Compositions and methods for inhibiting LPA expression

RNAi oligonucleotides targeting LPA mRNA in the liver address the challenge of high Lp(a) levels by reducing LPA expression, offering therapeutic benefits for cardiovascular and metabolic disorders.

JP7805386B2Active Publication Date: 2026-01-23DICERNA PHARMACEUTICALS INC
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
JP2024034617
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2020-09-04
Filing Date
2024-03-07
Publication Date
2026-01-23
Estimated Expiration
2041-08-05

AI Technical Summary

Technical Problem

High levels of lipoprotein(a) (Lp(a)) are associated with cardiovascular diseases and other disorders, and existing therapies are inadequate for effectively reducing Lp(a) levels.

Method used

Development of RNAi oligonucleotides that selectively inhibit LPA expression in the liver by targeting specific sequences in LPA mRNA, comprising sense and antisense strands with complementary regions, stem-loops, and modifications to enhance efficacy.

Benefits of technology

The RNAi oligonucleotides effectively reduce LPA expression, providing therapeutic benefits for conditions such as cardiometabolic diseases, atherosclerosis, dyslipidemia, and NASH by attenuating LPA-related disorders.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007805386000072
    Figure 0007805386000072
  • Figure 0007805386000073
    Figure 0007805386000073
  • Figure 0007805386000074
    Figure 0007805386000074
Patent Text Reader

Abstract

To provide oligonucleotides that inhibit apolipoprotein (a) (LPA) expression.SOLUTION: An RNAi oligonucleotide for reducing LPA expression comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a duplex region, wherein the antisense strand comprises a region complementarity to LPA mRNA target sequence with a specific base sequence, and wherein the complementarity region is at least 15 contiguous nucleotides in length.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present disclosure relates to oligonucleotides that inhibit the expression of apolipoprotein(a) (“LPA”) and uses thereof, particularly in relation to treating diseases, disorders, and / or conditions associated with LPA expression.

[0002] Reference to sequence listing The Sequence Listing is submitted concurrently with the specification as an ASCII text file with the file name DRNA_C002WO_ST25.txt, with a creation date of August 5, 2021, and a size of 238 kilobytes. The information in the electronic format of this Sequence Listing is incorporated herein by reference in its entirety. [Background technology]

[0003] Lipoprotein(a) (Lp(a)) is a heterogeneous low-density lipoprotein (LDL)-like particle containing a lipid core and apolipoprotein B (apoB-100), a unique component apolipoprotein(a) (apo(a)) bound to apoB-100 via disulfide bonds. The apo(a) gene (LPA) is expressed primarily in the liver, and expression is restricted to humans and non-human primates. Lp(a) levels in humans are genetically defined and do not change significantly with diet, exercise, or other lifestyle changes. LPA varies in length depending on the number of kringle KIV2 domains present, and its expression is inversely proportional to the number of domains present. Normal Lp(a) levels range from 0.1 to 25 mg / dl, with approximately 25% of the United States population having Lp(a) levels above 30 mg / dl. Analysis of Lp(a) levels in multiple studies suggests that high Lp(a) levels are an independent risk factor for cardiovascular disease, stroke, and other related disorders, including atherosclerotic stenosis. Furthermore, genome-wide association studies suggest that LPA is also a genetic risk factor for diseases such as atherosclerotic stenosis. A significant reduction in cardiovascular events has been observed when therapeutic lipoprotein apheresis is used to lower both Lp(a) and LDL levels in patients with hyperlipidemia.

[0004] Thus, there is a need for therapies and treatments related to these and other LPA-related disorders. Summary of the Invention

[0005] Embodiments of the present disclosure relate to compositions and methods for treating diseases, disorders, and / or conditions associated with LPA expression. This disclosure is based, in part, on the discovery and development of oligonucleotides that selectively inhibit and / or reduce LPA expression in the liver. Accordingly, target sequences within LPA mRNA have been identified, and RNAi oligonucleotides that bind to these target sequences and inhibit LPA mRNA expression have been generated. As shown herein, the RNAi oligonucleotides inhibited LPA expression in the liver of monkeys and humans. Without being bound by theory, the RNAi oligonucleotides described herein are useful for treating diseases, disorders, or conditions associated with LPA expression (e.g., cardiometabolic disease, atherosclerosis, dyslipidemia, NAFLD, and NASH).

[0006] Thus, in some embodiments, the present disclosure provides an RNAi oligonucleotide for reducing LPA expression, wherein the oligonucleotide comprises a sense strand and an antisense strand, the sense strand and the antisense strand form a duplex region, the antisense strand comprises a region of complementarity to any one of the LPA mRNA target sequences of SEQ ID NOs: 4-387, and the region of complementarity is at least 15 contiguous nucleotides in length.

[0007] In any of the foregoing or related embodiments, the sense strand is 15-50 nucleotides in length. In some embodiments, the sense strand is 18-36 nucleotides in length.

[0008] In any of the above or related embodiments, the antisense strand is 15 to 30 nucleotides in length.

[0009] In any of the foregoing or related embodiments, the antisense strand is 22 nucleotides in length, and the antisense strand and the sense strand form a duplexed region at least 19 nucleotides in length, optionally at least 20 nucleotides in length.

[0010] In any of the foregoing or related embodiments, the region of complementarity is at least 19 contiguous nucleotides in length, optionally at least 20 nucleotides in length.

[0011] In any of the foregoing or related embodiments, the 3' end of the sense strand comprises a stem-loop shown as S1-L-S2, where S1 is complementary to S2 and L forms a loop 3-5 nucleotides long between S1 and S2.

[0012] In some aspects, the present disclosure provides RNAi oligonucleotides for reducing LPA expression, wherein the oligonucleotide comprises a sense strand and an antisense strand 15 to 50 nucleotides in length, the sense strand and the antisense strand form a duplex region, the antisense strand comprises a region of complementarity to any one of the LPA mRNA target sequences set forth in SEQ ID NOs: 4 to 387, and the region of complementarity is at least 15 contiguous nucleotides in length.

[0013] In another aspect, the present disclosure provides an RNAi oligonucleotide for reducing LPA expression, wherein the oligonucleotide comprises a sense strand 15 to 50 nucleotides in length and an antisense strand 15 to 30 nucleotides in length, wherein the sense strand and the antisense strand form a duplex region, and the antisense strand comprises a region of complementarity to any one of the LPA mRNA target sequences set forth in SEQ ID NOs: 4 to 387, wherein the region of complementarity is at least 15 contiguous nucleotides in length.

[0014] In yet another aspect, the present disclosure provides an RNAi oligonucleotide for reducing LPA expression, wherein the oligonucleotide comprises a sense strand and an antisense strand 15 to 50 nucleotides in length, wherein the sense strand and the antisense strand form a duplex region, and the antisense strand comprises a region of complementarity to an LPA mRNA target sequence of any one of SEQ ID NOs: 4 to 387, wherein the region of complementarity is at least 19 contiguous nucleotides in length, and optionally 20 nucleotides in length.

[0015] In a further aspect, the present disclosure provides an RNAi oligonucleotide for reducing LPA expression, wherein the oligonucleotide comprises a sense strand and an antisense strand 18 to 36 nucleotides in length, wherein the sense strand and the antisense strand form a duplex region, and the antisense strand comprises a region of complementarity to an LPA mRNA target sequence of any one of SEQ ID NOs: 4 to 387, wherein the region of complementarity is at least 19 contiguous nucleotides in length, and optionally 20 nucleotides in length.

[0016] In another aspect, the present disclosure provides an RNAi oligonucleotide for reducing LPA expression, wherein the oligonucleotide comprises a sense strand 18 to 36 nucleotides in length and an antisense strand 22 nucleotides in length, wherein the sense strand and the antisense strand form a duplex region, and wherein the antisense strand comprises a region of complementarity to an LPA mRNA target sequence of any one of SEQ ID NOs: 4 to 387, wherein the region of complementarity is at least 19 contiguous nucleotides in length, and optionally 20 nucleotides in length.

[0017] In some aspects, the present disclosure provides RNAi oligonucleotides for reducing LPA expression, the oligonucleotide comprising a sense strand 18-36 nucleotides in length and an antisense strand 22 nucleotides in length, wherein the sense strand and the antisense strand form a duplex region, the 3' end of the sense strand comprises a stem-loop shown as S1-L-S2, wherein S1 is complementary to S2, and L forms a loop 3-5 nucleotides in length between S1 and S2, and the antisense strand comprises a region of complementarity to an LPA mRNA target sequence of any one of SEQ ID NOs: 4-387, wherein the region of complementarity is at least 19 contiguous nucleotides in length, and optionally 20 nucleotides in length.

[0018] In another aspect, the present disclosure provides an RNAi oligonucleotide for reducing LPA expression, the oligonucleotide comprising a sense strand 36 nucleotides in length and an antisense strand 22 nucleotides in length, wherein the sense strand and the antisense strand form a duplex region, the 3' end of the sense strand comprises a stem-loop shown as S1-L-S2, wherein S1 is complementary to S2, and L forms a loop 3 to 5 nucleotides in length between S1 and S2, and the antisense strand comprises a region of complementarity to an LPA mRNA target sequence of any one of SEQ ID NOs: 4 to 387, wherein the region of complementarity is at least 19 contiguous nucleotides in length, and optionally 20 nucleotides in length.

[0019] In yet another aspect, the present disclosure provides an RNAi oligonucleotide for reducing LPA expression, the oligonucleotide comprising a sense strand 36 nucleotides in length and an antisense strand 22 nucleotides in length, wherein the sense strand and antisense strand form a duplex region at least 19 nucleotides in length, optionally 20 nucleotides in length, the 3' end of the sense strand comprises a stem-loop shown as S1-L-S2, wherein S1 is complementary to S2, and L forms a loop 3 to 5 nucleotides in length between S1 and S2, and the antisense strand comprises a region of complementarity to an LPA mRNA target sequence of any one of SEQ ID NOs: 4 to 387, wherein the region of complementarity is at least 19 contiguous nucleotides in length, optionally 20 nucleotides in length.

[0020] In any of the foregoing or related aspects, L is a triloop or tetraloop. In some embodiments, L is a tetraloop. In some embodiments, the tetraloop comprises the sequence 5'-GAAA-3'.

[0021] In any of the foregoing or related embodiments, S1 and S2 are 1 to 10 nucleotides in length and have the same length. In some embodiments, S1 and S2 are 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, or 10 nucleotides in length. In some embodiments, S1 and S2 are 6 nucleotides in length. In some embodiments, the stem-loop comprises the sequence 5'-GCAGCCGAAAGGCUGC-3' (SEQ ID NO: 1197).

[0022] In any of the foregoing or related embodiments, the antisense strand comprises a 3'-overhanging sequence one or more nucleotides in length. In some embodiments, the 3'-overhanging sequence is 2 nucleotides in length, and optionally the 3'-overhanging sequence is GG.

[0023] In any of the foregoing or related embodiments, the oligonucleotide comprises at least one modified nucleotide. In some embodiments, the modified nucleotide comprises a 2'-modification. In some embodiments, the 2'-modification is selected from 2'-aminoethyl, 2'-fluoro, 2'-O-methyl, 2'-O-methoxyethyl, and 2'-deoxy-2'-fluoro-β-d-arabinonucleic acid. In some embodiments, all nucleotides comprising the oligonucleotide are modified, and optionally the modification is a 2'-modification selected from 2'-fluoro and 2'-O-methyl.

[0024] In any of the foregoing or related embodiments, the oligonucleotide comprises at least one modified internucleotide linkage. In some embodiments, at least one modified internucleotide linkage is a phosphorothioate linkage.

[0025] In any of the foregoing or related embodiments, the 4'-carbon of the sugar of the 5'-nucleotide of the antisense strand comprises a phosphate analog. In some embodiments, the phosphate analog is an oxymethylphosphonate, vinylphosphonate, or malonylphosphonate, and optionally the phosphate analog is a 4'-phosphate analog comprising 5'-methoxyphosphonate-4'-oxy.

[0026] In any of the above or related embodiments, at least one nucleotide of the oligonucleotide is conjugated to one or more targeting ligands.In some embodiments, each targeting ligand comprises a carbohydrate, an amino sugar, cholesterol, a polypeptide, or a lipid.In some embodiments, each targeting ligand comprises an N-acetylgalactosamine (GalNAc) moiety.In some embodiments, the GalNAc moiety is a monovalent GalNAc moiety, a divalent GalNAc moiety, a trivalent GalNAc moiety, or a tetravalent GalNAc moiety.In some embodiments, up to four nucleotides of L of the stem loop are each conjugated to a monovalent GalNAc moiety.

[0027] In any of the aforementioned or related embodiments, the sense strand comprises the nucleotide sequence of any one of SEQ ID NOs: 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, and 403.

[0028] In any of the aforementioned or related embodiments, the antisense strand comprises the nucleotide sequence of any one of SEQ ID NOs: 788, 789, 790, 791, 792, 793, 794, 795, 796, 797, 798, 799, 800, 801, 802, and 803.

[0029] In any of the above or related embodiments, the sense strand and the antisense strand comprise a nucleotide sequence selected from the group consisting of: (a) SEQ ID NOs: 393 and 793, respectively; (b) SEQ ID NOs: 388 and 788, respectively; (c) SEQ ID NOs: 389 and 789, respectively; (d) SEQ ID NOs: 390 and 790, respectively; (e) SEQ ID NOs: 391 and 791, respectively; (f) SEQ ID NOs: 392 and 792, respectively; (g) SEQ ID NOs: 394 and 794, respectively; (h) SEQ ID NOs: 395 and 795, respectively; (i) SEQ ID NOs: 396 and 796, respectively; (j) SEQ ID NOs: 397 and 797, respectively; (k) SEQ ID NOs: 398 and 798, respectively; (l) SEQ ID NOs: 399 and 799, respectively; (m) SEQ ID NOs: 400 and 800, respectively; (n) SEQ ID NOs: 401 and 801, respectively; (o) SEQ ID NOs: 402 and 802, respectively; and (p) SEQ ID NOs: 403 and 803, respectively.

[0030] In some embodiments, the sense strand comprises the nucleotide sequence set forth in SEQ ID NO:393, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:793. In some embodiments, the sense strand comprises the nucleotide sequence set forth in SEQ ID NO:388, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:788. In some embodiments, the sense strand comprises the nucleotide sequence set forth in SEQ ID NO:389, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:789. In some embodiments, the sense strand comprises the nucleotide sequence set forth in SEQ ID NO:390, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:790. In some embodiments, the sense strand comprises the nucleotide sequence set forth in SEQ ID NO:391, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:791. In some embodiments, the sense strand comprises the nucleotide sequence set forth in SEQ ID NO:392, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:792. In some embodiments, the sense strand comprises the nucleotide sequence set forth in SEQ ID NO:394, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:794. In some embodiments, the sense strand comprises the nucleotide sequence set forth in SEQ ID NO:395, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:795. In some embodiments, the sense strand comprises the nucleotide sequence set forth in SEQ ID NO: 396, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 796. In some embodiments, the sense strand comprises the nucleotide sequence set forth in SEQ ID NO: 397, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 797. In some embodiments, the sense strand comprises the nucleotide sequence set forth in SEQ ID NO: 398, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 798. In some embodiments, the sense strand comprises the nucleotide sequence set forth in SEQ ID NO: 399, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 799. In some embodiments, the sense strand comprises the nucleotide sequence set forth in SEQ ID NO: 400, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 800.In some embodiments, the sense strand comprises the nucleotide sequence set forth in SEQ ID NO: 401, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 801. In some embodiments, the sense strand comprises the nucleotide sequence set forth in SEQ ID NO: 402, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 802. In some embodiments, the sense strand comprises the nucleotide sequence set forth in SEQ ID NO: 403, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 803.

[0031] In some embodiments, the present disclosure provides an RNAi oligonucleotide for reducing LPA expression, wherein the oligonucleotide comprises a sense strand and an antisense strand, the sense strand and the antisense strand form a duplex region, all nucleotides comprising the sense strand and the antisense strand are modified, and the antisense strand comprises a region of complementarity to any one of the LPA mRNA target sequences of SEQ ID NOs: 4-387, wherein the region of complementarity is at least 15 contiguous nucleotides in length.

[0032] In a further embodiment, the present disclosure provides an RNAi oligonucleotide for reducing LPA expression, wherein the oligonucleotide comprises a sense strand and an antisense strand, the sense strand and the antisense strand form a duplex region, all nucleotides comprising the sense strand and the antisense strand are modified, the 4'-carbon of the sugar of the 5'-nucleotide of the antisense strand comprises a phosphate analog, and the antisense strand comprises a region of complementarity to any one of the LPA mRNA target sequences of SEQ ID NOs: 4-387, wherein the region of complementarity is at least 15 contiguous nucleotides in length.

[0033] In another embodiment, the present disclosure provides an RNAi oligonucleotide for reducing LPA expression, wherein the oligonucleotide comprises a sense strand and an antisense strand, the sense strand and the antisense strand form a duplex region, all nucleotides comprising the sense strand and the antisense strand are modified, the 4'-carbon of the sugar of the 5'-nucleotide of the antisense strand comprises a phosphate analog, and the antisense strand comprises a region of complementarity to any one of the LPA mRNA target sequences of SEQ ID NOs: 4-387, wherein the region of complementarity is at least 15 contiguous nucleotides in length.

[0034] In some embodiments, the present disclosure provides an RNAi oligonucleotide for reducing LPA expression, wherein the oligonucleotide comprises a sense strand and an antisense strand, the sense strand and the antisense strand form a duplex region, all nucleotides comprising the sense strand and the antisense strand are modified, the antisense strand and the sense strand comprise one or more 2'-fluoro and 2'-O-methyl modified nucleotides and at least one phosphorothioate linkage, the 4'-carbon of the sugar of the 5'-nucleotide of the antisense strand comprises a phosphate analog, and the antisense strand comprises a region of complementarity to any one of LPA mRNA target sequences of SEQ ID NOs: 4-387, wherein the region of complementarity is at least 15 contiguous nucleotides in length.

[0035] In some embodiments, the present disclosure provides a method for treating a subject having a disease, disorder, or condition associated with LPA expression, the method comprising administering to the subject a therapeutically effective amount of an RNAi oligonucleotide or pharmaceutical composition thereof described in any one of the preceding claims, thereby treating the subject.

[0036] In other embodiments, the present disclosure provides a pharmaceutical composition comprising an RNAi oligonucleotide described herein and a pharmaceutically acceptable carrier, delivery agent, or excipient.

[0037] In other embodiments, the present disclosure provides a method of delivering an oligonucleotide to a subject, the method comprising administering to the subject a pharmaceutical composition described herein.

[0038] In another embodiment, the present disclosure provides a method for reducing LPA expression in a cell, a population of cells, or a subject, the method comprising: i. contacting a cell or population of cells with an RNAi oligonucleotide or pharmaceutical composition described herein; or ii. A method is provided comprising administering to a subject an RNAi oligonucleotide or pharmaceutical composition described herein. In some embodiments, reducing LPA expression comprises reducing the amount or level of LPA mRNA, the amount or level of LPA protein, or both. In some embodiments, the subject has a disease, disorder, or condition associated with LPA expression. In some embodiments, the disease, disorder, or condition associated with LPA expression is a cardiometabolic disease, optionally atherosclerosis, dyslipidemia, NAFLD, and NASH. In some embodiments, the RNAi oligonucleotide or pharmaceutical composition is administered in combination with a second composition or therapeutic agent.

[0039] In another aspect, the disclosure provides a method for treating a subject having a disease, disorder, or condition associated with LPA expression, the method comprising administering to the subject a therapeutically effective amount of an RNAi oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a duplex region, and the antisense strand comprises a region of complementarity to an LPA mRNA target sequence of any one of SEQ ID NOs: 4-387, and the region of complementarity is at least 15 contiguous nucleotides in length.

[0040] In another embodiment, the present disclosure provides a method for treating a subject having a disease, disorder, or condition associated with LPA expression, the method comprising administering to the subject a therapeutically effective amount of an RNAi oligonucleotide or pharmaceutical composition thereof comprising a sense strand and an antisense strand selected from the rows set forth in Table 5, thereby treating the subject.

