the cell membrane using mechanical, electrical, ultrasonic, hydrodynamic, or laser-based energy, thereby facilitating DNA entry into targeted cells. For example, ceDNA vectors can be delivered by squeezing cells through a size-restricted channel or by temporarily disrupting the cell membrane by other means known in the art. In some cases, the ceDNA vector alone is injected as naked DNA directly into any one or more tissues selected from the liver, kidney, gallbladder, prostate, adrenal gland, heart, intestine, lung, and stomach, skin, thyroid, cardiac muscle, or skeletal muscle. In some cases, the ceDNA vector is delivered by a gene gun. Gold or tungsten spherical particles (1-3 μm diameter) coated with capsid-free AAV vectors can be accelerated to high speed by pressurized gas and penetrate into target tissue cells.
[0338] Specifically contemplated herein are compositions comprising a ceDNA vector for expression of FVIII protein and a pharmaceutically acceptable carrier. In some embodiments, the ceDNA vector is formulated in a lipid delivery system, such as the liposomes described herein. In some embodiments, such compositions are administered by any route desired by a skilled practitioner. The compositions can be administered to a subject by different routes, including orally, parenterally, sublingually, transdermally, rectally, transmucosally, topically, via inhalation, via buccal administration, intrapleurally, intravenously, intraarterially, intraperitoneally, subcutaneously, intramuscularly, intranasally, intrathecally, and intraarticularly, or a combination thereof. For veterinary use, the compositions can be administered in a suitably acceptable formulation according to standard veterinary practice. A veterinarian can easily determine the most appropriate dosing regimen and route of administration for a particular animal. The compositions can be administered by conventional syringes, needleless injection devices, "microprojectile bombardment guns," or other physical methods such as electroporation ("EP"), "hydrodynamic methods," or ultrasound.
[0339] In some cases, ceDNA vectors for the expression of FVIII protein are delivered by hydrodynamic injection, a simple and highly efficient method for the direct intracellular delivery of any water-soluble compound and particle to skeletal muscles throughout the viscera and limbs.
[0340] In some cases, ceDNA vectors for the expression of FVIII protein are delivered by ultrasound by creating nanoscopic pores in the membrane, which facilitates the intracellular delivery of DNA particles to cells of internal organs or tumors, so the size and concentration of the plasmid DNA play a major role in the efficiency of this system. In some cases, ceDNA vectors are delivered by magnetofection by using a magnetic field to concentrate the nucleic acid-containing particles in the target cells.
[0341] In some cases, chemical delivery systems can be used, for example, by using nanomer complexes, including the compression of negatively charged nucleic acids with cationic liposomes / micelles or polycationic nanomer particles belonging to cationic polymers.Cationic lipids used in delivery methods include, but are not limited to, monovalent cationic lipids, polyvalent cationic lipids, guanidine-containing compounds, cholesterol-derivative compounds, cationic polymers (e.g., poly(ethyleneimine), poly-L-lysine, protamine, other cationic polymers), and lipid-polymer hybrids.
[0342] A. Exosomes In some embodiments, the ceDNA vectors for expression of FVIII proteins disclosed herein are delivered by packaging them into exosomes. Exosomes are small membrane vesicles of endocytic origin that are released into the extracellular environment following fusion of multivesicular bodies with the plasma membrane. Their surface consists of a lipid bilayer from the plasma membrane of the donor cell, and they contain cytosol from the cell that produced the exosome and exhibit membrane proteins from the parent cell on their surface. Exosomes are produced by various cell types, including epithelial cells, B and T lymphocytes, mast cells (MCs), and dendritic cells (DCs). In some embodiments, exosomes with diameters of 10 nm to 1 μm, 20 nm to 500 nm, 30 nm to 250 nm, or 50 nm to 100 nm are contemplated for use. Exosomes can be isolated for delivery to target cells either by using their donor cells or by introducing specific nucleic acids into them. Various approaches known in the art can be used to produce exosomes containing the capsid-free AAV vectors of the invention.
[0343] B. Microparticles / Nanoparticles In some embodiments, the ceDNA vector for expressing the FVIII protein disclosed herein is delivered by lipid nanoparticles. Generally, lipid nanoparticles include an ionizable amino lipid (e.g., heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate, DLin-MC3-DMA, phosphatidylcholine (1,2-distearoyl-sn-glycero-3-phosphocholine, DSPC), cholesterol, and a coating lipid (polyethylene glycol-dimyristolglycerol, PEG-DMG), as disclosed, for example, by Tam et al. (2013). Advances in Lipid Nanoparticles for siRNA delivery. Pharmaceuticals 5(3):498-507.