[0041] In other embodiments, the present disclosure provides a method for treating a subject having a disease, disorder, or condition associated with LPA expression, the method comprising administering to the subject a therapeutically effective amount of an RNAi oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand are selected from the group consisting of: (a) SEQ ID NOs: 393 and 793, respectively; (b) SEQ ID NOs: 388 and 788, respectively; (c) SEQ ID NOs: 389 and 789, respectively; (d) SEQ ID NOs: 390 and 790, respectively; (e) SEQ ID NOs: 391 and 791, respectively; (f) SEQ ID NOs: 392 and 792, respectively; (g) SEQ ID NOs: 394 and 794, respectively; (h) SEQ ID NOs: 395 and 795, respectively; (i) SEQ ID NOs: 396 and 796, respectively; (j) SEQ ID NOs: 397 and 797, respectively; (k) SEQ ID NOs: 398 and 798, respectively; (l) SEQ ID NOs: 399 and 799, respectively; (m) SEQ ID NOs: 400 and 800, respectively; (n) SEQ ID NOs: 401 and 801, respectively; (o) SEQ ID NOs: 402 and 802, respectively; and (p) SEQ ID NOs: 403 and 803, respectively.

[0042] In some embodiments, the sense strand comprises the nucleotide sequence set forth in SEQ ID NO:393, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:793. In some embodiments, the sense strand comprises the nucleotide sequence set forth in SEQ ID NO:388, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:788. In some embodiments, the sense strand comprises the nucleotide sequence set forth in SEQ ID NO:389, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:789. In some embodiments, the sense strand comprises the nucleotide sequence set forth in SEQ ID NO:390, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:790. In some embodiments, the sense strand comprises the nucleotide sequence set forth in SEQ ID NO:391, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:791. In some embodiments, the sense strand comprises the nucleotide sequence set forth in SEQ ID NO:392, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:792. In some embodiments, the sense strand comprises the nucleotide sequence set forth in SEQ ID NO:394, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:794. In some embodiments, the sense strand comprises the nucleotide sequence set forth in SEQ ID NO:395, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:795. In some embodiments, the sense strand comprises the nucleotide sequence set forth in SEQ ID NO: 396, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 796. In some embodiments, the sense strand comprises the nucleotide sequence set forth in SEQ ID NO: 397, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 797. In some embodiments, the sense strand comprises the nucleotide sequence set forth in SEQ ID NO: 398, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 798. In some embodiments, the sense strand comprises the nucleotide sequence set forth in SEQ ID NO: 399, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 799. In some embodiments, the sense strand comprises the nucleotide sequence set forth in SEQ ID NO: 400, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 800.In some embodiments, the sense strand comprises the nucleotide sequence set forth in SEQ ID NO: 401, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 801. In some embodiments, the sense strand comprises the nucleotide sequence set forth in SEQ ID NO: 402, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 802. In some embodiments, the sense strand comprises the nucleotide sequence set forth in SEQ ID NO: 403, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 803.

[0043] In some embodiments, the disease, disorder, or condition associated with LPA expression is a cardiometabolic disease, optionally atherosclerosis, dyslipidemia, NAFLD, and NASH.

[0044] In some embodiments, the present disclosure provides for the use of an RNAi oligonucleotide or pharmaceutical composition described herein in the manufacture of a medicament for the treatment of a disease, disorder, or condition associated with LPA expression, optionally for the treatment of cardiometabolic disease, optionally for the treatment of atherosclerosis, dyslipidemia, NAFLD, and NASH.

[0045] In some embodiments, the present disclosure provides for the use of an RNAi oligonucleotide or pharmaceutical composition described herein for, or applicable for, use in the treatment of a disease, disorder, or condition associated with LPA expression, optionally for the treatment of cardiometabolic disease, optionally atherosclerosis, dyslipidemia, NAFLD, and NASH.

[0046] In other embodiments, the present disclosure provides a kit comprising an RNAi oligonucleotide described herein, an optional pharmaceutically acceptable carrier, and a package insert containing instructions for administration to a subject having a disease, disorder, or condition associated with LPA expression.

[0047] In any of the foregoing or related embodiments, the disease, disorder, or condition associated with LPA expression is a cardiometabolic disease, optionally atherosclerosis, dyslipidemia, NAFLD, and NASH. [Brief explanation of the drawings]

[0048] [Figure 1] 1 provides a graph showing the percent (%) of LPA mRNA in HEK293-LPA cells transfected with the indicated DsiRNAs compared to the percent of LPA mRNA in control mock-treated cells. [Figure 2] 1 provides a graph showing the percent (%) of LPA mRNA in HEK293-LPA cells transfected with the indicated DsiRNAs compared to the percent of LPA mRNA in control mock-treated cells. [Figure 3] 1 provides a graph showing the percent (%) of LPA mRNA in HEK293-LPA cells transfected with the indicated DsiRNAs compared to the percent of LPA mRNA in control mock-treated cells. [Figure 4] 1 provides a graph showing the percent (%) of LPA mRNA in HEK293-LPA cells transfected with the indicated DsiRNAs compared to the percent of LPA mRNA in control mock-treated cells. [Figure 5] 1 provides a graph showing the percent (%) of LPA mRNA in HepG2-LPA cells transfected with the indicated DsiRNAs compared to the percent of LPA mRNA in control mock-treated cells. [Figure 6] 1 provides a graph showing the percent (%) of LPA mRNA in HEK293-LPA cells transfected with the indicated DsiRNAs compared to the percent of LPA mRNA in control mock-treated cells. [Figure 7] 1 provides a graph showing the percent (%) of LPA mRNA in HEK293-LPA cells transfected with the indicated DsiRNAs compared to the percent of LPA mRNA in control mock-treated cells. [Figure 8] 1 provides a graph showing the percent (%) of LPA mRNA in liver samples from mice treated with the indicated GalNAc-conjugated LPA oligonucleotides compared to mice treated with phosphate buffered saline (PBS). [Figure 9] 1 provides a graph showing the percent (%) of LPA mRNA in liver samples from mice treated with the indicated GalNAc-conjugated LPA oligonucleotides compared to mice treated with phosphate buffered saline (PBS). [Figure 10] FIG. 1 provides a schematic diagram showing the structure and chemical modification pattern of a typical N-acetylgalactosamine (GalNAc)-conjugated LPA oligonucleotide. [Figure 11A] 1 provides a graph showing the percent (%) of LPA mRNA in liver samples from non-human primates (NHPs) treated with the indicated GalNAc-conjugated LPA oligonucleotides compared to PBS-treated NHPs at 28 days post-treatment. [Figure 11B] 1 provides a graph showing the percent (%) of LPA mRNA in liver samples from non-human primates (NHPs) treated with the indicated GalNAc-conjugated LPA oligonucleotides compared to PBS-treated NHPs at 56 days post-treatment. [Figure 11C] 1 provides a graph showing the percent (%) of LPA mRNA in liver samples from non-human primates (NHPs) treated with the indicated GalNAc-conjugated LPA oligonucleotides compared to PBS-treated NHPs at 84 days post-treatment. [Figure 11D] 1 provides a graph showing the percent (%) of PLG mRNA in liver samples from NHPs treated with the indicated GalNAc-conjugated LPA oligonucleotides compared to PBS-treated NHPs at day 28. [Figure 12]1 provides a graph showing the mean percent (%) of apo(a) protein in serum from NHPs treated with the indicated GalNAc-conjugated LPA oligonucleotides compared to NHPs treated with PBS over time. DETAILED DESCRIPTION OF THE INVENTION

[0049] I. Definition As used herein, "about" as applied to one or more values ​​of interest refers to a value similar to the stated reference value. In certain embodiments, unless otherwise specified or clear from the context, "about" refers to a range of values ​​within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less of the stated reference value in either direction (greater or less) (except where such number exceeds 100% of possible values).

[0050] As used herein, "administer," "administering," "administration," and the like refer to providing a substance (e.g., an oligonucleotide) to a subject in a pharmacologically useful manner (e.g., to treat a condition in the subject).

[0051] As used herein, the terms "apolipoprotein(a)" and abbreviated "apo(a)" refer to the apolipoprotein(a) polypeptide, a member of the apolipoprotein class of polypeptides that bind lipids to form lipoproteins. Apo(a) is a polymorphic glycoprotein encoded by the LPA gene in humans. LPA mRNA and apo(a) polypeptide are primarily expressed in the liver. Lipoprotein(a) (abbreviated as Lp(a)) is a class of lipoproteins formed in the liver and contains a single copy of apolipoprotein (apo) B-100 (Apo-B100) covalently bound to apo(a). In humans, apo(a) contains one copy each of KIV1, multiple copies of KIV2, and KIV3-KIV4. 10Lp(a) contains at least 10 subtypes of KIV repeats, KV, and an inactive protease-like domain, each composed of one copy of apo(a). The presence of apo(a) distinguishes Lp(a) from all other lipoprotein classes (Marcovina et al., (1995) Clin Chem. 41(2):246-55). For purposes of this disclosure, "apolipoprotein(a)" or "apo(a)" refers to the apo(a) polypeptide from any vertebrate or mammal, including, but not limited to, human, mouse, primate, monkey, bovine, chicken, rodent, rat, pig, sheep, and guinea pig. "Apo(a)" also refers to fragments or variants of native apo(a) that maintain at least one in vivo or in vitro activity of native apo(a). Apo(a) includes the full-length, unprocessed precursor of Apo(a), as well as mature forms resulting from post-translational processing. An exemplary sequence of a human LPA mRNA transcript is publicly available (GenBank Accession No. NM_005577.3) and disclosed herein (SEQ ID NO: 1). An exemplary sequence of a cynomolgus monkey LPA mRNA is publicly available (GenBank Accession No. XM_015448517.1) and disclosed herein (SEQ ID NO: 2).

[0052] As used herein, "asialoglycoprotein receptor" or "ASGPR" refers to a bipartite C-type lectin formed by a 48 kDa major subunit (ASGPR-1) and a 40 kDa minor subunit (ASGPR-2). ASGPR is expressed primarily on the sinusoidal surface of hepatocytes and plays a primary role in the binding, internalization, and subsequent excretion of circulating glycoproteins containing terminal galactose or GalNAc residues (asialoglycoproteins).

[0053] As used herein, "attenuate," "attenuate," "attenuation," and the like refer to reducing or effectively stopping. As a non-limiting example, one or more of the treatments herein can reduce or effectively stop the onset or progression of cardiometabolic disease, including atherosclerosis, dyslipidemia, NAFLD, and NASH in a subject. This attenuation can be exemplified, for example, by a reduction in one or more aspects of cardiometabolic disease, including atherosclerosis, dyslipidemia, NAFLD, and NASH (e.g., symptoms, tissue characteristics, and cellular, inflammatory, or immunological activity), the absence of detectable progression (worsening) of one or more aspects of cardiometabolic disease, including atherosclerosis, dyslipidemia, NAFLD, and NASH, or the absence of detectable aspects of cardiometabolic disease, including atherosclerosis, dyslipidemia, NAFLD, and NASH when otherwise expected.

[0054] As used herein, "complementary" refers to a structural relationship between two nucleotides (e.g., on two opposing nucleic acids or on opposing regions of a single nucleic acid strand) that allows the two nucleotides to base pair with each other. For example, purine nucleotides of one nucleic acid that are complementary to pyrimidine nucleotides of an opposing nucleic acid can base pair together by forming hydrogen bonds with each other. In some embodiments, complementary polynucleotide strands can base pair in a Watson-Crick manner or any other manner that allows the formation of a stable duplex. In some embodiments, two nucleic acids can have a region of multiple nucleotides that are complementary to each other, thereby forming a region of complementarity, as described herein.

[0055] As used herein, "deoxyribonucleotide" refers to a nucleotide that, when compared to a ribonucleotide, has a hydrogen atom in place of the hydroxyl at the 2' position of its pentose sugar. Modified deoxyribonucleotides are deoxyribonucleotides that have one or more modifications or substitutions at an atom other than the 2' position, including modifications or substitutions of the sugar, phosphate group, or base.

[0056] As used herein, a "double-stranded oligonucleotide" or "ds oligonucleotide" refers to an oligonucleotide that is substantially double-stranded. In some embodiments, the complementary base pairing in the duplex region(s) of a ds oligonucleotide is formed between antiparallel sequences of nucleotides in covalently separated nucleic acid strands. In some embodiments, the complementary base pairing in the duplex region(s) of a ds oligonucleotide is formed between antiparallel sequences of nucleotides in covalently linked nucleic acid strands. In some embodiments, the complementary base pairing in the duplex region(s) of a ds oligonucleotide is formed from a single nucleic acid strand that folds (e.g., via a hairpin) and provides a complementary antiparallel sequence of base-pairing nucleotides together. In some embodiments, a ds oligonucleotide comprises two covalently separated nucleic acid strands that are fully double-stranded with respect to each other. However, in some embodiments, a ds oligonucleotide comprises two covalently separated nucleic acid strands that are partially double-stranded (e.g., with overhangs at one or both ends). In some embodiments, ds oligonucleotides contain antiparallel sequences of partially complementary nucleotides and therefore may have one or more mismatches, which may include internal or terminal mismatches.

[0057] As used herein, with respect to nucleic acids (eg, oligonucleotides), "duplex" refers to the structure formed by complementary base pairing of two antiparallel sequences of nucleotides.

[0058] As used herein, "excipient" refers to a non-therapeutic agent that can be included in a composition to, for example, impart or contribute a desired consistency or stabilizing effect.

[0059] As used herein, "hepatocyte" or "plural hepatocytes" refers to cells of the liver parenchyma. These cells comprise approximately 70%-85% of the liver's mass and produce serum albumin, FBN, and the prothrombin loop of clotting factors (excluding factors 3 and 4). Markers of hepatocyte lineage cells include, but are not limited to, transthyretin (Ttr), glutamine synthetase (Glul), hepatocyte nuclear factor 1a (Hnf1a), and hepatocyte nuclear factor 4a (Hnf4a). Markers of mature hepatocytes include, but are not limited to, cytochrome P450 (Cyp3a11), fumarylacetoacetate hydrolase (Fah), glucose 6-phosphate (G6p), albumin (Alb), and OC2-2F8. See, e.g., Huch et al. (2013) Nature 494:247-250.

[0060] As used herein, "hepatotoxic agent" refers to a compound, virus, or other substance that is itself toxic to the liver or can be processed to form a metabolic product that is toxic to the liver. Hepatotoxic agents may include, but are not limited to, carbon tetrachloride (CCl4), acetaminophen (paracetamol), vinyl chloride, arsenic, chloroform, nonsteroidal anti-inflammatory drugs (such as aspirin and phenylbutazone).

[0061] As used herein, a "labile linker" refers to a linker that can be cleaved (e.g., by acidic pH). A "fairly stable linker" refers to a linker that cannot be cleaved.

[0062] As used herein, "liver inflammation" or "hepatitis" refers to a physical condition that results in swelling, dysfunction, and / or pain of the liver, particularly as a result of injury or infection, such as may be caused by exposure to hepatotoxic agents. Symptoms may include jaundice (yellowing of the skin and eyes), fatigue, weakness, nausea, vomiting, loss of appetite, weight loss, etc. If left untreated, liver inflammation can progress to fibrosis, cirrhosis, liver failure, or liver cancer.

[0063] As used herein, "liver fibrosis" or "fibrosis of the liver" refers to the excessive accumulation of extracellular matrix proteins in the liver, which may include collagens (I, III, and IV), FBN, undulin, elastin, laminin, hyaluronan, and proteoglycans, resulting from inflammation and liver cell death. If left untreated, liver fibrosis can progress to cirrhosis, liver failure, or liver cancer.

[0064] As used herein, a "loop" refers to an unpaired region of a nucleic acid (e.g., an oligonucleotide) that is flanked by two antiparallel regions of nucleic acid that are sufficiently complementary to each other that under appropriate hybridization conditions (e.g., in a phosphate buffer solution, inside a cell), the two antiparallel regions flanking the unpaired region hybridize to form a duplex (called a "stem").

[0065] As used herein, "modified internucleotide linkage" refers to an internucleotide linkage that has one or more chemical modifications compared to a reference internucleotide linkage containing a phosphodiester bond. In some embodiments, the modified nucleotide is a non-naturally occurring linkage. Typically, the modified internucleotide linkage imparts one or more desirable properties to the nucleic acid in which the modified internucleotide linkage is present. For example, the modified nucleotide can improve thermal stability, resistance to degradation, nuclease resistance, solubility, bioavailability, biological activity, reduced immunogenicity, etc.

[0066] As used herein, a "modified nucleotide" refers to a nucleotide having one or more chemical modifications compared to a corresponding reference nucleotide selected from adenine ribonucleotides, guanine ribonucleotides, cytosine ribonucleotides, uracil ribonucleotides, adenine deoxyribonucleotides, guanine deoxyribonucleotides, cytosine deoxyribonucleotides, and thymidine deoxyribonucleotides. In some embodiments, the modified nucleotide is a non-naturally occurring nucleotide. In some embodiments, the modified nucleotide has one or more chemical modifications in its sugar, nucleobase, and / or phosphate group. In some embodiments, the modified nucleotide has one or more chemical moieties conjugated to the corresponding reference nucleotide. Typically, the modified nucleotide confers one or more desirable properties to the nucleic acid in which the modified nucleotide is present. For example, the modified nucleotide can improve thermal stability, resistance to degradation, nuclease resistance, solubility, bioavailability, biological activity, reduced immunogenicity, etc.

[0067] As used herein, "nicked tetraloop structure" refers to a structure of an RNAi oligonucleotide characterized by separate sense and antisense strands, where the sense (passenger) strand has a region complementary to the antisense (guide) strand, and at least one of the strands (generally the sense strand) has a tetraloop configured to stabilize an adjacent stem region formed within said at least one strand.

[0068] As used herein, "oligonucleotide" refers to a short nucleic acid (e.g., less than about 100 nucleotides in length). An oligonucleotide can be single-stranded (ss) or ds. An oligonucleotide may or may not have a double-stranded region. As a non-limiting example, an oligonucleotide can be, but is not limited to, a small interfering RNA (siRNA), a microRNA (miRNA), a short hairpin RNA (shRNA), a dicer substrate interfering RNA (dsiRNA), an antisense oligonucleotide, a short siRNA, or a ss siRNA. In some embodiments, the ds oligonucleotide is an RNAi oligonucleotide.

[0069] As used herein, "overhang" refers to a terminal non-base-paired nucleotide(s) resulting from one strand or region extending beyond the end of the complementary strand with which it forms a duplex. In some embodiments, the overhang comprises one or more non-paired nucleotides extending from the duplex region at the 5'-end or 3'-end of the ds oligonucleotide. In certain embodiments, the overhang is a 3'- or 5'-overhang on the antisense strand or the sense strand of the ds oligonucleotide.

[0070] As used herein, "phosphate analog" refers to a chemical moiety that mimics the electrostatic and / or steric properties of a phosphate group. In some embodiments, the phosphate analog is placed at the 5'-terminal nucleotide of an oligonucleotide in place of the 5'-phosphate, which is often susceptible to enzymatic removal. In some embodiments, the 5'-phosphate analog comprises a phosphatase-resistant linkage. Examples of phosphate analogs include 5'-phosphonates, such as 5'-methylene phosphonate (5'-MP) and 5'-(E)-vinyl phosphonate (5'-VP). In some embodiments, an oligonucleotide has a phosphate analog at the 4'-carbon position of the sugar at the 5'-terminal nucleotide (referred to as a 4'-phosphate analog). An example of a 4'-phosphate analog is an oxymethyl phosphonate or an analog thereof, in which the oxygen atom of the oxymethyl group is attached to the sugar moiety (e.g., its 4'-carbon). See, e.g., U.S. Provisional Patent Application Nos. 62 / 383,207 (filed September 2, 2016) and 62 / 393,401 (filed September 12, 2016). Other modifications to the 5' end of oligonucleotides have been developed (see, e.g., International Patent Application No. WO2011 / 133871; U.S. Patent No. 8,927,513; and Prakash et al. (2015) Nucleic Acids Res. 43:2993-3011).

[0071] As used herein, "decreased expression" of a gene (e.g., LPA) refers to a decrease in the amount or level of an RNA transcript (e.g., LPA mRNA) or protein encoded by that gene in a cell, a population of cells, a sample, or a subject, when compared to an appropriate reference (e.g., a reference cell, a population of cells, a sample, or a subject), and / or a decrease in the amount or level of activity of that gene. For example, contacting a cell with an oligonucleotide herein (e.g., an oligonucleotide comprising an antisense strand having a nucleotide sequence complementary to a nucleotide sequence comprising LPA mRNA) can result in a decrease in the amount or level of LPA mRNA, apo(a) protein, and / or apo(a) activity (e.g., due to inactivation and / or degradation of LPA mRNA via the RNAi pathway) when compared to cells not treated with the ds oligonucleotide. Similarly, as used herein, "reducing expression" refers to an act that results in decreased expression of a gene (e.g., LPA). As used herein, "decreased LPA expression" refers to a decrease in the amount or level of LPA mRNA, apo(a) protein, and / or apo(a) activity in a cell, a population of cells, a sample, or a subject when compared to an appropriate reference (e.g., a reference cell, population of cells, sample, or subject).