[0344] In some embodiments, the lipid nanoparticles have an average diameter of about 10 to about 1000 nm. In some embodiments, the lipid nanoparticles have a diameter of less than 300 nm. In some embodiments, the lipid nanoparticles have a diameter of about 10 to about 300 nm. In some embodiments, the lipid nanoparticles have a diameter of less than 200 nm. In some embodiments, the lipid nanoparticles have a diameter of about 25 to about 200 nm. In some embodiments, the lipid nanoparticle preparation (e.g., a composition comprising a plurality of lipid nanoparticles) has a size distribution, with an average size (e.g., diameter) of about 70 nm to about 200 nm, more typically an average size of about 100 nm or less.
[0345] Various lipid nanoparticles known in the art can be used to deliver the ceDNA vector for expressing FVIII protein disclosed herein.For example, various delivery methods using lipid nanoparticles are described in United States Patent No. 9,404,127, 9,006,417 and 9,518,272.
[0346] In some embodiments, the ceDNA vector for expressing FVIII protein disclosed herein is delivered by gold nanoparticles.Generally, nucleic acid can be covalently bound to gold nanoparticles or non-covalently bound to gold nanoparticles (for example, by charge-charge interaction), for example, as described by Ding et al. (2014).Gold Nanoparticles for Nucleic Acid Delivery.Mol.Ther.22(6);1075-1083.In some embodiments, gold nanoparticle-nucleic acid conjugates are produced using the method described in, for example, U.S. Patent No. 6,812,334.
[0347] C. Conjugate In some embodiments, the ceDNA vector for expression of the FVIII protein disclosed herein is conjugated (e.g., covalently linked to an agent that increases cellular uptake). An "agent that increases cellular uptake" is a molecule that promotes the transport of nucleic acids through lipid membranes. For example, nucleic acids can be conjugated to lipophilic compounds (e.g., cholesterol, tocopherol, etc.), cell-penetrating peptides (CPPs) (e.g., penetratin, TAT, Syn1B, etc.), and polyamines (e.g., spermine). Further examples of agents that increase cellular uptake are disclosed, for example, in Winkler (2013). Oligonucleotide conjugates for therapeutic applications. Ther. Deliv. 4(7); 791-809.
[0348] In some embodiments, the ceDNA vector for expression of the FVIII protein disclosed herein is conjugated to a polymer (e.g., a polymer molecule) or a folate molecule (e.g., a folic acid molecule). In general, delivery of nucleic acids conjugated to polymers is known in the art, for example, as described in WO2000 / 34343 and WO2008 / 022309. In some embodiments, the ceDNA vector for expression of the FVIII protein disclosed herein is conjugated to a poly(amide) polymer, for example, as described in U.S. Patent No. 8,987,377. In some embodiments, the nucleic acid described by the present disclosure is conjugated to a folic acid molecule, for example, as described in U.S. Patent No. 8,507,455.
[0349] In some embodiments, the ceDNA vectors for expression of the FVIII proteins disclosed herein are conjugated to carbohydrates, for example, as described by US Pat. No. 8,450,467.
[0350] D. Nanocapsules Alternatively, nanocapsule formulations of the ceDNA vector for expressing the FVIII protein disclosed herein can be used. Nanocapsules can generally entrap substances in a stable and reproducible manner. To avoid side effects caused by intracellular polymer overload, such fine particles (approximately 0.1 μm in size) should be designed using polymers that can be degraded in vivo. Biodegradable polyalkyl-cyanoacrylate nanoparticles that meet these requirements are contemplated for use.
[0351] E. Liposomes The ceDNA vector for expressing the FVIII protein according to the present invention can be incorporated into liposomes for delivery to cells or target organs in a subject. Liposomes are vesicles with at least one lipid bilayer. Liposomes are typically used as carriers for drug / therapeutic drug delivery in the context of formulation development. They act by fusing with cell membranes and rearranging their lipid structure to deliver drugs or active pharmaceutical ingredients (APIs). Liposome compositions for such delivery are composed of compounds containing phospholipids, particularly phosphatidylcholine, although these compositions may also contain other lipids.
[0352] The formation and use of liposomes are generally known to those skilled in the art. Liposomes with improved serum stability and circulation half-life have been developed (U.S. Patent No. 5,741,516). Furthermore, various methods for liposomes and liposome-like preparations as potential drug carriers have been described (U.S. Patent Nos. 5,567,434, 5,552,157, 5,565,213, 5,738,868, and 5,795,587).