[0072] As used herein, "region of complementarity" refers to a sequence of nucleotides of a nucleic acid (e.g., a ds oligonucleotide) that is sufficiently complementary to an antiparallel sequence of nucleotides to allow hybridization between the two nucleotide sequences under suitable hybridization conditions (e.g., in a phosphate buffer, intracellularly, etc.). In some embodiments, the oligonucleotide herein comprises a targeting sequence that has a region complementary to an mRNA target sequence.

[0073] As used herein, "ribonucleotide" refers to a nucleotide having as its pentose sugar a ribose with a hydroxyl group at the 2' position. A modified ribonucleotide is a ribonucleotide with one or more modifications or substitutions at an atom other than the 2' position, including modifications or substitutions at the ribose, phosphate group, or base, or at any of these atoms.

[0074] As used herein, "RNAi oligonucleotide" refers to either (a) a ds oligonucleotide having a sense strand (passenger) and an antisense strand (guide), where the antisense strand or a portion of the antisense strand is used by Argonaute 2 (Ago2) endonuclease to cleave a target mRNA (e.g., LPA mRNA), or (b) a ss oligonucleotide having a single-stranded antisense strand, where the antisense strand (or a portion of the antisense strand) is used by Ago2 endonuclease to cleave a target mRNA (e.g., LPA mRNA).

[0075] As used herein, a "strand" refers to a single, continuous sequence of nucleotides linked together via internucleotide bonds (e.g., phosphodiester bonds, phosphorothioate bonds). In some embodiments, the strand has two free ends (e.g., a 5' end and a 3' end).

[0076] As used herein, "subject" refers to any mammal, including mice, rabbits, and humans. In one embodiment, the subject is a human or NHP. Also, "individual" or "patient" may be used interchangeably with "subject."

[0077] As used herein, "synthetic" refers to a nucleic acid or other molecule that is artificially synthesized (e.g., using a machine (e.g., a solid phase nucleic acid synthesizer)) or is not derived from a natural source (e.g., a cell or organism) that normally produces that molecule.

[0078] As used herein, a "targeting ligand" refers to a molecule (e.g., a carbohydrate, amino sugar, cholesterol, polypeptide, or lipid) that selectively binds to a cognate molecule (e.g., a receptor) in a tissue or cell of interest and can be conjugated to another substance for the purpose of targeting the other substance to the tissue or cell of interest. For example, in some embodiments, a targeting ligand can be conjugated to an oligonucleotide for the purpose of targeting the oligonucleotide to a specific tissue or cell of interest. In some embodiments, the targeting ligand selectively binds to a cell surface receptor. Thus, in some embodiments, the targeting ligand, when conjugated to the oligonucleotide, facilitates delivery of the oligonucleotide to a specific cell via selective binding to a receptor expressed on the surface of the cell and endosomal internalization by the cell of a complex comprising the oligonucleotide, targeting ligand, and receptor. In some embodiments, the targeting ligand is conjugated to the oligonucleotide via a linker that is cleaved after cellular internalization or during cellular internalization, such that the oligonucleotide is released from the targeting ligand within the cell.

[0079] As used herein, "tetraloop" refers to a loop that increases the stability of a contiguous duplex formed by hybridization of a contiguous sequence of nucleotides. The increase in stability is the expected average T of the contiguous stem duplex from a set of loops of equivalent length consisting of randomly selected sequences of nucleotides. m The melting temperature (T m For example, a tetraloop can be detected as an increase in T of at least about 50°C, at least about 55°C, at least about 56°C, at least about 58°C, at least about 60°C, at least about 65°C, or at least about 75°C in 10 mM NaHPO4 in a hairpin containing a duplex of at least 2 base pairs (bp) in length. mIn some embodiments, the tetraloop can stabilize the bp of the adjacent stem duplex through stacking interactions. Furthermore, interactions between nucleotides within the tetraloop include, but are not limited to, non-Watson-Crick base pairing, stacking interactions, hydrogen bonding, and contact interactions (Cheong et al. (1990) Nature 346:680-82; Heus & Pardi (1991) Science 253:191-94). In some embodiments, the tetraloop comprises or consists of 3 to 6 nucleotides, typically 4 to 5 nucleotides. In certain embodiments, the tetraloop comprises or consists of 3, 4, 5, or 6 nucleotides, which may or may not be modified (e.g., conjugated to a targeting moiety). In one embodiment, the tetraloop consists of 4 nucleotides. Any nucleotide can be used in the tetraloop, and the standard IUPAC-IUB symbols for such nucleotides can be used as described in Cornish-Bowden (1985) Nucleic Acids Res. 13:3021-3030. For example, the letter "N" can be used to mean that any base can be at that position, the letter "R" can be used to indicate that A (adenine) or G (guanine) can be at that position, and "B" can be used to indicate that C (cytosine), G (guanine), T (thymine), or U (uracil) can be at that position. Examples of tetraloops include the UNCG family of tetraloops (e.g., UUCG), the GNRA family of tetraloops (e.g., GAAA), and the CUUG tetraloop (Woese et al. (1990) Proc. Natl. Acad. Sci. USA 87:8467-8471; Antao et al. (1991) Nucleic Acids Res. 19:5901-5905).Examples of DNA tetraloops include tetraloops of the d(GNNA) family (e.g., d(GTTA)), tetraloops of the d(GNRA) family, tetraloops of the d(GNAB) family, tetraloops of the d(CNNG) family, and tetraloops of the d(TNCG) family (e.g., d(TTCG)). See, e.g., Nakano et al. (2002) Biochem. 41:4281-14292; Shinji et al. (2000) Nippon Kagakkai Koen Yokoshu 78:731. In some embodiments, the tetraloop is contained within a nicked tetraloop structure.

[0080] As used herein, "treat" or "treating" refers to the act of providing care to a subject in need thereof, for example, by administering a therapeutic agent (e.g., an oligonucleotide herein) to the subject for the purpose of improving the subject's health and / or well-being with respect to an existing condition (e.g., disease, disorder) or to prevent or reduce the likelihood of the condition occurring. In some embodiments, treatment comprises reducing the frequency or severity of at least one sign, symptom, or contributory factor of a condition (e.g., disease, disorder) experienced by the subject.

[0081] II. Oligonucleotide inhibitors of LPA expression The present disclosure provides, inter alia, oligonucleotides that inhibit LPA expression. In some embodiments, the oligonucleotides that inhibit LPA expression herein target LPA mRNA.

[0082] i. LPA target sequence In some embodiments, the oligonucleotide targets a target sequence containing LPA mRNA. In some embodiments, the oligonucleotide, or a portion, fragment, or strand thereof (e.g., the antisense strand or guide strand of a ds oligonucleotide) binds to or anneals to a target sequence containing LPA mRNA, thereby inhibiting LPA expression. In some embodiments, the oligonucleotide targets an LPA target sequence for the purpose of inhibiting LPA expression in vivo. In some embodiments, the amount or degree of inhibition of LPA expression by an oligonucleotide targeted to an LPA target sequence correlates with the efficacy of the oligonucleotide. In some embodiments, the amount or degree of inhibition of LPA expression by an oligonucleotide targeted to an LPA target sequence correlates with the amount or degree of therapeutic effect in a subject or patient with a disease, disorder, or condition associated with LPA expression who is treated with the oligonucleotide.

[0083] Through investigation and analysis of the nucleotide sequences of LPA mRNA encoding apo(a), including mRNA from several different species (e.g., human, cynomolgus monkey, and rhesus monkey; see, e.g., Example 1), and through results of in vitro and in vivo testing (see, e.g., Examples 2 and 3), it has been discovered that certain nucleotide sequences of LPA mRNA are more susceptible than others to oligonucleotide-based inhibition of LPA expression and are therefore useful as target sequences for the oligonucleotides herein. In some embodiments, the sense strand of an oligonucleotide (e.g., a ds oligonucleotide) described herein (e.g., Table 5) comprises an LPA target sequence. In some embodiments, a portion or region of the sense strand of a ds oligonucleotide described herein (e.g., Table 5) comprises an LPA target sequence. In some embodiments, the LPA target sequence comprises or consists of the sequence of any one of SEQ ID NOs: 4-387.

[0084] ii. LPA targeting sequence In some embodiments, the oligonucleotides herein have a region complementary to the LPA mRNA (e.g., within the LPA mRNA target sequence) for the purpose of targeting the LPA mRNA in cells and inhibiting LPA expression. In some embodiments, the oligonucleotides herein comprise an LPA targeting sequence (e.g., the antisense strand or guide strand of a ds oligonucleotide) having a region of complementarity that binds or anneals to the LPA target sequence by complementary (Watson-Crick) base pairing. The targeting sequence or region of complementarity is generally of appropriate length and base content to allow binding or annealing of the oligonucleotide (or strand thereof) to the LPA mRNA for the purpose of inhibiting LPA mRNA expression. In some embodiments, the targeting sequence or region of complementarity is at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, or at least about 30 nucleotides in length. In some embodiments, the targeting sequence or region of complementarity is about 12-30 (e.g., 12-30, 12-22, 15-25, 17-21, 18-27, 19-27, or 15-30) nucleotides in length. In some embodiments, the targeting sequence or region of complementarity is about 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the targeting sequence or region of complementarity is 18 nucleotides in length. In some embodiments, the targeting sequence or region of complementarity is 19 nucleotides in length. In some embodiments, the targeting sequence or region of complementarity is 20 nucleotides in length. In some embodiments, the targeting sequence or region of complementarity is 21 nucleotides in length.In some embodiments, the targeting sequence or complementary region is 22 nucleotides in length. In some embodiments, the targeting sequence or complementary region is 23 nucleotides in length. In some embodiments, the targeting sequence or complementary region is 24 nucleotides in length.

[0085] In some embodiments, the oligonucleotides herein comprise a targeting sequence or region of complementarity that is fully complementary to an LPA target sequence (e.g., the antisense strand or guide strand of a double-stranded oligonucleotide). In some embodiments, the targeting sequence or region of complementarity is partially complementary to an LPA target sequence. In some embodiments, the oligonucleotide comprises a targeting sequence or region of complementarity that is fully complementary to any one of SEQ ID NOs: 4-387. In some embodiments, the oligonucleotide comprises a targeting sequence or region of complementarity that is partially complementary to any one of SEQ ID NOs: 4-387.

[0086] In some embodiments, the oligonucleotides herein comprise a targeting sequence or region of complementarity that is complementary to a contiguous sequence of nucleotides comprising the LPA mRNA, the contiguous sequence of nucleotides being about 12 to about 30 nucleotides in length (e.g., 12-30, 12-28, 12-26, 12-24, 12-20, 12-18, 12-16, 14-22, 16-20, 18-20, or 18-19 nucleotides in length). In some embodiments, the oligonucleotides herein comprise a targeting sequence or region of complementarity that is complementary to a contiguous sequence of nucleotides comprising the LPA mRNA, the contiguous sequence of nucleotides being 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length. In some embodiments, the oligonucleotide comprises a targeting sequence or region of complementarity that is complementary to a contiguous sequence of nucleotides comprising the LPA mRNA, wherein the contiguous sequence of nucleotides is 19 nucleotides in length. In some embodiments, the oligonucleotide comprises a targeting sequence or region of complementarity that is complementary to a contiguous sequence of nucleotides comprising the LPA mRNA, wherein the contiguous sequence of nucleotides is 20 nucleotides in length. In some embodiments, the oligonucleotide comprises a targeting sequence or region of complementarity that is complementary to a contiguous sequence of nucleotides of any one of SEQ ID NOs: 4-387, wherein, optionally, the contiguous sequence of nucleotides is 19 nucleotides in length.

[0087] In some embodiments, the targeting sequence or region of complementarity of an oligonucleotide that is complementary to consecutive nucleotides of a sequence set forth in any one of SEQ ID NOs: 4-387 spans the entire length of the antisense strand. In some embodiments, the region of complementarity of an oligonucleotide that is complementary to consecutive nucleotides of a sequence set forth in any one of SEQ ID NOs: 4-387 spans a portion of the entire length of the antisense strand. In some embodiments, the oligonucleotides herein comprise a region of complementarity (e.g., on the antisense strand of a ds oligonucleotide) that is at least partially (e.g., fully) complementary to a consecutive stretch of nucleotides spanning nucleotides 1-20 of a sequence set forth in SEQ ID NOs: 4-387.

[0088] In some embodiments, the oligonucleotides herein comprise a targeting sequence or region of complementarity that has one or more base pair (bp) mismatches with the corresponding LPA target sequence. In some embodiments, the targeting sequence or region of complementarity can have up to about 1, up to about 2, up to about 3, up to about 4, up to about 5, etc. mismatches with the corresponding LPA target sequence, provided that the ability of the targeting sequence or region of complementarity to bind or anneal to LPA mRNA under appropriate hybridization conditions and / or the ability of the oligonucleotide to reduce or inhibit LPA expression is maintained. Alternatively, in some embodiments, the targeting sequence or region of complementarity contains no more than one, no more than two, no more than three, no more than four, or no more than five mismatches with the corresponding LPA target sequence, provided that the ability of the targeting sequence or region of complementarity to bind or anneal to LPA mRNA under appropriate hybridization conditions and / or the ability of the oligonucleotide to reduce or inhibit LPA expression is maintained. In some embodiments, the oligonucleotide comprises a target sequence or region of complementarity with one mismatch to the corresponding target sequence. In some embodiments, the oligonucleotide comprises a target sequence or region of complementarity with two mismatches to the corresponding target sequence. In some embodiments, the oligonucleotide comprises a target sequence or region of complementarity with three mismatches to the corresponding target sequence. In some embodiments, the oligonucleotide comprises a target sequence or region of complementarity with four mismatches to the corresponding target sequence. In some embodiments, the oligonucleotide comprises a target sequence or region of complementarity with five mismatches to the corresponding target sequence. In some embodiments, the oligonucleotide comprises a target sequence or region of complementarity with more than one mismatch (e.g., 2, 3, 4, 5, or more mismatches) to the corresponding target sequence, wherein at least two (e.g., all) of the mismatches are located consecutively (e.g., 2, 3, 4, 5, or more mismatches in a row), or the mismatches are scattered anywhere throughout the target sequence or region of complementarity.In some embodiments, the oligonucleotide comprises a target sequence or region of complementarity with more than one mismatch (e.g., 2, 3, 4, 5 or more mismatches) with the corresponding target sequence, wherein at least two (e.g., all) of the mismatches are positioned consecutively (e.g., 2, 3, 4, 5 or more mismatches consecutively), or at least one or more unmismatched base pairs are located between the mismatches, or a combination thereof.

[0089] iii. Types of oligonucleotides Various types of oligonucleotides and / or structures are useful for targeting LPA mRNA in the methods herein, including, but not limited to, RNAi oligonucleotides, antisense oligonucleotides, miRNA, etc. Any of the types of oligonucleotides described herein or elsewhere are contemplated for use as a framework for incorporating the LPA mRNA targeting sequences herein for the purpose of inhibiting LPA expression.

[0090] In some embodiments, the oligonucleotides herein inhibit LPA expression by participating in the RNA interference (RNAi) pathway upstream or downstream of Dicer involvement. For example, RNAi oligonucleotides have been developed in which each strand is approximately 19-25 nucleotides in size and has at least one 1-5 nucleotide 3' overhang (see, e.g., U.S. Patent No. 8,372,968). Longer oligonucleotides that are processed by Dicer to produce active RNAi products have also been developed (see, e.g., U.S. Patent No. 8,883,996). Further research has led to the creation of extended ds oligonucleotides in which at least one end of at least one strand extends beyond the target region of the duplex, with one strand containing a thermodynamically stable tetraloop structure (see, e.g., U.S. Patent Nos. 8,513,207 and 8,927,705, and International Patent Application Publication No. WO2010 / 033225). Such structures can include ss extensions (on one or both sides of the molecule) and ds extensions.

[0091] In some embodiments, the oligonucleotides herein are involved in the RNAi pathway downstream of Dicer involvement (e.g., Dicer cleavage). In some embodiments, the oligonucleotides have an overhang (e.g., 1, 2, or 3 nucleotides in length) at the 3' end of the sense strand. In some embodiments, the oligonucleotides (e.g., siRNAs) comprise a 21-nucleotide guide strand that is antisense to the target mRNA (e.g., LPA mRNA) and a complementary passenger strand, and both strands anneal to form a 19-bp duplex with a 2-nucleotide overhang at one or both 3' ends. Longer oligonucleotide designs are also contemplated, including oligonucleotides with a 23-nucleotide guide strand and a 21-nucleotide passenger strand, with a blunt end on the right side of the molecule (the 3' end of the passenger strand / the 5' end of the guide strand) and a 2-nucleotide 3' guide strand overhang on the left side of the molecule (the 5' end of the passenger strand / the 3' end of the guide strand). Such molecules have a 21-bp duplex region. See, for example, U.S. Patent Nos. 9,012,138; 9,012,621; and 9,193,753.

[0092] In some embodiments, the oligonucleotides herein comprise a sense strand and an antisense strand, both ranging in length from about 17 to 26 (e.g., 17 to 26, 20 to 25, or 21 to 23) nucleotides. In some embodiments, the oligonucleotides herein comprise a sense strand and an antisense strand, both ranging in length from about 19 to 22 nucleotides. In some embodiments, the sense strand and the antisense strand are of equal length. In some embodiments, the oligonucleotide comprises a sense strand and an antisense strand, and a 3' overhang is present on either the sense strand or the antisense strand, or on both the sense strand and the antisense strand. In some embodiments, for oligonucleotides having a sense strand and an antisense strand, both ranging in length from about 21 to 23 nucleotides, the 3' overhang on the sense strand, the antisense strand, or both the sense strand and the antisense strand is 1 or 2 nucleotides in length. In some embodiments, the oligonucleotide has a guide strand that is 22 nucleotides long and a passenger strand that is 20 nucleotides long, with a blunt end on the right side of the molecule (3' end of the passenger strand / 5' end of the guide strand) and a 2 nucleotide 3' guide strand overhang on the left side of the molecule (5' end of the passenger strand / 3' end of the guide strand). Such molecules have a 20 bp duplex region.

[0093] Other oligonucleotide designs for use with the compositions and methods herein include 16-mer siRNAs (see, e.g., NUCLEIC ACIDS IN CHEMISTRY AND BIOLOGY, Blackburn (ed.), Royal Society of Chemistry, 2006), shRNAs (e.g., those with stems of 19 bp or shorter; see, e.g., Moore et al. (2010) Methods Mol. Biol. 629:141-58), blunt siRNAs (e.g., 19 bp in length; see, e.g., Kraynack & Baker (2006) RNA 12:163-76), asymmetric siRNAs (aiRNAs; see, e.g., Sun et al. (2008) Nat. Biotechnol. 26:1379-82), asymmetric short duplex siRNAs (see, e.g., Chang et al. (2008) Nat. Biotechnol. 26:1379-82), and asymmetric short duplex siRNAs (see, e.g., Chang et al. (2008) Nat. Biotechnol. 26:1379-82). al. (2009) Mol. Ther. 17:725-32), forked siRNA (see, e.g., Hohjoh (2004) FEBS Lett. 557:193-198), ss siRNA (Elsner (2012) Nat. Biotechnol. 30:1063), dumbbell-shaped circular siRNA (see, e.g., Abe et al. (2007) J. Am. Chem. Soc. 129:15108-09), and small internal segmented interfering RNA (siRNA; see, e.g., Bramsen et al. (2007) Nucleic Acids Res. 35:5886-97). Further non-limiting examples of oligonucleotide structures that can be used in some embodiments to reduce or inhibit expression of LPA include microRNAs (miRNAs), short hairpin RNAs (shRNAs), and short siRNAs (see, e.g., Hamilton et al. (2002) EMBO J. 21:4671-79; see also U.S. Patent Application Publication No. 2009 / 0099115).