[0353] F. Exemplary Liposome and Lipid Nanoparticle (LNP) Compositions The ceDNA vector for expressing the FVIII protein according to the present invention can be attached to liposomes for delivery to cells, e.g., cells requiring transgene expression. Liposomes are vesicles with at least one lipid bilayer. Liposomes are typically used as carriers for drug / therapeutic drug delivery in the context of formulation development. They act by fusing with cell membranes and rearranging their lipid structure to deliver drugs or active pharmaceutical ingredients (APIs). Liposome compositions for such delivery are composed of compounds containing phospholipids, particularly phosphatidylcholine, although these compositions may also contain other lipids.
[0354] Lipid nanoparticles (LNPs) comprising ceDNA vectors are disclosed in International Application No. 2018 / 050042, filed September 7, 2018, and International Application No. 2018 / 064242, filed December 6, 2018, which are incorporated herein in their entireties, and are contemplated for use in the methods and compositions for ceDNA vectors for expression of FVIII proteins disclosed herein.
[0355] In some embodiments, the present disclosure provides liposomal formulations containing one or more compounds with polyethylene glycol (PEG) functional groups (so-called "PEGylated compounds"), which can reduce immunogenicity / antigenicity, provide hydrophilic and hydrophobic properties to the compounds, and reduce dosing frequency. Alternatively, the liposomal formulations simply contain polyethylene glycol (PEG) polymers as additional components. In such embodiments, the molecular weight of the PEG or PEG functional group can be between 62 Da and about 5,000 Da.
[0356] In some embodiments, the present disclosure provides liposomal formulations that will deliver APIs with extended- or controlled-release profiles over a period of hours to weeks. In some related embodiments, the liposomal formulations may include aqueous chambers bounded by a lipid bilayer. In other related embodiments, the liposomal formulations encapsulate APIs with components that undergo a physical transition at elevated temperatures, releasing the API over a period of hours to weeks.
[0357] In some embodiments, the liposomal formulation comprises sphingomyelin and one or more lipids disclosed herein. In some embodiments, the liposomal formulation comprises an Optisome.
[0358] In some aspects, the present disclosure provides lipids such as N-(carbonyl-methoxypolyethylene glycol 2000)-1,2-distearoyl-sn-glycero-3-phosphoethanolamine sodium salt, (distearoyl-sn-glycero-phosphoethanolamine), MPEG (methoxypolyethylene glycol) conjugated lipids, HSPC (hydrogenated soy phosphatidylcholine), PEG (polyethylene glycol), DSPE (distearoyl-sn-glycero-phosphoethanolamine), DSPC (distearoylphosphatidylcholine), DOPC (dioleoylphosphatidylcholine), DPPG (dipalmitoylphosphatidylglycerol), EPC (egg phosphatidylcholine), DOPS (dioleoyl ... DOPS (dioleoylphosphatidylcholine), DOPS (dioleoylphosphatidylcholine), DOPS (dioleoylphosphatidylcholine), DOPS (dioleoylphosphatidylcholine), DOPS (dioleoylphosphatidylcholine), DOPS (dioleoylphosphatidylcholine), DOPS (dioleoylphosphatidylcholine), DOPS (dioleoylphosphatidylcholine), DOPS (dioleoylphosphatidylcholine), DOPS (dioleoylphosphatidylcholine), DOPS (dioleoylphosphatidylcholine), DOPS (dioleoylphosphatidylcholine and (c) a liposome formulation comprising one or more lipids selected from dioleoyl-sn-glycero-phosphoethanolamine (DOPE), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-sn-glycero-phosphoethanolamine (DSPG), distearoylphosphatidylglycerol (DSPG), distearoyl-sn-glycero-phosphoethanolamine ...
[0359] In some embodiments, the present disclosure provides a liposome formulation comprising a phospholipid, cholesterol, and a PEGylated lipid in a molar ratio of 56:38:5. In some embodiments, the total lipid content of the liposome formulation is 2-16 mg / mL. In some embodiments, the present disclosure provides a liposome formulation comprising a lipid containing a phosphatidylcholine functional group, a lipid containing an ethanolamine functional group, and a PEGylated lipid. In some embodiments, the present disclosure provides a liposome formulation comprising a lipid containing a phosphatidylcholine functional group, a lipid containing an ethanolamine functional group, and a PEGylated lipid in a molar ratio of 3:0.015:2, respectively. In some embodiments, the present disclosure provides a liposome formulation comprising a lipid containing a phosphatidylcholine functional group, cholesterol, and a PEGylated lipid. In some embodiments, the present disclosure provides a liposome formulation comprising a lipid containing a phosphatidylch...