[0094] Also, in some embodiments, the oligonucleotide for reducing or inhibiting LPA expression herein is single-stranded (ss). Such structures may include, but are not limited to, ss RNAi molecules. Recent efforts have demonstrated the activity of ss RNAi molecules (see, for example, Matsui et al. (2016) Mol. Ther. 24:946-955). However, in some embodiments, the oligonucleotide herein is an antisense oligonucleotide (ASO). An antisense oligonucleotide is an ss oligonucleotide that has a nucleobase sequence that, when written or shown in the 5' to 3' direction, comprises the reverse complement of the target segment of a specific nucleic acid, and is appropriately modified to induce RNase H-mediated cleavage of its target RNA in cells (e.g., as a gapmer) or inhibit the translation of target mRNA in cells (e.g., as a mixer). ASOs for use herein can be modified in any suitable manner known in the art, including, for example, those set forth in U.S. Patent No. 9,567,587 (including, for example, modifications of the length of the nucleobase (pyrimidine, purine), the sugar moiety, and the heterocyclic portion of the nucleobase). Additionally, ASOs have been used for decades to reduce the expression of specific target genes (see, e.g., Bennett et al. (2017) Annu. Rev. Pharmacol. 57:81-105).

[0095] iv. Double-stranded oligonucleotides The present disclosure provides double-stranded (ds) oligonucleotides for targeting LPA mRNA and inhibiting LPA expression (e.g., via the RNAi pathway), comprising a sense strand (also referred to herein as a passenger strand) and an antisense strand (also referred to herein as a guide strand). In some embodiments, the antisense strand and the sense strand are separate strands and are not covalently linked. In some embodiments, the antisense strand and the sense strand are covalently linked.

[0096] In some embodiments, the sense strand has a first region (R1) and a second region (R2), where R2 comprises a first subregion (S1), a tetraloop (L) or triloop (triL), and a second subregion (S2), where L or triL is located between S1 and S2, and S1 and S2 form a second duplex (D2). D2 can vary in length. In some embodiments, D2 is about 1-6 bp in length. In some embodiments, D2 is 2-6, 3-6, 4-6, 5-6, 1-5, 2-5, 3-5, or 4-5 bp in length. In some embodiments, D2 is 1, 2, 3, 4, 5, or 6 bp in length. In some embodiments, D2 is 6 bp in length.

[0097] In some embodiments, R1 of the sense strand and the antisense strand form a first duplex (D1). In some embodiments, D1 is at least about 15 nucleotides in length (e.g., at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21). In some embodiments, D1 is in the range of about 12-30 nucleotides in length (e.g., 12-30, 12-27, 15-22, 18-22, 18-25, 18-27, 18-30, or 21-30 nucleotides in length). In some embodiments, D1 is at least 12 nucleotides in length (e.g., at least 12, at least 15, at least 20, at least 25, or at least 30 nucleotides in length). In some embodiments, D1 can be 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, D1 is 20 nucleotides in length. In some embodiments, D1, which comprises a sense strand and an antisense strand, does not span the entire length of the sense strand and / or the antisense strand. In some embodiments, D1, which comprises a sense strand and an antisense strand, spans the entire length of either the sense strand, the antisense strand, or both. In some embodiments, D1, which comprises a sense strand and an antisense strand, spans the entire length of both the sense strand and the antisense strand.

[0098] In some embodiments, the ds oligonucleotides herein comprise a sense strand having the sequence of any one of SEQ ID NOs: 388-403 and an antisense strand comprising a complementary sequence selected from SEQ ID NOs: 788-803, as arranged in Table 3. In certain embodiments, the sense strand comprises the sequence of SEQ ID NO: 393, and the antisense strand comprises the sequence of SEQ ID NO: 793.

[0099] It will be understood that in some embodiments, reference may be made to sequences set forth in a sequence listing to describe the structure of an oligonucleotide (e.g., a ds oligonucleotide) or other nucleic acid. In such embodiments, the actual oligonucleotide or other nucleic acid may have one or more alternative nucleotides (e.g., RNA counterparts of DNA nucleotides or DNA counterparts of RNA nucleotides) and / or one or more modified nucleotides and / or one or more modified internucleotide linkages and / or one or more other modifications compared to the specified sequence, while retaining essentially the same or similar complementary properties as the specified sequence.

[0100] In some embodiments, the ds oligonucleotide herein comprises a sense strand of 25 nucleotides and an antisense strand of 27 nucleotides, which generates the antisense strand that is incorporated into mature RISC when Dicer enzyme acts.In some embodiments, the sense strand of ds oligonucleotide is longer than 27 nucleotides (for example, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 nucleotides).In some embodiments, the sense strand of ds oligonucleotide is longer than 25 nucleotides (for example, 26, 27, 28, 29 or 30 nucleotides).

[0101] In some embodiments, the ds oligonucleotides herein have one 5' end that is thermodynamically unstable compared to the other 5' end. In some embodiments, asymmetric ds oligonucleotides are provided, with a blunt end at the 3' end of the sense strand and a 3' overhang at the 3' end of the antisense strand. In some embodiments, the 3' overhang on the antisense strand is about 1 to 8 nucleotides in length (e.g., 1, 2, 3, 4, 5, 6, 7, or 8 nucleotides in length). Typically, ds oligonucleotides for RNAi have a 2-nucleotide overhang at the 3' end of the antisense (guide) strand. However, other overhangs are possible. In some embodiments, the overhang is a 3' overhang comprising 1 to 6 nucleotides, optionally 1 to 5, 1 to 4, 1 to 3, 1 to 2, 2 to 6, 2 to 5, 2 to 4, 2 to 3, 3 to 6, 3 to 5, 3 to 4, 4 to 6, 4 to 5, 5 to 6 nucleotides in length, or 1, 2, 3, 4, 5, or 6 nucleotides in length. However, in some embodiments, the overhang is a 5' overhang comprising 1 to 6 nucleotides, optionally 1 to 5, 1 to 4, 1 to 3, 1 to 2, 2 to 6, 2 to 5, 2 to 4, 2 to 3, 3 to 6, 3 to 5, 3 to 4, 4 to 6, 4 to 5, 5 to 6 nucleotides in length, or 1, 2, 3, 4, 5, or 6 nucleotides in length.

[0102] In some embodiments, the two terminal nucleotides at the 3' end of the antisense strand are modified. In some embodiments, the two terminal nucleotides at the 3' end of the antisense strand are complementary to target mRNA (for example, LPA mRNA). In some embodiments, the two terminal nucleotides at the 3' end of the antisense strand are not complementary to target mRNA. In some embodiments, the two terminal nucleotides at the 3' end of each of the oligonucleotides in the nicked tetraloop structure are GG. Typically, one or both of the two terminal GG nucleotides at the 3' end of each of the ds oligonucleotides are not complementary to target mRNA.

[0103] In some embodiments, there are one or more (e.g., 1, 2, 3, 4, or 5) mismatches between the sense strand and the antisense strand. If there is more than one mismatch between the sense strand and the antisense strand, they may be arranged consecutively (e.g., 2, 3, or more consecutively) or may be scattered throughout the region of complementarity. In some embodiments, the 3'-end of the sense strand contains one or more mismatches. In one embodiment, two mismatches are incorporated into the 3'-end of the sense strand. In some embodiments, base mismatches or destabilization of a segment at the 3'-end of the sense strand of an oligonucleotide improve or increase the efficacy of ds oligonucleotides.

[0104] a. antisense strand In some embodiments, oligonucleotides (e.g., ds oligonucleotides) disclosed herein for targeting LPA mRNA and inhibiting LPA expression comprise an antisense strand comprising or consisting of a sequence set forth in any one of SEQ ID NOs: 404 to 803. In some embodiments, the oligonucleotides herein comprise an antisense strand comprising or consisting of at least about 12 (e.g., at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23) consecutive nucleotides of a sequence set forth in any one of SEQ ID NOs: 404 to 803.

[0105] In some embodiments, the oligonucleotides (e.g., ds oligonucleotides) herein comprise an antisense strand of up to about 40 nucleotides in length (e.g., up to 40, up to 35, up to 30, up to 27, up to 25, up to 21, up to 19, up to 17, or up to 12 nucleotides in length). In some embodiments, the oligonucleotides can have an antisense strand of at least about 12 nucleotides in length (e.g., at least 12, at least 15, at least 19, at least 21, at least 22, at least 25, at least 27, at least 30, at least 35, or at least 38 nucleotides in length). In some embodiments, oligonucleotides can have antisense strands ranging in length from about 12 to about 40 nucleotides (e.g., 12-40, 12-36, 12-32, 12-28, 15-40, 15-36, 15-32, 15-28, 17-22, 17-25, 19-27, 19-30, 20-40, 22-40, 25-40, or 32-40). In some embodiments, the oligonucleotide can have an antisense strand length of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides.

[0106] In some embodiments, the antisense strand of oligonucleotide is called " guide strand ".For example, the antisense strand that engages with RNA-induced silencing complex (RISC), binds with Argonaute protein such as Ago2, or binds with one or more similar factors, and induces the silencing of target gene is called guide strand.In some embodiments, the sense strand that is complementary to guide strand is called " passenger strand ".

[0107] B sense strand In some embodiments, oligonucleotides (e.g., ds oligonucleotides) herein for targeting LPA mRNA and inhibiting LPA expression comprise or consist of a sense strand sequence set forth in any one of SEQ ID NOs: 4 to 403. In some embodiments, the oligonucleotide has a sense strand that comprises or consists of at least about 12 (e.g., at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23) consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 4 to 403.

[0108] In some embodiments, the oligonucleotides (e.g., ds oligonucleotides) herein comprise a sense strand (or passenger strand) of up to about 40 nucleotides in length (e.g., up to 40, up to 36, up to 30, up to 27, up to 25, up to 21, up to 19, up to 17, or up to 12 nucleotides in length). In some embodiments, the oligonucleotides can have a sense strand of at least about 12 nucleotides in length (e.g., at least 12, at least 15, at least 19, at least 21, at least 25, at least 27, at least 30, at least 36, or at least 38 nucleotides in length). In some embodiments, the oligonucleotides can have a sense strand ranging in length from about 12 to about 40 nucleotides (e.g., 12-40, 12-36, 12-32, 12-28, 15-40, 15-36, 15-32, 15-28, 17-21, 17-25, 19-27, 19-30, 20-40, 22-40, 25-40, or 32-40). In some embodiments, the oligonucleotide can have a sense strand length of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides.

[0109] In some embodiments, the sense strand comprises a stem-loop structure at its 3'-end. In some embodiments, the sense strand comprises a stem-loop structure at its 5'-end. In some embodiments, the stem is a duplex 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 bp in length. In some embodiments, the stem-loop protects the oligonucleotide from degradation (e.g., enzymatic degradation) and facilitates or enhances targeting and / or delivery to target cells, tissues, or organs (e.g., the liver), or both. For example, in some embodiments, the loop of the stem-loop provides a nucleotide containing one or more modifications that facilitate, enhance, or increase targeting to a target mRNA (e.g., LPA mRNA), inhibition of target gene expression (e.g., LPA expression), and / or delivery to a target cell, tissue, or organ (e.g., the liver), or both. In some embodiments, the stem-loop itself or modifications to the stem-loop do not substantially affect the intrinsic gene expression inhibitory activity of the oligonucleotide, but facilitate, improve, or increase stability (e.g., providing protection against degradation) and / or delivery of the oligonucleotide to target cells, tissues, or organs (e.g., the liver). In certain embodiments, the oligonucleotide comprises a sense strand that includes a stem-loop designated as S1-L-S2 (e.g., at its 3' end), where S1 is complementary to S2 and L forms a single-stranded loop between S1 and S2 up to about 10 nucleotides in length (e.g., 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length). In some embodiments, the loop (L) is 4 nucleotides in length. Figure 10 depicts a non-limiting example of such an oligonucleotide. In some embodiments, the loop (L) of the stem-loop having the structure S1-L-S2 described above is a tetraloop (e.g., within a nicked tetraloop structure). In some embodiments, the tetraloop comprises a ribonucleotide, a deoxyribonucleotide, a modified nucleotide, a delivery ligand, and combinations thereof.

[0110] v. Oligonucleotide Modification Sugar modification In some embodiments, modified sugars (also referred to herein as sugar analogs) comprise modified deoxyribose or ribose moieties, e.g., where one or more modifications occur at the 2', 3', 4', and / or 5' carbons of the sugar. In some embodiments, modified sugars can also comprise unnatural alternative carbon structures, such as those present in locked nucleic acids ("LNAs"; see, e.g., Koshkin et al. (1998) Tetrahedon 54:3607-30), unlocked nucleic acids ("UNAs"; see, e.g., Snead et al. (2013) Mol. Ther-Nucl. Acids 2:e103), and bridged nucleic acids ("BNAs"; see, e.g., Imanishi & Obika (2002) Chem Commun. (Camb) 21:1653-59).

[0111] In some embodiments, the modification of the nucleotide at the sugar comprises a 2'-modification. In some embodiments, the 2'-modification can be 2'-O-propargyl, 2'-O-propylamine, 2'-amino, 2'-ethyl, 2'-fluoro (2'-F), 2'-aminoethyl (EA), 2'-O-methyl (2'-OMe), 2'-O-methoxyethyl (2'-MOE), 2'-O-[2-(methylamino)-2-oxoethyl] (2'-O-NMA), or 2'-deoxy-2'-fluoro-β-d-arabinonucleic acid (2'-FANA). In some embodiments, the modification is 2'-F, 2'-OMe, or 2'-MOE. In some embodiments, the modification at the sugar comprises a modification of the sugar ring, which can include a modification of one or more carbons of the sugar ring. For example, modifications of the sugar of a nucleotide can include those in which the 2'-oxygen of the sugar is linked to the 1'- or 4'-carbon of the sugar, or the 2'-oxygen is linked to the 1'- or 4'-carbon via an ethylene or methylene bridge. In some embodiments, the modified nucleotide has an acyclic sugar that lacks a bond between the 2'-carbon and the 3'-carbon. In some embodiments, the modified nucleotide has, for example, a thiol group at the 4'-position of the sugar.

[0112] In some embodiments, the oligonucleotides described herein comprise at least about one (e.g., at least 1, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, or more) modified nucleotide. In some embodiments, the sense strand of the oligonucleotide comprises at least about one (e.g., at least 1, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, or more) modified nucleotide. In some embodiments, the antisense strand of the oligonucleotide comprises at least about one (e.g., at least 1, at least 5, at least 10, at least 15, at least 20, or more) modified nucleotide.

[0113] In some embodiments, all nucleotides in the sense strand of the oligonucleotide are modified. In some embodiments, all nucleotides in the antisense strand of the oligonucleotide are modified. In some embodiments, all nucleotides in the oligonucleotide (i.e., both the sense and antisense strands) are modified. In some embodiments, the modified nucleotides include a 2'-modification (e.g., 2'-F or 2'-OMe, 2'-MOE, and 2'-deoxy-2'-fluoro-β-d-arabinonucleic acid). In some embodiments, the modified nucleotides include a 2'-modification (e.g., 2'-F or 2'-OMe).

[0114] The present disclosure provides oligonucleotides having different modification patterns. In some embodiments, the modified oligonucleotides include a sense strand sequence having a modification pattern shown in any one of Tables 3 and 4 (and FIG. 10) and an antisense strand having a modification pattern shown in any one of Tables 3 and 4 (and FIG. 10). In some embodiments, for these oligonucleotides, one or more of positions 8, 9, 10, or 11 of the sense strand are modified with a 2'-F group. In other embodiments, for these oligonucleotides, the sugar moieties of each of the nucleotides at positions 1 to 7 and 12 to 20 of the sense strand are modified with a 2'-OMe.

[0115] In some embodiments, the antisense strand has three nucleotides modified with 2'-F at the 2' position of the sugar moiety. In some embodiments, the sugar moieties at positions 2, 5, and 14 of the antisense strand, and optionally up to three nucleotides at positions 1, 3, 7, and 10 of the antisense strand, are modified with 2'-F. In other embodiments, the sugar moieties at positions 2, 5, and 14 of the antisense strand are modified with 2'-F. In other embodiments, the sugar moieties at positions 1, 2, 5, and 14 of the antisense strand are modified with 2'-F. In yet other embodiments, the sugar moieties at positions 1, 2, 3, 5, 7, and 14 of the antisense strand are modified with 2'-F. In yet other embodiments, the sugar moieties at positions 1, 2, 3, 5, 10, and 14 of the antisense strand are modified with 2'-F. In other embodiments, the sugar moieties at positions 2, 3, 5, 7, 10, and 14 of the antisense strand are modified with 2'-F.

[0116] b. 5'-terminal phosphate In some embodiments, the 5'-terminal phosphate group of an RNAi oligonucleotide enhances interaction with Ago2. However, oligonucleotides containing a 5'-phosphate group may be susceptible to degradation by phosphatases or other enzymes, potentially limiting their bioavailability in vivo. In some embodiments, the oligonucleotides (e.g., ds oligonucleotides) herein contain a 5'-phosphate analog that is resistant to such degradation. In some embodiments, the phosphate analog is an oxymethylphosphonate, vinylphosphonate, malonylphosphonate, or a combination thereof. In certain embodiments, the 3'-end of the oligonucleotide chain is linked to a chemical moiety (a "phosphate mimic") that mimics the electrostatic and steric properties of the natural 5'-phosphate group.

[0117] In some embodiments, oligonucleotides have a phosphate analog at the 4' carbon of the sugar (referred to as a 4'-phosphate analog). See, for example, International Patent Application Publication No. WO2018 / 045317. In some embodiments, the oligonucleotides herein contain a 4'-phosphate analog at the 5'-terminal nucleotide. In some embodiments, the phosphate analog is an oxymethylphosphonate or an analog thereof, in which the oxygen atom of the oxymethyl group is attached to the sugar moiety (e.g., at its 4'-carbon). In other embodiments, the 4'-phosphate analog is a thiomethylphosphonate or aminomethylphosphonate, or an analog thereof, in which the sulfur atom of the thiomethyl group or the nitrogen atom of the aminomethyl group is attached to the 4'-carbon of the sugar moiety. In certain embodiments, the 4'-phosphate analog is an oxymethylphosphonate. In some embodiments, the oxymethylphosphonate is represented by the formula -O-CH-PO(OH) or -O-CH-PO(OR), where R is independently selected from H, CH, an alkyl group, CHCHCN, CHOCOC(CH), CHOCHCHSi(CH), or a protecting group. In certain embodiments, the alkyl group is CHCH. More typically, R is independently selected from H, CH, or CHCH.

[0118] c. modified internucleoside linkage In some embodiments, the oligonucleotide comprises a modified internucleoside linkage. In some embodiments, phosphate modification or substitution can result in an oligonucleotide comprising at least about one (e.g., at least 1, at least 2, at least 3, or at least 5) modified internucleotide linkages. In some embodiments, any one of the oligonucleotides disclosed herein comprises from about 1 to about 10 (e.g., 1-10, 2-8, 4-6, 3-10, 5-10, 1-5, 1-3, or 1-2) modified internucleotide linkages. In some embodiments, any one of the oligonucleotides disclosed herein comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 modified internucleotide linkages.

[0119] The modified internucleotide linkage can be a phosphorodithioate linkage, a phosphorothioate linkage, a phosphotriester linkage, a thionoalkylphosphonate linkage, a thioalkylphosphotriester linkage, a phosphoramidite linkage, a phosphonate linkage, and / or a boranophosphate linkage. In some embodiments, at least one modified internucleotide linkage of any one of the oligonucleotides disclosed herein is a phosphorothioate linkage.

[0120] In some embodiments, the oligonucleotides described herein comprise a phosphorothioate linkage between one or more of positions 1 and 2 of the sense strand, positions 1 and 2 of the antisense strand, positions 2 and 3 of the antisense strand, positions 3 and 4 of the antisense strand, positions 20 and 21 of the antisense strand, and positions 21 and 22 of the antisense strand. In some embodiments, the oligonucleotides described herein comprise a phosphorothioate linkage between each of positions 1 and 2 of the sense strand, positions 1 and 2 of the antisense strand, positions 2 and 3 of the antisense strand, positions 20 and 21 of the antisense strand, and positions 21 and 22 of the antisense strand.

[0121] d. Base modification In some embodiments, the oligonucleotide herein has one or more modified nucleobases. In some embodiments, the modified nucleobase (also referred to herein as a base analog) is linked to the 1' position of the nucleotide sugar moiety. In certain embodiments, the modified nucleobase is a nitrogenous base. In certain embodiments, the modified nucleobase does not contain a nitrogen atom. See, for example, U.S. Patent Application Publication No. 2008 / 0274462. In some embodiments, the modified nucleotide contains a universal base. However, in certain embodiments, the modified nucleotide does not contain a nucleobase (abasic).