Claims
1. A capsid-free closed-end DNA (ceDNA) vector, comprising: A capsid-free closed-end DNA (ceDNA) vector comprising at least one nucleic acid sequence positioned between adjacent inverted terminal repeats (ITRs), wherein the at least one nucleic acid sequence encodes at least one Factor VIII (FVIII) protein, and the at least one nucleic acid sequence encoding the at least one FVIII protein has at least 95% identity to SEQ ID NO: 395, and the ceDNA vector expresses a FVIII protein, whereby the level of FVIII in the subject's serum is increased in a subject administered the ceDNA vector compared to a control, the control being a subject not administered the ceDNA vector, and the increase in the level of FVIII in the subject's serum is greater than 40% compared to the control.
2. 2. The ceDNA vector of claim 1, wherein the at least one nucleic acid sequence encoding at least one FVIII protein has at least 97% identity to SEQ ID NO:
395.
3. 2. The ceDNA vector of claim 1, wherein the at least one nucleic acid sequence encoding at least one FVIII protein has at least 99% identity to SEQ ID NO:
395.
4. The ceDNA vector of any one of claims 1 to 3, wherein the ceDNA vector comprises a nucleic acid sequence having at least 95% identity to SEQ ID NO:
214.
5. The ceDNA vector of any one of claims 1 to 4, wherein the ceDNA vector comprises a nucleic acid sequence that is at least 95% identical to SEQ ID NO:
214.
6. The ceDNA vector of any one of claims 1 to 5, wherein the ceDNA vector comprises a promoter operably linked to the at least one nucleic acid sequence encoding the at least one FVIII protein.
7. The ceDNA vector Enhancer; 5'UTR and / or intron sequences; 3'UTR sequences; and / or at least one polyA sequence The ceDNA vector according to any one of claims 1 to 6, comprising:
8. The ceDNA vector of any one of claims 1 to 7, wherein the at least one nucleic acid sequence is a cDNA.
9. 9. The ceDNA vector of claim 1, wherein at least one of the flanking ITRs comprises a functional terminal resolution site and a replication (Rep) protein binding site.
10. The ceDNA vector of any one of claims 1 to 9, wherein one or both of the flanking ITRs are derived from a virus selected from the group consisting of parvovirus, dependovirus, and adeno-associated virus (AAV).
11. the adjacent ITRs are symmetric or asymmetric; the adjacent ITRs are symmetric or substantially symmetric; the adjacent ITRs are asymmetric; and / or The ceDNA vector according to any one of claims 1 to 10, wherein one of the flanking ITRs is a wild-type ITR or both of the flanking ITRs are wild-type ITRs.
12. The ceDNA vector of any one of claims 1 to 11, wherein the flanking ITRs are derived from different viral serotypes.
13. The flanking ITRs are from the following pairs of virus serotypes: Table 2-1 Table 2-2 Table 2-3 and wherein the avian is avian AAV (AAAV), the bovine is bovine AAV (BAAV), the canine is canine AAV, the equine is equine AAV, the goat is caprine parvovirus, the sheep is ovine AAV, B19 is B19 parvovirus (GenBank Accession No. NC 000883), MVM is minute virus from mice (GenBank Accession No. NC 001510), the goose is goose parvovirus (GenBank Accession No. NC 001701), and the snake is snake parvovirus 1 (GenBank Accession No. NC 001702). 006148), the shrimp is shrimp parvovirus, the pig is porcine parvovirus, and the insect is insect AAV.
14. one or both of the flanking ITRs comprises a sequence selected from the group consisting of SEQ ID NO:5, SEQ ID NO:10, SEQ ID NO:2, SEQ ID NO:1, SEQ ID NO:7, SEQ ID NO:12, SEQ ID NO:8, SEQ ID NO:13, SEQ ID NO:9, SEQ ID NO:14, SEQ ID NOs:15-48; at least one of the flanking ITRs is altered from the wild-type AAV ITR sequence by a deletion, addition, or substitution that affects the overall three-dimensional conformation of the ITR; one or both of the flanking ITRs are derived from an AAV serotype selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12; one or both of the flanking ITRs are synthetic; and / or 14. The ceDNA vector of claim 1, wherein one of the flanking ITRs is not a wild-type ITR or both of the flanking ITRs are not wild-type ITRs.
15. 15. The ceDNA vector of any one of claims 1 to 14, wherein one or both of the flanking ITRs are derived from an adeno-associated virus (AAV) and are modified by a deletion, insertion, and / or substitution in at least one of the ITR regions selected from the group consisting of A, A', B, B', C, C', D, and D'.
16. 16. The ceDNA vector of claim 15, wherein the deletion, insertion, and / or substitution results in the deletion of all or part of the stem-loop structure formed by the A, A', B, B', C, or C' region.
17. one or both of the flanking ITRs have been modified by deletion, insertion, and / or substitution, resulting in the loss of all or part of the stem-loop structure formed by the B and B' regions; one or both of the flanking ITRs has been modified by deletion, insertion, and / or substitution, resulting in the loss of all or part of the stem-loop structure formed by the C and C' regions; one or both of the flanking ITRs is modified by a deletion, insertion, and / or substitution that results in the loss of all or part of the stem-loop structure formed by the B and B' regions and / or all or part of the stem-loop structure formed by the C and C' regions; one or both of the flanking ITRs comprises a single stem-loop structure in a region that, in the wild-type ITR, comprises a first stem-loop structure formed by the B and B' regions and a second stem-loop structure formed by the C and C' regions; one or both of the flanking ITRs comprises a single stem and two loops in a region that, in the wild-type ITR, comprises a first stem-loop structure formed by the B and B' regions and a second stem-loop structure formed by the C and C' regions; and / or 17. The ceDNA vector of claim 15 or 16, wherein one or both of the adjacent ITRs comprises a single stem and a single loop in a region that, in the wild-type ITR, comprises a first stem-loop structure formed by the B and B' regions and a second stem-loop structure formed by the C and C' regions.
18. 18. The ceDNA vector of any one of claims 1 to 17, wherein both flanking ITRs are modified in such a manner as to result in overall three-dimensional symmetry when the ITRs are inverted relative to each other.
19. 19. The ceDNA vector of any one of claims 1 to 18, wherein one or both of the flanking ITRs comprises a sequence selected from the group consisting of SEQ ID NO:5, SEQ ID NO:10, SEQ ID NO:2, SEQ ID NO:1, SEQ ID NO:7, SEQ ID NO:12, SEQ ID NO:8, SEQ ID NO:13, SEQ ID NO:9, SEQ ID NO:14, SEQ ID NOs:15 to 48.
20. The ceDNA vector of any one of claims 1 to 19, wherein the ceDNA vector comprises at least one regulatory switch.
21. 21. The ceDNA vector of claim 20, wherein the at least one regulatory switch is selected from the group consisting of a binary regulatory switch, a small molecule regulatory switch, a passcode regulatory switch, a nucleic acid-based regulatory switch, a post-transcriptional regulatory switch, a radiation- or ultrasound-controlled regulatory switch, a hypoxia-mediated regulatory switch, an inflammatory response regulatory switch, a shear-activated regulatory switch, and a kill switch.
22. A pharmaceutical composition comprising the ceDNA vector of any one of claims 1 to 21 for use in a method for expressing a FVIII protein in a cell.
23. 23. The pharmaceutical composition of claim 22, wherein the cells are hepatocytes.
24. 24. The pharmaceutical composition of claim 22 or 23, wherein the cell is in vitro or in vivo.
25. The pharmaceutical composition of any one of claims 22 to 24, wherein the at least one nucleic acid sequence is codon-optimized for expression in a cell.
26. 22. A pharmaceutical composition comprising the ceDNA vector of any one of claims 1 to 21 for use in a method for treating a subject with hemophilia A, wherein the increase in FVIII levels in the subject is greater than 40% compared to a control subject not administered the pharmaceutical composition.
27. 27. The pharmaceutical composition of claim 26, wherein the ceDNA vector is administered to a hepatocyte.
28. 28. The pharmaceutical composition of claim 26 or 27, wherein the ceDNA vector expresses the FVIII protein in hepatocytes.
29. The pharmaceutical composition of any one of claims 26 to 28, wherein the ceDNA vector is administered by intravenous injection.
30. A pharmaceutical composition comprising the ceDNA vector of any one of claims 1 to 21.
31. A cell containing the ceDNA vector according to any one of claims 1 to 21.
32. 32. The cell of claim 31 , wherein the cell is a hepatocyte.
33. A composition comprising the ceDNA vector of any one of claims 1 to 21 and a lipid.
34. 34. The composition of claim 33, wherein the lipid is a lipid nanoparticle (LNP).
35. A kit comprising a ceDNA vector according to any one of claims 1 to 21, a pharmaceutical composition according to any one of claims 22 to 30, a cell according to claim 31 or 32, or a composition according to claim 33 or 34 and instructions for use.
Citation Information
Patent Citations
Capsid-free AAV vector, composition, and method for vector production and gene delivery.
JP2014513928A
Optimized factor viii gene
WO2014127215A1
Adeno-associated virus factor viii vectors
WO2015038625A1
Cpg reduced factor viii variants, compositions and methods and uses for treatment of hemostasis disorders
WO2017075619A1
Closed-ended linear duplex DNA for non-viral gene transfer
WO2017152149A1