[0122] In some embodiments, a universal base is a heterocyclic moiety located at the 1' position of a nucleotide sugar moiety of a modified nucleotide, or at the equivalent position of a nucleotide sugar moiety substitution, that can be positioned opposite more than one type of base when present in a duplex without substantially altering the structure of the duplex. In some embodiments, compared to a reference single-stranded nucleic acid (e.g., an oligonucleotide) that is perfectly complementary to a target nucleic acid, a single-stranded nucleic acid containing a universal base has a lower T than a duplex formed with a complementary nucleic acid. m However, in some embodiments, compared to a reference single-stranded nucleic acid in which the universal base is replaced with a base resulting in one mismatch, the single-stranded nucleic acid containing the universal base exhibits a higher T than the duplex formed with the nucleic acid containing the mismatched base. m It forms a duplex with a target nucleic acid having the formula:

[0123] Non-limiting examples of universal binding nucleotides include, but are not limited to, inosine, 1-β-D-ribofuranosyl-5-nitroindole, and / or 1-β-D-ribofuranosyl-3-nitropyrrole (see U.S. Patent Application Publication No. 2007 / 0254362; Van Aerschot et al. (1995) Nucleic Acids Res. 23:4363-70; Loakes et al. (1995) Nucleic Acids Res. 23:2361-66; and Loakes & Brown (1994) Nucleic Acids Res. 22:4039-43).

[0124] e. Reversible modification Before reaching target cells, oligonucleotides can undergo certain modifications to protect them from the in vivo environment, but when they reach the cytosol of target cells, the efficacy or activity of oligonucleotides may be reduced.Reversible modifications can be carried out so that molecules retain desirable properties outside cells, and then, when they enter the cytosol environment of cells, the reversible modifications are removed.Reversible modifications can be removed, for example, by the action of intracellular enzymes or by intracellular chemical conditions (for example, by reduction by intracellular glutathione).

[0125] In some embodiments, the reversibly modified nucleotide comprises a glutathione-sensitive moiety. Typically, nucleic acid molecules are chemically modified with a cyclic disulfide moiety to mask the negative charge caused by the internucleotide diphosphate bond and improve cellular uptake and nuclease resistance. See U.S. Patent Application Publication No. 2011 / 0294869, International Patent Application Publication No. WO2014 / 088920 and WO2015 / 188197, and Meade et al. (2014) Nat. Biotechnol. 32:1256-63. This reversible modification of the internucleotide diphosphate bond is designed to be cleaved intracellularly by the reducing environment (e.g., glutathione) of the cytosol. An early example was a neutralizing phosphotriester modification, which was reported to be cleavable intracellularly (see Dellinger et al. (2003) J. Am. Chem. Soc. 125:940-50).

[0126] In some embodiments, such reversible modifications provide protection during in vivo administration (e.g., transport through blood and / or lysosomal / endosomal compartments of cells) where the oligonucleotide is exposed to nucleases and other harsh environmental conditions (e.g., pH). Upon release into the cytosol of cells, where glutathione levels are elevated compared to the extracellular space, the modification is reversed, yielding a cleaved oligonucleotide. The use of reversible glutathione-sensitive moieties allows for the introduction of sterically bulky chemical groups into the oligonucleotide of interest compared to options available using irreversible chemical modifications. This is because these larger chemical groups are removed in the cytosol and therefore do not interfere with the biological activity of the oligonucleotide within the cytosol of cells. Consequently, these larger chemical groups can be engineered to confer various advantages on the nucleotide or oligonucleotide, such as nuclease resistance, lipophilicity, charge, thermal stability, specificity, and reduced immunogenicity. In some embodiments, the structure of the glutathione-sensitive moiety can be engineered to alter its release kinetics.

[0127] In some embodiments, the glutathione-sensitive moiety is attached to the sugar of the nucleotide. In some embodiments, the glutathione-sensitive moiety is attached to the 2'-carbon of the sugar of the modified nucleotide. In some embodiments, the glutathione-sensitive moiety is positioned at the 5'-carbon of the sugar, particularly when the modified nucleotide is the 5'-terminal nucleotide of the oligonucleotide. In some embodiments, the glutathione-sensitive moiety is positioned at the 3'-carbon of the sugar, particularly when the modified nucleotide is the 3'-terminal nucleotide of the oligonucleotide. In some embodiments, the glutathione-sensitive moiety comprises a sulfonyl group. See, e.g., U.S. Provisional Patent Application No. 62 / 378,635, filed August 23, 2016, entitled "Compositions Comprising Reversibly Modified Oligonucleotides and Uses Thereof."

[0128] vi. Targeting Ligand In some embodiments, it may be desirable to target the oligonucleotides disclosed herein to one or more cells or one or more organs. Such a strategy may be useful to avoid undesirable effects in other organs or to avoid excessive loss of the oligonucleotide to cells, tissues, or organs that do not benefit from the oligonucleotide. Thus, in some embodiments, the oligonucleotides disclosed herein are modified to facilitate targeting and / or delivery to tissues, cells, or organs (e.g., to facilitate delivery of the oligonucleotide to the liver). In certain embodiments, the oligonucleotides disclosed herein are modified to facilitate delivery of the oligonucleotide to hepatocytes in the liver. In some embodiments, the oligonucleotide comprises at least one nucleotide (e.g., 1, 2, 3, 4, 5, 6, or more nucleotides) conjugated to one or more targeting ligands.

[0129] In some embodiments, the targeting ligand can comprise carbohydrate, amino sugar, cholesterol, peptide, polypeptide, protein or protein part (e.g., antibody or antibody fragment), or lipid. In some embodiments, the targeting ligand is an aptamer. For example, the targeting ligand can be an RGD peptide used to target tumor vasculature or glioma cells, a CREKA peptide for targeting tumor vasculature or tumor stroma, transferrin, lactoferrin, or an aptamer for targeting transferrin receptor expressed on CNS vasculature, or an anti-EGFR antibody for targeting EGFR on glioma cells. In certain embodiments, the targeting ligand is one or more GalNAc moieties.

[0130] In some embodiments, one or more (e.g., 1, 2, 3, 4, 5, or 6) nucleotides of the oligonucleotide are each conjugated to a separate targeting ligand. In some embodiments, 2 to 4 nucleotides of the oligonucleotide are each conjugated to a separate targeting ligand. In some embodiments, the targeting ligand is conjugated to 2 to 4 nucleotides at the end of either the sense or antisense strand (e.g., the targeting ligand is conjugated to a 2 to 4 nucleotide overhang or extension at the 5' or 3' end of the sense or antisense strand), thereby resembling the bristles of a toothbrush and the oligonucleotide in a toothbrush-like configuration. For example, the oligonucleotide can include a stem loop at either the 5' or 3' end of the sense strand, and 1, 2, 3, or 4 nucleotides of the stem loop can be individually conjugated to a targeting ligand. In some embodiments, an oligonucleotide (e.g., a ds oligonucleotide) provided by the present disclosure comprises a stem-loop at the 3' end of the sense strand, the loop of the stem-loop comprising a triloop or a tetraloop, and the three or four nucleotides comprising the triloop or tetraloop, respectively, are individually conjugated to a targeting ligand.

[0131] GalNAc is a high-affinity ligand for ASGPR, which is primarily expressed on the sinusoidal surface of hepatocytes, and plays a major role in the binding, internalization, and subsequent excretion of circulating glycoproteins containing terminal galactose or GalNAc residues (asialoglycoproteins). Oligonucleotides of the present disclosure can be conjugated (indirectly or directly) to GalNAc moieties and used to target these oligonucleotides to ASGPRs expressed in cells. In some embodiments, the oligonucleotides of the present disclosure are conjugated to at least one or more GalNAc moieties, and the GalNAc moieties target the oligonucleotide to ASGPRs expressed on cells of the human liver (e.g., human hepatocytes). In some embodiments, the GalNAc moieties target the oligonucleotide to the liver.

[0132] In some embodiments, the oligonucleotide of the present disclosure is directly or indirectly conjugated to monovalent GalNAc.In some embodiments, the oligonucleotide is directly or indirectly conjugated to more than one monovalent GalNAc (i.e., is conjugated to 2, 3 or 4 monovalent GalNAc moieties, typically is conjugated to 3 or 4 monovalent GalNAc moieties).In some embodiments, the oligonucleotide is conjugated to one or more divalent GalNAc, trivalent GalNAc or tetravalent GalNAc moieties.

[0133] In some embodiments, one or more (e.g., 1, 2, 3, 4, 5, or 6) nucleotides of the oligonucleotide are each conjugated to a GalNAc moiety. In some embodiments, 2 to 4 nucleotides of the tetraloop are each conjugated to a separate GalNAc. In some embodiments, 1 to 3 nucleotides of the triloop are each conjugated to a separate GalNAc. In some embodiments, a targeting ligand is conjugated to 2 to 4 nucleotides at either the sense or antisense strand's end (e.g., the ligand is conjugated to a 2 to 4 nucleotide overhang or extension at the 5' or 3' end of the sense or antisense strand), such that the GalNAc moieties resemble toothbrush bristles and the oligonucleotide resembles a toothbrush. In some embodiments, the GalNAc moieties are conjugated to nucleotides in the sense strand. For example, four GalNAc moieties can be conjugated to nucleotides in the tetraloop of the sense strand, with each GalNAc moiety being conjugated to a single nucleotide.

[0134] In some embodiments, the oligonucleotides herein comprise a monovalent GalNAc attached to a guanine nucleotide, designated as [ademG-GalNAc] or 2'-aminodiethoxymethanol-guanine-GalNAc, as shown below. [ka]

[0135] In some embodiments, the oligonucleotides herein comprise a monovalent GalNAc attached to an adenine nucleotide, referred to as [ademA-GalNAc] or 2'-aminodiethoxymethanol-adenine-GalNAc, as shown below. [ka]

[0136] An example of such a conjugation is shown below for a loop comprising the nucleotide sequence GAAA in the 5' to 3' direction (L = linker, X = heteroatom). The stem attachment points are indicated. Such a loop can be, for example, at positions 27-30 of the sense strand listed in Table 5 and shown in Figure 3. In the formula: [ka] is used to represent the point of attachment to the oligonucleotide chain. [ka]

[0137] The targeting ligand can be linked to the nucleotide using an appropriate method or chemical approach (e.g., click chemistry). In some embodiments, the targeting ligand is conjugated to the nucleotide using a click linker. In some embodiments, the targeting ligand is conjugated to any one of the nucleotides of the oligonucleotides described herein using an acetal-based linker. Acetal-based linkers are disclosed, for example, in International Patent Application Publication No. WO2016 / 100401. In some embodiments, the linker is a labile linker. However, in other embodiments, the linker is stable. An example of a loop containing the nucleotides GAAA in a 5' to 3' direction, in which a GalNAc moiety is attached to the nucleotide of the loop using an acetal linker, is shown below. Such a loop can be present, for example, at positions 27-30 of any one of the sense strands listed in Table 3 or Table 4 and shown in Figure 10. In the chemical formula: [ka] is the point of attachment to the oligonucleotide chain. [ka]

[0138] As mentioned above, targeting ligands can be linked to nucleotides using various suitable methods or chemical synthesis techniques (e.g., click chemistry).In some embodiments, targeting ligands are conjugated to nucleotides using click linkers.In some embodiments, targeting ligands are conjugated to any one of the nucleotides of the oligonucleotides described herein using acetal-based linkers.Acetal-based linkers are disclosed, for example, in International Patent Application Publication No. WO2016 / 100401.In some embodiments, linkers are unstable linkers.However, in other embodiments, linkers are stable linkers.

[0139] In some embodiments, a duplex extension (e.g., up to 3, 4, 5, or 6 bp in length) is positioned between the targeting ligand (e.g., the GalNAc moiety) and the ds oligonucleotide. In some embodiments, the oligonucleotide herein does not have a GalNAc conjugated thereto.

[0140] III. Preparations Various formulations have been developed to facilitate the use of oligonucleotides. For example, oligonucleotides can be delivered to a subject or cellular environment using formulations that minimize degradation, facilitate delivery and / or uptake, or impart other beneficial properties to the oligonucleotides in the formulation. In some embodiments, oligonucleotides are formulated in buffers such as phosphate-buffered saline, liposomes, micellar structures, and capsids.

[0141] Oligonucleotide formulations containing cationic lipids can be used to facilitate the transfection of oligonucleotides into cells. For example, cationic lipids such as lipofectin, cationic glycerol derivatives, and polycationic molecules (e.g., polylysine) can be used. Suitable lipids include oligofectamine, lipofectamine (Life Technologies), NC388 (Ribozyme Pharmaceuticals, Inc., Boulder, Colo.), or FuGene6 (Roche), all of which can be used according to the manufacturer's instructions.

[0142] Thus, in some embodiments, the formulation comprises lipid nanoparticles. In some embodiments, the excipient comprises a liposome, lipid, lipid complex, microsphere, microparticle, nanosphere, or nanoparticle, or can be formulated in other forms for administration to cells, tissues, organs, or the body of a subject in need of administration (see, e.g., Remington: THE SCIENCE AND PRACTICE OF PHARMACY, 22nd edition, Pharmaceutical Press, 2013).

[0143] In some embodiments, the formulations herein include an excipient. In some embodiments, the excipient confers improved stability, improved absorption, improved solubility, and / or therapeutic enhancement of the active ingredient to the composition. In some embodiments, the excipient is a buffer (e.g., sodium citrate, sodium phosphate, Tris base, or sodium hydroxide) or a vehicle (e.g., buffer solution, petrolatum, dimethyl sulfoxide, or mineral oil). In some embodiments, the oligonucleotide is lyophilized to extend its shelf life and then reconstituted into a solution prior to use (e.g., administration to a subject). Thus, the excipient in a composition comprising any one of the oligonucleotides described herein can be a lyoprotectant (e.g., mannitol, lactose, polyethylene glycol, or polyvinylpyrrolidone) or a disintegration temperature modifier (e.g., dextran, Ficoll™, or gelatin).

[0144] In some embodiments, a pharmaceutical composition is formulated to be compatible with its intended route of administration, including parenteral (e.g., intravenous, intramuscular, intraperitoneal, intradermal, subcutaneous), oral (e.g., inhalation), transdermal (e.g., topical), transmucosal, and rectal administration.

[0145] Pharmaceutical compositions suitable for injection include sterile aqueous solutions (if water soluble) or dispersions, and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, NJ) or phosphate-buffered saline (PBS). The carrier can be, for example, a solvent or dispersion medium containing water, ethanol, polyols (e.g., glycerol, propylene glycol, liquid polyethylene glycol, etc.), and suitable mixtures thereof. In many cases, it will be preferable to include isotonic agents, such as sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride, in the composition. Sterile injectable solutions can be prepared by mixing the required amount of oligonucleotide in a selected solvent, optionally with one or a combination of the ingredients listed above, followed by filter sterilization.

[0146] In some embodiments, the composition may contain at least about 0.1% or more of a therapeutic agent, although the percentage of active ingredient(s) may be from about 1% to about 80% or more by weight or volume of the total composition. Factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, and other pharmacological considerations will be contemplated by those skilled in the art of preparing such pharmaceutical formulations, and therefore, various dosages and treatment regimens may be desirable.

[0147] Some embodiments are directed to liver-targeted delivery of any of the oligonucleotides herein, although targeting of other tissues is also contemplated.

[0148] IV.How to use i. Decrease in intracellular LPA expression The present disclosure provides methods for contacting or delivering an effective amount of any of the oligonucleotides (e.g., ds oligonucleotides) described herein to a cell or population of cells for the purpose of reducing LPA expression. In some embodiments, the reduction in LPA expression is determined by measuring a reduction in the amount or level of LPA mRNA, apo(a) protein, or apo(a) activity in the cells. These methods can include the steps described herein, which may, but need not, be performed in the order described. However, other orders are also contemplated. Furthermore, individual or multiple steps may be performed in parallel and / or overlapping in time, and / or with individual or multiple repeated steps. Additionally, the methods may include additional, unspecified steps.

[0149] The methods herein are useful with any suitable cell type. In some embodiments, the cell is any cell that expresses mRNA (e.g., hepatocytes, macrophages, monocyte-derived cells, prostate cancer cells, brain, endocrine tissue, bone marrow, lymph nodes, lung, gallbladder, liver, duodenum, small intestine, pancreas, kidney, gastrointestinal tract, bladder, adipose and soft tissue, and skin cells). In some embodiments, the cell is a primary cell obtained from a subject. In some embodiments, primary cells have undergone a limited number of passages, thereby allowing the cell to substantially maintain its native phenotypic characteristics. In some embodiments, the cell to which the oligonucleotide is delivered is ex vivo or in vitro (i.e., delivery can be to cells in culture or to the organism in which the cell resides).

[0150] In some embodiments, the oligonucleotides herein are delivered to cells or cell populations using nucleic acid delivery methods known in the art, including but not limited to, injection of a solution containing the oligonucleotide, bombardment with particles coated with the oligonucleotide, exposing a cell or cell population to a solution containing the oligonucleotide, or electroporation of the cell membrane in the presence of the oligonucleotide.Other methods known in the art for delivering oligonucleotides to cells can be used, such as lipid-mediated carrier transport, chemical-mediated transport, and cationic liposome transfection, such as calcium phosphate.

[0151] In some embodiments, the reduction in LPA expression is determined by an assay or technique that evaluates one or more molecules, characteristics, or properties of a cell or population of cells associated with LPA expression (e.g., using an LPA expression biomarker), or by an assay or technique that evaluates a molecule that directly indicates LPA expression in a cell or population of cells (e.g., LPA mRNA or apo(a) protein). In some embodiments, the extent to which the oligonucleotides herein reduce LPA expression is assessed by comparing LPA expression in a cell or population of cells contacted with the oligonucleotide to a control cell or population of cells (e.g., a cell or population of cells that has not been contacted with the oligonucleotide or that has been contacted with a control oligonucleotide). In some embodiments, the control amount or level of LPA expression in the control cell or population of cells is predetermined so that it is not necessary to measure the control amount or level in every instance the assay or technique is performed. The predetermined level or value can take various forms. In some embodiments, the predetermined level or value can be a single cutoff value, such as a median or mean.

[0152] In some embodiments, contacting or delivering an oligonucleotide (e.g., a ds oligonucleotide) herein to a cell or population of cells reduces LPA expression. In some embodiments, the reduction in LPA expression is compared to a control amount or level of LPA expression in a cell or population of cells not contacted with the oligonucleotide or contacted with a control oligonucleotide. In some embodiments, the reduction in LPA expression is about 1% or less, about 5% or less, about 10% or less, about 15% or less, about 20% or less, about 25% or less, about 30% or less, about 35% or less, about 40% or less, about 45% or less, about 50% or less, about 55% or less, about 60% or less, about 70% or less, about 80% or less, or about 90% or less compared to the control amount or level of LPA expression. In some embodiments, the control amount or level of LPA expression is the amount or level of LPA mRNA and / or apo(a) protein in a cell or population of cells not contacted with the oligonucleotide herein. In some embodiments, the effect of oligonucleotide delivery to cell or cell population by the method herein is evaluated after any finite period or a certain time (for example, minutes, hours, days, weeks, months).For example, in some embodiments, LPA expression is determined in cell or cell population after contacting or delivering oligonucleotide to cell or cell population at least about 4 hours, about 8 hours, about 12 hours, about 18 hours, about 24 hours; or at least about 1 day, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, about 11 days, about 12 days, about 13 days, about 14 days, about 21 days, about 28 days, about 35 days, about 42 days, about 49 days, about 56 days, about 63 days, about 70 days, about 77 days, or about 84 days or more. In some embodiments, LPA expression is determined in the cell or population of cells at least about 1 month, about 2 months, about 3 months, about 4 months, about 5 months, or about 6 months or more after contacting or delivering the oligonucleotide to the cell or population of cells.

[0153] In some embodiments, the oligonucleotide is delivered in the form of a transgene engineered to express the oligonucleotide or strands comprising the oligonucleotide (e.g., its sense and antisense strands) in a cell. In some embodiments, the oligonucleotide is delivered using a transgene engineered to express any of the oligonucleotides disclosed herein. The transgene can be delivered using a viral vector (e.g., adenovirus, retrovirus, vaccinia virus, poxvirus, adeno-associated virus, or herpes simplex virus) or a non-viral vector (e.g., a plasmid or synthetic mRNA). In some embodiments, the transgene can be directly injected into the subject.

[0154] ii. Medical Use The present disclosure also provides oligonucleotides for use or adaptable for use in treating a subject who would benefit from reduced LPA expression (e.g., a human having a disease, disorder, or condition associated with LPA expression). In some embodiments, the present disclosure provides oligonucleotides for use or adapted for use in treating a subject having a disease, disorder, or condition associated with LPA expression. The present disclosure also provides oligonucleotides for use or adaptable for use in the manufacture of a medicament or pharmaceutical composition for treating a disease, disorder, or condition associated with LPA expression. In some embodiments, the oligonucleotides for use or adaptable for use target LPA mRNA and reduce LPA expression (e.g., via the RNAi pathway). In some embodiments, the oligonucleotides for use or adaptable for use target LPA mRNA and reduce the amount or level of LPA mRNA, apo(a) protein, and / or apo(a) activity.

[0155] Furthermore, in some embodiments of the methods herein, subjects with or predisposed to a disease, disorder, or condition associated with LPA expression are selected for treatment with the oligonucleotides (e.g., ds oligonucleotides) herein. In some embodiments, the methods include selecting individuals with or predisposed to a marker (e.g., biomarker) of a disease, disorder, or condition associated with LPA expression, such as, but not limited to, LPA mRNA, apo(a) protein, lipoprotein(a), or a combination thereof. Similarly, as described in more detail below, some embodiments of the methods provided by the present disclosure include steps such as measuring or obtaining a baseline value of a marker of LPA expression (e.g., lipoprotein(a)), and then comparing the value thus obtained with one or more other baseline values ​​or values ​​obtained after administering the oligonucleotide to the subject to evaluate the effectiveness of treatment.

[0156] iii. Treatment methods The present disclosure also provides methods of treating a subject having, suspected of having, or at risk of developing a disease, disorder, or condition associated with LPA expression with the oligonucleotides herein. In some embodiments, the present disclosure provides methods of using the oligonucleotides herein to treat or reduce the onset or progression of a disease, disorder, or condition associated with LPA expression. In other embodiments, the present disclosure provides methods of using the oligonucleotides herein to achieve one or more therapeutic effects in a subject having a disease, disorder, or condition associated with LPA expression. In some embodiments of the methods herein, the subject is treated by administering a therapeutically effective amount of any one or more of the oligonucleotides herein. In some embodiments, the treatment includes reducing LPA expression. In some embodiments, the subject is treated therapeutically. In some embodiments, the subject is treated prophylactically.

[0157] In some embodiments of the methods herein, an oligonucleotide herein, or a pharmaceutical composition comprising the oligonucleotide, is administered to a subject having a disease, disorder, or condition associated with LPA expression, such that LPA expression is reduced in the subject, thereby treating the subject. In some embodiments, the amount or level of LPA mRNA is reduced in the subject. In some embodiments, the amount or level of apo(a) protein is reduced in the subject. In some embodiments, the amount or level of lipoprotein(a) is reduced in the subject. In some embodiments, the amount or level of apo(a) activity is reduced in the subject. In some embodiments, the amount or level of triglycerides (TG) (e.g., one or more TGs or total TG) is reduced in the subject. In some embodiments, the amount or level of cholesterol (e.g., total cholesterol, LDL cholesterol, and / or HDL cholesterol) is reduced in the subject. In some embodiments, the amount or level of low-density lipoprotein (LDL) cholesterol is reduced in the subject. In some embodiments, the amount or activity of OxPL is reduced or fluctuates in the subject. In some embodiments, the amount or activity of LDL-C is reduced or fluctuates in the subject. In some embodiments, the amount or activity of apoB-100 is decreased or altered in the subject. In some embodiments, any combination of the following is decreased or altered in the subject: LPA expression, LPA mRNA amount or level, apo(a) protein amount or level, apo(a) activity amount or level, TG amount or level, cholesterol amount or level, OxPL amount or activity, LDL-C amount or activity, and / or apoB-100 amount or activity.

[0158] In some embodiments of the methods herein, the oligonucleotides herein, or pharmaceutical compositions comprising the oligonucleotides, are administered to a subject having a disease, disorder, or condition associated with LPA expression such that LPA expression in the subject is reduced by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or more than 99%, compared to LPA expression before administration of the oligonucleotide or pharmaceutical composition. In some embodiments, LPA expression in a subject is reduced by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or more than 99% when compared to LPA expression in a subject who has not received the oligonucleotide or pharmaceutical composition or who has received a control oligonucleotide, pharmaceutical composition, or treatment (e.g., a reference or control subject).

[0159] In some embodiments of the methods herein, the oligonucleotides herein, or pharmaceutical compositions comprising the oligonucleotides, are administered to a subject having a disease, disorder, or condition associated with LPA expression such that the amount or level of LPA mRNA in the subject is reduced by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or more than 99%, when compared to the amount or level of LPA mRNA before administration of the oligonucleotide or pharmaceutical composition. In some embodiments, the amount or level of LPA mRNA in a subject is reduced by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or more than 99% when compared to the amount or level of LPA mRNA in a subject who has not received the oligonucleotide or pharmaceutical composition or who has received a control oligonucleotide, pharmaceutical composition, or treatment (e.g., a reference or control subject).

[0160] In some embodiments of the methods herein, an oligonucleotide herein, or a pharmaceutical composition comprising the oligonucleotide, is administered to a subject having a disease, disorder, or condition associated with LPA expression such that the amount or level of apo(a) protein in the subject is reduced by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or more than 99%, compared to the amount or level of apo(a) protein before administration of the oligonucleotide or pharmaceutical composition. In some embodiments, the amount or level of apo(a) protein in a subject is reduced by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or more than 99% when compared to the amount or level of apo(a) protein in a subject who has not received the oligonucleotide or pharmaceutical composition or who has received a control oligonucleotide, pharmaceutical composition, or treatment (e.g., a reference or control subject).

[0161] In some embodiments of the methods herein, an oligonucleotide herein, or a pharmaceutical composition comprising the oligonucleotide, is administered to a subject having a disease, disorder, or condition associated with LPA expression such that the amount or level of apo(a) activity in the subject is reduced by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or more than 99%, compared to the amount or level of apo(a) activity before administration of the oligonucleotide or pharmaceutical composition. In some embodiments, the amount or level of apo(a) activity in a subject is reduced by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or more than 99% when compared to the amount or level of apo(a) activity in a subject who has not received the oligonucleotide or pharmaceutical composition or who has received a control oligonucleotide, pharmaceutical composition, or treatment (e.g., a reference or control subject).

[0162] In some embodiments of the methods herein, the oligonucleotide herein, or a pharmaceutical composition comprising the oligonucleotide, is administered to a subject having a disease, disorder, or condition associated with LPA expression such that the amount or level of lipoprotein (a) in the subject is reduced by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or more than 99%, when compared to the amount or level of lipoprotein (a) before administration of the oligonucleotide or pharmaceutical composition. In some embodiments, the amount or level of lipoprotein(a) in a subject is reduced by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or more than 99% when compared to the amount or level of lipoprotein(a) in a subject who has not received the oligonucleotide or pharmaceutical composition or who has received a control oligonucleotide, pharmaceutical composition, or treatment (e.g., a reference or control subject).

[0163] Lipoprotein(a) levels range widely in human adults, from less than 0.1 mg / dL to more than 200 mg / dL, thus showing up to three orders of magnitude of variation between individuals (Schmidt et al., (2016) J Lipid Res. 57(8):1339-1359). Lipoprotein(a) levels of less than 30 mg / dL are considered optimal in the United States and Canada (Anderson et al., (2016) Can J Cardiol 32:1263-82). The European Atherosclerosis Society (EAS) suggests a level of less than 50 mg / dL as optimal, and in Germany and the UK, a lipoprotein(a) level of less than 60 mg / dL is used as the cutoff for apheresis reimbursement (Tsimikas (2017) J Am Coll Cardiol. 69(6):692-711). In some embodiments, subjects selected for or treated with the oligonucleotides herein are confirmed or determined to have a lipoprotein(a) amount or level of about 30 mg / dL or greater. In some embodiments, subjects selected for or treated with the oligonucleotides herein are confirmed or determined to have a lipoprotein(a) amount or level greater than 30 mg / dL. In some embodiments, subjects selected for or treated with the oligonucleotides herein are confirmed or determined to have a lipoprotein(a) amount or level of about 50 mg / dL or greater. In some embodiments, subjects selected for or treated with the oligonucleotides herein are confirmed or determined to have a lipoprotein(a) amount or level of about 60 mg / dL or greater. In some embodiments, subjects selected for or treated with the oligonucleotides herein are confirmed or determined to have a lipoprotein(a) amount or level in the range of 30 mg / dL to 300 mg / dL.

[0164] Generally, the normal or desirable TG range for a human patient is less than 150 mg / dL of blood, with less than 100 mg / dL being considered ideal. In some embodiments, a patient selected for or treated is identified or determined to have a TG amount or level of 150 mg / dL or greater. In some embodiments, a patient selected for or treated is identified or determined to have a TG amount or level in the range of 150-199 mg / dL, which is considered a borderline high TG level. In some embodiments, a patient selected for or treated is identified or determined to have a TG amount or level in the range of 200-499 mg / dL, which is considered a high TG level. In some embodiments, a patient selected for or treated is identified or determined to have a TG amount or level in the range of 500 mg / dL or greater (i.e., greater than 500 mg / dL), which is considered a very high TG level. In some embodiments, patients selected for or treated are identified or determined to have an amount or level of TG that is 150 mg / dL or greater, 200 mg / dL or greater, or 500 mg / dL or greater. In some embodiments, patients selected for or treated are identified or determined to have an amount or level of TG that is 200 to 499 mg / dL, or 500 mg / dL or greater. In some embodiments, patients selected for or treated are identified or determined to have an amount or level of TG that is 200 mg / dL or greater.

[0165] In some embodiments of the methods herein, the oligonucleotides herein, or pharmaceutical compositions comprising the oligonucleotides, are administered to a subject having a disease, disorder, or condition associated with LPA expression such that the amount or level of cholesterol (e.g., total cholesterol, LDL cholesterol, and / or HDL cholesterol) in the subject is reduced by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or more than 99%, compared to the amount or level of cholesterol before administration of the oligonucleotide or pharmaceutical composition. In some embodiments, the amount or level of cholesterol in a subject is reduced by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or more than 99% when compared to the amount or level of cholesterol in a subject who has not received the oligonucleotide or pharmaceutical composition or who has received a control oligonucleotide, pharmaceutical composition, or treatment (e.g., a reference or control subject).

[0166] Generally, the normal or desirable cholesterol range (total cholesterol) for an adult human patient is less than 200 mg / dL of blood. In some embodiments, the patient selected for or treated is identified or determined to have a cholesterol amount or level of 200 mg / dL or greater. In some embodiments, the patient selected for or treated is identified or determined to have a cholesterol amount or level in the range of 200-239 mg / dL, which is considered a borderline high cholesterol level. In some embodiments, the patient selected for or treated is identified or determined to have a cholesterol amount or level in the range of 240 mg / dL and above (i.e., 240 mg / dL or greater), which is considered a high cholesterol level. In some embodiments, the patient selected for or treated is identified or determined to have a cholesterol amount or level of 200-239 mg / dL, or 240 mg / dL or greater. In some embodiments, the patient selected for or treated is identified or determined to have a cholesterol amount or level of 200 mg / dL or greater, or 240 mg / dL or greater.

[0167] In some embodiments of the methods herein, the oligonucleotides herein, or pharmaceutical compositions comprising the oligonucleotides, are administered to a subject having a disease, disorder, or condition associated with LPA expression such that the amount or level of LDL cholesterol in the subject is reduced by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or more than 99%, compared to the amount or level of LDL cholesterol before administration of the oligonucleotide or pharmaceutical composition. In some embodiments, the amount or level of LDL cholesterol in a subject is reduced by at least about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or more than 99% when compared to the amount or level of LDL cholesterol in a subject who has not received the oligonucleotide or pharmaceutical composition or who has received a control oligonucleotide, pharmaceutical composition, or treatment (e.g., a reference or control subject).

[0168] Generally, the normal or desirable LDL cholesterol range for an adult human patient is less than 100 mg / dL of blood. In some embodiments, a patient selected for or treated is identified or determined to have a cholesterol amount or level of 100 mg / dL or greater. In some embodiments, a patient selected for or treated is identified or determined to have an LDL cholesterol amount or level in the range of 100-129 mg / dL, which is considered supraoptimal. In some embodiments, a patient selected for or treated is identified or determined to have an LDL cholesterol amount or level in the range of 130-159 mg / dL, which is considered borderline high. In some embodiments, a patient selected for or treated is identified or determined to have an LDL cholesterol amount or level in the range of 160-189 mg / dL, which is considered a high LDL cholesterol level. In some embodiments, patients selected for or treated are identified or determined to have an amount or level of LDL cholesterol in the range of 190 mg / dL and above (i.e., 190 mg / dL or greater), which is considered an extremely high LDL cholesterol level. In some embodiments, patients selected for or treated are identified or determined to have an amount or level of LDL cholesterol that is 100 mg / dL or greater, 130 mg / dL or greater, 160 mg / dL or greater, or 190 mg / dL or greater, preferably 160 mg / dL or greater, or 190 mg / dL or greater. In some embodiments, patients selected for or treated are identified or determined to have an amount or level of LDL cholesterol between 100 and 129 mg / dL, 130 and 159 mg / dL, 160 and 189 mg / dL, or 190 mg / dL or greater.

[0169] Suitable methods for determining LPA expression, the amount or level of LPA mRNA, the amount or level of apo(a) protein, the amount or level of apo(a) activity, the amount or level of lipoprotein(a), and / or the amount or level of OxPL, LDL-C, apoB-100, TG, and / or LDL cholesterol in a subject or a sample from a subject are known in the art. Additionally, the Examples provided herein describe exemplary methods for determining LPA expression.

[0170] In some embodiments, the amount or level of LPA expression, LPA mRNA, apo(a) protein, apo(a) activity, OxPL, LDL-C, apoB-100, TG, LDL cholesterol, or any combination thereof, is decreased in a cell (e.g., a hepatocyte), a population or group of cells (e.g., an organoid), an organ (e.g., a liver), blood or a portion thereof (e.g., plasma), a tissue (e.g., liver tissue), a sample (e.g., a liver biopsy sample), or any other biological material obtained or isolated from a subject. In some embodiments, the amount or level of LPA expression, LPA mRNA, apo(a) protein, apo(a) activity, OxPL, LDL-C, apoB-100, TG, LDL cholesterol, or any combination thereof, is decreased in more than one type of cell (e.g., hepatocytes and one or more other types of cells), more than one group of cells, more than one organ (e.g., liver and one or more other organs), more than one blood fraction (e.g., plasma and one or more other blood fractions), more than one tissue (e.g., liver tissue and one or more other types of tissue), more than one sample (e.g., liver biopsy and one or more other types of biopsy) obtained or isolated from a subject.

[0171] Examples of diseases, disorders, or conditions associated with LPA expression include, but are not limited to, Burger's disease, peripheral artery disease, coronary artery disease, metabolic syndrome, acute coronary syndrome, aortic stenosis, aortic regurgitation, aortic dissection, retinal artery occlusion, cerebrovascular disease, mesenteric ischemia, superior mesenteric artery occlusion, renal artery stenosis, stable or unstable angina, acute coronary syndrome, heterozygous or homozygous familial hypercholesterolemia, hyperapobetalipoproteinemia, cerebrovascular atherosclerosis, cerebrovascular disease, and venous thrombosis, or a combination thereof.

[0172] Due to their high specificity, the oligonucleotides herein specifically target the mRNA of target genes in cells, tissues, or organs (e.g., the liver). In disease prevention, the target gene may be one that is required for the initiation or maintenance of the disease, or one that has been identified as being associated with a high risk of developing the disease. In disease treatment, the oligonucleotides can be contacted with cells or tissues that exhibit or mediate the disease. For example, oligonucleotides substantially identical to all or part of a wild-type (i.e., naturally occurring) or mutant gene associated with a disorder or condition related to LPA expression can be contacted with or introduced into a target cell or tissue type, such as hepatocytes or other liver cells.

[0173] In some embodiments, the target gene can be a target gene from any mammal, such as a human. Any gene can be silenced according to the methods described herein.

[0174] The methods described herein typically involve administering to a subject a therapeutically effective amount, i.e., an amount of the oligonucleotide of the present invention that can produce a desired therapeutic result. A therapeutically acceptable amount can be an amount that can treat a disease or disorder. The appropriate dosage for any one subject will depend on certain factors, including the subject's size, body surface area, age, the specific composition administered, the active ingredient(s) in the composition, the time and route of administration, overall health, and other drugs being administered at the same time.

[0175] In some embodiments, a subject is administered any one of the compositions herein enterally (e.g., orally, by gastric feeding tube, by duodenal feeding tube, via gastrostomy, or rectally), parenterally (e.g., subcutaneous injection, intravenous injection or infusion, intraarterial injection or infusion, intraosseous injection, intramuscular injection, intracerebral injection, intraventricular injection, intrathecal injection), topically (e.g., transdermally, by inhalation, eye drops, or via mucosa), or by direct injection into a target organ (e.g., the subject's liver). Typically, the oligonucleotide herein is administered intravenously or subcutaneously.

[0176] As a non-limiting example, the oligonucleotide of the present disclosure is typically administered quarterly (once every 3 months), every other month (once every 2 months), monthly or weekly.For example, oligonucleotide can be administered every week, or every 2 weeks or 3 weeks.Alternatively, oligonucleotide can be administered every day.In some embodiments, subject is administered one or more loading doses of oligonucleotide, followed by one or more maintenance doses of oligonucleotide.

[0177] In some embodiments, the subject to be treated is a human or non-human primate or other mammalian subject. Other exemplary subjects include domestic animals such as dogs and cats, livestock such as horses, cows, pigs, sheep, goats, and chickens, and animals such as mice, rats, guinea pigs, and hamsters.

[0178] V. Kit In some embodiments, the present disclosure provides kits comprising an oligonucleotide herein and instructions for use. In some embodiments, the kit comprises an oligonucleotide herein and a package insert containing instructions for use of the kit and / or any of its components. In some embodiments, the kit contains, in a suitable container, an oligonucleotide herein, one or more controls, and various buffers, reagents, enzymes, and other standard components well known in the art. In some embodiments, the container includes at least one vial, well, test tube, flask, bottle, syringe, or other container means into which the oligonucleotide is placed and, optionally, appropriately dispensed. In some embodiments in which additional components are provided, the kit includes an additional container into which this component is placed. The kit can also include means for tightly containing the oligonucleotide and any other reagents for commercial sale. Such containers can include injection-molded or blow-molded plastic containers into which the desired vials are retained. The container and / or kit can include instructions for use and / or warning labels.

[0179] In some embodiments, the kit comprises an oligonucleotide herein and a pharmaceutically acceptable carrier, or a pharmaceutical composition comprising the oligonucleotide, and instructions for use to treat or slow the progression of a disease, disorder, or condition associated with LPA expression in a subject in need thereof. [Example]

[0180] Although the present disclosure has been described with reference to specific embodiments illustrated in the following examples, it will be understood by those skilled in the art that various modifications can be made and equivalents can be substituted without departing from the true spirit and scope of the present disclosure. Furthermore, the following examples are presented for illustrative purposes and are not intended to limit the scope of the present disclosure in any manner. Furthermore, many modifications may be made to adapt a situation, material, composition of matter, process, process step or steps to the objective, spirit and scope of the present disclosure. All such modifications are intended to be within the scope of the present disclosure. Standard techniques well known in the art or those specifically described below are utilized.

[0181] Example 1: Preparation of double-stranded RNAi oligonucleotides Oligonucleotide synthesis and purification

[0182] The dsRNAi oligonucleotides described in the preceding examples are chemically synthesized using methods described herein. Generally, dsRNAi oligonucleotides are synthesized using solid-phase oligonucleotide synthesis methods described for 19-23mer siRNAs (see, e.g., Scaringe et al. (1990) Nucleic Acids Res. 18:5433-41 and Usman et al. (1987) J. Am. Chem. Soc. 109:7845-45; see also U.S. Patent Nos. 5,804,683; 5,831,071; 5,998,203; 6,008,400; 6,111,086; 6,117,657; 6,353,098; 6,362,323; 6,437,117; and 6,469,158).

[0183] Individual RNA strands are synthesized and HPLC-purified according to standard methods (Integrated DNA Technologies; Coralville, IA). For example, RNA oligonucleotides are synthesized using solid-phase phosphoramidite chemistry, deprotected, and desalted on a NAP-5 column (Amersham Pharmacia Biotech; Piscataway, NJ) using standard techniques (Damha & Olgivie (1993) Methods Mol. Biol. 20:81-114; Wincott et al. (1995) Nucleic Acids Res. 23:2677-84). Oligomers are purified using ion-exchange high-performance liquid chromatography (IE-HPLC) on an Amersham Source 15Q column (1.0 cm x 25 cm, Amersham Pharmacia Biotech) using a 15-minute linear step gradient. The gradient varies from 90:10 buffer A:B to 52:48 buffer A:B, where buffer A is 100 mM Tris, pH 8.5, and buffer B is 100 mM Tris, pH 8.5, 1 M NaCl. Samples are monitored at 260 nm, and peaks corresponding to full-length oligonucleotide species are collected, pooled, desalted on a NAP-5 column, and lyophilized.

[0184] The purity of each oligomer is determined by capillary electrophoresis (CE) on a Beckman PACE 5000 (Beckman Coulter, Inc.; Fullerton, CA). The CE capillary has an inner diameter of 100 μm and contains ssDNA 100R Gel (Beckman-Coulter). Typically, approximately 0.6 nmoles of oligonucleotide is injected into the capillary, run at an electric field of 444 V / cm, and detected by UV absorbance at 260 nm. A denaturing Tris-borate-7M-urea running buffer is purchased from Beckman-Coulter. Oligoribonucleotides that are at least 90% pure as assessed by CE are obtained for use in the experiments described below. Compounds are characterized by matrix-assisted laser desorption / ionization time-of-flight (MALDI-TOF) mass spectrometry on a Voyager DE™ Biospectometry Work Station (Applied Biosystems; Foster City, CA) according to the manufacturer's recommended protocol. Relative molecular weights of all oligomers are often obtained within 0.2% of the predicted molecular weight.

[0185] Preparation of duplexes

[0186] Resuspend the ssRNA oligomers in a duplex buffer consisting of 100 mM potassium acetate, 30 mM HEPES, pH 7.5 (e.g., to a concentration of 100 μM). Mix the complementary sense and antisense strands in equimolar amounts to obtain a final solution of, e.g., 50 μM duplex. Heat the sample to 100°C for 5 minutes in RNA buffer (IDT) and allow to cool to room temperature before use. Store dsRNA oligonucleotides at -20°C. Store ssRNA oligomers lyophilized or in nuclease-free water at -80°C.

[0187] Example 2: RNAi oligonucleotide inhibition of LPA expression in vitro Identification of mRNA target sequences of LPA

[0188] To identify RNAi oligonucleotide inhibitors of LPA expression, a computer-based algorithm was used to computationally identify LPA mRNA target sequences suitable for assaying inhibition of LPA expression by the RNAi pathway. The algorithm provides RNAi oligonucleotide guide (antisense) strand sequences, each with a region of complementarity to the appropriate LPA target sequence in human LPA mRNA (e.g., SEQ ID NO: 1; Table 1). Some of the guide strand sequences identified by the algorithm are also complementary to the corresponding LPA target sequence in monkey LPA mRNA (SEQ ID NO: 2; Table 1). RNAi oligonucleotides (formatted as DsiRNA oligonucleotides) were generated (Table 2), each with a unique guide strand that has a region of complementarity to the LPA target sequence identified by the algorithm. The passenger (sense) strand of the DsiRNA provided in Table 2 contains the unique human LPA mRNA target sequence identified by the algorithm.

[0189] [Table 1]

[0190] [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7] [Table 2-8] [Table 2-9] [Table 2-10] [Table 2-11] [Table 2-12] [Table 2-13] [Table 2-14] [Table 2-15] [Table 2-16] [Table 2-17] [Table 2-18] [Table 2-19] [Table 2-20] [Table 2-21] [Table 2-22]

[0191] In vitro cell-based assays

[0192] The ability of each of the DsiRNAs listed in Table 2 to inhibit LPA expression was determined using an in vitro cell-based assay. Briefly, human embryonic kidney 293 (HEK293) cells or HepG2 cells stably expressing the human LPA gene were transfected with 0.5 nM of each of the DsiRNAs listed in Table 2 in separate wells of a multiwell cell culture plate. The cells were maintained for 24 hours after transfection, and then the amount of remaining LPA mRNA from the transfected cells was determined using a TAQMAN®-based qPCR assay. Two qPCR assays, a 3' assay and a 5' assay, were used to determine LPA mRNA levels, measured using a PCR probe conjugated to 6-carboxyfluorescein (6-FAM).

[0193] The results of HEK293 and HepG2 cell-based assays to evaluate the ability of the DsiRNAs listed in Table 2 to inhibit LPA expression are shown in Figures 1-4 and 5, respectively. Cells transfected with GalNAc-conjugated LPA oligonucleotides (GalXC-LPA-3675, SEQ ID NOs: 1188 and 1189) were used as a positive control. DsiRNAs that resulted in approximately 15%-20% or less LPA mRNA remaining in DsiRNA-transfected cells compared to mock-transfected cells were generally considered to contain sequences that provided an appropriate amount of knockdown or reduction of target mRNA expression for further evaluation. Figures 1-5 show the percent of LPA mRNA remaining in DsiRNA-transfected cells compared to time-matched control cells, as indicated (3' assay = circle; 5' assay = triangle).

[0194] To further evaluate the DsiRNA hits, a subset of the DsiRNAs listed in Table 2 was tested to determine their ability to inhibit LPA expression using an in vitro cell-based assay at two different DsiRNA concentrations (Figures 6 and 7). Briefly, HEK293 cells stably expressing the human LPA gene were transfected with DsiRNAs at 0.1 nM and 0.5 nM in separate wells of a multi-well cell culture plate. Cells were maintained for 24 hours post-transfection, and the amount of remaining LPA mRNA from the transfected cells was then determined using a TAQMAN®-based qPCR assay. Two qPCR assays, a 3' assay and a 5' assay, were used to determine LPA mRNA levels, measured using a PCR probe conjugated to hexachlorofluorescein (HEX). Untransfected cells (UT), mock-transfected cells (Mock), and cells transfected with control oligonucleotides (NC1, SEQ ID NOs: 1191 and 1192; NC5, SEQ ID NOs: 1193 and 1194; and NC7, SEQ ID NOs: 1195 and 1196) were used as negative controls. As shown in Figures 6 and 7, the percent LPA mRNA remaining in HEK293 cells transfected with the indicated DsiRNAs is the average of LPA mRNA levels from the 3' and 5' assays, time-matched and normalized to mock-transfected control HEK293 cells.

[0195] Collectively, these results demonstrate that DsiRNAs designed to target human LPA mRNA inhibit LPA expression in cells, as determined by reduced amounts of LPA mRNA in DsiRNA-transfected cells compared with control cells. These results demonstrate that nucleotide sequences containing DsiRNAs are useful for generating RNAi oligonucleotides that inhibit LPA expression. Furthermore, these results demonstrate that multiple LPA mRNA target sequences are suitable for RNAi-mediated inhibition of LPA expression.

[0196] Example 3: RNAi oligonucleotide inhibition of LPA expression in vivo Among the DsiRNAs screened in the cell-based assay described in Example 2, the nucleotide sequences of 14 DsiRNAs were selected for further in vivo evaluation. Briefly, the nucleotide sequences of the 14 selected DsiRNAs were used to generate 14 corresponding double-stranded RNAi oligonucleotides containing a nicked tetraloop GalNAc-conjugated structure (referred to herein as "GalNAc-conjugated LPA oligonucleotides") with a 36-mer passenger strand and a 22-mer guide strand (Table 3). Furthermore, the nucleotide sequences containing the passenger and guide strands of the GalNAc-conjugated LPA oligonucleotides have distinct patterns of modified nucleotides and phosphorothioate linkages (see, e.g., Figure 10 for a schematic diagram of the general structure and chemical modification patterns (M1, M2, and M3) of GalNAc-conjugated LPA oligonucleotides). The three adenosine nucleotides that make up the tetraloop are each linked to a GalNAc moiety (CAS number: 14131-60-3).

[0197] [Table 3]

[0198] Mouse studies

[0199] The GalNAc-conjugated LPA oligonucleotides listed in Table 3 were evaluated in the HDI mouse model. HDI mice were engineered to transiently express human LPA mRNA in hepatocytes. The GalNAc-conjugated LPA oligonucleotide, LPA-3675-M2, was used as a benchmark control. Briefly, 6-8 week-old female CD-1 mice (n = 5) were subcutaneously treated with the indicated GalNAc-conjugated LPA oligonucleotide at a dose level of 0.5 mg / kg (Figure 8) or at dose levels of 0.25 mg / kg, 0.5 mg / kg, and 1 mg / kg (Figure 9). Three days (72 hours) later, mice were hydrodynamically injected (HDI) with a DNA plasmid encoding the complete human LPA gene under the control of the ubiquitous cytomegalovirus (CMV) promoter sequence. Liver samples were collected from the mice one day after DNA plasmid transfer. Total RNA from these mice was subjected to qRT-PCR analysis of LPA mRNA compared with mice treated with the same volume of PBS alone, and values ​​were normalized for transfection efficiency using the NeoR gene contained in the plasmid.

[0200] As shown in Figure 8, the indicated GalNAc-conjugated LPA oligonucleotides inhibited LPA expression, as determined by a reduction in the amount of LPA mRNA in liver samples from HDI mice treated with the oligonucleotides compared to mice treated with PBS. To further evaluate the ability of GalNAc-conjugated LPA oligonucleotides to inhibit LPA expression, two GalNAc-conjugated LPA oligonucleotide sequences (LPA-2900 and LPA-3675), each with a different chemical modification pattern (M2 and M3), were tested for their ability to inhibit LPA expression in the HDI mice described above at three different concentrations (0.25 mg / kg, 0.5 mg / kg, and 1.0 mg / kg). As shown in Figure 9, the indicated GalNAc-conjugated LPA oligonucleotides dose-dependently inhibited LPA expression in HDI mice.

[0201] Taken together, these results demonstrate that GalNAc-conjugated LPA oligonucleotides designed to target human LPA mRNA inhibit LPA expression in mice, as determined by a reduction in the amount of LPA mRNA in the livers of HDI mice compared with PBS-treated control mice. Based on these results, 10 of the 14 GalNAc-conjugated LPA oligonucleotides evaluated in HDI mice were selected for evaluation of their ability to inhibit LPA expression in non-human primates (NHPs). The 10 GalNAc-conjugated LPA oligonucleotides listed in Table 4 contain chemically modified nucleotides with patterns M1, M2, or M3, as described in Figure 10.

[0202] [Table 4]

[0203] Non-human primate (NHP) research

[0204] The GalNAc-conjugated LPA oligonucleotides listed in Table 4 were evaluated in cynomolgus monkeys (Macaca fascicularis). For this study, monkeys were grouped so that the average monkey weight (approximately 5.4 kg) was comparable between the control and experimental groups. Each cohort included two male and three female subjects. GalNAc-conjugated LPA oligonucleotides were administered subcutaneously on study day 0. Blood samples were collected on study days -8, -5, and 0, and weekly thereafter. Ultrasound-guided core needle liver biopsies were obtained on study days 28, 56, and 84. At each time point, total RNA from the liver biopsy samples was subjected to qRT-PCR analysis to measure LPA mRNA in monkeys treated with the oligonucleotides compared to monkeys treated with an equivalent volume of PBS. To normalize the data, measurements were performed relative to the geometric mean of two reference genes, PPIB and 18S rRNA. As shown in Figure 11A (day 28), Figure 11B (day 56), and Figure 11C (day 84), treatment of NHPs with the GalNAc-conjugated LPA oligonucleotides listed in Table 4 inhibited LPA expression in the liver, as determined by a decrease in the amount of LPA mRNA in liver samples from oligonucleotide-treated NHPs compared to PBS-treated NHPs. The amount of plasminogen (PLG) mRNA in liver samples from treated NHPs was also determined and is shown in Figure 11D. From the same NHP study, inhibition of LPA expression was also determined by measuring apo(a) protein serum from treated NHPs by ELISA. As shown in Figure 12, a significant decrease in serum apo(a) protein was observed in NHPs treated with GalNAc-conjugated LPA oligonucleotides compared to PBS-treated NHPs. The values ​​for the three pre-treatment samples were averaged and set to 100%, and data are reported as relative values ​​compared to the pre-treatment mean. Taken together, these results indicate that treatment of NHPs with GalNAc-conjugated LPA oligonucleotides reduced the amount of LPA mRNA in the liver and the amount of apo(a) protein in the serum.

[0205] Taken together, these results demonstrate that GalNAc-conjugated LPA oligonucleotides designed to target human LPA mRNA inhibit LPA expression in vivo (as determined by reduced amounts of LPA mRNA and apo(a) protein in treated animals).

[0206] Sequence Listing The following nucleic acid and / or amino acid sequences are referred to in the disclosure above and are provided below for reference:

[0207] [Table 5-1] [Table 5-2] [Table 5-3] [Table 5-4] [Table 5-5] [Table 5-6] [Table 5-7] [Table 5-8] [Table 5-9] [Table 5-10] [Table 5-11] [Table 5-12] Table 5-13 Table 5-14 Table 5-15 Table 5-16 Table 5-17 Table 5-18 Table 5-19 Table 5-20 Table 5-21 Table 5-22 Table 5-23 Table 5-24 Table 6-1 Table 6-2 Table 6-3 Table 6-4 Table 6-5 [Table 6-6] [Table 6-7] [Table 6-8] [Table 7-1] [Table 7-2] [Table 7-3] [Table 7-4] Modifications in Table 6: mC, mA, mG, mU = 2'-OMe ribonucleoside; fA, fC, fG, fU = 2'-F ribonucleoside; s = phosphorothioate; MePhosphonate-4O-mUs = [ka] ademA-GalNAc = GalNAc bound to an adenine nucleotide: [ka] Another aspect of the present invention may be as follows. [1] An RNAi oligonucleotide for reducing LPA expression, the oligonucleotide comprising a sense strand and an antisense strand, the sense strand and the antisense strand forming a double-stranded region, the antisense strand comprising a region of complementarity to any one of the LPA mRNA target sequences selected from SEQ ID NOs: 4 to 387, and the region of complementarity having a length of at least 15 consecutive nucleotides. [2] The RNAi oligonucleotide according to [1] above, wherein the sense strand is 15 to 50 nucleotides in length. [3] The RNAi oligonucleotide according to [1] or [2] above, wherein the sense strand is 18 to 36 nucleotides in length. [4] The RNAi oligonucleotide according to any one of [1] to [3] above, wherein the antisense strand is 15 to 30 nucleotides in length. [5] The RNAi oligonucleotide according to any one of [1] to [4], wherein the antisense strand is 22 nucleotides in length, and the antisense strand and the sense strand form a duplex region at least 19 nucleotides in length, optionally at least 20 nucleotides in length. [6] The RNAi oligonucleotide according to any one of [1] to [5], wherein the region of complementarity is at least 19 consecutive nucleotides in length, and optionally at least 20 nucleotides in length. [7] The RNAi oligonucleotide according to any one of [1] to [6], wherein the 3' end of the sense strand comprises a stem-loop represented as S1-L-S2, S1 is complementary to S2, and L forms a loop of 3 to 5 nucleotides between S1 and S2. [8] An RNAi oligonucleotide for reducing LPA expression, the oligonucleotide comprising a sense strand and an antisense strand, each of which is 15 to 50 nucleotides in length, wherein the sense strand and the antisense strand form a double-stranded region, the antisense strand comprises a region of complementarity to any one of the LPA mRNA target sequences selected from SEQ ID NOs: 4 to 387, and the region of complementarity is at least 15 consecutive nucleotides in length. [9] An RNAi oligonucleotide for reducing LPA expression, the oligonucleotide comprising a sense strand 15 to 50 nucleotides in length and an antisense strand 15 to 30 nucleotides in length, the sense strand and the antisense strand forming a double-stranded region, the antisense strand comprising a region of complementarity to any one of the LPA mRNA target sequences selected from SEQ ID NOs: 4 to 387, and the region of complementarity being at least 15 consecutive nucleotides in length.

[10] An RNAi oligonucleotide for reducing LPA expression, the oligonucleotide comprising a sense strand and an antisense strand, each of which is 15 to 50 nucleotides in length, wherein the sense strand and the antisense strand form a duplex region, and the antisense strand comprises a region of complementarity to any one of the LPA mRNA target sequences selected from SEQ ID NOs: 4 to 387, the region of complementarity being 19 consecutive nucleotides in length, and optionally 20 nucleotides in length.

[11] An RNAi oligonucleotide for reducing LPA expression, the oligonucleotide comprising a sense strand and an antisense strand, each of which is 18 to 36 nucleotides in length, wherein the sense strand and the antisense strand form a duplex region, and the antisense strand comprises a region of complementarity to any one of the LPA mRNA target sequences selected from SEQ ID NOs: 4 to 387, the region of complementarity being 19 consecutive nucleotides in length, and optionally 20 nucleotides in length.

[12] An RNAi oligonucleotide for reducing LPA expression, the oligonucleotide comprising a sense strand 18 to 36 nucleotides in length and an antisense strand 22 nucleotides in length, the sense strand and the antisense strand forming a duplex region, the antisense strand comprising a region of complementarity to any one of the LPA mRNA target sequences selected from SEQ ID NOs: 4 to 387, the region of complementarity being 19 consecutive nucleotides in length, and optionally 20 nucleotides in length.

[13] An RNAi oligonucleotide for reducing LPA expression, the oligonucleotide comprising a sense strand 18 to 36 nucleotides in length and an antisense strand 22 nucleotides in length, the sense strand and the antisense strand forming a duplex region, the 3' end of the sense strand comprising a stem-loop shown as S1-L-S2, S1 being complementary to S2, and L forming a loop 3 to 5 nucleotides in length between S1 and S2, the antisense strand comprising a region of complementarity to any one of the LPA mRNA target sequences of SEQ ID NOs: 4 to 387, the region of complementarity being 19 consecutive nucleotides in length, optionally 20 nucleotides in length.

[14] An RNAi oligonucleotide for reducing LPA expression, the oligonucleotide comprising a sense strand 36 nucleotides in length and an antisense strand 22 nucleotides in length, the sense strand and the antisense strand forming a duplex region, the 3' end of the sense strand comprising a stem-loop shown as S1-L-S2, S1 being complementary to S2, and L forming a loop 3 to 5 nucleotides in length between S1 and S2, the antisense strand comprising a region of complementarity to any one of the LPA mRNA target sequences of SEQ ID NOs: 4 to 387, the region of complementarity being 19 consecutive nucleotides in length, optionally 20 nucleotides in length.

[15] An RNAi oligonucleotide for reducing LPA expression, the oligonucleotide comprising a sense strand 36 nucleotides in length and an antisense strand 22 nucleotides in length, wherein the sense strand and the antisense strand form a duplex region at least 19 nucleotides in length, optionally 20 nucleotides in length, the 3' end of the sense strand comprises a stem-loop shown as S1-L-S2, wherein S1 is complementary to S2, and L forms a loop 3 to 5 nucleotides in length between S1 and S2, and the antisense strand comprises a region of complementarity to any one of the LPA mRNA target sequences of SEQ ID NOs: 4 to 387, the region of complementarity being 19 consecutive nucleotides in length, optionally 20 nucleotides in length.

[16] The RNAi oligonucleotide according to any one of [7] and

[13] to

[15] above, wherein L is a triloop or tetraloop.

[17] The RNAi oligonucleotide according to

[16] , wherein L is a tetraloop.

[18] The RNAi oligonucleotide according to

[17] , wherein the tetraloop comprises the sequence 5'-GAAA-3'.

[19] The RNAi oligonucleotide according to any one of

[16] to

[18] above, wherein S1 and S2 are 1 to 10 nucleotides in length and have the same length.

[20] The RNAi oligonucleotide according to

[19] , wherein S1 and S2 are 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, or 10 nucleotides in length.

[21] The RNAi oligonucleotide according to

[20] , wherein S1 and S2 are 6 nucleotides in length.

[22] The RNAi oligonucleotide according to any one of

[16] to

[21] above, wherein the stem loop comprises the sequence 5'-GCAGCCGAAAGGCUGC-3' (SEQ ID NO: 190).

[23] The RNAi oligonucleotide according to any one of [1] to

[22] above, wherein the antisense strand comprises a 3'-overhanging sequence having a length of one or more nucleotides.

[24] The RNAi oligonucleotide according to

[23] , wherein the 3' overhanging sequence is 2 nucleotides in length, and optionally the 3' overhanging sequence is GG.

[25] The RNAi oligonucleotide of any one of the preceding aspects, wherein the oligonucleotide comprises at least one modified nucleotide.

[26] The RNAi oligonucleotide according to

[25] , wherein the modified nucleotide comprises a 2' modification.

[27] The RNAi oligonucleotide of

[26] , wherein the 2'-modification is selected from 2'-aminoethyl, 2'-fluoro, 2'-O-methyl, 2'-O-methoxyethyl, and 2'-deoxy-2'-fluoro-β-d-arabinonucleic acid.

[28] The RNAi oligonucleotide according to any one of

[25] to

[27] , wherein all nucleotides constituting the oligonucleotide are modified, and optionally, the modification is a 2'-modification selected from 2'-fluoro and 2'-O-methyl.

[29] The RNAi oligonucleotide of any one of the preceding aspects, wherein the oligonucleotide comprises at least one modified internucleotide bond.

[30] The RNAi oligonucleotide according to

[29] , wherein at least one modified internucleotide bond is a phosphorothioate bond.

[31] The RNAi oligonucleotide of any one of the preceding aspects, wherein the 4'-carbon of the sugar of the 5'-nucleotide of the antisense strand comprises a phosphate analog.

[32] The RNAi oligonucleotide according to

[31] , wherein the phosphate analog is an oxymethylphosphonate, vinylphosphonate, or malonylphosphonate, and optionally, the phosphate analog is a 4'-phosphate analog comprising 5'-methoxyphosphonate-4'-oxy.

[33] The RNAi oligonucleotide of any one of the preceding aspects, wherein at least one nucleotide of the oligonucleotide is conjugated to one or more targeting ligands.

[34] The RNAi oligonucleotide according to

[33] , wherein each targeting ligand comprises a carbohydrate, an amino sugar, cholesterol, a polypeptide, or a lipid.

[35] The RNAi oligonucleotide according to

[33] , wherein each targeting ligand comprises an N-acetylgalactosamine (GalNAc) moiety.

[36] The RNAi oligonucleotide according to

[35] , wherein the GalNAc moiety is a monovalent GalNAc moiety, a divalent GalNAc moiety, a trivalent GalNAc moiety, or a tetravalent GalNAc moiety.

[37] The RNAi oligonucleotide according to any one of

[16] to

[32] , wherein up to four nucleotides of L in the stem-loop are each conjugated to a monovalent GalNAc moiety.

[38] The RNAi oligonucleotide according to any one of [1] to

[37] , wherein the sense strand comprises any one of the nucleotide sequences of SEQ ID NOs: 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, and 403.

[39] The RNAi oligonucleotide according to any one of [1] to

[38] , wherein the antisense strand comprises any one of the nucleotide sequences of SEQ ID NOs: 788, 789, 790, 791, 792, 793, 794, 795, 796, 797, 798, 799, 800, 801, 802, and 803.

[40] The RNAi oligonucleotide according to any one of [1] to

[39] above, wherein the sense strand and the antisense strand comprise a nucleotide sequence selected from the group consisting of: (a) SEQ ID NOs: 393 and 793, respectively; (b) SEQ ID NOs: 388 and 788, respectively; (c) SEQ ID NOs: 389 and 789, respectively; (d) SEQ ID NOs: 390 and 790, respectively; (e) SEQ ID NOs: 391 and 791, respectively; (f) SEQ ID NOs: 392 and 792, respectively; (g) SEQ ID NOs: 394 and 794, respectively; (h) SEQ ID NOs: 395 and 795, respectively; (i) SEQ ID NOs: 396 and 796, respectively; (j) SEQ ID NOs: 397 and 797, respectively; (k) SEQ ID NOs: 398 and 798, respectively; (l) SEQ ID NOs: 399 and 799, respectively; (m) SEQ ID NOs: 400 and 800, respectively; (n) SEQ ID NOs: 401 and 801, respectively; (o) SEQ ID NOs: 402 and 802, respectively; and (p) SEQ ID NOs: 403 and 803, respectively.

[41] The RNAi oligonucleotide according to any one of [1] to

[39] , wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 393 and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 793.

[42] The RNAi oligonucleotide according to any one of [1] to

[39] , wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 388 and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 788.

[43] The RNAi oligonucleotide according to any one of [1] to

[39] , wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 389 and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 789.

[44] The RNAi oligonucleotide according to any one of [1] to

[39] , wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 390 and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 790.

[45] The RNAi oligonucleotide according to any one of [1] to

[39] , wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 391 and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 791.

[46] The RNAi oligonucleotide according to any one of [1] to

[39] , wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 392 and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 792.

[47] The RNAi oligonucleotide according to any one of [1] to

[39] , wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 394 and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 794.

[48] ​​The RNAi oligonucleotide according to any one of [1] to

[39] , wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 395 and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 795.

[49] The RNAi oligonucleotide according to any one of [1] to

[39] , wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 396 and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 796.

[50] The RNAi oligonucleotide according to any one of [1] to

[39] , wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 397 and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 797.

[51] The RNAi oligonucleotide according to any one of [1] to

[39] , wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 398 and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 798.

[52] The RNAi oligonucleotide according to any one of [1] to

[39] , wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 399 and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 799.

[53] The RNAi oligonucleotide according to any one of [1] to

[39] , wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 400 and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 800.

[54] The RNAi oligonucleotide according to any one of [1] to

[39] , wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 401 and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 801.

[55] The RNAi oligonucleotide according to any one of [1] to

[39] , wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 402 and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 802.

[56] The RNAi oligonucleotide according to any one of [1] to

[39] , wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 403 and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 803.

[57] An RNAi oligonucleotide for reducing LPA expression, the oligonucleotide comprising a sense strand and an antisense strand, the sense strand and the antisense strand forming a double-stranded region, all nucleotides constituting the sense strand and the antisense strand being modified, the antisense strand comprising a region of complementarity to any one of the LPA mRNA target sequences selected from SEQ ID NOs: 4 to 387, and the region of complementarity having a length of at least 15 consecutive nucleotides.

[58] An RNAi oligonucleotide for reducing LPA expression, the oligonucleotide comprising a sense strand and an antisense strand, the sense strand and the antisense strand forming a double-stranded region, all nucleotides constituting the sense strand and the antisense strand being modified, the 4'-carbon of the sugar of the 5'-nucleotide of the antisense strand comprising a phosphate analog, the antisense strand comprising a region of complementarity to any one of the LPA mRNA target sequences of SEQ ID NOs: 4 to 387, and the region of complementarity being at least 15 consecutive nucleotides in length.

[59] An RNAi oligonucleotide for reducing LPA expression, the oligonucleotide comprising a sense strand and an antisense strand, the sense strand and the antisense strand forming a double-stranded region, all nucleotides constituting the sense strand and the antisense strand being modified, the 4'-carbon of the sugar of the 5'-nucleotide of the antisense strand comprising a phosphate analog, the antisense strand comprising a region of complementarity to any one of the LPA mRNA target sequences of SEQ ID NOs: 4 to 387, and the region of complementarity being at least 15 consecutive nucleotides in length.

[60] An RNAi oligonucleotide for reducing LPA expression, the oligonucleotide comprising a sense strand and an antisense strand, the sense strand and the antisense strand forming a double-stranded region, all nucleotides constituting the sense strand and the antisense strand being modified, the antisense strand and the sense strand containing one or more 2'-fluoro and 2'-O-methyl modified nucleotides and at least one phosphorothioate bond, the 4'-carbon of the sugar of the 5'-nucleotide of the antisense strand containing a phosphate analog, the antisense strand comprising a region of complementarity to any one of the LPA mRNA target sequences of SEQ ID NOs: 4 to 387, the RNAi oligonucleotide comprising a length of at least 15 consecutive nucleotides.

[61] A method for treating a subject having a disease, disorder, or condition associated with LPA expression, the method comprising administering to the subject a therapeutically effective amount of an RNAi oligonucleotide or a pharmaceutical composition thereof described in any one of the preceding aspects, thereby treating the subject.

[62] A pharmaceutical composition comprising the RNAi oligonucleotide according to any one of [1] to

[60] above, and a pharmaceutically acceptable carrier, delivery agent, or excipient.

[63] A method for delivering an oligonucleotide to a subject, the method comprising administering to the subject the pharmaceutical composition described in

[61] .

[64] A method for reducing LPA expression in a cell, a population of cells, or a subject, the method comprising: i. contacting the cell or the population of cells with the RNAi oligonucleotide described in any one of [1] to

[60] or the pharmaceutical composition described in

[62] ; or ii. The method, comprising the step of administering to the subject the RNAi oligonucleotide described in any one of [1] to

[83] or the pharmaceutical composition described in

[85] .

[65] The method described in

[64] , wherein reducing LPA expression includes reducing the amount or level of LPA mRNA, the amount or level of LPA protein, or both.

[66] The method described in

[64] or

[65] , wherein the subject has a disease, disorder, or condition associated with LPA expression.

[67] The method according to

[66] , wherein the disease, disorder, or condition associated with LPA expression is a cardiometabolic disease, optionally atherosclerosis, dyslipidemia, NAFLD, and NASH.

[68] The method according to any one of

[61] and

[63] to

[67] , wherein the RNAi oligonucleotide or pharmaceutical composition is administered in combination with a second composition or therapeutic agent.

[69] A method for treating a subject having a disease, disorder, or condition associated with LPA expression, the method comprising administering to the subject a therapeutically effective amount of an RNAi oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a duplex region, the antisense strand comprises a region of complementarity to any one of the LPA mRNA target sequences selected from SEQ ID NOs: 4 to 387, and the region of complementarity is at least 15 consecutive nucleotides in length.

[70] A method for treating a subject having a disease, disorder, or condition associated with LPA expression, the method comprising administering to the subject a therapeutically effective amount of an RNAi oligonucleotide or a pharmaceutical composition thereof comprising a sense strand and an antisense strand selected from the rows shown in Table 5, thereby treating the subject.

[71] A method for treating a subject having a disease, disorder, or condition associated with LPA expression, comprising administering to the subject a therapeutically effective amount of an RNAi oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand comprise a nucleotide sequence selected from the group consisting of: (a) SEQ ID NOs: 393 and 793, respectively; (b) SEQ ID NOs: 388 and 788, respectively; (c) SEQ ID NOs: 389 and 789, respectively; (d) SEQ ID NOs: 390 and 790, respectively; (e) SEQ ID NOs: 391 and 791, respectively; (f) SEQ ID NOs: 392 and 792, respectively; (g) SEQ ID NOs: 394 and 794, respectively; (h) SEQ ID NOs: 395 and 795, respectively; (i) SEQ ID NOs: 396 and 796, respectively; (j) SEQ ID NOs: 397 and 797, respectively; (k) SEQ ID NOs: 398 and 798, respectively; (l) SEQ ID NOs: 399 and 799, respectively; (m) SEQ ID NOs: 400 and 800, respectively; (n) SEQ ID NOs: 401 and 801, respectively; (o) SEQ ID NOs: 402 and 802, respectively; and (p) SEQ ID NOs: 403 and 803, respectively.

[72] The method described in

[71] , wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 393 and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 793.

[73] The method described in

[71] , wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 388 and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 788.

[74] The method described in

[71] , wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 389 and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 789.

[75] The method described in

[71] , wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 390 and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 790.

[76] The method described in

[71] , wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 391 and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 791.

[77] The method described in

[71] , wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 392 and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 792.

[78] The method described in

[71] , wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 394 and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 794.

[79] The method described in

[71] , wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 395 and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 795.

[80] The method described in

[71] , wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 396 and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 796.

[81] The method described in

[71] , wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 397 and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 797.

[82] The method described in

[71] , wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 398 and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 798.

[83] The method described in

[71] , wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 399 and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 799.

[84] The method described in

[71] , wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 400 and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 800.

[85] The method described in

[71] , wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 401 and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 801.

[86] The method described in

[71] , wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 402 and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 802.

[87] The method described in

[71] , wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 403 and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 803.

[88] The method according to any one of

[69] to

[87] , wherein the disease, disorder, or condition associated with LPA expression is a cardiometabolic disease, optionally atherosclerosis, dyslipidemia, NAFLD, and NASH.

[89] Use of the RNAi oligonucleotide described in any one of [1] to

[60] or the pharmaceutical composition described in

[62] in the manufacture of a pharmaceutical for the treatment of a disease, disorder, or condition associated with LPA expression, optionally for the treatment of cardiometabolic disease, optionally for the treatment of atherosclerosis, dyslipidemia, NAFLD, and NASH.

[90] The RNAi oligonucleotide of any one of [1] to

[60] or the pharmaceutical composition of

[62] , for use in or applicable for use in the treatment of a disease, disorder, or condition associated with LPA expression, optionally for the treatment of cardiometabolic disease, optionally for the treatment of atherosclerosis, dyslipidemia, NAFLD, and NASH.

[91] A kit comprising the RNAi oligonucleotide described in any one of [1] to

[60] above, an optional pharmaceutically acceptable carrier, and a package insert containing instructions for administration to a subject having a disease, disorder, or condition associated with LPA expression.

[92] An RNAi oligonucleotide or pharmaceutical composition for or applicable to the use described in

[89] , the use described in

[90] , or the kit described in

[91] , wherein the disease, disorder, or condition associated with LPA expression is a cardiometabolic disease, optionally atherosclerosis, dyslipidemia, NAFLD, and NASH.

Claims

1. An RNAi oligonucleotide comprising an antisense strand that forms a duplex region with a sense strand, wherein the antisense strand is 5' UAGAUGACCAAGCUUGGCAAGG (SEQ ID NO: 793) and the sense strand comprises a sequence defined as: 5' UUGCCAAGCUUGGUCAUCUAGCAGCCGAAAGGCUGC (SEQ ID NO: 393) and However, the RNAi oligonucleotide is An RNAi oligonucleotide comprising a sense strand that forms a duplex region with an antisense strand, wherein the sense strand is 5'[mUs][mU][mG][mC][mC][mA][mA][fG][fC][fU][fU][mG][mG][mU][mC][mA][mU] [mC][mU][mA][mG][mC][mA][mG][mC][mC][mG][ademA-GalN Ac][ademA-GalN Ac][ademA-GalNAc][mG][mG][mC][mU][mG][mC] (SEQ ID NO: 393) and the antisense strand is 5'[MePhosphonate-4O-mUs][fAs][fGs][fA][fU][mG][fA][mC][mC][fA][mA][mG][mC] [fU][mU][mG][mG][mC][mA][mAs][mGs][mG] (SEQ ID NO: 793) where: mUs indicates 2'-OMe uridine with a 3'-phosphorothioate linkage; mU indicates 2'-OMe uridine; mG indicates 2'-OMe guanosine; mC indicates 2'-OMe cytosine, mA indicates 2'-OMe adenosine; fG indicates 2'-F guanosine; fC indicates 2'-F cytosine; fU indicates 2'-F uridine, ademA-GalNAc represents 2'-aminodiethoxymethanol-adenine-GalNAc; MePhosphonate-4O-mUs indicates, fAs indicates 2'-F adenosine with a 3'-phosphorothioate linkage; fGs indicates 2'-F guanosine with a 3'-phosphorothioate bond; fA indicates 2'-F adenosine, mAs indicates 2'-OMe adenosine with a 3'-phosphorothioate linkage, and mGs indicates 2'-OMe guanosine with a 3'-phosphorothioate linkage, RNAi oligonucleotides that are not RNAi oligonucleotides.

2. The RNAi oligonucleotide of claim 1 , wherein the oligonucleotide contains at least one modified nucleotide or all nucleotides constituting the oligonucleotide are modified.

3. The RNAi oligonucleotide of claim 2, wherein the modified nucleotide comprises a 2' modification.

4. The RNAi oligonucleotide described in claim 3, wherein the 2' modification is a modification selected from 2'-aminoethyl, 2'-fluoro, 2'-O-methyl, 2'-O-methoxyethyl, and 2'-deoxy-2'-fluoro-β-d-arabinonucleic acid.

5. The RNAi oligonucleotide of claim 3, wherein the modification is a 2'-modification selected from 2'-fluoro and 2'-O-methyl.

6. The RNAi oligonucleotide of any one of claims 1 to 5, wherein the oligonucleotide comprises at least one modified internucleotide bond.

7. The RNAi oligonucleotide described in claim 6, wherein at least one modified internucleotide bond is a phosphorothioate bond.

8. The RNAi oligonucleotide of any one of claims 1 to 7, wherein the 4'-carbon of the sugar of the 5'-nucleotide of the antisense strand comprises a phosphate analog.

9. The RNAi oligonucleotide of claim 8, wherein the phosphate analog is an oxymethylphosphonate, vinylphosphonate, or malonylphosphonate.

10. The RNAi oligonucleotide of claim 8, wherein the phosphate analog is a 4'-phosphate analog comprising 5'-methoxyphosphonate-4'-oxy.

11. The RNAi oligonucleotide of any one of claims 1 to 10, wherein at least one nucleotide of the oligonucleotide is conjugated to one or more targeting ligands.

12. The RNAi oligonucleotide of claim 11, wherein each targeting ligand comprises a carbohydrate, an amino sugar, cholesterol, a polypeptide, or a lipid.

13. The RNAi oligonucleotide of claim 12, wherein each targeting ligand comprises an N-acetylgalactosamine (GalNAc) moiety.

14. The RNAi oligonucleotide of claim 13, wherein the GalNAc moiety is a monovalent GalNAc moiety, a divalent GalNAc moiety, a trivalent GalNAc moiety, or a tetravalent GalNAc moiety.

15. The RNAi oligonucleotide according to any one of claims 1 to 14, wherein the antisense strand is represented by the following formula: 5'[MePhosphonate-4O-mUs][fAs][fGs][fA][fU][mG][fA][mC][mC][fA][mA][mG][mC] [fU][mU][mG][mG][mC][mA][mAs][mGs][mG] (SEQ ID NO: 793) (In the formula, mU indicates 2'-OMe uridine; mG indicates 2'-OMe guanosine; mC indicates 2'-OMe cytosine, mA indicates 2'-OMe adenosine; fU indicates 2'-F uridine, MePhosphonate-4O-mUs has the following formula: indicates, fAs indicates 2'-F adenosine with a 3'-phosphorothioate linkage; fGs indicates 2'-F guanosine with a 3'-phosphorothioate bond; fA indicates 2'-F adenosine, mAs indicates 2'-OMe adenosine with a 3'-phosphorothioate linkage, and mGs indicates 2'-OMe guanosine with a 3'-phosphorothioate linkage.)

16. The RNAi oligonucleotide of any one of claims 1 to 14, wherein the sense strand is as follows: 5'[mUs][mU][mG][mC][mC][mA][mA][fG][fC][fU][fU][mG][mG][mU][mC][mA][mU] [mC][mU][mA][mG][mC][mA][mG][mC][mC][mG][ademA-GalN Ac][ademA-GalN Ac][ademA-GalNAc][mG][mG][mC][mU][mG][mC] (SEQ ID NO: 393) (In the formula, mUs indicates 2'-OMe uridine with a 3'-phosphorothioate linkage; mU indicates 2'-OMe uridine; mG indicates 2'-OMe guanosine; mC indicates 2'-OMe cytosine, mA indicates 2'-OMe adenosine; fG indicates 2'-F guanosine; fC indicates 2'-F cytosine; fU indicates 2'-F uridine, and ademA-GalNAc refers to 2'-aminodiethoxymethanol-adenine-GalNAc.

17. A pharmaceutical composition comprising the RNAi oligonucleotide of any one of claims 1 to 16 and a pharmaceutically acceptable carrier, delivery agent or excipient.

18. 18. The RNAi oligonucleotide of any one of claims 1 to 16 or the pharmaceutical composition of claim 17 for use in treating a subject having a disease, disorder, or condition associated with apolipoprotein(a) (LPA) gene expression, wherein the disease, disorder, or condition associated with LPA gene expression is a cardiometabolic disease, atherosclerosis, dyslipidemia, non-alcoholic fatty liver disease (NAFLD), or non-alcoholic steatohepatitis (NASH).

19. 18. The RNAi oligonucleotide of any one of claims 1 to 16 or the pharmaceutical composition of claim 17 for use in reducing apolipoprotein(a) (LPA) gene expression in a cell, a population of cells, or a subject, wherein the reduction in LPA gene expression comprises a reduction in the amount or level of LPA mRNA, the amount or level of LPA protein, or both.

20. The RNAi oligonucleotide or pharmaceutical composition for use according to claim 19, wherein the subject has a disease, disorder, or condition associated with LPA gene expression, and the disease, disorder, or condition associated with LPA gene expression is cardiometabolic disease, atherosclerosis, dyslipidemia, non-alcoholic fatty liver disease (NAFLD) or non-alcoholic steatohepatitis (NASH).

Citation Information

Patent Citations

  • Compositions and methods for inhibiting gene expression of lpa

    WO2017059223A2

  • Nucleic acids for inhibiting expression of LPA in a cell

    WO2019092283A1

  • Rnai constructs for inhibiting pnpla3 expression and methods of use thereof

    WO2019118638A2